WO2024090895A1 - Sicam-1 저해제를 포함하는 수지상 세포의 자가 활성화 억제용 조성물 - Google Patents

Sicam-1 저해제를 포함하는 수지상 세포의 자가 활성화 억제용 조성물 Download PDF

Info

Publication number
WO2024090895A1
WO2024090895A1 PCT/KR2023/016250 KR2023016250W WO2024090895A1 WO 2024090895 A1 WO2024090895 A1 WO 2024090895A1 KR 2023016250 W KR2023016250 W KR 2023016250W WO 2024090895 A1 WO2024090895 A1 WO 2024090895A1
Authority
WO
WIPO (PCT)
Prior art keywords
dendritic cells
composition
cells
activation
inhibitor
Prior art date
Application number
PCT/KR2023/016250
Other languages
English (en)
French (fr)
Inventor
곽종영
이인정
안 메이손 마자페리
Original Assignee
아주대학교산학협력단
(주)나노팬텍
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 아주대학교산학협력단, (주)나노팬텍 filed Critical 아주대학교산학협력단
Publication of WO2024090895A1 publication Critical patent/WO2024090895A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4166—1,3-Diazoles having oxo groups directly attached to the heterocyclic ring, e.g. phenytoin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4178—1,3-Diazoles not condensed 1,3-diazoles and containing further heterocyclic rings, e.g. pilocarpine, nitrofurantoin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/427—Thiazoles not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4402—Non condensed pyridines; Hydrogenated derivatives thereof only substituted in position 2, e.g. pheniramine, bisacodyl
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/472—Non-condensed isoquinolines, e.g. papaverine
    • A61K31/4725—Non-condensed isoquinolines, e.g. papaverine containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2821—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against ICAM molecules, e.g. CD50, CD54, CD102
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies

Definitions

  • the present invention relates to a composition and culture method that can inhibit self-activation of isolated immature primary dendritic cells, and can be used in the field of culturing immature dendritic cells or developing immune cell therapy.
  • Dendritic cells are antigen-presenting cells that provide a link between innate and adaptive immune responses. Dendritic cells are widely distributed throughout the body and are divided into several subtypes in the spleen, lymph nodes, mucous membranes, intestines, and epidermal tissues.
  • Inactive dendritic cells express low levels of major histocompatibility class-II (MHC-II) surface molecules and co-stimulatory molecules and rarely produce pro-inflammatory cytokines.
  • Dendritic cells can directly detect pathogens by pattern recognition receptors such as scavenger receptors, tollgate-like receptors, mannose receptors, etc., and phagocytose harmful signals derived from pathogens or damaged cells and antigens in their surroundings through a phagocytic mechanism. do.
  • Dendritic cells activated by these receptors are converted to a cell type with reduced antigen uptake capacity, increased expression of MHC-II, increased expression of co-stimulatory molecules such as CD80, CD86, and CD40, and the chemical receptor CCR7, and various types of cells. It is characterized by secretion of cytokines and increased migration to lymph nodes. These activated dendritic cells strongly induce T cell responses to specific antigens.
  • the process of phagocytosing and processing antigens is carried out by inactive dendritic cells.
  • the biggest problem in measuring the immunological function of these stable dendritic cells and using them as cell therapy products is the isolation and culture of tissue-derived primary dendritic cells (primary DC).
  • Primary dendritic cells isolated for cell culture undergo spontaneous activation from an inactive form to an active form within 12 hours in culture.
  • Self-activated dendritic cells have a very short survival period, making long-term culture impossible. Self-activation was observed to decrease somewhat when the number of dendritic cells was reduced under culture conditions or when cultured in a semi-solid gel, etc., and it was suggested that it occurs due to binding or contact between dendritic cells.
  • Dendritic cells which are currently used for culture as the most common method, are dendritic cells differentiated from bone marrow cells or monocytes and contain GM-CSF (granulocyte macrophage-colony stimulating factor) and tumor necrosis factor (TNF- ⁇ ). These cells are differentiated from these progenitor cells in the presence of the same inflammatory factors.
  • GM-CSF granulocyte macrophage-colony stimulating factor
  • TNF- ⁇ tumor necrosis factor
  • dendritic cells differentiated from these progenitor cells can be induced by cell culture of bone marrow cells or monocytes, but in the body, they belong to inflammatory dendritic cells that appear in vivo when single cells escape from the blood into tissues during inflammatory conditions.
  • dendritic cells activated in the process of differentiation from monocytes rather than primary dendritic cells present in lymph nodes can maintain relatively stable functions in culture, unlike unstimulated dendritic cells.
  • a culture method that can stably culture dendritic cells isolated from the spleen while maintaining them in an inactive state using a cell culture structure based on nano-micro hybrid fibers and a method for analyzing inactive dendritic cells have been reported. there is.
  • the present invention provides a technology that maintains the survival of primary dendritic cells isolated from immune tissue, exists in a functionally inactive state, phagocytizes antigens, and changes into an active form when subjected to immune or inflammatory stimulation, thereby maintaining the survival of primary dendritic cells in vivo.
  • the immunological response of dendritic cells that can occur can be implemented in culture.
  • Primary dendritic cells isolated in this way induce proliferation of T cells or co-culture with T cells to induce cytokine secretion, thereby providing immunity to diseases such as cancer, viral infection, autoimmune disease, organ transplant, allergy, and rheumatoid arthritis.
  • diseases such as cancer, viral infection, autoimmune disease, organ transplant, allergy, and rheumatoid arthritis.
  • the purpose of the present invention is to provide a composition for inhibiting self-activation of dendritic cells that can maintain primary dendritic cells isolated from lymphoid tissue in an inactive form.
  • the present invention aims to provide a culture method for maintaining dendritic cells in an inactive form by treating them with the composition.
  • the present invention aims to provide a method for producing an immune cell therapy agent using the composition.
  • a composition for inhibiting self-activation of dendritic cells containing an sICAM-1 (soluble Intercellular Adhesion Molecule 1) inhibitor containing an sICAM-1 (soluble Intercellular Adhesion Molecule 1) inhibitor.
  • composition for inhibiting self-activation of dendritic cells according to 1 above, wherein the inhibitor is a neutralizing antibody of sICAM-1 or an inhibitor of the binding between sICAM-1 and integrin.
  • composition for inhibiting self-activation of dendritic cells according to 2 above, wherein the integrin is ⁇ L ⁇ 2.
  • composition for inhibiting self-activation of dendritic cells according to 1 above, wherein the inhibitor is selected from the group consisting of compounds represented by the following formulas 1 to 5:
  • composition for inhibiting self-activation of dendritic cells according to 1 above, further comprising an integrin inhibitor that binds to integrin ⁇ 4 ⁇ 1 or ⁇ 5 ⁇ 1.
  • composition for inhibiting self-activation of dendritic cells according to 1 above, further comprising a peptide consisting of any one of SEQ ID NOs: 1 to 3.
  • composition for inhibiting self-activation of dendritic cells according to 5 above, wherein the integrin inhibitor is selected from the group consisting of compounds represented by the following formulas 6 to 10:
  • composition for inhibiting self-activation of dendritic cells according to any one of 1 to 7 above, wherein the dendritic cells are derived from the spleen or lymph nodes.
  • composition according to any one of items 1 to 7 above for inhibiting self-activation of dendritic cells for use in vitro is provided.
  • a method of culturing dendritic cells in an inactivated state comprising culturing dendritic cells under the composition of any one of 1 to 7 above.
  • the immunostimulants include CD40 (Cluster of differentiation 40) ligand, TNF- ⁇ (Tumor necrosis factor- ⁇ ), IL-1 ⁇ (Interleukin 1 ⁇ ), LPS (lipopolysaccharide), and poly (I:C) (Polyinosinic:polycytidylic acid), a method for producing an immune cell therapy agent selected from the group consisting of.
  • a dendritic cell composition in an inactivated state comprising the inhibitor of any one of items 1 to 4 above and dendritic cells mixed therewith.
  • Dendritic cells can be maintained in an inactive form in in vitro culture using the composition or method of the present invention.
  • the inactivated state of dendritic cells can be maintained for more than 24 hours using the composition or method of the present invention.
  • An immune cell therapy using inactive dendritic cells can be manufactured using the method of the present invention.
  • Figure 1 dendrites This is the q-PCR result measuring the amount of RNA of the integrin receptor expressed in dendritic cells immediately after isolating the cells from the spleen and culturing these cells for 2 hours.
  • Figure 2 shows DIC imaging results measuring cell aggregation of splenic dendritic cells cultured with BIO5192 added, and flow cytometry results measuring CD86 expressed on the surface of splenic dendritic cells.
  • Figure 3 shows CD4 + CD8 - , CD4 - CD8 + , CD4 - CD8 - , and This is the result of analyzing the UMAP plot measuring the expression of CD86 in the CD4 + CD8 + subtype.
  • Figure 4 shows CD4 + CD8 - , CD4 - CD8 + , CD4 - CD8 - , and CD4 + CD8 + in splenic dendritic cells after adding BIO5192, fibronectin, and peptide combination P 1 + P 2 + P 3 and culturing for 6 hours . This is the result of analyzing the ratio of cells by subtype from UMAP plot measurements that measure the number of subtypes.
  • Figure 5 shows the results of flow cytometry analysis measuring the expression level of CD86 in all splenic dendritic cells after adding BIO5192, ATN-161, fibronectin, and peptide combination P 1 +P 2 +P 3 and culturing for 6 hours.
  • Figure 6 shows CD4 + CD8 - , CD4 - CD8 + , CD4 - CD8 - and CD4 of splenic dendritic cells after adding BIO5192, ATN-16, fibronectin, and peptide combination P 1 +P 2 +P 3 and culturing for 6 hours. + This is the result of analyzing the CD86 expression ratio by subtype from the UMAP plot that measured the expression level of CD86 in the CD8 + subtype.
  • Figure 7 shows the results of flow cytometry analysis measuring how much the expression of CD86 is affected by adding BIO5192 and ATN-161 at various concentrations while culturing spleen dendritic cells for 6 hours and 24 hours.
  • Figure 8 shows Cytokine Array results measuring the amount of cytokines secreted into the culture medium after culturing spleen dendritic cells for each hour.
  • Figure 9 shows the results of measuring the culture medium obtained after culturing the spleen dendritic cells in Figure 8 for 3 hours and 24 hours using Cytokine Array.
  • Figure 10 shows ELISA results measuring the concentrations of sICAM-1 and TNF- ⁇ secreted in the culture medium after culturing primary spleen dendritic cells for 24 hours.
  • Figure 11 is an ELISA result measured by comparing the concentration of sICAM-1 secreted in the culture medium from spleen dendritic cells cultured for 24 hours after adding P 1 + P 2 + P 3 , a combination of fibronectin and peptide.
  • Figure 12 shows CD86 and MHC conditions after adding recombinant protein sICAM-1 and culturing spleen dendritic cells for 24 hours, as well as co-administration of fibronectin, peptide combination P 1 + P 2 + P 3 , and BIO5192 and ATN-161. These are the results of flow cytometry measuring the expression of -II and the results of ELISA measuring the amount of secreted TNF- ⁇ .
  • Figure 13 shows the results of DIC imaging measuring the degree of cell aggregation and flow cytometry analysis measuring the expression of CD86 after adding a neutralizing antibody against sICAM-1 and culturing splenic dendritic cells for 6 and 24 hours.
  • Figure 14 shows protein immunoblot results measuring the phosphorylation levels of PI3K, AKT, and IKK after primary spleen dendritic cells were dispensed into culture medium and left at 37 o C for 30 minutes.
  • Figure 15 shows the results of flow cytometry analysis measuring the expression of CD86 after adding A286982 at various concentrations and culturing spleen dendritic cells for 6 hours and 24 hours.
  • the present invention provides a composition for inhibiting self-activation of dendritic cells, including an inhibitor of the dendritic cell secretion factor sICAM-1 (Soluble Intercellular Adhesion Molecule 1).
  • sICAM-1 Soluble Intercellular Adhesion Molecule 1
  • Dendritic cells are immune cells that process pathogenic substances and display antigens on the surface for other cells of the immune system. They function as antigen-transmitting cells and act as mediators between the innate and adaptive immune responses.
  • the dendritic cells may be derived from lymphoid tissues such as the spleen and lymph nodes, or bone marrow, monocytes, etc., but are not limited thereto.
  • the dendritic cells may have different subtypes depending on the species, but are not limited thereto.
  • the subtype may be CD4+CD8-, CD4-CD8+, CD4-CD8-, or CD4+CD8+.
  • sICAM-1 soluble Intercellular Adhesion Molecule 1
  • ICAM-1 CD54
  • protease a secreted (soluble form) of ICAM-1
  • sICAM-1 is a secreted factor that induces self-activation in isolated dendritic cells (Examples 4 to 9), and a composition that inhibits self-activation of dendritic cells using an sICAM-1 inhibitor is provided. .
  • the inhibitor of sICAM-1 may be a substance that can block, inhibit, or interfere with the secretion, activity, and/or action mechanism of sICAM-1 in dendritic cells, and may be a compound, antibody, polypeptide, protein, RNA, or It includes forms such as nucleic acid molecules including DNA.
  • the mechanism of action may mean binding to dendritic cells, and specifically may be the interaction between sICAM-1 and integrin.
  • the inhibitor may be a neutralizing antibody of sICAM-1 or one that inhibits the binding between sICAM-1 and integrin.
  • the inhibitor of the binding between sICAM-1 and integrin may be one that binds to sICAM-1 or integrin, for example, a competitive inhibitor that binds to the binding site between sICAM-1 and integrin, or a non-competitive inhibitor that binds to a different binding site. It can be the best.
  • the inhibitor may selectively bind to sICAM-1 or an integrin that interacts with it.
  • the integrin binding to the sICAM-1 may be, for example, ⁇ L ⁇ 2 (CD11a) (LFA-1), ⁇ M ⁇ 2 (CD11b) (MAC-1), ⁇ X ⁇ 2 (CD11c), or ⁇ D ⁇ 2 (CD11D), specifically ⁇ L ⁇ 2. You can.
  • the inhibitor may be a neutralizing antibody or substance known as an inhibitor of sICAM-1 without particular restrictions, for example, known as an inhibitor of the interaction between ICAM-1 and integrin ⁇ L ⁇ 2.
  • A-286982 SAR 1118
  • BRT 377 BIRT 377
  • RWJ 50271 RWJ 50271
  • BMS-688521 BMS-688521
  • composition can be used in combination with other substances that inhibit self-activation of dendritic cells.
  • the composition may include an integrin inhibitor that binds to integrin ⁇ 4 ⁇ 1 or ⁇ 5 ⁇ 1, or a peptide consisting of any one of SEQ ID NOs: 1 to 3.
  • the integrin inhibitor may selectively bind to the integrin.
  • Examples of substances known as integrin inhibitors that bind to integrin ⁇ 4 ⁇ 1 or ⁇ 5 ⁇ 1 include: (BIO5192), (BIO-1211), (TCS 2314), (ATN-161) or (K34c) can be used, but is not limited thereto.
  • the peptide is a cell adhesion domain among the domains constituting fibronectin, and can inhibit self-activation by binding to the integrin binding site between dendritic cells in fibronectin.
  • the peptide consisting of the above sequence may be one or more types of peptides connected by a linker.
  • composition of the present invention can regulate dendritic cell-mediated immune responses, and specifically, can inhibit the self-activation of dendritic cells or regulate the self-antigen presentation ability of dendritic cells, but is not limited thereto.
  • the self-activation of dendritic cells refers to a natural activation phenomenon in which isolated dendritic cells are converted from an inactive form to an active form within 12 hours in culture.
  • the activated dendritic cells have the disadvantage of having a very short survival period and thus cannot be cultured for a long period of time, by inhibiting them through the composition of the present invention, it is possible to culture isolated dendritic cells in an inactive form capable of phagocytizing and processing antigens. do.
  • the dendritic cells may be isolated from lymphoid tissue, such as the spleen, lymph nodes, thymus, and tonsils.
  • composition for inhibiting activation of the present invention may be used in vivo or in vitro , but is preferably intended for use in vitro.
  • the present invention provides a method of culturing dendritic cells in an inactivated state, comprising culturing dendritic cells in the composition.
  • compositions and its effect to inhibit dendritic cell inactivation are as described above.
  • the composition may be added to the culture medium of dendritic cells.
  • Culture conditions for the dendritic cells can be appropriately selected by a person skilled in the art and are not particularly limited.
  • the concentration and treatment time of the composition are not limited to a specific concentration and time as long as it can inhibit self-activation of dendritic cells.
  • the treatment concentration may be, for example, 50 to 500 ⁇ g/mL, 100 to 400 ⁇ g/mL or 0 to 300 ⁇ g/mL per cell number 2 ⁇ 10 5 /cm, and the treatment time may be, for example, 2 to 48 hours. , 6 to 48 hours, 4 to 24 hours, 6 to 18 hours, 4 to 12 hours, 6 to 8 hours, or 6 to 24 hours, but is not limited thereto.
  • the dendritic cells may be cultured in three dimensions on a structure made of polycaprolactone (PCL) nanofibers, but are not limited thereto.
  • PCL polycaprolactone
  • the present invention provides a method for producing an immune cell therapy agent.
  • the method includes culturing dendritic cells under the composition described above; Subsequently, inducing activation of dendritic cells by treating them with an immune stimulant; And it may include co-culturing the activated dendritic cells and immune cells.
  • the immune cell therapy is a treatment method in which immune cells are extracted from the patient's blood, strengthened and modified, cultured, and then injected back into the body.
  • the immune cells are cells involved in the immune response in the immune system and are used as cell therapy. It means cells.
  • the immune cells may be, for example, T cells, B cells, dendritic cells, natural killer cells (NK cells), natural killer T cells (NKT cells), mast cells, or bone marrow-derived phagocytes, but are not limited thereto.
  • the immune stimulant is not particularly limited as long as it is a substance that exposes antigens to dendritic cells and causes them to convert into cells that display antigens on their surface.
  • the immune stimulant may induce increased expression of MHC-II, CD86, CD80, or CD40 on the surface of dendritic cells.
  • the immune stimulant may be a bacterial agent, CD40 agonist, TNF- ⁇ , IL-1 ⁇ , LPS or poly (I:C).
  • the step of co-culturing the activated dendritic cells and immune cells induces proliferation of immune cells and secretion of cytokines.
  • the ratio of the number of co-cultured immune cells based on activated dendritic cells may be 1 to 50, 4 to 30, 5 to 25, 10 to 30, or 15 to 25.
  • the co-culture time may be 2 to 144 hours, 4 to 120 hours, 12 to 96 hours, or 24 to 96 hours, 48 to 96 hours, or 48 hours to 72 hours, but is not limited thereto.
  • the immune cell therapeutic agent may be used for the treatment or prevention of cancer, bacterial and viral infectious diseases, chronic inflammatory diseases, or autoimmune diseases.
  • the above cancers include, for example, lung cancer, laryngeal cancer, stomach cancer, colon/rectal cancer, liver cancer, gallbladder cancer, pancreatic cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, kidney cancer, carcinoma derived from epithelial cells, and bone cancer.
  • muscle cancer fat cancer, sarcoma derived from connective tissue cells, leukemia, lymphoma, blood cancer derived from hematopoietic cells of multiple myeloma, tumors occurring in nervous tissue, thyroid cancer, colon cancer, testicular cancer, brain tumor, head and neck cancer.
  • bladder cancer epithelial cancer, adenocarcinoma, esophageal cancer, mesothelioma, skin cancer, or melanoma, but is not limited thereto.
  • the infectious disease may be a disease caused by infection with pathogens such as bacteria, spirochetes, rickettsiae, viruses, fungi, or parasites, but is not limited thereto.
  • the chronic inflammatory disease is a disease caused by long-term accumulation of inflammation, and is known to disrupt the immune system by causing cell aging and deformation and excessively activating the immune response, thereby causing metabolic diseases such as obesity and diabetes, and even autoimmune diseases. It is reported that it does.
  • the autoimmune disease is a disease that occurs when the body's immune system attacks internal normal cells rather than external antigens, such as rheumatoid arthritis, atopy, lupus, Crohn's disease, type 1 diabetes, ulcerative colitis, or multiple sclerosis. However, it is not limited to this.
  • an immune cell therapy agent can be manufactured using the composition of the present invention regardless of the type.
  • the present invention provides a dendritic cell composition in an inactivated state comprising the sICAM-1 inhibitor and dendritic cells mixed therewith.
  • the composition may include an integrin inhibitor that binds to integrin ⁇ 4 ⁇ 1 or ⁇ 5 ⁇ 1, or a peptide consisting of any one of SEQ ID NOs: 1 to 3,
  • the dendritic cells of the composition may be maintained in an inactivated state for, for example, 6 hours or more, 12 hours or more, 24 hours or more, or 48 hours or more, preferably 6 to 24 hours, 6 to 48 hours, or 12 to 48 hours. Alternatively, it may be 12 to 24 hours, but is not limited thereto.
  • the cell composition includes dendritic cells maintained in an inactivated state by the composition for inhibiting activation of dendritic cells, and the dendritic cells specifically inhibit the increase in expression of MHC-II, CD86, CD80 or CD40 factors. It may be a dendritic cell.
  • the dendritic cells can functionally phagocytose antigens while maintaining survival until they are stimulated and activated, and unlike activated dendritic cells, they can be cultured for a long period of time, causing proliferation of T cells in vitro or cooperating with T cells. By cultivating and promoting cytokine secretion, it is possible to develop immune cell treatments for various diseases.
  • Example 1 Measurement of RNA expression of integrin receptor in dendritic cells using quantitative real-time PCR (q-PCR) reaction
  • fibronectin binds to cellular integrin and the main amino acids of the binding domain were prepared as peptides, and the type of integrin that binds to each peptide is indicated.
  • the RGD (P 1 ), LDV (P 2 ), and PHSRN (P 3 ) peptides were purchased from Peptron (Daejeon, Korea) and manufactured with SHIMADZU LCMS-2020.
  • RNA of the integrin receptor expressed in splenic dendritic cells was measured by q-PCR.
  • CD11c + primary dendritic cells were isolated from the spleen, and the cells were distributed at 2 ⁇ 10 7 cells/mL in a 48-well culture plate and cultured for 2 hours at 37 o C and 5% CO 2 conditions.
  • Qiagen RNeasy Mini Kit Qiagen, Germany
  • RNA concentration was measured using a NanoDrop ND spectrophotometer (Nanodrop Technologies, USA). did.
  • RNA was reverse transcribed using the PrimeScript RT reagent Kit (TaKaRa, Japan), and quantitative real-time PCR (q-PCR) was performed using the synthesized cDNA.
  • the q-PCR reaction was measured using the QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific, USA) using SYBR Premix EX Taq (Tli RNase H Plus) mix (Takara, Japan).
  • the primers shown in Table 2 below were used in the experiment.
  • the Livak method ( ⁇ C t ) was used to measure the expression level in q-PCR analysis.
  • the level of mRNA expression in dendritic cells was determined by calculating the ratio of the amount of mRNA expression of each integrin receptor to the amount of ⁇ -actin mRNA expression and ⁇ E It was compared as a relative value for the ratio.
  • ⁇ 5 In uncultured dendritic cells, very low levels of ⁇ 5, ⁇ M, and ⁇ V were measured, but relatively high levels of ⁇ 4 were measured. In comparison, the expression levels of ⁇ 1 and ⁇ 2 were similar.
  • the expression level of ⁇ 5 did not significantly increase, but the expression levels of ⁇ 4, ⁇ 1, and ⁇ 2 showed a significant increase.
  • Example 2 Culture of spleen dendritic cells in medium supplemented with integrin receptor inhibitor
  • BIO5192 an inhibitor of integrin receptors expressed in splenic dendritic cells
  • BIO5192 is a compound that specifically binds and inhibits ⁇ 4 ⁇ 1 (VLA-4), inhibiting the binding of ⁇ 4 ⁇ 1 integrin to LDV of fibronectin.
  • BIO5192 was purchased and used from R&D Systems.
  • DIC differential interference contrast
  • BIO5192 results measured after 6 hours of incubation showed that cell aggregation was significantly reduced by 5 ⁇ M or more of BIO5192.
  • the inhibitory effect of BIO5192 on cell aggregation was also observed in dendritic cells cultured for 24 hours.
  • the expression of CD86 in primary dendritic cells cultured with the addition of BIO5192 was measured using a flow cytometer (MACSQuant VYB flow cytometer, Miltenyi Biotec), and the measurement results were analyzed using FlowJo v10 (Tree Star, Ashland). It was measured significantly lower compared to cells in which self-activation occurred without the addition of .
  • Example 3 Determination of the effect of integrin receptor inhibitors on autoactivation of splenic dendritic cell subtypes after culture
  • Dendritic cells stained with fluorescence-conjugated antibodies were measured using a flow cytometer (Cytek Aurora Flow Cytometry) (Cytek Biosciences, Fremont, CA, USA) and analyzed using the T-distributed stochastic neighbor embedding algorithm (T-SNE) (FlowJo) program. did.
  • T-SNE stochastic neighbor embedding algorithm
  • the analysis results were displayed as a Uniform Manifold Approximation and Projection (UMAP) plot, and the cells expressing and not expressing CD86 in each subtype were expressed as the number of cells.
  • BIO5129 was a combination of fibronectin and peptide P 1 +P 2 +P Similar to 3 , the increase in CD86 expression was suppressed.
  • ATN-161 (Ac-PHSCN-NH2, Selleckchem, Texas, USA), a peptide that binds and inhibits ⁇ 5 ⁇ 1, also showed a similar autoactivation inhibition effect as BIO5192.
  • each subtype of spleen dendritic cells was cultured with fibronectin, a peptide combination, and integrin receptor inhibitors BIO5192 and ATN-161, and CD86 expression was measured 6 hours later. Then, each subtype expressed CD86 as shown in the UMAP plot. Numbers of cells were compared as %. When only primary dendritic cells were cultured, CD86 expression increased in all subtypes. When fibronectin was added to the culture medium, the increase in CD86 expression was suppressed in all subtypes of dendritic cells, but in cultures containing the peptide combination P 1 + P 2 + P 3 , CD86 expression was reduced in CD4 + CD8 - and CD4 - CD8 - cells.
  • BIO5192 and ATN-161 were added at various concentrations and cultured for 6 or 24 hours, and then the expression level of CD86 was measured by flow cytometry.
  • the IC 50 of BIO5192 was 20 ⁇ M and the IC 50 of ATN-161 was 20 ⁇ M. It was 70 ⁇ M.
  • Example 4 Measurement of factors secreted from cultured spleen dendritic cells into culture medium
  • Example 5 Secretion of sICAM-1 from cultured spleen dendritic cells and measurement of the effects of fibronectin and peptide on it
  • fibronectin 200 ⁇ g/mL
  • peptide combination P 1 +P 2 +P 3 each 200 ⁇ g/mL
  • splenic dendritic cells (1 ⁇ 10 6 /mL) were incubated for 24 hours at a constant rate.
  • the concentration of sICAM-1 secreted into the culture medium was measured.
  • the amount of sICAM-1 secreted into the culture medium was significantly reduced by treatment with fibronectin or the peptide combination P 1 + P 2 + P 3 .
  • * has statistical significance as P ⁇ 0.05 or less compared to none.
  • Example 6 Secretion of sICAM-1 from cultured spleen dendritic cells and measurement of the effects of fibronectin and peptide on it
  • sICAM-1 the recombinant protein sICAM-1 (10 ng/mL) was added and spleen dendritic cells (1 ⁇ 10 6 /mL) were cultured for 24 hours to determine how the activity of spleen dendritic cells was affected.
  • sICAM-1 the expression levels of CD86 and MHC-II were significantly increased, and the secretion of TNF- ⁇ was also increased, suggesting that sICAM-1 increases cell activity.
  • This increase in autoactivation by sICAM-1 was observed with fibronectin (200 ⁇ g/mL), peptide combination P 1 +P 2 +P 3 (200 ⁇ g/mL each), and BIO5192 (50 ⁇ M) and ATN-161 (50 ⁇ M). ) was suppressed by co-administration.
  • * has statistical significance as P ⁇ 0.05 or less compared to none.
  • Example 7 Measurement of the effect of sICAM-1 neutralizing antibody on autoactivation in cultured primary dendritic cells
  • Example 8 Measurement of activation of signaling factors involved in autoactivation in cultured primary dendritic cells and the effect of activation inhibitors on this
  • anti-phospho-PI3-kinase p85(Tyr458)/p55(Tyr199) antibody (Cat. # 4228, Cell Signaling Technology), anti-phospho-AKT antibody. (Ser473, 1:1000) (Cat. #9271S, Cell Signaling Technology), anti-phospho-IKK- ⁇ / ⁇ antibody (Ser176/180, 1:5000) (Cat. # 2697T, Cell Signaling Technology), and anti-Beta Actin antibody (1:10,000) (Cat. #60008-1-Ig, Protein Tech, Illinois, USA).
  • the membrane treated with the primary antibody was washed three times with PBS blocking buffer and reacted with anti-rabbit horseradish peroxidase-linked secondary antibody (Cat.
  • Chemiluminescence reaction used ClarityTM western ECL substrate (Bio-Rad) and exposed to Medical X-ray film (AGFA, Berlin, Germany). Imaging was analyzed using Image J software (NIH, MD, USA). Phosphorylation of PI3K (phosphoinositide 3-kinase), AKT, and IKK- ⁇ / ⁇ significantly increased after 30 minutes of incubation, and phosphorylation of these proteins was significantly inhibited not only by the addition of fibronectin and peptide combination but also by neutralizing antibody against sICAM-1. .
  • Example 9 Inhibiting the binding of LFA-1 and ICAM-1 to self-activation of splenic dendritic cells after culture Measurement of the effect of inhibitors
  • A286982 (Selleckchem, Texas, USA), which inhibits binding to LFA-1, which is known to bind to ICAM-1, while culturing CD11c+ splenic dendritic cells (2 ⁇ 10 5 /mL) for 6 or 24 hours. After treatment, the level of CD86 expression in dendritic cells was measured. When A286982 was added in increasing concentrations, A286982 inhibited the expression of CD86 starting at a concentration of 0.1 nM and inhibited about 50% of auto-activation at a concentration of 5 nM.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 in vitro에서 배양한 수지상 세포 간의 접촉 후 자가 활성화를 유발하는 인자 sICAM-1이 분비되어 주위 세포를 자극하는 작용에 관여하는 저해제를 유효 성분으로 포함하는 초대 수지상 세포의 자가 활성화 억제 조성물에 관한 것이다. 상기 조성물은 수지상 세포 배양, 수지상 세포 활성화 유도, 및 다른 면역세포와의 공배양에 의한 면역조절을 통하여 암, 자가면역 질환, 및 염증성 질환의 치료제 개발 목적 등으로 유용하게 활용될 수 있다.

Description

SICAM-1 저해제를 포함하는 수지상 세포의 자가 활성화 억제용 조성물
본 발명은 분리된 미성숙 초대 수지상 세포의 자가 활성화를 억제할 수 있는 조성물 및 배양 방법 등에 관한 것으로, 미성숙 수지상 세포의 배양이나 면역세포치료제 개발 분야에서 활용될 수 있다.
수지상 세포(Dendritic cells, DCs)는 선천면역 반응과 적응면역 반응 사이의 연관성을 제공하는 항원 제시 세포이다. 수지상 세포는 몸 전체에 널리 분포되어 있으며 비장, 림프절, 점막, 장, 표피 조직에서 여러 아형으로 구분되어 있다.
비활성형의 수지상 세포는 낮은 수준으로 주조직 적합성 복합체 클래스 II (major histocompatibility class-II, MHC-II) 표면 분자와 공동 자극 분자를 표현하며, 염증 유도 사이토카인을 거의 생성하지 않는다. 수지상 세포는 스캐빈저 수용체, 톨게이트 유사 수용체, 만노스 수용체, 등과 같은 패턴 인식 수용체에 의해 병원체를 직접 감지할 수 있으며 탐식 메커니즘을 통해 병원균이나 손상 세포로부터 파생된 유해 신호와 그 주변에서의 항원을 탐식한다. 이들 수용체에 의하여 활성화된 수지상 세포는 항원 흡수능의 감소, MHC-II의 발현 증가, CD80, CD86 및 CD40과 같은 공동 자극 분자 및 화학 수용체인 CCR7의 발현이 증가된 세포형으로 전환되며, 다양한 종류의 사이토카인을 분비하고 림프절로의 이동이 증가하는 것이 특징이다. 이러한 활성화된 수지상 세포는 특정 항원에 대한 T세포 반응을 강력하게 유도한다.
항원을 탐식하고 처리하는 과정은 비활성 수지상 세포에 의하여 이루어진다. 이러한 안정된 수지상 세포의 면역학적 기능을 측정하고 세포치료제로서 이용하는데 있어서의 가장 큰 문제점은 조직 유래 초대 수지상 세포(primary DC)의 분리와 배양에 있다. 세포 배양을 위하여 분리된 초대 수지상 세포는 배양 상태에서 12 시간 이내 비활성형에서 활성형으로 자가 활성화(spontaneous activation)가 일어난다. 자가 활성화된 수지상 세포는 생존 기간이 매우 짧아서 장기간 배양이 불가능하다. 자가 활성화는 배양 조건에서 수지상 세포의 수를 줄이거나 반고체의 겔 등에서 배양할 경우 다소 감소하는 것으로 관찰되어 수지상 세포간의 결합이나 접촉에 의하여 일어난다고 제안되었으나, 구체적으로 어떠한 인자가 관여하는지 또는 비활성형으로 유지하며 배양할 수 있는 기술은 아직 보고된 바 없다.
비장 및 림프절의 3차원적 구조와 세포외 기질은 세포의 상호작용을 조절하고 조직 내 세포간의 응집에도 중요한 역할을 한다. 극소량의 콜라겐만이 림프절의 근위부(paracortical region) 내에 존재하고 비장과 같은 림프 조직에는 주요 세포외 기질로는 피브로넥틴이 발현되어 있으며 라미닌(laminin) 발현은 극히 적다. 사이토카인을 사용하여 단핵구로부터 분화시킨 수지상 세포는 피브로넥틴이나 라미닌으로 코팅한 플레이트에서 배양할 경우 수지상 세포의 형태가 변하고 비활성형으로 유지된다고 보고된 바 있다.
이러한 다양한 기술적인 한계점에 따라, 림프 조직에서 분리한 초대 수지상 세포를 배양하기 보다는 유전체 전환에 의한 형질전환형 수지상 세포주나 전구세포로부터 분화된 수지상 세포를 이용하는 기술 등을 적용하고 있다. 현재까지 가장 일반적인 방법으로서 배양용으로 사용하고 있는 수지상 세포는 골수세포 또는 단핵구에서 분화시킨 수지상 세포로 GM-CSF (granulocyte macrophage-colony stimulating factor) 및 종양괴사인자 (Tumor necrosis factor, TNF-α)와 같은 염증 인자가 존재하는 상태에서 이들 전구 세포로부터 분화된 세포이다.
따라서 이들 전구세포로부터 분화된 수지상 세포는 골수세포 또는 단핵구의 세포 배양에 의해 유도될 수는 있으나, 체내에서는 염증 상태에서 혈액으로부터 단세포가 조직으로 빠져나가 생체 내에서 나타나는 염증성 수지상 세포에 속한다. 그러나 이 경우 림프절에 존재하는 초대 수지상 세포가 아닌 단핵구로부터 분화되는 과정에서 활성화된 수지상 세포는 배양 상태에서는 자극 받지 않은 수지상 세포와는 다르게 비교적 안정적인 기능을 유지할 수 있다. 또한, 나노-마이크로 하이브리드 섬유를 기반으로 한 세포 배양용 구조물을 이용하여 비장에서 분리한 수지상 세포를 비활성형 상태로 유지하면서 안정적으로 배양할 수 있는 배양방법 및 비활성 수지상 세포의 분석 방법이 보고된 바 있다.
본 발명에서는 면역 조직으로부터 분리한 초대 수지상 세포의 생존을 유지하면서 기능적으로 비활성형의 상태로 존재하여 항원을 탐식하고 면역이나 염증 자극을 받는 경우에는 활성형으로 변할 수 있는 기술을 제공함으로써 생체 내에서 일어날 수 있는 수지상 세포의 면역학적 반응을 배양 상태에서 구현할 수 있다. 이렇게 분리한 초대 수지상 세포는 T 세포의 증식을 유발하거나, T 세포와 공배양하여 사이토카인 분비를 유발하여 암, 바이러스 감염, 자가면역 질환, 장기이식, 알러지, 및 류마티스 관절염 등에서 이들 질환에 대한 면역세포 치료제로서의 개발 가능성이 높다.
본 발명은 림프 조직에서 분리한 초대 수지상 세포를 비활성형으로 유지할 수 있는 수지상 세포의 자가 활성화 억제용 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 조성물을 처리하여 수지상 세포를 비활성형으로 유지하는 배양 방법을 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 조성물을 이용하여 면역세포치료제를 제조하는 방법을 제공하는 것을 목적으로 한다.
1. sICAM-1(soluble Intercellular Adhesion Molecule 1) 저해제를 포함하는 수지상 세포의 자가 활성화 억제용 조성물.
2. 위 1에 있어서, 상기 저해제는 sICAM-1의 중화항체, 또는 sICAM-1과 인테그린 간의 결합 저해제인 수지상 세포의 자가 활성화 억제용 조성물.
3. 위 2에 있어서, 상기 인테그린은 αLβ2인 수지상 세포의 자가 활성화 억제용 조성물.
4. 위 1에 있어서, 상기 저해제는 하기 화학식 1 내지 5로 표시된 화합물로 이루어진 군에서 선택된 것인 수지상 세포의 자가 활성화 억제용 조성물:
[화학식 1]
Figure PCTKR2023016250-appb-img-000001
[화학식 2]
Figure PCTKR2023016250-appb-img-000002
[화학식 3]
Figure PCTKR2023016250-appb-img-000003
[화학식 4]
Figure PCTKR2023016250-appb-img-000004
[화학식 5]
Figure PCTKR2023016250-appb-img-000005
.
5. 위 1에 있어서, 인테그린 α4β1 또는 α5β1에 결합하는 인테그린 저해제를 더 포함하는 수지상 세포의 자가 활성화 억제용 조성물.
6. 위 1에 있어서, 서열번호 1 내지 3 중 어느 하나의 서열로 이루어진 펩타이드를 더 포함하는, 수지상 세포의 자가 활성화 억제용 조성물.
7. 위 5에 있어서, 상기 인테그린 저해제는 하기 화학식 6 내지 10으로 표시된 화합물로 이루어진 군에서 선택된 것인, 수지상 세포의 자가 활성화 억제용 조성물:
[화학식 6]
Figure PCTKR2023016250-appb-img-000006
[화학식 7]
Figure PCTKR2023016250-appb-img-000007
[화학식 8]
Figure PCTKR2023016250-appb-img-000008
[화학식 9]
Figure PCTKR2023016250-appb-img-000009
[화학식 10]
Figure PCTKR2023016250-appb-img-000010
.
8. 위 1 내지 7 중 어느 한 항에 있어서, 상기 수지상 세포는 비장 또는 림프절에서 유래한 것인 수지상 세포의 자가 활성화 억제용 조성물.
9. 위 1 내지 7 중 어느 한 항에 있어서, 시험관 내에서(in vitro) 사용되기 위한 수지상 세포의 자가 활성화 억제용 조성물.
10. 위 1 내지 7 중 어느 한 항의 조성물 하에 수지상 세포를 배양하는 단계를 포함하는 수지상 세포를 비활성화 상태로 배양하는 방법.
11. 위 1 내지 7 중 어느 한 항의 조성물 하에 수지상 세포를 배양하는 단계; 상기 배양된 수지상 세포에 면역자극제를 처리하여 상기 수지상 세포를 활성화시키는 단계; 및 상기 활성화된 수지상 세포와 면역세포를 공배양하는 단계를 포함하는 면역세포치료제 제조 방법.
12. 위 11에 있어서, 상기 면역자극제는 CD40(Cluster of differentiation　40) 리간드, TNF-α(Tumor necrosis factor-α), IL-1β(Interleukin 1β), LPS(lipopolysaccharide) 및 poly (I:C)(Polyinosinic:polycytidylic acid)로 이루어진 군에서 선택된 것인, 면역세포치료제 제조 방법.
13. 위 11에 있어서, 상기 면역세포치료제는 암, 감염성질환, 만성염증 질환 또는 자가면역질환의 치료용인, 면역세포치료제 제조 방법.
14. 위 1 내지 4 중 어느 한 항의 저해제 및 이와 혼합된 수지상 세포를 포함하는 비활성화 상태인 수지상 세포 조성물.
본 발명의 조성물 또는 방법을 이용하여 in vitro 배양에서 수지상 세포를 비활성형으로 유지할 수 있다.
본 발명의 조성물 또는 방법을 이용하여 수지상 세포의 비활성화 상태를 24시간 이상 유지할 수 있다.
본 발명의 방법을 이용하여 비활성형 수지상 세포를 이용한 면역세포치료제를 제조할 수 있다.
도 1은 수지상 세포를 비장으로부터 분리한 직후의 수지상 세포와 이들 세포를 2 시간 배양한 후 발현하는 인테그린 수용체의 RNA가 발현되는 양을 측정한 q-PCR결과이다.
도 2는 BIO5192를 첨가하고 배양한 비장 수지상 세포의 세포 응집도를 측정한 DIC 이미징 결과와 비장 수지상 세포의 표면에서 발현되는 CD86을 측정한 유세포 분석 결과이다.
도 3은 BIO5192와 ATN-16, 피브로넥틴 및 펩타이드의 조합 P1+P2+P3을 첨가하고 6 시간 배양한 마우스 비장 수지상 세포의 CD4+CD8-, CD4-CD8+, CD4-CD8-, 및 CD4+CD8+ 아형에서 CD86의 발현을 측정한 UMAP plot을 분석한 결과이다
도 4는 BIO5192, 피브로넥틴, 및 펩타이드 조합 P1+P2+P3을 첨가하고 6 시간 배양한 후 비장 수지상 세포에서 CD4+CD8-, CD4-CD8+, CD4-CD8-, 및 CD4+CD8+ 아형의 수를 측정한 UMAP plot 측정치로부터 아형별 세포 비율을 분석한 결과이다.
도 5는 BIO5192, ATN-161, 피브로넥틴, 및 펩타이드 조합 P1+P2+P3을 첨가하고 6 시간 배양한 후 비장 수지상 세포 전체에서 CD86의 발현 정도를 측정한 유세포 분석의 결과이다.
도 6은 BIO5192, ATN-16, 피브로넥틴, 및 펩타이드 조합 P1+P2+P3을 첨가하고 6 시간 배양한 후 비장 수지상 세포의 CD4+CD8-, CD4-CD8+, CD4-CD8- 및 CD4+CD8+ 아형에서 CD86의 발현 정도를 측정한 UMAP plot으로부터 아형별 CD86 발현 비율을 분석한 결과이다.
도 7은 비장 수지상 세포를 6 시간 및 24 시간 동안 배양하면서 BIO5192와 ATN-161을 여러 농도로 첨가하여 CD86의 발현이 어느 정도 영향을 받는가를 측정한 유세포 분석 결과이다.
도 8은 비장 수지상 세포를 각 시간 별로 배양한 후 배양액으로 분비된 사이토카인의 양을 측정한 Cytokine Array 결과이다
도 9은 도 8에서 비장 수지상 세포를 3 시간 및 24 시간 배양한 후 얻은 배양액을 Cytokine Array로 측정한 결과이다.
도 10은 비장 초대 수지상 세포를 24 시간 동안 배양한 후 배양액 내 분비된 sICAM-1과 TNF-α의 농도를 측정한 ELISA 결과이다.
도 11은 피브로넥틴과 펩타이드 조합인 P1+P2+P3,를 첨가하고 24 시간 동안 배양한 비장 수지상 세포로부터 배양액에 분비되는 sICAM-1의 농도를 비교하여 측정한 ELISA 결과이다.
도 12는 재조합 단백질 sICAM-1을 첨가하고 24 시간 동안 비장 수지상 세포를 배양한 조건과 더불어 피브로넥틴, 펩타이드 조합 P1+P2+P3, 및 BIO5192와 ATN-161의 병용 투여한 후 CD86 및 MHC-II의 발현을 측정한 유세포 분석 결과와 분비된 TNF-α의 양을 측정한 ELISA 결과이다.
도 13은 sICAM-1에 대한 중화항체를 첨가하고 6 시간 및 24 시간 동안 비장 수지상 세포를 배양한 후 세포의 응집도를 측정한 DIC 이미징과 CD86의 발현을 측정한 유세포 분석 결과이다.
도 14는 초대 비장 수지상 세포를 배양액에 분주하고 37oC에서 30 분간 방치한 후 PI3K, AKT, 및 IKK의 인산화 정도를 측정한 단백 면역 블롯 결과이다.
도 15는 A286982를 농도 별로 첨가하고 6 시간 및 24 시간 동안 비장 수지상 세포를 배양한 후 CD86의 발현을 측정한 유세포 분석 결과이다.
본 발명은 수지상 세포의 분비 인자 sICAM-1(soluble Intercellular Adhesion Molecule 1) 저해제를 포함하는 수지상 세포의 자가 활성화 억제용 조성물을 제공한다.
수지상 세포(Dendritic cell)는 면역세포로 병원균 물질을 처리하여 면역계의 다른 세포를 위해 표면에 항원을 표시하는 것으로 항원 전달세포로 기능하므로, 선천성 면역반응과 후천성 면역반응 사이의 매개체로 기능한다.
상기 수지상 세포는 비장, 림프절 등 림프조직 또는 골수, 단핵구 등에서 유래할 수 있으나 이에 제한되는 것은 아니다.
상기 수지상 세포는 아형이 종에 따라 다를 수 있으며 이에 제한되지 아니한다. 상기 아형은 CD4+CD8-, CD4-CD8+, CD4-CD8-, 또는 CD4+CD8+ 일 수 있다.
sICAM-1(soluble Intercellular Adhesion Molecule 1)은 세포막에 결합한 ICAM-1(CD54)이 protease에 의하여 분해되어 분비되는 물질이다. 즉, sICAM-1은 ICAM-1의 분비형(soluble form)으로 분자량이 약 80-114 kDa이며 염증 및 면역반응에서 주요 세포부착 인자로서 작용을 한다.
본 발명에서는 sICAM-1이 또한 분리된 수지상 세포에서 자가 활성화를 유도하는 분비 인자임을 규명하였으며(실시예 4~9), sICAM-1 저해제를 이용하여 수지상 세포의 자가 활성화를 억제하는 조성물을 제공한다.
구체적으로 상기 sICAM-1의 저해제는 수지상 세포에서 sICAM-1의 분비, 활성 및/또는 작용기전을 방해, 억제, 또는 간섭할 수 있는 물질일 수 있으며, 화합물, 항체, 폴리펩타이드, 단백질, RNA 또는 DNA를 포함하는 핵산분자 등의 형태를 포함한다.
상기 작용기전은 수지상 세포와의 결합을 의미할 수 있고, 구체적으로 sICAM-1과 인테그린 간의 상호작용일 수 있다.
예를 들면, 상기 저해제는 sICAM-1의 중화항체이거나 sICAM-1과 인테그린 간의 결합을 저해하는 것일 수 있다.
상기 sICAM-1과 인테그린 간의 결합 저해제는 sICAM-1 또는 인테그린에 결합하는 것일 수 있으며, 예를 들어 sICAM-1과 인테그린 간의 결합 부위에 결합하는 경쟁적 저해제이거나, 이와 다른 결합 부위에 결합하는 비경쟁적 저해제일 수 있다.
상기 저해제는 sICAM-1 또는 이와 상호작용하는 인테그린에 선택적으로 결합하는 것일 수 있다.
상기 sICAM-1과 결합하는 인테그린은 예를 들면 αLβ2 (CD11a) (LFA-1), αMβ2 (CD11b) (MAC-1), αXβ2 (CD11c), 또는 αDβ2 (CD11D)일 수 있고, 구체적으로 αLβ2일 수 있다.
상기 저해제는 sICAM-1의 중화항체 또는 억제제로 알려진 물질을 특별한 제한 없이 사용할 수 있으며, 예를 들면 ICAM-1과 인테그린 αLβ2의 상호작용 억제제로 알려진
Figure PCTKR2023016250-appb-img-000011
(A-286982),
Figure PCTKR2023016250-appb-img-000012
(SAR 1118),
Figure PCTKR2023016250-appb-img-000013
(BIRT 377),
Figure PCTKR2023016250-appb-img-000014
(RWJ 50271) 또는
Figure PCTKR2023016250-appb-img-000015
(BMS-688521) 등이 이용될 수 있으나 이에 제한되는 것은 아니다.
상기 조성물은 수지상 세포의 자가 활성화를 억제하는 다른 물질과 병용하여 사용될 수 있다.
예를 들면, 상기 조성물은 인테그린 α4β1 또는 α5β1에 결합하는 인테그린 저해제, 또는 서열번호 1 내지 3 중 어느 하나의 서열로 이루어진 펩타이드를 포함할 수 있다.
상기 인테그린 저해제는 상기 인테그린에 선택적으로 결합하는 것일 수 있다.
상기 인테그린 α4β1 또는 α5β1에 결합하는 인테그린 저해제로 알려진 물질로 예를 들면
Figure PCTKR2023016250-appb-img-000016
(BIO5192),
Figure PCTKR2023016250-appb-img-000017
(BIO-1211),
Figure PCTKR2023016250-appb-img-000018
(TCS 2314),
Figure PCTKR2023016250-appb-img-000019
(ATN-161) 또는
Figure PCTKR2023016250-appb-img-000020
(K34c)을 사용할 수 있으나 이에 제한되는 것은 아니다.
상기 펩타이드는 피브로넥틴을 구성하는 도메인 중 세포 부착 도메인으로, 피브로넥틴에서 수지상 세포들 사이의 인테그린 결합 부위에 결합하여 자가 활성화를 억제할 수 있다.
상기 서열로 이루어진 펩타이드는 한 종류 이상의 펩타이드가 링커로 연결된 것일 수 있다.
본 발명의 조성물은 수지상 세포-매개 면역 반응을 조절할 수 있으며, 구체적으로는 수지상 세포의 자가 활성화 억제 또는 수지상 세포의 자가의 항원 제시능을 조절할 수 있으나 이에 제한되는 것은 아니다.
상기 수지상 세포의 자가 활성화는 분리된 수지상 세포가 배양 상태에서 12시간 이내 비활성형에서 활성형으로 전환되는 자연 활성화 현상을 의미한다.
상기 활성화된 수지상 세포는 생존 기간이 매우 짧아 장기간 배양이 불가능하다는 단점을 가지므로, 본 발명의 조성물을 통해 이를 억제함으로써 항원을 탐식하고 처리할 수 있는 비활성 형태로 분리된 수지상 세포를 배양할 수 있게 한다.
상기 수지상 세포는 림프 조직에서 분리된 것일 수 있고, 비장, 림프절, 흉선, 편도선 등일 수 있다.
본 발명의 활성화 억제용 조성물은 생체 내(in vivo) 또는 시험관 내에서(in vitro) 사용될 수 있으나, 바람직하게는 시험관 내에서(in vitro) 사용되기 위한 것일 수 있다.
또한, 본 발명은 상기 조성물 하에 수지상 세포를 배양하는 단계를 포함하는 수지상 세포를 비활성화 상태로 배양하는 방법을 제공한다.
상기 조성물 및 이의 수지상 세포 비활성화 억제 효과에 관한 구체적인 설명은 전술한 바와 같다.
상기 조성물은 수지상 세포의 배양 배지에 첨가되는 것일 수 있다.
상기 수지상 세포의 배양 조건은 당업자에 의해 적절히 선택될 수 있으며 특별히 제한되지 아니한다.
상기 조성물의 농도 및 처리 시간은 수지상 세포의 자가 활성화를 억제할 수 있다면, 특정 농도 및 시간에 제한되지 않는다. 처리 농도는 예를 들면 세포수 2 × 105/cm 당 50 내지 500 μg/mL, 100 내지 400 μg/mL 또는0 내지 300 μg/mL일 수 있고, 처리 시간은 예를 들면, 2 내지 48시간, 6 내지48시간, 4내지 24시간, 6내지 18시간, 4내지 12시간, 6 내지 8시간 또는 6 내지 24시간일 수 있으나, 이에 제한되는 것은 아니다.
상기 수지상 세포의 배양은 폴리카프로락톤(PCL) 나노섬유로 이루어진 구조체 상에서 3차원으로 배양이 이루어지는 것일 수 있으나, 이에 제한되는 것은 아니다.
또한 본 발명은 면역세포치료제의 제조 방법을 제공한다.
상기 방법은 전술한 상기 조성물 하에 수지상 세포를 배양하는 단계; 이후 면역 자극제를 처리하여 수지상 세포의 활성화를 유도하는 단계; 및 상기 활성화된 수지상 세포와 면역세포를 공배양하는 단계를 포함할 수 있다.
상기 면역세포 치료제는 환자의 혈액에서 면역세포를 추출하여 강화, 변형시키고 배양 후 다시 체내에 주사하는 방식의 치료제로, 상기 면역세포는 면역 시스템에서 면역 반응에 관여하는 세포로서, 세포 치료제로 이용되는 세포를 의미한다.
상기 면역세포는 예를 들면T 세포, B 세포, 수지상 세포, 자연 살해 세포(NK 세포), 자연 살해 T 세포(NKT 세포), 비만 세포 또는 골수 유래 식세포일 수 있으나 이에 제한되는 것은 아니다.
상기 면역 자극제는 수지상 세포에 항원을 노출시켜 표면에 항원을 표시하는 세포로 전환되는 것을 유발하는 물질이면 특별히 제한되지 않는다.
상기 면역 자극제는 수지상 세포의 표면에 MHC-II, CD86, CD80 또는 CD40의 발현이 증가되도록 유도시키는 것일 수 있다. 예를 들면 상기 면역 자극제는 박테리아 제제, CD40 작용제, TNF-α, IL-1β, LPS 또는 poly (I:C)일 수 있다.
상기 활성화된 수지상 세포와 면역세포를 공배양하는 단계는 면역세포의 증식 및 사이토카인의 분비를 유도한다.
예를 들면 활성화된 수지상세포 기준 공배양하는 면역세포수의 비율은 1 내지 50, 4 내지 30, 5 내지 25, 10 내지 30 또는 15 내지 25일 수 있다. 상기 공배양 시간은 2 내지 144시간, 4 내지 120시간, 12 내지 96시간 또는 24 내지 96시간, 48 내지 96시간 또는 48시간 내지 72시간으로 수행될 수 있으나, 이에 제한되는 것은 아니다.
상기 면역세포 치료제는 암, 세균 및 바이러스 감염성질환, 만성염증질환, 또는 자가면역질환의 치료 또는 예방용일 수 있다.
상기 암은 예를 들면, 폐암, 후두암, 위암, 대장/직장암, 간암, 담낭암, 췌장암, 유방암, 난소암, 자궁암, 자궁경부암, 전립선암, 신장암, 상피세포에서 유래하는 암종(carcinoma), 골암, 근육암, 지방암, 결합조직세포에서 유래하는 육종(sarcoma), 백혈병, 림프종, 다발성골수종의 조혈세포에서 유래하는 혈액암, 신경조직에 발생하는 종양, 갑상선암, 결장암, 고환암, 뇌종양, 두경부암, 방광암, 상피암, 선암, 식도암, 중피종, 피부암 또는 흑색종일 수 있으나, 이에 제한되는 것은 아니다.
상기 감염성 질환은 세균, 스피로헤타, 리케차, 바이러스, 진균 또는 기생충 등의 병원체에 감염되어 유발되는 질환일 수 있으나, 이에 제한되는 것은 아니다.
상기 만성염증 질환은 염증이 오랫동안 축적되어 생기는 질환으로, 세포 노화와 변형을 일으키고 면역 반응을 지나치게 활성화시켜 면역 시스템을 교란하는 것으로 알려져 있으며, 그에 따라 비만, 당뇨병과 같은 대사질환 또는 자가면역 질환까지 유발한다고 보고되어 있다.
상기 자가면역 질환은 인체 내부의 면역계가 외부 항원이 아닌 내부의 정상세포를 공격하여 발생하는 질환으로, 예를 들면 류마티스 관절염, 아토피, 루프스, 크론병, 1형 당뇨병, 궤양성 대장염 또는 다발성 경화증 등일 수 있으나, 이에 제한되는 것은 아니다.
상기 암, 감염성 질환 또는 면역질환 외에도 면역세포가 치료제로 이용될 수 있는 질환이라면 그 종류에 관계 없이 본 발명의 조성물을 이용하여 면역세포치료제를 제조할 수 있다.
또한, 본 발명은 상기 sICAM-1 저해제 및 이와 혼합된 수지상 세포를 포함하는 비활성화 상태인 수지상 세포 조성물을 제공한다.
상기 저해제 및 이의 수지상 세포 비활성화 억제 효과에 관한 구체적인 설명은 전술한 바와 같다.
상기 조성물은 인테그린 α4β1 또는 α5β1에 결합하는 인테그린 저해제, 또는 서열번호 1 내지 3 중 어느 하나의 서열로 이루어진 펩타이드를 포함할 수 있다,
상기 조성물의 수지상 세포는 비활성화 상태를 예를 들면 6시간 이상, 12시간 이상, 24시간 이상 또는 48시간 이상 유지되는 것일 수 있으며, 바람직하게는 6 내지 24시간, 6 내지 48시간, 12 내지 48시간 또는 12시간 내지 24시간일 수 있으나, 이에 제한되는 것은 아니다.
상기 세포 조성물은 전술한 수지상 세포의 활성화 억제용 조성물에 의해 비활성화 상태가 유지된 수지상 세포를 포함하는 것으로, 상기 수지상 세포는 구체적으로는 MHC-II, CD86, CD80 또는 CD40 인자의 발현 증가가 억제된 수지상 세포일 수 있다.
상기 수지상 세포는 자극을 받아 활성화되기 전까지는 생존을 유지하면서 기능적으로 항원을 탐식할 수 있으며, 활성화된 수지상 세포와는 달리 장기간 배양이 가능하여 체외에서 T 세포의 증식을 유발하거나, T 세포와 공배양하여 사이토카인 분비를 촉진하여 다양한 질환에 대한 면역세포 치료제 개발이 가능하다.
이하,　본　발명을　실시예에　의해　상세히　설명한다.　하기　실시예는　본　발명을　예시하는　것으로,　본　발명의　내용이　하기　실시예에　한정되는　것은　아니다.
실시예 1. Quantitative real-time PCR (q-PCR)반응으로 수지상 세포에서 인테그린 수용체 (integrin receptor)의 RNA 발현 측정
표 1에서 피브로넥틴이 세포의 인테그린에 결합하는 부위와 그 결합 도메인의 주요 구성 아미노산을 펩타이드로 제작하였으며 각 펩타이드에 결합하는 인테그린의 종류를 표시하였다. 펩타이드인 RGD (P1), LDV (P2), 및 PHSRN (P3) 펩타이드는 Peptron사 (대전, 한국)에 제작을 의뢰하고 구입하였으며 SHIMADZU LCMS-2020으로 제조되었다.
피브로넥틴에서 인테그린 결합 펩타이드의 아미노산 서열
Peptide
sequence 		Fibronectin Binding Domain Integrin
Receptor
P1 (RGD) III10 α3β1, α5β1, α8β1, αVβ1, αVβ3, αVβ6
P2 (LDV) III14-V α4β1, α4β7
P3 (PHSRN) III9 αIIbβ3, α5β1
도 1에서, 비장 수지상 세포에서 발현하는 인테그린 수용체의 RNA 양을 q-PCR법으로 측정하였다. 비장에서 CD11c+인 초대 수지상 세포를 분리하고 48웰 배양 플레이트에 세포를 2 × 107 cells/mL로 분주하여 37oC, 5% CO2 조건에서 2 시간 동안 배양하였다. 배양하지 않고 조직으로부터 바로 분리한 세포와 2 시간 배양한 세포로부터 RNA의 분리는 Qiagen RNeasy Mini Kit (Qiagen사, 독일)를 사용하였으며 RNA 농도는 NanoDrop ND spectrophotometer (Nanodrop Technologies사, 미국)를 사용하여 측정하였다. RNA는 PrimeScript RT reagent Kit (TaKaRa사, 일본)를 사용하여 역전사하였으며 함성된 cDNA를 사용하여 Quantitative real-time PCR (q-PCR)을 실행하였다. q-PCR 반응은 SYBR Premix EX Taq (Tli RNase H Plus) mix (Takara사, 일본)를 사용하여 QuantStudio쪠 3 Real-Time PCR System (Thermo Fisher Scientific사 미국)로 측정하였다. 아래 표 2에 나타낸 primer를 실험에 사용하였다. q-PCR 분석에서 발현 정도를 측정하기 위하여 Livak method (ΔΔCt)을 사용하였다.
Q-PCR에 사용한 Primer 리스트
Integrin
Receptors 		Forward sequence
(5'-3') 		Reverse sequence
(5'-3')
αE GGGTCCTACTTTGGCTCTGT (서열번호 4) GTGTGTGTGCCAAGGAGAAG (서열번호 5)
α4 AATTGGACCAAGTGAGGGACAA (서열번호 6) TCGCTAGATCCATACACAAATGA (서열번호 6)
α5 GAAGGGACGGAGTCAGTGTG (서열번호 8) TGAATGGTGCTGCACTGGAT (서열번호 9)
αL AGATCGAGTCCGGACCCACAG (서열번호 10) GGCAGTGAAGAGGCCTCCCG (서열번호 11)
αM AAACCACAGTCCCGCAGAGA (서열번호 12) CGTGTTCA CCAGCTGGCTTA (서열번호 13)
αV AATCTCCAGTGGCCTTACAA (서열번호 14) AGGAAGCAGATGACTTCAGG (서열번호 15)
β1 AATGCCAAATCTTGCGGAGAA (서열번호 16) TCTAAATCATCACATCGTGCAGAA (서열번호 17)
β2 GATAACATGTACAAGAGGAGCAATG (서열번호 18) CGCAAAGATGGGCTGGAT (서열번호 19)
β3 GGGGACTGCCTGTGTGACTC (서열번호 20) CTTTTCGGTCGTGGATGGTG (서열번호 21)
β6 TCTGAGGATGGAGTGCTGTG (서열번호 22) GGCACCAATGGCTTTACACT (서열번호 23)
β7 TGCAGCTCATCATGGATGCTTA (서열번호 24) CCGTCTTCTCAGGACCCTTACA (서열번호 25)
세포를 배양하기 전 조직으로부터 분리한 직후의 수지상 세포 (freshly isolated sDCs)와 2 시간 배양한 세포에서 mRNA 발현 정도는 β-액틴 mRNA 발현 양에 대한 각 인테그린 수용체의 mRNA의 발현 양의 비율을 구하고 αE의 비율에 대한 상대 수치로서 비교하였다. 배양하지 않은 수지상 세포에서는 α5, αM, 및 αV의 발현은 매우 적은 양이 측정되었으나 α4의 발현 양은 비교적 높게 측정되었다. 이에 비교하여 β1과 β2의 발현 양은 유사한 정도를 보였다. 2 시간 배양 후의 수지상 세포에서도 α5의 발현 양은 크게 증가하지 않았으나 α4, β1, 및 β2의 발현 양은 크게 증가하는 양상으로 나타났다.
실시예 2. 인테그린 수용체 저해제를 첨가한 배지에서 비장 수지상 세포의 배양
도 2에서, 비장 수지상 세포에서 발현하는 인테그린 수용체의 저해제인 BIO5192를 첨가하였을 때 비장 수지상 세포의 자가활성이 억제되는가를 측정하였다. BIO5192는 α4β1 (VLA-4)에 대하여 특이적으로 결합하여 억제하는 화합물로서 α4β1 인테그린이 피브로넥틴의 LDV에 결합하는 작용이 억제된다. BIO5192는 R&D Systems사로부터 구입하여 사용하였다. 비장으로부터 분리한 초대 수지상 세포(2 × 105/mL)를 48웰 플레이트에 분주하고 37℃와 5% CO2를 유지하는 세포 챔버 하에서 여러 농도의 BIO5192를 첨가하고 6 시간 및 24 시간 동안 배양한 후 세포가 단일 세포로 분포되거나 응집되는 정도를 공초점 현미경(Olympus confocal microscope FV1000, Olympus Corporation, n = 5)의 Differential interference contrast (DIC) 이미징으로 관찰하였다.
배양 6 시간 후 측정한 결과에서 5 μM 이상의 BIO5192에 의하여 세포 응집 현상은 현저하게 감소하는 것으로 나타났다. BIO5192의 세포 응집에 대한 억제 효능은 24 시간 동안 배양한 수지상 세포에서도 관찰되었다. BIO5192를 첨가하고 배양한 초대 수지상 세포에서 CD86의 발현을 유세포 분석기(MACSQuant VYB flow cytometer, Miltenyi Biotec)로 측정하고 측정 결과는 FlowJo v10 (Tree Star, Ashland)을 사용하여 분석하였을 때도 CD86의 발현은 BIO5192를 첨가하지 않고 배양한 자가활성이 일어난 세포에 비교하여 현저히 낮게 측정되었다.
실시예 3. 배양 후 비장 수지상 세포 아형의 자가 활성화에 대한 인테그린 수용체 저해제의 영향 측정
도 3에서, 비장 수지상 세포를 배양하면서 피브로넥틴, 펩타이드 조합 P1+P2+P3, 및 인테그린 수용체의 저해제인 BIO5192 (100 μM)와 ATN-161 (100 μM) 을 처리한 후 수지상 세포의 CD4+CD8-, CD4-CD8+, CD4-CD8-, 및 CD4+CD8+ 아형에서 CD86 발현의 정도를 측정하였다. 비장 수지상 세포는 배양 6 시간 후 다음의 형광으로 결합된 항체로 1 시간 동안 염색하였다; CD11-PE, CD86-FITC, CD4-PE.CY.7, CD8-APC (Thermo Fisher사). 형광이 결합된 항체로 염색된 수지상 세포는 유세포 분석기(Cytek Aurora Flow Cytometry) (Cytek　Biosciences,　Fremont,　CA,　USA)　로 측정하고 T-distributed stochastic neighbor embedding algorithm (T-SNE) (FlowJo) 프로그램으로 분석하였다. 분석한 결과는 Uniform Manifold Approximation and Projection (UMAP) plot으로 표시하고 각 subtype에서 CD86을 발현하는 세포와 발현하지 않는 세포들을 세포 수로 표시하였다.
도 4에서, 수지상 세포의 각 아형에 대한 UMAP plot으로 나타낸 결과에서 세포 수로 측정한 각 아형의 비율을 전체 세포에 대한 %로 표시하여 비교하였다. 비장에서 분리한 직후 배양하기 전의 수지상 세포는 CD4+CD8- 세포가 75% 정도를 차지하였으나 6 시간 배양한 세포는 CD4+CD8- 아형은 45%로 감소하였으며 CD4-CD8+와 CD4-CD8-아형이 각각 25% 정도로 증가하였다. CD4+CD8+ 아형은 전체 수지상 세포 중에서 비율적으로 유의한 변화를 보이지 않았다. 피브로넥틴이나 펩타이드 조합 P1+P2+P3으로 처리한 세포는 처리하지 않고 배양한 세포와 비교하여 아형의 비율에는 큰 변화가 없었으나 BIO5192를 처리한 경우는 CD4-CD8+ 세포의 비율이 약간 증가하는 것을 보였다. *는 Fresh와 비교하여 P <0.05 이하로서 통계적 유의성이 있으며 #는 none과 비교하여 P <0.05 이하로서 통계적 유의성이 있다.
도 5에서, 수지상 세포의 각 아형에 대한 UMAP plot으로 나타낸 결과에서 CD86을 발현하는 세포의 수를 전체 세포 수에 대한 %로 표시하여 비교하였을 때 BIO5129는 피브로넥틴과 펩타이드 조합 P1+P2+P3과 유사하게 CD86의 발현 증가를 억제하였다. α5β1에 결합하여 저해 작용을 하는 펩타이드인 ATN-161 (Ac-PHSCN-NH2, Selleckchem, 텍사스, 미국)도 BIO5192와 유사한 자가활성 억제 효과를 보였다. α4β1에 결합하는 BIO5192와 α5β1에 결합하는 ATN-161을 동시에 첨가하여도 CD86의 발현은 단독처리 보다 유의한 차이를 보이지 않았다. *는 none과 비교하여 P <0.05 이하로서 통계적 유의성이 있다.
도 6에서, 비장 수지상 세포의 각 아형들이 피브로넥틴, 펩타이드 조합, 및 인테그린 수용체 저해제인 BIO5192와 ATN-161을 첨가하고 배양한 6 시간 후 CD86 발현을 측정한 후 UMAP plot에서 나타난 CD86을 발현하는 아형별 세포의 수를 %로서 비교하였다. 초대 수지상 세포만을 배양하였을 때 모든 아형에서 CD86 발현이 증가하였다. 배양액에 피브로넥틴을 첨가하였을 때 수지상 세포의 모든 아형에서 CD86 발현의 증가는 억제되었으나 펩타이드 조합인 P1+P2+P3를 첨가한 배양에서 CD4+CD8-와 CD4-CD8- 세포에서 CD86 발현은 현저히 억제되었으며 CD4-CD8+ 세포에서 CD86의 발현은 영향을 받지 못하였다. BIO5192와 ATN-161은 피브로넥틴과 유사하게 CD4+CD8-, CD4-CD8+, 및 CD4-CD8- 세포에서 CD86의 발현을 억제하였다. *는 none과 비교하여 P <0.05 이하로서 통계적 유의성이 있다.
도 7에서, BIO5192와 ATN-161에 의하여 활성화가 억제되는 정도를 측정하기 위하여 여러 농도로 BIO5192와 ATN-161을 첨가하고 6 시간 혹은 24 시간 동안 배양한 후 CD86의 발현 정도를 유세포 분석기로 측정하였을 때 BIO5192의 IC50은 20 μM이었으며 ATN-161의 IC50은 70 μM이었다.
실시예 4. 배양한 비장 수지상 세포로부터 배양액으로 분비되는 인자 측정
도 8에서, 비장 수지상 세포를 배양한 후 자가활성을 유도하는 인자가 수지상 세포에서 분비되는가를 규명하기 위하여 수지상 세포(2 × 105 cells/500 μl)를 3, 6, 12, 및 24 시간 배양한 후 배양액에 분비된 사이토카인의 양을 Proteome Profiler Mouse Cytokine Array Kit, Panel A (R&D Systems)를 사용하여 측정하였다. 세포를 배양한 후 시간이 지남에 따라 증가하는 주요 사이토카인이나 케모카인을 A3 spot으로부터 D2 spot으로 측정되었으며 증가된 여러 사이토카인 중 TNF-α, sICAM-1 (soluble intercellular adhesion molecule-1), 및 CCL5의 분비되는 양을 표시하였다.
도 9에서, 비장 수지상 세포를 3 시간 및 24 시간 배양한 후 얻은 배양액을 Cytokine Array로 측정하여 주요 spot의 상대적인 mean pixel intensity를 나타내었다. 측정된 각 spot density 는 ImageJ 소프트웨어(NIH, Bethesda)로 분석하여 mean pixel intensity로 표시하였다. sICAM-1의 분비는 배양 3 시간 후 보다 24 시간 후에 2배 정도로 증가하였으며 TNF-α는 8배 정도 증가하였다.
실시예 5. 배양한 비장 수지상 세포로부터 sICAM-1의 분비와 이에 대한 피브로넥틴 및 펩타이드의 영향 측정
도 10에서, 비장 초대 수지상 세포(2 × 105/500 μl)를 24 시간 동안 배양한 후 배양액 내 분비된 sICAM-1 및 TNF-α의 농도는 시간 의존적으로 증가하였다. sICAM-1의 농도는 ELISA 키트(R&D Systems)를 사용하여 반응시켰고 마이크로 플레이트 분석기를 사용하여 450 nm 파장에서 측정하였다.
도 11에서, 피브로넥틴(200 μg/mL)과 펩타이드 조합 P1+P2+P3 (각 200 μg/mL)를 첨가하고 비장 수지상 세포(1 × 106/mL)는 24 시간 동안 배양하면서 일정 시간 후 배양액으로 분비되는 sICAM-1의 농도를 측정하였다. 배양액으로 분비되는 sICAM-1의 양은 피브로넥틴이나 펩타이드 조합 P1+P2+P3의 처리에 의하여 현저히 감소되었다. *는 none과 비교하여 P <0.05 이하로서 통계적 유의성이 있다.
실시예 6. 배양한 비장 수지상 세포로부터 sICAM-1의 분비와 이에 대한 피브로넥틴 및 펩타이드의 영향 측정
도 12에서, 재조합 단백질인 sICAM-1(10 ng/mL)을 첨가하고 비장 수지상 세포(1 × 106/mL)를 24 시간 동안 배양하면서 비장 수지상 세포의 활성이 어떠한 영향을 받는가를 측정하였다. sICAM-1을 처리한 세포에서 CD86 및 MHC-II의 발현 양이 유의적으로 증가하였으며 TNF-α의 분비도 증가하는 결과를 보임으로써 sICAM-1은 세포활성을 증가시킨다는 것을 제시한다. 이러한 sICAM-1에 의한 자가 활성화의 증가는 피브로넥틴 (200 μg/mL), 펩타이드 조합 P1+P2+P3 (각 200 μg/mL), 및 BIO5192 (50 μM)과 ATN-161 (50 μM)의 병용투여에 의하여 억제되었다. *는 none과 비교하여 P <0.05 이하로서 통계적 유의성이 있다.
실시예 7. 배양한 초대 수지상 세포에서 자가활성에 대한 sICAM-1 중화항체의 영향 측정
도 13에서, 초대 수지상 세포(2 × 105/mL)를 24웰 플레이트에 분주하고 ICAM-1에 대한 중화항체(10 μg/mL) (AF796, Polyclonal　Goat　IgG, R&D Systems, Inc. Minneapolis, MN, USA)와 대조군의 isotype IgG (10 μg/mL)를 첨가하고 6 시간 혹은 24 시간 동안 배양한 후 세포의 응집도와 CD86의 발현을 측정하였다. 대조군의 항체와 비교하여 sICAM-1에 대한 항체를 처리한 경우 수지상 세포의 응집이 현저하게 억제되었으며 CD86의 발현도 증가되지 않았다.
실시예 8. 배양한 초대 수지상 세포에서 자가활성에 관여하는 신호전달 인자의 활성화와 이에 대한 활성화 저해제의 영향 측정
도 14에서 초대 비장 수지상 세포(2 × 106/mL)를 배양액에 분주하고 37oC에서 30 분간 방치하였을 때 여러 신호전달 인자들 중에서 어떠한 인자의 활성화가 일어나는가를 Western blot 방법으로 신호전달 인자의 인산화 정도를 측정하였다. 비장 초대 수지상 세포를 피브로넥틴 (200 μg/mL), 펩타이드 조합 P1+P2+P3 (각 200 μg/mL), 및 sICAM-1 중화항체 (10 μg/ml)을 첨가하고 30분간 배양하였다. 배양한 세포는 채취하여 phosphatase와 proteases 억제제(Cell signaling Technology사, MA, 미국)를 첨가한 세포 용해 완충액에 부유시키고 4oC에서 20분간 처리하였다. 각 샘플의 단백질 양은 Bradford 측정키트 (Bio-Rad사, Hercules, California, 미국)를 사용하여 측정하였다. 각 샘플은 5Х sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) 완충액 (250 mM Tris-HCL pH 6.8, 0.25% bromophenol blue, 50% glycerol, 10% SDS, 0.5 M dithiothreitol)을 첨가하고 95°C에서 10분간 처리한 후 전기영동을 시행하기 전까지 -20°C에서 보관하였다. 샘플 당 10 μg 단백질을 by 8% (v/v) SDS-PAGE 겔에서 전기영동을 시행한 후 wet transfer Mini-Trans Blot system (Bio-Rad사)을 사용하여 nitrocellulose membrane으로 transfer하였다. 각 멤브레인들은 0.05% tween과 5% bovine serum albumin를 함유하는 PBS blocking 완충액에 담구고 실온에서 1시간 처리하였다.
다음의 항체를 사용하여 4°C 에서 12시간 처리하였다: 항-phospho-PI3-kinase p85(Tyr458)/p55(Tyr199) 항체 (Cat. # 4228, Cell Signaling Technology사), 항-phospho-AKT 항체(Ser473, 1:1000) (Cat. #9271S, Cell Signaling Technology사), 항-phospho-IKK-α/β 항체(Ser176/180, 1:5000) (Cat. # 2697T, Cell Signaling Technology사), 및 항-Beta Actin 항체(1:10,000) (Cat. #60008-1-Ig, Protein Tech사, Illinois, 미국). 일차 항체를 처리한 멤브레인은 PBS blocking 완충액으로 3회 세척하고 항-rabbit horseradish peroxidase-linked secondary antibody (Cat. #ab6721, Abcam사, 영국)로 실온에서 1시간 반응시켰다. Chemiluminescence 반응은 Clarity™ western ECL substrate (Bio-Rad사)을 사용하였으며 Medical X-ray film (AGFA사, Berlin, 독일)에 노출시켰다. 이미징은 Image J software (NIH, MD, 미국)를 사용하여 분석하였다. PI3K(phosphoinositide 3-kinase), AKT 및 IKK-α/β의 인산화는 배양 30분 후 현저히 증가하였으며 이들 단백질의 인산화는 피브로넥틴 및 펩타이드 조합의 첨가 분만 아니라 sICAM-1에 대한 중화항체에 의하여 현저히 억제되었다.
실시예 9. 배양 후 비장 수지상 세포의 자가 활성화에 대한 LFA-1과 ICAM-1의 결합을 억제하는 저해제의 영향 측정
도 15에서, CD11c+ 비장 수지상 세포(2 × 105/mL)를 6 시간 혹은 24 시간 동안 배양하면서 ICAM-1에 결합한다고 알려져 있는 LFA-1와의 결합을 저해하는 A286982 (Selleckchem사, 텍사스, 미국)을 처리한 후 수지상 세포에서 CD86 발현의 정도를 측정하였다. A286982를 농도 별로 증가하여 첨가하였을 때 A286982는 0.1 nM 농도부터 CD86의 발현을 억제하였으며 5 nM 농도에서 자가 활성화의 50% 정도를 억제하였다.

Claims (14)

  1. sICAM-1(soluble Intercellular Adhesion Molecule 1) 저해제를 포함하는 수지상 세포의 자가 활성화 억제용 조성물.
  2. 청구항 1에 있어서, 상기 저해제는 sICAM-1의 중화항체, 또는 sICAM-1과 인테그린 간의 결합 저해제인 수지상 세포의 자가 활성화 억제용 조성물.
  3. 청구항 2에 있어서, 상기 인테그린은 αLβ2인 수지상 세포의 자가 활성화 억제용 조성물.
  4. 청구항 1에 있어서, 상기 저해제는 하기 화학식 1 내지 5로 표시된 화합물로 이루어진 군에서 선택된 것인 수지상 세포의 자가 활성화 억제용 조성물:
    [화학식 1]
    Figure PCTKR2023016250-appb-img-000021
    [화학식 2]
    Figure PCTKR2023016250-appb-img-000022
    [화학식 3]
    Figure PCTKR2023016250-appb-img-000023
    [화학식 4]
    Figure PCTKR2023016250-appb-img-000024
    [화학식 5]
    Figure PCTKR2023016250-appb-img-000025
    .
  5. 청구항 1에 있어서, 인테그린 α4β1 또는 α5β1에 결합하는 인테그린 저해제를 더 포함하는 수지상 세포의 자가 활성화 억제용 조성물.
  6. 청구항 1에 있어서, 서열번호 1 내지 3 중 어느 하나의 서열로 이루어진 펩타이드를 더 포함하는, 수지상 세포의 자가 활성화 억제용 조성물.
  7. 청구항 5에 있어서, 상기 인테그린 저해제는 하기 화학식 6 내지 10으로 표시된 화합물로 이루어진 군에서 선택된 것인, 수지상 세포의 자가 활성화 억제용 조성물:
    [화학식 6]
    Figure PCTKR2023016250-appb-img-000026
    [화학식 7]
    Figure PCTKR2023016250-appb-img-000027
    [화학식 8]
    Figure PCTKR2023016250-appb-img-000028
    [화학식 9]
    Figure PCTKR2023016250-appb-img-000029
    [화학식 10]
    Figure PCTKR2023016250-appb-img-000030
    .
  8. 청구항 1 내지 7 중 어느 한 항에 있어서, 상기 수지상 세포는 비장 또는 림프절에서 유래한 것인 수지상 세포의 자가 활성화 억제용 조성물.
  9. 청구항 1 내지 7 중 어느 한 항에 있어서, 시험관 내에서(in vitro) 사용되기 위한 수지상 세포의 자가 활성화 억제용 조성물.
  10. 청구항 1 내지 7 중 어느 한 항의 조성물 하에 수지상 세포를 배양하는 단계를 포함하는 수지상 세포를 비활성화 상태로 배양하는 방법.
  11. 청구항 1 내지 7 중 어느 한 항의 조성물 하에 수지상 세포를 배양하는 단계;
    상기 배양된 수지상 세포에 면역자극제를 처리하여 상기 수지상 세포를 활성화시키는 단계; 및
    상기 활성화된 수지상 세포와 면역세포를 공배양하는 단계를 포함하는 면역세포치료제 제조 방법.
  12. 청구항 11에 있어서, 상기 면역자극제는 CD40(Cluster of differentiation　40) 리간드, TNF-α(Tumor necrosis factor-α), IL-1β(Interleukin 1β), LPS(lipopolysaccharide) 및 poly (I:C)(Polyinosinic:polycytidylic acid)로 이루어진 군에서 선택된 것인, 면역세포치료제 제조 방법.
  13. 청구항 11에 있어서, 상기 면역세포치료제는 암, 감염성질환, 만성염증 질환 또는 자가면역질환의 치료용인, 면역세포치료제 제조 방법.
  14. 청구항 1 내지 4 중 어느 한 항의 저해제 및 이와 혼합된 수지상 세포를 포함하는 비활성화 상태인 수지상 세포 조성물.
PCT/KR2023/016250 2022-10-28 2023-10-19 Sicam-1 저해제를 포함하는 수지상 세포의 자가 활성화 억제용 조성물 WO2024090895A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0141542 2022-10-28
KR1020220141542A KR20240068808A (ko) 2022-10-28 2022-10-28 sICAM-1 저해제를 포함하는 수지상 세포의 자가 활성화 억제용 조성물

Publications (1)

Publication Number Publication Date
WO2024090895A1 true WO2024090895A1 (ko) 2024-05-02

Family

ID=90831165

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/016250 WO2024090895A1 (ko) 2022-10-28 2023-10-19 Sicam-1 저해제를 포함하는 수지상 세포의 자가 활성화 억제용 조성물

Country Status (2)

Country Link
KR (1) KR20240068808A (ko)
WO (1) WO2024090895A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007137300A2 (en) * 2006-05-23 2007-11-29 Bellicum Pharmaceuticals, Inc. Modified dendritic cells having enhanced survival and immunogenicity and related compositions and methods
KR20100072902A (ko) * 2008-12-22 2010-07-01 한국생명공학연구원 마나산틴 ａ를 유효성분으로 포함하는 수지상 세포 성숙화 억제용 조성물
KR20150033978A (ko) * 2013-09-25 2015-04-02 충북대학교 산학협력단 투실라곤을 유효성분으로 포함하는 수지상세포의 성숙화 억제용 조성물
KR20200054722A (ko) * 2018-11-12 2020-05-20 조선대학교산학협력단 홍조류추출물을 이용한 미성숙수지상세포 분화유도용 배지조성물 및 미성숙수지상세포 분화유도방법
JP2022091314A (ja) * 2020-12-09 2022-06-21 株式会社アルプ再生医療研究所 クラスター制御培養による樹状細胞の調製法

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007137300A2 (en) * 2006-05-23 2007-11-29 Bellicum Pharmaceuticals, Inc. Modified dendritic cells having enhanced survival and immunogenicity and related compositions and methods
KR20100072902A (ko) * 2008-12-22 2010-07-01 한국생명공학연구원 마나산틴 ａ를 유효성분으로 포함하는 수지상 세포 성숙화 억제용 조성물
KR20150033978A (ko) * 2013-09-25 2015-04-02 충북대학교 산학협력단 투실라곤을 유효성분으로 포함하는 수지상세포의 성숙화 억제용 조성물
KR20200054722A (ko) * 2018-11-12 2020-05-20 조선대학교산학협력단 홍조류추출물을 이용한 미성숙수지상세포 분화유도용 배지조성물 및 미성숙수지상세포 분화유도방법
JP2022091314A (ja) * 2020-12-09 2022-06-21 株式会社アルプ再生医療研究所 クラスター制御培養による樹状細胞の調製法

Also Published As

Publication number Publication date
KR20240068808A (ko) 2024-05-20

Similar Documents

Publication Publication Date Title
WO2018074758A2 (ko) 면역질환 치료를 위한 고효능 줄기세포 선별방법
Ling et al. Mesenchymal stem cells overexpressing IFN-β inhibit breast cancer growth and metastases through Stat3 signaling in a syngeneic tumor model
WO2018097540A2 (ko) 무혈청면역세포배양용 배지첨가키트, 상기 키트를 이용한 면역세포배양방법, 상기 키트 또는 배양방법에 의해 얻어진 무혈청면역세포배양액 및 상기 배양액을 포함하는 화장료조성물
WO2016048107A1 (ko) 인터페론-감마 또는 인터류킨-1베타를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
KR101705412B1 (ko) Stat3 억제제가 처리된 간엽줄기세포를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물
WO2011115323A1 (ko) 디엘케이원-에프씨 융합 단백질을 유효성분으로 함유하는 암 전이 억제용 조성물
WO2022103138A1 (ko) 비피도박테리움 롱검 rapo (kctc13773bp)를 포함하는 암 예방 또는 치료용 조성물
Hiscox et al. Inhibition of cancer cell motility and invasion by interleukin-12
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
WO2024090895A1 (ko) Sicam-1 저해제를 포함하는 수지상 세포의 자가 활성화 억제용 조성물
WO2017146538A1 (ko) 조절 t 세포 매개성 질환의 예방 또는 치료용 약학적 조성물
WO2021158091A2 (ko) 케모카인 억제제, 콜로니 자극 인자 억제제 및 면역항암제를 포함하는 암의 예방 또는 치료용 조성물 및 병용 요법
WO2015199402A1 (ko) 특정 유전자 발현이 증가된 수지상세포의 제조방법 및 이를 이용하여 제조된 수지상세포를 포함하는 자가면역질환 치료 또는 예방용 조성물
WO2022131742A1 (ko) 소포체 스트레스 유발 물질로 처리된 세포 유래 엑소좀 및 이의 용도
WO2016117960A1 (ko) 면역질환 치료 효능을 갖는 grim19이 과발현된 중간엽줄기세포 및 이의 용도
WO2015023147A1 (ko) mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물
WO2012050269A1 (ko) 결핵균의 rv0351 단백질을 포함하는 수지상 세포의 성숙화 촉진용 조성물
WO2019027214A9 (ko) 동종-중간엽 줄기세포 및 이의 용도
Simhan et al. Human decidual cell Toll-like receptor signaling in response to endotoxin: the effect of progestins
WO2022092915A1 (ko) Gdf15를 유효성분으로 함유하는 면역질환의 예방 및 치료용 조성물
WO2018155890A1 (ko) 남성형 탈모 표적 유전자의 발현을 억제하는 비대칭 siRNA
WO2022108306A1 (ko) 인터류킨-33을 처리하여 면역원성이 향상된 cd103+ fcgr3+ 수지상세포의 제조방법 및 상기 수지상세포를 포함하는 면역항암치료용 약학적 조성물
WO2015194710A1 (ko) Stat3 억제제가 처리된 간엽줄기세포를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물
Dabbous et al. Macrophage and lymphocyte potentiation of syngeneic tumor cell and host fibroblast collagenolytic activity in rats
WO2022235072A1 (ko) 수지상 세포의 배양 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23883002

Country of ref document: EP

Kind code of ref document: A1