WO2024080818A1 - 상이한 tm 값을 가지는 2개의 프로브를 이용하여 샘플 내 타겟 핵산을 검출하는 방법 - Google Patents

상이한 tm 값을 가지는 2개의 프로브를 이용하여 샘플 내 타겟 핵산을 검출하는 방법 Download PDF

Info

Publication number
WO2024080818A1
WO2024080818A1 PCT/KR2023/015809 KR2023015809W WO2024080818A1 WO 2024080818 A1 WO2024080818 A1 WO 2024080818A1 KR 2023015809 W KR2023015809 W KR 2023015809W WO 2024080818 A1 WO2024080818 A1 WO 2024080818A1
Authority
WO
WIPO (PCT)
Prior art keywords
target nucleic
nucleic acid
signal
probe
composition
Prior art date
Application number
PCT/KR2023/015809
Other languages
English (en)
French (fr)
Inventor
이한빛
김정우
Original Assignee
주식회사 씨젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 씨젠 filed Critical 주식회사 씨젠
Publication of WO2024080818A1 publication Critical patent/WO2024080818A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

Definitions

  • the present disclosure relates to a method for detecting a target nucleic acid in a sample using two probes with different Tm values.
  • Real-time detection methods For detection of target nucleic acids, real-time detection methods that can detect target nucleic acids while monitoring target amplification in real time are widely used. Real-time detection methods generally use labeled probes or primers that specifically hybridize to the target nucleic acid.
  • Examples of methods using hybridization between a labeled probe and a target nucleic acid include the molecular beacon method (Tyagi et al., Nature Biotechnology v.14 MARCH 1996) using a dual-labeled probe with a hairpin structure, the HyBeacon method (French DJ et al., Mol Cell Probes, 15(6):363-374 (2001)), hybridization probe method using two probes each labeled as a donor and an acceptor (Bernad et al., 147-148 Clin Chem) 2000; 46) and the Lux method using single-labeled oligonucleotides (US Pat. No. 7,537,886).
  • the TaqMan method (US Pat. Nos. 5,210,015 and 5,538,848) using a dual-labeled probe and cleavage of the probe by the 5'-nuclease activity of DNA polymerase is widely used in the art.
  • Examples of methods using labeled primers include the Sunrise primer method (Nazarenko et al., 2516-2521 Nucleic Acids Research, 1997, v.25 no.12, and US Pat. No. 6,117,635) and the Scorpion primer method. (Whitcombe et al., 804-807, Nature Biotechnology v.17 AUGUST 1999 and US Pat. No. 6,326,145) and the TSG primer method (WO 2011-078441).
  • the number of target nucleic acids that can be simultaneously detected in one reaction depends on the number of available labels (e.g., 5 or less). limited by
  • the present inventors have made extensive research efforts to develop a novel method for detecting target nucleic acids in real time with improved convenience and high cost-effectiveness and efficiency.
  • efforts were made to develop a method that can detect multiple target nucleic acid sequences using a single type of label.
  • the target nucleic acid can be detected when using two probes with different Tm values that can hybridize adjacently on the target nucleic acid.
  • multiple target nucleic acids can be detected in real time using a single type of label. It was confirmed that it could be detected.
  • the purpose of the present disclosure is to provide a method for detecting n target nucleic acids in a sample.
  • Another object of the present disclosure is to provide a method for detecting target nucleic acid in a sample.
  • Another object of the present disclosure is to provide a composition for detecting target nucleic acid in a sample.
  • a method for detecting n target nucleic acids in a sample comprising the following steps:
  • n is an integer of 2 or more
  • the incubation includes a plurality of cycles, and detection of the signal is performed in at least one cycle among the plurality of cycles,
  • Each of the n target nucleic acid detection compositions provides a change in a signal indicating the presence of the corresponding target nucleic acid at a corresponding detection temperature among the n detection temperatures in the presence of the corresponding target nucleic acid,
  • the i th target nucleic acid detection composition provides a signal change indicating the presence of the i th target nucleic acid at the i th detection temperature among the n detection temperatures in the presence of the i th target nucleic acid, , provides a constant signal at other detection temperatures,
  • the i represents an integer from 1 to n , the i th detection temperature is lower than the i +1 th detection temperature,
  • the composition for detecting the i- th target nucleic acid has a signal-changing temperature range in which the signal changes depending on the presence of the i - th target nucleic acid and the i- th target nucleic acid. Even if the target nucleic acid is present, the signal has one or two signal-constant temperature ranges that are constant,
  • composition for detecting the i target nucleic acid is a composition for detecting the i target nucleic acid
  • InterSC Inter-Signal-Change composition, wherein the signal-change temperature range is higher than one signal-constant temperature range of two signal-constant temperature ranges and is lower than the other signal-constant temperature range.
  • At least one composition among the n compositions for detecting target nucleic acids includes a first probe and a second probe having different Tm values
  • the first probe comprises a hybridizing nucleotide sequence to a first region of the corresponding target nucleic acid
  • the first probe has a reporter molecule and a first quencher molecule
  • the reporter molecule and the first quencher molecule are (i) before the first probe hybridizes to the corresponding target nucleic acid, the reporter molecule and the first quencher molecule are in close proximity to each other, thereby causing the first quencher molecule to quenching the signal from a reporter molecule, and (ii) upon hybridization of the first probe and the corresponding target nucleic acid, the reporter molecule and the first quencher molecule are separated, thereby causing the first quencher molecule to It is present in a position that can unquench the signal from the reporter molecule,
  • the second probe comprises a hybridizing nucleotide sequence to a second region of the corresponding target nucleic acid
  • the second probe has a second quencher molecule
  • the Tm value of the first probe is higher than the Tm value of the second probe
  • the reporter molecule of the first probe is quenched by the second quencher molecule of the second probe;
  • step (b) determining the presence of n target nucleic acids from the signal detected in step (a), wherein the presence of the i - th target nucleic acid is determined by a change in the signal detected at the i -th detection temperature.
  • the first quencher molecule is 12 to 60 nucleotides apart from the reporter molecule.
  • the reporter molecule is linked to the 3'-terminal region or 5'-terminal region of the first probe.
  • the second quencher molecule of the second probe when the first probe and the second probe hybridize to the corresponding target nucleic acid, the second quencher molecule of the second probe is adjacent to the reporter molecule of the first probe, and thus Therefore, the reporter molecule and the second quencher molecule exist at a position where the second quencher molecule can quench the signal from the reporter molecule.
  • the second quencher molecule when the first probe and the second probe hybridize to the corresponding target nucleic acid, the second quencher molecule is located immediately adjacent to or separated from the reporter molecule by 1 to 4 nucleotides.
  • the second quencher molecule is connected to the 3'-end portion or the 5'-end portion of the second probe.
  • the reporter molecule when the second probe is hybridized to the corresponding target nucleic acid downstream in the 3' direction of the first probe, the reporter molecule is located at the 3'-terminal region of the first probe. and the second quencher molecule is located at the 5'-end region of the second probe.
  • the reporter molecule when the second probe is hybridized to the corresponding target nucleic acid upstream in the 5' direction of the first probe, the reporter molecule is located at the 5'-terminal region of the first probe. and the second quencher molecule is located at the 3'-end region of the second probe.
  • the first quencher molecule of the first probe and the second quencher molecule of the second probe are the same type of quencher molecule.
  • the 3'-end of the first probe and/or the second probe is blocked to prevent extension.
  • the composition including the first probe and the second probe having different Tm values has the signal-change temperature range being greater than the first signal-constant temperature range among the two signal-constant temperature ranges. It is an InterSC composition that is high and lower than the second signal-constant temperature range among the two signal-constant temperature ranges.
  • the first probe and the second probe are hybridized to the corresponding target nucleic acid at a temperature within the first signal-predetermined temperature range.
  • the first probe and the second probe do not hybridize to the corresponding target nucleic acid at a temperature within the second signal-certain temperature range.
  • the first probe hybridizes to the corresponding target nucleic acid, but the second probe hybridizes to the corresponding target nucleic acid. Not hybridized.
  • the signal-change temperature range depends on Tm values of the first probe and the second probe.
  • the i -th detection temperature is selected within the signal-change temperature range of the composition for detecting the i -th target nucleic acid, and the i -th detection temperature is selected from the signal-change temperature range of the composition for detecting another target nucleic acid. Not included in temperature range.
  • the signal-change temperature range of the composition for detecting the i- th target nucleic acid may partially overlap with the signal-change temperature range of the composition for detecting the target nucleic acid having an adjacent detection temperature, but is not adjacent. It does not overlap with the signal-change temperature range of the composition for detecting a target nucleic acid having a different detection temperature.
  • the first composition for detecting a target nucleic acid is an UnderSC or InterSC composition
  • the second composition for detecting a target nucleic acid is an InterSC or OverSC composition
  • the first composition for detecting target nucleic acid is an UnderSC or InterSC composition
  • the nth composition for detecting target nucleic acid is an InterSC or OverSC composition
  • the first target nucleic acid And the composition for detecting each target nucleic acid other than the nth target nucleic acid is an InterSC composition.
  • the composition for detecting the i- th target nucleic acid includes a label that provides a signal depending on the presence of the i -th target nucleic acid.
  • the label is linked to the oligonucleotide or is inserted into the oligonucleotide during the incubation.
  • the composition for detecting the ith target nucleic acid provides a dimer that provides a signal change.
  • the dimer that provides the signal change is initially included in the composition for detecting the ith target nucleic acid.
  • the dimer that provides the signal change is produced by hybridization between an oligonucleotide to which a label is linked and an oligonucleotide capable of hybridizing with the oligonucleotide to which the label is linked.
  • the dimer that provides the signal change is generated during incubation.
  • the dimer that provides the signal change is produced by hybridization between a label-linked oligonucleotide and the corresponding target nucleic acid.
  • the dimer that provides the signal change is produced by a cleavage reaction dependent on the presence of the corresponding target nucleic acid.
  • the dimer that provides the signal change includes a label.
  • the composition for detecting the i- th target nucleic acid provides a dimer that provides a signal change
  • the signal-change temperature range of the composition for detecting the i- th target nucleic acid is the length of the dimer and/or It changes depending on the sequence.
  • detection of the signal is performed in at least two cycles among the plurality of cycles.
  • the signal change is measured using signals detected in at least two cycles among the plurality of cycles.
  • the signal change at the i th detection temperature is measured using a signal detected in at least one cycle among the plurality of cycles and a reference signal value.
  • the reference signal value is obtained from a reaction in which the i- th target nucleic acid is absent.
  • signal detection at each of the n detection temperatures is performed using a single type of detector.
  • signals detected at the n detection temperatures are not distinguished from each other by the single type of detector.
  • the incubation includes a nucleic acid amplification reaction.
  • a method for detecting a target nucleic acid in a sample comprising the following steps:
  • the first probe comprises a hybridizing nucleotide sequence to a first region of the target nucleic acid
  • the first probe has a reporter molecule and a first quencher molecule
  • the reporter molecule and the first quencher molecule are (i) before the first probe hybridizes to the target nucleic acid, the reporter molecule and the first quencher molecule are close to each other, whereby the first quencher molecule is the reporter molecule quenching the signal from, and (ii) upon hybridization of the first probe and the target nucleic acid, the reporter molecule and the first quencher molecule are separated, thereby causing the first quencher molecule to separate from the reporter molecule. It exists in a position where the signal can be unquenched,
  • the second probe comprises a hybridizing nucleotide sequence to a second region of the target nucleic acid
  • the second probe has a second quencher molecule
  • the Tm value of the first probe is higher than the Tm value of the second probe
  • the reporter molecule of the first probe is quenched by the second quencher molecule of the second probe
  • step (c) determining the presence of the target nucleic acid from the signal detected in step (b).
  • the second quencher molecule of the second probe when the first probe and the second probe hybridize to the target nucleic acid, the second quencher molecule of the second probe is adjacent to the reporter molecule of the first probe, thereby, The reporter molecule and the second quencher molecule are present at a position where the second quencher molecule can quench the signal from the reporter molecule.
  • the second quencher molecule is connected to the 3'-end portion or the 5'-end portion of the second probe.
  • the reporter molecule when the second probe is hybridized to the corresponding target nucleic acid downstream in the 3' direction of the first probe, the reporter molecule is located at the 3'-terminal region of the first probe. and the second quencher molecule is located at the 5'-end region of the second probe.
  • the reporter molecule when the second probe is hybridized to the corresponding target nucleic acid upstream in the 5' direction of the first probe, the reporter molecule is located at the 5'-terminal region of the first probe. and the second quencher molecule is located at the 3'-end region of the second probe.
  • the first quencher molecule of the first probe and the second quencher molecule of the second probe are the same type of quencher molecule.
  • a composition comprising a first probe and a second probe having different Tm values has a signal-changing temperature range in which a signal changes depending on the presence of the target nucleic acid; SChTR) and two signal-constant temperature ranges (SCoTR) where the signal is constant even in the presence of the target nucleic acid.
  • SChTR signal-changing temperature range in which a signal changes depending on the presence of the target nucleic acid
  • SCoTR two signal-constant temperature ranges
  • the signal-change temperature range is higher than the first signal-constant temperature range of the two signal-constant temperature ranges and is higher than the second signal-constant temperature range of the two signal-constant temperature ranges. low.
  • the first probe and the second probe are hybridized to the target nucleic acid at a temperature within the first signal-predetermined temperature range.
  • the first probe and the second probe do not hybridize to the target nucleic acid at a temperature within the second signal-certain temperature range.
  • the first probe hybridizes to the target nucleic acid at a temperature within the signal-change temperature range, but the second probe does not hybridize to the target nucleic acid.
  • the signal-change temperature range depends on Tm values of the first probe and the second probe.
  • the signal detected in step (b) is a signal dependent on the presence of the target nucleic acid.
  • step (b) is performed at a detection temperature selected within the signal-change temperature range.
  • the incubation includes a nucleic acid amplification reaction.
  • the incubation in step (a) includes a plurality of cycles, and the detection of the signal in step (b) is performed in at least one cycle among the plurality of cycles.
  • the presence of the target nucleic acid in step (c) is determined by a signal change, and the signal change uses a signal detected in at least one cycle among the plurality of cycles and a reference signal value. It is measured.
  • the reference signal value is obtained from a reaction in which the target nucleic acid is absent.
  • the incubation in step (a) includes a plurality of cycles, and the detection of the signal in step (b) is performed in at least two cycles among the plurality of cycles.
  • the presence of the target nucleic acid in step (c) is determined by a signal change, and the signal change is measured using signals detected in at least two cycles among the plurality of cycles.
  • composition for detecting a target nucleic acid in a sample comprising:
  • the first probe has a reporter molecule and a first quencher molecule
  • the reporter molecule and the first quencher molecule are (i) before the first probe hybridizes to the target nucleic acid, the reporter molecule and the first quencher molecule are close to each other, whereby the first quencher molecule is the reporter molecule quenching the signal from, and (ii) upon hybridization of the first probe and the target nucleic acid, the reporter molecule and the first quencher molecule are separated, thereby causing the first quencher molecule to separate from the reporter molecule. is in a position to unquench the signal; and
  • the second probe has a second quencher molecule
  • the Tm value of the first probe is higher than the Tm value of the second probe
  • the reporter molecule of the first probe is quenched by the second quencher molecule of the second probe.
  • the second quencher molecule of the second probe when the first probe and the second probe hybridize to the target nucleic acid, the second quencher molecule of the second probe is adjacent to the reporter molecule of the first probe, thereby, The reporter molecule and the second quencher molecule are present at a position where the second quencher molecule can quench the signal from the reporter molecule.
  • the second quencher molecule is connected to the 3'-end portion or the 5'-end portion of the second probe.
  • the reporter molecule when the second probe is hybridized to the corresponding target nucleic acid downstream in the 3' direction of the first probe, the reporter molecule is located at the 3'-terminal region of the first probe. and the second quencher molecule is located at the 5'-end region of the second probe.
  • the reporter molecule when the second probe is hybridized to the corresponding target nucleic acid upstream in the 5' direction of the first probe, the reporter molecule is located at the 5'-terminal region of the first probe. and the second quencher molecule is located at the 3'-end region of the second probe.
  • the first quencher molecule of the first probe and the second quencher molecule of the second probe are the same type of quencher molecule.
  • the composition has two components: a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and a signal that is constant even in the presence of the target nucleic acid. It has a signal-constant temperature range (SCoTR).
  • SChTR signal-changing temperature range
  • SCoTR signal-constant temperature range
  • the signal-change temperature range is higher than the first signal-constant temperature range of the two signal-constant temperature ranges and is higher than the second signal-constant temperature range of the two signal-constant temperature ranges. low.
  • the first probe and the second probe are hybridized to the target nucleic acid at a temperature within the first signal-predetermined temperature range.
  • the first probe and the second probe do not hybridize to the target nucleic acid at a temperature within the second signal-certain temperature range.
  • the first probe hybridizes to the target nucleic acid at a temperature within the signal-change temperature range, but the second probe does not hybridize to the target nucleic acid.
  • the signal-change temperature range depends on Tm values of the first probe and the second probe.
  • the present disclosure is a method for detecting a plurality of target nucleic acids with only a single type of label using a plurality of detection temperatures in one reaction vessel, and the method according to the present disclosure is performed only at the detection temperature corresponding to each of the plurality of target nucleic acids. It is characterized by providing signal changes dependent on the presence of the corresponding target nucleic acid.
  • At least one target nucleic acid among a plurality of target nucleic acids is detected using two probes having different Tm values that can hybridize adjacent to each other on the target nucleic acid.
  • the second feature of the present disclosure is that the composition for detecting a target nucleic acid comprising two probes having different Tm values changes the signal depending on the presence of the target nucleic acid in a reaction with the target nucleic acid (e.g., amplification reaction).
  • the signal has two signal-constant temperature ranges where the signal is constant even if the target nucleic acid and target nucleic acid are present.
  • the composition for detecting a target nucleic acid comprising two probes having different Tm values has the signal-change temperature range higher than the first signal-constant temperature range among the two signal-constant temperature ranges, and the two signal-constant temperature ranges.
  • the second signal in the constant temperature range is an InterSC composition that has lower characteristics than the constant temperature range.
  • the composition for detecting a target nucleic acid comprising two probes with different Tm values not only enables detection of a single target nucleic acid, but also enables detection of a plurality of target nucleic acids in real time using a single type of label. Make it detectable. Specifically, when using a plurality of target nucleic acid detection compositions for detecting a plurality of target nucleic acids, the signal-change temperature range of each of the plurality of target nucleic acid detection compositions is adjusted (e.g., adjusted so as not to overlap each other) to form a single Multiple target nucleic acids can be detected in real time using tangible labels. In particular, it has the advantage of dramatically shortening the analysis time compared to the prior art, which requires melting analysis after target amplification to detect multiple target nucleic acids using a single type of label.
  • FIG. 1 shows a composition for detecting a target nucleic acid containing two probes in the absence of a target nucleic acid or having different Tm values according to the present disclosure and before reaction between the target nucleic acid, (i) a first signal - a certain temperature range, (ii) ) signal-change temperature range, and (iii) second signal-constant temperature range, showing the shapes of the first probe and the second probe.
  • Figure 2 shows a specific embodiment in which a second probe is hybridized to a target nucleic acid downstream in the 3' direction of the first probe, in the presence of the target nucleic acid (i) first signal - constant temperature range, (ii) signal - change. Temperature range and (iii) second signal - shows the shape of the first probe and the second probe in a certain temperature range.
  • Figure 3 shows a specific embodiment in which the second probe is hybridized to the target nucleic acid upstream in the 5' direction of the first probe, in the presence of the target nucleic acid (i) first signal-constant temperature range, (ii) signal-change temperature. range and (iii) second signal - shows the shape of the first probe and the second probe in a certain temperature range.
  • Figure 4 shows a melt curve for a target nucleic acid amplification reaction using a composition for detecting target nucleic acid containing two probes with different Tm values according to the present disclosure.
  • Figure 4 (a) shows (i) the first cycle before the reaction of the target nucleic acid in the initial cycle, mid-cycle, and late cycle according to the amplification of the target nucleic acid using a composition for detecting the target nucleic acid containing two probes with different Tm values. It represents the total content ratio (or abundance %) of the probe and/or second probe, and (ii) the total content ratio (or abundance %) of the first probe and/or second probe reacted with the target nucleic acid, and the bottom graph shows It shows the melt curve in the early, middle and late cycles.
  • the numbers in row (i) refer to the total content ratio (or abundance %) of the first probe and the second probe present in the form (i) to (iii) of Figure 1, and the numbers in row (ii) means the total content ratio (or abundance %) of the first probe and the second probe present in the form (i) to (iii) of FIG. 2 or (i) to (iii) of FIG. 3.
  • Figure 4(b) is a summation of the melt curves in each cycle of Figure 4(a).
  • Figure 5 shows melt curves in the early/mid/late cycles according to target nucleic acid amplification using the molecular beacon method, which can be adopted as the UnderSC signal generation method.
  • (a) shows the shape of the molecular beacon depending on the presence or absence of the target nucleic acid
  • (i) represents the shape of the molecular beacon in the absence of the target nucleic acid or before reaction with the target nucleic acid
  • (ii) represents the shape of the molecular beacon after reacting with the target nucleic acid.
  • the shape of the molecular beacon is shown below.
  • (b) shows the melt curve in the early, mid, and late cycles according to target nucleic acid amplification
  • (c) is a combination of the melt curves in (b) for each of the early/mid/late cycles.
  • Figure 6 shows melt curves in the early/mid/late cycles according to target nucleic acid amplification using the PTOCE-based method, which can be adopted as an InterSC signal generation method.
  • Figure 6 (a) shows the form of the oligonucleotide of the PTOCE-based method depending on the presence or absence of the target nucleic acid, (i) shows the shape of the oligonucleotide (PTO and CTO) when the target nucleic acid is absent or before reaction with the target nucleic acid. represents the form, and (ii) represents the form of the oligonucleotide (extended duplex) after reacting with the target nucleic acid.
  • Figure 6 (b) shows melt curves in the early, mid, and late cycles according to target nucleic acid amplification, and (c) is a combination of the melt curves in (b) for each of the early/mid/late cycles. will be.
  • Figure 7 shows melt curves in the early/mid/late cycles according to target nucleic acid amplification using a double quenching method that can be adopted as an OverSC signal generation method.
  • Figure 7 (a) shows the form of the oligonucleotide of the double quenching method depending on the presence or absence of the target nucleic acid
  • (i) is the form of the oligonucleotide (PTO and CQO) in the absence of the target nucleic acid or before reaction with the target nucleic acid.
  • (ii) represents the form of the oligonucleotide (activated tag dimer fragment) after reaction with the target nucleic acid.
  • Figure 7 (b) shows the melt curve in the early, mid, and late cycles according to target nucleic acid amplification
  • Figure 7 (c) shows the melt curve in (b) for the early/mid/late cycles, respectively. It is a combination of curves.
  • Figure 8 shows the temperature ranges that can be selected as detection temperatures when SChTRs do not overlap or partially overlap each other.
  • Figure 9 shows the amplification curve results by temperature of real-time PCR in Example 1.
  • Figure 10 shows the amplification curve results by temperature of multiplex real-time PCR in Example 2.
  • the present inventors have made extensive research efforts to develop a new method for detecting target nucleic acids in real time with improved convenience and high efficiency.
  • efforts were made to develop a method that can detect multiple target nucleic acid sequences using a single type of label.
  • the target nucleic acid can be detected when using two probes with different Tm values that can hybridize adjacently on the target nucleic acid.
  • using a single type of label multiple target nucleic acids can be detected. It was confirmed that it could be detected.
  • the present disclosure provides a method for detecting n target nucleic acids in a sample comprising the following steps:
  • n is an integer of 2 or more
  • the incubation includes a plurality of cycles, and detection of the signal is performed in at least one cycle among the plurality of cycles,
  • Each of the n target nucleic acid detection compositions provides a change in a signal indicating the presence of the corresponding target nucleic acid at a corresponding detection temperature among the n detection temperatures in the presence of the corresponding target nucleic acid,
  • the composition for detecting the i - th target nucleic acid provides a signal change indicating the presence of the i-th target nucleic acid at the i - th detection temperature among the n detection temperatures in the presence of the i - th target nucleic acid, , provides a constant signal at other detection temperatures,
  • the i represents an integer from 1 to n , the i th detection temperature is lower than the i +1 th detection temperature,
  • the composition for detecting the i- th target nucleic acid has a signal-changing temperature range in which the signal changes depending on the presence of the i - th target nucleic acid and the i- th target nucleic acid. Even if the target nucleic acid is present, the signal has one or two signal-constant temperature ranges that are constant,
  • composition for detecting the i target nucleic acid is a composition for detecting the i target nucleic acid
  • InterSC Inter-Signal-Change composition, wherein the signal-change temperature range is higher than one signal-constant temperature range of two signal-constant temperature ranges and is lower than the other signal-constant temperature range.
  • At least one composition among the n compositions for detecting target nucleic acids includes a first probe and a second probe having different Tm values
  • the first probe comprises a hybridizing nucleotide sequence to a first region of the corresponding target nucleic acid
  • the first probe has a reporter molecule and a first quencher molecule
  • the reporter molecule and the first quencher molecule are (i) before the first probe hybridizes to the corresponding target nucleic acid, the reporter molecule and the first quencher molecule are in close proximity to each other, thereby causing the first quencher molecule to quenching the signal from a reporter molecule, and (ii) upon hybridization of the first probe and the corresponding target nucleic acid, the reporter molecule and the first quencher molecule are separated, thereby causing the first quencher molecule to It is present in a position that can unquench the signal from the reporter molecule,
  • the second probe comprises a hybridizing nucleotide sequence to a second region of the corresponding target nucleic acid
  • the second probe has a second quencher molecule
  • the Tm value of the first probe is higher than the Tm value of the second probe
  • the reporter molecule of the first probe is quenched by the second quencher molecule of the second probe;
  • step (b) determining the presence of n target nucleic acids from the signal detected in step (a), wherein the presence of the i - th target nucleic acid is determined by a change in the signal detected at the i -th detection temperature.
  • first, second, A, B, (a), (b), (i), and (ii) may be used. These terms are only used to distinguish the component from other components, and the essence, order, or order of the component is not limited by the term.
  • a sample suspected to contain one or more target nucleic acids among the n target nucleic acids is mixed with a composition for detecting n target nucleic acids and incubated.
  • target nucleic acid refers to a nucleic acid sequence to be detected or quantified.
  • the target nucleic acid includes double strands as well as single strands.
  • the target nucleic acid includes sequences initially present in the nucleic acid sample as well as sequences newly generated in the reaction.
  • the target nucleic acids include all DNA (gDNA and cDNA), RNA molecules and hybrids thereof (chimeric nucleic acids).
  • the target nucleic acid may be in double-stranded or single-stranded form.
  • Target nucleic acids include all naturally occurring prokaryotic nucleic acids, eukaryotic (e.g., protozoa and parasites, fungi, yeast, higher plants, lower animals, and higher animals including mammals and humans) nucleic acids, viruses (e.g., Herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, poliovirus, etc.) nucleic acid or viroid nucleic acid. Additionally, the nucleic acid molecule may be any nucleic acid molecule produced or capable of being produced recombinantly, or any nucleic acid molecule that is or may be chemically synthesized. Accordingly, the nucleic acid sequence may or may not be found in nature. The target nucleic acid sequence may be a known or unknown sequence.
  • the n target nucleic acids may include nucleotide variations.
  • one of the n target nucleic acids may contain one type of nucleotide variation, and the other may contain a different type of nucleotide variation.
  • nucleotide variation may refer to the substitution, deletion, or insertion of a single or multiple nucleotides in a DNA sequence at a specific position among a continuous DNA segment. These consecutive DNA segments contain a gene or some other region of a chromosome. These nucleotide variations may be mutations or polymorphic allele variations.
  • nucleotide variations detected in the present disclosure include single nucleotide polymorphisms (SNPs), mutations, deletions, insertions, substitutions, and translocations.
  • nucleotide variations include various mutations within the human genome (e.g., mutations in the methylenetetrahydrofolate reductase (MTHFR) gene), mutations associated with drug resistance in pathogens, and tumorigenic-causing mutations.
  • MTHFR methylenetetrahydrofolate reductase
  • nucleotide variation includes any variation at a specific position in a nucleic acid sequence. That is, the term “nucleotide variation” includes the wild type and all mutant forms thereof at a specific position in the nucleic acid sequence.
  • n target nucleic acids herein may be genes from n different organisms, n different genes from the same organism, or a combination thereof.
  • sample means a cell, tissue or fluid from a biological source, or any other medium that can be beneficially evaluated in accordance with the present invention, including viruses, bacteria, tissues, cells, blood, serum. , plasma, lymph, milk, urine, feces, ocular fluid, saliva, semen, brain extracts, spinal fluid, appendix, spleen and tonsil tissue extracts, amniotic fluid, ascites and non-biological samples (such as food and water). Additionally, the sample includes naturally-occurring nucleic acid molecules isolated from biological sources and synthetic nucleic acid molecules. Additionally, the sample may be a lysate, extract, or isolated target nucleic acid itself for a specific specimen.
  • the incubation reaction refers to any reaction that induces a change in signal depending on the presence of the corresponding target nucleic acid at the corresponding detection temperature as each target nucleic acid reacts with the composition for detecting the corresponding target nucleic acid.
  • Incubation in the present disclosure includes multiple cycles.
  • step (a) incubation may include an amplification reaction, for example, a signal amplification reaction and/or a nucleic acid amplification reaction.
  • an amplification reaction for example, a signal amplification reaction and/or a nucleic acid amplification reaction.
  • the amplification reaction includes multiple cycles.
  • the incubation in step (a) is performed under conditions that allow target amplification along with signal change by the composition for detecting target nucleic acid.
  • These conditions include temperature, salt concentration, and pH of the solution.
  • the incubation in step (a) is performed in a signal amplification process without nucleic acid amplification.
  • the signal can be amplified simultaneously with target amplification.
  • the signal can be amplified without target amplification.
  • the signal change occurs in a process that includes signal amplification and target amplification.
  • amplification of the target nucleic acid may be performed according to polymerase chain reaction (PCR).
  • PCR is widely used in the art for target nucleic acid amplification and involves cycles of denaturation of the target nucleic acid, annealing (hybridization) between the target nucleic acid and primers, and primer extension (Mullis et al., US Pat. Nos. 4,683,195, 4,683,202 and No. 4,800,159; Saiki et al., (1985) Science 230, 1350-1354).
  • the amplification of the target nucleic acid is performed using ligase chain reaction (LCR) (U.S. Patent Nos. 4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al., eds, 1990). )), strand displacement amplification (SDA) (Walker, et al., Nucleic Acids Res. 20(7):1691-6 (1992); Walker PCR Methods Appl 3(1):1-6 (1993) ), transcription-mediated amplification (Phyffer, et al., J. Clin. Microbiol. 34:834-841 (1996); Vuorinen, et al. , J. Clin. Microbiol.
  • LCR ligase chain reaction
  • SDA strand displacement amplification
  • HAD helicase dependent amplification
  • NASBA nucleic acid sequence-based amplification
  • RCA rolling circle amplification
  • DNA polymerases can be used in the amplification reaction, including the “Klenow” fragment of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase, Vent® polymerase, and TerminatorTM polymerase. Includes.
  • the polymerase is a thermostable DNA polymerase that can be obtained from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermus flavus, Thermococcus litoralis , and Pyrococcus furiosus (Pfu). do. Most of the above polymerases can be isolated from the bacteria themselves or can be purchased commercially.
  • the above-described amplification method can amplify a target nucleic acid and/or signal through repetition of a series of reactions with or without changing the temperature.
  • the unit of amplification that includes repetition of the above series of reactions is expressed as a “cycle.”
  • the cycle can be expressed in number of repetitions or time depending on the amplification method used.
  • the series of reactions may be performed sequentially.
  • a denaturation reaction of the target nucleic acid i.e., template
  • a primer extension reaction may be sequentially performed.
  • the cycle can be expressed as a number of repetitions.
  • the above series of reactions can be performed simultaneously.
  • a primer annealing reaction may be performed on some of the plurality of templates at the same time, and the primers may already be annealed and a primer extension reaction may be performed on other templates.
  • the cycle can be expressed in time. Specifically, one cycle may be 5 seconds, 10 seconds, 30 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 10 minutes, 20 minutes, 30 minutes, 1 hour, or 2 hours.
  • the incubation can be performed for multiple cycles that can measure changes in signal depending on the presence of the target nucleic acid.
  • the number of the plurality of cycles is 2 to 100 cycles, 2 to 90 cycles, 2 to 80 cycles, 2 to 70 cycles, 2 to 60 cycles, 2 to 50 cycles, 2 to 40 cycles, 2 to 30 cycles, 2 to 20 cycles, 2 to 10 cycles, 5 to 100 cycles, 5 to 90 cycles, 5 to 80 cycles, 5 to 70 cycles, 5 to 60 cycles, 5 to 50 cycles, 5 to 40 cycles, 5 to 30 cycles, 5 to 20 cycles, 5 to 10 cycles, 10 to 100 cycles, 10 to 90 cycles, 10 to 80 cycles, 10 to 70 cycles, 10 to 60 cycles, 10 to 50 cycles, 10 to 40 cycles, 10 to 30 cycles, 10 It may be 20 cycles, 20 to 100 cycles, 20 to 90 cycles, 20 to 80 cycles, 20 to 70 cycles, 20 to 60 cycles, 20 to 50 cycles, 10 to 40 cycles, 10 to 30 cycles, 10 It may be 20 cycles, 20 to 100 cycles, 20 to 90 cycles, 20 to 80 cycles, 20 to 70 cycles, 20
  • detection of the signal may be performed at each cycle, a selected subset of cycles, or an end-point of an incubation reaction comprising a plurality of cycles.
  • the target nucleic acid amplification reaction may be a multi-target nucleic acid sequence amplification reaction.
  • multiple target nucleic acid amplification reaction refers to a reaction that targets and amplifies two or more nucleic acids in one reaction vessel.
  • a multi-target nucleic acid amplification reaction refers to a reaction that amplifies two or more nucleic acids together.
  • a multi-target nucleic acid amplification reaction involves 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 20 or more nucleic acid amplification reactions. More than 30, 40 or more, or more than 50 target nucleic acids can be amplified together.
  • the method according to the present disclosure uses a single type of label to react 2 to 50, 2 to 40, 2 to 30, 2 to 20, or 2 labels in one reaction vessel.
  • a greater number of target nucleic acids than the number of target nucleic acids that can be detected using a single type of label according to the method of the present disclosure such as, More target nucleic acids can be detected by multiples of the number of types of labels used.
  • a method according to the present disclosure is used to determine whether at least one of n target nucleic acids is present in a sample. For example, when n is 2, the present disclosure can be used to determine whether at least one of the first target nucleic acid and the second target nucleic acid is present in the sample. As another example, when n is 3, the present disclosure can be used to determine whether at least one of the first target nucleic acid, the second target nucleic acid, and the third target nucleic acid is present in the sample.
  • n is an integer of 2 or more.
  • n may be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45 or 50. It is not limited.
  • compositions for detecting n target nucleic acids that is, compositions for detecting first to nth target nucleic acids, to detect n target nucleic acids ( n is an integer of 2 or more), that is, first to nth target nucleic acids, respectively. This is used.
  • compositions for detecting first to nth target nucleic acids refers to a compilation or mixture of compositions specific for each of the first to nth target nucleic acids.
  • a composition for detecting one target nucleic acid is specific for one corresponding target nucleic acid.
  • the phrase “a composition for detecting a target nucleic acid is specific for one corresponding target nucleic acid” means that the composition for detecting a target nucleic acid is involved in the detection of the one corresponding target nucleic acid, but is involved in the detection of other target nucleic acids. It means not doing it.
  • the phrase means that the composition for detecting a target nucleic acid interacts with one corresponding target nucleic acid but does not interact with other target nucleic acids.
  • the composition for detecting the n-th target nucleic acid is specific for the n-th target nucleic acid, for example, the composition for detecting the first target nucleic acid is specific for the first target nucleic acid, and the composition for detecting the second target nucleic acid is specific for the second target nucleic acid. It is specific for the third The composition for detecting a target nucleic acid is specific for a third target nucleic acid.
  • the combination of the first to nth target nucleic acid detection compositions used herein is used together in one reaction, that is, the combination of the first to nth target nucleic acid detection compositions exists together in one reaction solution or reaction vessel. .
  • composition for detecting a target nucleic acid refers to a composition containing components used to detect a target nucleic acid.
  • each of the first to nth target nucleic acid detection compositions includes a label that provides a signal depending on the presence of the corresponding target nucleic acid among the first to nth target nucleic acids, Signals provided from each composition for detecting the nth target nucleic acid are not distinguished from each other by a single detection channel.
  • a composition for detecting a target nucleic acid may include various oligonucleotides involved in the amplification and detection of the target nucleic acid.
  • the label herein may be linked to an oligonucleotide or may exist in free form. or incorporated into the oligonucleotide during said incubation.
  • compositions for detecting the target nucleic acid examples include, but are not limited to, an oligonucleotide set used to amplify or detect the target nucleic acid, a label, a nucleic acid polymerase, a buffer, a polymerase cofactor, and a deoxyribonucleotide- Includes 5-triphosphate, etc.
  • the composition for detecting a target nucleic acid may include various polynucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit nucleic acid polymerase activity.
  • composition for detecting a target nucleic acid may include a set of oligonucleotides or reagents required to perform a positive control reaction.
  • the optimal amount of reagent to be used in a particular reaction can be readily determined by one skilled in the art having the benefit of the present disclosure.
  • Components of the composition for detecting target nucleic acids may be present or stored in one container or a plurality of containers before reaction.
  • the document describes various conventional signal generation methods according to the number and order of these signal-change temperature ranges and signal-constant temperature ranges, with (i) the signal-change temperature range being lower than the signal-constant temperature range; UnderSC (Under-Signal-Change) signal generation method, (ii) the signal-change temperature range is higher than the signal-constant temperature range of one of the two signal-constant temperature ranges and is higher than the signal-constant temperature range of the other one.
  • One of the InterSC (Inter-Signal-Change) signal generation method which has a low characteristic
  • the OverSC Over-Signal-Change
  • composition for detecting n target nucleic acids used herein is also a composition to which any one of the above three signal generation methods is applied. That is, the compositions for detecting n target nucleic acids used in the present disclosure are (i) UnderSC (Under-Signal-Change) composition, (ii) InterSC (Inter-Signal-Change) composition, and (iii) OverSC (Over- Signal-Change) composition.
  • UnderSC Under-Signal-Change
  • InterSC Inter-Signal-Change
  • OverSC Over- Signal-Change
  • the first composition for detecting target nucleic acid is an UnderSC or InterSC composition
  • the second composition for detecting target nucleic acid is an InterSC or OverSC composition
  • the first composition for detecting target nucleic acid is an UnderSC or InterSC composition
  • the nth composition for detecting target nucleic acid is an InterSC or OverSC composition
  • the first target nucleic acid and the first The composition for detecting each target nucleic acid other than the n target nucleic acid is an InterSC composition.
  • At least one of the n compositions for detecting target nucleic acids is a composition including a first probe and a second probe having different Tm values.
  • probe refers to a single-stranded nucleic acid molecule containing a region or regions that are substantially complementary to a target nucleic acid.
  • composition for detecting a target nucleic acid comprising a first probe and a second probe having different Tm values
  • Tm values used as at least one of the compositions for detecting target nucleic acids for detecting n target nucleic acids
  • FIG. 1 shows a composition for detecting a target nucleic acid containing two probes in the absence of a target nucleic acid or having different Tm values according to the present disclosure and before reaction between the target nucleic acid, (i) a first signal - a certain temperature range, (ii) ) signal-change temperature range, and (iii) second signal-constant temperature range, showing the shapes of the first probe and the second probe.
  • FIGS. 2 and 3 show the first probe and the second probe in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range when a target nucleic acid is present. Shows the shape of the probe. Specifically, Figures 2 and 3 show the shapes of the first probe and the second probe in the reaction product in which the target nucleic acid is amplified (eg, the product of the late cycle).
  • the first probe includes a hybridizing nucleotide sequence to a first region of the target nucleic acid. That is, the first probe can hybridize to the first region of the target nucleic acid.
  • hybridize As used herein, the terms “hybridize,” “hybridizing,” or “hybridization” refer to the formation of a double strand by non-covalent bonding between two complementary single-stranded polynucleotides under specific hybridization conditions or stringent conditions.
  • one oligonucleotide “comprises a hybridizing nucleotide sequence" to another oligonucleotide means that all or part of one oligonucleotide contains the complementary nucleotide sequence necessary for hybridization with all or part of another oligonucleotide. It means to have.
  • complementary is used to mean sufficiently complementary that a primer or probe will hybridize selectively to a target nucleic acid sequence under predetermined annealing or stringency conditions, including “substantially complementary” and “completely complementary.” It has the meaning of encompassing all things that are “perfectly complementary,” and preferably means completely complementary.
  • non-complementary is used to mean sufficiently non-complementary that a primer or probe will not selectively hybridize to a particular sequence under certain annealing or stringency conditions, and "substantially non-complementary” ( It has a meaning encompassing both “substantially non-complementary” and “completely non-complementary”, and preferably means completely non-complementary.
  • the portion of one oligonucleotide may be considered an individual oligonucleotide.
  • Hybridization can occur between two nucleic acid strands that are either completely matched or substantially matched with some mismatches (e.g., 1-4 mismatches). Complementarity for hybridization may vary depending on hybridization conditions, especially temperature.
  • Hybridization between two oligonucleotides can be performed under suitable hybridization conditions, which are generally determined by optimization procedures. Conditions such as temperature, concentration of components, number of hybridizations and washes, buffer components and their pH and ionic strength depend on various factors, including the length and GC amount of oligonucleotides (e.g., first and second probes) and target nucleic acid nucleotide sequence. It may vary depending on the factor. For example, when using relatively short oligonucleotides, it is desirable to adopt low stringent conditions.
  • the first probe has a reporter molecule and a first quencher molecule.
  • a reporter molecule linked to the first probe and a first quencher molecule are located close to each other. Because of this, the first quencher molecule linked to the first probe quenches the signal from the reporter molecule linked to the first probe.
  • the expression “a reporter molecule and a quencher molecule are in close proximity to each other” means that (i) the oligonucleotide containing both the reporter molecule and the quencher molecule has a specific conformational structure, such as a random coil or hairpin; (ii) by forming a hairpin structure, the reporter molecule and the quencher molecule therein are three-dimensionally adjacent to each other, or (ii) the oligonucleotide containing the reporter molecule and the oligonucleotide containing the quencher molecule are double-stranded. This means that the reporter molecule and the quencher molecule are close to each other.
  • the first probe before hybridizing with the target nucleic acid, forms a random coil or hairpin structure so that the first quencher molecule linked to the first probe receives a signal from the reporter molecule linked to the first probe. Perform intramolecular quenching.
  • the reporter molecule of the first probe and the first quencher molecule are spaced apart from each other. Specifically, the first probe hybridizes to the target nucleic acid, so that the first quencher molecule of the first probe is separated from the reporter molecule of the first probe, thereby causing the first quencher molecule to transmit the signal from the reporter molecule. Unquench.
  • the expression "the reporter molecule and the quencher molecule are spaced apart from each other” means that (i) the oligonucleotide containing both the reporter molecule and the quencher molecule forms a double strand with another oligonucleotide, thereby causing the oligonucleotide
  • the reporter molecule and the quencher molecule are three-dimensionally separated due to a specific conformational change (e.g., disruption of the hairpin structure), or (ii) the reporter molecule forms a double strand. This means that the oligonucleotide and the oligonucleotide containing the quencher molecule dissociate from each other and the reporter molecule and the quencher molecule are spaced apart from each other.
  • the reporter molecule and the first quencher molecule are (i) before the first probe hybridizes to the target nucleic acid, the reporter molecule and the first quencher molecule are close to each other, whereby the first quencher molecule A quencher molecule quenches the signal from the reporter molecule, and (ii) when the first probe and the target nucleic acid hybridize, the reporter molecule and the first quencher molecule are separated, thereby causing the first quencher molecule is present in a position that can unquench the signal from the reporter molecule.
  • the first quencher molecule of the first probe is 12 to 60 nucleotides, 15 to 60 nucleotides, 18 to 60 nucleotides, 20 to 60 nucleotides, 12 to 50 nucleotides, and 15 to 50 nucleotides from the reporter molecule of the first probe.
  • the reporter molecule is linked to the 3'-terminal region or the 5'-terminal region of the first probe.
  • 3'-end region or “5'-end region” as used herein when referring to a first probe and/or a second probe refers to a continuous region of any length from the 3'-end or 5'-end of the probe. It refers to a region or region containing a sequence.
  • the 3'-terminal region of a probe refers to a sequence comprising 1 to 10 nucleotides from its 3'-end, specifically 1 to 5 nucleotides, more specifically 1 to 3 nucleotides
  • the probe 5'-end means a sequence comprising 1 to 10 nucleotides from its 5'-end, specifically 1 to 5 nucleotides, more particularly 1 to 3 nucleotides from its 5'-end.
  • the second probe comprises a hybridizing nucleotide sequence to a second region of the target nucleic acid. That is, the second probe can hybridize to the second region of the target nucleic acid.
  • the second probe has a second quencher molecule.
  • the first region and the second region of the target nucleic acid are adjacent to each other.
  • first region and the second region of the target nucleic acid refers to the reporter molecule of the first probe hybridized to the first region of the target nucleic acid and the second region of the target nucleic acid.
  • second quencher molecules of the second probe hybridized to are close enough to interact with each other. That is, as long as the second quencher molecule of the second probe hybridized to the second region of the target nucleic acid can quench the signal from the reporter molecule of the first probe hybridized to the first region of the target nucleic acid, the target nucleic acid
  • the first region and the second region may be located immediately adjacent to each other without separation or may be located in close proximity with some separation.
  • the first region and the second region of the target nucleic acid may be located immediately adjacent to each other.
  • the first region and the second region of the target nucleic acid may be located immediately adjacent to each other to form a nick.
  • the first region and the second region of the target nucleic acid may be located close to each other.
  • the first region of the target nucleic acid is located 1-30 nucleotides, 1-20 nucleotides, 1-15 nucleotides, 1-10 nucleotides, 1-5 nucleotides, or 1-4 nucleotides away from the second region of the target nucleic acid. can do.
  • the first region and the second region of the target nucleic acid may overlap each other. For example, there may be an overlap of 1-10 nucleotides, 1-7 nucleotides, 1-5 nucleotides, 1-3 nucleotides or 1-2 nucleotides.
  • the reporter molecule of the first probe is quenched by the second quencher molecule of the second probe.
  • the second probe hybridizes to the second region of the target nucleic acid so that the second quencher molecule of the second probe is hybridized to the second region of the target nucleic acid. adjacent to the reporter molecule of the first probe hybridized to the first region, thereby causing the second quencher molecule to intermolecularly quench the signal from the reporter molecule.
  • the second quencher molecule of the second probe when the first probe and the second probe hybridize to the target nucleic acid, the second quencher molecule of the second probe is adjacent to the reporter molecule of the first probe, thereby causing the second The reporter molecule and the second quencher molecule are present at a position where the quencher molecule can quench the signal from the reporter molecule.
  • the second quencher molecule when the first probe and the second probe hybridize to the target nucleic acid, the second quencher molecule is located immediately adjacent to or within 4 nucleotides from the reporter molecule. More specifically, the second quencher molecule is 1, 2, 3, or 4 nucleotides apart from the reporter molecule.
  • the second quencher molecule is linked to the 3'-terminal region or 5'-terminal region of the second probe.
  • the reporter molecule when the second probe is hybridized to the target nucleic acid downstream in the 3' direction of the first probe, the reporter molecule is located at the 3'-terminal region of the first probe, The second quencher molecule is located at the 5'-terminal region of the second probe.
  • the expression used herein to describe the position between the first probe and the second probe refers to the first probe hybridized to the target nucleic acid. This means that the second probe is hybridized to the target nucleic acid so that the 5'-end of the second probe is located next to the 3'-end. If this is explained based on the first region and the second region of the target nucleic acid, the first region of the target nucleic acid is located downstream of the second region of the target nucleic acid in the 3'-direction (see FIG. 2).
  • the reporter molecule when the second probe is hybridized to the target nucleic acid upstream in the 5' direction of the first probe, the reporter molecule is located at the 5'-terminal region of the first probe, and 2 The quencher molecule is located at the 3'-end region of the second probe.
  • the expression used herein to describe the position between the first probe and the second probe refers to the expression of the first probe hybridized to the target nucleic acid. This means that the second probe is hybridized to the target nucleic acid so that the 3'-end of the second probe is located next to the 5'-end. If this is expressed based on the first region and the second region of the target nucleic acid, the first region of the target nucleic acid is located upstream in the 5'-direction of the second region of the target nucleic acid (see FIG. 3).
  • the first probe and/or the second probe is “blocked” at its 3′-end to prevent extension.
  • Blocking can be achieved according to conventional methods. For example, blocking involves adding a chemical moiety such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane-diol moiety to the 3'-hydroxyl group of the last nucleotide. It can be implemented. Alternatively, blocking can be performed by removing the 3'-hydroxyl group of the last nucleotide or using a nucleotide without a 3'-hydroxyl group, such as dideoxynucleotide.
  • the reporter molecules and quencher molecules used in the present disclosure are interactive labels.
  • a fluorescence resonance energy transfer (FRET) labeling system includes a fluorescent reporter molecule (donor molecule) and a quencher molecule (acceptor molecule).
  • the energy donor is fluorescent, but the energy acceptor may be fluorescent or non-fluorescent.
  • the energy donor is non-fluorescent, such as a chromophore, and the energy acceptor is fluorescent.
  • the energy donor is luminescent, such as bioluminescent, chemiluminescent, or electrochemiluminescent, and the acceptor is fluorescent.
  • Interactive labeling systems include label pairs based on “contact-mediated quenching” (Salvatore et al., Nucleic Acids Research , 2002 (30) no.21 e122 and Johansson et al., J. AM. CHEM SOC 2002 (124) pp 6950-6956).
  • the interactive labeling system includes any labeling system that induces a signal change by interaction between at least two molecules (eg, dyes).
  • Reporter molecules and quencher molecules useful as interactive labels can include any molecules known in the art. Examples of these molecules are: Cy2TM (506), YO-PROTM-1 (509), YOYOTM-1 (509), Calcein (517), FITC (518), FluorXTM (519), Alexa TM (520), Rhodamine 110 (520), Oregon GreenTM 500 (522), Oregon GreenTM 488 (524), RiboGreenTM (525), Rhodamine GreenTM (527), Rhodamine 123 (529), Magnesium GreenTM ( 531), Calcium GreenTM (533), TO-PROTM-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/ 568 (568), BODIPY564/570 (570), Cy3TM (570), AlexaTM 546 (570), TRITC (572), Magnesium OrangeTM (575), Phycoerythrin R&B (575), Rho
  • Suitable reporter-quencher pairs are described in various publications: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); U.S. Patent Nos. 3,996,345 and 4,351,760
  • non-fluorescent black quencher molecules can be used that can quench fluorescence of a broad range of wavelengths or specific wavelengths.
  • non-fluorescent black quencher molecules are BHQ and DABCYL.
  • the reporter includes the donor of FRET and the quencher includes the remaining partner (acceptor) of FRET.
  • fluorescein dye is used as a reporter and rhodamine dye is used as a quencher.
  • the second quencher molecule linked to the second probe is the same type of quencher molecule as the first quencher molecule linked to the first probe.
  • the first quencher molecule connected to the first probe is a non-fluorescent black quencher molecule (e.g., BHQ)
  • the second quencher molecule connected to the second probe is a non-fluorescent black quencher molecule (e.g., BHQ) of the same type.
  • the first quencher molecule connected to the first probe is a fluorescent acceptor molecule (e.g., rhodamine dye)
  • the second quencher molecule connected to the second probe is also a fluorescent acceptor molecule of the same type (e.g., rhodamine dye). dye) can be used.
  • the composition for detecting target nucleic acid according to the present disclosure including the first probe and the second probe reacts with the target nucleic acid to provide a signal dependent on the presence of the target nucleic acid.
  • the composition for detecting a target nucleic acid comprising a first probe and a second probe according to the present disclosure provides a change in signal as the target nucleic acid is amplified.
  • the first probe and the second probe according to the present disclosure are characterized in that they have different Tm values.
  • the Tm value of the hybrid between the first probe and the target nucleic acid is higher than the Tm value of the hybrid between the second probe and the target nucleic acid.
  • the Tm value of the first probe is at least 2°C, 3°C, 4°C, 5°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C than the Tm value of the second probe. , higher than 14°C, 15°C or 20°C.
  • the composition for detecting a target nucleic acid according to the present disclosure is a temperature range in which the signal changes depending on the presence of the target nucleic acid in a reaction with the target nucleic acid (e.g., amplification reaction), that is, , a signal-changing temperature range and two temperature ranges in which the signal does not change even if the target nucleic acid is present, that is, two signal-constant temperature ranges.
  • Figures 1 to 3 show the predominant forms of the first probe and the second probe depending on the presence or absence of target nucleic acid and temperature.
  • Figure 1 shows a composition for detecting a target nucleic acid containing two probes in the absence of a target nucleic acid or having different Tm values according to the present disclosure, before the reaction between the target nucleic acid and (i) a first signal - a certain temperature range; It shows the shapes of the first probe and the second probe in (ii) the signal-varying temperature range and (iii) the second signal-constant temperature range.
  • the first signal - a certain temperature range, signal change
  • the first probe forms a random coil or hairpin structure such that the reporter molecule of the first probe and the quencher molecule of the first probe are located close to each other.
  • the hairpin structure may also collapse and exist in the form of a random coil. This causes the first quencher molecule to quench the signal from the reporter molecule over the entire temperature range.
  • the second probe exists as a single strand over the entire temperature range (see Figure 1 (i) to Figure 1 (iii)).
  • Figure 2 shows a specific embodiment in which a second probe is hybridized to a target nucleic acid downstream in the 3' direction of the first probe, in the presence of the target nucleic acid (i) first signal - constant temperature range, (ii) signal - change. Temperature range and (iii) second signal - shows the shape of the first probe and the second probe in a certain temperature range.
  • Figure 3 shows a specific embodiment in which the second probe is hybridized to the target nucleic acid upstream in the 5' direction of the first probe, in the presence of the target nucleic acid (i) first signal-constant temperature range, (ii) signal-change temperature. range and (iii) second signal - shows the shape of the first probe and the second probe in a certain temperature range.
  • both the first probe and the second probe hybridize to the target nucleic acid in the first signal-certain temperature range.
  • the first probe hybridizes to the first region of the target nucleic acid and the reporter molecule of the first probe and the first quencher molecule are separated, with the first quencher molecule unquenching the signal from the reporter molecule, but the second probe
  • the second quencher molecule of the second probe and the reporter molecule of the first probe are close to each other, so that the second quencher molecule quenches the signal from the reporter molecule (FIG. 2(i) or FIG. (see (i) of 3).
  • the reporter molecule in the first signal-certain temperature range, is the first quencher molecule or the second quencher regardless of the presence of the target nucleic acid. It is quenched by molecules. Because of this, in the first signal-constant temperature range, the signal is constant without change in the signal even if the target nucleic acid is present.
  • the first probe hybridizes to the first region of the target nucleic acid, but the second probe does not hybridize to the second region of the target nucleic acid in the signal-change temperature range. That is, the second probe dissociates from the target nucleic acid and exists as a single strand.
  • both the first quencher molecule of the first probe and the second quencher molecule of the second probe are spaced apart from the reporter molecule of the first probe, unquenching the signal from the reporter molecule ((ii) of FIG. 2 or FIG. 3 (see (ii) of). That is, as shown in (ii) of FIG. 1 and (ii) of FIG. 2 or FIG.
  • the first quencher molecule quenches the signal from the reporter molecule. , if the target nucleic acid is present, the first quencher molecule and the second quencher molecule unquench the signal from the reporter molecule. Because of this, the signal changes depending on the presence of the target nucleic acid in the signal-change temperature range.
  • the first quencher molecule of the first probe approaches the reporter molecule of the first probe and quenches the signal from the reporter molecule (see (iii) in FIG. 2 or (iii) in FIG. 3). That is, as shown in (iii) of FIG. 1 and (iii) of FIG.
  • the reporter molecule in the second signal-certain temperature range, the reporter molecule is quenched by the first quencher molecule regardless of the presence of the target nucleic acid. there is. Because of this, in the second signal-constant temperature range, the signal is constant without change in the signal even if the target nucleic acid is present.
  • a first probe and a second probe that have not yet participated in the reaction may be present together, and in this case, the two probes are temperature-dependent. Accordingly, it exists in the form of (i) to (iii) of Figure 1.
  • the content of the first probe and the second probe is the concentration contained in the composition for initially detecting the target nucleic acid. is constant.
  • the first probe and the second probe included in the composition for detecting target nucleic acid may exist in the form of Figures 1 to 3 depending on the presence or absence of the target nucleic acid and/or temperature change, and the degree of reaction with the target nucleic acid.
  • Figure 4 shows (i) the target nucleic acid in the initial cycle, mid-cycle, and late cycle following target nucleic acid amplification using a composition for detecting target nucleic acid containing two probes with different Tm values according to the present disclosure. Represents the total content ratio (or abundance %) of the first probe and/or second probe before reaction, and (ii) the total content ratio (or abundance %) of the first probe and/or second probe reacted with the target nucleic acid, , showing the melt curve in the early, middle and late cycles.
  • the number in row (i) in (a) of Figure 4 refers to the total content ratio (or abundance %) of the first probe and the second probe present in the form (i) to (iii) of Figure 1.
  • the numbers in rows (a) to (ii) of Figure 4 are the total content of the first probe and the second probe present in the form (i) to (iii) of Figure 2 or (i) to (iii) of Figure 3. It means ratio (or abundance %).
  • “content ratio” or “abundance ratio” used while referring to the first probe and/or second probe reacted with the target nucleic acid refers to the hybridization that can be formed by hybridization of the two probes at a specific temperature (or temperature range). It refers to the content ratio (or abundance %) of the cargo.
  • the content ratio (or abundance %) of the first probe reacted with the target nucleic acid is the first probe present in the form (i) to (iii) of Figure 2. It means the total content ratio (or abundance %).
  • the content ratio of rows (i) and (ii) in (a) of Figure 4 changes as the cycle increases, that is, as the target nucleic acid is amplified.
  • a graph such as (b) in FIG. 4 can be obtained.
  • the content of the first probe and the second probe reacted with the target nucleic acid increases as the target nucleic acid is amplified.
  • the content of the first and second probes that do not react with the target nucleic acid decreases. That is, the content ratio between them changes, and as the target nucleic acid is amplified, the signal indicating the presence of the target nucleic acid also changes. Due to this change in content ratio, the signal indicating the presence of the target nucleic acid in the signal-change temperature range also changes. Therefore, the composition for detecting a target nucleic acid according to the present disclosure can provide a signal dependent on the presence of the target nucleic acid.
  • the two signals constant-temperature In this range, the signal does not change and is constant.
  • the composition for detecting a target nucleic acid has two signal-constant temperature ranges: a signal-change temperature range in which the signal changes depending on the presence of the target nucleic acid, and a signal-constant temperature range in which the signal is constant even in the presence of the target nucleic acid. .
  • the signal-change temperature range is higher than the first signal-constant temperature range among the two signal-constant temperature ranges, and the two signal-constant temperature ranges are higher than the first signal-constant temperature range.
  • the second signal in the constant temperature range is an InterSC composition that has lower characteristics than the constant temperature range.
  • the signal-change temperature range is determined depending on Tm values of the first probe and the second probe. Accordingly, the signal-varying temperature range and the two signal-constant temperature ranges can be controlled by adjusting the Tm value of the first probe and the Tm value of the second probe.
  • signal-constant temperature range refers to the range of temperatures over which a composition for detecting a target nucleic acid provides a constant signal despite the presence of the target nucleic acid.
  • the signal-constant temperature range is a temperature range in which the composition for detecting a target nucleic acid provides a constant signal even over reaction time, which herein refers to the temperature range in which the composition for detecting a target nucleic acid does not provide a significant signal, or the temperature range in which the composition for detecting a target nucleic acid does not provide a significant signal, or It may also be referred to as a temperature range that does not provide a signal indicating its presence.
  • signal-changing temperature range refers to the temperature range over which a composition for detecting a target nucleic acid provides a signal that changes depending on the presence of the target nucleic acid.
  • the signal-change temperature range is a temperature range in which the composition for detecting a target nucleic acid provides a signal that changes over reaction time, which is the temperature range in which the composition for detecting a target nucleic acid provides a significant signal herein, or the temperature range in which the composition for detecting a target nucleic acid provides a significant signal, or the target nucleic acid It may also be referred to as the temperature range that provides a signal indicating the presence of.
  • constant signal means that the signal does not substantially change during the reaction between the target nucleic acid and the composition for detecting the target nucleic acid (e.g., target nucleic acid amplification reaction). That is, the term “constant signal” refers to all or any signal patterns excluding significant signal changes caused by amplification of existing target nucleic acids.
  • the constant signal means no signal change. For example, if the signal during an amplification reaction does not exceed the intensity of the background signal or the intensity of the signal in the absence of the target nucleic acid, it can be expressed as “the signal is constant.”
  • a constant signal may be used interchangeably herein with a signal that does not change or a signal that does not show change.
  • signal change means a significant signal change, that is, a significant change in signal indicating the presence of a target nucleic acid.
  • a significant signal change i.e., a signal change indicative of the presence of a target nucleic acid
  • a signal change indicative of the presence of a target nucleic acid refers to the occurrence or disappearance of a signal with a distinct intensity compared to the intensity of the background signal or the intensity of the signal in the absence of the target nucleic acid, or This means that as the target nucleic acid and/or signal is amplified during the incubation reaction of step (a), the intensity of the signal indicating the presence of the target nucleic acid is substantially increased or substantially decreased.
  • the signal change includes “signal generation or disappearance” and “signal increase or decrease” from the label.
  • the signal change may occur depending on the presence or absence of the target nucleic acid.
  • a signal change may occur as a signal indicating the presence of a target nucleic acid is generated or extinguished.
  • the signal change may occur during amplification of the target nucleic acid.
  • signal changes may occur as the amount of target nucleic acid increases during amplification of the target nucleic acid.
  • a signal indicating the presence of the target nucleic acid may increase or decrease, leading to a signal change.
  • the signal change may occur upon amplification of a signal dependent on the target nucleic acid.
  • a signal when a signal is amplified depending on the target nucleic acid, the intensity of the signal changes, thereby changing the signal.
  • the signal dependent on the presence of the target nucleic acid is amplified, the signal indicating the presence of the target nucleic acid increases or decreases, leading to a signal change.
  • signal change and/or “constant signal” are based on signals detected at the same temperature during a nucleic acid amplification reaction using the same target nucleic acid detection composition.
  • signal change and/or “constant signal” are used based on the difference in signal values detected at the same temperature using a composition for detecting n target nucleic acids, and specifically, “signal change” and/or “ “Constant signal” refers to (i) the difference between signal values detected at the same temperature in multiple cycles, or (ii) the difference between the “reference signal value” described later and the signal value detected at the same temperature as the temperature at which the reference signal value is set. Based on this, it is referred to as “change of signal” and/or “constant signal”. That is, “signal change” and/or “constant signal” are not referred to based on differences between signal values detected at different temperatures.
  • the expression “one temperature range is lower than the other temperature range” used in relation to the signal-change temperature range and the signal-constant temperature range of the composition for detecting the target nucleic acid means the highest temperature within one temperature range. It means that is lower than the lowest temperature within the other temperature range. Conversely, the expression “one temperature range is higher than another temperature range” means that the lowest temperature within one temperature range is higher than the highest temperature within the other temperature range. For example, saying that the signal-constant temperature range is higher than the signal-varying temperature range means that the lowest temperature within the signal-constant temperature range is higher than the highest temperature within the signal-varying temperature range.
  • the composition for detecting the target nucleic acid may additionally include a primer capable of amplifying the target nucleic acid sequence including the first region and the second region of the target nucleic acid.
  • the composition for detecting a target nucleic acid may additionally include a polymerase for amplifying the target nucleic acid.
  • the polymerase is a polymerase without nuclease activity (e.g., 5' ⁇ 3' exonuclease activity).
  • the polymerase is a polymerase that has nuclease activity (e.g., 5' ⁇ 3' exonuclease activity).
  • the first probe and/or the second probe are resistant to nuclease activity.
  • the composition for detecting a target nucleic acid according to the present disclosure is characterized by having a signal-change temperature range and two signal-constant temperature ranges. Due to these features, the signal-change temperature range can be adjusted to detect not only a single target nucleic acid but also a single signal-change temperature range. Detection of multiple target nucleic acids is also possible using a tangible label. However, when a polymerase having nuclease activity is used, the first probe and/or the second probe may be cleaved by the nuclease activity.
  • Cleavage of this probe leads to release of the reporter molecule, first quencher molecule and/or second quencher molecule linked to the probe, and the reporter molecule is unquenched from the first quencher molecule and/or second quencher molecule over the entire temperature range. .
  • the signal changes depending on the presence of the target nucleic acid over the entire temperature range without a signal-constant temperature range.
  • the composition for detecting a target nucleic acid includes a polymerase with nuclease activity, for example, 5' ⁇ 3' exonuclease activity
  • the first probe and/or the second probe have 5' ⁇ 3' exonuclease activity. 'It is desirable to have resistance to nuclease activity.
  • resistance to 5' ⁇ 3' exonuclease activity is conferred by nucleotides having a backbone resistant to 5' ⁇ 3' exonuclease activity, various phosphorothioates.
  • the method for detecting n target nucleic acids uses compositions for detecting n different target nucleic acids corresponding to each target nucleic acid to detect n different target nucleic acids.
  • the method for detecting n different target nucleic acids corresponds to the target nucleic acids.
  • At least one of the n target nucleic acid detection compositions is an InterSC target nucleic acid detection composition, which relates to a method of using a target nucleic acid detection composition comprising two probes having different Tm values according to the present disclosure.
  • n 2
  • a composition for detecting a first target nucleic acid and a composition for detecting a second target nucleic acid are used to detect each of the first target nucleic acid and the second target nucleic acid, and among the two compositions for detecting the target nucleic acid, A composition for detecting a target nucleic acid is used, including two probes, at least one of which has different Tm values.
  • n 3
  • a composition for detecting a first target nucleic acid, a composition for detecting a second target nucleic acid, and a composition for detecting a third target nucleic acid are used to detect each of the first target nucleic acid, the second target nucleic acid, and the third target nucleic acid.
  • At least one of the three target nucleic acid detection compositions includes two probes with different Tm values.
  • the signal generation methods of the composition for detecting the first target nucleic acid and the composition for detecting the second target nucleic acid can be combined as shown in Table 1 below.
  • the composition for detecting the first to third target nucleic acids can be combined as shown in Table 2.
  • "UnderSC”, “InterSC”, and “OverSC” refer to UnderSC, InterSC, and OverSC compositions to which various UnderSC, InterSC, and OverSC signal generation methods known in the art are applied, respectively, and in particular, "InterSC” refers to an InterSC composition to which a signal generation method is applied that is different from the method of using two probes with different Tm values according to the present disclosure.
  • UnderSC composition InterSC composition and OverSC composition
  • Figure 5 the molecular beacon method (Tyagi et al., Nature Biotechnology v.14 MARCH 1996), in Figure 6 PTOCE.
  • the signal-varying temperature range and signal-constant temperature range(s) are shown for the -based method (WO 2012/096523) and the double-quenching method (WO 2016/101959) in Figure 7.
  • WO 2012/096523 the WO 2012/096523
  • WO 2016/101959 double-quenching method
  • (a) shows the oligonucleotide contained in the composition for detecting target nucleic acid depending on the presence or absence of the target nucleic acid
  • (i) shows the oligonucleotide contained in the composition for detecting the target nucleic acid depending on the presence or absence of the target nucleic acid or the presence or absence of the target nucleic acid.
  • (ii) represents the form of the oligonucleotide after the composition for detecting target nucleic acid reacts with the target nucleic acid.
  • PTOCE-based method generally involves the formation of an extended strand that is dependent on the presence of the target nucleic acid.
  • the term “PTOCE-based method” is used herein to encompass a variety of methods for providing a signal, including cleavage and extension of PTO to form an extended strand.
  • a specific implementation of signal generation by the PTOCE-based method includes the following steps:
  • step (a) hybridizing the target nucleic acid with the upstream oligonucleotide and PTO; (b) contacting the result of step (a) with an enzyme having 5'nuclease activity under conditions for cleavage of the PTO;
  • the upstream oligonucleotide or its extended strand induces cleavage of the PTO by an enzyme having the 5'nuclease activity, the cleavage comprising the 5'-tagging site or a portion of the 5'-tagging site of the PTO.
  • step (a) releasing fragments that: (c) hybridizing the fragment released from the PTO with CTO; The fragment released from the PTO hybridizes to the capturing site of the CTO; (d) carrying out an extension reaction using the product of step (c) and a template-dependent nucleic acid polymerase; The fragment hybridized to the capturing site of the CTO is extended to form an extended strand, and (e) detecting the formation of the extended strand by measuring a signal generated depending on the presence of the extended strand.
  • a primer set for amplification of the target nucleic acid may be used instead of the upstream oligonucleotide.
  • the method additionally includes repeating all or part of steps (a)-(e) above, including denaturation between repeating cycles.
  • a specific implementation of signal generation by the double quenching analysis method includes the following steps:
  • the PTO includes (i) a targeting site comprising a nucleotide sequence substantially complementary to the target nucleic acid sequence, (ii) a melting temperature determining region (MTDR) comprising a nucleotide sequence non-complementary to the target nucleic acid sequence.
  • a targeting site comprising a nucleotide sequence substantially complementary to the target nucleic acid sequence
  • MTDR melting temperature determining region
  • the CQO comprises (i) a capturing site comprising a nucleotide sequence that is reverse complementary to the MTDR of the PTO and (ii) at least one quenching molecule, wherein the MTDR comprises the capturing site of the CQO and hybridize to form a tag duplex; (c) contacting the tag dimer with an enzyme having nuclease activity; When the tag dimer is hybridized to the target nucleic acid sequence, the enzyme having nuclease activity induces cleavage of the tag dimer, comprising a PTO fragment comprising an MTDR hybridized to the CQO capturing site and at least one fluorophore.
  • the composition for detecting n target nucleic acids provides a change in a signal indicating the presence of the corresponding target nucleic acid at a corresponding detection temperature among the n detection temperatures.
  • the composition for detecting the i th target nucleic acid among the n target nucleic acids provides a signal change at the i th detection temperature among the n detection temperatures in the presence of the i th target nucleic acid, and provides a constant signal at other detection temperatures. do.
  • i represents an integer from 1 to n , and the i th detection temperature is lower than the i +1 th detection temperature.
  • i represents an integer from 1 to n
  • i represents an integer from 1 to 3
  • i represents an integer from 1 to 3
  • the second detection temperature is lower than the third detection temperature.
  • the composition for detecting the i- th target nucleic acid has a signal-changing temperature range in which the signal changes depending on the presence of the i - th target nucleic acid. range) and one or two signal-constant temperature ranges where the signal is constant even when the ith target nucleic acid is present.
  • the composition for detecting the ith target nucleic acid is (i) an UnderSC (Under-Signal-Change) composition having the characteristic that the signal-change temperature range is lower than the signal-constant temperature range, (ii) An InterSC (Inter-Signal-Change) composition having the characteristic that the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other signal-constant temperature range, and ( iii) Any one of OverSC (Over-Signal-Change) compositions having the characteristic that the signal-change temperature range is higher than the signal-constant temperature range.
  • UnderSC Under-Signal-Change
  • An InterSC Inter-Signal-Change composition having the characteristic that the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other signal-constant temperature range
  • Any one of OverSC (Over-Signal-Change) compositions having the characteristic that the signal-change temperature range is higher than the signal-constant temperature range.
  • the composition for detecting the i -th target nucleic acid provides a signal change (i.e., a change in the i - th signal) according to amplification of the target nucleic acid at the i -th detection temperature when the i - th target nucleic acid is present.
  • a signal change i.e., a change in the i - th signal
  • the composition for detecting the i -th target nucleic acid provides a signal change (i.e., a change in the i - th signal) according to amplification of the target nucleic acid at the i -th detection temperature when the i - th target nucleic acid is present.
  • the signal is constant.
  • the composition for detecting the i- th target nucleic acid has a signal-change temperature range in which the signal changes as the target nucleic acid is amplified, and a signal-constant temperature range in which the signal is constant even if the target nucleic acid is amplified.
  • i -th signal refers to a signal provided by the composition for detecting the i-th target nucleic acid at the i -th detection temperature, and is used interchangeably with “signal at the i-th detection temperature.”
  • the i- th signal may mean a signal provided by n compositions for detecting target nucleic acids, including the composition for detecting the i -th target nucleic acid, at the i -th detection temperature.
  • the composition for detecting the i-th target nucleic acid does not change the signal at the i -th detection temperature during the incubation reaction (e.g., target nucleic acid amplification reaction) and produces a constant signal when the i-th target nucleic acid is not present. to provide.
  • the signal-change temperature range is a temperature range in which a difference in signal value (eg, signal intensity) occurs depending on the presence or absence of the target nucleic acid.
  • the signal-change temperature range is a temperature range in which the signal value changes depending on the degree of amplification of the target nucleic acid (eg, the amount of amplified target nucleic acid).
  • the signal-constant temperature range is a temperature range in which the signal value does not change regardless of the presence of the target nucleic acid. That is, the signal-constant temperature range is a temperature range in which there is no difference between the signal value when the target nucleic acid is present and the signal value when the target nucleic acid is not present.
  • the i -th detection temperature may be selected within the signal-change temperature range of the composition for detecting the i-th target nucleic acid.
  • the composition for detecting the i -th target nucleic acid is referred to herein as having the i -th detection temperature.
  • the i- th target nucleic acid corresponding to the composition for detecting the i- th target nucleic acid may be referred to as the target nucleic acid having the i-th detection temperature.
  • one detection temperature determined by the composition for detecting the corresponding target nucleic acid is assigned to one target nucleic acid.
  • the composition for detecting a first target nucleic acid when n is 2, provides a change in signal at the first detection temperature in the presence of the first target nucleic acid and detects another detection temperature, that is, the second detection temperature. Temperature provides a constant signal;
  • the composition for detecting a second target nucleic acid provides a change in signal at the second detection temperature in the presence of the second target nucleic acid, and provides a constant signal at another detection temperature, that is, the first detection temperature.
  • the composition for detecting the first target nucleic acid when n is 3, provides a change in signal at the first detection temperature in the presence of the first target nucleic acid, and at another detection temperature, that is, at the second detection temperature. temperature and a third detection temperature, providing a constant signal;
  • the composition for detecting a second target nucleic acid provides a change in signal at the second detection temperature in the presence of the second target nucleic acid, and provides a constant signal at other detection temperatures, that is, the first detection temperature and the third detection temperature;
  • the composition for detecting a third target nucleic acid provides a change in signal at the third detection temperature in the presence of the third target nucleic acid, and provides a constant signal at other detection temperatures, that is, the first detection temperature and the second detection temperature.
  • the i -th detection temperature is selected within the signal-change temperature range of the composition for detecting the i-th target nucleic acid, and the i -th detection temperature is selected within the signal-change temperature range of the composition for detecting another target nucleic acid. not included.
  • the signal-change temperature range of any one of the compositions for detecting a target nucleic acid may overlap with the signal-change temperature range of a composition for detecting a target nucleic acid having an adjacent detection temperature, but not adjacent to the composition.
  • the signal-change temperature range of the composition for detecting a target nucleic acid having a detection temperature does not overlap with each other.
  • the detection temperature of the composition for detecting a target nucleic acid having a signal-change temperature range that overlaps the signal-change temperature range of the composition for detecting other target nucleic acids is the signal-change temperature of the composition for detecting other target nucleic acids among the signal-change temperature ranges. It is selected from a temperature range that does not overlap with the temperature range.
  • the signal-change temperature range of any one of the compositions for detecting a target nucleic acid may overlap with the signal-change temperature range of a composition for detecting a target nucleic acid having an adjacent detection temperature, but there are two One of the signal-change temperature ranges is not completely encompassed by the other signal-change temperature range.
  • adjacent detection temperature is used to refer to consecutive detection temperatures among n detection temperatures, for example, the adjacent detection temperature of the i th detection temperature is the i -1 th detection temperature or the i +1 th detection temperature.
  • the signal-change temperature range of the composition for detecting the i- th target nucleic acid may partially overlap with the signal-change temperature range of the composition for detecting the target nucleic acid having an adjacent detection temperature, but the non-adjacent detection temperature It does not overlap with the signal-change temperature range of the composition for detecting target nucleic acids.
  • the composition for detecting the i- th target nucleic acid includes a label that provides a signal depending on the presence of the i -th target nucleic acid.
  • the label may be linked to an oligonucleotide or may exist in free form. Alternatively, it may be incorporated into an oligonucleotide during the incubation (e.g., nucleic acid amplification reaction). That is, the composition for detecting a target nucleic acid may contain an oligonucleotide to which a label is linked from the beginning, or the label may be inserted into a newly generated oligonucleotide (e.g., an extended strand) during an incubation reaction to provide an oligonucleotide to which a label is linked. there is.
  • the incubation e.g., nucleic acid amplification reaction
  • the composition for detecting the ith target nucleic acid includes an incorporating label that is incorporated into the oligonucleotide during incubation and provides a signal depending on the presence of the ith target nucleic acid.
  • the composition for detecting the i-th target nucleic acid provides a label-linked oligonucleotide that serves to provide a signal depending on the presence of the i-th target nucleic acid.
  • the composition for detecting the i- th target nucleic acid initially contains an oligonucleotide linked to a label, which serves to provide a signal depending on the presence of the i-th target nucleic acid.
  • the first probe and the second probe having different Tm values correspond to an example of a label-linked oligonucleotide herein.
  • the composition for detecting the ith target nucleic acid includes a label and an oligonucleotide that provide a signal dependent on the presence of the target nucleic acid, and the label is inserted into the oligonucleotide during an incubation reaction (e.g., nucleic acid amplification reaction).
  • an incubation reaction e.g., nucleic acid amplification reaction.
  • a label-linked oligonucleotide that serves to provide a signal dependent on the presence of a target nucleic acid can be provided.
  • label-linked oligonucleotide refers to an oligonucleotide involved in the generation of a signal to be detected.
  • the oligonucleotide linked to the label may include an oligonucleotide (eg, probe or primer) that specifically hybridizes to the target nucleic acid;
  • the oligonucleotide to which the label is linked may include a capture oligonucleotide that specifically hybridizes to the fragment;
  • the oligonucleotide to which the label is linked is an oligonucleotide that specifically hybridizes to the extended strand, and an oligonucleotide produced by inserting a label while the fragment is extended. It may include nucleotides, oligonucleotides that specifically hybridize to the capture oligonucleotide, and combinations thereof.
  • the oligonucleotide linked to the label includes an oligonucleotide involved in actual signal generation. For example, hybridization or non-hybridization of a label-linked oligonucleotide with another oligonucleotide (e.g., a label-linked oligonucleotide or an oligonucleotide comprising a nucleotide sequence complementary to the target nucleic acid) determines signal generation.
  • another oligonucleotide e.g., a label-linked oligonucleotide or an oligonucleotide comprising a nucleotide sequence complementary to the target nucleic acid
  • the oligonucleotide linked to the label may be a 'probe' known in the art.
  • the 3'-end of the probe is “blocked” to prevent its extension. Blocking can be achieved according to conventional methods. For example, blocking involves adding a chemical moiety such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane-diol moiety to the 3'-hydroxyl group of the last nucleotide. It can be implemented. Alternatively, blocking can be performed by removing the 3'-hydroxyl group of the last nucleotide or using a nucleotide without a 3'-hydroxyl group, such as dideoxynucleotide.
  • a chemical moiety such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothi
  • the oligonucleotide linked to the label may be composed of at least one oligonucleotide.
  • the oligonucleotide to which the label is linked when the oligonucleotide to which the label is linked is composed of a plurality of oligonucleotides, the oligonucleotide to which the label is linked may have the label in various ways. For example, all or some of the plurality of oligonucleotides may have at least one label.
  • the label may be a single label or an interactive label comprising a reporter molecule and a quencher molecule.
  • the single label includes a fluorescent label, a luminescent label, a chemiluminescent label, an electrochemical label, and a metal label.
  • the single label provides different signals (e.g., different signal intensities) depending on whether it is present on a double strand or a single strand.
  • the single label is a fluorescent label. Preferred types and binding sites of single fluorescent labels for use in the present disclosure are disclosed in U.S. Pat. Nos. 7,537,886 and 7,348,141, the teachings of which are incorporated herein by reference in their entirety.
  • the single fluorescent labels include JOE, FAM, TAMRA, ROX and fluorescein-based labels.
  • the single label can be linked to the oligonucleotide by a variety of methods.
  • the label is linked to the probe through a spacer containing a carbon atom (e.g., a 3-carbon spacer, a 6-carbon spacer, or a 12-carbon spacer).
  • the interactive label may be an interactive label comprising at least one reporter molecule and at least one quencher molecule.
  • the interactive label may be an interactive dual label comprising one reporter molecule and one quencher molecule.
  • the interactive label may be an interactive label comprising one reporter molecule and two quencher molecules.
  • the label when the label is a single label, the single label may be linked to one oligonucleotide.
  • the interaction label when the label is an interaction label, the interaction label may be an interaction label comprising at least one reporter molecule and at least one quencher molecule, and the interaction label may be one oligonucleotide They may all be linked to each other, or they may each be linked to a plurality of oligonucleotides.
  • an insertion label may be used in the process of generating a signal by inserting a label during primer extension (e.g., Plexor method, Sherrill CB, et al., Journal of the American Chemical Society , 126:4550-45569 (2004 )). Additionally, the insertion label can also be used in signal generation by a dimer formed in a manner dependent on cleavage of an intermediate oligonucleotide hybridized to a target nucleic acid sequence.
  • primer extension e.g., Plexor method, Sherrill CB, et al., Journal of the American Chemical Society , 126:4550-45569 (2004 )
  • the insertion label can also be used in signal generation by a dimer formed in a manner dependent on cleavage of an intermediate oligonucleotide hybridized to a target nucleic acid sequence.
  • the insertion label may be generally linked to a nucleotide. Additionally, nucleotides with non-natural bases may be used.
  • non-natural base refers to derivatives of natural bases such as adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). This means that they can form hydrogen-bonded base pairs.
  • non-natural base includes bases that have a different base pairing pattern than the natural base as the mother compound, such as U.S. Pat. Nos. 5,432,272, 5,965,364, 6,001,983, and It is described in No. 6,037,120. Base pairing between non-natural bases involves two or three hydrogen bonds like natural bases. Additionally, base pairs between non-natural bases are also formed in specific ways.
  • non-natural bases include the following bases in base pair combinations: iso-C/iso-G, iso-dC/iso-dG, Z/P, V/J, K/X, H/ J, Pa/Ds, Pa/Q, Pn/Ds, Pn/Dss, Px/Ds, NaM/5SICS, 5FM/5SICS, and M/N (see US Pat. Nos. 5,432,272; 5,965,364; 6,001,983; 6,037,120; 6,140,496 6,627,456; 7,422,850; and Filip Wojciechowski et al . , 2011, 40, 5669-5679.
  • the method according to the present disclosure uses a composition for detecting a target nucleic acid that provides a dimer, thereby using a single type of label (e.g., one fluorescent label) and multiple target nucleic acids without additional analysis such as melting analysis. can be detected in real time.
  • each of the n compositions for detecting target nucleic acids provides one or more dimers.
  • the term “duplex” refers to a double-stranded nucleic acid molecule formed by hybridizing two single-stranded nucleic acid molecules containing partially or fully complementary sequences to each other under hybridization conditions.
  • the two single-strands forming the dimer may exist in a bound form (i.e., a double-stranded form) or a dissociated form (i.e., two single-stranded forms) depending on the temperature (in particular, the detection temperature).
  • the term “dimer” refers to a duplex in associated form and a duplex in dissociated form. It can be used in an inclusive sense.
  • the dimer may be referred to as a “hybrid.”
  • association or dissociation has the same meaning as the term “hybridization or denaturation.”
  • a composition for detecting a target nucleic acid provides a dimer as used herein may mean providing a dimer in a bound form and/or a dimer in a dissociated form.
  • the expression “the composition for detecting a target nucleic acid produces a dimer during incubation” as used herein may mean producing a dimer in a bound form and/or a dimer in a dissociated form during the incubation reaction.
  • At least one of the dimers provided by the composition for detecting a target nucleic acid is a dimer that provides a signal.
  • the dimer is a dimer that provides a signal change. That is, the composition for detecting the i target nucleic acid provides a dimer that provides a signal. Specifically, the composition for detecting the i target nucleic acid provides a dimer that provides a signal change depending on the presence of the i target nucleic acid.
  • the term “dimer providing a signal” refers to a dimer that can provide a signal that can be distinguished depending on whether the dimer is in a bound or dissociated state. For example, this means that the bound form of the dimer generates (or quenches) a signal, and the dissociated form of the dimer quenches (or generates) a signal.
  • the dimer providing the signal may include at least one label.
  • the term “dimer providing a signal change” refers to a dimer whose content changes depending on the presence of the target nucleic acid, thereby providing a signal change indicating the presence of the target nucleic acid.
  • a hybrid between the first probe and/or the second probe and the target nucleic acid provides a change in the signal described herein. This corresponds to an example of a dimer.
  • the dimer that provides the signal change comprises a label.
  • at least one label is linked to at least one of the two single strands constituting the dimer.
  • the dimer that provides the signal change includes a single label, in which case the single label is linked to either one of the two single strands that make up the dimer.
  • the dimer providing the signal change includes an interaction label, in which case the interaction label is linked to either one of the two strands constituting the dimer providing the signal change, or Alternatively, one of the interaction labels is linked to one of the two single strands and the other of the interaction labels is linked to the other of the two single strands.
  • the composition for detecting the ith target nucleic acid provides a dimer that provides a signal change.
  • the composition for detecting the ith target nucleic acid provides a signal from the label when the dimer that provides the signal change exists in a bound form. That is, the composition for detecting the ith target nucleic acid provides a signal depending on the binding of two single-stranded nucleic acid molecules constituting the dimer.
  • the composition for detecting the ith target nucleic acid provides a signal from the label when the dimer providing the signal change exists in a dissociated form. That is, the composition for detecting the i- th target nucleic acid provides a signal depending on the dissociation of the two single-stranded nucleic acid molecules constituting the dimer.
  • association and dissociation of the dimer may occur by temperature.
  • the dimer that provides the signal change may be a dimer included in the composition for detecting target nucleic acid from the beginning.
  • the dimer that provides the signal change when included in a composition for detecting a target nucleic acid, the dimer is involved in hybridization between an oligonucleotide to which a label is linked and an oligonucleotide capable of hybridizing with the oligonucleotide to which the label is linked.
  • an oligonucleotide to which a label is linked can be created by A double-stranded nucleic acid hybridization probe (US Patent No. 7,799,522) known in the art as a Yin-Yang probe detects signal changes contained in a composition for detecting a target nucleic acid from the beginning. This corresponds to an example of the provided dimer.
  • the dimer that provides the signal change when the dimer that provides the signal change is initially included in the composition for detecting the target nucleic acid, the content of the dimer that provides the signal change changes depending on the presence of the target nucleic acid, and specifically, the content decreases, providing signal change.
  • a double-stranded nucleic acid hybridization probe i.e., a dimer that provides a signal change
  • a double-stranded nucleic acid hybridization probe included in a composition for detecting a target nucleic acid from the beginning may amplify one of the two single strands constituting the salvage probe as the target nucleic acid is amplified. It pairs with the target nucleic acid to create a new dimer, and the content of the double-stranded nucleic acid hybridization probe is reduced, thereby providing a signal change depending on the presence of the target nucleic acid.
  • the dimer that provides the change in the signal may be a dimer newly provided during the incubation reaction by the composition for detecting the target nucleic acid.
  • the dimer that provides the signal change generated during the incubation reaction may be provided by hybridization between a label-linked oligonucleotide and the target nucleic acid.
  • the dimer that provides the signal change generated during the incubation reaction may be a dimer formed by a cleavage reaction dependent on the presence of a target nucleic acid.
  • an extended duplex containing a label generated dependently on the presence of a target nucleic acid corresponds to an example of a dimer formed by a cleavage reaction dependent on the presence of the target nucleic acid ( Figure 6(a) (see (ii)).
  • 5'-nuclease and 3'-nuclease especially nucleic acid polymerase with 5'-nuclease activity, nucleic acid polymerase with 3'-nuclease activity or FEN nuclease are used.
  • nucleic acid polymerase with 5'-nuclease activity nucleic acid polymerase with 3'-nuclease activity or FEN nuclease
  • the signal change is caused by a dimer formed in a cleavage-dependent manner of an intermediate oligonucleotide that specifically hybridizes to the target nucleic acid.
  • the term “mediation oligonucleotide” refers to an oligonucleotide that mediates the creation of a dimer that does not contain a target nucleic acid.
  • the cleavage of the mediator oligonucleotide itself does not generate a signal
  • the fragment (cleavage product) formed by the cleavage after hybridization and cleavage of the mediator oligonucleotide participates in a continuous reaction for signal generation.
  • hybridization or cleavage of the intermediate oligonucleotide itself does not generate a signal.
  • the mediating oligonucleotide comprises an oligonucleotide that mediates the production of a dimer by hybridizing to a target nucleic acid sequence and chopping to release a fragment.
  • the fragment mediates the creation of a dimer by extension of the fragment on a capture oligonucleotide.
  • the intermediate oligonucleotide comprises (i) a targeting site comprising a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a tagging site comprising a nucleotide sequence non-complementary to the target nucleic acid sequence.
  • the composition for detecting the target nucleic acid includes a tagging oligonucleotide that hybridizes to the target nucleic acid, and a cleavage reaction dependent on the presence of the target nucleic acid may include cleavage of the tagging oligonucleotide.
  • the tagging oligonucleotide corresponds to an example of the above-described intermediate oligonucleotide.
  • cleavage of the intermediate oligonucleotide releases a fragment, which specifically hybridizes to and extends on the capture oligonucleotide.
  • the capture oligonucleotide includes a label
  • the capture oligonucleotide corresponds to an example of an oligonucleotide to which a label is linked herein.
  • the mediating oligonucleotide hybridized to the target nucleic acid sequence is cleaved to release a fragment, the fragment specifically hybridizes to the capture oligonucleotide, and the fragment is extended to form an extension strand, which is It causes the formation of an extended duplex between the strand and the capture oligonucleotide, providing a signal indicating the presence of the target nucleic acid.
  • a third oligonucleotide comprising a hybridized nucleotide sequence complementary to the extended strand may be additionally used.
  • hybridization of the third oligonucleotide and the extended strand forms a different type of dimer, which provides a signal indicating the presence of the target nucleic acid (e.g., PCE-SH).
  • the other types of dimers are the dimers that provide signal changes.
  • the signal from the dimer formed in a manner dependent on cleavage of the mediating oligonucleotide can be generated using the PTOCE (PTO cleavage and extension) method (WO 2012/096523), PCE-SH (PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization) method (WO 2013) /115442) and PCE-NH (PTO Cleavage and Extension-Dependent Non-Hybridization) method (WO 2014/104818).
  • PTOCE PTO cleavage and extension
  • PCE-SH PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization
  • PCE-NH PTO Cleavage and Extension-Dependent Non-Hybridization
  • oligonucleotides are as follows: mediating oligonucleotide corresponds to Probing and Tagging Oligonucleotide (PTO), and capture oligonucleotide corresponds to Capturing and Tagging Oligonucleotide (PTO). It corresponds to a templating oligonucleotide (Capturing and Templating Oligonucleotide (CTO)), and the third oligonucleotide corresponds to a Signaling Oligonucleotide (SO) or Hybridization Oligonucleotide (HO). SO, HO, CTO, extension strands, or combinations thereof can serve as label-linked oligonucleotides.
  • PTO Probing and Tagging Oligonucleotide
  • capture oligonucleotide corresponds to Capturing and Tagging Oligonucleotide (PTO). It corresponds to a templating oligonucleotide (Capturing and
  • the dimer that provides the signal change may be a single-type dimer or a multi-type dimer. Specifically, if the dimer providing the signal change is a single-type dimer, the number of dimers may be 1, and if the dimer providing the signal change is a multi-type dimer, the number of dimers may be 2. , 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20, and more specifically, 2, 3, or 4, or more. Specifically, there may be two or three.
  • either the single-type dimer or the multi-type dimer comprises a label.
  • the dimer that provides the signal change is a single-type dimer
  • the content of the single-type dimer changes depending on the presence of the target nucleic acid, thereby changing the signal.
  • the dimer when the dimer is a multi-type dimer, the content ratio between the plural-type dimers changes depending on the presence of the target nucleic acid, thereby changing the signal.
  • the hybrid between the first probe and the target nucleic acid and the hybrid between the second probe and the target nucleic acid are examples of multi-type dimers. It applies.
  • the Tm values of the multi-type dimers are different from each other.
  • the Tm values between the dimers are at least 2°C, 3°C, 4°C, 5°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, or 20°C different.
  • the content of the dimer is determined by the amount of the dimer when the two nucleic acid strands constituting the dimer are dissociated (i.e., a dissociated form of the dimer) and the amount of the dimer when the two nucleic acid strands are hybridized (i.e., bound). It means the sum of the amount of dimers (dimers in the same form).
  • At least two of the multi-type dimers comprise the same single-strand.
  • the same single-strand is contained in the first dimer initially included in the composition for detecting target nucleic acid, and a new second dimer containing the same single-strand is generated during the incubation reaction.
  • the same single-strand contained in the first dimer can be considered to be consumed during the incubation reaction to generate the second dimer, thereby reducing the content of the first dimer containing the same single-strand.
  • the content of the second dimer containing the same single-strand can be considered to have increased.
  • the signal-change temperature range of the composition for detecting the ith target nucleic acid may be determined depending on the length and/or sequence of the dimer that provides the signal change.
  • the composition for detecting the target nucleic acid when the composition for detecting the ith target nucleic acid provides a single-type dimer, the composition for detecting the target nucleic acid may have one signal-change temperature range and one signal-constant temperature range. .
  • the signal-change range and signal-constant temperature range can be determined depending on the length and/or sequence of the single-type dimer.
  • the composition for detecting the ith target nucleic acid when the composition for detecting the ith target nucleic acid provides multiple-type dimers, specifically, two types of dimers, the composition for detecting the target nucleic acid has one signal-change temperature range and two types of dimers.
  • Signal - can have a certain temperature range.
  • the signal-change range and signal-constant temperature range can be determined depending on the length and/or sequence of the two types of dimers.
  • any one of the n compositions for detecting target nucleic acids may include an amplification oligonucleotide that serves to amplify the corresponding target nucleic acid.
  • the amplified oligonucleotide may be identical to the oligonucleotide to which the label is linked.
  • amplification oligonucleotide refers collectively to oligonucleotides that serve to amplify target nucleic acids.
  • the amplification oligonucleotide may be a 'primer' known in the art.
  • the term 'primer' refers to conditions that induce the synthesis of a primer extension product complementary to the target nucleic acid strand (template), i.e., in the presence of nucleotides and a polymerizing agent such as DNA polymerase, and at a suitable temperature and pH. refers to an oligonucleotide that can serve as a starting point for synthesis.
  • Primers should be sufficiently long to prime the synthesis of the extension product in the presence of a polymerizing agent. The appropriate length of the primer depends on a number of factors, such as temperature, application, and source of the primer.
  • the primer may include a forward primer (also referred to as an upstream primer or upstream oligonucleotide), a reverse primer (also referred to as a downstream primer or downstream oligonucleotide), or both.
  • the amplified oligonucleotide may be an oligonucleotide with a structure known in the art, or may be synthesized in a manner known in the art.
  • amplification oligonucleotide and the label-linked oligonucleotide are the same means that one oligonucleotide not only acts as an amplification oligonucleotide that amplifies the target nucleic acid, but also serves as a label-linked oligonucleotide that generates a signal in the presence of the target nucleic acid. it means.
  • an oligonucleotide linked to a label may hybridize with a target nucleic acid to extend and generate a signal.
  • composition for detecting a target nucleic acid used in the present disclosure does not provide a signal at all temperatures in the presence of the target nucleic acid.
  • compositions for detecting target nucleic acids containing oligonucleotides of different sequences may be considered different from each other.
  • the compositions for detecting different target nucleic acids have different detection temperatures.
  • the detection temperature according to the present disclosure may be determined in advance by considering the signal-change temperature ranges of each of the compositions for detecting n target nucleic acids.
  • the signal-change temperature range of any one of the n compositions for detecting target nucleic acids may be determined depending on the length and/or sequence of the dimer. That is, by controlling the Tm value of the dimer, the signal-change temperature range can be determined in advance.
  • the signal change is caused by a label-linked oligonucleotide (e.g., a molecular beacon) that specifically hybridizes to the target nucleic acid
  • detection of the signal is determined by measuring the Tm value of the label-linked oligonucleotide. By adjusting , it can be successfully achieved at a predetermined detection temperature.
  • a Scorpion primer when used as the oligonucleotide linked to the label, detection of the signal is successfully achieved at a predetermined temperature by adjusting the Tm value of the site hybridizing to the extended strand.
  • the signal when the signal is generated by a dimer formed in the presence of the target nucleic acid sequence, detection of the signal is successfully achieved at a predetermined temperature by adjusting the Tm value of the dimer. For example, when the signal is generated by a PTOCE-based method, detection of the signal is successfully achieved at a predetermined temperature by controlling the Tm value of the extended duplex formed by extension of the PTO fragment on the CTO.
  • the PTOCE-based method has the advantage of being able to easily control the Tm value of the dimer or a third hybridization whose hybridization is affected by the dimer.
  • the detection temperature is determined in consideration of the signal-change temperature range depending on the dimer provided by the composition for detecting target nucleic acid.
  • the detection temperature of any one of the n compositions for detecting n target nucleic acids may be predetermined within a signal-change temperature range that does not overlap with the signal-change temperature range of the other compositions (see Figure 8).
  • the detection temperatures assigned to the composition for detecting target nucleic acids are at least 2°C, 3°C, 4°C, 5°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C. , differ by more than 15°C or 20°C.
  • the n detection temperatures are 45°C to 97°C, 45°C to 96°C, 45°C to 95°C, 45°C to 94°C, 45°C to 93°C, 45°C to 92°C, 45°C.
  • the highest detection temperature (i.e., the nth detection temperature) among the detection temperatures is 70°C to 97°C, 70°C to 95°C, 70°C to 93°C, 70°C to 90°C, 73°C to 97°C, 73°C to 95°C, 73°C to 93°C, 73°C to 90°C, 75°C to 97°C, 75°C to 95°C, 75°C to 93°C, 75°C to 90°C, 78°C to 97°C, 78°C to 95°C, 78°C to 93°C, 78°C to 90°C, 80°C to 97°C, 80°C to 95°C, 80°C to 93°C, 80°C to 90°C, 83°C to 97°C, 83°C to 95°C °C, 83°C to 93°C, 83°C to 90°C, 85°C to 97°C, 85°C to
  • the lowest detection temperature (i.e., first detection temperature) among the n detection temperatures is 45°C to 70°C, 45°C to 68°C, 45°C to 65°C, 45°C to 63°C, and 45°C to 60°C.
  • the middle detection temperature (e.g., the second detection temperature to the n -1th detection temperature) among the n detection temperatures is 55°C to 85°C, 55°C to 83°C, 55°C to 80°C, and 55°C to 78°C, 55°C to 7.5°C, 55°C to 73°C, 55°C to 70°C, 55°C to 68°C, 55°C to 65°C, 55°C to 63°C, 55°C to 60°C, 58°C to 85°C , 5.8°C to 83°C, 58°C to 80°C, 58°C to 78°C, 58°C to 75°C, 58°C to 73°C, 58°C to 70°C, 58°C to 68°C, 58°C to 65°C, 58 °C to 63°C, 58°C to 60°C, 60°C to 85°C, 60°C to 83°C, 60°C to 85
  • n target nucleic acids are each assigned to n detection temperatures, then n compositions for detecting n target nucleic acids suitable for the detection temperatures are prepared, and then step (a) is performed. You can.
  • the first detection temperature is selected from the temperature range of 50°C to 60°C
  • the second detection temperature is selected from the temperature range of 65°C to 75°C
  • the first detection temperature is selected from the temperature range of 65°C to 75°C.
  • the detection temperature can be selected in the temperature range of 80°C to 95°C.
  • step (a) the signal is detected at n detection temperatures during incubation.
  • detection of the signal can be performed at each cycle, selected cycles, or at the end-point of reaction.
  • detection of the signal can be performed in at least one cycle.
  • the signal may be detected at n detection temperatures in one selected cycle, or at n detection temperatures each in two selected cycles.
  • the signals i.e., the first signal, the second signal, and the third signal
  • the signals have the first detection temperature, the second detection temperature, and is detected at a third detection temperature
  • the signal is detected at the first detection temperature, the second detection temperature, and the third detection temperature in 30 cycles.
  • detection of the signal can be performed in at least two cycles.
  • the signal change can be measured using signals detected in the at least two cycles.
  • nucleic acid amplification can be performed for 30, 40, 45, or 50 cycles of PCR, and signals can be measured at n detection temperatures for each cycle. That is, signal values detected at each detection temperature in a plurality of cycles can be shown as an amplification curve (a set of data points composed of RFU and cycles) at each detection temperature.
  • an amplification curve at a first detection temperature, an amplification curve at a second detection temperature, and an amplification curve at a third detection temperature can be obtained, The change in signal can be confirmed from the amplification curve.
  • the term “amplification curve” refers to a signal-generating reaction of a target analyte (specifically, a target nucleic acid), particularly a curve obtained through an amplification reaction.
  • the amplification curve includes a curve obtained when the target nucleic acid is present in the sample during the amplification reaction and a curve or line obtained when the target nucleic acid is not present in the sample during the amplification reaction.
  • a signal change or constant signal can be measured from an indicator indicating amplification of a target nucleic acid.
  • the term “amplification indicator” refers to an indicator that is closely related to the occurrence of amplification of the target nucleic acid, which can be obtained from the signal provided in step (a).
  • the indicator may refer to a value generated depending on target nucleic acid amplification.
  • the indicator may be an indicator that provides a larger value as the amplification of the target nucleic acid increases (i.e., the amount of the target nucleic acid increases), or it may be an index that provides a smaller value as the amplification increases.
  • the indicator may be any indicator as long as it indicates amplification.
  • the indicator may include one obtained from an amplification curve.
  • the indicator refers to the value of the signal in a specific cycle (e.g., RFU) in the amplification curve, the value of the signal in each cycle, the difference in signal value between specific cycles, or the difference in signal value between a reference signal value and a specific cycle. It can be included.
  • the indicator is a cycle threshold (Ct) value, ⁇ RFU (e.g., RFU difference between two cycles or RFU difference between a reference RFU and RFU in a specific cycle, etc.), or RFU ratio (e.g., It may be the RFU ratio of the cycle or the RFU ratio between the reference RFU and the RFU in a specific cycle, etc.), but is not limited thereto.
  • Ct cycle threshold
  • RFU ratio e.g., It may be the RFU ratio of the cycle or the RFU ratio between the reference RFU and the RFU in a specific cycle, etc.
  • the indicator of amplification is the Ct value or the Cq value.
  • the concepts of Ct values and Cq values are well known in the art.
  • an indicator indicating amplification is ⁇ RFU or RFU ratio of RFU values obtained in the amplification reaction.
  • the indicator is the difference (subtraction) or ratio between the RFU of two cycles, or the difference (subtraction) or ratio between a reference RFU and the RFU of a specific cycle.
  • the method according to the present disclosure utilizes the fact that the composition for detecting a target nucleic acid provides a signal change dependent on the presence of the target nucleic acid only at the corresponding detection temperature.
  • the method according to the present disclosure can measure signal changes by checking signal values detected at the detection temperature in at least two cycles.
  • the method according to the present disclosure can measure the signal change using the signal value at the detection temperature detected in one cycle (i.e., the signal value detected in step (a)) and the reference signal value. there is.
  • the first and last cycles for detecting the signal may be selected to be separated from each other by at least 1 to 20 cycles.
  • the first and last cycles for detecting the signal are 1 cycle, 2 cycles, 3 cycles, 4 cycles, 5 cycles, 6 cycles, 7 cycles, 8 cycles, 9 cycles, 10 cycles, 11 cycles, and 12 cycles.
  • Cycles, 13 cycles, 14 cycles, 15 cycles, 16 cycles, 17 cycles, 18 cycles, 19 cycles or 20 cycles may be selected to be separated, more specifically 5 cycles, 10 cycles, 15 cycles, 20 cycles or 30 cycles. More may be chosen to be separated.
  • detection of the signal is performed in at least one cycle: an intermediate cycle including an exponential phase region, or a late cycle including a plateau region.
  • an intermediate cycle including an exponential phase region or a late cycle including a plateau region.
  • the initial cycle includes cycles up to the end cycle divided by 3 and the adjacent cycle. For example, if the final cycle is 45, 45 divided by 3 is 15, so the initial cycle may be determined as 1 to 20 cycles, 1 to 15 cycles, 1 to 10 cycles, or 1 to 5 cycles.
  • the intermediate cycle can be determined by dividing the end cycle by 2 and the adjacent cycle. For example, if the final cycle is 45 cycles, 45 divided by 2 is 22.5, so the intermediate cycle is 16 to 30 cycles. It can be determined as 18 to 30 cycles, 20 to 30 cycles, 16 to 27 cycles, 18 to 27 cycles, 20 to 27 cycles, 16 to 25 cycles, 18 to 25 cycles or 20 to 25 cycles.
  • the end cycle can be determined as the end cycle of the amplification reaction or as a cycle adjacent to the end cycle.
  • the terminal cycle may be 31 to 45 cycles, 35 to 45 cycles, 38 to 45 cycles, 40 to 45 cycles, or 43 to 45 cycles.
  • the initial cycle, intermediate cycle, and late cycle may be changed depending on the final cycle number of the amplification reaction.
  • the signal change can be measured using the signal detected in the at least one cycle and a “reference signal value.”
  • the reference signal value may refer to a value that can confirm a signal change dependent on the presence of the target nucleic acid through a separate reaction.
  • the reference signal value can be obtained from a reaction in the absence of the corresponding target nucleic acid at the corresponding detection temperature.
  • the reference signal value may be the “signal value at the detection temperature” when the target nucleic acid is absent.
  • n reference signal values for n detection temperatures there are n reference signal values for n detection temperatures.
  • the “signal value at the detection temperature (e.g., i - th detection temperature)” detected when the target nucleic acid (e.g., i -th target nucleic acid) is not present is obtained through a separate negative control reaction. You can.
  • the reference signal value can be obtained by performing a negative control reaction simultaneously or separately from the method according to the present disclosure.
  • the reference signal value can be obtained through a negative control reaction.
  • the reference signal value at the i-th detection temperature is obtained by mixing a sample (e.g., distilled water) not containing the i- th target nucleic acid with a composition for detecting n target nucleic acids to amplify the nucleic acid at the i-th detection temperature. It can be obtained by detecting the signal.
  • signal detection can be performed in any cycle.
  • the signal value detected in any one of the initial cycles of the negative control reaction can be used as the reference signal value, or the signal value detected in any one of the late cycles of the negative control reaction can be used as the reference signal value. More specifically, the signal value detected in the same cycle as the cycle in which the signal is detected in step (a) can be used as the reference signal value.
  • the reference signal value can be obtained through a positive control reaction.
  • a sample containing the i- th target nucleic acid is mixed with a composition for detecting the i- th target nucleic acid, amplifying the nucleic acid, and detecting a signal at the i -th detection temperature.
  • the cycle in which the signal value is detected may be a cycle of the baseline region of the positive control reaction.
  • the baseline region refers to a region in which a signal (eg, a fluorescence signal) remains substantially constant during the initial cycle of an amplification reaction (eg, PCR). Because the level of amplification product in this region is not sufficient to be detectable, most of the fluorescence signal in this region is due to background signal, which includes the fluorescence signal of the reaction sample itself and the fluorescence signal of the measurement system itself. That is, the signal value detected in the cycle of the baseline region of the positive control reaction will be substantially the same as the reference signal value obtained from a reaction in which the target nucleic acid is absent (eg, a negative control reaction).
  • the signal change can be measured through the difference between the reference signal value and the signal value detected in step (a).
  • the reference signal value may be a threshold value predetermined from a negative control reaction in consideration of the background signal and sensitivity of the detector or the characteristics of the label used.
  • the significance of the signal change can be determined using the threshold value.
  • the threshold value can be determined by a known threshold value setting method. For example, the threshold value can be determined by considering background signal, sensitivity, label characteristics, signal deviation or error range of the detector, etc.
  • a threshold value used as the reference signal value, if the signal value detected in step (a) is equal to or greater than the threshold value, it may be determined that the signal has changed.
  • signal detection at each of the n detection temperatures may be performed using a single type of detector.
  • the single type of detector is one detector.
  • signals generated from the labels of oligonucleotides linked to each label included in the composition for detecting n target nucleic acids are not distinguished from each other for each target nucleic acid by a single type of detector.
  • a single or one type of fluorescent label refers to a fluorescent label having identical or substantially identical signal properties (eg, optical properties, emission wavelength, and electrical signal).
  • FAM and CAL Fluor 610 provide different types of signals.
  • single or one type of fluorescent label means that the signals from the fluorescent label are indistinguishable from each other using the detection channel.
  • This single or type of fluorescent label does not depend on the chemical structure of the fluorescent label, so even if two fluorescent labels have different chemical structures, they are considered one type if they cannot be distinguished using the detection channel. .
  • signals generated from n compositions for detecting target nucleic acids that commonly contain one type of fluorescent label are not distinguished by one detection channel.
  • the term “detection channel” refers to a means for detecting signals from a single type of fluorescent label.
  • Thermocyclers available in the art such as ABI 7500 (Applied Biosystems), QuantStudio (Applied Biosystems), CFX96 (Bio-Rad Laboratories), Cobas z 480 (Roche), LightCycler (Roche), etc., provide several different types of fluorescence. It contains several channels (e.g., photodiodes) for detecting signals from the label, and these channels correspond to the detection channels herein.
  • the detection channel used in this disclosure includes means capable of detecting a signal.
  • the detection channel may be a photodiode capable of detecting a fluorescence signal of a specific wavelength.
  • signals detected at each of the n detection temperatures are indistinguishable from each other by the single type of detector.
  • step (a) After detection of the signal, the presence of n target nucleic acids is determined from the signal detected in step (a).
  • the presence of the i-th target nucleic acid is determined by a change in the signal detected at the i -th detection temperature.
  • the presence of the i - th target nucleic acid is determined by measuring a change in the signal from the signal detected at the i -th detection temperature.
  • the signal is constant at the i-th detection temperature, it can be determined that the i-th target nucleic acid is absent.
  • the signal change can be measured using a signal detected in at least two cycles, or using a signal detected in at least one cycle and a “reference signal value.”
  • Determining the presence of the target nucleic acid from the signal detected at each detection temperature can be accomplished by measuring the signal change described above in step (a), such as using an indicator indicative of amplification and various methods known in the art. It can be done.
  • n is 3, and when detecting signals at 10 cycles, 20 cycles, and 30 cycles, the signals detected at the first detection temperature (the first signal at cycle 10, the first signal at cycle 20) Determining the presence of the first target nucleic acid from the first signal and the first signal at 30 cycles), and the signals detected at the second detection temperature (the second signal at 10 cycles, the second signal at 20 cycles and Determine the presence of the second target nucleic acid from the signals detected at a third detection temperature (the second signal at cycle 10, the third signal at cycle 20 and the third signal at cycle 30). The presence of the third target nucleic acid can be determined from the third signal).
  • n 4, and when detecting a signal at 30 cycles, the first target is selected from the signal detected at the first detection temperature (i.e., the first signal at 30 cycles) and the reference signal value. Determining the presence of a nucleic acid, determining the presence of the second target nucleic acid from a signal detected at a second detection temperature (i.e., the second signal at cycle 30) and a reference signal value, and determining the presence of the second target nucleic acid and the signal detected at a third detection temperature. (i.e., the third signal at cycle 30) and the reference signal value to determine the presence of the third target nucleic acid.
  • the reference signal value can be obtained through a separate negative control reaction or positive control reaction.
  • the method according to the present disclosure can be performed with a negative control reaction.
  • the signal value detected in the negative control reaction can be used as a reference signal value.
  • the signal detected in one cycle (e.g., the last cycle) at the i -th detection temperature is the same detection temperature (i.e., the i -th detection temperature) in the negative control reaction. It is possible to determine whether the signal has changed by comparing it with the signal detected in the same cycle (eg, the last cycle).
  • n 3 and when detection of a signal at 30 cycles is performed, the detected signal at the first detection temperature (i.e., the first signal at 30 cycles) and the first reference signal value (e.g., negative).
  • the presence of the first target nucleic acid is determined from the signal detected at the second detection temperature (i.e., the signal at the first detection temperature detected at 30 cycles of the control reaction) and the second Determine the presence of the second target nucleic acid from a reference signal value (e.g., the signal at a second detection temperature detected at 30 cycles of a negative control reaction), and the signal detected at a third detection temperature (e.g., the signal at 30 cycles).
  • the presence of the third target nucleic acid can be determined from the third signal) and the third reference signal value (e.g., the signal at the third detection temperature detected in 30 cycles of the negative control reaction).
  • the method according to the present disclosure can be performed with a positive control reaction.
  • the signal value detected in the positive control reaction can be used as a reference signal value.
  • the first signal detected at cycle 30, which is a signal detected at 1 cycle, e.g., cycle 30, at the i detection temperature is detected in a cycle prior to 30 cycles, e.g., 1 cycle, at the i detection temperature of the positive control reaction. By comparing it to one signal, you can determine whether the signal has changed.
  • positive Signal detection in the control reaction may be performed at least 30 cycles prior, 20 cycles prior, 10 cycles prior, or 5 cycles prior to the cycle detecting the signal in step (a).
  • n 3
  • a signal detected at a first detection temperature i.e., the first signal at 30 cycles
  • a first reference signal value e.g., the 1 Determine the presence of the first target nucleic acid from the signal at the first detection temperature detected in 1 cycle of the target nucleic acid positive control reaction
  • the signal detected at the second detection temperature i.e., the second signal at 30 cycles
  • a second reference signal value e.g., a signal at a second detection temperature detected in one cycle of a second target nucleic acid positive control reaction
  • the presence of the third target nucleic acid from a signal i.e., the third signal at 30 cycles
  • a third reference signal value e.g., the signal at the third detection temperature detected in one cycle of the third target nucleic acid positive control reaction.
  • the present disclosure provides a method for detecting a target nucleic acid in a sample comprising the following steps:
  • the first probe comprises a hybridizing nucleotide sequence to a first region of the target nucleic acid
  • the first probe has a reporter molecule and a first quencher molecule
  • the reporter molecule and the first quencher molecule are (i) before the first probe hybridizes to the target nucleic acid, the reporter molecule and the first quencher molecule are close to each other, whereby the first quencher molecule is the reporter molecule quenching the signal from, and (ii) upon hybridization of the first probe and the target nucleic acid, the reporter molecule and the first quencher molecule are separated, thereby causing the first quencher molecule to separate from the reporter molecule. It exists in a position where the signal can be unquenched,
  • the second probe comprises a hybridizing nucleotide sequence to a second region of the target nucleic acid
  • the second probe has a second quencher molecule
  • the Tm value of the first probe is higher than the Tm value of the second probe
  • the reporter molecule of the first probe is quenched by the second quencher molecule of the second probe
  • step (c) determining the presence of the target nucleic acid from the signal detected in step (b).
  • the second aspect of the present disclosure uses a composition for detecting a target nucleic acid comprising two probes having different Tm values described above in the first aspect of the present disclosure, the common content between them causes complexity of the present specification. Omitted to avoid excessive duplication.
  • a sample suspected of containing a target nucleic acid is mixed and incubated with a composition for detecting a target nucleic acid including a first probe and a second probe having different Tm values according to the present disclosure.
  • the incubation reaction is a reaction in which the target nucleic acid reacts with the composition for detecting the target nucleic acid to provide a signal depending on the presence of the target nucleic acid at any temperature selected within the signal-change temperature range of the composition for detecting the target nucleic acid. means.
  • step (a) incubation includes an amplification reaction, specifically, an amplification reaction of a target nucleic acid.
  • the amplification reaction includes multiple cycles.
  • the first probe includes a hybridizing nucleotide sequence to a first region of the target nucleic acid. That is, the first probe can hybridize to the first region of the target nucleic acid.
  • the first probe has a reporter molecule and a first quencher molecule.
  • a reporter molecule linked to the first probe and a first quencher molecule are located close to each other. Because of this, the first quencher molecule linked to the first probe quenches the signal from the reporter molecule linked to the first probe.
  • a random coil or hairpin structure is formed so that the first quencher molecule linked to the first probe is connected to the first probe.
  • the signal from the linked reporter molecule is quenched intramolecularly.
  • the reporter molecule of the first probe and the first quencher molecule are spaced apart from each other. Specifically, the first probe hybridizes to the target nucleic acid, so that the first quencher molecule of the first probe is separated from the reporter molecule of the first probe, thereby causing the first quencher molecule to transmit the signal from the reporter molecule. Unquench.
  • the reporter molecule and the first quencher molecule are (i) before the first probe hybridizes to the target nucleic acid, the reporter molecule and the first quencher molecule are close to each other, whereby the first quencher molecule A quencher molecule quenches the signal from the reporter molecule, and (ii) when the first probe and the target nucleic acid hybridize, the reporter molecule and the first quencher molecule are separated, thereby causing the first quencher molecule is present in a position that can unquench the signal from the reporter molecule.
  • the reporter molecule is linked to the 3'-terminal region or the 5'-terminal region of the first probe.
  • the second probe comprises a hybridizing nucleotide sequence to a second region of the target nucleic acid. That is, the second probe can hybridize to the second region of the target nucleic acid.
  • the second probe has a second quencher molecule.
  • the first region and the second region of the target nucleic acid are adjacent to each other.
  • the reporter molecule of the first probe is quenched by the second quencher molecule of the second probe.
  • the second probe hybridizes to the second region of the target nucleic acid so that the second quencher molecule of the second probe is hybridized to the second region of the target nucleic acid. adjacent to the reporter molecule of the first probe hybridized to the first region, thereby causing the second quencher molecule to intermolecularly quench the signal from the reporter molecule.
  • the second quencher molecule of the second probe when the first probe and the second probe hybridize to the target nucleic acid, the second quencher molecule of the second probe is adjacent to the reporter molecule of the first probe, thereby causing the second The reporter molecule and the second quencher molecule are present at a position where the quencher molecule can quench the signal from the reporter molecule.
  • the second quencher molecule is linked to the 3'-terminal region or 5'-terminal region of the second probe.
  • the reporter molecule when the second probe is hybridized to the target nucleic acid downstream in the 3' direction of the first probe, the reporter molecule is located at the 3'-terminal region of the first probe, The second quencher molecule is located at the 5'-terminal region of the second probe.
  • the reporter molecule when the second probe is hybridized to the target nucleic acid upstream in the 5' direction of the first probe, the reporter molecule is located at the 5'-terminal region of the first probe, and 2 The quencher molecule is located at the 3'-end region of the second probe.
  • the first probe and/or the second probe is “blocked” at its 3′-end to prevent extension.
  • the reporter molecules and quencher molecules used in the present disclosure are interactive labels.
  • the second quencher molecule linked to the second probe is the same type of quencher molecule as the first quencher molecule linked to the first probe.
  • the composition for detecting target nucleic acid according to the present disclosure including the first probe and the second probe reacts with the target nucleic acid to provide a signal dependent on the presence of the target nucleic acid.
  • the composition for detecting a target nucleic acid comprising a first probe and a second probe according to the present disclosure provides a change in signal as the target nucleic acid is amplified.
  • the first probe and the second probe according to the present disclosure are characterized in that they have different Tm values.
  • the composition for detecting a target nucleic acid according to the present disclosure is a temperature range in which the signal changes depending on the presence of the target nucleic acid in a reaction with the target nucleic acid (e.g., amplification reaction), that is, , a signal-changing temperature range and two temperature ranges in which the signal does not change even in the presence of the target nucleic acid, that is, two signal-constant temperature ranges ( Figure 1 to 3).
  • the signal-change temperature range is higher than the first signal-constant temperature range among the two signal-constant temperature ranges, It is an InterSC composition that has lower characteristics than the second signal-constant temperature range among the two signal-constant temperature ranges.
  • the content of the first probe and the second probe is the concentration contained in the composition for initially detecting the target nucleic acid. is constant.
  • the first probe and the second probe included in the composition for detecting a target nucleic acid may exist in the form of Figures 1 to 3 depending on the presence or absence of the target nucleic acid and/or temperature change, and the target nucleic acid Depending on the degree of reaction (eg, degree of amplification of the target nucleic acid), the content of the first probe and the second probe present in the form of FIGS.
  • the composition for detecting a target nucleic acid can provide a signal dependent on the presence of the target nucleic acid.
  • the two signals constant-temperature In this range, the signal does not change and is constant.
  • both the first probe and the second probe hybridize to the target nucleic acid at a temperature within the first signal-certain temperature range.
  • the first probe hybridizes to the first region of the target nucleic acid, but the second probe does not hybridize to the second region of the target nucleic acid, at a temperature within the signal-change temperature range.
  • neither the first probe nor the second probe hybridizes to the target nucleic acid at a temperature within the second signal-certain temperature range.
  • the signal-change temperature range is determined depending on Tm values of the first probe and the second probe. Accordingly, the signal-varying temperature range and the two signal-constant temperature ranges can be controlled by adjusting the Tm value of the first probe and the Tm value of the second probe.
  • detection of a signal indicating the presence of a target nucleic acid can be achieved by measuring a signal that changes during an incubation reaction, that is, as the target nucleic acid is amplified.
  • the signal detected in step (b) is a signal dependent on the presence of the target nucleic acid.
  • step (b) is performed at a temperature selected within the signal-change temperature range (i.e., detection temperature).
  • detection of the signal in step (b) is performed during and/or after the incubation reaction. Specifically, detection of the signal may be performed at each cycle of an incubation reaction including a plurality of cycles, at selected partial cycles, or at the end-point of reaction.
  • detection of the signal in step (b) is performed in at least one cycle out of a plurality of cycles. For example, during an incubation reaction comprising multiple cycles, it is carried out in at least one cycle, either in the mid cycle or in the late cycle.
  • detection of the signal in step (b) may be performed in one cycle during an incubation reaction comprising multiple cycles. In this case, it is difficult to determine whether the signal changes depending on the target nucleic acid during the incubation reaction using only the signal value detected in one cycle. Therefore, a signal indicating the presence of a target nucleic acid can be confirmed using a separate reference signal value.
  • the reference signal value may refer to a value that can confirm a signal change dependent on the presence of a target nucleic acid through a separate reaction.
  • the reference value can be obtained from a reaction in which the target nucleic acid is absent (eg, a negative control reaction).
  • the reference signal value may be the “signal value at the detection temperature” detected when the target nucleic acid is absent.
  • detection of the signal in step (b) is carried out in at least two cycles. For example, during an incubation reaction comprising multiple cycles, it is carried out in at least two cycles. Changes in the signal can be measured by detecting signal values at the detection temperature detected in the two or more cycles.
  • the presence of the target nucleic acid is determined from the signal detected in step (b).
  • the presence of the target nucleic acid in step (c) is determined by signal change.
  • step (c) measures a change in the signal using signals detected in at least two cycles among the plurality of cycles, and when the signal changes, it is determined that the target nucleic acid is present. decide On the other hand, if the signal is constant, it is determined that the target nucleic acid is absent.
  • the presence of the target nucleic acid in step (c) is determined by measuring the change in the signal using the signal detected in at least one cycle among the plurality of cycles and the above-described reference signal value, and determining the change in the signal. In this case, it is determined that the target nucleic acid is present. On the other hand, if the signal is constant, it is determined that the target nucleic acid is absent.
  • the present disclosure provides a composition for detecting a target nucleic acid in a sample comprising:
  • the first probe has a reporter molecule and a first quencher molecule
  • the reporter molecule and the first quencher molecule are (i) before the first probe hybridizes to the target nucleic acid, the reporter molecule and the first quencher molecule are close to each other, whereby the first quencher molecule is the reporter molecule quenching the signal from, and (ii) upon hybridization of the first probe and the target nucleic acid, the reporter molecule and the first quencher molecule are separated, thereby causing the first quencher molecule to separate from the reporter molecule. is in a position to unquench the signal; and
  • the second probe has a second quencher molecule
  • the Tm value of the first probe is higher than the Tm value of the second probe
  • the reporter molecule of the first probe is quenched by the second quencher molecule of the second probe.
  • the present disclosure provides a kit comprising a composition for detecting n target nucleic acids for detecting n target nucleic acids in a sample:
  • n is an integer of 2 or more
  • Each of the n target nucleic acid detection compositions provides a change in a signal indicating the presence of the corresponding target nucleic acid at a corresponding detection temperature among the n detection temperatures in the presence of the corresponding target nucleic acid,
  • the composition for detecting the i - th target nucleic acid provides a signal change indicating the presence of the i-th target nucleic acid at the i - th detection temperature among the n detection temperatures in the presence of the i - th target nucleic acid, , provides a constant signal at other detection temperatures,
  • the i represents an integer from 1 to n , the i th detection temperature is lower than the i +1 th detection temperature,
  • the composition for detecting the i - th target nucleic acid has a signal-changing temperature range in which the signal changes depending on the presence of the i -th target nucleic acid and the i- th target nucleic acid. Even if the target nucleic acid is present, the signal has one or two signal-constant temperature ranges that are constant,
  • composition for detecting the i target nucleic acid is a composition for detecting the i target nucleic acid
  • InterSC Inter-Signal-Change composition, wherein the signal-change temperature range is higher than one signal-constant temperature range of two signal-constant temperature ranges and is lower than the other signal-constant temperature range.
  • At least one composition among the n compositions for detecting target nucleic acids includes a first probe and a second probe having different Tm values
  • the first probe comprises a hybridizing nucleotide sequence to a first region of the corresponding target nucleic acid
  • the first probe has a reporter molecule and a first quencher molecule
  • the reporter molecule and the first quencher molecule are (i) before the first probe hybridizes to the corresponding target nucleic acid, the reporter molecule and the first quencher molecule are in close proximity to each other, thereby causing the first quencher molecule to quenching the signal from a reporter molecule, and (ii) upon hybridization of the first probe and the corresponding target nucleic acid, the reporter molecule and the first quencher molecule are separated, thereby causing the first quencher molecule to It is present in a position that can unquench the signal from the reporter molecule,
  • the second probe comprises a hybridizing nucleotide sequence to a second region of the corresponding target nucleic acid
  • the second probe has a second quencher molecule
  • the Tm value of the first probe is higher than the Tm value of the second probe
  • the reporter molecule of the first probe is quenched by the second quencher molecule of the second probe.
  • kit of the present disclosure is manufactured to practice the method of the present disclosure, common content among them is omitted to avoid excessive duplication that causes complexity of the present specification.
  • the kit may further include instructions describing the method of the present invention.
  • instructions for describing or practicing the method of the present invention may be recorded on a suitable recording medium.
  • instructions may be printed on substrates such as paper and plastic.
  • the instructions may be presented as an electronically stored data file on a suitable computer-readable recording medium, such as CD-ROMs and diskettes.
  • no actual instructions are included within the kit, but a means to obtain instructions is provided from a remote source, such as via the Internet.
  • a kit that includes a web address where the instructions can be viewed and/or where the instructions can be downloaded.
  • Example 1 Detection of target nucleic acid using two probes with different Tm values
  • Genomic DNA of Ureaplasma Parvum (Accession number: ATCC 27815) was used as a template for the target nucleic acid.
  • the detection temperature of the UP target nucleic acid was set to 68°C, and the first and second regions were selected in the 3′ to 5′ direction on the target nucleic acid template.
  • the sequences and lengths of the first and second probes were designed so that the Tm value of the first probe was 70°C and the Tm value of the second probe was 64°C.
  • the first probe comprises a sequence complementary to the first region of the target nucleic acid and connects a first quencher molecule (AZOQ2) at its 5'-end and a reporter molecule (Cal Fluor Red 610) at its 3'-end. connected.
  • the second probe contains a sequence complementary to the second region, its 5'-end is linked to a second quencher molecule (AZOQ2), and its 3'-end is blocked with Spacer C3 to prevent elongation by DNA polymerase. .
  • Primer pairs for amplifying the region containing the first and second regions of the target nucleic acid were designed as shown in Table 3.
  • Oligonucleotide sequence target nucleic acid order number Raise it type order (5'-3') UP One of target nucleic acid 1st and 2nd regions AGATTTATACGGTATTACAACTGGTGATAGCGTTAGATTAGGAGATACAAATCTTTGAGTTAAAGTTGAAAAAGACTTAACTACTTAT GGTGAAGAATCTGTTTTTGGTGGTGGAAA AAC CCTACGTGAAGGTATGGGAATGAA TTCTACTATGAAGTTAGATGATAAATTAGGTAATGCTGAAGT 2 UP-forward primer AGATTTATACGGTATTACAACTG 3 UP-reverse primer ACTTCAGCATTACCTAATTTATC 4 UP-First Probe [AZOQ2]GGTGAAGAATCTGTTTTTGGTGGTGGAAA[Cal Fluor Red 610] 5 UP-2nd probe [AZOQ2]CCTACGTGAAGGTATGGGGAAT[Spacer C3]
  • UP-forward primer SEQ ID NO: 2
  • UP-reverse primer SEQ ID NO: 2
  • 5 pmoles of UP-first probe SEQ ID NO: 4
  • 5 pmoles of UP-second probe SEQ ID NO: 5
  • DNA polymerase 2U SD Polymerase HotStart (BIORON, Germany)
  • dNTP 1Mm and MgSO 4 100mM were added to prepare a final 20 ⁇ l reaction mixture.
  • the reverse primer concentration was adjusted to be higher than the forward primer concentration so that more of the target nucleic acid strand hybridized by the first and second probes among the double-stranded target nucleic acids could be amplified.
  • the tube containing the reaction mixture was placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 92°C for 2 minutes, followed by 15 seconds at 92°C, 15 seconds at 57°C, and 5 seconds at 68°C.
  • the cycle of 10 seconds at 72°C and 5 seconds at 76°C was repeated 50 times.
  • Detection of the signal is performed at a temperature of 57°C at which both the first probe and the second probe hybridize to the target nucleic acid in each cycle (i.e., the first signal - a temperature within a certain temperature range), the first probe hybridizes to the target nucleic acid, and the second probe hybridizes to the target nucleic acid.
  • the detection temperature at which non-hybridization to the target nucleic acid i.e., a temperature within the signal-change temperature range
  • the temperature at which both the first and second probes non-hybridize to the target nucleic acid i.e., the second signal-constant temperature
  • Temperature within the range was carried out at 76°C, a total of three temperatures.
  • the amplification curves at 57°C, which is a temperature within the first signal-certain temperature range, and 76°C, which is a temperature within the second signal-certain temperature range show that the signal does not change as the target nucleic acid is amplified.
  • the amplification curve at the detection temperature of 68°C showed that the signal changed as the target nucleic acid was amplified.
  • the target nucleic acid detection method can confirm a signal (i.e., a change in signal) indicating the presence of a target nucleic acid using a reference signal value obtained from a negative control reaction.
  • the present inventors set a reference signal value of 300 from the signal value of the negative control reaction (i.e., RFU: 0), and if the signal values at 57°C, 68°C, and 76°C were higher than the reference signal value, it was determined that the signal had changed. did.
  • RFU negative control reaction
  • Tube 1 500 pg of UP genomic DNA
  • Tube 2 negative control
  • a plurality of target nucleic acids can be detected using a single type of label in one reaction vessel.
  • Genomic DNA of Ureaplasma parvum (UP) (accession number: ATCC 27815) and genomic DNA of Chlamydia trachomatis (CT) (accession number: ATCC VR-1500) were used as target nucleic acid templates.
  • the detection temperature of the UP target nucleic acid i.e., the first detection temperature
  • the detection temperature of the CT target nucleic acid i.e., the second detection temperature
  • the first and second areas were selected in the 5′ direction.
  • the sequence and length of the first and second probes for detecting the first target nucleic acid, UP were designed to be 70°C and 64°C, respectively, and the second target nucleic acid, CT
  • the sequence and length of the first and second probes for detecting were designed so that the Tm values were 76.5°C and 71.5°C, respectively.
  • the first and second probes for detecting UP, the first target nucleic acid were used in the same manner as Table 3 in Example 1-1.
  • each first probe for two target nucleic acids comprises a sequence complementary to the first region of the corresponding target nucleic acid and connects at its 5'-end a first quencher molecule (AZOQ2) and at its 3'-end.
  • -A reporter molecule Cal Fluor Red 610 was connected to the end.
  • Each second probe for two target nucleic acids contains a sequence complementary to the second region of the corresponding target nucleic acid, has a second quencher molecule (AZOQ2) attached to its 5'-end and DNA at its 3'-end.
  • blocking was performed with Spacer C3.
  • Primer pairs for amplifying the region containing the first region and the second region of the first target nucleic acid and primer pairs for amplifying the region including the first region and the second region of the second target nucleic acid are shown in Table 5. Designed.
  • Oligonucleotide sequence target nucleic acid order number Raise it type Sequence (5'-3') UP One of target nucleic acid 1st and 2nd regions AGATTTATACGGTATTACAACTGGTGATAGCGTTAGATTAGGAGATACAAATCTTTGAGTTAAAGTTGAAAAAGACTTAACTACTTAT GGTGAAGAATCTGTTTTTGGTGGTGGAAA AAC CCTACGTGAAGGTATGGGAATGAA TTCTACTATGAAGTTAGATGATAAATTAGGTAATGCTGAAGT 2 UP-forward primer AGATTTATACGGTATTACAACTG 3 UP-reverse primer ACTTCAGCATTACCTAATTTATC 4 UP-First Probe [AZOQ2]GGTGAAGAATCTGTTTTTGGTGGTGGAAA[Cal Fluor Red 610] 5 UP-2nd probe [AZOQ2]CCTACGTGAAGGTATGGGGAAT[Spacer C3] CT 6 of target nucleic acid 1st and 2nd regions CTTTATTAGGAG
  • Target nucleic acid (tube 1: 500 pg of UP genomic DNA; tube 2: 500 pg of CT genomic DNA; tube 3: mixture of 500 pg of UP genomic DNA and 500 pg of CT genomic DNA and tube 4: distilled water (negative control))
  • UP-forward primer 5 pmole (SEQ ID NO: 2)
  • UP-reverse primer 20 pmole (SEQ ID NO: 3)
  • UP-first probe 5 pmole SEQ ID NO: 4
  • UP-second for UP nucleic acid amplification (tube 1: 500 pg of UP genomic DNA
  • tube 2 500 pg of CT genomic DNA
  • tube 3 mixture of 500 pg of UP genomic DNA and 500 pg of CT genomic DNA
  • tube 4 distilled water (negative control)
  • UP-forward primer 5 pmole SEQ ID NO: 2
  • UP-reverse primer 20 pmole SEQ ID NO: 3
  • UP-first probe 5 pmole (SEQ ID NO: 4)
  • Probe 5 pmole (SEQ ID NO: 5), CT-forward primer for CT nucleic acid amplification 5 pmole (SEQ ID NO: 7), CT-reverse primer 20 pmole (SEQ ID NO: 8), CT-first probe 5 pmole (SEQ ID NO: Number: 9) and CT-second probe 5 pmole (SEQ ID NO: 10) were mixed, then DNA polymerase (2U SD Polymerase HotStart (BIORON, Germany)), dNTP 1Mm, MgSO 4 100mM were added to make a final volume of 20 ⁇ l.
  • a reaction mixture was prepared.
  • the reverse primer concentration was adjusted to be higher than the forward primer concentration so that more of the target nucleic acid strand hybridized by the first and second probes among the double-stranded target nucleic acids could be amplified.
  • the tube containing the reaction mixture was placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 92°C for 2 minutes, followed by 15 seconds at 92°C, 15 seconds at 57°C, and 5 seconds at 68°C. , cycles of 10 seconds at 72°C, 5 seconds at 76°C, and 5 seconds at 85°C were repeated 50 times. Detection of the signal was performed at 57°C, 68°C (first detection temperature), 76°C (second detection temperature), and 85°C for each cycle.
  • CFX96 Real-time Cycler Bio-Rad
  • 57°C is the temperature within the first signal-certain temperature range of the composition for detecting UP target nucleic acid and the temperature within the first signal-certain temperature range of the composition for detecting CT target nucleic acid.
  • First signal - At 57°C which is within a certain temperature range, when the target nucleic acid is absent, the first probe and the second probe are present in the form of (i) in FIG. 1, and the reporter molecule is quenched by the first quencher molecule. In the case where the target nucleic acid is present, the first probe and the second probe are present in the form (i) of FIG. 2, and the reporter molecule is quenched by the second quencher molecule. That is, at the corresponding temperature, both the composition for detecting UP target nucleic acid and the composition for detecting CT target nucleic acid provide a constant signal regardless of the presence of the corresponding target nucleic acid.
  • 85°C is a temperature within a certain temperature range of the second signal of the composition for detecting UP target nucleic acid and is a temperature within a certain temperature range of the second signal of the composition for detecting CT target nucleic acid.
  • Second signal - At 85°C which is within a certain temperature range, when the target nucleic acid is absent, the first probe and the second probe are present in the form (iii) of FIG. 1, and the reporter molecule is quenched by the first quencher molecule.
  • the first probe and the second probe are present in the form (iii) of FIG. 2, and the reporter molecule is quenched by the first quencher molecule. That is, at the corresponding temperature, both the composition for detecting UP target nucleic acid and the composition for detecting CT target nucleic acid provide a constant signal regardless of the presence of the corresponding target nucleic acid.
  • the first detection temperature of 68°C is a temperature within the signal-change temperature range of the composition for detecting UP target nucleic acid and is a temperature within the first signal-constant temperature range of the composition for detecting CT target nucleic acid.
  • the composition for detecting a CT target nucleic acid provides a constant signal regardless of the presence of the CT target nucleic acid at 68°C, which is a temperature within the first signal-constant temperature range.
  • the first probe and the second probe for the UP target nucleic acid are present in the form of (ii) in Figure 1 when the UP target nucleic acid is absent, so that the reporter molecule is quenched by the first quencher molecule and the UP target nucleic acid is present.
  • the reporter molecule is separated from the first quencher molecule and the second quencher molecule and is unquenched. Due to this, the composition for detecting UP target nucleic acid at the corresponding temperature provides a signal change depending on the presence of the target nucleic acid.
  • the second detection temperature, 76°C is a temperature within the second signal-constant temperature range of the composition for detecting the target nucleic acid and is within the signal-change temperature range of the composition for detecting the CT target nucleic acid.
  • the composition for detecting UP target nucleic acid provides a constant signal at 76°C, which is a temperature within the second signal-constant temperature range, regardless of the presence of UP target nucleic acid.
  • the first probe and the second probe for the CT target nucleic acid are present in the form (ii) of Figure 1 when the CT target nucleic acid is absent, so that the reporter molecule of the first probe is quenched by the first quencher molecule, and the CT
  • the reporter molecule of the first probe is unquenched by the first quencher molecule and the second quencher molecule. Due to this, the composition for detecting CT target nucleic acid at the corresponding temperature provides a signal change depending on the presence of the target nucleic acid.
  • Figure 10 shows the multiplex PCR results and amplification curves for each temperature. As shown in Figure 10, the amplification curves at 57°C and 85°C were constant with no signal change in tubes 1 to 4, regardless of the presence of UP target nucleic acid and/or CT target nucleic acid.
  • the amplification curve at 68°C which is the first detection temperature, confirmed that the signal changed as the UP target nucleic acid was amplified in tubes 1 and 3 containing the UP target nucleic acid.
  • the amplification curve at 76°C which is the second detection temperature, confirmed that the signal changed as the CT target nucleic acid was amplified in tubes 2 and 3 containing the CT target nucleic acid.
  • a signal indicating the presence of the target nucleic acid i.e., change in signal
  • the present inventors set a reference signal value of 300 from the signal value of the negative control reaction (i.e., RFU: 0), and if the signal values at 57°C, 68°C, 76°C, and 85°C are higher than the reference signal value, the signal changes. It was judged that it was done.
  • Tube 1 500 pg of UP genomic DNA
  • Tube 2 500 pg of CT genomic DNA
  • Tube 3 500 pg UP genomic DNA and 500 pg CT genomic DNA;
  • Tube 4 negative control
  • the composition for detecting a target nucleic acid can provide a signal dependent on the target nucleic acid only at a specified detection temperature by adjusting the Tm values of the first probe and the second probe.
  • Example 2 using this principle, it was confirmed that multiple target nucleic acids can be detected in real time with a single detector using the same type of label in one reaction vessel.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 타겟 핵산 상에 인접하게 혼성화 할 수 있는 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물 및 상기 타겟 핵산 검출용 조성물을 이용하여 샘플 내 n개의 타겟 핵산을 검출하는 방법에 관한 것으로, 단일 유형의 표지를 이용하여 복수의 타겟 핵산을 실시간으로 검출할 수 있으며 개선된 편의성 및 높은 비용 효과와 효율성을 가진다.

Description

상이한 TM 값을 가지는 2개의 프로브를 이용하여 샘플 내 타겟 핵산을 검출하는 방법
본 개시는 상이한 Tm 값을 가지는 2개의 프로브를 이용하여 샘플 내 타겟 핵산을 검출하는 방법에 관한 것이다.
타겟 핵산의 검출을 위해, 실시간 방식으로 타겟 증폭을 모니터링하면서 타겟 핵산을 검출할 수 있는 실시간 검출 방법이 널리 이용되고 있다. 실시간 검출 방법은 일반적으로 타겟 핵산과 특이적으로 혼성화되는 표지된 프로브 또는 프라이머를 이용한다.
표지된 프로브 및 타겟 핵산 간의 혼성화를 이용하는 방법의 예는 헤어핀 구조를 갖는 이중-표지된 프로브를 이용하는 분자 비콘(Molecular beacon) 방법(Tyagi 등, Nature Biotechnology v.14 MARCH 1996), HyBeacon 방법(French DJ 등, Mol. Cell Probes, 15(6):363-374(2001)), 공여체(donor) 및 수용체(acceptor)로 각각 표지된 2개의 프로브를 이용한 혼성화 프로브 방법(Bernad 등, 147-148 Clin Chem 2000; 46) 및 단일-표지된 올리고뉴클레오타이드를 이용한 럭스(Lux) 방법(미국 특허 제7,537,886호)을 포함한다. 이중-표지된 프로브와 DNA 중합효소의 5’-뉴클레아제 활성에 의한 상기 프로브의 절단을 이용한 TaqMan 방법(미국 특허 제5,210,015호 및 제5,538,848호)이 본 기술분야에서 널리 이용되고 있다.
표지된 프라이머를 이용하는 방법의 예는 선라이즈(Sunrise) 프라이머 방법(Nazarenko 등, 2516-2521 Nucleic Acids Research, 1997, v.25 no.12, 및 미국 특허 제6,117,635호) 및 스콜피온(Scorpion) 프라이머 방법(Whitcombe 등, 804-807, Nature Biotechnology v.17 AUGUST 1999 및 미국 특허 제6,326,145호) 및 TSG 프라이머 방법(WO 2011-078441)을 포함한다.
상기 기술된 종래 실시간 검출 기술들은 하나의 표지를 사용하여 하나의 타겟 핵산만을 검출할 수 있으므로, 하나의 반응에서 동시에 검출될 수 있는 타겟 핵산의 수가 이용가능한 표지의 수(예컨대, 5개 이하)에 의해 제한된다.
따라서, 단일 타겟 핵산의 실시간 검출뿐만 아니라, 단일 유형의 표지를 이용하여 복수의 타겟 핵산을 실시간으로 검출할 수 있는 신규한 방법 또는 접근법의 개발이 요구된다.
본 명세서 전체에 걸쳐 다수의 인용문헌 및 특허 문헌이 참조되고 그 인용이 표시되어 있다. 인용된 문헌 및 특허의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 개선된 편의성 및 높은 비용-효과 및 효율성을 가지면서, 실시간으로 타겟 핵산을 검출하기 위한 신규한 방법을 개발하고자 예의 연구 노력하였다. 특히, 단일 유형의 표지를 이용하여 복수의 타겟 핵산 서열을 검출할 수 있는 방법을 개발하고자 노력하였다. 그 결과, 타겟 핵산 상에 인접하게 혼성화할 수 있는 상이한 Tm 값을 가지는 2개의 프로브를 이용하는 경우, 타겟 핵산을 검출할 수 있는 것을 확인하였으며, 나아가 단일 유형의 표지를 이용하여 복수의 타겟 핵산을 실시간으로 검출할 수 있는 것을 확인하였다.
따라서, 본 개시의 목적은 샘플 내 n개의 타겟 핵산을 검출하는 방법을 제공하는데 있다.
본 개시의 다른 목적은 샘플 내 타겟 핵산의 검출 방법을 제공하는데 있다.
본 개시의 또 다른 목적은 샘플 내 타겟 핵산 검출용 조성물을 제공하는데 있다.
본 개시의 다른 목적 및 이점은 첨부한 청구범위와 함께 하기의 상세한 설명에 의해 보다 명확해질 것이다.
본 개시의 일 양태에 따르면, 다음의 단계를 포함하는 샘플 내 n개의 타겟 핵산을 검출하는 방법을 제공한다:
(a) 하나의 반응 용기에서 상기 n개의 타겟 핵산 중 하나 이상의 타겟 핵산을 함유할 것으로 의심되는 샘플을 n개의 타겟 핵산 검출용 조성물과 인큐베이션하면서, n개의 검출 온도에서 시그널을 검출하는 단계;
상기 n은 2 이상의 정수이고,
상기 인큐베이션은 복수의 사이클을 포함하고, 상기 시그널의 검출은 상기 복수의 사이클 중 최소 1개의 사이클에서 실시하며,
상기 n개의 타겟 핵산 검출용 조성물의 각각은 대응하는 타겟 핵산의 존재하에 상기 n개의 검출 온도 중 대응하는 검출 온도에서 대응하는 타겟 핵산의 존재를 나타내는 시그널의 변화를 제공하며,
상기 n개의 타겟 핵산 검출용 조성물 중 제i 타겟 핵산 검출용 조성물은 상기 제i 타겟 핵산의 존재하에 상기 n개의 검출 온도 중 제i 검출 온도에서 상기 제i 타겟 핵산의 존재를 나타내는 시그널 변화를 제공하고, 그 외의 검출 온도에서는 일정한 시그널을 제공하며,
상기 i는 1부터 n까지의 정수를 나타내고, 상기 제i 검출 온도는 제i+1 검출 온도보다 낮고,
상기 n개의 검출 온도를 모두 포함하는 온도 범위 내에서, 상기 제i 타겟 핵산 검출용 조성물은 제i 타겟 핵산 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위(signal-changing temperature range) 및 제i 타겟 핵산이 존재하여도 시그널이 일정한 하나 또는 두 개의 시그널-일정 온도 범위(signal-constant temperature range)를 가지며,
상기 제i 타겟 핵산 검출용 조성물은,
(i) 상기 시그널-변화 온도 범위가 상기 시그널-일정 온도 범위보다 낮은 특징을 갖는 UnderSC(Under-Signal-Change) 조성물,
(ii) 상기 시그널-변화 온도 범위가 2개의 시그널-일정 온도 범위 중 하나의 시그널-일정 온도 범위보다 높고, 다른 하나의 시그널-일정 온도 범위보다는 낮은 특징을 갖는 InterSC(Inter-Signal-Change) 조성물, 및
(iii) 상기 시그널-변화 온도 범위가 상기 시그널-일정 온도 범위보다 높은 특징을 갖는 OverSC(Over-Signal-Change) 조성물 중 어느 하나의 조성물이며,
상기 n개의 타겟 핵산 검출용 조성물 중 최소 하나의 조성물은 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하고,
상기 제1 프로브는 대응하는 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가지며,
상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 대응하는 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 대응하는 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재하고,
상기 제2 프로브는 상기 대응하는 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
상기 제2 프로브는 제2 퀀처 분자를 가지며,
상기 제1 프로브의 Tm 값은 제2 프로브의 Tm 값 보다 높고, 및
상기 제1 프로브 및 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭되며; 및
(b) 상기 단계 (a)에서 검출된 시그널로부터 n개의 타겟 핵산의 존재를 결정하는 단계로서, 상기 제i 검출 온도에서 검출된 시그널 변화에 의해 상기 제i 타겟 핵산의 존재를 결정하는 단계.
본 개시의 일 구현예에 따르면, 상기 제1 퀀처 분자는 상기 리포터 분자로부터 12 내지 60 뉴클레오타이드 이격되어 있다.
본 개시의 일 구현예에 따르면, 상기 리포터 분자는 제1 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결되어 있다.
본 개시의 일 구현예에 따르면, 상기 제1 프로브 및 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화하면, 상기 제2 프로브의 제2 퀀처 분자는 상기 제1 프로브의 리포터 분자와 인접하고, 이로 인해, 상기 제2 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시킬 수 있는 위치에 상기 리포터 분자 및 제2 퀀처 분자가 존재한다.
본 개시의 일 구현예에 따르면, 제1 프로브 및 제2 프로브가 대응하는 타겟 핵산에 혼성화되는 경우, 상기 제2 퀀처 분자는 상기 리포터 분자로부터 바로 인접하게 위치하거나 또는 1 내지 4 뉴클레오타이드 이격되어 있다.
본 개시의 일 구현예에 따르면, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결되어 있다.
본 개시의 일 구현예에 따르면, 상기 제1 프로브의 3' 방향으로 다운스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 3'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 5'-말단 부위에 위치한다.
본 개시의 일 구현예에 따르면, 상기 제1 프로브의 5' 방향으로 업스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 5'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위에 위치한다.
본 개시의 일 구현예에 따르면, 제1 프로브의 제1 퀀처 분자 및 제2 프로브의 제2 퀀처 분자는 동일한 유형의 퀀처 분자이다.
본 개시의 일 구현예에 따르면, 상기 제1 프로브 및/또는 제2 프로브는 그의 3'-말단이 블록킹되어 연장이 방지된다.
본 개시의 일 구현예에 따르면, 상기 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 조성물은 상기 시그널-변화 온도 범위가 2개의 시그널-일정 온도 범위 중 제1 시그널-일정 온도 범위보다 높고, 2개의 시그널-일정 온도 범위 중 제2 시그널-일정 온도 범위보다는 낮은 InterSC 조성물이다.
본 개시의 일 구현예에 따르면, 상기 대응하는 타겟 핵산 존재 하에, 상기 제1 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 대응하는 타겟 핵산에 혼성화되어 있다.
본 개시의 일 구현예에 따르면, 상기 대응하는 타겟 핵산 존재 하에, 상기 제2 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 대응하는 타겟 핵산에 혼성화되어 있지 않다.
본 개시의 일 구현예에 따르면, 상기 대응하는 타겟 핵산 존재 하에, 상기 시그널-변화 온도 범위 내의 온도에서 상기 제1 프로브는 상기 대응하는 타겟 핵산에 혼성화되지만 상기 제2 프로브는 상기 대응하는 타겟 핵산에 혼성화되지 않는다.
본 개시의 일 구현예에 따르면, 상기 시그널-변화 온도 범위는 상기 제1 프로브 및 상기 제2 프로브의 Tm 값들에 의존적이다.
본 개시의 일 구현예에 따르면, 상기 제i 검출 온도는 상기 제i 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위 내에서 선택되고, 상기 제i 검출 온도는 다른 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위에는 포함되지 않는다.
본 개시의 일 구현예에 따르면, 상기 제i 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위는 인접한 검출 온도를 가지는 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위와 부분적으로 중첩될 수 있으나, 인접하지 않은 검출 온도를 가지는 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위와 서로 중첩하지 않는다.
본 개시의 일 구현예에 따르면, 상기 n이 2인 경우, 제1 타겟 핵산 검출용 조성물은 UnderSC 또는 InterSC 조성물이고, 및 제2 타겟 핵산 검출용 조성물은 InterSC 또는 OverSC 조성물이다.
본 개시의 일 구현예에 따르면, 상기 n이 3이상인 경우, 제1 타겟 핵산 검출용 조성물은 UnderSC 또는 InterSC 조성물이고, 제n 타겟 핵산 검출용 조성물은 InterSC 또는 OverSC 조성물이며, 및 상기 제1 타겟 핵산 및 상기 제n 타겟 핵산 이외의 각각의 타겟 핵산 검출용 조성물은 InterSC 조성물이다.
본 개시의 일 구현예에 따르면, 상기 제i 타겟 핵산 검출용 조성물은 제i 타겟 핵산의 존재에 의존적으로 시그널을 제공하는 표지를 포함한다.
본 개시의 일 구현예에 따르면, 상기 표지는 올리고뉴클레오타이드에 연결되어 있거나 또는 상기 인큐베이션 동안 올리고뉴클레오타이드에 삽입된다.
본 개시의 일 구현예에 따르면, 상기 제i 타겟 핵산 검출용 조성물은 시그널 변화를 제공하는 이합체를 제공한다.
본 개시의 일 구현예에 따르면, 상기 시그널 변화를 제공하는 이합체는 상기 제i 타겟 핵산 검출용 조성물에 처음부터 포함되어 있다.
본 개시의 일 구현예에 따르면, 상기 시그널 변화를 제공하는 이합체는 표지가 연결된 올리고뉴클레오타이드 및 상기 표지가 연결된 올리고뉴클레오타이드와 혼성화할 수 있는 올리고뉴클레오타이드 간의 혼성화에 의해 생성된다.
본 개시의 일 구현예에 따르면, 상기 시그널 변화를 제공하는 이합체는 인큐베이션 동안 생성된다.
본 개시의 일 구현예에 따르면, 상기 시그널 변화를 제공하는 이합체는 표지가 연결된 올리고뉴클레오타이드 및 상기 해당하는 타겟 핵산 간의 혼성화에 의해 생성된다.
본 개시의 일 구현예에 따르면, 상기 시그널 변화를 제공하는 이합체는 상기 해당하는 타겟 핵산의 존재에 의존적인 절단 반응에 의해서 생성된다.
본 개시의 일 구현예에 따르면, 상기 시그널 변화를 제공하는 이합체는 표지를 포함하고 있다.
본 개시의 일 구현예에 따르면, 상기 제i 타겟 핵산 검출용 조성물은 시그널 변화를 제공하는 이합체를 제공하고, 상기 제i 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위는 상기 이합체의 길이 및/또는 서열에 의존적으로 변화한다.
본 개시의 일 구현예에 따르면, 상기 시그널의 검출은 상기 복수의 사이클 중 최소 2개의 사이클에서 실시된다.
본 개시의 일 구현예에 따르면, 상기 시그널 변화는 상기 복수의 사이클 중 최소 2개의 사이클에서 검출된 시그널을 이용하여 측정한다.
본 개시의 일 구현예에 따르면, 상기 제i 검출 온도에서의 시그널 변화는 상기 복수의 사이클 중 최소 1개의 사이클에서 검출된 시그널과 기준 시그널 값을 이용하여 측정한다.
본 개시의 일 구현예에 따르면, 상기 기준 시그널 값은 상기 제i 타겟 핵산이 부존재하는 반응으로부터 얻어진다.
본 개시의 일 구현예에 따르면, 상기 n개의 검출 온도 각각에서의 시그널 검출은 단일 유형의 검출기(single type of detector)를 이용하여 수행된다.
본 개시의 일 구현예에 따르면, 상기 n개의 검출 온도에서 검출된 시그널은 상기 단일 유형의 검출기에 의해 서로 구별되지 않는다.
본 개시의 일 구현예에 따르면, 상기 인큐베이션은 핵산 증폭 반응을 포함한다.
본 개시의 다른 양태에 따르면, 다음의 단계를 포함하는 샘플 내 타겟 핵산 검출 방법을 제공한다:
(a) 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 타겟 핵산 검출용 조성물을 샘플과 인큐베이션하는 단계;
상기 제1 프로브는 상기 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가지며,
상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재하고,
상기 제2 프로브는 상기 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
상기 제2 프로브는 제2 퀀처 분자를 가지며,
상기 제1 프로브의 Tm 값은 제2 프로브의 Tm 값 보다 높고, 및
상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭되며; 및
(b) 시그널을 검출하는 단계; 및
(c) 상기 단계 (b)에서 검출된 시그널로부터 상기 타겟 핵산의 존재를 결정하는 단계.
본 개시의 일 구현예에 따르면, 상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화하면, 상기 제2 프로브의 제2 퀀처 분자는 상기 제1 프로브의 리포터 분자와 인접하고, 이로 인해, 상기 제2 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시킬 수 있는 위치에 상기 리포터 분자 및 제2 퀀처 분자가 존재한다.
본 개시의 일 구현예에 따르면, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결되어 있다.
본 개시의 일 구현예에 따르면, 상기 제1 프로브의 3' 방향으로 다운스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 3'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 5'-말단 부위에 위치한다.
본 개시의 일 구현예에 따르면, 상기 제1 프로브의 5' 방향으로 업스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 5'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위에 위치한다.
본 개시의 일 구현예에 따르면, 제1 프로브의 제1 퀀처 분자 및 제2 프로브의 제2 퀀처 분자는 동일한 유형의 퀀처 분자이다.
본 개시의 일 구현예에 따르면, 상기 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 조성물은 상기 타겟 핵산 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위(signal-changing temperature range; SChTR) 및 상기 타겟 핵산이 존재하여도 시그널이 일정한 두 개의 시그널-일정 온도 범위(signal-constant temperature range; SCoTR)를 가진다.
본 개시의 일 구현예에 따르면, 상기 시그널-변화 온도 범위는 2개의 시그널-일정 온도 범위 중 제1 시그널-일정 온도 범위보다 높고, 2개의 시그널-일정 온도 범위 중 제2 시그널-일정 온도 범위보다는 낮다.
본 개시의 일 구현예에 따르면, 상기 타겟 핵산 존재 하에, 상기 제1 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 타겟 핵산에 혼성화되어 있다.
본 개시의 일 구현예에 따르면, 상기 타겟 핵산 존재 하에, 상기 제2 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 타겟 핵산에 혼성화되어 있지 않다.
본 개시의 일 구현예에 따르면, 상기 타겟 핵산 존재 하에, 상기 시그널-변화 온도 범위 내의 온도에서 상기 제1 프로브는 상기 타겟 핵산에 혼성화되지만 상기 제2 프로브는 상기 타겟 핵산에 혼성화되지 않는다.
본 개시의 일 구현예에 따르면, 상기 시그널-변화 온도 범위는 상기 제1 프로브 및 상기 제2 프로브의 Tm 값들에 의존적이다.
본 개시의 일 구현예에 따르면, 상기 단계 (b)에서 검출된 시그널은 상기 타겟 핵산 존재에 의존적인 시그널이다.
본 개시의 일 구현예에 따르면, 상기 단계 (b)는 상기 시그널-변화 온도 범위 내에서 선택된 검출 온도에서 실시된다.
본 개시의 일 구현예에 따르면, 상기 인큐베이션은 핵산 증폭 반응을 포함한다.
본 개시의 일 구현예에 따르면, 상기 단계 (a)의 인큐베이션은 복수의 사이클을 포함하고, 상기 단계 (b)의 시그널의 검출은 상기 복수의 사이클 중 최소 1개의 사이클에서 실시된다.
본 개시의 일 구현예에 따르면, 상기 단계 (c)의 타겟 핵산의 존재는 시그널 변화에 의해 결정되고, 상기 시그널 변화는 상기 복수의 사이클 중 최소 1개의 사이클에서 검출된 시그널과 기준 시그널 값을 이용하여 측정된다.
본 개시의 일 구현예에 따르면, 상기 기준 시그널 값은 상기 타겟 핵산이 부존재하는 반응으로부터 얻어진다.
본 개시의 일 구현예에 따르면, 상기 단계 (a)의 인큐베이션은 복수의 사이클을 포함하고, 상기 단계 (b)의 시그널의 검출은 상기 복수의 사이클 중 최소 2개의 사이클에서 실시된다.
본 개시의 일 구현예에 따르면, 상기 단계 (c)의 타겟 핵산의 존재는 시그널 변화에 의해 결정되고, 상기 시그널 변화는 상기 복수의 사이클 중 최소 2개의 사이클에서 검출된 시그널들을 이용하여 측정된다.
본 개시의 또 다른 양태에 따르면, 다음을 포함하는 샘플 내 타겟 핵산 검출용 조성물을 제공한다:
(a) 상기 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하는 제1 프로브;
상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가지며,
상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재하고; 및
(b) 상기 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하는 제2 프로브;
상기 제2 프로브는 제2 퀀처 분자를 가지며,
상기 제1 프로브의 Tm 값은 제2 프로브의 Tm 값 보다 높고, 및
상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭된다.
본 개시의 일 구현예에 따르면, 상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화하면, 상기 제2 프로브의 제2 퀀처 분자는 상기 제1 프로브의 리포터 분자와 인접하고, 이로 인해, 상기 제2 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시킬 수 있는 위치에 상기 리포터 분자 및 제2 퀀처 분자가 존재한다.
본 개시의 일 구현예에 따르면, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결되어 있다.
본 개시의 일 구현예에 따르면, 상기 제1 프로브의 3' 방향으로 다운스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 3'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 5'-말단 부위에 위치한다.
본 개시의 일 구현예에 따르면, 상기 제1 프로브의 5' 방향으로 업스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 5'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위에 위치한다.
본 개시의 일 구현예에 따르면, 제1 프로브의 제1 퀀처 분자 및 제2 프로브의 제2 퀀처 분자는 동일한 유형의 퀀처 분자이다.
본 개시의 일 구현예에 따르면, 상기 조성물은 상기 타겟 핵산 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위(signal-changing temperature range; SChTR) 및 상기 타겟 핵산이 존재하여도 시그널이 일정한 두 개의 시그널-일정 온도 범위(signal-constant temperature range; SCoTR)를 가진다.
본 개시의 일 구현예에 따르면, 상기 시그널-변화 온도 범위는 2개의 시그널-일정 온도 범위 중 제1 시그널-일정 온도 범위보다 높고, 2개의 시그널-일정 온도 범위 중 제2 시그널-일정 온도 범위보다 낮다.
본 개시의 일 구현예에 따르면, 상기 타겟 핵산 존재 하에, 상기 제1 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 타겟 핵산에 혼성화되어 있다.
본 개시의 일 구현예에 따르면, 상기 타겟 핵산 존재 하에, 상기 제2 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 타겟 핵산에 혼성화되어 있지 않다.
본 개시의 일 구현예에 따르면, 상기 타겟 핵산 존재 하에, 상기 시그널-변화 온도 범위 내의 온도에서 상기 제1 프로브는 상기 타겟 핵산에 혼성화되지만 상기 제2 프로브는 상기 타겟 핵산에 혼성화되지 않다.
본 개시의 일 구현예에 따르면, 상기 시그널-변화 온도 범위는 상기 제1 프로브 및 상기 제2 프로브의 Tm 값들에 의존적이다.
본 개시의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 개시는 하나의 반응 용기에서 복수의 검출 온도를 이용하여 단일 유형의 표지만으로도 복수의 타겟 핵산을 검출하는 방법으로, 본 개시에 따른 방법은 복수의 타겟 핵산 각각에 대응하는 검출 온도에서만 대응하는 타겟 핵산 존재에 의존적으로 시그널 변화를 제공하는 것이 특징이다.
특히, 복수의 타겟 핵산 중 최소 하나의 타겟 핵산은 타겟 핵산 상에 서로 인접하게 혼성화할 수 있는 상이한 Tm 값을 가지는 2개의 프로브를 이용하여 검출한다.
(b) 본 개시의 두 번째 특징은 상기 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물이 타겟 핵산과의 반응(예컨대, 증폭 반응)에서 타겟 핵산의 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위 및 타겟 핵산이 존재하여도 시그널이 일정한 2개의 시그널-일정 온도 범위를 가진다는 것이다. 구체적으로, 상기 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물은 상기 시그널-변화 온도 범위가 2개의 시그널-일정 온도 범위 중 제1 시그널-일정 온도 범위보다 높고, 2개의 시그널-일정 온도 범위 중 제2 시그널-일정 온도 범위보다는 낮은 특징을 가지는 InterSC 조성물이다.
(c) 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물은 단일 타겟 핵산의 검출을 가능하게 할 뿐만 아니라, 단일 유형의 표지를 이용하여 복수의 타겟 핵산을 실시간으로 검출할 수 있게 한다. 구체적으로, 복수의 타겟 핵산을 검출하기 위한 복수의 타겟 핵산 검출용 조성물을 이용하는 경우, 상기 복수의 타겟 핵산 검출용 조성물 각각의 시그널-변화 온도 범위를 조절(예컨대, 서로 중첩되지 않도록 조절)하여 단일 유형의 표지를 이용하여 복수의 타겟 핵산을 실시간으로 검출할 수 있다. 특히, 단일 유형의 표지를 이용하여 복수의 타겟 핵산을 검출하기 위해 타겟 증폭 후 멜팅 분석을 필요로 하는 종래 기술 대비 분석 시간이 획기적으로 단축되는 장점이 있다.
도 1은 타겟 핵산이 부존재하거나 또는 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물과 타겟 핵산과의 반응 전, (i) 제1 시그널-일정 온도 범위, (ii) 시그널-변화 온도 범위 및 (iii) 제2 시그널-일정 온도 범위에서 제1 프로브 및 제2 프로브의 형태를 보여준다.
도 2는 제2 프로브가 제1 프로브의 3’ 방향으로 다운스트림에 타겟 핵산에 혼성화되는 구체적인 구현예에 대하여, 타겟 핵산 존재하에 (i) 제1 시그널-일정 온도 범위, (ii) 시그널-변화 온도 범위 및 (iii) 제2 시그널-일정 온도 범위에서의 제1 프로브 및 제2 프로브의 형태를 보여준다.
도 3은 제2 프로브가 제1 프로브의 5’ 방향으로 업스트림에 타겟 핵산에 혼성화되는 구체적인 구현예에 대하여, 타겟 핵산 존재하에 (i) 제1 시그널-일정 온도 범위, (ii) 시그널-변화 온도 범위 및 (iii) 제2 시그널-일정 온도 범위에서의 제1 프로브 및 제2 프로브의 형태를 보여준다.
도 4는 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물을 이용한 타겟 핵산 증폭 반응에 대한 멜트 커브를 나타낸 것이다. 도 4의 (a)는 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물을 이용한 타겟 핵산 증폭에 따른 초기 사이클, 중기 사이클 및 말기 사이클에서의 (i) 타겟 핵산의 반응 전의 제1 프로브 및/또는 제2 프로브의 총 함량비(또는 존재비 %), 및 (ii) 타겟 핵산과 반응한 제1 프로브 및/또는 제2 프로브의 총 함량비(또는 존재비 %)를 나타내며, 하단 그래프는 초기, 중기 및 말기 사이클에서의 멜트 커브(melt curve)를 나타낸 것이다. 구체적으로, (i)행의 숫자는 도 1의 (i) 내지 (iii) 형태로 존재하는 제1 프로브 및 제2 프로브의 총 함량비(또는 존재비 %)를 의미하며, (ii)행의 숫자는 도 2의 (i) 내지 (iii) 또는 도 3의 (i) 내지 (iii) 형태로 존재하는 제1 프로브 및 제2 프로브의 총 함량비(또는 존재비 %)를 의미한다. 도 4의 (b)는 상기 도 4의 (a)의 각 사이클에서의 멜트 커브를 합친 것이다.
도 5는 UnderSC 시그널 발생 방식으로 채택 가능한 분자 비콘 방법을 이용한 타겟 핵산 증폭에 따른 초기/중기/말기 사이클에서의 멜트 커브를 나타낸 것이다. (a)는 타겟 핵산 존재 여부에 따른 분자 비콘의 형태를 나타낸 것으로, (i)는 타겟 핵산이 부존재하거나 또는 타겟 핵산과의 반응 전 분자 비콘의 형태를 나타내고, (ii)는 타겟 핵산과 반응한 후의 분자 비콘의 형태를 나타낸다. (b)는 타겟 핵산 증폭에 따른 초기, 중기 및 말기 사이클에서의 멜트 커브(melt curve)를 나타내며, (c)는 초기/중기/말기 사이클 각각에 대한 (b)의 멜트 커브를 합친 것이다.
도 6은 InterSC 시그널 발생 방식으로 채택 가능한 PTOCE-기반 방법을 이용한 타겟 핵산 증폭에 따른 초기/중기/말기 사이클에서의 멜트 커브를 나타낸 것이다. 도 6의 (a)는 타겟 핵산 존재 여부에 따른 PTOCE-기반 방법의 올리고뉴클레오타이드의 형태를 나타낸 것으로, (i)는 타겟 핵산이 부존재하거나 또는 타겟 핵산과의 반응 전 올리고뉴클레오타이드(PTO 및 CTO)의 형태를 나타내고, (ii)는 타겟 핵산과 반응한 후의 올리고뉴클레오타이드(연장이합체)의 형태를 나타낸다. 도 6의 (b)는 타겟 핵산 증폭에 따른 초기, 중기 및 말기 사이클에서의 멜트 커브(melt curve)를 나타내며, (c)는 초기/중기/말기 사이클 각각에 대한 (b)의 멜트 커브를 합친 것이다.
도 7은 OverSC 시그널 발생 방식으로 채택 가능한 이중 퀀칭 방법을 이용한 타겟 핵산 증폭에 따른 초기/중기/말기 사이클에서의 멜트 커브를 나타낸 것이다. 도 7의 (a)는 타겟 핵산 존재 여부에 따른 이중 퀀칭 방법의 올리고뉴클레오타이드의 형태를 나타낸 것으로, (i)는 타겟 핵산이 부존재하거나 또는 타겟 핵산과의 반응 전 올리고뉴클레오타이드(PTO 및 CQO)의 형태를 나타내고, (ii)는 타겟 핵산과 반응한 후의 올리고뉴클레오타이드(활성화된 태그 이합체 단편)의 형태를 나타낸다. 도 7의 (b)는 타겟 핵산 증폭에 따른 초기, 중기 및 말기 사이클에서의 멜트 커브(melt curve)를 나타내며, 도 7의 (c)는 초기/중기/말기 사이클 각각에 대한 (b)의 멜트 커브를 합친 것이다.
도 8은 SChTR들이 서로 겹치지 않거나 또는 부분적으로 겹치는 경우 검출 온도로 각각 선택 가능한 온도 범위를 보여준다.
도 9는 실시예 1의 실시간 PCR의 온도별 증폭 곡선 결과이다.
도 10은 실시예 2의 멀티플렉스 실시간 PCR의 온도별 증폭 곡선 결과이다.
본 발명자들은 향상된 편의성 및 높은 효율성을 가지면서, 실시간으로 타겟 핵산을 검출하기 위한 신규한 방법을 개발하고자 예의 연구 노력하였다. 특히, 단일 유형의 표지를 이용하여 복수의 타겟 핵산 서열을 검출할 수 있는 방법을 개발하고자 노력하였다. 그 결과, 타겟 핵산 상에 인접하게 혼성화할 수 있는 상이한 Tm 값을 가지는 2개의 프로브를 이용하는 경우, 타겟 핵산을 검출할 수 있는 것을 확인하였으며, 나아가 단일 유형의 표지를 이용하여, 복수의 타겟 핵산을 검출할 수 있는 것을 확인하였다.
I. 샘플 내 n 개의 타겟 핵산 검출 방법
일 양태에서, 본 개시는 다음의 단계를 포함하는, 샘플 내 n개의 타겟 핵산을 검출하는 방법을 제공한다:
(a) 하나의 반응 용기에서 상기 n개의 타겟 핵산 중 하나 이상의 타겟 핵산을 함유할 것으로 의심되는 샘플을 n개의 타겟 핵산 검출용 조성물과 인큐베이션하면서, n개의 검출 온도에서 시그널을 검출하는 단계;
상기 n은 2 이상의 정수이고,
상기 인큐베이션은 복수의 사이클을 포함하고, 상기 시그널의 검출은 상기 복수의 사이클 중 최소 1개의 사이클에서 실시하며,
상기 n개의 타겟 핵산 검출용 조성물의 각각은 대응하는 타겟 핵산의 존재하에 상기 n개의 검출 온도 중 대응하는 검출 온도에서 대응하는 타겟 핵산의 존재를 나타내는 시그널의 변화를 제공하며,
상기 n개의 타겟 핵산 검출용 조성물 중 제i 타겟 핵산 검출용 조성물은 상기 제i 타겟 핵산의 존재하에 상기 n개의 검출 온도 중 제i 검출 온도에서 상기 제i 타겟 핵산의 존재를 나타내는 시그널 변화를 제공하고, 그 외의 검출 온도에서는 일정한 시그널을 제공하며,
상기 i는 1부터 n까지의 정수를 나타내고, 상기 제i 검출 온도는 제i+1 검출 온도보다 낮고,
상기 n개의 검출 온도를 모두 포함하는 온도 범위 내에서, 상기 제i 타겟 핵산 검출용 조성물은 제i 타겟 핵산 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위(signal-changing temperature range) 및 제i 타겟 핵산이 존재하여도 시그널이 일정한 하나 또는 두 개의 시그널-일정 온도 범위(signal-constant temperature range)를 가지며,
상기 제i 타겟 핵산 검출용 조성물은,
(i) 상기 시그널-변화 온도 범위가 상기 시그널-일정 온도 범위보다 낮은 특징을 갖는 UnderSC(Under-Signal-Change) 조성물,
(ii) 상기 시그널-변화 온도 범위가 2개의 시그널-일정 온도 범위 중 하나의 시그널-일정 온도 범위보다 높고, 다른 하나의 시그널-일정 온도 범위보다는 낮은 특징을 갖는 InterSC(Inter-Signal-Change) 조성물, 및
(iii) 상기 시그널-변화 온도 범위가 상기 시그널-일정 온도 범위보다 높은 특징을 갖는 OverSC(Over-Signal-Change) 조성물 중 어느 하나의 조성물이며,
상기 n개의 타겟 핵산 검출용 조성물 중 최소 하나의 조성물은 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하고,
상기 제1 프로브는 대응하는 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가지며,
상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 대응하는 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 대응하는 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재하고,
상기 제2 프로브는 상기 대응하는 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
상기 제2 프로브는 제2 퀀처 분자를 가지며,
상기 제1 프로브의 Tm 값은 제2 프로브의 Tm 값 보다 높고, 및
상기 제1 프로브 및 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭되며; 및
(b) 상기 단계 (a)에서 검출된 시그널로부터 n개의 타겟 핵산의 존재를 결정하는 단계로서, 상기 제i 검출 온도에서 검출된 시그널 변화에 의해 상기 제i 타겟 핵산의 존재를 결정하는 단계.
본 개시의 구성 요소를 설명하는 데 있어서, 제1, 제2, A, B, (a), (b), (i), (ii) 등의 용어를 사용할 수 있다. 이러한 용어는 그 구성 요소를 다른 구성 요소와 구별하기 위한 것일 뿐, 그 용어에 의해 해당 구성 요소의 본질이나 차례 또는 순서 등이 한정되지 않는다.
이하, 본 발명을 상세하게 설명하면 다음과 같다:
단계 (a): 인큐베이션 및 시그널의 검출
먼저, 하나의 반응 용기에서 상기 n개의 타겟 핵산 중 하나 이상의 타겟 핵산을 함유할 것으로 의심되는 샘플을 n개의 타겟 핵산 검출용 조성물과 혼합하여 인큐베이션한다.
본 명세서에서 사용되는 용어 “타겟 핵산”, “타겟 핵산 서열” 또는 “타겟 서열”은 검출 또는 정량하고자 하는 핵산 서열을 의미한다. 상기 타겟 핵산은 이중 가닥뿐만 아니라 단일 가닥을 포함한다. 상기 타겟 핵산은 핵산 샘플 내에 초기에 존재하는 서열뿐만 아니라 반응에서 새롭게 생성된 서열을 포함한다.
상기 타겟 핵산은 모든 DNA(gDNA 및 cDNA), RNA 분자 및 이들의 혼성체(키메라 핵산)를 포함한다. 상기 타겟 핵산은 이중-가닥 또는 단일-가닥 형태일 수 있다.
타겟 핵산은 모든 자연(naturally occurring) 원핵세포 핵산, 진핵세포(예컨대, 원생동물과 기생동물, 균류, 효모, 고등 식물, 하등 동물 및 포유동물과 인간을 포함하는 고등동물) 핵산, 바이러스(예컨대, 헤르페스 바이러스, HIV, 인플루엔자 바이러스, 엡스타인-바 바이러스, 간염 바이러스, 폴리오바이러스 등) 핵산 또는 비로이드 핵산을 포함한다. 또한 상기 핵산 분자는 재조합에 의해 생산된 또는 생산될 수 있는 어떠한 핵산 분자 또는 화학적으로 합성된 또는 합성될 수 있는 어떠한 핵산 분자일 수 있다. 따라서, 상기 핵산 서열은 자연에서 발견되거나 또는 발견되지 않을 수 있다. 상기 타겟 핵산 서열은 알려진 또는 알려지지 않은 서열일 수 있다.
일 구현예에 있어서, 상기 n개의 타겟 핵산은 뉴클레오타이드 변이(nucleotide variation)를 포함할 수 있다. 예컨대, 상기 n개의 타겟 핵산 중 하나는 한 가지 유형의 뉴클레오타이드 변이를 포함하고, 다른 하나는 다른 유형의 뉴클레오타이드 변이를 포함할 수 있다.
본 명세서에서 사용되는 용어 “뉴클레오타이드 변이(nucleotide variation)”는 연속의 DNA 세그먼트 중 특정 위치의 DNA 서열에서의 어떤 단일 또는 복수의 뉴클레오타이드의 치환, 결실 또는 삽입을 의미할 수 있다. 이러한 연속적 DNA 세그먼트들은 하나의 유전자 또는 하나의 염색체의 어떤 다른 부위를 포함한다. 이러한 뉴클레오타이드 변이는 돌연변이(mutant) 또는 다형성 대립유전자 변이(polymorphic allele variations)일 수 있다. 예를 들어, 본 개시에서 검출되는 뉴클레오타이드 변이는 단일 뉴클레오타이드 다형성(single nucleotide polymorphism; SNP), 돌연변이(mutation), 결실, 삽입, 치환 및 전좌를 포함한다. 뉴클레오타이드 변이의 예는, 인간 지놈 내의 다양한 변이(예컨대, 메틸렌사수소 엽산 환원효소(methylenetetrahydrofolate reductase; MTHFR) 유전자의 변이), 병원체의 약제 내성과 관련된 변이 및 종양 형성-유발 변이를 포함한다. 본 명세서에서 사용되는 용어 “뉴클레오타이드 변이”는 핵산 서열의 특정 위치에서의 모든 변이를 포함한다. 즉, 용어 “뉴클레오타이드 변이”는 핵산 서열의 특정 위치에서의 야생형 및 그의 모든 돌연변이형을 포함한다.
본원에서 n개의 타겟 핵산은 n개의 상이한 유기체로부터의 유전자이거나, 동일한 유기체로부터의 n개의 상이한 유전자이거나, 또는 이의 조합일 수 있다.
본 명세서에서 용어 “샘플”은 생물학적 공급원으로부터의 세포, 조직 또는 유체, 또는 본 발명에 따라 유익하게 평가될 수 있는 어떠한 다른 미디엄(medium)을 의미하며, 바이러스, 세균, 조직, 세포, 혈액, 혈청, 혈장, 림프, 우유, 소변, 분변, 안구액, 타액, 정액, 뇌 추출물, 척수액, 충수, 비장 및 편도 조직 추출물, 양수, 복수 및 비-생물학적 샘플(예컨대, 식품 및 물)을 포함한다. 또한, 상기 샘플은 생물학적 공급원으로부터 단리된 자연(natural-occurring)의 핵산 분자 및 합성한 핵산 분자를 포함한다. 또한, 상기 샘플은 특정 검체에 대한 용해물(lysate), 추출물 또는 단리된 타겟 핵산 그 자체일 수 있다.
본원에서 인큐베이션 반응은 각각의 타겟 핵산이 대응하는 타겟 핵산 검출용 조성물과 반응함에 따라, 대응하는 검출 온도에서 대응하는 타겟 핵산 존재에 의존적으로 시그널의 변화를 유도하는 임의의 반응을 의미한다.
본 개시에서 인큐베이션은 복수의 사이클을 포함한다.
일 구현예에 있어서, 상기 단계 (a) 인큐베이션은 증폭 반응을 포함할 수있으며, 예컨대, 시그널 증폭 반응 및/또는 핵산 증폭 반응을 포함할 수 있다.
일 구현예에 있어서, 상기 증폭 반응은 복수의 사이클을 포함한다.
일 구현예에 있어서, 상기 단계 (a)의 인큐베이션은 타겟 핵산 검출용 조성물에 의한 시그널 변화와 함께 타겟 증폭이 가능한 조건하에서 실시된다. 이러한 조건은 용액의 온도, 염 농도 및 pH를 포함한다.
일 구현예에 있어서, 상기 단계 (a)의 인큐베이션은 핵산 증폭이 없는 시그널 증폭 과정에서 실시된다.
일 구현예에 있어서, 상기 시그널은 타겟 증폭과 동시에 증폭될 수 있다. 택일적으로, 상기 시그널은 타겟 증폭 없이 증폭될 수 있다.
일 구현예에 있어서, 상기 시그널 변화는 시그널 증폭 및 타겟 증폭을 포함하는 과정에서 발생한다.
일 구현예에 있어서, 타겟 핵산의 증폭은 중합효소 연쇄 반응(polymerase chain reaction; PCR)에 따라 실시될 수 있다. PCR은 타겟 핵산 증폭을 위해 당업계에서 널리 이용되며, 타겟 핵산의 변성, 타겟 핵산 및 프라이머 간의 어닐링(혼성화) 및 프라이머 연장의 사이클을 포함한다(Mullis 등, 미국 특허 제4,683,195호, 제4,683,202호 및 제4,800,159호; Saiki 등, (1985) Science 230, 1350-1354).
일 구현예에 있어서, 타겟 핵산의 증폭은 리가아제 연쇄반응(ligase chain reaction (LCR)) (미국특허 제4,683,195호 및 제4,683,202호; PCR Protocols: A Guide to Methods and Applications (Innis 등, eds, 1990)), 가닥 치환 증폭(strand displacement amplification (SDA)) (Walker, 등, Nucleic Acids Res. 20(7):1691-6 (1992); Walker PCR Methods Appl 3(1):1-6 (1993)), 전사 매개 증폭(transcription-mediated amplification) (Phyffer, 등, J. Clin. Microbiol. 34:834-841 (1996); Vuorinen, 등, J. Clin. Microbiol. 33:1856-1859 (1995)), 헬리카제-의존 증폭(helicase dependent amplification, HAD) (M. Vincent, Y. Xu and H. Kong, EMBO Rep., 2004, 5, 795-800), 염기순서기반증폭(nucleic acid sequence-based amplification (NASBA)) (Compton, Nature 350(6313):91-2 (1991)), 롤링서클 증폭(rolling circle amplification, RCA) (Lisby, Mol. Biotechnol. 12(1):75-99 (1999); Hatch 등, Genet. Anal. 15(2):35-40 (1999)), Q-beta 레플리카제(Q-Beta Replicase) (Lizardi 등, BiolTechnology 6:1197 (1988)), 루프-매개 등온 증폭(Loop-mediated isothermal amplification, LAMP) (Y. Mori, H. Kanda and T. Notomi, J. Infect. Chemother., 2013, 19, 404-411) 또는 재조합효소 중합효소 증폭(Recombinase Polymerase Amplification, RPA) (J. Li, J. Macdonald and F. von Stetten, Analyst, 2018, 144, 31-67)에 의해 실시될 수 있다.
다양한 DNA 중합효소가 증폭 반응에 이용될 수 있으며, E. coli DNA 중합효소 I의 “클레나우”단편, 열안정성 DNA 중합효소 및 박테리오파아지 T7 DNA 중합효소, Vent® 중합효소, Terminator™ 중합효소 등을 포함한다. 구체적으로, 중합효소는 다양한 박테리아 종으로부터 얻을 수 있는 열안정성 DNA 중합효소이고, 이는 Thermus aquaticus(Taq), Thermus thermophilus(Tth), Thermus filiformis, Thermus flavus, Thermococcus litoralis, 및 Pyrococcus furiosus(Pfu)를 포함한다. 상기 중합효소 대부분은 박테리아 그 자체로부터 분리될 수 있고 또는 상업적으로 구입할 수 있다.
상기 상술한 증폭 방법은 온도를 변화시키거나 변화시키지 않는 일련의 반응들의 반복을 통하여 타겟 핵산 및/또는 시그널을 증폭할 수 있다. 상기 일련의 반응들의 반복을 포함하는 증폭의 단위는 “사이클(cycle)”로 표현된다. 상기 사이클은 사용되는 증폭 방법에 따라 반복 횟수 또는 시간으로 표현될 수 있다.
일 구현예에 있어서, 상기 일련의 반응들은 순차적으로 실시될 수 있다. 예컨대, PCR의 경우, 타겟 핵산(즉, 주형)의 변성 반응 후 프라이머의 어닐링 반응을 실시하고, 이어서, 프라이머의 연장 반응이 순차적으로 실시될 수 있다. 이러한 경우, 사이클은 반복 횟수로 표현될 수 있다.
일 구현예에 있어서, 상기 일련의 반응들은 동시에 실시될 수 있다. 예컨대, 등온 증폭 방법 중 하나인 LAMP의 경우, 동 시간대에 복수의 주형 중 일부 주형에서는 프라이머의 어닐링 반응이 실시되고, 다른 주형에서는 이미 프라이머가 어닐링되어 프라이머의 연장 반응이 실시되고 있을 수 있다. 이러한 경우, 사이클은 시간으로 표현될 수 있다. 구체적으로, 1 사이클은 5초, 10초, 30초, 1분, 2분, 3분, 4분, 5분, 10분, 20분, 30분, 1시간 또는 2시간일 수 있다.
일 구현예에 있어서, 상기 인큐베이션은 타겟 핵산 존재에 의존적인 시그널의 변화를 측정할 수 있는 복수의 사이클 동안 실시될 수 있다. 예컨대, 상기 복수의 사이클의 수는 2 내지 100 사이클, 2 내지 90 사이클, 2 내지 80 사이클, 2 내지 70 사이클, 2 내지 60 사이클, 2 내지 50 사이클, 2 내지 40 사이클, 2 내지 30 사이클, 2 내지 20 사이클, 2 내지 10 사이클, 5 내지 100 사이클, 5 내지 90 사이클, 5 내지 80 사이클, 5 내지 70 사이클, 5 내지 60 사이클, 5 내지 50 사이클, 5 내지 40 사이클, 5 내지 30 사이클, 5 내지 20 사이클, 5 내지 10 사이클, 10 내지 100 사이클, 10 내지 90 사이클, 10 내지 80 사이클, 10 내지 70 사이클, 10 내지 60 사이클, 10 내지 50 사이클, 10 내지 40 사이클, 10 내지 30 사이클, 10 내지 20 사이클, 20 내지 100 사이클, 20 내지 90 사이클, 20 내지 80 사이클, 20 내지 70 사이클, 20 내지 60 사이클, 20 내지 50 사이클, 20 내지 40 사이클 또는 20 내지 30 사이클일 수 있으며, 구체적으로, 10 사이클, 15 사이클, 20 사이클, 25 사이클, 30 사이클, 35 사이클, 40 사이클, 45 사이클 또는 50 사이클일 수 있다.
일 구현예에 있어서, 상기 시그널의 검출은 복수의 사이클을 포함하는 인큐베이션 반응의 각 사이클, 선택된 일부 사이클, 또는 엔드-포인트(end-point)에서 실시될 수 있다.
일 구현예에 있어서, 상기 타겟 핵산의 증폭 반응은 다중 타겟 핵산 서열 증폭 반응일 수 있다.
본 명세서에서 사용되는 용어 “다중 타겟 핵산 증폭 반응”(multiple target nucleic acid amplification reaction)은 하나의 반응 용기에서 둘 이상의 핵산을 타겟으로 하여 이를 증폭하는 반응을 의미한다. 다중 타겟 핵산 증폭 반응은 둘 이상의 핵산을 함께 증폭시키는 반응을 말한다. 예컨대, 다중 타겟 핵산 증폭 반응은 하나의 반응에서 2개 이상, 3개 이상, 4개 이상, 5개 이상, 6개 이상, 7개 이상, 8개 이상, 9개 이상, 10개 이상, 20개 이상, 30개 이상, 40개 이상 또는 50개 이상의 타겟 핵산을 함께 증폭시킬 수 있다.
일 구현예에 있어서, 본 개시에 따른 방법은 하나의 반응 용기에서 단일 유형의 표지를 이용하여 2개 내지 50개, 2개 내지 40개, 2개 내지 30개, 2개 내지 20개, 2개 내지 15개, 2개 내지 12개, 2개 내지 10개, 2개 내지 9개, 2개 내지 8개, 2개 내지 7개, 2개 내지 6개, 2개 내지 5개, 3개 내지 50개, 3개 내지 40개, 3개 내지 30개, 3개 내지 20개, 3개 내지 15개, 3개 내지 12개, 3개 내지 10개, 3개 내지 9개, 3개 내지 8개, 3개 내지 7개, 3개 내지 6개, 3개 내지 5개, 4개 내지 50개, 4개 내지 40개, 4개 내지 30개, 4개 내지 20개, 4개 내지 15개, 4개 내지 12개, 4개 내지 10개, 4개 내지 9개, 4개 내지 8개, 4개 내지 7개, 4개 내지 6개 또는 4개 내지 5개의 타겟 핵산을 검출할 수 있다.
일 구현예에 있어서, 본 개시에 따른 방법은 복수 유형의 표지를 이용하는 경우, 본 개시의 방법에 따라 단일 유형의 표지를 이용하여 검출할 수 있는 타겟 핵산 수 보다 더 많은 수의 타겟 핵산, 예컨대, 사용하는 표지의 유형 수의 배 수만큼 더 많은 타겟 핵산을 검출 수 있다.
본 개시에 따른 방법은 샘플 내에 n개의 타겟 핵산 중 최소 하나가 존재하는지 여부를 결정하기 위해 사용된다. 예컨대, n이 2인 경우, 본 개시는 제1 타겟 핵산 및 제2 타겟 핵산 중 최소 하나가 샘플 내에 존재하는지 여부를 결정하기 위해 사용될 수 있다. 또 다른 예로, n이 3인 경우, 본 개시는 제1 타겟 핵산, 제2 타겟 핵산 및 제3 타겟 핵산 중 최소 하나가 샘플 내에 존재하는지 여부를 결정하기 위해 사용될 수 있다.
일 구현예에 있어서, 상기 n은 2이상의 정수이다. 예컨대, n은 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45 또는 50일 수 있으나, 이에 한정되지 않는다.
본 개시는 n개(n은 2 이상의 정수임)의 타겟 핵산, 즉 제1 내지 제n 타겟 핵산 각각을 검출하기 위해 n개의 타겟 핵산 검출용 조성물, 즉 제1 내지 제n 타겟 핵산 검출용 조성물의 조합이 사용된다.
본원에 사용된 바와 같이, 용어 “제1 내지 제n 타겟 핵산 검출용 조성물의 조합”은 제1 내지 제n 타겟 핵산 각각에 특이적인 조성물의 모음(compilation) 또는 혼합물(mixture)을 지칭한다. 본원에서, 하나의 타겟 핵산 검출용 조성물은 하나의 대응하는 타겟 핵산에 특이적이다. 상기 문구 “하나의 타겟 핵산 검출용 조성물이 하나의 대응하는 타겟 핵산에 특이적”이라는 것은 상기 타겟 핵산 검출용 조성물이 상기 하나의 대응하는 타겟 핵산의 검출에 관여하지만 그 외의 타겟 핵산의 검출에는 관여하지 않는다는 것을 의미한다. 달리 말하면, 상기 문구는 상기 타겟 핵산 검출용 조성물이 하나의 대응하는 타겟 핵산과 상호작용하지만 그 외의 타겟 핵산과는 상호작용하지 않는다는 것을 의미한다.
본원에서 제n 타겟 핵산 검출용 조성물은 제n 타겟 핵산에 특이적이며, 예를 들어 제1 타겟 핵산 검출용 조성물은 제1 타겟 핵산에 특이적이고, 제2 타겟 핵산 검출용 조성물은 제2 타겟 핵산에 특이적이며, 제3 타겟 핵산 검출용 조성물은 제3 타겟 핵산에 특이적이다.
본원에서 사용되는 제1 내지 제n 타겟 핵산 검출용 조성물의 조합은 하나의 반응에서 함께 사용되며, 즉 제1 내지 제n 타겟 핵산 검출용 조성물의 조합은 하나의 반응액 또는 반응 용기 내에 함께 존재한다.
본원에 사용된 용어 “타겟 핵산 검출용 조성물”은 타겟 핵산을 검출하기 위해 사용되는 구성요소들을 함유하는 조성물을 의미한다.
본 개시의 방법에 따르면, 상기 제1 내지 제n 타겟 핵산 검출용 조성물 각각은 제1 내지 제n 타겟 핵산 중 대응하는 타겟 핵산의 존재에 의존적으로 시그널을 제공하는 표지를 포함하고, 상기 제1 내지 제n 타겟 핵산 검출용 조성물 각각으로부터 제공되는 시그널은 단일 검출 채널에 의해 서로 구별되지 않는다.
타겟 핵산 검출용 조성물은 타겟 핵산의 증폭 및 검출에 관여하는 다양한 올리고뉴클레오타이드를 포함할 수 있다.
본원에서 표지는 올리고뉴클레오타이드에 연결되거나 자유로운 형태(free form)로 존재할 수 있다. 또는 상기 인큐베이션 동안 올리고뉴클레오타이드에 삽입된다.
전술한 표지 및 올리고뉴클레오타이드는 상기 제1 내지 제n 타겟 핵산 검출용 조성물 내의 핵심 요소로서 언급되었을 뿐, 상기 올리고뉴클레오타이드 외에도 다양한 구성요소가 추가로 포함될 수 있다는 점에 유의한다.
상기 타겟 핵산 검출용 조성물에 포함되는 구성요소의 예는, 비제한적으로 타겟 핵산을 증폭 또는 검출하기 위해 사용되는 올리고뉴클레오타이드 세트, 표지, 핵산 중합효소, 버퍼, 중합효소 보조인자 및 데옥시리보뉴클레오타이드-5-트리포스페이트 등을 포함한다. 선택적으로, 상기 타겟 핵산 검출용 조성물은 다양한 폴리뉴클레오타이드 분자, 역전사 효소, 다양한 버퍼 및 시약, 및 핵산 중합효소 활성을 억제하는 항체를 포함할 수 있다. 또한 상기 타겟 핵산 검출용 조성물은 양성 대조군 반응을 실시하는 데 필요한 올리고뉴클레오타이드 세트 또는 시약을 포함할 수 있다. 특정 반응에서 사용되는 시약의 최적량은 본 개시사항의 이점을 알고 있는 당업자에 의해 용이하게 결정될 수 있다. 상기 타겟 핵산 검출용 조성물의 구성요소들은 반응 전에 하나의 용기 또는 복수의 용기 내에 존재 또는 보관될 수 있다.
국제출원 공개 WO 2022-265463은 타겟 핵산을 검출하기 위한 당업계에 공지된 다양한 시그널 발생 방식들이 타겟 핵산의 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위(signal-changing temperature range; SChTR) 및 타겟 핵산이 존재하여도 시그널이 변화하지 않는 하나 또는 두개의 시그널-일정 온도 범위(signal-constant temperature range; SCoTR)를 가진다는 것을 개시하였다. 또한, 상기 문헌은 이러한 시그널-변화 온도 범위 및 시그널-일정 온도 범위의 개수와 이들의 순서에 따라, 종래의 다양한 시그널 발생 방식들을 (i) 시그널-변화 온도 범위가 시그널-일정 온도 범위보다 낮은 특징을 갖는 UnderSC(Under-Signal-Change) 시그널 발생 방식, (ii) 시그널-변화 온도 범위가 2개의 시그널-일정 온도 범위 중 하나의 시그널-일정 온도 범위보다 높고, 다른 하나의 시그널-일정 온도 범위보다는 낮은 특징을 갖는 InterSC(Inter-Signal-Change) 시그널 발생 방식, 및 (iii) 시그널-변화 온도 범위가 시그널-일정 온도 범위보다 높은 특징을 갖는 OverSC(Over-Signal-Change) 시그널 발생 방식 중 어느 하나로 분류할 수 있음을 개시하였다.
본원에서 사용되는 n개의 타겟 핵산 검출용 조성물 역시, 상기 3가지 시그널 발생 방식 중 어느 하나가 적용된 조성물이다. 즉, 본 개시에서 사용되는 n개의 타겟 핵산 검출용 조성물은 각각 (i) UnderSC(Under-Signal-Change) 조성물, (ii) InterSC(Inter-Signal-Change) 조성물, 및 (iii) OverSC(Over-Signal-Change) 조성물 중 어느 하나의 조성물이다.
일 구현예에 있어서, 상기 n이 2인 경우, 제1 타겟 핵산 검출용 조성물은 UnderSC 또는 InterSC 조성물이고, 및 제2 타겟 핵산 검출용 조성물은 InterSC 또는 OverSC 조성물이다.
일 구현예에 있어서, 상기 n이 3이상인 경우, 제1 타겟 핵산 검출용 조성물은 UnderSC 또는 InterSC 조성물이고, 제n 타겟 핵산 검출용 조성물은 InterSC 또는 OverSC 조성물이며, 및 상기 제1 타겟 핵산 및 상기 제n 타겟 핵산 이외의 각각의 타겟 핵산 검출용 조성물은 InterSC 조성물이다.
더불어, 상기 n개의 타겟 핵산 검출용 조성물 중 최소 하나는 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 조성물이다.
본 명세서에서 사용되는 용어 "프로브(probe)"는 타겟 핵산에 실질적으로 상보적인 부위 또는 부위들을 포함하는 단일-가닥 핵산 분자를 의미한다.
본 개시에서 n개의 타겟 핵산을 검출하기 위한 타겟 핵산 검출용 조성물 중 최소 하나로 사용되는 “상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 타겟 핵산 검출용 조성물”에 대하여 다음과 같이 도면을 참조하여 보다 상세히 설명하나, 이에 한정되는 것은 아니다.
도 1은 타겟 핵산이 부존재하거나 또는 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물과 타겟 핵산과의 반응 전, (i) 제1 시그널-일정 온도 범위, (ii) 시그널-변화 온도 범위 및 (iii) 제2 시그널-일정 온도 범위에서 제1 프로브 및 제2 프로브의 형태를 보여준다.
도 2 및 도 3은 타겟 핵산이 존재하는 경우, (i) 제1 시그널-일정 온도 범위, (ii) 시그널-변화 온도 범위 및 (iii) 제2 시그널-일정 온도 범위에서 제1 프로브 및 제2 프로브의 형태를 보여준다. 구체적으로, 도 2 및 도 3은 타겟 핵산이 증폭된 반응 결과물(예컨대, 말기 사이클의 결과물)에서 제1 프로브 및 제2 프로브의 형태를 나타낸 것이다.
(i) 제1 프로브
제1 프로브는 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함한다. 즉, 상기 제1 프로브는 타겟 핵산의 제1 영역에 혼성화할 수 있다.
본원에 사용된 용어 "혼성화하다", "혼성화하는" 또는 "혼성화"는 특정 혼성화 조건 또는 엄격 조건 하에 2개의 상보적 단일 가닥 폴리뉴클레오타이드 간의 비공유 결합에 의한 이중 가닥의 형성을 지칭한다.
특히, 본원에서 하나의 올리고뉴클레오타이드가 다른 올리고뉴클레오타이드에 대한 "혼성화 뉴클레오타이드 서열을 포함한다"는 표현은 하나의 올리고뉴클레오타이드의 전체 또는 일부가 다른 올리고뉴클레오타이드의 전체 또는 일부와 혼성화하는데 필요한 상보적인 뉴클레오타이드 서열을 갖는다는 것을 의미한다.
용어 "상보적"은 소정의 어닐링 또는 엄격 조건하에서 프라이머 또는 프로브가 타겟 핵산 서열에 선택적으로 혼성화할 정도로 충분히 상보적인 것을 의미하기 위해 사용되며, "실질적으로 상보적(substantially complementary)" 및 "완전히 상보적(perfectly complementary)"인 것을 모두 포괄하는 의미를 가지며, 바람직하게는 완전히 상보적인 것을 의미한다.
반면, 용어 "비-상보적"은 소정의 어닐링 또는 엄격 조건 하에서 프라이머 또는 프로브가 특정 서열에 선택적으로 혼성화되지 않을 정도로 충분히 비-상보적인 것을 의미하기 위해 사용되며, "실질적으로 비-상보적(substantially non-complementary)" 및 "완전히 비-상보적(perfectly noncomplementary)"인 것을 모두 포괄하는 의미를 가지며, 바람직하게는 완전히 비-상보적인 것을 의미한다.
또한, 본원에서 하나의 올리고뉴클레오타이드의 부위와 다른 올리고뉴클레오타이드의 혼성화를 언급할 때, 상기 하나의 올리고뉴클레오타이드의 부위는 개별적인 올리고뉴클레오타이드로 간주될 수 있다.
혼성화는 완전히 매치하거나 일부 미스매치(예컨대, 1-4개의 미스매치)를 갖고 실질적으로 매치되는 2개의 핵산 가닥 사이에서 일어날 수 있다. 혼성화를 위한 상보성은 혼성화 조건, 특히 온도에 따라 달라질 수 있다.
두 개의 올리고뉴클레오타이드 간의 혼성화(예컨대, 제1 프로브 및 타겟 핵산간의 혼성화)는 최적화 절차에 의하여 일반적으로 결정되는 적합한 혼성화 조건 하에서 실시될 수 있다. 온도, 성분의 농도, 혼성화 및 세척 횟수, 버퍼 성분 및 이들의 pH 및 이온 세기와 같은 조건은 올리고뉴클레오타이드(예컨대, 제1 프로브 및 제2 프로브)의 길이 및 GC 양 및 타겟 핵산 뉴클레오타이드 서열을 포함한 다양한 인자에 따라 달라질 수 있다. 예를 들어, 상대적으로 짧은 올리고뉴클레오타이드를 이용하는 경우, 낮은 엄격 조건(stringent condition)을 채택하는 것이 바람직하다. 혼성화를 위한 상세한 조건은 문헌[Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001); 및 M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y.(1999)]에서 확인할 수 있다.
용어 "어닐링"과 "혼성화"는 차이가 없으며, 이들 용어는 상호교환적으로 사용될 것이다.
상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가진다.
일 구현예에 있어서, 상기 제1 프로브가 상기 타겟 핵산과 혼성화하기 전, 상기 제1 프로브에 연결된 리포터 분자 및 제1 퀀처 분자는 서로 근접하게 위치한다. 이로 인해, 상기 제1 프로브에 연결된 제1 퀀처 분자는 상기 제1 프로브에 연결된 리포터 분자로부터의 시그널을 퀀칭(quenching)시킨다.
본 명세서에서 사용되는 표현 "리포터 분자 및 퀀처 분자가 서로 근접하다"는 것은 (i) 리포터 분자 및 퀀처 분자를 모두 포함하고 있는 올리고뉴클레오타이드가 특정한 형태적 구조, 예컨대, 랜덤 코일(random coli) 또는 헤어핀(hairpin) 구조를 형성함으로써 그 안의 리포터 분자 및 퀀처 분자가 3차원적으로 서로 근접(three-dimensionally adjacent)하거나 또는 (ii) 리포터 분자를 포함하는 올리고뉴클레오타이드 및 퀀처 분자를 포함하는 올리고뉴클레오타이드가 이중 가닥을 형성하여 리포터 분자 및 퀀처 분자가 서로 근접한 것을 의미한다.
일 구현예에 있어서, 상기 제1 프로브는 상기 타겟 핵산과 혼성화되기 전, 랜덤 코일 또는 헤어핀 구조를 형성하여 상기 제1 프로브에 연결된 제1 퀀처 분자가 상기 제1 프로브에 연결된 리포터 분자로부터의 시그널을 분자내 퀀칭(intramolecular quenching)시킨다.
일 구현예에 있어서, 상기 제1 프로브가 상기 타겟 핵산과 혼성화하면, 상기 제1 프로브의 리포터 분자 및 제1 퀀처 분자는 서로 이격된다. 구체적으로, 상기 제1 프로브가 타겟 핵산에 혼성화하여, 상기 제1 프로브의 제1 퀀처 분자가 상기 제1 프로브의 리포터 분자와 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭한다.
본 명세서에서 사용되는 표현 "리포터 분자 및 퀀처 분자가 서로 이격된다"는 것은 (i) 리포터 분자 및 퀀처 분자를 모두 포함하고 있는 올리고뉴클레오타이드가 다른 올리고뉴클레오타이드와 이중 가닥을 형성하고 이로 인해, 올리고뉴클레오타이드의 특정한 형태 구조의 변화(예컨대, 헤어핀 구조의 붕괴(disruption))에 의하여 리포터 분자 및 퀀처 분자가 3차원적으로 이격(three-dimensionally separated)되거나 또는 (ii) 이중 가닥을 형성하고 있던 리포터 분자를 포함하는 올리고뉴클레오타이드와 퀀처 분자를 포함하는 올리고뉴클레오타이드가 서로 해리되어 리포터 분자 및 퀀처 분자가 서로 이격되는 것을 의미한다.
일 구현예에 있어서, 상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재한다. 구체적으로, 상기 제1 프로브의 제1 퀀처 분자는 상기 제1 프로브의 리포터 분자로부터 12 내지 60 뉴클레오타이드, 15 내지 60 뉴클레오타이드, 18 내지 60 뉴클레오타이드, 20 내지 60 뉴클레오타이드, 12 내지 50 뉴클레오타이드, 15 내지 50 뉴클레오타이드, 18 내지 0 뉴클레오타이드, 20 내지 650 뉴클레오타이드, 12 내지 40 뉴클레오타이드, 15 내지 40 뉴클레오타이드, 18 내지 40 뉴클레오타이드, 20 내지 40 뉴클레오타이드, 12 내지 30 뉴클레오타이드, 15 내지 30 뉴클레오타이드, 18 내지 30 뉴클레오타이드 또는 20 내지 30 뉴클레오타이드 이격되어 있으며, 구체적으로, 15 뉴클레오타이드 내지 60 뉴클레오타이드, 보다 구체적으로 18 뉴클레오타이드 내지 30 뉴클레오타이드 이격되어 있다.
일 구현예에 있어서, 상기 리포터 분자는 제1 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결된다.
본 명세서에서 제1 프로브 및/또는 제2 프로브를 언급하면서 사용되는 용어“3'-말단 부위” 또는 “5'-말단 부위”는 프로브의 3'-말단 또는 5'-말단으로부터 어떤 길이의 연속적인 서열을 포함하는 부위 또는 구역을 의미한다. 예컨대, 프로브의 3'-말단 부위는 그의 3'-말단으로부터 1 내지 10 뉴클레오타이드를 포함하는 서열, 구체적으로, 1 내지 5 뉴클레오타이드, 보다 구체적으로, 1 내지 3 뉴클레오타이드를 포함하는 서열을 의미하며, 프로브의 5'-말단은 그의 5'-말단으로부터 1 내지 10 뉴클레오타이드를 포함하는 서열, 구체적으로, 1 내지 5 뉴클레오타이드, 보다 구체적으로, 1 내지 3 뉴클레오타이드를 포함하는 서열을 의미한다.
(ii) 제2 프로브
제2 프로브는 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함한다. 즉, 상기 제2 프로브는 타겟 핵산의 제2 영역에 혼성화할 수 있다.
또한, 상기 제2 프로브는 제2 퀀처 분자를 가진다.
본 개시에서, 상기 타겟 핵산의 제1 영역 및 제2 영역은 서로 인접해 있다.
본 명세서에서 타겟 핵산의 제1 영역 및 제2 영역을 언급하면서 사용되는 용어“인접(adjacent)”은 상기 타겟 핵산의 제1 영역에 혼성화된 제1 프로브의 리포터 분자와 상기 타겟 핵산의 제2 영역에 혼성화된 제2 프로브의 제2 퀀처 분자가 서로 상호 작용할 수 있을 정도로 충분히 가까운 것을 의미한다. 즉, 상기 타겟 핵산의 제2 영역에 혼성화된 제2 프로브의 제2 퀀처 분자가 상기 타겟 핵산의 제1 영역에 혼성화된 제1 프로브의 리포터 분자로부터의 시그널을 퀀칭할 수 있는 한, 상기 타겟 핵산의 제1 영역 및 제2 영역은 이격 없이 서로 바로 인접하게(immediately adjacent) 위치하거나 일부 이격된 가까운(in close proximity) 위치에 위치할 수 있다. 일 구현예에 있어서, 상기 타겟 핵산의 제1 영역 및 제2 영역은 서로 바로 인접하게 위치할 수 있다. 예컨대, 상기 타겟 핵산의 제1 영역 및 제2 영역은 바로 가까이에 위치하여 닉(nick)을 형성할 수 있다. 다른 구현예에 있어서, 상기 타겟 핵산의 제1 영역 및 제2 영역은 서로 가까운 위치에 위치할 수 있다. 예컨대, 상기 타겟 핵산의 제1 영역은 상기 타겟 핵산의 제2 영역으로부터 1-30 뉴클레오타이드, 1-20 뉴클레오타이드, 1-15 뉴클레오타이드, 1-10 뉴클레오타이드, 1-5 뉴클레오타이드 또는 1-4 뉴클레오타이드 이격되어 위치할 수 있다. 또 다른 구현예에 있어서, 상기 타겟 핵산의 제1 영역 및 제2 영역은 서로 중첩될 수 있다. 예컨대, 1-10 뉴클레오타이드, 1-7 뉴클레오타이드, 1-5 뉴클레오타이드, 1-3 뉴클레오타이드 또는 1-2 뉴클레오타이드가 중첩될 수 있다.
일 구현예에 있어서, 상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭된다. 구체적으로, 상기 제1 프로브가 상기 타겟 핵산의 제1 영역에 혼성화되어 있는 경우, 상기 제2 프로브는 상기 타겟 핵산의 제2 영역에 혼성화하여 상기 제2 프로브의 제2 퀀처 분자가 상기 타겟 핵산의 제1 영역에 혼성화되어 있는 제1 프로브의 리포터 분자에 인접하고, 이로 인해, 상기 제2 퀀처 분자가 상기 리포터 분자로부터의 시그널을 분자간 퀀칭(intermolecular quenching)시킨다.
일 구현예에 있어서, 상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화하면, 상기 제2 프로브의 제2 퀀처 분자는 상기 제1 프로브의 리포터 분자와 인접하고, 이로 인해, 상기 제2 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시킬 수 있는 위치에 상기 리포터 분자 및 제2 퀀처 분자가 존재한다. 구체적으로, 상기 제1 프로브 및 제2 프로브가 타겟 핵산에 혼성화되는 경우, 상기 제2 퀀처 분자는 상기 리포터 분자로부터 바로 인접하게 위치하거나 또는 4 뉴클레오타이드 이내에 위치한다. 보다 구체적으로, 상기 제2 퀀처 분자는 상기 리포터 분자로부터 1, 2, 3 또는 4 뉴클레오타이드 이격되어 있다.
일 구현예에 있어서, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결되어 있다.
일 구현예에 있어서, 상기 제1 프로브의 3' 방향으로 다운스트림에 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 3'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 5'-말단 부위에 위치한다.
본 명세서에서 제1 프로브 및 제2 프로브 간의 위치를 설명하면서 사용하는 표현 “제1 프로브의 3' 방향으로 다운스트림에 제2 프로브가 타겟 핵산에 혼성화한다”는 것은 타겟 핵산에 혼성화된 제1 프로브의 3'-말단 옆에 제2 프로브의 5'-말단이 위치하도록 제2 프로브가 타겟 핵산에 혼성화되는 것을 의미한다. 이를 타겟 핵산의 제1 영역 및 제2 영역을 기준으로 설명하면, 상기 타겟 핵산의 제1 영역은 상기 타겟 핵산의 제2 영역의 3'-방향으로 다운스트림에 위치한다(도 2 참조).
일 구현예에 있어서, 상기 제1 프로브의 5' 방향으로 업스트림에 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 5'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위에 위치한다.
본 명세서에서 제1 프로브 및 제2 프로브 간의 위치를 설명하면서 사용하는 표현 “제1 프로브의 5' 방향으로 업스트림에 제2 프로브가 타겟 핵산에 혼성화한다”는 것은 타겟 핵산에 혼성화된 제1 프로브의 5'-말단 옆에 제2 프로브의 3'-말단이 위치하도록 제2 프로브가 타겟 핵산에 혼성화되는 것을 의미한다. 이를 타겟 핵산의 제1 영역 및 제2 영역을 기준으로 나타내면, 상기 타겟 핵산의 제1 영역은 상기 타겟 핵산의 제2 영역의 5'-방향으로 업스트림에 위치한다(도 3 참조).
일 구현예에 있어서, 제1 프로브 및/또는 제2 프로브는 그의 3'-말단이 "블록킹"되어 연장이 방지된다. 블록킹은 종래 방법에 따라 달성될 수 있다. 예를 들면, 블록킹은 마지막 뉴클레오타이드의 3'-히드록실기에 바이오틴, 표지, 포스페이트기, 알킬기, 비-뉴클레오타이드 링커, 포스포로티오에이트 또는 알칸-디올 잔기와 같은 화학적 모이어티(moiety)를 추가하여 실시할 수 있다. 택일적으로, 블록킹은 마지막 뉴클레오타이드의 3’-히드록실기를 제거하거나 또는 다이디옥시뉴클레오타이드와 같이 3'-히드록실기가 없는 뉴클레오타이드를 이용하여 실시할 수 있다.
본 개시에서 사용되는 리포터 분자 및 퀀처 분자는 상호작용적 표지이다. 상기 상호작용적 표지 시스템의 대표적 예로서, FRET(fluorescence resonance energy transfer) 표지 시스템은 형광 리포터 분자(공여체 분자) 및 퀀처 분자(수용체 분자)를 포함한다. FRET에서 에너지 공여체는 형광성이나, 에너지 수용체는 형광성 또는 비-형광성일 수 있다. 상호작용적 표지 시스템의 다른 형태에서, 에너지 공여체는 비-형광성, 예컨대, 발색단(chromophore)이고 에너지 수용체는 형광성이다. 상호작용적 표지 시스템의 또 다른 형태에서, 에너지 공여체는 발광성(luminescent), 예컨대, 생물발광성, 화학발광성, 전기화학발광성이며, 수용체는 형광성이다. 상호작용적 표지 시스템은 “접촉-매개 퀀칭(contact-mediated quenching)”에 기반한 표지 쌍을 포함한다(Salvatore 등, Nucleic Acids Research, 2002 (30) no.21 e122 and Johansson 등, J. AM. CHEM. SOC 2002 (124) pp 6950-6956). 상기 상호작용적 표지 시스템은 최소 2개의 분자(예컨대, 염료) 간의 상호작용에 의해 시그널 변화를 유도하는 어떠한 표지 시스템도 포함한다.
상호작용적 표지로서 유용한 리포터 분자 및 퀀처 분자는 당업계에 알려진 어떠한 분자도 포함할 수 있다. 이러한 분자의 예는 다음과 같다: Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™(531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568), BODIPY564/570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), Rphycocyanin (642), C-Phycocyanin (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) 및 Quasar 705 (610). 괄호의 숫자는 나노미터 단위로 표시한 최대 발광 파장이다. 특정 구현예에 있어서, 리포터 분자 및 퀀처 분자는 JOE, FAM, TAMRA, ROX 및 플루오레세인-기반 표지를 포함한다.
적합한 리포터-퀀처 쌍은 다음과 같이 다양한 문헌에 개시되어 있다: Pesce 등, editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White 등, Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); 미국 특허 제3,996,345호 및 제4,351,760호.
일 구현예에 있어서, 광범위 파장 또는 특정 파장의 형광을 퀀칭할 수 있는 비-형광 블랙 퀀처 분자가 이용될 수 있다. 비-형광 블랙 퀀처 분자의 예는 BHQ 및 DABCYL이다.
본 개시에 적용되는 FRET 표지에서, 리포터는 FRET의 공여체를 포함하고 퀀처는 FRET의 나머지 파트너(수용체)를 포함한다. 예를 들어, 플루오레세인 염료(fluorescein dye)는 리포터로 이용되고 로다민 염료(rhodamine dye)는 퀀처로 이용된다.
일 구현예에 있어서, 상기 제2 프로브에 연결된 제2 퀀처 분자는 상기 제1 프로브에 연결된 제1 퀀처 분자와 동일한 유형의 퀀처 분자이다. 예컨대, 제1 프로브에 연결된 제1 퀀처 분자가 비-형광 블랙 퀀처 분자(예컨대, BHQ)인 경우, 제2 프로브에 연결된 제2 퀀처 분자는 동일한 유형의 비-형광 블랙 퀀처 분자(예컨대, BHQ)를 사용할 수 있으며, 제1 프로브에 연결된 제1 퀀처 분자가 형광성 수용체 분자(예컨대, 로다민 염료)인 경우, 제2 프로브에 연결된 제2 퀀처 분자 역시, 동일한 유형의 형광성 수용체 분자(예컨대, 로다민 염료)를 사용할 수 있다.
상술한 단계 (a)의 인큐베이션 반응을 통해, 제1 프로브 및 제2 프로브를 포함하는 본 개시에 따른 타겟 핵산 검출용 조성물은 타겟 핵산과 반응하여 타겟 핵산 존재에 의존적인 시그널을 제공한다. 구체적으로, 본 개시에 따른 제1 프로브 및 제2 프로브를 포함하는 타겟 핵산 검출용 조성물은 타겟 핵산이 증폭됨에 따라, 시그널의 변화를 제공한다.
본 개시에 따른 제1 프로브 및 제2 프로브는 서로 상이한 Tm 값을 갖는 것이 특징이다. 구체적으로, 상기 제1 프로브와 타겟 핵산 간의 혼성화물의 Tm 값은 상기 제2 프로브와 타겟 핵산 간의 혼성화물의 Tm 값보다 높다. 예컨대, 상기 제1 프로브의 Tm 값은 제2 프로브의 Tm 값보다 최소 2℃, 3℃, 4℃, 5℃, 7℃, 8℃, 9℃, 10℃, 11℃, 12℃, 13℃, 14℃, 15℃ 또는 20℃ 이상 높다.
이러한 상이한 Tm 값을 가지는 2개의 프로브를 이용함으로써, 본 개시에 따른 타겟 핵산 검출용 조성물은 타겟 핵산과의 반응(예컨대, 증폭 반응)에서 타겟 핵산의 존재에 의존적으로 시그널이 변화하는 온도 범위, 즉, 시그널-변화 온도 범위(signal-changing temperature range) 및 타겟 핵산이 존재하여도 시그널이 변화하지 않는 2개의 온도 범위, 즉, 2개의 시그널-일정 온도 범위(signal-constant temperature range)를 가진다.
도 1 내지 도 3은 타겟 핵산 존재 여부 및 온도에 따른 제1 프로브 및 제2 프로브의 우세한 형태를 나타낸다.
먼저, 도 1은 타겟 핵산이 부존재하거나 또는 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물과 타겟 핵산과의 반응 전, (i) 제1 시그널-일정 온도 범위, (ii) 시그널-변화 온도 범위 및 (iii) 제2 시그널-일정 온도 범위에서 제1 프로브 및 제2 프로브의 형태를 보여준다.
일 구현예에 있어서, 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물이 타겟 핵산과 반응 전이거나 타겟 핵산이 부존재하는 경우, 제1 시그널-일정 온도 범위, 시그널 변화 온도 범위 및 제2 시그널-일정 온도 범위 모두에서 제1 프로브는 랜덤 코일 또는 헤어핀 구조를 형성하여 제1 프로브의 리포터 분자는 제1 프로브의 퀀처 분자와 서로 근접하게 위치한다. 특히, 제2 시그널-일정 온도 범위에서는 헤어핀 구조도 붕괴되어 랜덤 코일 형태로 존재할 수 있다. 이로 인해, 전체 온도 범위에서 제1 퀀처 분자가 리포터 분자로부터의 시그널을 퀀칭시킨다. 한편, 제2 프로브는 타겟 핵산이 부존재하는 경우, 전체 온도 범위에서 단일 가닥으로 존재한다(도 1의 (i) 내지 도 1의 (iii) 참조).
도 2는 제2 프로브가 제1 프로브의 3’ 방향으로 다운스트림에 타겟 핵산에 혼성화되는 구체적인 구현예에 대하여, 타겟 핵산 존재하에 (i) 제1 시그널-일정 온도 범위, (ii) 시그널-변화 온도 범위 및 (iii) 제2 시그널-일정 온도 범위에서의 제1 프로브 및 제2 프로브의 형태를 보여준다.
도 3은 제2 프로브가 제1 프로브의 5’ 방향으로 업스트림에 타겟 핵산에 혼성화되는 구체적인 구현예에 대하여, 타겟 핵산 존재하에 (i) 제1 시그널-일정 온도 범위, (ii) 시그널-변화 온도 범위 및 (iii) 제2 시그널-일정 온도 범위에서의 제1 프로브 및 제2 프로브의 형태를 보여준다.
일 구현예에 있어서, 타겟 핵산이 존재하는 경우, 제1 시그널-일정 온도 범위에서 제1 프로브 및 제2 프로브는 모두 타겟 핵산에 각각 혼성화된다. 이러한 온도 범위에서는 제1 프로브는 타겟 핵산의 제1 영역에 혼성화되어 제1 프로브의 리포터 분자 및 제1 퀀처 분자는 분리되면서 제1 퀀처 분자가 리포터 분자로부터의 시그널을 언퀀칭시키나, 제2 프로브가 타겟 핵산의 제2 영역에 혼성화되어 제2 프로브의 제2 퀀처 분자와 제1 프로브의 리포터 분자가 서로 근접하여 제2 퀀처 분자가 리포터 분자로부터의 시그널을 퀀칭시킨다(도 2의 (i) 또는 도 3의 (i) 참조). 즉, 도 1의 (i) 및 도 2 또는 도 3의 (i)에 나타난 바와 같이, 제1 시그널-일정 온도 범위에서는 타겟 핵산의 존재 여부와 무관하게 리포터 분자가 제1 퀀처 분자 또는 제2 퀀처 분자에 의해 퀀칭되어 있다. 이로 인해, 제1 시그널-일정 온도 범위에서는 타겟 핵산이 존재하여도 시그널 변화 없이 시그널이 일정하다.
일 구현예에 있어서, 타겟 핵산이 존재하는 경우, 시그널-변화 온도 범위에서는 제1 프로브는 타겟 핵산의 제1 영역에 혼성화되지만, 제2 프로브는 타겟 핵산의 제2 영역에 혼성화되지 않는다. 즉, 제2 프로브는 타겟 핵산으로부터 해리되어 단일 가닥으로 존재한다. 이러한 온도 범위에서는 제1 프로브의 제1 퀀처 분자 및 제2 프로브의 제2 퀀처 분자 모두 제1 프로브의 리포터 분자로부터 이격되어 리포터 분자로부터의 시그널을 언퀀칭시킨다(도 2의 (ii) 또는 도 3의 (ii) 참조). 즉, 도 1의 (ii) 및 도 2 또는 도 3의 (ii)에 나타난 바와 같이, 시그널-변화 온도 범위에서는 타겟 핵산이 부존재하는 경우에는 제1 퀀처 분자가 리포터 분자로부터의 시그널을 퀀칭시키는 반면, 타겟 핵산이 존재하는 경우에는 제1 퀀처 분자 및 제2 퀀처 분자가 리포터 분자로부터의 시그널을 언퀀칭시킨다. 이로 인해, 시그널-변화 온도 범위에서는 타겟 핵산의 존재에 의존적으로 시그널이 변화한다.
일 구현예에 있어서, 타겟 핵산이 존재하는 경우, 제2 시그널-일정 온도 범위에서는 제1 프로브 및 제2 프로브 모두 타겟 핵산에 혼성화되어 있지 않다. 즉, 제1 프로브 및 제2 프로브 모두 타겟 핵산으로부터 해리되어 단일 가닥으로 존재한다. 이러한 온도 범위에서는 제1 프로브의 제1 퀀처 분자가 제1 프로브의 리포터 분자에 근접하여 리포터 분자로부터의 시그널을 퀀칭시킨다(도 2의 (iii) 또는 도 3의 (iii) 참조). 즉, 도 1의 (iii) 및 도 2 또는 도 3의 (iii)에 나타난 바와 같이, 제2 시그널-일정 온도 범위에서는 타겟 핵산의 존재 여부와 무관하게 리포터 분자가 제1 퀀처 분자에 의해 퀀칭되어 있다. 이로 인해, 제2 시그널-일정 온도 범위에서는 타겟 핵산이 존재하여도 시그널 변화 없이 시그널이 일정하다.
한편, 타겟 핵산이 증폭 중인 중간 반응 결과물(예컨대, 초기 또는 중기 사이클의 결과물)의 경우, 아직 반응에 참여하지 않은 제1 프로브 및 제2 프로브가 함께 존재할 수 있으며, 이 때, 2개의 프로브는 온도에 따라 상기 도 1의 (i) 내지 (iii)의 형태로 존재한다.
일 구현예에 있어서, 본 개시에 따른 타겟 핵산 검출용 조성물과 타겟 핵산과의 반응(예컨대, 타겟 핵산 증폭 반응) 동안 제1 프로브 및 제2 프로브의 함량은 초기 타겟 핵산 검출용 조성물에 포함된 농도로 일정하다. 타겟 핵산 검출용 조성물에 포함된 제1 프로브 및 제2 프로브는 상술한 바와 같이 타겟 핵산의 존재 여부 및/또는 온도 변화에 따라 도 1 내지 도 3의 형태로 존재할 수 있으며, 타겟 핵산과의 반응 정도(예컨대, 타겟 핵산의 증폭 정도)에 따라 도 1의 형태로 존재하는 제1 프로브 및 제2 프로브의 함량과 도2 또는 도 3의 형태로 존재하는 제1 프로브 및 제2 프로브의 함량 간의 비율이 변화한다.
도 4의 (a)는 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물을 이용한 타겟 핵산 증폭에 따른 초기 사이클, 중기 사이클 및 말기 사이클에서의 (i) 타겟 핵산의 반응 전의 제1 프로브 및/또는 제2 프로브의 총 함량비(또는 존재비 %), 및 (ii) 타겟 핵산과 반응한 제1 프로브 및/또는 제2 프로브의 총 함량비(또는 존재비 %)를 나타내며, 초기, 중기 및 말기 사이클에서의 멜트 커브(melt curve)를 나타낸 것이다. 구체적으로, 도 4의 (a)에서 (i)행의 숫자는 도 1의 (i) 내지 (iii) 형태로 존재하는 제1 프로브 및 제2 프로브의 총 함량비(또는 존재비 %)를 의미하며, 도 4의 (a)에서 (ii)행의 숫자는 도 2의 (i) 내지 (iii) 또는 도 3의 (i) 내지 (iii) 형태로 존재하는 제1 프로브 및 제2 프로브의 총 함량비(또는 존재비 %)를 의미한다.
본 개시에서 타겟 핵산과 반응한 제1 프로브 및/또는 제2 프로브를 언급하면서 사용되는 “함량비” 또는 “존재비”는 특정 온도(또는 온도 범위)에서 두 개의 프로브가 혼성화하여 형성할 수 있는 혼성화물의 함량비(또는 존재비%)를 의미하는 것으로, 예컨대, 타겟 핵산과 반응한 제1 프로브의 함량비(또는 존재비 %)는 도 2의 (i) 내지 (iii) 형태로 존재하는 제1 프로브의 총 함량비(또는 존재비 %)를 의미한다.
도 4의 (a)의 (i) 및 (ii) 행의 함량비는 사이클이 증가함에 따라, 즉, 타겟 핵산이 증폭됨에 따라 변화한다. 특히, 초기/중기/말기 사이클 각각에 대한 멜트 커브를 합치면 도 4의 (b)와 같은 그래프를 얻을 수 있다. 상기 그래프를 통해 본 개시에 따른 타겟 핵산 검출용 조성물은 타겟 핵산이 존재하여도 시그널이 일정한 2개의 온도 범위가 존재하며, 타겟 핵산이 증폭됨에 따라 시그널이 변화하는 온도 범위가 존재하는 것을 확인할 수 있다.
구체적인 구현예에 있어서, 타겟 핵산과 반응한 제1 프로브 및 제2 프로브의 함량은 타겟 핵산이 증폭됨에 따라 증가한다. 반면, 타겟 핵산이 증폭됨에 따라, 타겟 핵산과 반응하지 않은 제1 프로브 및 제2 프로브의 함량은 감소하게 된다. 즉, 이들 간의 함량 비율은 변화하고, 타겟 핵산이 증폭됨에 따라 타겟 핵산의 존재를 나타내는 시그널 역시 변화하게 된다. 이러한 함량비의 변화에 의해 시그널-변화 온도 범위에서 타겟 핵산의 존재를 나타내는 시그널 역시 변화하게 된다. 따라서, 본 개시에 따른 타겟 핵산 검출용 조성물은 타겟 핵산 존재에 의존적인 시그널을 제공할 수 있다. 한편, 타겟 핵산이 증폭됨에 따라 타겟 핵산과 반응한 제1 프로브 및/또는 제2 프로브와 타겟 핵산과 반응하지 않은 제1 프로브 및/또는 제2 프로브 간의 함량비가 변할지라도, 2개의 시그널 일정-온도 범위에서는 시그널이 변화하지 않고 일정하다.
상술한 바와 같이, 본 개시에 따른 타겟 핵산 검출용 조성물은 타겟 핵산 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위 및 상기 타겟 핵산이 존재하여도 시그널이 일정한 두 개의 시그널-일정 온도 범위를 가진다. 구체적으로, 상기 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 조성물은 상기 시그널-변화 온도 범위가 2개의 시그널-일정 온도 범위 중 제1 시그널-일정 온도 범위보다 높고, 2개의 시그널-일정 온도 범위 중 제2 시그널-일정 온도 범위보다는 낮은 특징을 갖는 InterSC 조성물이다.
일 구현예에 있어서, 상기 시그널-변화 온도 범위는 상기 제1 프로브 및 상기 제2 프로브의 Tm 값들에 의존적으로 결정된다. 따라서, 상기 시그널-변화 온도 범위 및 2개의 시그널-일정 온도 범위는 상기 제1 프로브의 Tm 값 및 제2 프로브의 Tm 값을 조절하여 제어할 수 있다.
본원에 사용된 바와 같이, “시그널-일정 온도 범위(signal-constant temperature range; SCoTR)”는 타겟 핵산 검출용 조성물이 타겟 핵산의 존재에도 불구하고 일정한 시그널을 제공하는 온도의 범위를 지칭한다. 상기 시그널-일정 온도 범위는 타겟 핵산 검출용 조성물이 반응 시간이 경과함에도 일정한 시그널을 제공하는 온도 범위이며, 이는 본원에서 타겟 핵산 검출용 조성물이 유의한 시그널을 제공하지 않는 온도 범위, 또는 타겟 핵산의 존재를 나타내는 시그널을 제공하지 않는 온도 범위로도 지칭될 수 있다.
본원에서 사용된 바와 같이, “시그널-변화 온도 범위(signal-changing temperature range; SChTR)”는 타겟 핵산 검출용 조성물이 타겟 핵산의 존재에 의존적으로 변화하는 시그널을 제공하는 온도 범위를 지칭한다. 상기 시그널-변화 온도 범위는 타겟 핵산 검출용 조성물이 반응 시간이 경과함에 따라 변화하는 시그널을 제공하는 온도 범위이며, 이는 본원에서 타겟 핵산 검출용 조성물이 유의한 시그널을 제공하는 온도 범위, 또는 타겟 핵산의 존재를 나타내는 시그널을 제공하는 온도 범위로도 지칭될 수 있다.
본원에서 “일정한 시그널”은 타겟 핵산과 타겟 핵산 검출용 조성물 간의 반응(예컨대, 타겟 핵산 증폭 반응) 동안 시그널이 실질적으로 변하지 않는 것을 의미한다. 즉, 상기 용어 “일정한 시그널”은 존재하는 타겟 핵산의 증폭에 의해 나타나는 유의한(significant) 시그널 변화를 제외한 모든 또는 어떠한 시그널 패턴을 의미한다. 특히, 상기 일정한 시그널은 비-시그널 변화(no signal change)를 의미한다. 예컨대, 증폭 반응 동안 시그널이 백그라운드 시그널의 강도 또는 타겟 핵산의 부재하의 시그널의 강도를 초과하지 않는 경우, “시그널이 일정하다”라고 표현할 수 있다. 본원에서 일정한 시그널은 변화하지 않는 시그널 또는 변화를 나타내지 않는 시그널과 상호교환적으로 사용될 수 있다.
본원에서 “시그널 변화”는 유의한 시그널 변화, 즉 시그널의 변화가 타겟 핵산의 존재를 나타내는 유의한 변화인 것을 의미한다. 예를 들어, 유의한 시그널 변화, 즉 타겟 핵산의 존재를 나타내는 시그널 변화는 백그라운드 시그널의 강도 또는 타겟 핵산의 부재하의 시그널의 강도와 비교하여 구별되는 강도를 갖는 시그널의 발생 또는 소멸을 의미하거나, 또는 상기 단계 (a)의 인큐베이션 반응 동안 타겟 핵산 및/또는 시그널이 증폭됨에 따라, 타겟 핵산의 존재를 나타내는 시그널의 강도가 실질적으로 증가 또는 실질적으로 감소하는 것을 의미한다.
일 구현예에 있어서, 상기 시그널 변화는 표지로부터 “시그널 발생 또는 소멸” 및 “시그널 증가 또는 감소”를 포함한다.
일 구현예에 있어서, 상기 시그널 변화는 타겟 핵산의 존재 여부에 의해 발생할 수 있다. 예를 들어, 시그널 변화는 타겟 핵산의 존재를 나타내는 시그널이 발생 또는 소멸함에 따라 발생할 수 있다.
일 구현예에 있어서, 상기 시그널 변화는 타겟 핵산의 증폭시에 발생할 수 있다. 즉, 시그널 변화는 타겟 핵산의 증폭시에 타겟 핵산 양이 증가함에 따라 발생할 수 있다. 예를 들어, 타겟 핵산의 증폭시, 타겟 핵산의 존재를 나타내는 시그널이 증가 또는 감소하여 시그널 변화를 유도할 수 있다.
일 구현예에 있어서, 상기 시그널 변화는 타겟 핵산에 의존적인 시그널의 증폭시에 발생할 수 있다. 즉, 타겟 핵산에 의존적인 시그널 증폭시 시그널의 강도가 변화하여 시그널을 변화시킨다. 예를 들어, 타겟 핵산 존재에 의존적인 시그널이 증폭됨에 따라, 타겟 핵산의 존재를 나타내는 시그널이 증가 또는 감소하여 시그널 변화를 유도한다.
본원에서 “시그널 변화” 및/또는 “일정한 시그널”은 동일한 타겟 핵산 검출용 조성물을 이용한 핵산 증폭 반응 동안 동일한 온도에서 검출된 시그널들을 기초로 한다. 예컨대, “시그널 변화” 및/또는 “일정한 시그널”은 n개의 타겟 핵산 검출용 조성물을 이용하여 동일한 온도에서 검출한 시그널 값들의 차이에 기초하여 사용되며, 구체적으로, “시그널 변화” 및/또는 “일정한 시그널”은 (i) 복수의 사이클에서 동일한 온도에서 검출된 시그널 값들 간의 차이 또는 (ii) 후술하는 “기준 시그널 값”과 상기 기준 시그널 값이 설정된 온도와 동일한 온도에서 검출된 시그널 값의 차이에 기초하여 “시그널의 변화” 및/또는 “일정한 시그널”이라 지칭된다. 즉, “시그널 변화” 및/또는 “일정한 시그널”은 상이한 온도에서 검출한 시그널 값들 간의 차이에 기초하여 지칭되는 것이 아니다.
본원에서, 상기 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위 및 시그널-일정 온도 범위와 관련하여 사용되는 표현 “하나의 온도 범위가 다른 하나의 온도 범위보다 낮다”는 것은 하나의 온도 범위 내의 최고 온도가 다른 하나의 온도 범위 내의 최저 온도보다 낮다는 것을 의미한다. 반대로, 표현 “하나의 온도 범위가 다른 하나의 온도 범위보다 높다”는 것은 하나의 온도 범위 내의 최저 온도가 다른 하나의 온도 범위 내의 최고 온도보다 높다는 것을 의미한다. 예컨대, 시그널-일정 온도 범위가 시그널-변화 온도 범위보다 높다는 것은 시그널-일정 온도 범위 내의 최저 온도가 시그널-변화 온도 범위 내의 최고 온도보다 높다는 것을 의미한다.
일 구현예에 있어서, 상기 타겟 핵산 검출용 조성물은 상기 타겟 핵산의 제1 영역 및 제2 영역을 포함하는 타겟 핵산 서열을 증폭할 수 있는 프라이머를 추가적으로 포함할 수 있다.
일 구현예에 있어서, 상기 타겟 핵산 검출용 조성물은 타겟 핵산을 증폭하기 위한 중합효소를 추가적으로 포함할 수 있다.
일 구현예에 있어서, 상기 중합효소는 뉴클레아제 활성(예컨대, 5’→ 3’엑소뉴클레아제 활성)이 없는 중합효소이다.
다른 구현예에 있어서, 상기 중합효소는 뉴클레아제 활성(예컨대, 5’→ 3’엑소뉴클레아제 활성)을 가지는 중합효소이다. 이러한 경우, 상기 제1 프로브 및/또는 제2 프로브는 뉴클레아제 활성에 대한 내성을 가진다.
본 개시에 따른 타겟 핵산 검출용 조성물은 시그널-변화 온도 범위 및 2개의 시그널-일정 온도 범위를 가지는 것이 특징이며, 이러한 특징으로 인해, 시그널-변화 온도 범위를 조절하여 단일 타겟 핵산의 검출뿐만 아니라 단일 유형의 표지를 이용하여 복수의 타겟 핵산 검출도 가능해진다. 그러나, 뉴클레아제 활성을 가지는 중합효소를 사용하는 경우, 제1 프로브 및/또는 제2 프로브는 상기 뉴클레아제 활성에 의해 절단될 수 있다. 이러한 프로브의 절단은 프로브에 연결된 리포터 분자, 제1 퀀처 분자 및/또는 제2 퀀처 분자의 방출을 유도하고, 리포터 분자는 제1 퀀처 분자 및/또는 제2 퀀처 분자로부터 전체 온도 범위에서 언퀀칭된다. 이로 인해, 본 개시에 따른 타겟 핵산 검출용 조성물은 시그널-일정 온도 범위 없이 전체 온도 범위에서 타겟 핵산의 존재에 의존적으로 시그널이 변화하게 된다. 따라서, 상기 타겟 핵산 검출용 조성물이 뉴클레아제 활성, 예컨대, 5’→ 3’엑소뉴클레아제 활성이 있는 중합효소를 포함하는 경우, 상기 제1 프로브 및/또는 제2 프로브는 5’→ 3’뉴클레아제 활성에 대한 내성을 가지는 것이 바람직하다.
일 구현예에 있어서, 5' → 3' 엑소뉴클레아제에 활성에 대한 내성은 5' → 3' 엑소뉴클레아제 활성에 대한 내성을 갖는 백본이 있는 뉴클레오타이드에 의하여 부여되며, 다양한 포스포로티오에이트 연결(linkage), 포스포네이트 연결, 포스포로아미데이트 연결 및 2'-카보하이드레이트 변형을 포함하고, 보다 바람직하게는 포스포로티오에이트 연결, 알킬 포스포트리에스테르 연결, 아릴 포스포트리에스테르 연결, 알킬 포스포네이트 연결, 아릴 포스포네이트 연결, 하이드로겐 포스포네이트 연결, 알킬 포스포로아미데이트 연결, 아릴 포스포로아미데이트 연결, 포스포로세레네이트 연결, 2'-O-아미노프로필 변형, 2'-O-알킬 변형, 2'-O-알릴 변형, 2'-O-부틸 변형, α-아노머릭 올리고데옥시뉴클레오타이드 및 1-(4'-티오-β-D-리보퓨라노실) 변형을 포함한다.
전술한 바와 같이, 본 개시에 따른 n개의 타겟 핵산 검출 방법은 n개의 서로 다른 타겟 핵산을 검출하기 위해, 각각의 타겟 핵산에 대응하는 n개의 서로 다른 타겟 핵산 검출용 조성물을 이용하며, 특히, 상기 n개의 타겟 핵산 검출용 조성물 중 최소 하나는 InterSC 타겟 핵산 검출용 조성물인 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물을 사용하는 방법에 관한 것이다. 예컨대, n이 2인 경우, 제1 타겟 핵산 및 제2 타겟 핵산 각각을 검출하기 위하여, 제1 타겟 핵산 검출용 조성물 및 제2 타겟 핵산 검출용 조성물을 이용하며, 2개의 타겟 핵산 검출용 조성물 중 최소 하나는 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물을 이용한다. n이 3인 경우, 제1 타겟 핵산, 제2 타겟 핵산 및 제3 타겟 핵산 각각을 검출하기 위하여, 제1 타겟 핵산 검출용 조성물, 제2 타겟 핵산 검출용 조성물 및 제3 타겟 핵산 검출용 조성물을 이용하며, 3개의 타겟 핵산 검출용 조성물 중 최소 하나는 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물을 이용한다.
구체적으로, n이 2인 경우, 제1 타겟 핵산 검출용 조성물 및 제2 타겟 핵산 검출용 조성물의 시그널 발생 방식은 하기 표 1과 같이 조합될 수 있다. n이 3인 경우, 제1 타겟 핵산 검출용 조성물 내지 제3 타겟 핵산 검출용 조성물은 표 2와 같이 조합될 수 있다. 표 1 및 표 2에서 "UnderSC", "InterSC" 및 "OverSC"는 당업계에 공지된 다양한 UnderSC, InterSC 및 OverSC 시그널 발생 방식이 각각 적용된 UnderSC, InterSC 및 OverSC 조성물을 의미하며, 특히, "InterSC"는 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 이용하는 방법과는 다른 시그널 발생 방식이 적용된 InterSC 조성물을 의미한다.
n이 2인 경우
N=2 제1 타겟 제2 타겟
1 UnderSC 본 개시에 따른 조성물
2 본 개시에 따른 조성물 본 개시에 따른 조성물
3 본 개시에 따른 조성물 InterSC
4 InterSC 본 개시에 따른 조성물
5 본 개시에 따른 조성물 OverSC
n이 3인 경우
N=3 제1 타겟 제2 타겟 제3 타겟
1 본 개시에 따른 조성물 InterSC InterSC
2 본 개시에 따른 조성물 InterSC OverSC
3 UnderSC 본 개시에 따른 조성물 InterSC
4 UnderSC 본 개시에 따른 조성물 OverSC
5 InterSC 본 개시에 따른 조성물 InterSC
6 InterSC 본 개시에 따른 조성물 OverSC
7 UnderSC InterSC 본 개시에 따른 조성물
8 InterSC InterSC 본 개시에 따른 조성물
9 본 개시에 따른 조성물 본 개시에 따른 조성물 InterSC
10 본 개시에 따른 조성물 본 개시에 따른 조성물 OverSC
11 본 개시에 따른 조성물 InterSC 본 개시에 따른 조성물
12 UnderSC 본 개시에 따른 조성물 본 개시에 따른 조성물
13 InterSC 본 개시에 따른 조성물 본 개시에 따른 조성물
14 본 개시에 따른 조성물 본 개시에 따른 조성물 본 개시에 따른 조성물
상기 UnderSC 조성물, InterSC 조성물 및 OverSC 조성물에 관한 구체적인 설명은 국제 공개 WO2022-265463을 참조하며, 이는 전체가 참조로 본원에 포함된다. UnderSC 조성물, InterSC 조성물 및 InterSC 조성물에 의해 채택될 수 있는 당업계에 공지된 대표적인 시그널 발생 방식의 예로서, 도 5에서 분자 비콘 방법(Tyagi 등, Nature Biotechnology v.14 MARCH 1996), 도 6에서 PTOCE-기반 방법(WO 2012/096523) 및 도 7에서 이중-퀀칭 방법(WO 2016/101959)에 대하여 시그널-변화 온도 범위 및 시그널-일정 온도 범위(들)를 보여주고 있다. 구체적으로, 도 5 내지 도 7의 각 도면에서, (a)는 타겟 핵산 존재 여부에 따른 타겟 핵산 검출용 조성물에 포함된 올리고뉴클레오타이드를 나타낸 것으로, (i)는 타겟 핵산이 부존재하거나 또는 타겟 핵산과의 반응 전 올리고뉴클레오타이드의 형태 및 (ii)는 타겟 핵산 검출용 조성물이 타겟 핵산과 반응한 후의 올리고뉴클레오타이드의 형태를 나타낸다. (b)는 타겟 핵산 증폭에 따른 초기, 중기 및 말기 사이클에서의 멜트 커브(melt curve)를 나타내며, (c)는 초기/중기/말기 사이클 각각에 대한 멜트 커브를 합친 그래프이다.PTOCE-기반 방법은 일반적으로 타겟 핵산의 존재에 의존적인 연장 가닥의 형성을 수반한다. 상기 용어 “PTOCE-기반 방법”은 PTO의 절단 및 연장을 통한 연장 가닥의 형성을 포함하는, 시그널을 제공하기 위한 다양한 방법들을 포괄하기 위하여 본원에서 사용된다.
PTOCE-기반 방법에 의한 시그널 발생의 특정 구현예는 다음의 단계를 포함한다:
(a) 타겟 핵산을 업스트림 올리고뉴클레오타이드 및 PTO와 혼성화시키는 단계; (b) 상기 PTO의 절단을 위한 조건하에서 5'뉴클레아제 활성을 갖는 효소에 상기 단계 (a)의 결과물을 접촉시키는 단계로서; 상기 업스트림 올리고뉴클레오타이드 또는 그의 연장 가닥은 상기 5'뉴클레아제 활성을 갖는 효소에 의한 상기 PTO의 절단을 유도하며, 상기 절단은 상기 PTO의 5'-태깅 부위 또는 5'-태깅 부위의 일부를 포함하는 단편을 방출하고; (c) 상기 PTO로부터 방출된 상기 단편과 CTO를 혼성화시키는 단계로서; 상기 PTO로부터 방출된 상기 단편은 상기 CTO의 캡처링 부위에 혼성화되고; (d) 단계 (c)의 결과물 및 주형-의존적 핵산 중합효소를 이용하여 연장 반응을 실시하는 단계로서; 상기 CTO의 상기 캡처링 부위에 혼성화된 상기 단편은 연장되어 연장 가닥을 형성하며, 그리고 (e) 상기 연장 가닥의 존재에 의존적으로 발생되는 시그널을 측정하여 상기 연장 가닥의 형성을 검출하는 단계. 상기 단계 (a)에서, 상기 업스트림 올리고뉴클레오타이드 대신에 타겟 핵산의 증폭을 위한 프라이머 세트가 사용될 수 있다. 이러한 경우, 상기 방법은 반복 사이클 사이에 변성을 포함하여 상기 단계 (a)-(e)의 모두 또는 일부를 반복하는 것을 추가적으로 포함한다.
이중 퀀칭 분석 방법에 의한 시그널 발생의 특정 구현예는 다음의 단계를 포함한다:
(a) 타겟 핵산 서열을 PTO에 혼성화시키는 단계로서; 상기 PTO는 (i)타겟 핵산 서열에 실질적으로 상보적인 뉴클레오타이드 서열을 포함하는 타겟팅 부위, (ii) 타겟 핵산 서열에 비-상보적인 뉴클레오타이드 서열을 포함하는 멜팅 온도 결정 영역(Melting Temperature Deciding Region; MTDR) 및 (iii) 최소 하나의 형광단 및 최소 하나의 퀀처를 포함하는 최소 한 세트의 상호작용 표지를 포함하며; (b) 상기 PTO와 CQO를 혼성화시키는 단계로서; 상기 CQO는 (i) 상기 PTO의 MTDR에 대해 역상보적(reverse complementary)인 뉴클레오타이드 서열을 포함하는 캡처링 부위 및 (ii) 최소 하나의 퀀칭 분자를 포함하며, 상기 MTDR은 CQO의 캡처링 부위와 혼성화하여 태그 이합체(Tag Duplex)를 형성하고; (c) 태그 이합체를 뉴클레아제 활성을 가지는 효소와 접촉시키는 단계로서; 태그 이합체가 타겟 핵산 서열에 혼성화된 경우, 상기 뉴클레아제 활성을 가지는 효소는 태그 이합체의 절단을 유도하여, CQO 캡처링 부위에 혼성화된 MTDR 및 최소 하나의 형광단을 포함하는 PTO 단편을 포함하는 활성화된 태그 이합체 단편을 방출하고; (d) 활성화된 태그 이합체 단편을 멜팅 및/또는 혼성화시켜 최소 하나의 형광단으로부터 시그널을 얻고; 및 (e) 상기 최소 하나의 형광단으로부터의 시그널을 측정하여 활성화된 태그 이합체 단편을 검출하는 단계; 상기 시그널은 타겟 핵산 서열의 존재를 나타낸다.
일 구현예에 있어서, 상기 n개의 타겟 핵산 검출용 조성물은 각각 상기 n개의 검출 온도 중 대응하는 검출 온도에서 대응하는 타겟 핵산의 존재를 나타내는 시그널의 변화를 제공한다.
예컨대, 상기 n개의 타겟 핵산 중 제i 타겟 핵산 검출용 조성물은 상기 제i 타겟 핵산의 존재하에 상기 n개의 검출 온도 중 제i 검출 온도에서 시그널 변화를 제공하고, 그 외의 검출 온도에서는 일정한 시그널을 제공한다.
일 구현예에 있어서, 상기 i는 1부터 n까지의 정수를 나타내고, 상기 제i 검출 온도는 제i+1 검출 온도보다 낮다. 일 구현예에 있어서, i가 n인 경우, i+1 검출 온도(즉, n+1 검출 온도)는 존재하지 않는다. 예컨대, n이 3인 경우, i는 1부터 3까지의 정수를 나타내고, 제1 검출 온도, 제2 검출 온도 및 제3 검출 온도가 존재하며, 제1 검출 온도는 제2 검출 온도보다 낮으며, 제2 검출 온도는 제3 검출 온도보다 낮다.
본 개시에 따르면, 상기 n개의 검출 온도를 모두 포함하는 온도 범위 내에서, 상기 제i 타겟 핵산 검출용 조성물은 제i 타겟 핵산 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위(signal-changing temperature range) 및 제i 타겟 핵산이 존재하여도 시그널이 일정한 하나 또는 두 개의 시그널-일정 온도 범위(signal-constant temperature range)를 가진다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물은, (i) 상기 시그널-변화 온도 범위가 상기 시그널-일정 온도 범위보다 낮은 특징을 갖는 UnderSC(Under-Signal-Change) 조성물, (ii) 상기 시그널-변화 온도 범위가 2개의 시그널-일정 온도 범위 중 하나의 시그널-일정 온도 범위보다 높고, 다른 하나의 시그널-일정 온도 범위보다는 낮은 특징을 갖는 InterSC(Inter-Signal-Change) 조성물, 및 (iii) 상기 시그널-변화 온도 범위가 상기 시그널-일정 온도 범위보다 높은 특징을 갖는 OverSC(Over-Signal-Change) 조성물 중 어느 하나의 조성물이다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 상기 제i 타겟 핵산이 존재하는 경우, 상기 제i 검출 온도에서 타겟 핵산의 증폭에 따라 시그널 변화(즉, 제i 시그널의 변화)를 제공하는 반면, 상기 제i 검출 온도 이외의 검출 온도에서는 타겟 핵산이 증폭되어도 시그널 변화를 제공하지 않는다(즉, 시그널이 일정하다). 즉, 상기 제i 타겟 핵산 검출용 조성물은 타겟 핵산이 증폭됨에 따라 시그널이 변화하는 시그널-변화 온도 범위 및 타겟 핵산이 증폭되어도 시그널이 일정한 시그널-일정 온도 범위를 가진다.
본원에서 사용하는 용어 “제i 시그널”은 제i 타겟 핵산 검출용 조성물이 제i 검출 온도에서 제공하는 시그널을 의미하며, “제i 검출 온도에서의 시그널”과 상호교환적으로 사용된다. 일 구현예에 있어서, n개의 타겟 핵산을 검출할 경우, 제i 시그널은 제i 타겟 핵산 검출용 조성물을 포함하는 n개의 타겟 핵산 검출용 조성물들이 제i 검출 온도에서 제공하는 시그널을 의미할 수 있다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 상기 제i 타겟 핵산이 존재하지 않을 경우, 인큐베이션 반응(예컨대, 타겟 핵산 증폭 반응) 동안 제i 검출 온도에서 시그널이 변화하지 않고 일정한 시그널을 제공한다.
일 구현예에 있어서, 상기 시그널-변화 온도 범위는 타겟 핵산의 존재 여부에 따라 시그널 값(예컨대, 시그널의 강도)의 차이가 발생하는 온도 범위이다.
일 구현예에 있어서, 상기 시그널-변화 온도 범위는 타겟 핵산의 증폭 정도(예컨대, 증폭된 타겟 핵산의 양)에 따라 시그널 값이 변화하는 온도 범위이다.
일 구현예에 있어서, 상기 시그널-일정 온도 범위는 타겟 핵산의 존재와 무관하게 시그널의 값이 변화하지 않는 온도 범위이다. 즉, 상기 시그널-일정 온도 범위는 타겟 핵산이 존재할 경우의 시그널 값과 타겟 핵산이 존재하지 않을 경우의 시그널 값의 차이가 없는 온도 범위이다.
일 구현예에 있어서, 상기 제i 검출 온도는 상기 제i 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위 내에서 선택될 수 있다. 이 경우, 본원에서 제i 타겟 핵산 검출용 조성물은 제i 검출 온도를 갖는 것으로 지칭된다. 또한 제i 타겟 핵산 검출용 조성물에 대응하는 제i 타겟 핵산은 제i 검출 온도를 가지는 타겟 핵산으로 지칭될 수 있다.
일 구현예에 따르면, 상기 대응하는 타겟 핵산 검출용 조성물에 의해 결정되는 하나의 검출 온도는 하나의 타겟 핵산에 할당된다.
구체적인 일 구현예에 있어서, n이 2인 경우, 제1 타겟 핵산 검출용 조성물은 제1 타겟 핵산의 존재하에, 제1 검출 온도에서 시그널의 변화를 제공하고, 다른 검출 온도, 즉, 제2 검출 온도에서는 일정한 시그널을 제공하며; 제2 타겟 핵산 검출용 조성물은 제2 타겟 핵산의 존재하에, 제2 검출 온도에서 시그널의 변화를 제공하고, 다른 검출 온도, 즉, 제1 검출 온도에서는 일정한 시그널을 제공한다.
다른 구체적인 구현예에 있어서, n이 3인 경우, 제1 타겟 핵산 검출용 조성물은 제1 타겟 핵산의 존재하에, 제1 검출 온도에서 시그널의 변화를 제공하고, 다른 검출 온도, 즉, 제2 검출 온도 및 제3 검출 온도에서는 일정한 시그널을 제공하며; 제2 타겟 핵산 검출용 조성물은 제2 타겟 핵산의 존재하에, 제2 검출 온도에서 시그널의 변화를 제공하고, 다른 검출 온도, 즉, 제1 검출 온도 및 제3 검출 온도에서는 일정한 시그널을 제공하며; 제3 타겟 핵산 검출용 조성물은 제3 타겟 핵산의 존재하에, 제3 검출 온도에서 시그널의 변화를 제공하고, 다른 검출 온도, 즉, 제1 검출 온도 및 제2 검출 온도에서 일정한 시그널을 제공한다.
일 구현예에 있어서, 상기 제i 검출 온도는 상기 제i 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위 내에서 선택되고, 상기 제i 검출 온도는 다른 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위에는 포함되지 않는다.
일 구현예에 있어서, 상기 타겟 핵산 검출용 조성물들 중 어느 하나의 조성물의 시그널-변화 온도 범위는 인접한 검출 온도를 가지는 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위와 중첩될 수 있으나, 인접하지 않은 검출 온도를 가지는 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위와는 서로 중첩하지 않는다. 이러한 경우, 다른 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위와 중첩되는 시그널-변화 온도 범위를 가지는 타겟 핵산 검출용 조성물의 검출 온도는 시그널-변화 온도 범위 중에서도 다른 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위와 중첩하지 않는 온도 범위에서 선택된다. 이렇게 서로 시그널-변화 온도 범위가 중첩하지 않는 온도 범위에서 검출 온도를 선택함으로써, 하나의 검출 온도에서 하나의 특정 타겟 핵산의 존재를 나타내는 시그널만을 제공할 수 있다 (참조 도 8).
일 구현예에 있어서, 상기 타겟 핵산 검출용 조성물들 중 어느 하나의 조성물의 시그널-변화 온도 범위는 인접한 검출 온도를 가지는 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위와 중첩할 수는 있으나, 두 개의 시그널-변화 온도 범위 중 어느 하나가 다른 시그널-변화 온도 범위에 완전히 포함되지는 않는다.
용어 “인접한 검출 온도”는 n개의 검출 온도 중 연속된 검출 온도를 지칭하기 위해 사용되며, 예컨대, 제i 검출 온도의 인접한 검출 온도는 제i-1 검출 온도 또는 제i+1 검출 온도이다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위는 인접한 검출 온도를 가지는 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위와 부분적으로 중첩될 수 있으나, 인접하지 않은 검출 온도를 가지는 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위와 중첩하지 않는다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 제i 타겟 핵산의 존재에 의존적으로 시그널을 제공하는 표지를 포함한다.
일 구현예에 있어서, 상기 표지는 올리고뉴클레오타이드에 연결되어 있거나 자유로운 형태(free form)로 존재할 수 있다. 또는 상기 인큐베이션(예컨대, 핵산 증폭 반응) 동안 올리고뉴클레오타이드에 삽입될 수 있다. 즉, 타겟 핵산 검출용 조성물이 처음부터 표지가 연결된 올리고뉴클레오타이드를 포함하고 있거나, 또는 인큐베이션 반응 동안 새로 생성되는 올리고뉴클레오타이드(예컨대, 연장 가닥)에 상기 표지가 삽입되어 표지가 연결된 올리고뉴클레오타이드를 제공할 수 있다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 인큐베이션 동안 올리고뉴클레오타이드에 삽입되어 제i 타겟 핵산의 존재에 의존적으로 시그널을 제공하는 삽입 표지(incorporating label)를 포함한다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 제i 타겟 핵산의 존재에 의존적으로 시그널을 제공하는 역할을 하는, 표지가 연결된 올리고뉴클레오타이드를 제공한다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 제i 타겟 핵산의 존재에 의존적으로 시그널을 제공하는 역할을 하는, 표지가 연결된 올리고뉴클레오타이드를 처음부터 포함하고 있다. 상기 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브가 본원에서 표지가 연결된 올리고뉴클레오타이드의 일 예에 해당한다.
택일적으로, 상기 제i 타겟 핵산 검출용 조성물이 타겟 핵산의 존재에 의존적으로 시그널을 제공하는 표지 및 올리고뉴클레오타이드를 포함하고, 상기 표지는 인큐베이션 반응(예컨대, 핵산 증폭 반응) 동안 올리고뉴클레오타이드에 삽입되어, 타겟 핵산의 존재에 의존적으로 시그널을 제공하는 역할을 하는, 표지가 연결된 올리고뉴클레오타이드를 제공할 수 있다.
본 명세서에서 사용되는 용어 “표지가 연결된 올리고뉴클레오타이드”는 검출되는 시그널의 발생에 관여하는 올리고뉴클레오타이드이다.
일 구현예에 있어서, 상기 표지가 연결된 올리고뉴클레오타이드는 타겟 핵산에 특이적으로 혼성화되는 올리고뉴클레오타이드(예컨대, 프로브 또는 프라이머)를 포함할 수 있으며; 타겟 핵산에 혼성화된 프로브 또는 프라이머가 절단되어 단편을 방출하는 경우, 상기 표지가 연결된 올리고뉴클레오타이드는 상기 단편에 특이적으로 혼성화되는 캡처 올리고뉴클레오타이드(capture oligonucleotide)를 포함할 수 있으며; 상기 캡처 올리고뉴클레오타이드에 혼성화된 단편이 연장되어 연장 가닥을 형성하는 경우, 상기 표지가 연결된 올리고뉴클레오타이드는 상기 연장 가닥에 특이적으로 혼성화되는 올리고뉴클레오타이드, 상기 단편이 연장되는 동안 표지가 삽입되어 생성된 올리고뉴클레오타이드, 상기 캡처 올리고뉴클레오타이드에 특이적으로 혼성화되는 올리고뉴클레오타이드, 및 이들의 조합을 포함할 수 있다.
일 구현예에 따르면, 상기 표지가 연결된 올리고뉴클레오타이드는 실제 시그널 발생에 관여하는 올리고뉴클레오타이드를 포함한다. 예를 들어, 표지가 연결된 올리고뉴클레오타이드와 다른 올리고뉴클레오타이드(예컨대, 표지가 연결된 올리고뉴클레오타이드 또는 타겟 핵산에 상보적인 뉴클레오타이드 서열을 포함하는 올리고뉴클레오타이드)의 혼성화 또는 비-혼성화가 시그널 발생을 결정한다.
일 구현예에 있어서, 상기 표지가 연결된 올리고뉴클레오타이드는 당업계에 공지된 '프로브'일 수 있다. 일 구현예에 따르면, 프로브의 3'-말단은 "블록킹"되어 그의 연장이 방지된다. 블록킹은 종래 방법에 따라 달성될 수 있다. 예를 들면, 블록킹은 마지막 뉴클레오타이드의 3'-히드록실기에 바이오틴, 표지, 포스페이트기, 알킬기, 비-뉴클레오타이드 링커, 포스포로티오에이트 또는 알칸-디올 잔기와 같은 화학적 모이어티(moiety)를 추가하여 실시할 수 있다. 택일적으로, 블록킹은 마지막 뉴클레오타이드의 3'-히드록실기를 제거하거나 또는 다이디옥시뉴클레오타이드와 같이 3'-히드록실기가 없는 뉴클레오타이드를 이용하여 실시할 수 있다.
일 구현예에 따르면, 상기 표지가 연결된 올리고뉴클레오타이드는 최소 하나의 올리고뉴클레오타이드로 구성될 수 있다. 일 구현예에 따르면, 상기 표지가 연결된 올리고뉴클레오타이드가 복수의 올리고뉴클레오타이드로 구성된 경우, 상기 표지가 연결된 올리고뉴클레오타이드는 다양한 방식으로 표지를 가질 수 있다. 예를 들어, 복수의 올리고뉴클레오타이드 중 모두 또는 일부가 최소 하나의 표지를 가질 수 있다.
일 구현예에 있어서, 상기 표지는 단일 표지 또는 리포터 분자 및 퀀처 분자를 포함하는 상호작용적 표지일 수 있다.
예를 들어, 상기 단일 표지는 형광 표지, 발광 표지, 화학발광 표지, 전기화학 표지 및 금속 표지를 포함한다. 일 구현예에 있어서, 상기 단일 표지는 이중 가닥에 존재하는지 또는 단일 가닥에 존재하는지에 따라 상이한 시그널(예컨대, 상이한 시그널 강도)을 제공한다. 일 구현예에 있어서, 상기 단일 표지는 형광 표지이다. 본 개시에서 사용되는 단일 형광 표지의 바람직한 종류 및 결합 사이트는 미국 특허 제7,537,886호 및 제7,348,141호에 개시되어 있으며, 그의 교시 사항은 그 전체로서 본 명세서에 참조로 포함된다. 예를 들어, 상기 단일 형광 표지는 JOE, FAM, TAMRA, ROX 및 플루오레세인-기반 표지를 포함한다. 상기 단일 표지는 다양한 방법에 의해 올리고뉴클레오타이드에 연결될 수 있다. 예를 들어, 상기 표지는 탄소 원자를 포함하는 스페이서(예컨대, 3-카본 스페이서, 6-카본 스페이서 또는 12-카본 스페이서)를 통해 프로브에 연결된다.
일 구현예에 있어서, 상기 상호작용적 표지는 최소 하나의 리포터 분자 및 최소 하나의 퀀처 분자를 포함하는 상호작용적 표지일 수 있다. 구체적으로, 상기 상호작용적 표지는 하나의 리포터 분자 및 하나의 퀀처 분자를 포함하는 상호작용적 이중 표지일 수 있다. 또는 상기 상호작용적 표지는 하나의 리포터 분자 및 2개의 퀀처 분자를 포함하는 상호작용적 표지일 수 있다.
상호작용적 표지의 상세한 설명과 예는 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 타겟 핵산 검출용 조성물에 적용 가능한 상호작용적 표지에 대해 설명하는 섹션을 참조한다.
일 구현예에 있어서, 상기 표지가 단일 표지인 경우, 상기 단일 표지는 하나의 올리고뉴클레오타이드에 연결될 수 있다.
일 구현예에 있어서, 상기 표지가 상호작용 표지일 경우, 상기 상호작용 표지는 최소 하나의 리포터 분자 및 최소 하나의 퀀처 분자를 포함하는 상호작용 표지일 수 있으며, 상기 상호작용 표지는 하나의 올리고뉴클레오타이드에 모두 연결되거나, 또는 복수의 올리고뉴클레오타이드에 각각 연결될 수 있다.
일 구현예에 있어서, 삽입 표지는 프라이머 연장 동안 표지를 삽입하여 시그널을 발생시키는 과정에서 사용될 수 있다(예컨대, Plexor 방법, Sherrill C B, 등, Journal of the American Chemical Society, 126:4550-45569 (2004)). 또한, 상기 삽입 표지는 타겟 핵산 서열에 혼성화된 매개 올리고뉴클레오타이드의 절단에 의존적인 방식으로 형성된 이합체에 의한 시그널 발생에서도 사용될 수 있다.
일 구현예에 있어서, 상기 삽입 표지는 일반적으로 뉴클레오타이드에 연결될 수 있다. 또한, 비-자연 염기를 갖는 뉴클레오타이드가 이용될 수도 있다
본 명세서에서 사용되는 용어 “비-자연 염기(non-natural base)”는 아데닌(A), 구아닌(G), 티민(T), 시토신(C) 및 우라실(U)과 같은 자연 염기의 유도체를 의미하며, 이들은 수소-결합 염기 쌍을 형성할 수 있다. 본 명세서에서 사용되는 용어 “비-자연 염기”는 모화합물(mother compound)로서 자연 염기와 상이한 염기 쌍 패턴을 갖는 염기를 포함하며, 예컨대, 미국 특허 제5,432,272호, 제5,965,364호, 제6,001,983호 및 제6,037,120호에 기재되어 있다. 비-자연 염기들 간의 염기 쌍은 자연 염기와 같이 2개 또는 3개의 수소결합을 포함한다. 또한, 비-자연 염기들 간의 염기 쌍은 특정한 방식으로도 형성된다. 비-자연 염기의 특정한 예는 염기 쌍 조합에서 다음과 같은 염기들을 포함한다: iso-C/iso-G, iso-dC/iso-dG, Z/P, V/J, K/X, H/J, Pa/Ds, Pa/Q, Pn/Ds, Pn/Dss, Px/Ds, NaM/5SICS, 5FM/5SICS, 및 M/N (참조 U.S. Pat. Nos. 5,432,272; 5,965,364; 6,001,983; 6,037,120; 6,140,496; 6,627,456; 6,617,106; 및 7,422,850; 및 Filip Wojciechowski 등, Chem. Soc. Rev., 2011, 40, 5669-5679).
종래 복수의 타겟 핵산 검출 방법들은 상이한 타겟 핵산에 대한 상이한 종류의 형광 표지의 사용을 필요로 하거나, 또는 한 종류의 형광 표지를 이용하더라도, 멜팅 커브 분석 등과 같이 추가의 분석이 필요하다는 단점이 있다. 이에 반해, 본 개시에 따른 방법은 이합체를 제공하는 타겟 핵산 검출용 조성물을 이용함으로써, 단일 유형의 표지(예컨대, 하나의 형광 표지)를 이용하면서도, 멜팅 분석과 같은 추가적인 분석 없이도, 복수의 타겟 핵산을 실시간으로 검출할 수 있다.
일 구현예에 있어서, 상기 n개의 타겟 핵산 검출용 조성물 각각은 하나 이상의 이합체를 제공한다.
본 명세서에서 사용된 용어 “이합체(duplex)”는 두 개의 단일-가닥 핵산 분자가 부분적 또는 전체적으로 서로 상보적인 서열을 포함하고 있어 혼성화 조건하에서 서로 혼성화되어 형성된 이중-가닥 핵산 분자를 의미한다. 이합체를 형성하는 두 개의 단일-가닥은 온도(특히, 검출 온도)에 따라 결합된 형태(즉, 이중-가닥 형태)로 존재하거나 또는 해리된 형태(즉, 두 개의 단일-가닥 형태)로 존재할 수 있다. 이러한 관점에서, “타겟 핵산 검출용 조성물이 이합체를 제공한다”는 표현과 관련하여 용어“이합체”는 결합된 형태의 이합체(duplex in associated form) 및 해리된 형태의 이합체(duplex in dissociated form)를 포괄하는 의미로 사용될 수 있다.
일 구현예에 있어서, 상기 이합체는 “혼성화물(hybrid)”로 지칭될 수 있다.
용어 “결합(association) 또는 해리(dissociation)”는 용어 “혼성화 또는 변성”과 동일한 의미를 갖는다.
전술한 바와 같이, 본 명세서에서 사용되는 표현 “타겟 핵산 검출용 조성물이 이합체를 제공한다”는 것은 결합된 형태의 이합체 및/또는 해리된 형태의 이합체를 제공하는 것을 의미할 수 있다. 마찬가지로, 본 명세서에서 사용되는 표현 ”타겟 핵산 검출용 조성물이 인큐베이션 동안 이합체를 생성한다”는 것은 인큐베이션 반응 동안 결합된 형태의 이합체 및/또는 해리된 형태의 이합체를 생성하는 것을 의미할 수 있다.
일 구현예에 있어서, 상기 타겟 핵산 검출용 조성물이 제공하는 이합체 중 최소 하나는 시그널을 제공하는 이합체이다. 특히, 상기 이합체는 시그널 변화를 제공하는 이합체이다. 즉, 제i 타겟 핵산 검출용 조성물은 시그널을 제공하는 이합체를 제공하며, 구체적으로, 상기 제i 타겟 핵산 검출용 조성물은 제i 타겟 핵산의 존재에 의존적으로 시그널 변화를 제공하는 이합체를 제공한다.
본 명세서에서 사용된 용어 “시그널을 제공하는 이합체”는 상기 이합체가 결합된 상태 또는 해리된 상태인지 여부에 따라 구별될 수 있는 시그널을 제공할 수 있는 이합체를 의미한다. 예컨대, 이는 결합된 형태의 이합체는 시그널을 발생(또는 소멸) 시키고, 해리된 형태의 이합체는 시그널을 소멸(또는 발생)시키는 것을 의미한다.
일 구현예에 있어서, 상기 시그널을 제공하는 이합체는 최소 하나의 표지를 포함할 수 있다.
본 명세서에서 사용된 용어 “시그널 변화를 제공하는 이합체”는 상기 타겟 핵산 존재에 의존적으로 함량이 변화하여, 타겟 핵산 존재를 나타내는 시그널 변화를 제공하는 이합체를 의미한다. 구체적으로, 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물에서, 제1 프로브 및/또는 제2 프로브와 타겟 핵산 간의 혼성화물이 본원에서 설명하는 시그널의 변화를 제공하는 이합체의 일 예에 해당한다.
일 구현예에 있어서, 상기 시그널 변화를 제공하는 이합체는 표지를 포함한다. 구체적으로, 상기 이합체를 구성하는 2개의 단일 가닥 중 최소 한 가닥에 최소 하나의 표지가 연결되어 있다. 예컨대, 상기 시그널 변화를 제공하는 이합체는 단일 표지를 포함하고, 이러한 경우, 상기 단일 표지는 상기 이합체를 구성하는 2개의 단일 가닥 중 어느 하나의 가닥에 연결되어 있다. 또 다른 예로, 상기 시그널 변화를 제공하는 이합체에는 상호작용 표지를 포함하며, 이러한 경우, 상기 상호작용 표지는 상기 시그널 변화를 제공하는 이합체를 구성하는 두 개의 가닥 중 어느 한 가닥에 모두 연결되어 있거나, 또는 상호작용 표지 중 하나는 두 개의 단일 가닥 중 어느 한 가닥에 연결되고 상호작용 표지 중 다른 하나는 두 개의 단일 가닥 중 나머지 가닥에 연결되어 있다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 시그널 변화를 제공하는 이합체를 제공한다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 상기 시그널 변화를 제공하는 이합체가 결합된 형태로 존재할 경우, 상기 표지로부터 시그널을 제공한다. 즉, 상기 제i 타겟 핵산 검출용 조성물은 이합체를 구성하는 2개의 단일-가닥 핵산 분자의 결합에 의존적으로 시그널을 제공한다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 상기 시그널 변화를 제공하는 이합체가 해리된 형태로 존재할 경우, 상기 표지로부터 시그널을 제공한다. 즉, 상기 제i 타겟 핵산 검출용 조성물은 이합체를 구성하는 2개의 단일-가닥 핵산 분자의 해리에 의존적으로 시그널을 제공한다.
일 구현예에 있어서, 상기 이합체의 결합 및 해리는 온도에 의해 발생할 수 있다.
일 구현예에 있어서, 상기 시그널 변화를 제공하는 이합체는 처음부터 (원래부터) 타겟 핵산 검출용 조성물에 포함되어 있는 이합체일 수 있다.
일 구현예에 있어서, 상기 시그널 변화를 제공하는 이합체가 타겟 핵산 검출용 조성물에 포함되어 있는 경우, 상기 이합체는 표지가 연결된 올리고뉴클레오타이드 및 상기 표지가 연결된 올리고뉴클레오타이드와 혼성화할 수 있는 올리고뉴클레오타이드 간의 혼성화에 의해 생성될 수 있다. 당업계에 공지된 인양(Yin-Yang) 프로브로 알려진 이중-가닥 핵산 혼성화 프로브(double-stranded nucleic acid hybridization probe; 미국 특허 제7,799,522호)는 처음부터 타겟 핵산 검출용 조성물에 포함되어 있는 시그널 변화를 제공하는 이합체의 일 예에 해당한다.
일 구현예에 있어서, 상기 시그널 변화를 제공하는 이합체가 타겟 핵산 검출용 조성물에 처음부터 포함되어 있는 경우, 상기 시그널 변화를 제공하는 이합체의 함량은 타겟 핵산 존재에 의존적으로 변화하여, 구체적으로 함량이 감소하여, 시그널 변화를 제공한다. 예컨대, 타겟 핵산 검출용 조성물에 처음부터 포함되어 있는 이중-가닥 핵산 혼성화 프로브(즉, 시그널 변화를 제공하는 이합체)는 타겟 핵산이 증폭됨에 따라 인양 프로브를 구성하는 2개의 단일 가닥 중 어느 하나가 증폭된 타겟 핵산과 쌍을 이루어 새로운 이합체를 생성하고, 이중-가닥 핵산 혼성화 프로브의 함량은 감소하게 되며, 이로 인해, 타겟 핵산 존재에 의존적으로 시그널 변화를 제공한다.
일 구현예에 있어서, 상기 시그널의 변화를 제공하는 이합체는 상기 타겟 핵산 검출용 조성물에 의해 인큐베이션 반응 동안 새롭게 제공되는 이합체일 수 있다.
일 구현예에 있어서, 상기 인큐베이션 반응 동안 생성되는 상기 시그널 변화를 제공하는 이합체는 표지가 연결된 올리고뉴클레오타이드 및 상기 타겟 핵산 간의 혼성화에 의해 제공될 수 있다.
표지가 연결된 올리고뉴클레오타이드 및 타겟 핵산 간의 이합체 형성에 의한 시그널은 스콜피온 방법(Whitcombe 등, Nature Biotechnology 17:804-807(1999)), 선라이즈(또는 Amplifluor) 방법(Nazarenko 등, Nucleic Acids Research, 25(12):2516-2521(1997), 및 미국 특허 제6,117,635호), 럭스 방법(미국 특허 제7,537,886호), 플렉서(Plexor) 방법(Sherrill CB, 등, Journal of the American Chemical Society, 126:4550-4556(2004)), 분자 비콘 방법(Tyagi 등, Nature Biotechnology v.14 MARCH 1996), Hybeacon 방법(French DJ 등, Mol. Cell Probes, 15(6):363-374(2001)), 인접한 혼성화 프로브 방법(Bernard P.S. 등, Anal. Biochem., 273:221(1999)) 및 LNA 방법 (미국 특허 제6,977,295호)을 포함하는 다양한 방법에 의해 발생될 수 있다.
일 구현예에 있어서, 상기 인큐베이션 반응 동안 생성되는 상기 시그널 변화를 제공하는 이합체는 타겟 핵산의 존재에 의존적인 절단 반응에 의해서 형성된 이합체일 수 있다. 상술한 PTOCE-기반 방법에서, 타겟 핵산 존재에 의존적으로 생성되는 표지를 포함하는 연장이합체가 타겟 핵산의 존재에 의존적인 절단 반응에 의해서 형성된 이합체의 일 예에 해당한다(도 6의 (a)의 (ii)참조). 상기 반응을 위해, 5'-뉴클레아제 및 3'-뉴클레아제, 특히 5'-뉴클레아제 활성을 갖는 핵산 중합효소, 3'-뉴클레아제 활성을 갖는 핵산 중합효소 또는 FEN 뉴클레아제가 사용될 수 있다.
일 구현예에 있어서, 상기 시그널 변화는 타겟 핵산에 특이적으로 혼성화된 매개 올리고뉴클레오타이드의 절단에 의존적인 방식으로 형성된 이합체에 의해 발생된다.
본 명세서에서 사용되는 용어 “매개 올리고뉴클레오타이드(mediation oligonucleotide)”는 타겟 핵산을 포함하지 않는 이합체의 생성을 매개하는 올리고뉴클레오타이드이다.
일 구현예에 있어서, 상기 매개 올리고뉴클레오타이드의 절단 자체로는 시그널이 발생하지 않고, 매개 올리고뉴클레오타이드의 혼성화 및 절단 후에 상기 절단에 의해 형성된 단편(절단 산물)이 시그널 발생을 위한 연속적인 반응에 관여한다.
일 구현예에 있어서, 상기 매개 올리고뉴클레오타이드의 혼성화 또는 절단 자체로는 시그널이 발생하지 않는다.
일 구현예에 있어서, 상기 매개 올리고뉴클레오타이드는 타겟 핵산 서열에 혼성화되고 절단되어 단편을 방출함으로써 이합체의 생성을 매개하는 올리고뉴클레오타이드를 포함한다.
일 구현예에 있어서, 상기 단편은 캡처 올리고뉴클레오타이드 상에서 상기 단편의 연장에 의한 이합체의 생성을 매개한다.
일 구현예에 따르면, 상기 매개 올리고뉴클레오타이드는 (i) 타겟 핵산 서열에 상보적인 혼성화 뉴클레오타이드 서열을 포함하는 타겟팅 부위 및 (ii) 타겟 핵산 서열에 비-상보적인 뉴클레오타이드 서열을 포함하는 태깅 부위를 포함한다.
일 구현예에 있어서, 상기 타겟 핵산 검출용 조성물은 상기 타겟 핵산에 혼성화하는 태깅 올리고뉴클레오타이드를 포함하고, 상기 타겟 핵산의 존재에 의존적인 절단 반응은 상기 태깅 올리고뉴클레오타이드의 절단을 포함할 수 있다. 상기 태깅 올리고뉴클레오타이드는 전술한 매개 올리고뉴클레오타이드의 일 예에 해당한다.
일 구현예에 따르면, 상기 매개 올리고뉴클레오타이드의 절단은 단편을 방출하며, 상기 단편은 캡처 올리고뉴클레오타이드에 특이적으로 혼성화되고 상기 캡처 올리고뉴클레오타이드 상에서 연장된다. 상기 캡처 올리고뉴클레오타이드가 표지를 포함하고 있는 경우, 상기 캡처 올리고뉴클레오타이드는 본원에서 표지가 연결된 올리고뉴클레오타이드의 일 예에 해당한다.
일 구현예에 따르면, 타겟 핵산 서열에 혼성화된 매개 올리고뉴클레오타이드는 절단되어 단편을 방출하고, 상기 단편은 캡처 올리고뉴클레오타이드에 특이적으로 혼성화되며, 상기 단편은 연장되어 연장 가닥을 형성하고, 이는 상기 연장 가닥 및 캡처 올리고뉴클레오타이드 간의 연장이합체의 형성을 야기하여 타겟 핵산의 존재를 나타내는 시그널을 제공한다.
일 구현예에 따르면, 상기 연장 가닥에 상보적인 혼성화 뉴클레오타이드 서열을 포함하는 제3 올리고뉴클레오타이드가 추가적으로 사용될 수 있다. 이러한 경우, 상기 제3 올리고뉴클레오타이드 및 연장 가닥의 혼성화는 다른 유형의 이합체를 형성하여 타겟 핵산의 존재를 나타내는 시그널을 제공한다(예컨대, PCE-SH). 이 때, 상기 다른 유형의 이합체가 시그널 변화를 제공하는 이합체이다.
상기 매개 올리고뉴클레오타이드의 절단에 의존적인 방식으로 형성된 이합체에 의한 시그널은 PTOCE(PTO cleavage and extension) 방법(WO 2012/096523), PCE-SH(PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization) 방법(WO 2013/115442) 및 PCE-NH(PTO Cleavage and Extension-Dependent Non-Hybridization) 방법(WO 2014/104818)을 포함하는 다양한 방법에 의해 발생될 수 있다.
상술한 참조문헌에 개시된 용어와 관련하여, 올리고뉴클레오타이드의 상응하는 예는 다음과 같다: 매개 올리고뉴클레오타이드는 프로빙 앤드 태깅 올리고뉴클레오타이드(Probing and Tagging Oligonucleotide; PTO)에 상응하고, 캡처 올리고뉴클레오타이드는 캡처링 앤드 템플레이팅 올리고뉴클레오타이드(Capturing and Templating Oligonucleotide; CTO)에 상응하며, 제3 올리고뉴클레오타이드는 시그널링 올리고뉴클레오타이드(Signaling Oligonucleotide; SO) 또는 혼성화 올리고뉴클레오타이드(Hybridization Oligonucleotide; HO)에 상응한다. SO, HO, CTO, 연장 가닥 또는 이들의 조합은 표지가 연결된 올리고뉴클레오타이드로서 역할을 할 수 있다.
일 구현예에 있어서, 상기 시그널 변화를 제공하는 이합체는 단일-유형 이합체 또는 복수-유형 이합체일 수 있다. 구체적으로, 상기 시그널 변화를 제공하는 이합체가 단일-유형 이합체인 경우, 상기 이합체의 수는 1개일 수 있으며, 상기 시그널 변화를 제공하는 이합체가 복수-유형 이합체인 경우, 상기 이합체의 수는 2개, 3개, 4개, 5개, 6개, 7개, 8개, 9개, 10개, 15개 또는 20개일 수 있으며, 보다 구체적으로, 2개, 3개 또는 4개일 수 있으며, 보다 더 구체적으로 2개 또는 3개일 수 있다.
일 구현예에 있어서, 상기 단일-유형 이합체 또는 복수 유형 이합체 중 어느 하나의 이합체는 표지를 포함한다.
일 구현예에 있어서, 상기 시그널 변화를 제공하는 이합체가 단일-유형 이합체인 경우, 상기 단일-유형 이합체의 함량은 타겟 핵산의 존재에 의존적으로 변화하고, 이에 의해 시그널을 변화시킨다.
일 구현예에 있어서, 상기 이합체가 복수-유형 이합체인 경우, 상기 복수-유형 이합체들 간의 함량 비율이 타겟 핵산의 존재에 의존적으로 변화하고, 이에 의해 시그널을 변화시킨다. 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물에서, 제1 프로브와 타겟 핵산 간의 혼성화물 및 제2 프로브와 타겟 핵산 간의 혼성화물이 복수-유형 이합체의 일 예에 해당한다.
일 구현예에 있어서, 상기 복수-유형 이합체들의 Tm 값은 서로 상이하다. 예컨대, 상기 이합체들 간의 Tm 값은 서로 최소 2℃, 3℃, 4℃, 5℃, 7℃, 8℃, 9℃, 10℃, 11℃, 12℃, 13℃, 14℃, 15℃ 또는 20℃ 상이하다.
일 구현예에 있어서, 상기 이합체의 함량은 상기 이합체를 구성하는 두 개의 핵산 가닥이 해리된 상태의 이합체(즉, 해리된 형태의 이합체)의 양과 상기 두 개의 핵산 가닥이 혼성화된 상태(즉, 결합된 형태의 이합체)의 이합체의 양의 합을 의미하는 것이다.
일 구현예에 있어서, 상기 복수-유형 이합체 중 최소 2개는 동일한 단일-가닥을 포함한다. 이러한 경우, 상기 동일한 단일-가닥은 타겟 핵산 검출용 조성물에 처음부터 포함되어 있는 첫 번째 이합체에 포함되어 있고, 인큐베이션 반응 동안 상기 동일한 단일-가닥을 포함하는 새로운 두 번째 이합체가 생성된다. 이러한 경우, 상기 첫 번째 이합체에 포함되어 있던 동일한 단일-가닥은 인큐베이션 반응 동안 두번째 이합체를 생성하며 소모된 것으로 간주될 수 있으며, 이로 인해, 상기 동일한 단일-가닥을 포함하는 첫 번째 이합체의 함량은 감소하고, 상기 동일한 단일-가닥을 포함하는 두번째 이합체의 함량은 증가한 것으로 간주할 수 있다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위는 상기 시그널 변화를 제공하는 이합체의 길이 및/또는 서열에 의존적으로 결정될 수 있다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물이 단일-유형 이합체를 제공하는 경우, 상기 타겟 핵산 검출용 조성물은 하나의 시그널-변화 온도 범위 및 하나의 시그널-일정 온도 범위를 가질 수 있다. 상기 시그널-변화 범위 및 시그널-일정 온도 범위는 상기 단일-유형 이합체의 길이 및/또는 서열에 의존적으로 결정될 수 있다.
일 구현예에 있어서, 상기 제i 타겟 핵산 검출용 조성물이 복수-유형 이합체, 구체적으로, 2개 유형의 이합체를 제공하는 경우, 상기 타겟 핵산 검출용 조성물은 하나의 시그널-변화 온도 범위 및 2개의 시그널-일정 온도 범위를 가질 수 있다. 상기 시그널-변화 범위 및 시그널-일정 온도 범위는 상기 2개 유형의 이합체의 길이 및/또는 서열에 의존적으로 결정될 수 있다.
일 구현예에 있어서, 상기 n개의 타겟 핵산 검출용 조성물 중 어느 하나는 대응하는 타겟 핵산을 증폭시키는 역할을 하는 증폭 올리고뉴클레오타이드를 포함할 수 있다. 일 구현예에 있어서, 상기 증폭 올리고뉴클레오타이드는 상기 표지가 연결된 올리고뉴클레오타이드와 동일할 수 있다.
본원에서, “증폭 올리고뉴클레오타이드”는 타겟 핵산을 증폭시키는 역할을 하는 올리고뉴클레오타이드를 총칭한다.
일 구현예에 있어서, 상기 증폭 올리고뉴클레오타이드는 당업계에 공지된 '프라이머'일 수 있다. 명세서에서 사용되는 용어 '프라이머'는 타겟 핵산 가닥(주형)에 상보적인 프라이머 연장 산물의 합성이 유도되는 조건 하에, 즉, 뉴클레오타이드와 DNA 중합효소와 같은 중합제의 존재시에, 그리고 적합한 온도와 pH에서, 합성의 개시점으로 작용할 수 있는 올리고뉴클레오타이드를 가리킨다. 프라이머는, 중합제의 존재 하에서 연장 산물의 합성을 프라이밍시킬 수 있을 정도로 충분히 길어야 한다. 프라이머의 적합한 길이는 다수의 요소, 예컨대, 온도, 응용분야 및 프라이머의 소스(source)에 따라 결정된다.
상기 프라이머는 정방향 프라이머(업스트림 프라이머 또는 업스트림 올리고뉴클레오타이드로도 지칭됨), 역방향 프라이머(다운스트림 프라이머 또는 다운스트림 올리고뉴클레오타이드로도 지칭됨) 또는 둘 모두를 포함할 수 있다. 상기 증폭 올리고뉴클레오타이드는 당업계에 알려진 구조를 갖는 올리고뉴클레오타이드일 수 있거나, 또는 당업계에 공지된 방식으로 합성될 수 있다.
증폭 올리고뉴클레오타이드 및 표지가 연결된 올리고뉴클레오타이드가 동일하다는 것은 하나의 올리고뉴클레오타이드가 타겟 핵산을 증폭시키는 증폭 올리고뉴클레오타이드의 역할뿐만 아니라 타겟 핵산의 존재시에 시그널을 발생시키는 표지가 연결된 올리고뉴클레오타이드의 역할을 한다는 것을 의미한다. 일 예로서, 표지가 연결된 올리고뉴클레오타이드가 타겟 핵산과 혼성화하여 연장되고 시그널을 발생시킬 수 있다.
본 개시에 사용되는 타겟 핵산 검출용 조성물은 타겟 핵산의 존재 하에 모든 온도에서 시그널을 제공하는 것이 아님에 유의한다.
일 구현예에 있어서, 타겟 핵산 검출용 조성물의 시그널 발생 방식들이 동일하더라도, 상이한 서열의 올리고뉴클레오타이드를 포함하는 타겟 핵산 검출용 조성물은 서로 상이한 것으로 간주될 수 있다. 상기 상이한 타겟 핵산 검출용 조성물들은 서로 상이한 검출 온도를 가진다.
일 구현예에 있어서, 본 개시에 따른 검출 온도는 n개의 타겟 핵산 검출용 조성물 각각의 시그널-변화 온도 범위들을 고려하여 미리 결정될 수 있다.
일 구현예에 있어서, 상기 n개의 타겟 핵산 검출용 조성물 중 어느 하나의 조성물의 시그널-변화 온도 범위는 상기 이합체의 길이 및/또는 서열에 의존적으로 결정될 수 있다. 즉, 상기 이합체의 Tm 값을 조절함으로써, 시그널-변화 온도 범위를 미리 결정할 수 있다.
일 구현예에 있어서, 상기 시그널 변화가 상기 타겟 핵산에 특이적으로 혼성화되는 표지가 연결된 올리고뉴클레오타이드(예컨대, 분자 비콘)에 의해 발생되는 경우, 상기 시그널의 검출은 상기 표지가 연결된 올리고뉴클레오타이드의 Tm 값을 조절함으로써 미리 결정된 검출 온도에서 성공적으로 이루어질 수 있다.
일 구현예에 있어서, 상기 표지가 연결된 올리고뉴클레오타이드로서, 스콜피온 프라이머가 사용되는 경우, 상기 시그널의 검출은 연장 가닥에 혼성화되는 부위의 Tm 값을 조절함으로써 미리 결정된 온도에서 성공적으로 이루어진다.
일 구현예에 있어서, 상기 시그널이 상기 타겟 핵산 서열의 존재에 따라 형성된 이합체에 의해 발생되는 경우, 상기 시그널의 검출은 상기 이합체의 Tm 값을 조절함으로써 미리 결정된 온도에서 성공적으로 이루어진다. 예를 들어, 상기 시그널이 PTOCE-기반 방법에 의해 발생되는 경우, 상기 시그널의 검출은 CTO 상에서 PTO 단편의 연장에 의해 형성된 연장이합체의 Tm 값을 조절함으로써 미리 결정된 온도에서 성공적으로 이루어진다.
상기 PTOCE-기반 방법은 상기 이합체의 Tm 값 또는 상기 이합체에 의해 혼성화가 영향을 받는 제3의 혼성화물의 Tm 값을 쉽게 제어할 수 있다는 이점을 가진다.
상술한 바와 같이, 상기 검출 온도는 타겟 핵산 검출용 조성물이 제공하는 이합체에 좌우되는 시그널-변화 온도 범위를 고려하여 결정된다.
일 구현예에 있어서, n개의 타겟 핵산을 검출하기 위한 n개의 조성물 중 어느 하나의 검출 온도는 다른 조성물의 시그널-변화 온도 범위와는 중첩하지 않는 시그널-변화 온도 범위 내에서 미리 결정될 수 있다(참조 도 8).
일 구현예에 있어서, 타겟 핵산 검출용 조성물에 대해 할당된 상기 검출 온도는 서로 최소 2℃, 3℃, 4℃, 5℃, 7℃, 8℃, 9℃, 10℃, 11℃, 12℃, 15℃ 또는 20℃ 이상 상이하다.
일 구현예에 있어서, 상기 n개의 검출 온도는 45℃ 내지 97℃, 45℃ 내지 96℃, 45℃ 내지 95℃, 45℃ 내지 94℃, 45℃ 내지 93℃, 45℃ 내지 92℃, 45℃ 내지 91℃, 45℃ 내지 90℃, 46℃ 내지 97℃, 46℃ 내지 96℃, 46℃ 내지 95℃, 46℃ 내지 94℃, 46℃ 내지 93℃, 46℃ 내지 92℃, 46℃ 내지 91℃, 46℃ 내지 90℃, 47℃ 내지 97℃, 47℃ 내지 96℃, 47℃ 내지 95℃, 47℃ 내지 94℃, 47℃ 내지 93℃, 47℃ 내지 92℃, 47℃ 내지 91℃, 47℃ 내지 90℃, 48℃ 내지 97℃, 48℃ 내지 96℃, 48℃ 내지 95℃, 48℃ 내지 94℃, 48℃ 내지 93℃, 48℃ 내지 92℃, 48℃ 내지 91℃, 48℃ 내지 90℃, 49℃ 내지 97℃, 49℃ 내지 96℃, 49℃ 내지 95℃, 49℃ 내지 94℃, 49℃ 내지 93℃, 49℃ 내지 92℃, 49℃ 내지 91℃, 49℃ 내지 90℃, 50℃ 내지 97℃, 50℃ 내지 96℃, 50℃ 내지 95℃, 50℃ 내지 94℃, 50℃ 내지 93℃, 50℃ 내지 92℃, 50℃ 내지 91℃ 또는 50℃ 내지 90℃의 온도 범위로부터 선택될 수 있다.
예를 들어, 상기 검출 온도 중 최고 검출 온도(즉, 제n 검출 온도)는 70℃ 내지 97℃, 70℃ 내지 95℃, 70℃ 내지 93℃, 70℃ 내지 90℃, 73℃ 내지 97℃, 73℃ 내지 95℃, 73℃ 내지 93℃, 73℃ 내지 90℃, 75℃ 내지 97℃, 75℃ 내지 95℃, 75℃ 내지 93℃, 75℃ 내지 90℃, 78℃ 내지 97℃, 78℃ 내지 95℃, 78℃ 내지 93℃, 78℃ 내지 90℃, 80℃ 내지 97℃, 80℃ 내지 95℃, 80℃ 내지 93℃, 80℃ 내지 90℃, 83℃ 내지 97℃, 83℃ 내지 95℃, 83℃ 내지 93℃, 83℃ 내지 90℃, 85℃ 내지 97℃, 85℃ 내지 95℃, 85℃ 내지 93℃ 또는 85℃ 내지 90℃의 온도 범위로부터 선택될 수 있다.
예를 들어, 상기 n개의 검출 온도 중 최저 검출 온도(즉, 제1 검출 온도)는 45℃ 내지 70℃, 45℃ 내지 68℃, 45℃ 내지 65℃, 45℃ 내지 63℃, 45℃ 내지 60℃, 45℃ 내지 58℃, 45℃ 내지 55℃, 48℃ 내지 70℃, 48℃ 내지 68℃, 48℃ 내지 65℃, 48℃ 내지 63℃, 48℃ 내지 60℃, 48℃ 내지 58℃, 48℃ 내지 55℃, 50℃ 내지 70℃, 50℃ 내지 68℃, 50℃ 내지 65℃, 50℃ 내지 63℃, 50℃ 내지 60℃, 50℃ 내지 58℃, 50℃ 내지 55℃의 온도 범위로부터 선택될 수 있다.
예를 들어, 상기 n개의 검출 온도 중 중간 검출 온도(예컨대, 제2 검출 온도 내지 제n-1 검출 온도)는 55℃ 내지 85℃, 55℃ 내지 83℃, 55℃ 내지 80℃, 55℃ 내지 78℃, 55℃ 내지 7.5℃, 55℃ 내지 73℃, 55℃ 내지 70℃, 55℃ 내지 68℃, 55℃ 내지 65℃, 55℃ 내지 63℃, 55℃ 내지 60℃, 58℃ 내지 85℃, 5.8℃ 내지 83℃, 58℃ 내지 80℃, 58℃ 내지 78℃, 58℃ 내지 75℃, 58℃ 내지 73℃, 58℃ 내지 70℃, 58℃ 내지 68℃, 58℃ 내지 65℃, 58℃ 내지 63℃, 58℃ 내지 60℃, 60℃ 내지 85℃, 60℃ 내지 83℃, 60℃ 내지 80℃, 60℃ 내지 78℃, 60℃ 내지 75℃, 60℃ 내지 73℃, 60℃ 내지 70℃, 60℃ 내지 68℃, 60℃ 내지 65℃, 60℃ 내지 63℃, 63℃ 내지 85℃, 63℃ 내지 83℃, 63℃ 내지 80℃, 63℃ 내지 78℃, 63℃ 내지 75℃, 63℃ 내지 73℃, 63℃ 내지 70℃, 63℃ 내지 68℃, 63℃ 내지 65℃, 65℃ 내지 85℃, 65℃ 내지 83℃, 65℃ 내지 80℃, 65℃ 내지 78℃, 65℃ 내지 75℃, 65℃ 내지 73℃, 65℃ 내지 70℃, 65℃ 내지 68℃, 68℃ 내지 85℃, 68℃ 내지 83℃, 68℃ 내지 80℃, 68℃ 내지 78℃, 68℃ 내지 75℃, 68℃ 내지 73℃, 68℃ 내지 70℃, 70℃ 내지 85℃, 70℃ 내지 83℃, 70℃ 내지 80℃, 70℃ 내지 78℃, 70℃ 내지 75℃ 또는 70℃ 내지 73℃의 온도 범위로부터 선택될 수 있다.
일 구현예에 따르면, n개의 타겟 핵산은 각각 n개의 검출 온도에 할당된 다음, 상기 검출 온도에 적합한 n개의 타겟 핵산을 검출하기 위한 n개의 조성물이 제조되고, 이어 상기 단계 (a)가 실시될 수 있다.
일 구현예에서, 상기 n이 3인 경우, 상기 제1 검출 온도는 50℃ 내지 60℃의 온도 범위에서 선택되고, 상기 제2 검출 온도는 65℃ 내지 75℃의 온도 범위에서 선택되며, 상기 제3 검출 온도는 80℃ 내지 95℃의 온도 범위에서 선택될 수 있다.
단계 (a)에서, 시그널은 인큐베이션 동안 n개의 검출 온도에서 검출된다.
일 구현예에 있어서, 시그널의 검출은 각 사이클, 선택된 사이클, 또는 반응의 엔드-포인트(end-point of reaction)에서 실시될 수 있다.
일 구현예에 있어서, 상기 시그널의 검출은 최소 1개의 사이클에서 실시할 수 있다. 예컨대, 시그널은 선택된 1개의 사이클에서 n개의 검출 온도에서 검출될 수 있거나, 또는 선택된 2개의 사이클에서 각각 n개의 검출 온도에서 검출될 수 있다. 예컨대, 상기 n이 3이고, 시그널이 1 사이클 및 30 사이클에서 검출되는 경우, 시그널(즉, 제1 시그널, 제2 시그널 및 제3 시그널)은 1 사이클에서 제1 검출 온도, 제2 검출 온도 및 제3 검출 온도에서 검출되고, 시그널은 30 사이클에서 제1 검출 온도, 제2 검출 온도 및 제3 검출 온도에서 검출된다.
일 구현예에 있어서, 상기 시그널의 검출은 최소 2개의 사이클에서 실시할 수 있다.
일 구현예에 있어서, 상기 시그널 변화는 상기 최소 2개의 사이클에서 검출된 시그널을 이용하여 측정할 수 있다. 예컨대, 핵산 증폭은 PCR의 30 사이클, 40 사이클, 45 사이클 또는 50 사이클 동안 수행될 수 있고, 각 사이클마다 n개의 검출 온도에서 시그널이 측정될 수 있다. 즉, 복수의 사이클에서 각각의 검출 온도에서 검출된 시그널 값들은 각 검출 온도에서의 증폭 곡선(RFU 및 사이클로 구성된 데이터 포인트의 집합)으로 도시될 수 있다. 구체적인 예로, n이 3인 경우, 각 타겟 핵산이 존재하는 경우, 제1 검출 온도에서의 증폭 곡선, 제2 검출 온도에서의 증폭 곡선, 및 제3 검출 온도에서의 증폭 곡선을 수득할 수 있으며, 상기 증폭 곡선으로부터 시그널의 변화를 확인할 수 있다.
본 명세서에서 용어 "증폭 곡선(amplification curve)"은 타겟 분석물질(구체적으로, 타겟 핵산)의 시그널-발생 반응, 특히 증폭 반응을 통하여 얻은 곡선을 의미한다. 증폭 곡선은 증폭 반응 중 샘플에 타겟 핵산이 존재하는 경우에 수득되는 곡선 및 증폭 반응 중 샘플에 타겟 핵산이 존재하지 않은 경우에 얻은 곡선 또는 선을 포함한다.
일 구현예에 있어서, 시그널 변화 또는 일정한 시그널은 타겟 핵산의 증폭을 나타내는 지표로부터 측정할 수 있다.
본원에서 사용된 용어 "증폭을 나타내는 지표(indicator)"는 단계 (a)에서 제공된 시그널로부터 얻을 수 있는, 타겟 핵산의 증폭의 발생과 밀접한 관련이 있는 지표를 의미한다. 상기 지표는 타겟 핵산 증폭에 의존적으로 생성되는 값을 의미할 수 있다. 상기 지표는 타겟 핵산의 증폭이 증가(즉, 타겟 핵산의 양이 증가)할수록 큰 수치를 제공하는 지표, 또는 증폭이 증가할수록 작은 수치를 제공하는 지표일 수 있다. 상기 지표는 증폭을 나타내는 한 어떠한 지표일 수 있다.
일 구현예에 있어서, 상기 지표는 증폭 곡선으로부터 수득된 것을 포함할 수 있다. 상기 지표는 증폭 곡선에서 특정 사이클에서의 시그널의 값(예컨대, RFU), 각 사이클에서의 시그널의 값, 특정 사이클 간의 시그널의 값의 차이, 또는 기준 시그널 값과 특정 사이클 간의 시그널의 값의 차이를 포함할 수 있다. 일 구현예에 있어서, 상기 지표는 Ct(cycle threshold) 값, ΔRFU(예를 들어, 두 사이클의 RFU 차이 또는 기준 RFU와 특정 사이클에서의 RFU 간의 RFU 차이 등) 또는 RFU 비율(예를 들어, 두 사이클의 RFU 비율 또는 기준 RFU와 특정 사이클에서의 RFU 간의 RFU 비율 등)일 수 있으나, 이에 한정되는 것은 아니다.
일 구현예에 따르면, 증폭을 나타내는 지표는 Ct 값 또는 Cq 값이다. Ct 값 및 Cq 값의 개념은 당업계에 널리 알려져 있다.
일 구현예에 따르면, 증폭을 나타내는 지표는 증폭 반응에서 수득한 RFU 값들의 ΔRFU 또는 RFU 비율이다. 예를 들어, 상기 지표는 두 사이클의 RFU 간의 차이(빼기) 또는 비율이거나, 기준 RFU와 특정 사이클의 RFU 간의 차이(빼기) 또는 비율이다.
본 개시에 따른 방법은 타겟 핵산 검출용 조성물이 대응하는 검출 온도에서만 타겟 핵산 존재에 의존적으로 시그널 변화를 제공한다는 점을 이용한다. 일 구현예에 따르면, 본 개시에 따른 방법은 최소 2개의 사이클에서 검출 온도에서 검출된 시그널 값들을 확인하여 시그널 변화를 측정할 수 있다. 다른 구현예에 있어서, 본 개시에 따른 방법은 하나의 사이클에서 검출된 검출 온도에서의 시그널 값(즉, 단계 (a)에서 검출된 시그널 값)과 기준 시그널 값을 이용하여 시그널 변화를 측정할 수 있다.
일 구현예에 있어서, 상기 단계 (a)에서 복수의 사이클에서 시그널을 검출할 경우, 시그널을 검출하는 첫 번째 사이클과 마지막 사이클은 서로 최소 1 사이클 내지 20 사이클 분리되도록 선택될 수 있다. 구체적으로, 상기 시그널을 검출하는 첫 번째 사이클과 마지막 사이클은 서로 1 사이클, 2 사이클, 3 사이클, 4 사이클, 5 사이클, 6 사이클, 7 사이클, 8 사이클, 9 사이클, 10 사이클, 11 사이클, 12 사이클, 13 사이클, 14 사이클, 15 사이클, 16 사이클, 17 사이클, 18 사이클, 19 사이클 또는 20 사이클 분리되도록 선택될 수 있으며, 보다 구체적으로, 5 사이클, 10 사이클, 15 사이클, 20 사이클 또는 30 사이클 이상 분리되도록 선택될 수 있다.
일 구현예에 있어서, 상기 시그널의 검출은 지수기(exponential phase) 영역을 포함하는 중기 사이클(intermediate cycle) 또는 정체기(plateau) 영역을 포함하는 말기 사이클(late cycle) 중 최소 1개의 사이클에서 실시될 수 있다. 예컨대, 2개의 사이클에서 시그널을 검출할 경우, 하나는 베이스라인 영역을 포함하는 초기 사이클 중 어느 한 사이클에서 실시하고, 나머지 하나는 중기 또는 말기 사이클 중 어느 한 사이클에서 실시하거나, 또는 하나는 중기 사이클 중 어느 한 사이클에서 실시하고, 나머지 하나는 중기 또는 말기 사이클 중 어느 한 사이클에서 실시할 수 있다.
일 구현예에 있어서, 상기 초기 사이클은 최종 사이클(end cycle)을 3으로 나눈 값과 인접한 사이클까지의 사이클을 포함한다. 예컨대, 최종 사이클이 45인 경우, 45를 3으로 나누면 15이므로, 상기 초기 사이클은 1 내지 20 사이클, 1 내지 15 사이클, 1 내지 10 사이클 또는 1 내지 5 사이클로 결정될 수 있다. 상기 중기 사이클은 최종 사이클(end cycle)을 2로 나눈 값과 인접한 사이클로 결정될 수 있다. 예를 들어, 최종 사이클이 45 사이클인 경우, 45를 2로 나누면 22.5이므로, 중기 사이클은 16 내지 30 사이클. 18 내지 30 사이클, 20 내지 30 사이클, 16 내지 27 사이클, 18 내지 27 사이클, 20 내지 27 사이클, 16 내지 25 사이클, 18 내지 25 사이클 또는 20 내지 25 사이클로 결정될 수 있다. 말기 사이클은 증폭 반응의 최종 사이클(end cycle) 또는 최종 사이클과 인접한 사이클로 결정될 수 있다. 예를 들어, 최종 사이클이 45 사이클이라면 말기 사이클은 31 내지 45 사이클, 35 내지 45 사이클, 38 내지 45 사이클, 40 내지 45 사이클 또는 43 내지 45 사이클일 수 있다. 상기 초기 사이클, 중기 사이클 및 말기 사이클은 증폭 반응의 최종 사이클 수에 따라 변경될 수 있다.
일 구현예에 있어서, 상기 시그널 변화는 상기 최소 1개의 사이클에서 검출된 시그널과 “기준 시그널 값(reference signal value)”을 이용하여 측정할 수 있다. 상기 기준 시그널 값은 별도의 반응을 통해 타겟 핵산의 존재에 의존적인 시그널 변화를 확인할 수 있는 값을 지칭할 수 있다.
일 구현예에 있어서, 상기 기준 시그널 값은 대응하는 검출 온도에서 대응하는 타겟 핵산이 부존재하는 반응으로부터 얻을 수 있다. 예컨대, 기준 시그널 값은 타겟 핵산이 부존재할 경우에 “검출 온도에서의 시그널 값”일 수 있다.
일 구현예에 있어서, n개의 검출 온도에 대하여 n개의 기준 시그널 값이 존재한다.
일 구현예에 있어서, 상기 타겟 핵산(예컨대, 제i 타겟 핵산)이 존재하지 않는 경우에 검출된 “검출 온도(예컨대, 제i 검출 온도)에서의 시그널 값”은 별도의 음성 대조군 반응을 통해 얻을 수 있다.
일 구현예에 있어서, 상기 기준 시그널 값은 음성 대조군 반응을 본 개시에 따른 방법과 동시에 또는 별도로 실시하여 얻을 수 있다.
일 구현예에 있어서, 상기 기준 시그널 값은 음성 대조군 반응을 통해 얻을 수 있다. 구체적인 일 구현예에 따르면, 제i 검출 온도에서의 기준 시그널 값은 제i 타겟 핵산을 포함하지 않는 샘플(예컨대, 증류수)을 n개의 타겟 핵산 검출용 조성물과 혼합하여 핵산을 증폭하면서 제i 검출 온도에서 시그널을 검출하여 얻을 수 있다. 이때, 시그널의 검출은 어떠한 사이클에서도 실시할 수 있다. 구체적으로, 음성 대조군 반응의 초기 사이클 중 어느 한 사이클에서 검출된 시그널 값을 기준 시그널 값으로 사용하거나, 음성 대조군 반응의 말기 사이클 중 어느 한 사이클에서 검출된 시그널 값을 기준 시그널 값으로 사용할 수 있다. 보다 구체적으로, 단계 (a)에서 시그널을 검출하는 사이클과 동일한 사이클에서 검출된 시그널 값을 기준 시그널 값으로 사용할 수 있다.
일 구현예에 있어서, 상기 기준 시그널 값은 양성 대조군 반응을 통해 얻을 수 있다. 구체적인 일 구현예에 따르면, 제i 타겟 핵산을 포함하는 샘플을 제i 타겟 핵산 검출용 조성물과 혼합하여 핵산을 증폭하면서 제i 검출 온도에서 시그널을 검출하여 얻을 수 있다.
상기 양성 대조군 반응을 통해 기준 시그널 값을 얻는 경우, 시그널 값이 검출되는 사이클은 상기 양성 대조군 반응의 베이스라인 영역의 사이클일 수 있다. 상기 베이스라인 영역은 증폭 반응(예컨대, PCR)의 초기 사이클(initial cycle) 동안 시그널(예컨대, 형광 시그널)이 실질적으로 일정하게 유지되는 영역을 의미한다. 이 영역에서는 증폭 산물의 수준이 검출 가능한 정도로 충분하지 않기 때문에, 이 영역의 형광 시그널의 대부분은 반응 시료 자체의 형광 시그널 및 측정 시스템 자체의 형광 시그널을 포함하는 배경 신호(background signal)에 기인한다. 즉, 양성 대조군 반응의 베이스 라인 영역의 사이클에서 검출된 시그널 값은 타겟 핵산이 부존재하는 반응(예컨대, 음성 대조군 반응)으로부터 얻은 기준 시그널 값과 실질적으로 동일할 것이다.
일 구현예에 있어서, 상기 기준 시그널 값과 상기 단계 (a)에서 검출된 시그널 값의 차이를 통해 시그널 변화를 측정할 수 있다.
일 구현예에 있어서, 상기 기준 시그널 값은 검출기의 배경 시그널 및 민감도 또는 사용된 표지의 특성 등을 고려하여 음성 대조군 반응으로부터 미리 결정된 역치값일 수 있다. 상기 역치값을 이용하여 시그널 변화의 유의성을 결정할 수 있다. 상기 역치값은 공지된 역치값 설정 방법에 의해 결정될 수 있다. 예컨대, 역치값은 배경 신호, 민감도, 표지 특성, 검출기의 시그널 편차 또는 오차 범위 등을 고려하여 결정할 수 있다.
일 구현예에 있어서, 상기 기준 시그널 값으로 역치값을 사용하는 경우, 상기 단계 (a)에서 검출된 시그널 값이 상기 역치값과 같거나 큰 경우, 시그널이 변화한 것으로 결정할 수 있다.
일 구현예에 있어서, 상기 n개의 검출 온도 각각에서의 시그널 검출은 단일 유형의 검출기(single type of detector)를 이용하여 수행될 수 있다.
일 구현예에 있어서, 상기 단일 유형의 검출기는 하나의 검출기이다. 일 구현예에 있어서, 상기 n개의 타겟 핵산 검출용 조성물에 포함된 각각의 표지가 연결된 올리고뉴클레오타이드의 표지로부터 발생하는 시그널은 단일 유형의 검출기에 의해 각 타겟 핵산에 대해 서로 구별되지 않는다.
본 명세서에서 사용되는 단일 또는 하나의 유형의 형광 표지는 동일하거나 실질적으로 동일한 시그널 특성(예컨대, 광학적 특성, 발광 파장 및 전기적 시그널)을 갖는 형광 표지를 의미한다. 예를 들어, FAM 및 CAL Fluor 610은 상이한 유형의 시그널을 제공한다.
본원에서, 단일 또는 하나의 유형의 형광 표지는 형광 표지로부터의 시그널이 검출 채널을 사용하여 서로 구별되지 않는다는 것을 의미한다. 이러한 단일 또는 하나의 유형의 형광 표지는 형광 표지의 화학 구조에 좌우되는 것은 아니며, 따라서 2개의 형광 표지의 서로 상이한 화학 구조를 갖는 경우에도 이들이 검출 채널을 사용하여 구별되지 않으면 하나의 유형으로 고려된다.
본 개시에 따르면, 하나의 유형의 형광 표지를 공통적으로 포함하는 n개의 타겟 핵산 검출용 조성물로부터 발생하는 시그널은 하나의 검출 채널에 의해 구별되지 않는다.
본 명세서에서 사용되는 용어 “검출 채널”은 단일 유형의 형광 표지로부터의 시그널을 검출하기 위한 수단을 의미한다. 당업계에서 이용가능한 써모사이클러, 예컨대 ABI 7500(Applied Biosystems), QuantStudio(Applied Biosystems), CFX96(Bio-Rad Laboratories), Cobas z 480(Roche), LightCycler(Roche) 등은 몇 개의 상이한 유형의 형광 표지로부터의 시그널을 검출하기 위한 몇 개의 채널(예컨대, 광다이오드)을 포함하고 있으며, 상기 채널이 본원에서의 검출 채널에 해당한다.
본 개시에서 사용되는 검출 채널은 시그널을 검출할 수 있는 수단을 포함한다. 예를 들어, 검출 채널은 특정 파장의 형광 시그널을 검출할 수 있는 광다이오드일 수 있다.
일 구현예에 있어서, 상기 n개의 검출 온도 각각에서 검출된 시그널은 상기 단일 유형의 검출기에 의해 서로 구별되지 않는다.
단계 (b): 타겟 핵산의 존재의 결정
시그널의 검출 후, 상기 단계 (a)에서 검출된 시그널로부터 n개의 타겟 핵산의 존재를 결정한다.
일 구현예에 있어서, 상기 제i 검출 온도에서 검출된 시그널 변화에 의해 상기 제i 타겟 핵산의 존재를 결정한다. 예컨대, 상기 제i 검출 온도에서 검출된 시그널로부터 시그널의 변화를 측정하여 상기 제i 타겟 핵산의 존재를 결정한다.
일 구현예에 있어서, 제i 검출 온도에서 시그널의 변화가 측정되면, 제i 타겟 핵산이 존재하는 것으로 결정할 수 있다.
일 구현예에 있어서, 제i 검출 온도에서 시그널이 일정하면, 제i 타겟 핵산이 부존재하는 것으로 결정할 수 있다.
일 구현예에 있어서, 시그널 변화는 최소 2개의 사이클에서 검출된 시그널을 이용하거나, 최소 1개의 사이클에서 검출된 시그널과 “기준 시그널 값(reference signal value)”을 이용하여 측정할 수 있다.
각 검출 온도에서 검출된 시그널로부터 타겟 핵산의 존재를 결정하는 것은 단계 (a)에서 상술한 시그널 변화를 측정하는 방법, 예컨대, 증폭을 나타내는 지표를 사용하는 방법 및 당업계에 공지된 다양한 방법에 의해 수행될 수 있다.
특정 구현예에 있어서, n은 3이고, 10 사이클, 20 사이클 및 30 사이클에서 시그널의 검출을 실시하는 경우, 제1 검출 온도에서 검출된 시그널들(10 사이클에서의 제1 시그널, 20 사이클에서의 제1 시그널 및 30 사이클에서의 제1 시그널)로부터 상기 제1 타겟 핵산의 존재를 결정하고, 제2 검출 온도에서 검출된 시그널들(10 사이클에서의 제2 시그널, 20 사이클에서의 제2 시그널 및 30 사이클에서의 제2 시그널)로부터 상기 제2 타겟 핵산의 존재를 결정하고, 제3 검출 온도에서 검출된 시그널들(10 사이클에서의 제3 시그널, 20 사이클에서의 제3 시그널 및 30 사이클에서의 제3 시그널)로부터 상기 제3 타겟 핵산의 존재를 결정할 수 있다.
특정 구현예에 있어서, n은 4이고, 30 사이클에서 시그널의 검출을 실시하는 경우, 제1 검출 온도에서 검출된 시그널(즉, 30 사이클에서의 제1 시그널)과 기준 시그널 값으로부터 상기 제1 타겟 핵산의 존재를 결정하고, 제2 검출 온도에서 검출된 시그널(즉, 30 사이클에서의 제2 시그널)과 기준 시그널 값으로부터 상기 제2 타겟 핵산의 존재를 결정하고, 제3 검출 온도에서 검출된 시그널(즉, 30 사이클에서의 제3 시그널)과 기준 시그널 값으로부터 상기 제3 타겟 핵산의 존재를 결정한다.
일 구현예에 있어서, 상기 기준 시그널 값은 별도의 음성 대조군 반응 또는 양성 대조군 반응을 통해 얻을 수 있다.
일 구현예에 있어서, 본 개시에 따른 방법은 음성 대조군 반응과 함께 실시될 수 있다. 상기 음성 대조군 반응에서 검출된 시그널 값은 기준 시그널 값으로 사용될 수 있다. 예컨대, 제i 타겟 핵산 검출용 조성물을 포함하는 반응에서, 제i 검출 온도에서 1개의 사이클(예컨대, 마지막 사이클)에서 검출된 시그널은 음성 대조군 반응에서, 동일한 검출 온도(즉, 제i 검출 온도)에서 동일한 사이클(예컨대, 마지막 사이클)에서 검출한 시그널과 비교하여 시그널의 변화 여부를 결정할 수 있다.
특정 구현예에 있어서, n은 3이고, 30 사이클에서 시그널의 검출을 실시하는 경우, 제1 검출 온도에서 검출된 시그널(즉, 30 사이클에서 제1 시그널)과 제1 기준 시그널 값(예컨대, 음성 대조군 반응의 30 사이클에서 검출된 제1 검출 온도에서의 시그널)으로부터 상기 제1 타겟 핵산의 존재를 결정하고, 제2 검출 온도에서 검출된 시그널(즉, 30 사이클에서의 제2 시그널)과 제2 기준 시그널 값(예컨대, 음성 대조군 반응의 30 사이클에서 검출된 제2 검출 온도에서의 시그널)으로부터 상기 제2 타겟 핵산의 존재를 결정하며, 제3 검출 온도에서 검출된 시그널(즉, 30 사이클에서의 제3 시그널)과 제3 기준 시그널 값(예컨대, 음성 대조군 반응의 30 사이클에서 검출된 제3 검출 온도에서의 시그널)으로부터 상기 제3 타겟 핵산의 존재를 결정할 수 있다.
일 구현예에 있어서, 본 개시에 따른 방법은 양성 대조군 반응과 함께 실시될 수 있다. 상기 양성 대조군 반응에서 검출된 시그널 값은 기준 시그널 값으로 사용될 수 있다. 예컨대, 제i 검출 온도에서 1개의 사이클, 예컨대, 30 사이클에서 검출된 시그널인 30 사이클에서 검출된 제1 시그널은 양성 대조군 반응의 제i 검출 온도에서 30 사이클보다 이전 사이클, 예컨대, 1 사이클에서 검출한 시그널과 비교하여 시그널이 변하였는지 결정할 수 있다.
일 구현예에 있어서, 상기 단계 (a)에서 1개의 사이클에서 시그널 검출을 수행하고, 양성 대조군 반응을 통해 얻은 기준 시그널 값을 사용하여 시그널 변화를 측정하는 경우, 상기 기준 시그널 값을 얻기 위하여, 양성 대조군 반응에서 시그널 검출은 단계 (a)에서 시그널을 검출하는 사이클보다 최소 30 사이클 이전, 20 사이클 이전, 10 사이클 이전, 또는 5 사이클 이전의 사이클에서 실시될 수 있다.
특정 구현예에 있어서, n은 3이고, 30 사이클에서 시그널의 검출을 실시하는 경우, 제1 검출 온도에서 검출된 시그널(즉, 30 사이클에서 제1 시그널)과 제1 기준 시그널 값(예컨대, 제1 타겟 핵산 양성 대조군 반응의 1 사이클에서 검출된 제1 검출 온도에서의 시그널)으로부터 상기 제1 타겟 핵산의 존재를 결정하고, 제2 검출 온도에서 검출된 시그널(즉, 30 사이클에서의 제2 시그널)과 제2 기준 시그널 값(예컨대, 제2 타겟 핵산 양성 대조군 반응의 1 사이클에서 검출된 제2 검출 온도에서의 시그널)으로부터 상기 제2 타겟 핵산의 존재를 결정하며, 제3 검출 온도에서 검출된 시그널(즉, 30 사이클에서의 제3 시그널)과 제3 기준 시그널 값(예컨대, 제3 타겟 핵산 양성 대조군 반응의 1 사이클에서 검출된 제3 검출 온도에서의 시그널)으로부터 상기 제3 타겟 핵산의 존재를 결정할 수 있다.
II. 샘플 내 타겟 핵산 검출 방법
다른 양태에서, 본 개시는 다음의 단계를 포함하는 샘플 내 타겟 핵산 검출 방법을 제공한다:
(a) 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 타겟 핵산 검출용 조성물을 샘플과 인큐베이션하는 단계;
상기 제1 프로브는 상기 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가지며,
상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재하고,
상기 제2 프로브는 상기 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
상기 제2 프로브는 제2 퀀처 분자를 가지며,
상기 제1 프로브의 Tm 값은 제2 프로브의 Tm 값 보다 높고, 및
상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭되며; 및
(b) 시그널을 검출하는 단계; 및
(c) 상기 단계 (b)에서 검출된 시그널로부터 상기 타겟 핵산의 존재를 결정하는 단계.
본 개시의 두 번째 양태는 본 개시의 첫 번째 양태에서 상술한 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물을 이용하기 때문에, 이들 사이의 공통된 내용은 본 명세서의 복잡성을 초래하는 과도한 중복을 피하기 위해 생략한다.
본 개시에 따른 방법을 각 단계에 따라 설명하면 다음과 같다.
단계 (a): 인큐베이션
먼저, 타겟 핵산을 함유할 것으로 의심되는 샘플을 본 개시에 따른 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 타겟 핵산 검출용 조성물과 혼합하여 인큐베이션한다.
일 구현예에 있어서, 상기 인큐베이션 반응은 타겟 핵산이 상기 타겟 핵산 검출용 조성물과 반응하여 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위 내에서 선택된 어느 온도에서 타겟 핵산 존재에 의존적으로 시그널을 제공하는 반응을 의미한다.
일 구현예에 있어서, 상기 단계 (a) 인큐베이션은 증폭 반응, 구체적으로, 타겟 핵산의 증폭 반응을 포함한다.
일 구현예에 있어서, 상기 증폭 반응은 복수의 사이클을 포함한다.
인큐베이션에 대한 상세한 설명은 전술한 첫 번째 양태에서 인큐베이션에 대해 설명하는 섹션을 참조한다.
제1 프로브는 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함한다. 즉, 상기 제1 프로브는 타겟 핵산의 제1 영역에 혼성화할 수 있다.
상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가진다.
일 구현예에 있어서, 상기 제1 프로브가 상기 타겟 핵산과 혼성화하기 전, 상기 제1 프로브에 연결된 리포터 분자 및 제1 퀀처 분자는 서로 근접하게 위치한다. 이로 인해, 상기 제1 프로브에 연결된 제1 퀀처 분자는 상기 제1 프로브에 연결된 리포터 분자로부터의 시그널을 퀀칭(quenching)시킨다.
일 구현예에 있어서, 상기 제1 프로브는 상기 타겟 핵산과 혼성화되기 전, 랜덤 코일(random coil) 또는 헤어핀(hairpin) 구조를 형성하여 상기 제1 프로브에 연결된 제1 퀀처 분자가 상기 제1 프로브에 연결된 리포터 분자로부터의 시그널을 분자내 퀀칭(intramolecular quenching)시킨다.
일 구현예에 있어서, 상기 제1 프로브가 상기 타겟 핵산과 혼성화하면, 상기 제1 프로브의 리포터 분자 및 제1 퀀처 분자는 서로 이격된다. 구체적으로, 상기 제1 프로브가 타겟 핵산에 혼성화하여, 상기 제1 프로브의 제1 퀀처 분자가 상기 제1 프로브의 리포터 분자와 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭한다.
일 구현예에 있어서, 상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재한다.
일 구현예에 있어서, 상기 리포터 분자는 제1 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결된다.
제2 프로브는 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함한다. 즉, 상기 제2 프로브는 타겟 핵산의 제2 영역에 혼성화할 수 있다.
또한, 상기 제2 프로브는 제2 퀀처 분자를 가진다.
본 개시에서, 상기 타겟 핵산의 제1 영역 및 제2 영역은 서로 인접해 있다.
일 구현예에 있어서, 상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭된다. 구체적으로, 상기 제1 프로브가 상기 타겟 핵산의 제1 영역에 혼성화되어 있는 경우, 상기 제2 프로브는 상기 타겟 핵산의 제2 영역에 혼성화하여 상기 제2 프로브의 제2 퀀처 분자가 상기 타겟 핵산의 제1 영역에 혼성화되어 있는 제1 프로브의 리포터 분자에 인접하고, 이로 인해, 상기 제2 퀀처 분자가 상기 리포터 분자로부터의 시그널을 분자간 퀀칭(intermolecular quenching)시킨다.
일 구현예에 있어서, 상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화하면, 상기 제2 프로브의 제2 퀀처 분자는 상기 제1 프로브의 리포터 분자와 인접하고, 이로 인해, 상기 제2 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시킬 수 있는 위치에 상기 리포터 분자 및 제2 퀀처 분자가 존재한다.
일 구현예에 있어서, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결되어 있다.
일 구현예에 있어서, 상기 제1 프로브의 3' 방향으로 다운스트림에 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 3'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 5'-말단 부위에 위치한다.
일 구현예에 있어서, 상기 제1 프로브의 5' 방향으로 업스트림에 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 5'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위에 위치한다.
일 구현예에 있어서, 제1 프로브 및/또는 제2 프로브는 그의 3'-말단이 "블록킹"되어 연장이 방지된다.
본 개시에서 사용되는 리포터 분자 및 퀀처 분자는 상호작용적 표지이다.
일 구현예에 있어서, 상기 제2 프로브에 연결된 제2 퀀처 분자는 상기 제1 프로브에 연결된 제1 퀀처 분자와 동일한 유형의 퀀처 분자이다.
단계 (a)의 인큐베이션 반응을 통해, 제1 프로브 및 제2 프로브를 포함하는 본 개시에 따른 타겟 핵산 검출용 조성물은 타겟 핵산과 반응하여 타겟 핵산 존재에 의존적인 시그널을 제공한다. 구체적으로, 본 개시에 따른 제1 프로브 및 제2 프로브를 포함하는 타겟 핵산 검출용 조성물은 타겟 핵산이 증폭됨에 따라, 시그널의 변화를 제공한다.
본 개시에 따른 제1 프로브 및 제2 프로브는 서로 상이한 Tm 값을 갖는 것이 특징이다.
이러한 상이한 Tm 값을 가지는 2개의 프로브를 이용함으로써, 본 개시에 따른 타겟 핵산 검출용 조성물은 타겟 핵산과의 반응(예컨대, 증폭 반응)에서 타겟 핵산의 존재에 의존적으로 시그널이 변화하는 온도 범위, 즉, 시그널-변화 온도 범위(signal-changing temperature range) 및 타겟 핵산이 존재하여도 시그널이 변화하지 않는 2개의 온도 범위, 즉, 2개의 시그널-일정 온도 범위(signal-constant temperature range)를 가진다(도 1 내지 도 3 참조).
구체적으로, 상기 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 타겟 핵산 검출용 조성물은 상기 시그널-변화 온도 범위가 2개의 시그널-일정 온도 범위 중 제1 시그널-일정 온도 범위보다 높고, 2개의 시그널-일정 온도 범위 중 제2 시그널-일정 온도 범위보다는 낮은 특징을 갖는 InterSC 조성물이다.
일 구현예에 있어서, 본 개시에 따른 타겟 핵산 검출용 조성물과 타겟 핵산과의 반응(예컨대, 타겟 핵산 증폭 반응) 동안 제1 프로브 및 제2 프로브의 함량은 초기 타겟 핵산 검출용 조성물에 포함된 농도로 일정하다. 첫번째 양태에서 전술한 바와 같이, 타겟 핵산 검출용 조성물에 포함된 제1 프로브 및 제2 프로브는 타겟 핵산의 존재 여부 및/또는 온도 변화에 따라 도 1 내지 도 3의 형태로 존재할 수 있으며, 타겟 핵산과의 반응 정도(예컨대, 타겟 핵산의 증폭 정도)에 따라 도 1 내지 도 3의 형태로 존재하는 제1 프로브 및 제2 프로브의 함량이 변화한다. 구체적으로, 타겟 핵산과 반응한 제1 프로브 및 제2 프로브의 함량은 타겟 핵산이 증폭됨에 따라 증가한다. 반면, 타겟 핵산이 증폭됨에 따라, 타겟 핵산과 반응하지 않은 제1 프로브 및 제2 프로브의 함량은 감소하게 된다. 즉, 이들 간의 함량 비율은 변화하고, 타겟 핵산이 증폭됨에 따라 타겟 핵산의 존재를 나타내는 시그널 역시 변화하게 된다. 이러한 함량비의 변화에 의해 시그널-변화 온도 범위에서 타겟 핵산의 존재를 나타내는 시그널 역시 변화하게 된다. 따라서, 본 개시에 따른 타겟 핵산 검출용 조성물은 타겟 핵산 존재에 의존적인 시그널을 제공할 수 있다. 한편, 타겟 핵산이 증폭됨에 따라 타겟 핵산과 반응한 제1 프로브 및/또는 제2 프로브와 타겟 핵산과 반응하지 않은 제1 프로브 및/또는 제2 프로브 간의 함량비가 변할지라도, 2개의 시그널 일정-온도 범위에서는 시그널이 변화하지 않고 일정하다.
일 구현예에 있어서, 타겟 핵산이 존재하는 경우, 제1 시그널-일정 온도 범위 내의 온도에서 제1 프로브 및 제2 프로브는 모두 타겟 핵산에 각각 혼성화된다.
일 구현예에 있어서, 타겟 핵산이 존재하는 경우, 시그널-변화 온도 범위내의 온도에서는 제1 프로브는 타겟 핵산의 제1 영역에 혼성화되지만, 제2 프로브는 타겟 핵산의 제2 영역에 혼성화되지 않는다.
일 구현예에 있어서, 타겟 핵산이 존재하는 경우, 제2 시그널-일정 온도 범위 내의 온도에서 제1 프로브 및 제2 프로브 모두 타겟 핵산에 혼성화되어 있지 않다.
일 구현예에 있어서, 상기 시그널-변화 온도 범위는 상기 제1 프로브 및 상기 제2 프로브의 Tm 값들에 의존적으로 결정된다. 따라서, 상기 시그널-변화 온도 범위 및 2개의 시그널-일정 온도 범위는 상기 제1 프로브의 Tm 값 및 제2 프로브의 Tm 값을 조절하여 제어할 수 있다.
단계 (b): 시그널의 검출
본 단계에서는, 타겟 핵산 존재를 나타내는 시그널을 검출한다.
일 구현예에 있어서, 타겟 핵산의 존재를 나타내는 시그널의 검출은 인큐베이션 반응 동안, 즉, 타겟 핵산이 증폭됨에 따라 변화하는 시그널을 측정하여 달성될 수 있다.
일 구현예에 있어서, 상기 단계 (b)에서 검출된 시그널은 상기 타겟 핵산 존재에 의존적인 시그널이다.
일 구현예에 있어서, 상기 단계 (b)는 상기 시그널-변화 온도 범위 내에서 선택된 어느 한 온도(즉, 검출 온도)에서 실시된다.
일 구현예에 있어서, 상기 단계 (b)의 시그널의 검출은 상기 인큐베이션 반응 동안 및/또는 인큐베이션 후 실시된다. 구체적으로, 상기 시그널의 검출은 복수의 사이클을 포함하는 인큐베이션 반응의 각 사이클, 선택된 일부 사이클, 또는 반응의 엔드-포인트(end-point of reaction)에서 실시될 수 있다.
일 구현예에 있어서, 상기 단계 (b)의 시그널의 검출은 복수의 사이클 중 최소 1개의 사이클에서 실시된다. 예컨대, 복수의 사이클을 포함하는 인큐베이션 반응 동안 중기 사이클 또는 말기 사이클에서 최소 1개의 사이클에서 실시된다.
일 구현예에 있어서, 상기 단계 (b)의 시그널의 검출은 복수의 사이클을 포함하는 인큐베이션 반응 동안 1개의 사이클에서 실시될 수 있다. 이러한 경우, 상기 1개의 사이클에서 검출한 시그널 값만으로는 인큐베이션 반응 동안 타겟 핵산에 의존적으로 시그널이 변화하는지를 확인하기 어렵다. 따라서, 별도의 기준 시그널 값을 이용하여 타겟 핵산 존재를 나타내는 시그널을 확인할 수 있다.
상기 기준 시그널 값은 별도의 반응을 통해 타겟 핵산 존재에 의존적인 시그널 변화를 확인할 수 있는 값을 지칭할 수 있다. 일 구현예에 있어서, 상기 기준값은 타겟 핵산이 부존재하는 반응(예컨대, 음성 대조군 반응)으로부터 얻을 수 있다. 예컨대, 기준 시그널 값은 타겟 핵산이 부존재할 경우에 검출된 “검출 온도에서의 시그널 값”일 수 있다.
일 구현예에 있어서, 상기 단계 (b)의 시그널의 검출은 최소 2개의 사이클에서 실시된다. 예컨대, 복수의 사이클을 포함하는 인큐베이션 반응 동안 최소 2개의 사이클에서 실시된다. 상기 2개 이상의 사이클에서 검출된 검출 온도에서의 시그널 값들을 검출하여 시그널의 변화를 측정할 수 있다.
단계 (c): 타겟 핵산 존재의 결정
마지막으로, 상기 단계 (b)에서 검출한 시그널로부터 타겟 핵산의 존재를 결정한다.
일 구현예에 있어서, 상기 단계 (c)의 타겟 핵산의 존재는 시그널 변화에 의해 결정된다.
일 구현예에 있어서, 상기 단계 (c)는 상기 복수의 사이클 중 최소 2개의 사이클에서 검출된 시그널들을 이용하여 시그널의 변화를 측정(measure)하고, 시그널이 변화한 경우, 타겟 핵산이 존재하는 것으로 결정한다. 반면, 시그널이 일정한 경우, 타겟 핵산이 부존재하는 것으로 결정한다.
일 구현예에 있어서, 상기 단계 (c)의 타겟 핵산의 존재는 상기 복수의 사이클 중 최소 1개의 사이클에서 검출된 시그널과 상술한 기준 시그널 값을 이용하여 시그널의 변화를 측정하고, 시그널이 변화한 경우, 타겟 핵산이 존재하는 것으로 결정한다. 반면, 시그널이 일정한 경우, 타겟 핵산이 부존재하는 것으로 결정한다.
III. 샘플 내 타겟 핵산 검출용 조성물
또 다른 양태에서, 본 개시는 다음을 포함하는 샘플 내 타겟 핵산 검출용 조성물을 제공한다:
(a) 상기 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하는 제1 프로브;
상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가지며,
상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재하고; 및
(b) 상기 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하는 제2 프로브;
상기 제2 프로브는 제2 퀀처 분자를 가지며,
상기 제1 프로브의 Tm 값은 제2 프로브의 Tm 값 보다 높고, 및
상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭된다.
본 개시의 세 번째 양태는 본 개시의 두 번째 양태의 방법을 실시하기 위해 제조되므로, 이들 사이의 공통된 내용은 본 명세서의 복잡성을 초래하는 과도한 중복을 피하기 위해 생략한다.
IV. 타겟 핵산을 검출하기 위한 키트
또 다른 양태에서, 본 개시는 샘플 내 n개의 타겟 핵산을 검출하기 위한 n개의 타겟 핵산 검출용 조성물을 포함하는 키트를 제공한다:
상기 n은 2 이상의 정수이고,
상기 n개의 타겟 핵산 검출용 조성물의 각각은 대응하는 타겟 핵산의 존재하에 상기 n개의 검출 온도 중 대응하는 검출 온도에서 대응하는 타겟 핵산의 존재를 나타내는 시그널의 변화를 제공하며,
상기 n개의 타겟 핵산 검출용 조성물 중 제i 타겟 핵산 검출용 조성물은 상기 제i 타겟 핵산의 존재하에 상기 n개의 검출 온도 중 제i 검출 온도에서 상기 제i 타겟 핵산의 존재를 나타내는 시그널 변화를 제공하고, 그 외의 검출 온도에서는 일정한 시그널을 제공하며,
상기 i는 1부터 n까지의 정수를 나타내고, 상기 제i 검출 온도는 제i+1 검출 온도보다 낮고,
상기 n개의 검출 온도를 모두 포함하는 온도 범위 내에서, 상기 제i 타겟 핵산 검출용 조성물은 제i 타겟 핵산 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위(signal-changing temperature range) 및 제i 타겟 핵산이 존재하여도 시그널이 일정한 하나 또는 두 개의 시그널-일정 온도 범위(signal-constant temperature range)를 가지며,
상기 제i 타겟 핵산 검출용 조성물은,
(i) 상기 시그널-변화 온도 범위가 상기 시그널-일정 온도 범위보다 낮은 특징을 갖는 UnderSC(Under-Signal-Change) 조성물
(ii) 상기 시그널-변화 온도 범위가 2개의 시그널-일정 온도 범위 중 하나의 시그널-일정 온도 범위보다 높고, 다른 하나의 시그널-일정 온도 범위보다는 낮은 특징을 갖는 InterSC(Inter-Signal-Change) 조성물, 및
(iii) 상기 시그널-변화 온도 범위가 상기 시그널-일정 온도 범위보다 높은 특징을 갖는 OverSC(Over-Signal-Change) 조성물 중 어느 하나의 조성물이며,
상기 n개의 타겟 핵산 검출용 조성물 중 최소 하나의 조성물은 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하고,
상기 제1 프로브는 대응하는 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가지며,
상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 대응하는 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 대응하는 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재하고,
상기 제2 프로브는 상기 대응하는 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
상기 제2 프로브는 제2 퀀처 분자를 가지며,
상기 제1 프로브의 Tm 값은 제2 프로브의 Tm 값 보다 높고, 및
상기 제1 프로브 및 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭된다.
본 개시의 키트는 본 개시의 방법을 실시하기 위해 제조되므로, 이들 사이의 공통된 내용은 본 명세서의 복잡성을 초래하는 과도한 중복을 피하기 위해 생략한다.
일 구현예에 따르면, 상기 키트는 본 발명의 방법을 기재한 설명서를 추가로 포함할 수 있다.
일 구현예에 따르면, 상기 본 발명의 방법을 기술하거나 실시하기 위한 설명서는 적합한 기록 매체에 기록될 수 있다. 예를 들어, 설명서는 종이 및 플라스틱과 같은 기판에 인쇄될 수 있다. 다른 구현예에서, 설명서는 CD-ROM 및 디스켓과 같은 적합한 컴퓨터 해독가능한 기록매체 상에 존재하는 전자 저장 데이터 파일로 존재할 수 있다. 또 다른 구현예에서, 상기 키트 내에 실질적인 설명서는 포함되지 않으며, 다만 원격 소스로부터, 예컨대 인터넷을 통해, 설명서를 얻는 수단이 제공된다. 상기 구현예의 한 예는 설명서를 볼 수 있는 웹 주소 및/또는 설명서를 다운로드할 수 있는 웹 주소를 포함하는 키트이다.
이하, 실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 첨부된 청구항에 제시된 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어 명백할 것이다.
실시예
실시예 1: 상이한 Tm 값을 가지는 2개의 프로브를 이용한 타겟 핵산의 검출
본 개시에 따른 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 이용하여 타겟 핵산 검출이 가능한지 확인하였다.
1-1. 타겟 핵산 및 올리고뉴클레오타이드의 준비
타겟 핵산의 주형으로 Ureaplasma Parvum (UP) (기탁번호: ATCC 27815)의 지놈 DNA를 사용하였다. UP 타겟 핵산의 검출 온도를 68℃로 설정하고, 타겟 핵산 주형 상에서 3′에서 5′방향으로 제1 영역 및 제2 영역을 선택하였다.
그 다음, 표 3과 같이, 제1 프로브의 Tm 값은 70℃ 및 제2 프로브의 Tm 값은 64℃가 되도록 제1 프로브 및 제2 프로브의 서열 및 길이를 디자인하였다. 구체적으로, 제1 프로브는 타겟 핵산의 제1 영역에 상보적인 서열을 포함하고 그의 5′-말단에는 제1 퀀처 분자(AZOQ2)를 연결하고 그의 3′-말단에는 리포터 분자(Cal Fluor Red 610)를 연결하였다. 제2 프로브는 제2 영역에 상보적인 서열을 포함하고 그의 5′-말단에는 제2 퀀처 분자(AZOQ2)를 연결하고 그의 3′-말단은 DNA 중합효소에 의한 신장을 막기 위해 Spacer C3로 블로킹하였다.
타겟 핵산의 제1 영역 및 제2 영역을 포함하는 부위를 증폭하기 위한 프라이머 쌍을 표 3과 같이 디자인하였다.
올리고뉴클레오타이드 서열
타겟
핵산		 서열
번호		 올리고
타입		 서열
(5' -3’)
UP 1 타겟 핵산의
제1 및 제2 영역		 AGATTTATACGGTATTACAACTGGTGATAGCGTTAGATTAGGAGATACAAATCTTTGAGTTAAAGTTGAAAAAGACTTAACTACTTATGGTGAAGAATCTGTTTTTGGTGGTGGAAAAACCCTACGTGAAGGTATGGGAATGAATTCTACTATGAAGTTAGATGATAAATTAGGTAATGCTGAAGT
2 UP-정방향 프라이머 AGATTTATACGGTATTACAACTG
3 UP-역방향 프라이머 ACTTCAGCATTACCTAATTTATC
4 UP-제1 프로브 [AZOQ2]GGTGAAGAATCTGTTTTTGGTGGTGGAAA[Cal Fluor Red 610]
5 UP-제2 프로브 [AZOQ2]CCTACGTGAAGGTATGGGAAT[Spacer C3]
볼드체: 타겟 핵산의 제1 영역 밑줄: 타겟 핵산의 제2 영역
1-2. 실시간 중합효소 연쇄반응
상기 올리고뉴클레오타이드를 이용하여 실시간 중합효소 연쇄반응을 실시하였다.
타겟 핵산(튜브 1: 500 pg의 UP 지놈 DNA; 튜브 2: 증류수(음성 대조군))에 UP 증폭을 위한 UP-정방향 프라이머 5 pmole(서열 번호: 2), UP-역방향 프라이머 20 pmole(서열 번호: 3), UP-제1 프로브 5 pmole(서열 번호: 4) 및 UP-제2 프로브 5 pmole(서열 번호: 5)을 혼합한 다음, DNA 중합효소 (2U SD Polymerase HotStart (BIORON, Germany)), dNTP 1Mm, MgSO4 100mM를 첨가하여 최종 20 ㎕의 반응 혼합물을 제조하였다. 이중 가닥 타겟 핵산 중 제1 프로브 및 제2 프로브가 혼성화하는 타겟 핵산 가닥이 더 많이 증폭될 수 있도록 역방향 프라이머 농도를 정방향 프라이머 농도보다 높게 조절하였다.
상기 반응 혼합물을 함유하고 있는 튜브를 실시간 열순환기(CFX96 Real-time Cycler, Bio-Rad)에 위치시켜 92℃에서 2분간 변성시키고, 92℃에서 15초, 57℃에서 15초, 68℃에서 5초, 72℃에서 10초, 76℃에서 5초의 사이클을 50회 반복하였다. 시그널의 검출은 매 사이클마다 제1 프로브 및 제2 프로브가 타겟 핵산에 모두 혼성화되는 온도(즉, 제1 시그널-일정 온도 범위 내의 온도) 57℃, 제1 프로브는 타겟 핵산에 혼성화되고 제2 프로브는 타겟 핵산에 비-혼성화되는 검출 온도(즉, 시그널-변화 온도 범위 내의 온도) 68℃ 및 제1 프로브 및 제2 프로브가 타겟 핵산에 모두 비-혼성화되는 온도(즉, 제2 시그널-일정 온도 범위 내의 온도) 76℃, 총 3개의 온도에서 실시하였다.
그 결과, 도 9에 나타난 바와 같이, 제1 시그널-일정 온도 범위 내의 온도인 57℃와 제2 시그널-일정 온도 범위 내의 온도인 76℃에서의 증폭 곡선은 타겟 핵산 이 증폭됨에 따라 시그널이 변화하지 않고 일정한 반면, 검출 온도인 68℃에서의 증폭 곡선은 타겟 핵산이 증폭함에 따라 시그널이 변화하는 것을 확인할 수 있었다. 이러한 결과는 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물을 이용하여, 실시간으로 타겟 핵산을 검출할 수 있음을 의미한다. 또한, 본 개시에 따른 상이한 Tm 값을 가지는 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물은 상술한 바와 같이, InterSC 시그널 발생 방식인 것을 확인하였다.
한편, 음성 대조군 반응(튜브 2)의 경우, 57℃, 68℃ 및 76℃에서 모두 시그널이 일정한 것을 확인하였다.
상술한 바와 같이, 본 개시에 따른 타겟 핵산 검출 방법은 음성 대조군 반응으로부터 얻은 기준 시그널 값을 이용하여 타겟 핵산 존재를 나타내는 시그널(즉, 시그널의 변화)을 확인할 수 있다. 본 발명자들은 음성 대조군 반응의 시그널 값 (즉, RFU: 0)으로부터 기준 시그널 값 300을 설정하였고, 57℃, 68℃ 및 76℃에서의 시그널 값이 상기 기준 시그널 값 이상이면 시그널이 변화한 것으로 판단하였다. 그 결과, 표 4에 나타난 바와 같이, 튜브 1은 검출 온도인 68℃에서만 Ct값 24.43으로 시그널이 변화하는 것을 확인하였으며, 57℃ 및 76℃에서는 시그널이 변화하지 않고 일정한 것을 확인하였다.
튜브 Ct (Cycle threshold)
57℃ 68℃ 76℃
1 N/A 24.43 N/A
2 N/A N/A N/A
튜브 1 : 500 pg의 UP 지놈 DNA;
튜브 2 : 음성 대조군;
N/A : Not Applicable
실시예 2: 복수의 타겟 핵산의 검출
본 개시에 따르면, 복수의 타겟 핵산 검출용 조성물들의 시그널-변화 온도 범위를 조절함으로써, 하나의 반응 용기에서 단일 유형의 표지를 이용하여 복수의 타겟 핵산을 검출할 수 있다.
이에, 본 개시에 따른 2개의 프로브를 포함하는 타겟 핵산 검출용 조성물을 이용하여 하나의 반응 용기에서 단일 유형의 표지로 복수의 타겟 핵산을 검출할 수 있는지 확인하였다.
2-1. 타겟 핵산 및 올리고뉴클레오타이드의 준비
타겟 핵산의 주형으로 Ureaplasma parvum (UP) (기탁번호: ATCC 27815)의 지놈 DNA 및 Chlamydia trachomatis (CT) (기탁번호: ATCC VR-1500)의 지놈 DNA를 사용하였다. UP 타겟 핵산의 검출 온도(즉, 제1 검출 온도)는 68℃로 설정하고, CT 타겟 핵산의 검출 온도(즉, 제2 검출 온도)는 76℃로 설정하고, 각각의 타겟 핵산 주형 상에서 3′에서 5′방향으로 제1 영역 및 제2 영역을 선택하였다.
그 다음, 표 5와 같이, 제1 타겟 핵산인 UP를 검출하기 위한 제1 프로브 및 제2 프로브의 Tm 값은 각각 70℃ 및 64℃가 되도록 서열 및 길이를 디자인하였으며, 제2 타겟 핵산인 CT를 검출하기 위한 제1 프로브 및 제2 프로브의 Tm 값은 각각 76.5℃ 및 71.5℃가 되도록 서열 및 길이를 디자인하였다. 제1 타겟 핵산인 UP를 검출하기 위한 제1 프로브 및 제2 프로브는 상기 실시예 1-1의 표 3과 동일하게 사용하였다.
구체적으로, 2개의 타겟 핵산에 대한 각각의 제1 프로브는 대응하는 타겟 핵산의 제1 영역에 상보적인 서열을 포함하고 그의 5′-말단에는 제1 퀀처 분자(AZOQ2)를 연결하고, 그의 3′-말단에는 리포터 분자(Cal Fluor Red 610)를 연결하였다. 2개의 타겟 핵산에 대한 각각의 제2 프로브는 대응하는 타겟 핵산의 제2 영역에 상보적인 서열을 포함하고 그의 5′-말단에는 제2 퀀처 분자(AZOQ2)를 연결하고 그의 3′-말단은 DNA 중합효소에 의한 신장을 막기 위해 Spacer C3로 블로킹하였다.
제1 타겟 핵산의 제1 영역 및 제2 영역을 포함하는 부위를 증폭하기 위한 프라이머 쌍 및 제2 타겟 핵산의 제1 영역 및 제2 영역을 포함하는 부위를 증폭하기 위한 프라이머 쌍을 표 5와 같이 디자인하였다.
올리고뉴클레오타이드 서열
타겟
핵산		 서열
번호		 올리고
타입		 서열 (5'-3')
UP 1 타겟 핵산의
제1 및 제2 영역		 AGATTTATACGGTATTACAACTGGTGATAGCGTTAGATTAGGAGATACAAATCTTTGAGTTAAAGTTGAAAAAGACTTAACTACTTATGGTGAAGAATCTGTTTTTGGTGGTGGAAAAACCCTACGTGAAGGTATGGGAATGAATTCTACTATGAAGTTAGATGATAAATTAGGTAATGCTGAAGT
2 UP-정방향 프라이머 AGATTTATACGGTATTACAACTG
3 UP-역방향 프라이머 ACTTCAGCATTACCTAATTTATC
4 UP-제1 프로브 [AZOQ2]GGTGAAGAATCTGTTTTTGGTGGTGGAAA[Cal Fluor Red 610]
5 UP-제2 프로브 [AZOQ2]CCTACGTGAAGGTATGGGAAT[Spacer C3]
CT 6 타겟 핵산의
제1 및 제2 영역		 CTTTATTAGGAGGAACTGAAATAGGAAAATTCACAGTCACACCCAAAAGCTCTGGGAGCATGTTCTTAGTCTCAGCAGATATTATTGCATCAAGAATGGAAGGCGGCGTTGTTCTAGCTTTGGTACGAGAAGGTGATTCTAAGCCCTGCGCGATTAGTTATGGATACTCATCAGGCGTTCCTAATTTATGTAGTCTAAGAACCAG
7 CT-정방향 프라이머 CTTTATTAGGAGGAACTGAAATAGG
8 CT-역방향 프라이머 CTGGTTCTTAGACTACATAAATTAGG
9 CT-제1 프로브 [AZOQ2]TGCATCAAGAATGGAAGGCGGCGTTGTTCTAGCT[Cal Fluor Red 610]
10 CT-제2 프로브 [AZOQ2]GGTACGAGAAGGTGATTCTAAGCCCTGCG[Spacer C3]
볼드체: 타겟 핵산의 제1 영역
밑줄: 타겟 핵산의 제2 영역
2-2. 멀티플렉스 실시간 중합효소 연쇄반응
상기 올리고뉴클레오타이드를 이용하여 하나의 반응 용기에서 멀티플렉스 실시간 중합효소 연쇄반응을 실시하였다.
타겟 핵산(튜브 1: 500 pg의 UP 지놈 DNA; 튜브 2: 500 pg의 CT 지놈 DNA; 튜브 3: 500 pg의 UP 지놈 DNA 및 500 pg의 CT 지놈 DNA 혼합물 및 튜브 4: 증류수(음성 대조군))에 UP 핵산 증폭을 위한 UP-정방향 프라이머 5 pmole(서열 번호: 2), UP-역방향 프라이머 20 pmole(서열 번호: 3), UP-제1 프로브 5 pmole(서열 번호: 4), UP-제2 프로브 5 pmole(서열 번호: 5), CT 핵산 증폭을 위한 CT-정방향 프라이머 5 pmole(서열 번호: 7), CT-역방향 프라이머 20 pmole(서열 번호: 8), CT-제1 프로브 5 pmole(서열 번호: 9) 및 CT-제2 프로브 5 pmole(서열 번호: 10)을 혼합한 다음, DNA 중합효소 (2U SD Polymerase HotStart (BIORON, Germany)), dNTP 1Mm, MgSO4 100mM를 첨가하여 최종 20 ㎕의 반응 혼합물을 제조하였다. 이중 가닥 타겟 핵산 중 제1 프로브 및 제2 프로브가 혼성화하는 타겟 핵산 가닥이 더 많이 증폭될 수 있도록 역방향 프라이머 농도를 정방향 프라이머 농도보다 높게 조절하였다.
상기 반응 혼합물을 함유하고 있는 튜브를 실시간 열순환기(CFX96 Real-time Cycler, Bio-Rad)에 위치시켜 92℃에서 2분간 변성시키고 92℃에서 15초, 57℃에서 15초, 68℃에서 5초, 72℃에서 10초, 76℃에서 5초, 85℃에서 5초의 사이클을 50회 반복하였다. 시그널의 검출은 매 사이클 마다 57℃, 68℃(제1 검출 온도), 76℃(제2 검출 온도) 및 85℃에서 실시하였다.
57℃는 UP 타겟 핵산 검출용 조성물의 제1 시그널-일정 온도 범위 내의 온도이면서 CT 타겟 핵산 검출용 조성물의 제1 시그널-일정 온도 범위 내의 온도이다. 제1 시그널-일정 온도 범위 내의 온도인 57℃에서, 타겟 핵산이 부존재하는 경우에는 제1 프로브 및 제2 프로브가 도 1의 (i)의 형태로 존재하여 리포터 분자는 제1 퀀처 분자에 의해 퀀칭되고, 타겟 핵산이 존재하는 경우에는 제1 프로브 및 제2 프로브가 도 2의 (i) 형태로 존재하여 리포터 분자는 제2 퀀처 분자에 의해 퀀칭된다. 즉, 해당 온도에서 UP 타겟 핵산 검출용 조성물 및 CT 타겟 핵산 검출용 조성물 모두 대응하는 타겟 핵산 존재 여부와 상관없이 일정한 시그널을 제공한다.
85℃는 UP 타겟 핵산 검출용 조성물의 제2 시그널-일정 온도 범위 내의 온도이면서 CT 타겟 핵산 검출용 조성물의 제2 시그널-일정 온도 범위 내의 온도이다. 제2 시그널-일정 온도 범위 내의 온도인 85℃에서, 타겟 핵산이 부존재하는 경우에는 제1 프로브 및 제2 프로브가 도 1의 (iii)의 형태로 존재하여 리포터 분자는 제1 퀀처 분자에 의해 퀀칭되고, 타겟 핵산이 존재하는 경우에는 제1 프로브 및 제2 프로브가 도 2의 (iii) 형태로 존재하여 리포터 분자는 제1 퀀처 분자에 의해 퀀칭된다. 즉, 해당 온도에서 UP 타겟 핵산 검출용 조성물 및 CT 타겟 핵산 검출용 조성물 모두 대응하는 타겟 핵산 존재 여부와 상관없이 일정한 시그널을 제공한다.
한편, 제1 검출 온도인 68℃는 UP 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위 내의 온도이면서 CT 타겟 핵산 검출용 조성물의 제1 시그널-일정 온도 범위 내의 온도이다. CT 타겟 핵산 검출용 조성물은 전술한 바와 같이 제1 시그널-일정 온도 범위 내의 온도인 68℃에서, CT 타겟 핵산 존재 여부와 상관없이 일정한 시그널을 제공한다. 반면, UP 타겟 핵산에 대한 제1 프로브 및 제2 프로브는 UP 타겟 핵산이 부존재하는 경우 도 1의 (ii)의 형태로 존재하여 리포터 분자는 제1 퀀처 분자에 의해 퀀칭되고, UP 타겟 핵산이 존재하는 경우에는 도 2의 (ii)의 형태로 존재하여 리포터 분자는 제1 퀀처 분자 및 제2 퀀처 분자로부터 분리되고 언퀀칭된다. 이로 인해, 해당 온도에서 UP 타겟 핵산 검출용 조성물은 타겟 핵산 존재에 의존적으로 시그널 변화를 제공한다.
제2 검출 온도인 76℃ UP 타겟 핵산 검출용 조성물의 제2 시그널-일정 온도 범위 내의 온도이면서 CT 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위 내의 온도이다. UP 타겟 핵산 검출용 조성물은 전술한 바와 같이 제2 시그널-일정 온도 범위 내의 온도인 76℃에서, UP 타겟 핵산 존재 여부와 상관없이 일정한 시그널을 제공한다. 반면, CT 타겟 핵산에 대한 제1 프로브 및 제2 프로브는 CT 타겟 핵산이 부존재하는 경우 도 1의 (ii)의 형태로 존재하여 제1 프로브의 리포터 분자는 제1 퀀처 분자에 의해 퀀칭되고, CT 타겟 핵산이 존재하는 경우에는 도 2의 (ii)의 형태로 존재하여 제1 프로브의 리포터 분자가 제1 퀀처 분자 및 제2 퀀처 분자에 의해 언퀀칭된다. 이로 인해, 해당 온도에서 CT 타겟 핵산 검출용 조성물은 타겟 핵산 존재에 의존적으로 시그널 변화를 제공한다.
도 10은 멀티플렉스 PCR 결과로서, 각 온도별 증폭 곡선을 나타낸다. 도 10에 나타난 바와 같이, 57℃ 및 85℃에서의 증폭 곡선은 UP 타겟 핵산 및/또는 CT 타겟 핵산의 존재 여부와 무관하게, 튜브 1 내지 4 모두 시그널이 변화하지 않고 일정하였다.
한편, 제1 검출 온도인 68℃에서의 증폭 곡선은 UP 타겟 핵산을 함유하는 튜브 1 및 튜브 3에서 UP 타겟 핵산이 증폭됨에 따라 시그널이 변화하는 것이 확인되었다.
또한, 제2 검출 온도인 76℃에서의 증폭 곡선은 CT 타겟 핵산을 함유하는 튜브 2 및 튜브 3에서 CT 타겟 핵산이 증폭됨에 따라 시그널이 변화하는 것이 확인되었다.
음성 대조군 반응인 튜브 4에서는 모든 온도에서의 증폭 곡선에서 시그널이 변화하지 않고 일정한 것을 확인하였다.
이러한 결과는 본 개시에 따른 타겟 핵산 검출용 조성물의 제1 프로브 및 제2 프로브의 Tm 값을 조절(즉, 시그널-변화 온도 범위를 조절)함으로써, 하나의 반응 용기에서 단일 유형의 표지를 이용하여 복수의 타겟 핵산을 검출할 수 있음을 의미한다.
이어서, 음성 대조군 반응으로부터 얻은 기준 시그널 값을 이용하여 타겟 핵산 존재를 나타내는 시그널(즉, 시그널의 변화)을 확인하였다. 본 발명자들은 음성 대조군 반응의 시그널 값(즉, RFU: 0)으로부터 기준 시그널 값 300을 설정하였고, 57℃, 68℃, 76℃ 및 85℃에서의 시그널 값이 상기 기준 시그널 값 이상이면 시그널이 변화한 것으로 판단하였다. 그 결과, 표 6에 나타난 바와 같이, 튜브 1은 UP 타겟 핵산의 검출 온도(즉, 제1 검출 온도)인 68℃에서만 Ct 값 24.24로 시그널이 변화하는 것을 확인하였으며, 튜브 2는 CT 타겟 핵산의 검출 온도(즉, 제2 검출 온도)인 76℃에서만 Ct 값 24.12로 시그널이 변화하는 것을 확인하였다. 튜브 3은 제1 검출 온도 68℃에서 및 제2 검출 온도 76℃에서 각각 Ct 값 24.69 및 23.69로 시그널이 변화하는 것을 확인하였다. 반면, 57℃ 및 85℃에서는 시그널이 변화하지 않고 일정한 것을 확인하였다.
이러한 결과는, 상술한 바와 같이, 복수의 상이한 타겟 핵산이 이들 각각의 검출 온도에서 독립적으로 검출될 수 있음을 나타낸다.
튜브 Ct (Cycle threshold)
57℃ 68℃ 76℃ 85℃
1 N/A 24.24 N/A N/A
2 N/A N/A 24.12 N/A
3 N/A 24.69 23.69 N/A
4 N/A N/A N/A N/A
튜브 1: 500 pg의 UP 지놈 DNA;
튜브 2: 500 pg의 CT 지놈 DNA;
튜브 3: 500 pg의 UP 지놈 DNA 및 500 pg의 CT 지놈 DNA;
튜브 4: 음성 대조군;
N/A: Not Applicable
종합컨대, 본 개시에 따른 타겟 핵산 검출용 조성물은 제1 프로브 및 제2 프로브의 Tm 값을 서로 조절함으로써, 지정된 검출 온도에서만 타겟 핵산에 의존적인 시그널을 제공할 수 있다. 이는, 복수의 타겟 핵산 각각에 대한 제1 프로브 및 제2 프로브의 Tm 값을 조절함으로써, 서로 상이한 검출 온도에서 해당하는 타겟 핵산에 대한 시그널만을 제공할 수 있도록 조절할 수 있음을 의미한다. 실시예 2에서는 이러한 원리를 이용하여 하나의 반응 용기에서 동일한 유형의 표지를 이용하여 단일 검출기만으로 복수의 타겟 핵산을 실시간으로 검출할 수 있는 것을 확인하였다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (68)

  1. 다음의 단계를 포함하는, 샘플 내 n개의 타겟 핵산을 검출하는 방법:
    (a) 하나의 반응 용기에서 상기 n개의 타겟 핵산 중 하나 이상의 타겟 핵산을 함유할 것으로 의심되는 샘플을 n개의 타겟 핵산 검출용 조성물과 인큐베이션하면서, n개의 검출 온도에서 시그널을 검출하는 단계;
    상기 n은 2 이상의 정수이고,
    상기 인큐베이션은 복수의 사이클을 포함하고, 상기 시그널의 검출은 상기 복수의 사이클 중 최소 1개의 사이클에서 실시하며,
    상기 n개의 타겟 핵산 검출용 조성물의 각각은 대응하는 타겟 핵산의 존재하에 상기 n개의 검출 온도 중 대응하는 검출 온도에서 대응하는 타겟 핵산의 존재를 나타내는 시그널의 변화를 제공하며,
    상기 n개의 타겟 핵산 검출용 조성물 중 제i 타겟 핵산 검출용 조성물은 상기 제i 타겟 핵산의 존재하에 상기 n개의 검출 온도 중 제i 검출 온도에서 상기 제i 타겟 핵산의 존재를 나타내는 시그널 변화를 제공하고, 그 외의 검출 온도에서는 일정한 시그널을 제공하며,
    상기 i는 1부터 n까지의 정수를 나타내고, 상기 제i 검출 온도는 제i+1 검출 온도보다 낮고,
    상기 n개의 검출 온도를 모두 포함하는 온도 범위 내에서, 상기 제i 타겟 핵산 검출용 조성물은 제i 타겟 핵산 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위(signal-changing temperature range) 및 제i 타겟 핵산이 존재하여도 시그널이 일정한 하나 또는 두 개의 시그널-일정 온도 범위(signal-constant temperature range)를 가지며,
    상기 제i 타겟 핵산 검출용 조성물은,
    (i) 상기 시그널-변화 온도 범위가 상기 시그널-일정 온도 범위보다 낮은 특징을 갖는 UnderSC(Under-Signal-Change) 조성물,
    (ii) 상기 시그널-변화 온도 범위가 2개의 시그널-일정 온도 범위 중 하나의 시그널-일정 온도 범위보다 높고, 다른 하나의 시그널-일정 온도 범위보다는 낮은 특징을 갖는 InterSC(Inter-Signal-Change) 조성물, 및
    (iii) 상기 시그널-변화 온도 범위가 상기 시그널-일정 온도 범위보다 높은 특징을 갖는 OverSC(Over-Signal-Change) 조성물 중 어느 하나의 조성물이며,
    상기 n개의 타겟 핵산 검출용 조성물 중 최소 하나의 조성물은 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하고,
    상기 제1 프로브는 대응하는 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
    상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가지며,
    상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 대응하는 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 대응하는 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재하고,
    상기 제2 프로브는 상기 대응하는 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
    상기 제2 프로브는 제2 퀀처 분자를 가지며,
    상기 제1 프로브의 Tm 값은 제2 프로브의 Tm 값 보다 높고, 및
    상기 제1 프로브 및 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭되며; 및
    (b) 상기 단계 (a)에서 검출된 시그널로부터 n개의 타겟 핵산의 존재를 결정하는 단계로서, 상기 제i 검출 온도에서 검출된 시그널 변화에 의해 상기 제i 타겟 핵산의 존재를 결정하는 단계.
  2. 제1항에 있어서, 상기 제1 퀀처 분자는 상기 리포터 분자로부터 12 내지 60 뉴클레오타이드 이격되어 있는 것을 특징으로 하는 방법.
  3. 제1항에 있어서, 상기 리포터 분자는 제1 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결되어 있는 것을 특징으로 하는 방법.
  4. 제1항에 있어서, 상기 제1 프로브 및 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화하면, 상기 제2 프로브의 제2 퀀처 분자는 상기 제1 프로브의 리포터 분자와 인접하고, 이로 인해, 상기 제2 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시킬 수 있는 위치에 상기 리포터 분자 및 제2 퀀처 분자가 존재하는 것을 특징으로 하는 방법.
  5. 제4항에 있어서, 제1 프로브 및 제2 프로브가 대응하는 타겟 핵산에 혼성화되는 경우, 상기 제2 퀀처 분자는 상기 리포터 분자로부터 바로 인접하게 위치하거나 또는 1 내지 4 뉴클레오타이드 이격되어 있는 것을 특징으로 하는 방법.
  6. 제1항에 있어서, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결되어 있는 것을 특징으로 하는 방법.
  7. 제1항에 있어서, 상기 제1 프로브의 3' 방향으로 다운스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 3'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 5'-말단 부위에 위치하는 것을 특징으로 하는 방법.
  8. 제1항에 있어서, 상기 제1 프로브의 5' 방향으로 업스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 5'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위에 위치하는 것을 특징으로 하는 방법.
  9. 제1항에 있어서, 제1 프로브의 제1 퀀처 분자 및 제2 프로브의 제2 퀀처 분자는 동일한 유형의 퀀처 분자인 것을 특징으로 하는 방법.
  10. 제1항에 있어서, 상기 제1 프로브 및/또는 제2 프로브는 그의 3'-말단이 블록킹되어 연장이 방지된 것을 특징으로 하는 방법.
  11. 제1항에 있어서, 상기 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 조성물은 상기 시그널-변화 온도 범위가 2개의 시그널-일정 온도 범위 중 제1 시그널-일정 온도 범위보다 높고, 2개의 시그널-일정 온도 범위 중 제2 시그널-일정 온도 범위보다는 낮은 특징을 갖는 InterSC 조성물인 것을 특징으로 하는 방법.
  12. 제11항에 있어서, 상기 대응하는 타겟 핵산 존재 하에, 상기 제1 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 대응하는 타겟 핵산에 혼성화되어 있는 것을 특징으로 하는 방법.
  13. 제11항에 있어서, 상기 대응하는 타겟 핵산 존재 하에, 상기 제2 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 대응하는 타겟 핵산에 혼성화되어 있지 않는 것을 특징으로 하는 방법.
  14. 제11항에 있어서, 상기 대응하는 타겟 핵산 존재 하에, 상기 시그널-변화 온도 범위 내의 온도에서 상기 제1 프로브는 상기 대응하는 타겟 핵산에 혼성화되지만 상기 제2 프로브는 상기 대응하는 타겟 핵산에 혼성화되지 않는 것을 특징으로 하는 방법.
  15. 제11항에 있어서, 상기 시그널-변화 온도 범위는 상기 제1 프로브 및 상기 제2 프로브의 Tm 값들에 의존적인 것을 특징으로 하는 방법.
  16. 제1항에 있어서, 상기 제i 검출 온도는 상기 제i 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위 내에서 선택되고, 상기 제i 검출 온도는 다른 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위에는 포함되지 않는 것을 특징으로 하는 방법.
  17. 제1항에 있어서, 상기 제i 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위는 인접한 검출 온도를 가지는 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위와 부분적으로 중첩될 수 있으나, 인접하지 않은 검출 온도를 가지는 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위와 서로 중첩하지 않는 것을 특징으로 하는 방법.
  18. 제1항에 있어서, 상기 n이 2인 경우, 제1 타겟 핵산 검출용 조성물은 UnderSC 또는 InterSC 조성물이고, 및 제2 타겟 핵산 검출용 조성물은 InterSC 또는 OverSC 조성물인 것을 특징으로 하는 방법.
  19. 제1항에 있어서, 상기 n이 3이상인 경우, 제1 타겟 핵산 검출용 조성물은 UnderSC 또는 InterSC 조성물이고, 제n 타겟 핵산 검출용 조성물은 InterSC 또는 OverSC 조성물이며, 및 상기 제1 타겟 핵산 및 상기 제n 타겟 핵산 이외의 각각의 타겟 핵산 검출용 조성물은 InterSC 조성물인 것을 특징으로 하는 방법.
  20. 제1항에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 제i 타겟 핵산의 존재에 의존적으로 시그널을 제공하는 표지를 포함하는 것을 특징으로 하는 방법.
  21. 제20항에 있어서, 상기 표지는 올리고뉴클레오타이드에 연결되어 있거나 또는 상기 인큐베이션 동안 올리고뉴클레오타이드에 삽입되는 것을 특징으로 하는 방법.
  22. 제1항에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 시그널 변화를 제공하는 이합체를 제공하는 것을 특징으로 하는 방법.
  23. 제22항에 있어서, 상기 시그널 변화를 제공하는 이합체는 상기 제i 타겟 핵산 검출용 조성물에 처음부터 포함되어 있는 것을 특징으로 하는 방법.
  24. 제23항에 있어서, 상기 시그널 변화를 제공하는 이합체는 표지가 연결된 올리고뉴클레오타이드 및 상기 표지가 연결된 올리고뉴클레오타이드와 혼성화할 수 있는 올리고뉴클레오타이드 간의 혼성화에 의해 생성되는 것을 특징으로 하는 방법.
  25. 제22항에 있어서, 상기 시그널 변화를 제공하는 이합체는 인큐베이션 동안 생성되는 것을 특징으로 하는 방법.
  26. 제25항에 있어서, 상기 시그널 변화를 제공하는 이합체는 표지가 연결된 올리고뉴클레오타이드 및 상기 해당하는 타겟 핵산 간의 혼성화에 의해 생성되는 것을 특징으로 하는 방법.
  27. 제25항에 있어서, 상기 시그널 변화를 제공하는 이합체는 상기 해당하는 타겟 핵산의 존재에 의존적인 절단 반응에 의해서 생성되는 것을 특징으로 하는 방법.
  28. 제22항에 있어서, 상기 시그널 변화를 제공하는 이합체는 표지를 포함하고 있는 것을 특징으로 하는 방법.
  29. 제1항에 있어서, 상기 제i 타겟 핵산 검출용 조성물은 시그널 변화를 제공하는 이합체를 제공하고, 상기 제i 타겟 핵산 검출용 조성물의 시그널-변화 온도 범위는 상기 이합체의 길이 및/또는 서열에 의존적으로 변화하는 것을 특징으로 하는 방법.
  30. 제1항에 있어서, 상기 시그널의 검출은 상기 복수의 사이클 중 최소 2개의 사이클에서 실시되는 것을 특징으로 하는 방법.
  31. 제30항에 있어서, 상기 시그널 변화는 상기 복수의 사이클 중 최소 2개의 사이클에서 검출된 시그널을 이용하여 측정하는 것을 특징으로 하는 방법.
  32. 제1항에 있어서, 상기 제i 검출 온도에서의 시그널 변화는 상기 복수의 사이클 중 최소 1개의 사이클에서 검출된 시그널과 기준 시그널 값을 이용하여 측정하는 것을 특징으로 하는 방법.
  33. 제32항에 있어서, 상기 기준 시그널 값은 상기 제i 타겟 핵산이 부존재하는 반응으로부터 얻어진 것을 특징으로 하는 방법.
  34. 제1항에 있어서, 상기 n개의 검출 온도 각각에서의 시그널 검출은 단일 유형의 검출기(single type of detector)를 이용하여 수행되는 것을 특징으로 하는 방법.
  35. 제34항에 있어서, 상기 n개의 검출 온도에서 검출된 시그널은 상기 단일 유형의 검출기에 의해 서로 구별되지 않는 것을 특징으로 하는 방법.
  36. 제1항에 있어서, 상기 인큐베이션은 핵산 증폭 반응을 포함하는 것을 특징으로 하는 방법.
  37. 다음의 단계를 포함하는 샘플 내 타겟 핵산 검출 방법:
    (a) 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 타겟 핵산 검출용 조성물을 샘플과 인큐베이션하는 단계;
    상기 제1 프로브는 상기 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
    상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가지며,
    상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재하고,
    상기 제2 프로브는 상기 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하고,
    상기 제2 프로브는 제2 퀀처 분자를 가지며,
    상기 제1 프로브의 Tm 값은 제2 프로브의 Tm 값 보다 높고, 및
    상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭되며; 및
    (b) 시그널을 검출하는 단계; 및
    (c) 상기 단계 (b)에서 검출된 시그널로부터 상기 타겟 핵산의 존재를 결정하는 단계.
  38. 제37항에 있어서, 상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화하면, 상기 제2 프로브의 제2 퀀처 분자는 상기 제1 프로브의 리포터 분자와 인접하고, 이로 인해, 상기 제2 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시킬 수 있는 위치에 상기 리포터 분자 및 제2 퀀처 분자가 존재하는 것을 특징으로 하는 방법.
  39. 제37항에 있어서, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결되어 있는 것을 특징으로 하는 방법.
  40. 제37항에 있어서, 상기 제1 프로브의 3' 방향으로 다운스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 3'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 5'-말단 부위에 위치하는 것을 특징으로 하는 방법.
  41. 제37항에 있어서, 상기 제1 프로브의 5' 방향으로 업스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 5'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위에 위치하는 것을 특징으로 하는 방법.
  42. 제37항에 있어서, 제1 프로브의 제1 퀀처 분자 및 제2 프로브의 제2 퀀처 분자는 동일한 유형의 퀀처 분자인 것을 특징으로 하는 방법.
  43. 제37항에 있어서, 상기 상이한 Tm 값을 가지는 제1 프로브 및 제2 프로브를 포함하는 조성물은 상기 타겟 핵산 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위(signal-changing temperature range; SChTR) 및 상기 타겟 핵산이 존재하여도 시그널이 일정한 두 개의 시그널-일정 온도 범위(signal-constant temperature range; SCoTR)를 가지는 것을 특징으로 하는 방법.
  44. 제43항에 있어서, 상기 시그널-변화 온도 범위는 2개의 시그널-일정 온도 범위 중 제1 시그널-일정 온도 범위보다 높고, 2개의 시그널-일정 온도 범위 중 제2 시그널-일정 온도 범위보다는 낮은 것을 특징으로 하는 방법.
  45. 제44항에 있어서, 상기 타겟 핵산 존재 하에, 상기 제1 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 타겟 핵산에 혼성화되어 있는 것을 특징으로 하는 방법.
  46. 제44항에 있어서, 상기 타겟 핵산 존재 하에, 상기 제2 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 타겟 핵산에 혼성화되어 있지 않는 것을 특징으로 하는 방법.
  47. 제44항에 있어서, 상기 타겟 핵산 존재 하에, 상기 시그널-변화 온도 범위 내의 온도에서 상기 제1 프로브는 상기 타겟 핵산에 혼성화되지만 상기 제2 프로브는 상기 타겟 핵산에 혼성화되지 않는 것을 특징으로 하는 방법.
  48. 제43항에 있어서, 상기 시그널-변화 온도 범위는 상기 제1 프로브 및 상기 제2 프로브의 Tm 값들에 의존적인 것을 특징으로 하는 방법.
  49. 제37항에 있어서, 상기 단계 (b)에서 검출된 시그널은 상기 타겟 핵산 존재에 의존적인 시그널인 것을 특징으로 하는 방법.
  50. 제43항에 있어서, 상기 단계 (b)는 상기 시그널-변화 온도 범위 내에서 선택된 검출 온도에서 실시되는 것을 특징으로 하는 방법.
  51. 제37항에 있어서, 상기 인큐베이션은 핵산 증폭 반응을 포함하는 것을 특징으로 하는 방법.
  52. 제37항에 있어서, 상기 단계 (a)의 인큐베이션은 복수의 사이클을 포함하고, 상기 단계 (b)의 시그널의 검출은 상기 복수의 사이클 중 최소 1개의 사이클에서 실시되는 것을 특징으로 하는 방법.
  53. 제52항에 있어서, 상기 단계 (c)의 타겟 핵산의 존재는 시그널 변화에 의해 결정되고, 상기 시그널 변화는 상기 복수의 사이클 중 최소 1개의 사이클에서 검출된 시그널과 기준 시그널 값을 이용하여 측정되는 것을 특징으로 하는 방법.
  54. 제53항에 있어서, 상기 기준 시그널 값은 상기 타겟 핵산이 부존재하는 반응으로부터 얻어진 것을 특징으로 하는 방법.
  55. 제37항에 있어서, 상기 단계 (a)의 인큐베이션은 복수의 사이클을 포함하고, 상기 단계 (b)의 시그널의 검출은 상기 복수의 사이클 중 최소 2개의 사이클에서 실시되는 것을 특징으로 하는 방법.
  56. 제52항에 있어서, 상기 단계 (c)의 타겟 핵산의 존재는 시그널 변화에 의해 결정되고, 상기 시그널 변화는 상기 복수의 사이클 중 최소 2개의 사이클에서 검출된 시그널들을 이용하여 측정되는 것을 특징으로 하는 방법.
  57. 다음을 포함하는 샘플 내 타겟 핵산 검출용 조성물:
    (a) 상기 타겟 핵산의 제1 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하는 제1 프로브;
    상기 제1 프로브는 리포터 분자 및 제1 퀀처 분자를 가지며,
    상기 리포터 분자 및 제1 퀀처 분자는 (i) 상기 제1 프로브가 상기 타겟 핵산에 혼성화하기 전에는 상기 리포터 분자 및 상기 제1 퀀처 분자는 서로 근접하고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시키고, 및 (ii) 상기 제1 프로브와 상기 타겟 핵산이 혼성화하면, 상기 리포터 분자와 상기 제1 퀀처 분자는 분리되고, 이로 인해, 상기 제1 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭시킬 수 있는 위치에 존재하고; 및
    (b) 상기 타겟 핵산의 제2 영역에 대한 혼성화 뉴클레오타이드 서열을 포함하는 제2 프로브;
    상기 제2 프로브는 제2 퀀처 분자를 가지며,
    상기 제1 프로브의 Tm 값은 제2 프로브의 Tm 값 보다 높고, 및
    상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화되는 경우, 제1 프로브의 리포터 분자는 제2 프로브의 제2 퀀처 분자에 의해 퀀칭된다.
  58. 제57항에 있어서, 상기 제1 프로브 및 상기 제2 프로브가 상기 타겟 핵산에 혼성화하면, 상기 제2 프로브의 제2 퀀처 분자는 상기 제1 프로브의 리포터 분자와 인접하고, 이로 인해, 상기 제2 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭시킬 수 있는 위치에 상기 리포터 분자 및 제2 퀀처 분자가 존재하는 것을 특징으로 하는 조성물.
  59. 제57항에 있어서, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위 또는 5'-말단 부위에 연결되어 있는 것을 특징으로 하는 조성물.
  60. 제57항에 있어서, 상기 제1 프로브의 3' 방향으로 다운스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 3'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 5'-말단 부위에 위치하는 것을 특징으로 하는 조성물.
  61. 제57항에 있어서, 상기 제1 프로브의 5' 방향으로 업스트림에 상기 제2 프로브가 상기 대응하는 타겟 핵산에 혼성화되는 경우, 상기 리포터 분자는 상기 제1 프로브의 5'-말단 부위에 위치하며, 상기 제2 퀀처 분자는 상기 제2 프로브의 3'-말단 부위에 위치하는 것을 특징으로 하는 조성물.
  62. 제57항에 있어서, 제1 프로브의 제1 퀀처 분자 및 제2 프로브의 제2 퀀처 분자는 동일한 유형의 퀀처 분자인 것을 특징으로 하는 조성물.
  63. 제57항에 있어서, 상기 조성물은 상기 타겟 핵산 존재에 의존적으로 시그널이 변화하는 시그널-변화 온도 범위(signal-changing temperature range; SChTR) 및 상기 타겟 핵산이 존재하여도 시그널이 일정한 두 개의 시그널-일정 온도 범위(signal-constant temperature range; SCoTR)를 가지는 것을 특징으로 하는 조성물.
  64. 제63항에 있어서, 상기 시그널-변화 온도 범위는 2개의 시그널-일정 온도 범위 중 제1 시그널-일정 온도 범위보다 높고, 2개의 시그널-일정 온도 범위 중 제2 시그널-일정 온도 범위보다는 낮은 것을 특징으로 하는 조성물.
  65. 제64항에 있어서, 상기 타겟 핵산 존재 하에, 상기 제1 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 타겟 핵산에 혼성화되어 있는 것을 특징으로 하는 조성물.
  66. 제64항에 있어서, 상기 타겟 핵산 존재 하에, 상기 제2 시그널-일정 온도 범위 내의 온도에서 상기 제1 프로브 및 제2 프로브는 상기 타겟 핵산에 혼성화되어 있지 않는 것을 특징으로 하는 조성물.
  67. 제64항에 있어서, 상기 타겟 핵산 존재 하에, 상기 시그널-변화 온도 범위 내의 온도에서 상기 제1 프로브는 상기 타겟 핵산에 혼성화되지만 상기 제2 프로브는 상기 타겟 핵산에 혼성화되지 않는 것을 특징으로 하는 조성물.
  68. 제63항에 있어서, 상기 시그널-변화 온도 범위는 상기 제1 프로브 및 상기 제2 프로브의 Tm 값들에 의존적인 것을 특징으로 하는 조성물.
PCT/KR2023/015809 2022-10-14 2023-10-13 상이한 tm 값을 가지는 2개의 프로브를 이용하여 샘플 내 타겟 핵산을 검출하는 방법 WO2024080818A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220132461 2022-10-14
KR10-2022-0132461 2022-10-14

Publications (1)

Publication Number Publication Date
WO2024080818A1 true WO2024080818A1 (ko) 2024-04-18

Family

ID=90669962

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/015809 WO2024080818A1 (ko) 2022-10-14 2023-10-13 상이한 tm 값을 가지는 2개의 프로브를 이용하여 샘플 내 타겟 핵산을 검출하는 방법

Country Status (1)

Country Link
WO (1) WO2024080818A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040229253A1 (en) * 2003-02-18 2004-11-18 Hyldig-Nielsen Jens J. Compositions and methods for multiplex analysis of polynucleotides
KR20100134139A (ko) * 2008-05-06 2010-12-22 키아겐 게엠베하 반응에서 다중 핵산 서열의 동시 검출
WO2019203623A1 (en) * 2018-04-20 2019-10-24 Seegene, Inc. . Method and apparatus for detecting a plurality of target nucleic acid sequences in sample
US20200392568A1 (en) * 2013-11-19 2020-12-17 Brandeis University Multiplex target detection assay
KR102358734B1 (ko) * 2014-03-28 2022-02-08 주식회사 씨젠 상이한 검출 온도를 이용한 타겟 핵산 서열의 검출

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040229253A1 (en) * 2003-02-18 2004-11-18 Hyldig-Nielsen Jens J. Compositions and methods for multiplex analysis of polynucleotides
KR20100134139A (ko) * 2008-05-06 2010-12-22 키아겐 게엠베하 반응에서 다중 핵산 서열의 동시 검출
US20200392568A1 (en) * 2013-11-19 2020-12-17 Brandeis University Multiplex target detection assay
KR102358734B1 (ko) * 2014-03-28 2022-02-08 주식회사 씨젠 상이한 검출 온도를 이용한 타겟 핵산 서열의 검출
WO2019203623A1 (en) * 2018-04-20 2019-10-24 Seegene, Inc. . Method and apparatus for detecting a plurality of target nucleic acid sequences in sample

Similar Documents

Publication Publication Date Title
WO2015068957A1 (en) Method for the detection of multiple target nucleic acids using clamping probes and detection probes
WO2017188669A2 (ko) 절단된 상보적인 태그 절편을 이용한 표적 핵산 서열 검출 방법 및 그 조성물
WO2011149255A9 (en) Modified rnase h and detection of nucleic acid amplification
CN101855362A (zh) 用于检测肺炎链球菌的引物和探针
WO2019013451A1 (ko) 유전자 변이 특이성이 증가된 dna 중합효소 및 이의 활성 증가용 pcr 버퍼 조성물
WO2017122896A1 (ko) 수산생물전염병 원인바이러스의 판별 및 검출용 유전자 마커,및 이를 이용한 원인바이러스의 판별 및 검출 방법
WO2020218831A1 (ko) 신규한 등온 단일 반응용 프로브 세트 및 이의 용도
WO2019107893A2 (ko) 표적핵산 증폭방법 및 표적핵산 증폭용 조성물
WO2024080818A1 (ko) 상이한 tm 값을 가지는 2개의 프로브를 이용하여 샘플 내 타겟 핵산을 검출하는 방법
WO2022045843A1 (en) Method for positive control reaction using pre-positive control composition
WO2024106890A1 (ko) 퀀칭-pto 절단 및 연장(quenching-pto cleavage and extension; q-ptoce) 어세이에 의한 타겟 핵산의 검출
WO2022265463A1 (en) Detection of multiple target nucleic acid using multiple detection temperatures
WO2020145715A1 (ko) Tert 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트
WO2023106866A1 (ko) 단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머 및 이를 이용한 핵산 등온 증폭 방법
WO2023043280A1 (ko) 합성 비자연 염기를 포함하는 태그 올리고뉴클레오타이드를 이용한 타겟 핵산 서열의 검출
WO2016190654A1 (ko) 상보적 염기서열과 미스-매치된 염기서열 그리고 reporter와 quencher를 포함하는 이중 기능성 올리고뉴클레오타이드 및 이를 이용한 핵산 증폭 및 측정 방법
WO2020122679A1 (en) Method for detecting a target analyte in a sample using an s-shaped function for a slope data set
WO2023195780A1 (en) Method for detecting three target nucleic acids in sample
WO2011139032A2 (ko) 표적 유전자의 다양한 변이가 존재하는 유전자 영역을 증폭하기 위한 프라이머 조성물
WO2019022520A1 (ko) 핵산 복합체 페어, 경쟁 구조체, 이를 이용한 pcr 키트
EP4301880A1 (en) Method for detection of sars-cov-2 mutations
WO2015167087A1 (ko) Dna 복제수 변이를 이용한 강직성 척추염 발병 위험도 예측 방법
WO2023075569A1 (ko) 분할된 t7 프로모터를 이용한 등온 단일 반응용 프로브 세트 및 이의 용도
WO2024005458A1 (ko) 베타-하이드록시산을 이용한 타겟 핵산의 증폭 방법
WO2020145734A1 (ko) Braf 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23877741

Country of ref document: EP

Kind code of ref document: A1