WO2023283962A1 - Capside aav modifiée pour thérapie génique et méthodes associées - Google Patents

Capside aav modifiée pour thérapie génique et méthodes associées Download PDF

Info

Publication number
WO2023283962A1
WO2023283962A1 PCT/CN2021/106935 CN2021106935W WO2023283962A1 WO 2023283962 A1 WO2023283962 A1 WO 2023283962A1 CN 2021106935 W CN2021106935 W CN 2021106935W WO 2023283962 A1 WO2023283962 A1 WO 2023283962A1
Authority
WO
WIPO (PCT)
Prior art keywords
aav
aav9
cell
certain embodiments
raav
Prior art date
Application number
PCT/CN2021/106935
Other languages
English (en)
Inventor
Linyu SHI
Weiya BAI
Original Assignee
Huigene Therapeutics Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huigene Therapeutics Co., Ltd. filed Critical Huigene Therapeutics Co., Ltd.
Priority to PCT/CN2021/106935 priority Critical patent/WO2023283962A1/fr
Priority to CN202280054384.8A priority patent/CN117858891A/zh
Priority to PCT/CN2022/106118 priority patent/WO2023284879A1/fr
Publication of WO2023283962A1 publication Critical patent/WO2023283962A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14145—Special targeting system for viral vectors

Definitions

  • Adeno-associated virus as a vector AAV is a single-stranded DNA parvovirus, the genome of which comprises the rep gene and the cap gene flanked by two inverted terminal repeats (ITRs) .
  • the rep gene encodes, from a single ORF, Rep78, Rep68, Rep52 and Rep40, which aid AAV genome replication and virion assembly.
  • Three capsid proteins (VP1, VP2 and VP3) are generated from a single cap ORF but are regulated by transcription from a rare start codon (ACG) and alternative splicing. As a result, VP1 and VP2 have the same amino acids as VP3 in their C-terminus.
  • assembly-activating protein which is essential for capsid assembly, is encoded from an in-frame shifted ORF within the cap gene.
  • All AAV virions are composed of 60 VP subunits at a 1: 1: 10 ratio of VP1: VP2: VP3.
  • VP3 assembly-activating protein
  • Comparison of the AAV VP3 structure among various serotypes has revealed highly homologous sequences interspersed with more evolutionary divergent areas. These amino acid stretches are commonly designated as variable regions (VRs) I through IX.
  • VRs are localized at the surface of the assembled capsid and are assumed to be responsible for the capsid interaction with cell surface receptors and other host factors. Because of their location, VRs are also predicted to be less critical for capsid assembly. Therefore, the guiding principle of the capsid’s design to obtain novel AAV vectors was to modify only surface VRs while keeping the backbone sequence unchanged to maintain the integrity of the assembling scaffold.
  • rAAV Recombinant adeno-associated viruses
  • rAAVs are vectors used for in vivo gene transfer to carry out gene therapies and facilitate the gene transfer critical for a wide variety of basic science studies and clinical gene therapies.
  • rAAVs Several characteristics make rAAVs attractive as gene delivery vehicles: (i) they provide long-term transgene expression, (ii) they are not associated with any known human disease, (iii) they elicit relatively weak immune responses, (iv) they are capable of transducing a variety of dividing and non-dividing cell types and (v) the rAAV genome can be packaged into a variety of capsids, or protein coat of the virus, which have different transduction characteristics and tissue tropisms.
  • rAAV-gene based therapy has been successful in pre-clinical models in a variety of diseases including Rett syndrome, congenital ALS, Parkinson's , Huntington's disease and so on.
  • AAV vectors constitute valuable gene delivery tools, there is still a strong demand for the development of improved AAVs.
  • the successful use of rAAVs for the treatment of diseases and for scientific studies has been constrained by the lack of capsid serotypes that can efficiently transduce certain difficult cell types or tissues. And AAV vectors with greater transduction efficacy are always required to help patients get desired therapeutic effects with the lowest drug dose.
  • One aspect of the invention provides a modified adeno-associated virus (mAAV) capsid protein comprising a retargeting peptide of SEQ ID NO: 4 inserted into, and/or substituting one or more residues of, a wild-type adeno-associated virus (AAV) capsid protein at any one of subdomains IV-VIII of the GH loop of the wild-type AAV capsid protein.
  • mAAV modified adeno-associated virus
  • the retargeting peptide is inserted into, and/or substitutes said one or more residues of subdomain VIII of GH loop.
  • the retargeting peptide is inserted into and substitutes two residues corresponding to wild-type AAV9 VP1 capsid protein residues A587 and Q588.
  • the retargeting peptide comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 1.
  • the retargeting peptide comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 2.
  • the retargeting peptide comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 3.
  • the wild-type adeno-associated virus (AAV) capsid protein is AAV9 VP1, AAV9 VP2, or AAV9 VP3.
  • the mAAV capsid protein further comprises one or more additional mutation (s) other than the incorporated retargeting peptide.
  • mAAV modified adeno-associated virus
  • capsid protein comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 25.
  • mAAV modified adeno-associated virus
  • capsid protein comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 26.
  • mAAV modified adeno-associated virus
  • capsid protein comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 27.
  • Another aspect of the invention provides a recombinant adeno-associated virus (rAAV) viral particle, comprising a polynucleotide encapsidated within a capsid shell comprising an mAAV capsid polypeptide of the invention.
  • rAAV adeno-associated virus
  • the polynucleotide comprises a gene of interest (GOI) flanked by a 5’ ITR, a 3’ ITR, or both.
  • GOI gene of interest
  • the gene of interest is (a) a nucleic acid sequence encoding a trophic factor, a growth factor, or a soluble protein; (b) a cDNA that restores protein function to humans or animals harboring a genetic mutation (s) in that gene; (c) a cDNA that encodes a protein that can be used to control or alter the activity or state of a cell; (d) a cDNA that encodes a protein or a nucleic acid used for assessing the state of a cell; (e) a cDNA and/or associated guide RNA for performing genomic engineering; (f) a sequence for genome editing via homologous recombination; (g) a DNA sequence encoding a therapeutic RNA; (h) a shRNA or an artificial miRNA delivery system; and/or (i) a DNA sequence that influences the splicing of an endogenous gene.
  • the gene of interest is: RPE65, REP1, LRAT, GRP143, TYR, BEST1, MERTK, MYO7A, ADAM9, RGR, RS1, CEP290, RPGR, BBS4, USH2D, RPGRIP, TULP1, CRB1, GUCY2D, AIPL1, CRX, ABCA4, PDE6B, RHO, PRPH2, NR2E3, NRL, CNGA3, CNGB3, GNAT2, PDE6C, RLBP1, ND4, or an agent that antagonize the function /expression thereof.
  • the gene of interest is operatively linked to a transcriptional regulatory cassette comprising a promoter, such as a constitutive promoter, or a retina specific promoter (e.g., a promoter from GFAP, RLBP1, ProB2, Human RHO, RHOK, GRK1, Human blue opsin HB570, Human blue opsin HB569, PR0.5, PR1.7, PR2.1, 3LCR-PR0.5, hIRBP, IRBPe/GNAT2, CAR/ARR3, Crx2kb, ProA1, ProA4, ProC1, mGrm6, ProB4, Cabp5, Human red opsin, G1.7p, hRPE65p, NA65p, VMD2, or RS1) , and optionally an enhancer that modulates transcription from the constitutive promoter or the retina specific promoter.
  • a promoter such as a constitutive promoter, or a retina specific promoter
  • a retina specific promoter e.g., a promoter from GFAP, RL
  • the gene of interest is: apolipoprotein E (ApoE) , apoE2, survival motor neuron 1 (SMN1) , acid alpha-glucosidase (GAA) , battenin, aspartoacylase protein (ASPA) , Aromatic L-amino acid decarboxylase (AADC) , lysosomal tripeptidyl peptidase I (TPP1) , lysosomal acid ⁇ -galactosidase ( ⁇ gal) , N-sulfoglycosamine sulfohydrolase (SGSH) , alpha-N-acetylglucosaminidase (NAGLU) , iduronate 2-sulfatase (IDS) , NPC1, frataxin (FXN) , gigaxonin, Glial cell line-derived neurotrophic factor (GDNF) , CLN6 Transmembrane ER Protein, alpha-Apoprotein
  • the gene of interest is operatively linked to a transcriptional regulatory cassette, such as a constitutive promoter, or a CNS specific promoter (e.g., a promoter from Syn1, NSE, GFAP, MAG, MBP, F4/80, CD68, PAG, vGLUT, or GAD) , and optionally an enhancer that modulates transcription from the constitutive promoter or the CNS-specific promoter.
  • a transcriptional regulatory cassette such as a constitutive promoter, or a CNS specific promoter (e.g., a promoter from Syn1, NSE, GFAP, MAG, MBP, F4/80, CD68, PAG, vGLUT, or GAD)
  • a CNS specific promoter e.g., a promoter from Syn1, NSE, GFAP, MAG, MBP, F4/80, CD68, PAG, vGLUT, or GAD
  • an enhancer that modulates transcription from the constitutive promoter or the CNS-specific promote
  • the encapsidated polynucleotide further comprises: 1) an enhancer; 2) an intron or an exon that promotes the expression of the GOI; 3) a WPRE sequence; 4) a 5’ UTR coding sequence; 5) a 3’ UTR coding sequence; 6) an miRNA detargeting sequence; and/or 7) a polyA signal sequence.
  • Another aspect of the invention provides a polynucleotide encoding the modified adeno-associated virus (mAAV) capsid protein of the invention, a polynucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%sequence identity thereof.
  • mAAV modified adeno-associated virus
  • the polynucleotide is codon-optimized for mammalian expression.
  • Another aspect of the invention provides a vector comprising the polynucleotide of the invention.
  • the vector is a plasmid or a viral vector (e.g., HSV or baculovirus vector) .
  • Another aspect of the invention provides a host cell comprising the modified adeno-associated virus (mAAV) capsid protein of the invention, the rAAV viral particle of the invention, the polynucleotide of the invention, or the vector of the invention.
  • mAAV modified adeno-associated virus
  • Another aspect of the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising the modified adeno-associated virus (mAAV) capsid protein of the invention, the rAAV viral particle of the invention, the polynucleotide of the invention, or the vector of the invention.
  • mAAV modified adeno-associated virus
  • Another aspect of the invention provides a method of treating a ocular disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the rAAV of the invention.
  • the gene of interest of the rAAV when compared to an otherwise identical reference rAAV with wild type AAV9 capsid, is preferentially expressed in a retinal cell.
  • the retinal cell is selected from the group consisting of: a photoreceptor (e.g., a rod cell; a cone cell) , a retinal ganglion cell (RGC) , a muller cell (amuller glial cell) , a bipolar cell, an amacrine cell, a horizontal cell, or a retinal pigment epithelium (RPE) cell.
  • a photoreceptor e.g., a rod cell; a cone cell
  • RRC retinal ganglion cell
  • a muller cell amuller glial cell
  • bipolar cell e.g., an amacrine cell
  • amacrine cell e.g., a amacrine cell
  • horizontal cell e.g., a horizontal cell
  • RPE retinal pigment epithelium
  • the ocular disease or disorder is one or more selected from the group consisting of dry eye syndrome (e.g., DES, Chronic dry eye, Keratitis sicca; Xerophthalmia; Keratoconjunctivitis sicca) , Sjogren's syndrome, uveitis, noninfectious uveitis, anterior uveitis (iritis) , chorioretinitis, posterior uveitis, conjunctivitis, allergic conjunctivitis, keratitis, keratoconjunctivitis, vernal keratoconjunctivitis (VKC) , atopic keratoconjunctivitis, systemic immune mediated diseases such as cicatrizing conjunctivitis and other autoimmune disorders of the ocular surface, blepharitis, scleritis, age-related macular degeneration (AMD) , diabetic retinopathy (DR) , diabetic
  • Another aspect of the invention provides a method of treating a central nervous system (CNS) disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the rAAV of the invention.
  • CNS central nervous system
  • the gene of interest of the rAAV when compared to an otherwise identical reference rAAV with wild type AAV9 capsid, is preferentially expressed in a CNS cell.
  • the CNS cell is selected from the group consisting of: a neuron, a glial cell, and a vascular cell.
  • the CNS disease or disorder is selected from the group consisting of: brain or spinal cord injury, Bell's palsy, cervical spondylosis, carpal tunnel syndrome, brain or spinal cord tumors, peripheral neuropathy, Guillain-Barré syndrome, headache, epilepsy, dizziness, and neuralgia.
  • Another aspect of the invention provides a method of producing rAAV, wherein the rAAV comprises the mAAV capsid protein of the invention, the method comprising introducing an rAAV vector encoding a gene of interest to a producing or packaging cell line expressing the mAAV capsid protein of the invention.
  • the producing or packaging cell line is infected with a vector encoding the mAAV capsid protein of the invention.
  • the producer or packaging cell line is HEK293, HEK293T, A549, sf9 (insect cells) , or HeLa cells.
  • Another aspect of the invention provides a retargeting peptide comprising, consisting essentially of, or consisting of SEQ ID NO: 4, such as any one of SEQ ID NOs: 1-3.
  • the retargeting peptide when incorporated into subdomain VIII of the GH loop of the VP1, VP2, and/or VP3 capsid protein of AAV9, confers tropism for retinal tissues /cells and CNS.
  • FIG. 1A Schematic diagram of the capsid variants of the invention.
  • FIG. 1B Amino acid sequence of the inserted peptides in the capsid variants.
  • FIG. 2A Fluorescence microscopic evaluation of tdTomato expression in cross sections of the retinal tissue 4 weeks after intravitreal injection.
  • FIG. 2B Fluorescence microscopic evaluation of tdTomato expression in cross sections of the retinal tissue 4 weeks after intravitreal injection.
  • RPE retinal pigment epithelial
  • ONL outer nuclear layer
  • INL inner nuclear layer
  • GCL layer of ganglion cells.
  • FIG. 3A Fluorescence microscopic evaluation of tdTomato expression in cross sections of the retinal tissue 4 weeks after subretinal injection.
  • FIG. 3B Fluorescence microscopic evaluation of tdTomato expression in cross sections of the retinal tissue 4 weeks after subretinal injection.
  • RPE retinal pigment epithelial
  • ONL outer nuclear layer
  • INL inner nuclear layer
  • GCL layer of ganglion cells.
  • FIG. 4A Fluorescence microscopic evaluation of tdTomato expression in sagittal sections of the brain 4 weeks after intrathecal injection.
  • FIG. 4B Fluorescence microscopic evaluation of tdTomato expression in transverse sections of the spine cord 4 weeks after intrathecal injection.
  • FIG. 5 shows a multi-sequence alignment of AAV1-AAV13 VP1 capsids, including the conserved domains and variable sequences within the GH loop (about 230 amino acids, located between the ⁇ G and ⁇ H strands) , including subdomains IV-VIII of the GH loop.
  • Sequences 1-14 are AAV9 (SEQ ID NO: 15) , AAV1 (SEQ ID NO: 6) , AAV2 (SEQ ID NO: 7) , AAV3A (SEQ ID NO: 8) , AAV3B (SEQ ID NO: 9) , AAV4 (SEQ ID NO: 10) , AAV5 (SEQ ID NO: 11) , AAV6 (SEQ ID NO: 12) , AAV7 (SEQ ID NO: 13) , AAV8 (SEQ ID NO: 14) , AAV10 (SEQ ID NO: 16) , AAV11 (SEQ ID NO: 17) , AAV12 (SEQ ID NO: 18) , and AAV13 (SEQ ID NO: 19) .
  • Consensus sequence is SEQ ID NO: 5.
  • FIG. 6 shows a phylogenetic tree of the various Clades of AAV capsids.
  • the invention described herein provides modified AAV capsids with altered tropism compared to the wild-type AAV9 capsid from which the modified capsids derive, and a recombinant AAV (rAAV) viral particle comprising an AAV viral capsid shell comprising such modified AAV capsid proteins.
  • rAAV recombinant AAV
  • the invention is partly based on the surprising discovery that certain retargeting peptides of the invention can be inserted into and/or substituting certain residues of the wild-type AAV sequences, particularly sequences within the GH loop, including GH loop subdomains IV-VIII (e.g., subdomain VIII) , to alter tropism.
  • certain retargeting peptides of the invention can be inserted into and/or substituting certain residues of the wild-type AAV sequences, particularly sequences within the GH loop, including GH loop subdomains IV-VIII (e.g., subdomain VIII) , to alter tropism.
  • substitution of two residues in subdomain VIII of the GH loop in the wild-type AAV9 capsid -which corresponds to residues A587 and Q588 of the wild-type AAV9 VP1 capsid protein -with any one of several subject retargeting peptides led to altered tropism of the wt AAV9, with enhanced tropism towards tissues such as retina and CNS.
  • AAV viral vectors comprising such modified AAV capsids may be used to enhance delivery of any gene of interest to the retina or CNS as a target tissue, using any suitable delivery means (such as transduction via intravitreal injection or subretinal injection to the retina, and transduction via lumbar puncture-intrathecal injection to the CNS) .
  • the rAAV viral particles of the invention can be used to deliver a DNA (e.g., single-stranded DNA) or RNA nucleic acid comprising any transgene or gene of interest (GOI) of suitable length (e.g., within the packaging limit of the various AAVs) to a host cell compatible with the tropism of the AAV capsid shell.
  • a DNA e.g., single-stranded DNA
  • RNA nucleic acid comprising any transgene or gene of interest (GOI) of suitable length (e.g., within the packaging limit of the various AAVs)
  • a host cell compatible with the tropism of the AAV capsid shell.
  • the rAAV vectors are referred to herein as AAV vectors or rAAV vectors.
  • AAV or rAAV vectors can comprise DNA or RNA viral genetic material.
  • One aspect of the invention provides a retargeting peptide that, when incorporated into an AAV capsid, such as in subdomain IV or VIII of the GH loop of the VP1, VP2, and/or VP3 of the AAV capsid (e.g., AAV9) , confers tropism for retinal tissues /cells and CNS.
  • an AAV capsid such as in subdomain IV or VIII of the GH loop of the VP1, VP2, and/or VP3 of the AAV capsid (e.g., AAV9) , confers tropism for retinal tissues /cells and CNS.
  • the retargeting peptide of the invention is about 6-14 residues in length. In certain embodiments, the retargeting peptide of the invention is about 6 residues in length. In certain embodiments, the retargeting peptide of the invention is about 7 residues in length. In certain embodiments, the retargeting peptide of the invention is about 8 residues in length. In certain embodiments, the retargeting peptide of the invention is about 9 residues in length. In certain embodiments, the retargeting peptide of the invention is about 10 residues in length. In certain embodiments, the retargeting peptide of the invention is about 11 residues in length.
  • the retargeting peptide of the invention is about 12 residues in length. In certain embodiments, the retargeting peptide of the invention is about 13 residues in length. In certain embodiments, the retargeting peptide of the invention is about 14 residues in length.
  • the retargeting peptide of the invention is about 9 or 10 residues in length, and is represented by Formula I:
  • X1-X10 each represent an amino acid as defined below; optionally, one of X2-X6, such as X5 or X6, may be absent (e.g., X5 may be absent, or X6 may be absent, but both are not absent) ;
  • X1 is D, E, N or Q, e.g., D or E;
  • X2 is A, G, S, T, L, I, V, or absent, e.g., A, S, T or G (such as A or G) ;
  • X3 is T, S, P, A, G, or absent, e.g., T or S;
  • X4 is V, L, I, G, A, or absent, e.g., V, L, or I;
  • X5 is A, G, S, T, L, I, V, or absent, e.g., A, S, T, or G (such as A or G) ;
  • X6 is A, G, S, T, L, V, or absent, e.g., A, S, T, or G (e.g., A or G) ;
  • X7 is V, L, I, G or A, e.g., V, L, or I;
  • X8 is F, Y, or P, e.g., F or P;
  • X9 is F, Y, or P, e.g., F or P;
  • X10 is K, R, H, N, or Q, e.g., K, R, or H (such as K or R) .
  • the retargeting peptide of SEQ ID NO: 4 when the retargeting peptide of SEQ ID NO: 4 is inserted into an AAV capsid, it is flanked by up to 4 residues (e.g., L1 and L2 N-terminal to X1, and/or L3-L4 C-terminal to X10) , wherein L1-L4 can independently either be naturally present in the AAV capsids, or are not naturally present in the wt AAV capsid.
  • L1 and L2 N-terminal to X1, and/or L3-L4 C-terminal to X10 residues
  • L1-L4 can independently either be naturally present in the AAV capsids, or are not naturally present in the wt AAV capsid.
  • L1-L4 each represents an optional linker amino acid that together flank the retargeting peptide sequences at the N-terminal (L1 and L2) and/or the C-terminal end (L3 and L4) .
  • each of L1, L2, L3 and L4, if present, is independently any amino acids.
  • each of L1-L4 is independently selected from A, Q, L, I, V, G, S and T.
  • each of L1-L4 is independently selected from A, Q, G and S.
  • L1-L2 are /correspond to AAV9 VP1 residues Q585-S586 or A587-Q588, and/or L3-L4 are /correspond to AAV9 VP1 residues A589-Q590
  • the retargeting peptide comprises, consisting essentially of, or consists of SEQ ID NO: 1 (EATVGLFPK) .
  • the retargeting peptide comprises, consisting essentially of, or consists of SEQ ID NO: 2 (EATLAAVFPK) .
  • the retargeting peptide comprises, consisting essentially of, or consists of SEQ ID NO: 3 (EATLGIFPK) .
  • tropism-altering or retargeting peptides of the invention can be inserted into various wild-type AAV capsids (such as wild-type AAV9 capsids) to alter their tropism.
  • AAV serotypes known in the art such as the one listed in the section above, share considerable degrees of sequence and structural similarity, such that the tropism-altering or retargeting peptides of the invention can be inserted into AAV capsids other than the wild-type AAV9 capsids as illustrated herein, and lead to altered tropism of these modified non-AAV9-based capsids.
  • the X-ray crystallography structure of one of the first AAV capsids –AAV2 VP1 – was resolved at 3A resolution in 2002 (Xie, Proc. Natl. Acad. Sci. USA. 99: 10405-10410, 2002) , and provided the crucial knowledge to facilitate further retargeting modifications of AAV2 and the other serotypes.
  • amino acid sequence alignments of AAV2 the canine parvovirus whose crystal structure was previously determined (Tsao, Science 251: 1456-1464, 1991)
  • the other AAV serotypes as well as other neutralizing antibody binding data such as epitope mapping and mutagenesis, together have provided a wealth of information about certain surface-displayed domains and regions in AAV capsids that interfere with primary receptor binding, thus serving as a general guide to positioning insertions of foreign epitopes.
  • Xie (supra) noted that there are striking similarities and differences among the crystal structures of AAV2 and the other crystallized parvoviruses.
  • the core of all parvoviruses shares the ⁇ -barrel motif, consisting of anti-parallel ⁇ -sheets.
  • sequence identity of the motif between autonomous and dependoviruses is low, these motifs can be superimposed, suggesting a high degree of functional similarity.
  • the ⁇ -sheets that make up the barrel motif of AAV serotypes all share a high level of sequence identity.
  • the looped-out domains between the ⁇ -sheets generally have less overall identity, with the longest loop located between ⁇ -sheets G and H (or the so-called “GH loop” ) .
  • This GH loop is approximately 230 amino acids in length for the AAV serotypes, as well as many autonomous parvoviruses (Chapman and Rossmann, Structure, sequence, and function correlations among parvoviruses. Virology 194: 491-508, 1993) , and occupies greater than one-third of the total structure.
  • the size of the GH loop although similar between AAV serotypes and autonomous parvoviruses, is the most divergent of any sequence in the capsid. This low homology at the amino acid level is reflected in surface topology differences and in epitopes for receptor binding.
  • AAV2 has three clusters of three peaks centered about, and separated by about the 3-fold axis of symmetry of the AAV2 capsid.
  • the peaks create a pocket with a diameter of
  • the sequences that compose these structures are all from the GH loop.
  • Similar structures were also found in Aleutian mink disease parvovirus and the insect densovirus which has 96 fewer amino acids in its GH loop.
  • the retargeting peptide of the invention can be inserted into or substituting one or more residues in a variable region or a subdomain inside the GH-loop of the respective AAV wild-type capsids, such as subdomain IV, V, VI, VII, or VIII of the GH loop of any of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and the related AAV capsids in the respective clades to which these AAV capsids belong (see FIG. 6) .
  • AAV9, together with AAVhu31 and AAVhu32 belong to Clade F.
  • AAV capsid VP1 protein sequences including those of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.
  • eB, Anc80L65, Anc80L65AAP, and 7m8, are provided below.
  • AAV1 SEQ ID NO: 6, see line 2 in FIG. 5.
  • AAV2 SEQ ID NO: 7, see line 3 in FIG. 5.
  • AAV3A SEQ ID NO: 8, see line 4 in FIG. 5.
  • AAV3B SEQ ID NO: 9, see line 5 in FIG. 5.
  • AAV4 SEQ ID NO: 10, see line 6 in FIG. 5.
  • AAV5 SEQ ID NO: 11, see line 7 in FIG. 5.
  • AAV6 SEQ ID NO: 12, see line 8 in FIG. 5.
  • AAV7 SEQ ID NO: 13, see line 9 in FIG. 5.
  • AAV8 SEQ ID NO: 14, see line 10 in FIG. 5.
  • AAV9 SEQ ID NO: 15, see line 1 in FIG. 5.
  • AAV10 SEQ ID NO: 16, see line 11 in FIG. 5.
  • AAV11 SEQ ID NO: 17, see line 12 in FIG. 5.
  • AAV12 SEQ ID NO: 18, see line 13 in FIG. 5.
  • AAV-DJ SEQ ID NO: 20.
  • AAV-PHP. eB SEQ ID NO: 21.
  • Anc80L65 SEQ ID NO: 22.
  • Selected capsid sequences are aligned using MUSCLE (MUltiple Sequence Comparison by Log-Expectation) , an online tool available from the EMBL-EBI website using the default parameters, and the results, including consensus sequence, are shown in FIG. 5.
  • MUSCLE MUltiple Sequence Comparison by Log-Expectation
  • the ⁇ G and ⁇ H beta-sheets, and the GH loop sequences in between, of the representative AAV capsids (AAV1-AAV13) , as well as subdomains IV-VIII of these capsids, are labeled in FIG. 5 accordingly.
  • subdomains IV comprises, consists essentially of, or consists of a stretch of AAV capsid residues, the first (i.e., the most N-terminal residue of the stretch) of which is immediately C terminal to the residue corresponding to AAV9 VP1 residue I451, and the last (i.e., the most C-terminal residue of the stretch) of which is immediately N terminal to the residue corresponding to AAV9 VP1 residue L461.
  • the stretch of AAV1 capsid residues in subdomain IV includes residues N451 –D460 of AAV1 VP1
  • the stretch of AAV9 capsid residues in subdomain IV includes residues N452 –T460 of AAV9 VP1.
  • subdomains V comprises, consists essentially of, or consists of a stretch of AAV capsid residues, the first (i.e., the most N-terminal residue of the stretch) of which is immediately C terminal to the residue corresponding to AAV9 VP1 residue Q487, and the last (i.e., the most C-terminal residue of the stretch) of which is immediately N terminal to the residue corresponding to AAV9 VP1 residue A506. That is, the stretch of AAV9 capsid residues in subdomain V includes residues R488 –G505 of AAV9 VP1.
  • subdomains VI comprises, consists essentially of, or consists of a stretch of AAV capsid residues, the first (i.e., the most N-terminal residue of the stretch) of which is immediately C terminal to the residue corresponding to AAV9 VP1 residue S526, and the last (i.e., the most C-terminal residue of the stretch) of which is immediately N terminal to the residue corresponding to AAV9 VP1 residue S540. That is, the stretch of AAV9 capsid residues in subdomain VI includes residues H527 –G539 of AAV9 VP1.
  • subdomains VII comprises, consists essentially of, or consists of a stretch of AAV capsid residues, the first (i.e., the most N-terminal residue of the stretch) of which is immediately C terminal to the residue corresponding to AAV9 VP1 residue G544, and the last (i.e., the most C-terminal residue of the stretch) of which is immediately N terminal to the residue corresponding to AAV9 VP1 residue M559. That is, the stretch of AAV9 capsid residues in subdomain VII includes residues K545 –V558 of AAV9 VP1.
  • subdomains VIII comprises, consists essentially of, or consists of a stretch of AAV capsid residues, the first (i.e., the most N-terminal residue of the stretch) of which is immediately C terminal to the residue corresponding to AAV9 VP1 residue V580, and the last (i.e., the most C-terminal residue of the stretch) of which is immediately N terminal to the residue corresponding to AAV9 VP1 residue G594. That is, the stretch of AAV9 capsid residues in subdomain VIII includes residues A581 –T593 of AAV9 VP1.
  • the retargeting peptide of the invention can be inserted into or substituting one or more residues in subdomain IV (corresponding to residues N452 –T460 of AAV9 VP1) of any of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and the related AAV capsids in the respective Clades to which these AAV capsids belong, such as subdomain IV of AAV9.
  • residues in subdomain IV corresponding to residues N452 –T460 of AAV9 VP1 of any of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and the related AAV capsids in the respective Clades to which these AAV capsids belong, such as subdomain IV of AAV9.
  • the retargeting peptide of the invention can be inserted into or substituting one or more residues in subdomain V (corresponding to residues R488 –G505 of AAV9 VP1) of any of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and the related AAV capsids in the respective Clades to which these AAV capsids belong, such as subdomain V of AAV9.
  • residues in subdomain V corresponding to residues R488 –G505 of AAV9 VP1 of any of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and the related AAV capsids in the respective Clades to which these AAV capsids belong, such as subdomain V of AAV9.
  • the retargeting peptide of the invention can be inserted into or substituting one or more residues in subdomain VI (corresponding to residues H527 –G539 of AAV9 VP1) of any of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and the related AAV capsids in the respective Clades to which these AAV capsids belong, such as subdomain VI of AAV9.
  • residues in subdomain VI corresponding to residues H527 –G539 of AAV9 VP1 of any of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and the related AAV capsids in the respective Clades to which these AAV capsids belong, such as subdomain VI of AAV9.
  • the retargeting peptide of the invention can be inserted into or substituting one or more residues in subdomain VII (corresponding to residues K545 –V558 of AAV9 VP1) of any of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and the related AAV capsids in the respective Clades to which these AAV capsids belong, such as subdomain VII of AAV9.
  • residues in subdomain VII corresponding to residues K545 –V558 of AAV9 VP1 of any of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and the related AAV capsids in the respective Clades to which these AAV capsids belong, such as subdomain VII of AAV9.
  • the retargeting peptide of the invention can be inserted into or substituting one or more residues in subdomain VIII (corresponding to residues A581 – T593, or S586-A589 of AAV9 VP1) of any of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and the related AAV capsids in the respective Clades to which these AAV capsids belong, such as subdomain VIII of AAV9.
  • subdomain VIII corresponding to residues A581 – T593, or S586-A589 of AAV9 VP1 of any of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and the related AAV capsids in the respective Clades to which these AAV capsi
  • Another aspect of the invention provides a recombinant or modified adeno-associated virus (mAAV) capsid protein comprising a retargeting peptide of SEQ ID NO: 4 inserted into, and/or substituting one or more residues of, a wild-type adeno-associated virus (AAV) capsid protein at any one of subdomains IV-VIII of the GH loop of the wild-type AAV capsid protein.
  • mAAV modified adeno-associated virus
  • the retargeting peptide is inserted into, and/or substitutes the one or more residues of subdomain IV of GH loop. In certain embodiments, the retargeting peptide is inserted into, and/or substitutes the one or more residues of subdomain V of GH loop. In certain embodiments, the retargeting peptide is inserted into, and/or substitutes the one or more residues of subdomain VI of GH loop. In certain embodiments, the retargeting peptide is inserted into, and/or substitutes the one or more residues of subdomain VII of GH loop. In certain embodiments, the retargeting peptide is inserted into, and/or substitutes the one or more residues of subdomain VIII of GH loop.
  • the retargeting peptide is inserted into and substitutes two residues corresponding to wild-type AAV9 VP1 capsid protein residues A587 and Q588.
  • the retargeting peptide comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 1 (EATVGLFPK) .
  • the retargeting peptide comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 2 (EATLAAVFPK) .
  • the retargeting peptide comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 3 (EATLGIFPK) .
  • a related aspect of the invention provides a modified adeno-associated virus (mAAV) capsid protein comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 25.
  • a related aspect of the invention provides a modified adeno-associated virus (mAAV) capsid protein comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 26.
  • a related aspect of the invention provides a modified adeno-associated virus (mAAV) capsid protein comprises, consists essentially of, or consists of the polypeptide of SEQ ID NO: 27.
  • Protein sequences of the above representative recombinant AAV9 VP1 based capsids are provided below (peptide insertion bold italics) .
  • the VP1 capsid protein is from AAV9.
  • a recombinant VP1 capsid protein comprising a retargeting peptide insertion comprising 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acids.
  • the recombinant VP1 comprises a deletion comprising 1, 2, 3, 4, or 5 amino acids.
  • substitution of the residues corresponding to A587 and Q588 of wt AAV9 VP1 is by any one of the amino acids sequences such as EATVGLFPK (SEQ ID NO: 1) , EATLAAVFPK (SEQ ID NO: 2) , or EATLGIFPK (SEQ ID NO: 3) .
  • the substitution is by any one of the amino acids sequences has no more than 1, 2, 3, 4, or 5 changes (e.g., conserved substitutions) compared to any one of SEQ ID NOs: 1-3.
  • the peptide insertion is after S586 (AAV9 VP1 numbering) .
  • amino acids A587 and Q588 are deleted.
  • the mAAV capsid protein further comprises one or more additional mutation (s) other than the incorporated retargeting peptide.
  • the mAAV is based on or derived from wild-type AAV9 capsid, such as AAV9 VP1.
  • the modified capsid is otherwise identical to wt AAV VP1 (e.g., wt AAV9 VP1) capsid protein, except for the substitution of residues corresponding to wt AAV9 VP1 residues A587 and Q588 with SEQ ID NO: 4 (such as any one of SEQ ID NOs: 1-3) .
  • the modified AAV capsid protein further comprises one or more changes (e.g., addition, deletion, and/or substitution) in residues other than the substitution corresponding to wt AAV9 VP1 residues A587 and Q588, such that the modified AAV capsid is at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%identical to the corresponding wt AAV VP1 capsid outside the residues corresponding to wt AAV9 VP1 residues A587 and Q588 (i.e., in residues 1-586 and 589
  • the modified AAV capsid protein further comprises no more than 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 amino acid sequence differences compared to wt AAV VP1, other than the substitution corresponding to wt AAV9 VP1 residues A587 and Q588 by SEQ ID NO: 4 (such as any one of SEQ ID NOs: 1-3) .
  • amino acid sequence difference can be assessed by aligning the sequences of the modified AAV capsid with that of the wt AAV (e.g., AAV9) VP1, and count each difference (substitution, deletion and addition) in the sequence alignment as one difference.
  • the mAAV is based on or derived from wild-type AAV capsid VP2, such as wt AAV9 capsid VP2, which corresponds to residues 138-736 of wt AAV9 VP1.
  • residue 1 of wt AAV9 VP2 corresponds to residue 138 of wt AAV9 VP1
  • residues A450 and Q451 of VP2 correspond to residues A587 and Q588 of VP1, respectively.
  • the modified capsid is otherwise identical to wt AAV VP2 (e.g., wt AAV9 VP2) capsid protein, except for the substitution corresponding to wt AAV9 VP2 residues A450 and Q451 with SEQ ID NO: 4 (such as any one of SEQ ID NOs: 1-3) .
  • the modified AAV capsid protein further comprising one or more changes (e.g., addition, deletion, and/or substitution) in residues other than those corresponding to wt AAV9 VP2 A450 and Q451, such that the modified AAV capsid is at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%identical to the corresponding wt AAV VP2 capsid outside the substituted residues corresponding to wt AAV9 VP2 residues A450 and Q451 (i.e., in residues 1-449 and 452-599 of wt AAV9 VP2) .
  • the modified AAV capsid protein further comprises no more than 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 amino acid sequence differences compared to the corresponding wt AAV VP2, other than the substitution of residues corresponding to wt AAV9 VP2 residues A450 and Q451 by SEQ ID NO: 4 (such as any one of SEQ ID NOs: 1-3) .
  • amino acid sequence difference can be assessed by aligning the sequences of the modified AAV capsid with that of the wt AAV (e.g., AAV9) VP2, and count each difference (substitution, deletion and addition) in the sequence alignment as one difference.
  • the mAAV is based on or derived from wild-type AAV capsid VP3, such as wild-type AAV9 capsid VP3, which corresponds to residues 203-736 of wt AAV9 VP1.
  • wild-type AAV9 capsid VP3 corresponds to residue 203 of AAV9 VP1
  • residues A385 and Q386 of VP3 correspond to residues A587 and Q588 of VP1, respectively.
  • the modified capsid is otherwise identical to wt AAV VP3 capsid protein, except for the substitution of residues corresponding to wt AAV9 VP3 residues A385 and Q386 with SEQ ID NO: 4 (such as any one of SEQ ID NOs: 1-3) .
  • the modified AAV capsid protein further comprising one or more changes (e.g., addition, deletion, and/or substitution) in residues other than the substituted residues corresponding to wt AAV9 VP3 residues A385 and Q386, such that the modified AAV capsid is at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%identical to the corresponding wt AAV VP3 capsid outside the substituted residues corresponding to wt AAV9 VP3 residues A385 and Q386 (i.e., in residues 1-384 and 387-534 of wt AAV9 VP3) .
  • one or more changes e.g., addition, deletion, and/or substitution in residues other than the substituted residues corresponding to wt AAV9 VP3 residues A385 and Q386, such that the
  • the modified AAV capsid protein further comprises no more than 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 amino acid sequence differences compared to the corresponding wt AAV VP3, other than the substitution of residues corresponding to wt AAV9 VP3 residues A385 and Q386 by SEQ ID NO: 4 (such as any one of SEQ ID NOs: 1-3) .
  • amino acid sequence difference can be assessed by aligning the sequences of the modified AAV capsid with that of the wt AAV (e.g., AAV9) VP3, and count each difference (substitution, deletion and addition) in the sequence alignment as one difference.
  • rAAV adeno-associated virus
  • AAV or rAAV viral particle includes viral particles comprising a polynucleotide encapsidated within a capsid shell comprising any one or more modified AAV capsid proteins of the invention.
  • the capsid shell may consists of only the subject modified AAV capsids, or may comprise the subject modified AAV capsids as well as any other wild-type or engineered capsids of any adeno-associated virus (AAV) (such as those belonging to the genus Dependoparvovirus, which in turn belongs to the family Parvoviridae) .
  • AAV adeno-associated virus
  • the capsid shell comprises a modified AAV (e.g., AAV9) VP1 capsid as described herein.
  • the capsid shell may further comprise wt AAV (e.g., AAV9) VP1, VP2, and/or VP3.
  • the capsid shell comprises a modified AAV (e.g., AAV9) VP2 capsid as described herein.
  • the capsid shell may further comprise wt AAV (e.g., AAV9) VP1, VP2, and/or VP3.
  • the capsid shell comprises a modified AAV (e.g., AAV9) VP3 capsid as described herein.
  • the capsid shell may further comprise wt AAV (e.g., AAV9) VP1, VP2, and/or VP3.
  • the capsid shell comprises a modified AAV (e.g., AAV9) VP1 capsid and a modified AAV (e.g., AAV9) VP2 capsid as described herein.
  • the capsid shell may further comprise wt AAV (e.g., AAV9) VP1, VP2, and/or VP3.
  • the capsid shell comprises a modified AAV (e.g., AAV9) VP2 capsid and a modified AAV (e.g., AAV9) VP3 capsid as described herein.
  • the capsid shell may further comprise wt AAV (e.g., AAV9) VP1, VP2, and/or VP3.
  • the capsid shell comprises a modified AAV (e.g., AAV9) VP1 capsid and a modified AAV (e.g., AAV9) VP3 capsid as described herein.
  • the capsid shell may further comprise wt AAV (e.g., AAV9) VP1, VP2, and/or VP3.
  • the capsid shell comprises a modified AAV (e.g., AAV9) VP1 capsid, a modified AAV (e.g., AAV9) VP2 capsid, and a modified AAV (e.g., AAV9) VP3 capsid as described herein.
  • the capsid shell may further comprise wt AAV (e.g., AAV9) VP1, VP2, and/or VP3.
  • the capsid shell may further comprise one or more additional VP capsid (s) from non-AAV9 AAV capsid (s) , or non-AAV9 parvoviral capsids.
  • the polynucleotide comprises a gene of interest (GOI) flanked by a 5’ ITR and a 3’ ITR, or one of the ITR’s.
  • the GOI (such as a ssDNA or ssRNA) is linked to a 3’ ITR (but not a 5’ ITR) .
  • the ITR refers to an RNA sequence.
  • the 5’ ITR, the 3’ ITR, or both ITR’s may be from AAV9, a non-AAV9 AAV (such as AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh10, AAVpo. 1, AAV12 etc.
  • the 5’ ITR may be from AAV2 (or AAV9) .
  • the 3’ ITR may be from AAV2 (or AAV9) .
  • both the 5’ and 3’ ITR’s are from AAV2 (or AAV9) .
  • the 5’ ITR, the 3’ ITR, or both are wild-type ITR sequences.
  • one or both ITR’s are modified ITR sequences that may have a mutation, e.g., a deletion, such as a 5’ deletion in the 5’ ITR, or a 3’ deletion in the 3’ ITR, or an internal deletion, so long as the modified ITR contains a functional RBE (Rep binding element) sequence.
  • the modified ITR contains the RBE sequence, a small palindrome that comprises a single tip of an internal hairpin within the terminal repeat (or RBE’ sequence) , and the trs (terminal resolution site) .
  • the GOI can be any gene (s) or coding sequence (s) , including coding sequence for a protein or polypeptide, or a non-protein product, such as any non-translated RNA or non-coding RNA (ncRNA, such as siRNA, piRNA, short hairpin RNA or shRNA, microRNA or miRNA or precursors thereof including pre-miRNA and pri-miRNA, antisense sequence or oligonucleotide (ASO) , guide RNA or gRNA for CRISPR/Cas, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR, ribozyme, aptamer, or other functional polynucleotide that does not encode protein.
  • ncRNA non-coding RNA
  • ASO antisense sequence or oligonucleotide
  • guide RNA or gRNA for CRISPR/Cas rRNA,
  • the GOI is (a) a nucleic acid sequence encoding a trophic factor, a growth factor, or a soluble protein; (b) a cDNA that restores protein function to humans or animals harboring a genetic mutation (s) in that gene; (c) a cDNA that encodes a protein that can be used to control or alter the activity or state of a cell; (d) a cDNA that encodes a protein or a nucleic acid used for assessing the state of a cell; (e) a cDNA and/or associated guide RNA for performing genomic engineering; (f) a sequence for genome editing via homologous recombination; (g) a DNA sequence encoding a therapeutic RNA; (h) a shRNA or an artificial miRNA delivery system; and/or (i) a DNA sequence that influences the splicing of an endogenous gene.
  • the AAV viral vector encapsidated within the modified AAV capsid of the invention comprises a GOI that encodes a protein or polypeptide that remedies a gene defective in a target cell (to be infected by the AAV) , wherein expression of the GOI in the target cell remedies the defect.
  • a target cell having a null or partial loss-of-function mutation in the gene such that the lack of the gene product by the gene is causative of the defect in the target cell, and that expression of the GOI partially or completely restores the function of the gene to remedy the defect.
  • the AAV viral vector encapsidated within the modified AAV capsid of the invention comprises a GOI that encodes an antagonizing agent that remedies a defect in a target cell (to be infected by the AAV) , wherein expression of the antagonizing agent /GOI in the target cell remedies the defect.
  • a target cell having a deleterious mutation e.g., dominant gain-of-function mutation, presence of a wild-type or mutant gene causative of the defect, duplication or other large scale genomic defects, etc.
  • the antagonizing agent can be any of an RNAi reagent (e.g., siRNA, shRNA, miRNA) , antisense oligonucleotides (ASOs) , ZFN, TALEN or CRISPR/Cas systems that targets one or more disease genes, DNA-or RNA-base editors for gene editing, encoded neutralizing antibodies or antigen-binding fragments thereof, etc.
  • RNAi reagent e.g., siRNA, shRNA, miRNA
  • ASOs antisense oligonucleotides
  • ZFN ZFN
  • TALEN TALEN
  • CRISPR/Cas systems that targets one or more disease genes
  • DNA-or RNA-base editors for gene editing encoded neutralizing antibodies or antigen-binding fragments thereof, etc.
  • the GOI effects gene addition /gene replacement. In certain embodiments, the GOI effects gene knockdown /knockout. In certain embodiments, the GOI effects gene correction (e.g., using DNA-base editing) . In certain embodiments, the GOI effects RNA correction (e.g., using RNA base editing) . In certain embodiments, the GOI effects gene-expression correction (e.g., using ASO or CRISPR etc to modulate transcripts splicing) .
  • the transcript of the coding sequence or the gene of interest may be further processed inside the cell (e.g., pre-or pri-miRNA may be further processed after transcription to become miRNA, mRNA may be spliced) .
  • Processing of the transcript or an RNA coding sequence can produce one or more RNA products, such as siRNA, miRNA, and/or mRNA, which may be further translated into protein product (s) , or be incorporated into other cellular machinery such as the RISC complex or a CRISPR/Cas effector enzyme (such as a Class 2, type II, V, or VI effector enzyme) .
  • the GOI may comprise one or more introns between exons.
  • the GOI corresponds to a cDNA (e.g., without unspliced intron) .
  • the GOI comprises one coding sequence. In certain embodiments, the GOI comprises more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) coding sequences. In certain embodiments, the GOI comprises two or more coding sequences encoding identical or different products (such as light chain and heavy chain of an antibody, a protein and a non-coding polynucleotide, two functionally related or complementary products, etc) .
  • the length of the coding sequence of the GOI, or the combined length of all coding sequences of the GOI, is no more than the maximum length of DNA or RNA that can be packaged into a particular or chosen AAV viral particle, which can differ from one specific AAV viral particle from another.
  • the packaging capacity of the AAV is about 4.7 kb, or between 4.3-5.2 kb.
  • the protein can be any protein of interest, including enzymes, structural proteins, membrane proteins, cytokines, antibodies or antigen-binding fragments thereof, G proteins, GPCRs, kinases, transcription factors, etc.
  • the GOI encodes a product for treating an ocular disease or disorder, such as an inherited retinal dystrophies (IRD) , Retinitis Pigmentosa (RP) , Choroideremia, Stargardt disease, Cone-rod Dystrophy (CRD) , Leber Congenital Amaurosis (LCA) .
  • an ocular disease or disorder such as an inherited retinal dystrophies (IRD) , Retinitis Pigmentosa (RP) , Choroideremia, Stargardt disease, Cone-rod Dystrophy (CRD) , Leber Congenital Amaurosis (LCA) .
  • the ocular disease or disorder is due to or caused by an autosomal recessive mutation
  • the GOI encodes a gene product that remedies the autosomal recessive mutation (e.g., the GOI encodes a wide type gene that is the subject of the autosomal recessive mutation) .
  • the ocular disease or disorder is due to or caused by an autosomal dominant mutation
  • the GOI encodes a gene product that remedies the autosomal dominant mutation (e.g., the GOI encodes an antagonist of the mutant, such as a CRISPR/Cas effector and a guide RNA, or an RNAi reagent or antisense that specifically targeting the mutant gene or transcript) .
  • the ocular disease or disorder is due to or caused by an X-linked mutation
  • the GOI encodes a gene product that remedies the X-linked mutation
  • the GOI encodes a product for treating a neuronal /CNS disease or disorder.
  • the GOI is codon optimized for optimal expression in a target tissue.
  • the target tissue is a mammalian tissue, such as human tissue.
  • the GOI is under the transcriptional control of a promoter, and optionally an enhancer that modulates (e.g., enhances) the transcription from the promoter.
  • an enhancer that modulates (e.g., enhances) the transcription from the promoter.
  • Exemplary non-limiting promoters include: constitutive promoters, tissue-specific promoters, inducible promoters, temperature sensitive promoters, etc. Exemplary promoters and enhancers are described herein below (incorporated by reference) .
  • the promoter is specific for an ocular tissue, such as a retina specific promoter.
  • the promoter is specific for a CNS tissue, such as a neuronal specific promoter, or a glial cell (such as astrocyte) specific promoter.
  • the polynucleotide comprising the GOI further comprises an intron and/or an exon that enhances expression of the GOI.
  • intron refers to a non-coding segment of a DNA or an RNA, which are normally removed a transcribed RNA through splicing.
  • the polynucleotide sequence of the invention may comprise an intron sequence, such as an intron sequence from a heterologous gene ( “heterologous” with respect to the gene of interest or GOI, which is to be expressed as a transgene delivered to a host cell by the rAAV viral particle of the invention) , in order to enhance the expression of the GOI.
  • heterologous with respect to the gene of interest or GOI, which is to be expressed as a transgene delivered to a host cell by the rAAV viral particle of the invention
  • Such intron sequence in the RNA sequence of the invention may or may not be removed by splicing.
  • such intron sequence may further comprise a transcribed enhancer or a part thereof, since certain enhancers can be located within an intron of a coding DNA.
  • exon refers to a coding segment of a DNA or an RNA, which exon is to be translated into a protein sequence.
  • an exon sequence within the polynucleotide sequence of the invention may encode part of or the entirety of the GOI to be expressed as a transgene delivered to a host cell by the rAAV viral particle of the invention.
  • an exon sequence within the polynucleotide sequence of the invention may belong to a heterologous gene (with respect to the GOI) , and the presence of such exon may enhance the expression of the GOI.
  • the polynucleotide comprising the GOI further comprises a polyA signal sequence.
  • exemplary polyA signals and sequences are described herein below (incorporated by reference) .
  • the polynucleotide comprising the GOI further comprises a 5’ UTR region, a 3’ UTR region, or both. Exemplary UTR’s are described herein below (incorporated by reference) .
  • the polynucleotide comprising the GOI further comprises a filler sequence.
  • Another aspect of the invention provides a polynucleotide encoding any one of the modified capsid protein of the invention.
  • Another aspect of the invention provides a vector comprising the polynucleotide of the invention.
  • the vector is a plasmid, or a viral vector such as AdV, HSV or baculovirus vector designed for AAV production.
  • Another aspect of the invention provides a method of treating or preventing an ocular disease or disorder in a subject in need thereof, the method comprising administering to (the eye (s) of) the subject a therapeutically effective amount of the rAAV of the invention, or an rAAV comprising any one of the modified AAV capsid of the invention.
  • treating may include preventing a disease, disorder or condition from occurring in a cell, a tissue, a system, animal or human which may be predisposed to the disease, disorder and/or condition but has not yet been diagnosed as having it; stabilizing a disease, disorder or condition, e.g., arresting its development; and/or relieving one or more symptoms of the disease, disorder or condition, e.g., causing regression of the disease, disorder and/or condition.
  • the treatment is not preventive-only treatment, and/or not prophylactic-only treatment (e.g., treatment excludes preventive or prophylactic treatment) .
  • a therapeutic that “prevents” a disorder or condition refers to a treatment that, in a statistical sample, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset or reduces the severity of one or more symptoms of the disorder or condition relative to the untreated control sample.
  • the gene of interest of /encoded by the rAAV is preferentially expressed in a retinal cell wherein compared to an otherwise identical reference rAAV with wild type AAV9 capsids.
  • the retinal cell is selected from the group consisting of: a photoreceptor (e.g., a rod cell; or a cone cell) , a retinal ganglion cell (RGC) , a muller cell (amuller glial cell) , a bipolar cell, an amacrine cell, a horizontal cell, or a retinal pigment epithelium (RPE) cell.
  • a photoreceptor e.g., a rod cell; or a cone cell
  • RRC retinal ganglion cell
  • a muller cell amuller glial cell
  • bipolar cell e.g., an amacrine cell
  • amacrine cell e.g., a amacrine cell
  • horizontal cell e.g., a horizontal cell
  • RPE retinal pigment epithelium
  • the ocular disease or disorder is one or more selected from the group consisting of dry eye syndrome (e.g., DES, Chronic dry eye, Keratitis sicca; Xerophthalmia; Keratoconjunctivitis sicca) , Sjogren's syndrome, uveitis, noninfectious uveitis, anterior uveitis (iritis) , chorioretinitis, posterior uveitis, conjunctivitis, allergic conjunctivitis, keratitis, keratoconjunctivitis, vernal keratoconjunctivitis (VKC) , atopic keratoconjunctivitis, systemic immune mediated diseases such as cicatrizing conjunctivitis and other autoimmune disorders of the ocular surface, blepharitis, scleritis, age-related macular degeneration (AMD) , diabetic retinopathy (DR) , diabetic
  • Another aspect of the invention provides a method of treating a central nervous system (CNS) disease or disorder in a subject in need thereof, the method comprising administering to (the CNS of) the subject a therapeutically effective amount of the rAAV of the invention, or an rAAV comprising any one of the modified AAV capsid of the invention.
  • CNS central nervous system
  • the gene of interest of the rAAV is preferentially expressed in a CNS cell compared to an otherwise identical reference rAAV with wild type AAV9 capsids.
  • the CNS cell is selected from the group consisting of: a neuron, a glial cell, and a vascular cell.
  • the CNS disease or disorder is selected from the group consisting of: brain or spinal cord injury, Bell's palsy, cervical spondylosis, carpal tunnel syndrome, brain or spinal cord tumors, peripheral neuropathy, Guillain-Barré syndrome, headache, epilepsy, dizziness, and neuralgia.
  • Another aspect of the invention provides a method of producing rAAV comprising a modified AAV capsid protein of the invention, the method comprising introducing an rAAV vector encoding a gene of interest to a producer or packaging cell line expressing the modified AAV capsid protein of the invention, under conditions suitable to package the GOI into an AAV capsid shell comprising the modified AAV capsid protein of the invention.
  • the producer or packaging cell line is infected with a vector encoding the modified AAV capsid protein of the invention.
  • the producer or packaging cell line is HEK293, HEK293T, sf9(insect cells) , A549, or HeLa cells.
  • the subject viral particles comprising the modified AAV capsids of the invention can be used to encapsidate any polynucleotide sequences having at least one ITR sequence, such as the 5’ ITR, the 3’ ITR, or both.
  • the ITR sequences can be derived from any known ITR sequences of the various AAV serotypes in the art, including any natural or recombinant AAV serotypes.
  • Exemplary non-limiting ITR sequences can be, or can be derived from any one of the following AAV serotypes: AAV1, AAV10, AAV106.1/hu. 37, AAV11, AAV114.3/hu. 40, AAV 12, AAV127.2/hu. 41, AAV127.5/hu. 42, AAV128.1/hu. 43, AAV128.3/hu. 44, AAV130.4/hu. 48, AAV145.1/hu. 53, AAV145.5/hu. 54, AAV145.6/hu. 55, AAV16.12/hu. l 1, AAV16.3, AAV16.8/hu. 10, AAV161.10/hu. 60, AAV161.6/hu.
  • AAV5 AAV52.1/hu. 20, AAV52/hu. 19, AAV5-22/rh. 58, AAV5-3/rh. 57, AAV54.1/hu. 21, AAV54.2/hu. 22, AAV54.4R/hu. 27, AAV54.5/hu. 23, AAV54.7 /hu.24, AAV58.2/hu. 25, AAV6, AAV6.1, AAV6.1.2, AAV6.2, AAV7, AAV7.2, AAV7.3/hu.
  • AAV8 AAV-8b, AAV-8h, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV A3.3, AAV A3.4, AAV A3.5, AAV A3.7, AAV-b, AAVC1, AAVC2, AAVC5, AAVCh. 5, AAVCh. 5R1, AAVcy. 2, AAVcy. 3, AAVcy. 4, AAVcy. 5, AAVCy. 5Rl, AAVCy. 5R2, AAVCy. 5R3, AAVCy. 5R4, AAVcy.
  • AAVhu. l AAVhu. 12, AAVhu. 13, AAVhu. 14/9, AAVhu. 15, AAVhu. 16, AAVhu. 17, AAVhu. 18, AAVhu. 19, AAVhu. 2, AAVhu. 20, AAVhu. 21, AAVhu. 22, AAVhu. 23.2, AAVhu. 24, AAVhu. 25, AAVhu. 27, AAVhu. 28, AAVhu. 29, AAVhu. 29R, AAVhu. 3, AAVhu. 31, AAVhu. 32, AAVhu. 34, AAVhu. 35, AAVhu. 37, AAVhu. 39, AAVhu. 4, AAVhu.
  • AAVLG-9/hu. 39 AAVLG-9/hu.
  • AAVrh. 64R2 AAVrh. 65, AAVrh. 67, AAVrh. 68, AAVrh. 69, AAVrh. 70, AAVrh. 72, AAVrh. 73, AAVrh. 74, AAVrh. 8, AAVrh.
  • AAVrh8R AAVrh8R A586R mutant, AAVrh8R R533A mutant, BAAV, BNP61 AAV, BNP62 AAV, BNP63 AAV, bovine AAV, caprine AAV, Japanese AAV 10, true type AAV (ttAAV) , UPENN AAV 10, AAV-LK16, AAAV, AAV Shuffle 100-1, AAV Shuffle 100-2, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV SM 100-10, AAV SM 100-3, AAV SM 10-1, AAV SM 10-2, and/or AAV SM 10-8.
  • the modified AAV capsids of the invention in addition to the incorporation of SEQ ID NO: 4, such as substitution of residues corresponding to wt AAV9 VP1 capsid residues A587 and Q588, may comprise one or more additional changes.
  • the modified AAV capsid of the invention may comprise a further change in the otherwise wt AAV9 sequence outside the substitution, such as the sequence changes described by Pulichla et al. (Molecular Therapy 19 (6) : 1070-1078, 2011) , or such as the changes in AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.
  • a further change in the otherwise wt AAV9 sequence outside the substitution such as the sequence changes described by Pulichla et al. (Molecular Therapy 19 (6) : 1070-1078, 2011) , or such as the changes in AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.
  • the modified AAV capsid of the invention may additionally comprise one or more changes in amino acids 390-627 (AAV9 VP1 numbering) as described by Pulichla et al. (Molecular Therapy 19 (6) : 1070-1078, 2011, incorporated herein by reference) .
  • the additional changes may be, but are not limited to: AAV9.1 (G1594C; D532H) , AAV6.2 (T1418A and T1436X; V473D and I479K) , AAV9.3 (T1238A; F413Y) , AAV9.4 (T1250C and A1617T; F417S) , AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V) , AAV9.6 (T1231A; F411I) , AAV9.9 (G1203A, G1785T, W595C) , AAV9.10 (A1500G, T1676C; M559T) , AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L) , AAV9.13 (A1369C, A1720T; N457H, T574S)
  • the modified AAV capsid of the invention may additionally comprise a sequence change described in US 6,156,303, such as AAV3B (SEQ ID NOs: 1 and 10 of US 6,156,303) , AAV6 (SEQ ID NOs: 2, 7 and 11 of US 6,156,303) , AAV2 (SEQ ID NOs: 3 and 8 of US 6,156,303) , AAV3A (SEQ ID NOs: 4 and 9, of US 6,156,303) , or derivatives thereof.
  • AAV3B SEQ ID NOs: 1 and 10 of US 6,156,303
  • AAV6 SEQ ID NOs: 2, 7 and 11 of US 6,156,303
  • AAV2 SEQ ID NOs: 3 and 8 of US 6,156,303
  • AAV3A SEQ ID NOs: 4 and 9, of US 6,156,303
  • the modified AAV capsid of the invention may additionally comprise features of AAV-DJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8) , as described by Grimm et al. (Journal of Virology 82 (12) : 5887-5911, 2008) .
  • the amino acid sequence of AAV-DJ8 may comprise two or more mutations in order to remove the heparin binding domain (HBD) .
  • the AAV-DJ sequence described as SEQ ID NO: 1 in US 7, 588, 772 may comprise two mutations: (1) R587Q (Arg at amino acid 587 is changed to glutamine Gln) , and (2) R590T.
  • the AAV-DJ like sequence changes may comprise one or more of the three mutations: (1) K406R, (2) R587Q, and (3) R590T.
  • the modified AAV capsid of the invention may additionally comprise a sequence feature as described in WO2015/121501, such as in true type AAV (ttAAV) (SEQ ID NO: 2 of WO2015/121501) , in the so-called UPenn AAV10 (SEQ ID NO: 8 of WO2015/121501) , or in the so-called Japanese AAV10 (SEQ ID NO: 9 of WO2015/121501) , or variants thereof.
  • ttAAV true type AAV
  • UPenn AAV10 SEQ ID NO: 8 of WO2015/121501
  • Japanese AAV10 SEQ ID NO: 9 of WO2015/121501
  • modified AAV capsids of the invention can be used with any one or more AAV’s with different tropism to create hybrid capsid shells.
  • Any one or more of the AAV serotypes described herein or above (see above, incorporated herein by reference) can be used with the modified AAV capsids for this purpose.
  • the modified AAV capsids of the invention can be used in a hybrid capsid sequence derived from two or more capsids.
  • AAV2G9 comprises sequences from AAV2 and AAV9. Any one or more of the AAV serotypes described herein or above (see Sec. 2 above, incorporated herein by reference) can be used with the modified AAV capsids for this purpose.
  • the modified AAV capsid of the invention may additionally comprise at least one AAV capsid CD8 + T-cell epitope.
  • the AAV may be AAV1, AAV2 or AAV8.
  • the modified AAV capsid may additionally comprise features of PHP.
  • a or PHP. B as described in Deverman (Nature Biotechnology. 34 (2) : 204-209, 2016, incorporated herein by reference) .
  • the modified AAV capsid may additionally comprise features of a serotype generated by Cre-recombination-based AAV targeted evolution (CREATE) described by Deverman et al., (Nature Biotechnology 34 (2) : 204-209, 2016, incorporated herein by reference) .
  • CREATE Cre-recombination-based AAV targeted evolution
  • the AAV serotypes generated in this manner have improved CNS transduction and/or neuronal and astrocytic tropism, as compared to other AAV serotypes.
  • the rAAV viral particles of the invention comprises a polynucleotide encoding a gene of interest (GOI) , and may further comprise additional optional sequence elements (such as expression control elements) that may enhance or regulate the expression of the GOI.
  • GOI gene of interest
  • additional optional sequence elements such as expression control elements
  • Expression control elements present within the GOI-containing polynucleotide facilitate proper heterologous polynucleotide (e.g., GOI) transcription and/or translation, including, e.g., splicing signal for introns, maintenance of the correct reading frame of the gene to permit in-frame translation of mRNA and, stop codons etc.
  • heterologous polynucleotide e.g., GOI
  • expression control elements are nucleic acid sequence (s) , such as promoters and enhancers that influence expression of an operably linked heterologous polynucleotide (e.g., GOI) .
  • s nucleic acid sequence
  • Such elements typically act in cis but may also act in trans.
  • Expression control can be effected at the level of transcription, translation, splicing, message stability, etc.
  • an expression control element that modulates transcription is juxtaposed near the 5'end (i.e., “upstream” ) of the transcribed polynucleotide.
  • Expression control elements can also be located at the 3'end (i.e., “downstream” ) of the transcribed sequence or within the transcript (e.g., in an intron) . Expression control elements can be located at a distance away from the transcribed gene of interest sequence (e.g., 100 to 500, 500 to 1000, 2,000 to 5,000, or more nucleotides from the gene of interest polynucleotide) . Nevertheless, owing to the polynucleotide length limitations for viral vectors, such as AAV vectors, such expression control elements will typically be within 1-1,000, 1-500, 1-250, or 1-100 nucleotides from the transcribed gene of interest sequence.
  • Introns are known to possess a posttranscriptional regulatory element that efficiently induces transport of mRNA out of the nucleus and enhances mRNA stability.
  • the GOI-containing polynucleotide includes one or more introns or a fragment thereof.
  • the one or more introns are fragments of the gene of interest.
  • the one or more introns are heterologous to the gene of interest.
  • Introns have been reported to affect the levels of gene expression. This effect is known as Intron Mediated Enhancement (IME) of gene expression (Lu et al., Mol Genet Genomics 279: 563-572, 2008) .
  • the levels of gene expression are increases by about 1.5-fold, about 2-fold, about 2.5-fold, about 3-fold, about 3.5 fold, about 4-fold, about 4.5-fold, about 5-fold, about 5.5-fold, about 6-fold, about 6.5-fold, about 7-fold, about 7.5-fold, about 8-fold, about 8.5-fold, about 9-fold, about 9.5-fold, or about 10-fold when compared to gene expression from a sequence without the one or more introns.
  • Non-limiting introns include SV40 intron, beta globin intron, and short chimeric intron (CIB) .
  • Other introns include the ColE2-RNA-OUT, OIPR, and R6K-RNA-OUT introns described in Lu et al., Hum Gene Ther. 2017; 28 (1) : 125-134 (incorporated by reference) ; the human hemoglobin subunit beta (HBB2) synthetic intron (Snyder et al., Hum Gene Ther, 8 (1997) , pp. 1891-1900, incorporated by reference) .
  • HBB2 human hemoglobin subunit beta
  • the one or more introns may be less than 25 nucleotides, less than 50 nucleotides, less than 100 nucleotides, less than 150 nucleotides, less than 200 nucleotides, less than 250 nucleotides, less than 300 nucleotides, less than 350 nucleotides, less than 400 nucleotides, less than 450 nucleotides, or less than 500 nucleotides.
  • the one or more introns may be more than 25 nucleotides, more than 50 nucleotides, more than 100 nucleotides, more than 150 nucleotides, more than 200 nucleotides, more than 250 nucleotides, more than 300 nucleotides, more than 350 nucleotides, more than 400 nucleotides, more than 450 nucleotides, or more than 500 nucleotides.
  • the one or more introns may be about 50 to about 100 nucleotides, about 50 to about 200 nucleotides, about 50 to about 300 nucleotides, about 50 to about 400 nucleotides, about 50 to about 500 nucleotides, about 100 to about 200 nucleotides, about 100 to about 300 nucleotides, about 100 to about 400 nucleotides, about 100 to about 500 nucleotides, about 200 to about 300 nucleotides, about 200 to about 400 nucleotides, about 200 to about 500 nucleotides, about 300 to about 400 nucleotides, about 300 to about 500 nucleotides, or about 400 to about 500 nucleotides.
  • Enhancer can refer to a sequence that is located adjacent to the gene of interest. Enhancer elements are typically located upstream of a promoter element in the GOI-containing polynucleotide, but can also be located downstream of or within an intron sequence (e.g., a gene of interest) and remain functional. Thus the enhancer or part thereof may be present in a transcribed RNA sequence.
  • Non-limiting examples of suitable enhancers include a CMV enhancer.
  • an enhancer element can be located 100 base pairs, 200 base pairs, or 300 or more base pairs upstream or downstream of a gene of interest (e.g., in the RNA AAV vector or a DNA AAV vector) .
  • Enhancer elements typically increase expressed of a gene of interest above increased expression afforded by a promoter element.
  • UTRs refer to RNA that are not translated after transcription.
  • the 5’ UTR is upstream of the start code of the gene of interest and the 3’ UTR is downstream of the stop codon of the gene of interest.
  • the 5’ and/or 3’ UTRs may have an insertion, deletion, or modification to enhance stability of the transcribed gene of interest.
  • the 5′UTR may comprise a translation initiation sequence such as, but not limited to, a Kozak sequence and an internal ribosome entry site (IRES) .
  • Kozak sequences have the consensus CCR (A/G) CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG) , which is followed by another G.
  • 3′UTRs are known to have stretches of Adenosines and Uridines embedded in them. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes (Chen et al, 1995) : Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. C-Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA (U/A) (U/A) nonamers. Molecules containing this type of AREs include GM-CSF and TNF-a. Class III ARES are less well defined.
  • the 5’ UTR and/or 3’UTR may comprise heterologous sequence to the gene of interest. In some embodiments, the 5’ UTR and/or 3’ UTR are native to the gene of interest.
  • a 5’ UTR and/or a 3’ UTR from an mRNA normally expressed in a specific tissue or organ such as lung, liver, pancreas, endothelial cells, CNS, neurons, astrocytes, skeletal muscle, cardiac muscle, smooth muscle, blood, hematopoietic cells may be used in the RNA sequence of the invention comprising a GOI targeted to one or more of these tissues.
  • the DNA AAV vector or RNA AAV vector comprises a transcribed modified AAV ITR that is 5’ to a polyA sequence, a polyA signal sequence (e.g., AAUAAA) , or a sequence for RNA transcription termination (e.g., a histone downstream element) .
  • polyA sequence ” “polyA tail, ” “polyA signal sequence, ” and “a sequence for RNA transcription termination” are defined herein above.
  • Representative polyA signal sequence and surrounding sequences include human growth hormone (hGH) polyA sequence (see Liu et al., Gene Ther 20: 308–317, 2013, incorporated by reference) , bovine growth hormone polyadenylation signal (bGHpA) (Goodwin and Rottman, J Biol Chem. 1992 Aug 15; 267 (23) : 16330-4, incorporated by reference) , SV40 early or late polyadenylation signal, and the synthetic polyA signal used in Choi et al. (Mol Brain. 2014; 7: 17, incorporated herein by reference) .
  • hGH human growth hormone
  • bGHpA bovine growth hormone polyadenylation signal
  • SV40 early or late polyadenylation signal SV40 early or late polyadenylation signal
  • synthetic polyA signal used in Choi et al. (Mol Brain. 2014; 7: 17, incorporated herein by reference) .
  • a “transcription enhancer” refer to cis-acting nucleotide sequences that can increase the transcription of the gene of interest.
  • the transcription enhancer can be located in the intron or partially in an exon region of the GOI-containing polynucleotide of the invention.
  • the GOI-containing polynucleotide of the invention comprises a transcribed WPRE sequence, encoded by the WPRE sequence on the encoding DNA.
  • Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) is a 600-bp or so DNA sequence that, when transcribed, creates a tertiary structure enhancing expression.
  • WPRE is commonly used in molecular biology to increase expression of genes delivered by viral vectors. It is a tripartite regulatory element with gamma, alpha, and beta components.
  • the alpha component is 80 bp long: GCCACGGCGGAACTCATCGCCGCC TGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGG T (SEQ ID NO: 30) .
  • the alpha component is only 9%as active as the full tripartite WPRE sequence, which is 100%identical to base pairs 1093-1684 of the Woodchuck hepatitis B virus (WHV8) genome.
  • the WPRE sequence or part thereof (such as the gamma, alpha, and beta elements, preferably in the given order) is present in a 3’ UTR region coding sequence of a GOI-containing polynucleotide encapsidated in the rAAV viral particle of the invention, to substantially increase stability and protein yield of the GOI-containing polynucleotide of the invention.
  • the WPRE sequence is a shorted WPRE (WPRE2) containing a minimal gamma element and a partial alpha-beta element (see Kalev-Zylinska, J Neurosci. 2007, 27: 10456-10467, incorporated by reference) .
  • the WPRE sequence is a shorted WPRE (WPRE3) containing minimal gamma and alpha elements (see Choi et al., Mol Brain 7, 17 (2014) , incorporated by reference) .
  • the RNA sequence of the invention comprises a WPRE sequence and a GOI lacking introns.
  • promoter as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.
  • the GOI-containing polynucleotide of the invention may comprise a promoter for transcribing the GOI.
  • promoter/regulatory sequence means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence. In some instances, this sequence may be the core promoter sequence. In other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product.
  • the promoter /regulatory sequence may, for example, be one which expresses the gene product (e.g., the RNA sequence of the invention) in a tissue or cell type specific manner.
  • operable linkage or “operably linked” refers to a physical or functional juxtaposition of the components so described as to permit them to function in their intended manner.
  • the relationship is such that the control element modulates expression of the heterologous polynucleotide.
  • two DNA sequences operably linked means that the two DNAs are arranged (cis or trans) in such a relationship that at least one of the DNA sequences is able to exert a physiological effect upon the other sequence.
  • the promoter is a constitutive promoter.
  • a “constitutive” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.
  • exemplary promoter may include: a ⁇ glucuronidase (GUSB) promoter, a cytomegalovirus (CMV) immediate-early (Ie) enhancer and/or promoter, a chicken ⁇ -actin (CBA) promoter or derivative thereof such as a CAG promoter, CB promoter, a (human) elongation factor 1 ⁇ -subunit (EF1 ⁇ ) promoter, and a ubiquitin C (UBC) promoter.
  • GUSB ⁇ glucuronidase
  • CMV cytomegalovirus
  • Ie immediate-early
  • CBA chicken ⁇ -actin
  • CAG promoter CAG promoter
  • CB promoter CB promoter
  • EF1 ⁇ elongation factor 1 ⁇ -subunit
  • UBC ubiquitin C
  • the promoter is an inducible promoter.
  • an “inducible” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.
  • the promoter is a tissue-specific promoter, a species specific promoter, or a cell cycle-specific promoter. See Parr et al., Nat. Med. 3: 1145-9, 1997 (entire contents incorporated herein by reference) .
  • tissue-or cell-type-specific promoter is a nucleotide sequence which, when operably linked with a polynucleotide encodes or specified by a gene, causes the gene product to be produced in a specific cell type or a specific tissue preferentially, due to, for example, the cell /tissue is a cell type or tissue type in which the promoter is normally active.
  • Tissue-or cell type-specific promoters may include neuronal tissue specific promoter; CNS-or PNS-specific promoter such as astrocyte, oligodendrocyte, or neuronal promotor; hematopietic lineage specific promoter such as B cell promoter, T cell promoter, NK cell promoter, monocyte promoter, leukocyte promoter, macrophage promoter; endothelial cell promoter; pancreatic promoter; liver /hepatic cell promoter; lung tissue promoter, etc.
  • CNS-or PNS-specific promoter such as astrocyte, oligodendrocyte, or neuronal promotor
  • hematopietic lineage specific promoter such as B cell promoter, T cell promoter, NK cell promoter, monocyte promoter, leukocyte promoter, macrophage promoter
  • endothelial cell promoter pancreatic promoter
  • liver /hepatic cell promoter lung tissue promoter, etc.
  • tissue-specific promoters include prion promoter, neuron-specific enolase (NSE) , neurofilament light (NFL) promoter, neurofilament heavy (NFH) promoter, platelet-derived growth factor (PDGF) , platelet-derived growth factor B-chain (PDGF- ⁇ ) , synapsin (Syn) , synapsin 1 (Syn1) , methyl-CpG binding protein 2 (MeCP2) , Ca2+/calmodulin-dependent protein kinase II (CaMKII) , metabotropic glutamate receptor 2 (mGluR2) , neurofilament light (NFL) or heavy (NFH) , ⁇ -globin minigene n ⁇ 2, preproenkephalin (PPE) , enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2) promoters.
  • NSE neuron-specific enolase
  • NSE neurofilament light
  • Astrocyte-specific promoters include glial fibrillary acidic protein (GFAP) and EAAT2 promoters.
  • Oligodendrocyte-specific promoters include the myelin basic protein (MBP) promoter.
  • MBP myelin basic protein
  • the promoter is a retina specific promoter. In certain embodiments, the promoter is a promoter from or derived from GFAP, RLBP1, ProB2, Human RHO, RHOK, GRK1, Human blue opsin HB570, Human blue opsin HB569, PR0.5, PR1.7, PR2.1, 3LCR-PR0.5, hIRBP, IRBPe/GNAT2, CAR/ARR3, Crx2kb, ProA1, ProA4, ProC1, mGrm6, ProB4, Cabp5, Human red opsin, G1.7p, hRPE65p, NA65p, VMD2, or RS1.
  • the promoter is a CNS specific promoter. In certain embodiments, the promoter is a promoter from or derived from Syn1, NSE, GFAP, MAG, MBP, F4/80, CD68, PAG, vGLUT, or GAD.
  • the promoter is heterologous to the gene of interest. In some embodiments, the promoter is the natural promoter of the gene of interest. In some embodiments, the heterologous promoter includes an insertion, deletion, substitution, and/or other mutation. In some embodiments, the natural promoter includes an insertion, deletion, substitution, and/or other mutation.
  • the promoter is a Pol II promoter. In certain embodiments, the promoter is a Pol III promoter, such as H1 and U6 promoter.
  • localized delivery of the AAV viral particles of the invention can preferentially deliver the AAV viral particle of the invention to specific target cells, tissues, or organs
  • systemic delivery through, for example, intraveneous injection or other intravascular administration, can sometimes lead to infection of more or more non-target cells, tissue, or organs, and undesired expression of the transgene or gene-of-interest (GOI) carried by the AAV vector genome of the invention.
  • GOI gene-of-interest
  • the liver is a major target for many AAV vectors, even though liver expression of the transgene may not be desired for certain GOIs.
  • undesired, and potentially toxic off-target transduction and transgene expression in non-target tissues or organs may include the CNS, skeletal muscle, heart, pancreas, and antigen-presenting cells (APCs) .
  • APCs antigen-presenting cells
  • Such undesired off-target transduction has led to a range of toxic side effects including thrombocytopenia, transaminitis, lethal hemorrhage and shock, anemia, renal failure, complement activation, neuron degeneration, acute elevations in liver enzymes and/or reductions in platelets.
  • tissue or cell specific expression of the AAV viral particles of the invention can be partly controlled by the viral capsids of the AAV viral particles, as well as the tissue-or cell-specific promoters.
  • tissue or cell-specific expression can be partly controlled by certain tissue detargeting sites or detargeting sequences present in the RNA transcript of the AAV vector genome of the invention.
  • tissue detargeting site /sequence can prevent, suppress, or otherwise inhibit the expression of the GOI on the AAV vector genome of the invention, based on the expression of certain endogenous microRNAs (miRNAs) or controlled exogenous miRNA in the non-targeting tissue.
  • the small, noncoding miRNAs generally regulate gene expression by post-transcriptional silencing through two mechanisms –by reducing target mRNA stability and/or protein expression (e.g., by two-to four fold or less) when partially complementary to a target mRNA sequence, or by cleaving the target mRNA and/or triggering its degradation when nearly perfectly complementary to the target mRNA.
  • the AAV vector genome of the invention comprises coding sequence for a microRNA (miR) detargeting site /sequence, or a microRNA binding site series (miRBSS) , or a reverse complement thereof, wherein the miR binding site series comprise one, two, three, four, five, or more copies of a miR binding site (miRBS) .
  • the miR binding site series comprise three copies of miR binding sites that maybe identical or different.
  • the “miR binding site series” or the “miR binding site” includes an RNA sequence on the RNA transcript produced by transcribing the AAV vector genome.
  • the “miR binding site series” or the “miR binding site” also includes the DNA sequence corresponding to the RNA sequence, in that they differ only by the T in DNA and the U in RNA.
  • the reverse complement of such DNA is the coding sequence for the RNA sequence. That is, in certain embodiments, in an expression cassette containing a DNA positive strand, the miR binding site sequence is the reverse complement of the miRNA to which it binds.
  • the miR binding site is substantially complementary to (e.g., is a reverse complement sequence of) a microRNA (miR) guide strand sequence, such as the guide strand sequence of a naturally existing miR inside a host cell, such that when the AAV vector genome is transcribed in the host cell infected by the AAV to produce an RNA transcript comprising the miR binding site or miR binding site series, the miR (e.g., naturally existing miR inside the host cell) can bind to the miR binding site or the miR binding site series to interfere with the expression of any transgene on the RNA transcript in the host cell.
  • miR microRNA
  • the miR binding site series or the miR binding site is located in the 3’-UTR region of a transgene (or gene of interest (GOI) ) transcript, before the polyA sequence.
  • the miR binding site series or the miR binding site is located in the 5’-UTR region of the transgene.
  • the miR binding site series or the miR binding site is located in both the 5’-and 3’-UTR region of the transgene.
  • the AAV vector genome comprises coding sequence for at least two (e.g., three) miR binding sites located in the 5’ UTR, and at least two (e.g., three) miR binding sites located in the 3’ UTR.
  • the start of the first of the at least one or more (e.g., three) miR binding site is within 20, 40, 60, 80, 100, 120 nucleotides from the 3’ end of the gene coding sequence or the beginning of the polyA sequence in the RNA transcript.
  • the end of the last of the at least one or more (e.g., three) miR binding site is within 20, 40, 60, 80, 100, 120 nucleotides from the 5’ end of the gene coding sequence or the 5’ end of the GOI RNA transcript.
  • each miR binding site is independently (designed to be) 100%identical, or nearly 100%identical (e.g., with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches) to the miR in the host cell.
  • the mismatched nucleotides are contiguous. In certain embodiments, the mismatched nucleotides are non-contiguous. In certain embodiments, the mismatched nucleotides occur outside the seed region-binding sequence of the miR binding site, such as at one or both ends of the miR binding site.
  • each miR binding site is independently at least about 90%, 95%, 96%, 97%, 98%, or 99%identical, or nearly 100%identical to the miR in the host cell.
  • the RNA transcript comprising the miR binding site upon binding to the miR in the host cell, is eventually cleaved and/or degraded, thus preventing /attenuating /eliminating the expression of any transgene on the RNA transcript.
  • each miR binding site is independently exact complementarity (100%) , or partial complementarity to the miRNA seed sequence with some mismatches.
  • each miR binding site independently comprises at least 7-8 nucleotides which are 100%complementary to the miRNA seed sequence.
  • each miR binding site independently consists of a sequence which is 100%complementary to the miRNA seed sequence.
  • each miR binding site series contains multiple copies (e.g., two or three copies) of the sequence which is 100%complementary to the seed sequence.
  • the region of 100%complementarity comprises at least 30%of the length of each miR binding site sequence. In certain embodiments, the remainder of the miR binding site sequence has at least about 80%to about 99%complementarity to the miRNA.
  • each miR binding site is independently (designed to be) somewhat identical to the miR in the host cell, such that the RNA transcript comprising the miR binding site binds to the miR in the host cell with reduced complementarity, and reduces (but does not completely) eliminate the expression of the transgene on the RNA transcript.
  • the miRBSS comprises two or more copies of miR binding sites, such as three miR binding sites.
  • the two or more copies of miR binding sites are in tandem, e.g., appear consecutively, or be separated by one or more nucleotides from each other or one another.
  • the two or more copies of miR binding sites are identical in sequence.
  • three miR binding sites can be identical in sequence.
  • the miR binding site series comprises, consists essentially of, or consists of two copies of miR binding sites that are different in sequence.
  • the miR binding site series comprises, consists essentially of, or consists of three copies of miR binding sites that are each different in sequence from the other.
  • the miR binding site series comprises, consists essentially of, or consists of three copies of miR binding sites, two of which are identical in sequence while the third is different in sequence.
  • the two miR binding sites with identical sequence can be in tandem, or be separated by the miR binding site with a different sequence.
  • each of the miR binding site or sequence region may independently have a length such as, but not limited to, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112,
  • each of the miR binding site or sequence region is independently at least about 7 to about 28 nucleotides in length, at least about 8 to about 28 nucleotides in length, 7-28 nucleotides, 8-18 nucleotides, 12-28 nucleotides, about 20 to about 26 nucleotides, about 22 nucleotides, about 24 nucleotides, or about 26 nucleotides in length, and which optionally contains at least one consecutive region (e.g., 7 or 8 nucleotides) which is complementary to the seed sequence of the miRNA (e.g., miR183) .
  • the miR binding site is complementary to a miR expressed in a non-target tissue at a high copy number, such as more than 10,000 copies per cell, 20,000 copies per cell, 30,000 copies per cell, 40,000 copies per cell, 50,000 copies per cell, 60,000 copies per cell, 70,000 copies per cell, 80,000 copies per cell, or 100,000 copies or more per cell.
  • the miR binding site is complementary to a miR expressed in heart and skeletal muscle, such as miR-1.
  • the miR binding site is complementary to a miR expressed in liver or hepatocytes, such as miR122.
  • the miR binding site is complementary to a miR expressed in hematopoietic lineage, including immune cells (e.g., antigen presenting cells or APC, including dendritic cells (DCs) , macrophages, and B-lymphocytes) , such as those described in US2018/0066279 (all incorporated herein by reference, especially Tables 1-3) , including miR-15a, miR-16-1, miR-17, miR-8a, miR-19a, miR-20a, miR-19b-l, miR-21, miR-29a, miR-29b, miR-29c, miR-30b, miR-31, miR-34a, miR-92a-l, miR-106a, miR-125a, miR-125b, miR-126, miR-142-3p (miR142) , miR-146a, miR-150, miR-155, miR-181a, miR-223 and miR-424.
  • immune cells
  • the miR binding site is complementary to an APC-specific miR expressed in APCs, such as dendritic cells (DCs) , such as miR-30b, miR-34a, miR-125a, miR-125b, miR-142-3p, and miR-155.
  • APCs dendritic cells
  • the miR binding site series comprises, consists essentially of, or consists of at least one miR binding site sequence for a hematopoietic lineage-specific miR.
  • said at least one miR binding site sequence for a hematopoietic lineage-specific miR comprises, consists essentially of, or consists of a sequence at least 80%, 85%, 90%, at least 95%, at least 99%, or 100%identical to any one of the sequences in Table 2 of US2018/0066279 (incorporated herein by reference) .
  • miR-15a Monocytes CD5 + B cells miR-16-1 Monocytes, CD5 + B cells miR-17 B-and T-cells, monocyte miR-18a B-and T-cells, monocyte miR-19a B-and T-cells, monocyte miR-20a B-and T-cells, monocyte miR-19b-1 B-and T-cells, monocyte miR-21 Myeloid cells miR-29a T-cells miR-29b T-cells miR-29c T-cells miR-30b DC (dendritic cells) miR-31 T-cells miR-34a DC, B-cells miR-92a-1 B-and T-cells, monocyte miR-106a Monocytes miR-125a B-cells, DC, monocytes miR-126 Endothelial cells, pDC miR-125b B-cells, DC, monocytes miR-142-3p Hematopoietic stem cells, T reg miR-146a Moncytes
  • the miR binding site is complementary to a miR expressed in DRG (dorsal root ganglion) neurons, such as miR96, miR182, or miR183.
  • the miR binding site series comprises, consists essentially of, or consists of at least one miR183 binding site sequence.
  • the at least one miR183 binding site comprises, consists essentially of, or consists of a sequence at least 80%, 85%, 90%, at least 95%, at least 99%, or 100%identical to AGTGAATTCTACCA GTGCCAT A (SEQ ID NO: 28) , where the sequence complementary to the miR-183 seed sequence is double underlined.
  • the miR binding site series comprises, consists essentially of, or consists of at least one miR182 binding site sequence.
  • the at least one miR182 binding site comprises, consists essentially of, or consists of a sequence at least 80%, 85%, 90%, at least 95%, at least 99%, or 100%identical to AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 29) .
  • the miR binding site series comprises, consists essentially of, or consists of at least one miR96 binding site sequence.
  • the at least one miR96 binding site comprises, consists essentially of, or consists of a sequence at least 80%, 85%, 90%, at least 95%, at least 99%, or 100%identical to AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 30) .
  • the miR binding site series comprises at least 1, 2, 3, 4, 5, or 6 miR183/182/96 binding site sequence (s) .
  • the miR binding site series comprises two or more miR binding sites that may be identical or different. In certain embodiments, miR binding sites within the miR binding site series are continuous and not separated by spacer (s) .
  • a “spacer” is generally any selected nucleic acid sequence of, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, which is located between two or more consecutive miR binding site sequences.
  • the spacer is a non-coding sequence of about 1 to about 12 nucleotides, or 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 nucleotide in length.
  • a spacer is located 3’ to the first miR binding site sequence and/or 5’ to the last miR binding site sequence.
  • the spacers between the miR binding sequences are the same when more than one spacers are present in the miR binding site series. In other embodiments, at least two spacers are different in sequence.
  • the AAV vector genome of the invention comprises a miRBS that limits the expression of the GOI in RPE cells.
  • miR binding sites for the RPE-specific miR-204 can block AAV-mediated gene expression in RPE cells, resulting in PR-specific expression.
  • the AAV vector genome of the invention comprises one or more (e.g., 1, 2, 3, 4, 5, or 6) miR-204 binding site (s) that limits the expression of the GOI in RPE cells.
  • the AAV vector genome of the invention comprises a miRBS that limits the expression of the GOI in PR.
  • miR binding sites for the PR-specific miR-124 can block AAV-mediated gene expression in PR (photoreceptor) cells, resulting in RPE-specific expression.
  • the AAV vector genome of the invention comprises one or more (e.g., 1, 2, 3, 4, 5, or 6) miR-124 binding site (s) that limits the expression of the GOI in PR cells.
  • the rAAV viral particles of the invention can be used to deliver any gene of interest to any suitable target cell, tissue, or organism for any use for gene therapy.
  • IRDs Inherited retinal dystrophies encompass a diverse group of blinding diseases affecting approximately 1 in 3,000 people. There is significant genotypic and phenotypic variability with over 300 genes and gene loci currently implicated in IRDs, with conditions inherited in autosomal recessive, autosomal dominant, or X-linked pattern. IRDs have become a major topic of medical interest after ground-breaking clinical trials led to the first ever FDA-approved in vivo gene product, voretigene neparvovec-rzyl also known as Luxturna. Ocular gene therapies for autosomal recessive diseases are rapidly expanding with improved efficiency in second generation viral vectors and additional developments being researched.
  • gene editing and RNA modulation strategies are being evaluated to antagonize the deleterious effect of dominant mutations. These technologies will be especially important in treatment of autosomal dominant diseases.
  • gene editing and RNA modulation strategies are not only useful for antagonizing the deleterious effect of dominant mutations, but also useful for large gene defect correction.
  • DNA editing or DNA base editing
  • gene expression correction e.g., by using CRISPR or antisense oligonucleotides (ASOs) to modulate transcripts splicing
  • ASOs antisense oligonucleotides
  • the modified AAV capsids and rAAV comprising the same may be used in the treatment of such ocular diseases in gene therapy.
  • Transduction of retinal pigment epithelial (RPE) cells with an AAV based on serotype 2 has partially corrected retinal blindness in LCA2.
  • RPE retinal pigment epithelial
  • PR rod and cone photoreceptors
  • the normal human retina contains two main classes of light-sensing neurons: rod PRs, which are sensitive to dim light, and cone PR, which respond to bright light stimuli. Gene mutations hinder the function of either or both of these sets of cells, and lead to their degeneration and subsequent loss of vision. Over 200 different genes/loci are implicated in these types of blinding disorders (see sph. uth. tmc. edu dot retnet dot disease dot htm) .
  • the GOI of the invention to be encompassed by the AAV vector genome encapsidated with the modified AAV capsids of the invention includes any one of the known target genes responsible for any of the disorders listed in the above website, e.g., target genes the expression of which, as the GOI carried by the AAV vectors of the invention, alleviates at least one symptom of the disorders.
  • the GOI of the invention to be encompassed by the AAV vector genome encapsidated with the modified AAV capsids of the invention includes an agent that antagonizes the function /expression of any one of the known target genes responsible for any of the disorders listed in the above website, e.g., target genes the expression of which is associated with or causative of at least one symptom of the disorders, and the down-regulation of the expression of which by the agent (that antagonizes the function /expression of the known target genes) alleviates at least one symptom of the disorders.
  • antagonizing agents include any one or more of: ZFN, TALEN, or CRISPR system nucleases (that targets the dominant disease genes, and/or be used as tools for correcting genes or modulating gene expression) ; antibodies or antigen binding fragments thereof (that neutralize a gene product of the dominant disease genes, such as anti-VEGF antibody) ; RNAi reagents (siRNA, shRNA, miRNA etc) , antisense polynucleotides, or other non-coding polynucleotides (that down-regulate the expression of the dominant disease genes) , etc.
  • target genes include any one or more of: RPE65, REP1, LRAT, GRP143, TYR, BEST1, MERTK, MYO7A, ADAM9, RGR, RS1, CEP290, RPGR, BBS4, USH2D, RPGRIP, TULP1, CRB1, GUCY2D, AIPL1, CRX, ABCA4, PDE6B, RHO, PRPH2, NR2E3, NRL, CNGA3, CNGB3, GNAT2, PDE6C, RLBP1, and ND4.
  • Retinitis pigmentosa primarily affects rod PR but can result in secondary abnormalities of cones.
  • Cone and cone-rod dystrophies such as Stargardt's disease are characterized by a primary cone involvement, with possibly concomitant loss of rods.
  • Achromatopsia is associated with reduced or minimal cone function, and the complete form of this disorder is autosomal recessive in inheritance.
  • Age-related macular degeneration affects rods and cones centrally in the retina due to atrophy of the retinal pigment epithelium.
  • AAV2, AAV7 and AAV8 can efficiently transduce rods, only AAV9 targeted cones both centrally and peripherally efficiently at low doses, likely due to the abundance of galactosylated glycans, the primary receptor for AAV9, on cone PRs.
  • AAV9 and derivatives with modified AAV capsids of the invention are ideal candidates for strategies that require restoration of cone PR function.
  • AAV9 showed inferior long-term transduction stability in mouse retina via subretinal injection, it played a totally different pattern in non-human primates, AAV9 could not only target rods like other AAV serotypes but also target cones both centrally and peripherally efficiently at low doses 4 months after injection.
  • AAV9 and derivatives with modified AAV capsids of the invention are ideal vectors for retina transduction especially in human.
  • the rAAVs of the invention are administered locally, for ocular gene therapy.
  • rAAV particles of the invention are administered to the subretinal space (i.e. a cavity that is formed after injection of liquids between the RPE and the PRs) .
  • the rAAVs of the invention are administered into the eye's vitreous, resulting in transduction of cells within the inner retina, mainly of ganglion cells and muller glial cells.
  • AAV serotypes Few of the naturally occurring AAV serotypes is capable of transducing PRs when administered intravitreally because of the physical barrier at the inner limiting membrane or the lack of appropriate receptors at the ILM. Each route of administration has its own advantages and disadvantages. Intravitreal injection is minimally invasive but leads to higher immune responses. Subretinal injection of rAAVs would help reduce immunogenicity of the product and less product is needed, however it is invasive.
  • the rAAV viral particles of the invention can be used to deliver any gene of interest to any suitable target cell, tissue, or organism (such as an ocular tissue /cell or a CNS tissue or cell) , for any use for gene therapy to such suitable target cells, tissues, or organisms.
  • a rAAV comprising the modified AAV capsids of the invention is administered to a subject in need thereof.
  • the rAAV can be administered to treat ocular diseases or disorders.
  • the rAAV is administered via intravitreal injection (i.e., by injecting the vector into the vitreous of the eye) or subretinal injection (i.e., by injecting the vector into the space between RPE cells and photoreceptors) .
  • the ocular disease is one or more selected from the group consisting of dry eye syndrome (e.g., DES, Chronic dry eye, Keratitis sicca; Xerophthalmia; Keratoconjunctivitis sicca) , Sjogren's syndrome, uveitis, noninfectious uveitis, anterior uveitis (iritis) , chorioretinitis, posterior uveitis, conjunctivitis, allergic conjunctivitis, keratitis, keratoconjunctivitis, vernal keratoconjunctivitis (VKC) , atopic keratoconjunctivitis, systemic immune mediated diseases such as cicatrizing conjunctivitis and other autoimmune disorders of the ocular surface, blepharitis, scleritis, age-related macular degeneration (AMD) , diabetic retinopathy (DR) , diabetic macular
  • the ocular disease is dry eye syndrome. In one embodiment, the ocular disease is allergic conjunctivitis. In one embodiment the ocular disease is age-related macular degeneration (AMD) . In one embodiment the ocular disease is diabetic retinopathy.
  • AMD age-related macular degeneration
  • ocular disease As used herein, the terms “ocular disease, ” “ocular condition, ” “eye disease, ” and “eye condition” refer to diseases/conditions of the eye (s) that can be sight threatening, lead to eye discomfort, and may signal systemic health problems.
  • Dry eye syndrome (DES, Chronic dry eye, Keratitis sicca; Xerophthalmia; Keratoconjunctivitis sicca) can be defined as a condition that includes a variety of disorders that result in a loss of, or altered composition of, the natural tear film, which maintains the surface of the eye. Without this tear film, vision is impaired and patients may suffer severe ocular discomfort.
  • DES can be caused by excessive tear evaporation or by a reduction of tear production in the lacrimal gland, which is the site of tear production. Though the exact causes of this condition are unknown, there is evidence supporting the link between reduced tear production and inflammation of one or more components of the lacrimal apparatus.
  • DES may also be a manifestation of Sjogren's syndrome which is an autoimmune disorder in which the glands that produce tears and saliva are destroyed. This leads to dry mouth, decreased tearing, and other dry mucous membranes.
  • Noninfectious uveitis is a chronic inflammatory, putative Th1/Th17-mediated autoimmune disease associated with substantial visual morbidity and is potentially blinding. Blindness from uveitis usually does not occur from a single inflammatory episode; rather, cumulative damage results from recurrent episodes of inflammation.
  • the inflammatory sequelae resulting in vision loss may include one or more of cystoid macular edema, cataracts, vitreous debris, glaucoma, macular pathology (scarring and atrophy) , optic neuropathy, and retinal detachment.
  • Anterior uveitis occurs in the front of the eye and is the most common form of uveitis.
  • Par planitis is an inflammation of the pars plana, a narrow area between the iris and the choroid.
  • Posterior uveitis chondroitis
  • Posterior uveitis affects primarily the choroid; the back portion of the uveal tract. If the retina is also involved, it is called chorioretinitis.
  • Posterior uveitis may occur in association with an autoimmune disease, or follow a systemic infection. In posterior uveitis, inflammation can last from months to years and may cause permanent vision damage, even with treatment.
  • Uveitis can cause vision impairment, ocular pain, and loss of vision. It is estimated that about 10%of new cases of blindness in the U.S. are caused by uveitis. Approximately 300,000 people suffer from uveitis in the U.S. alone, the majority of whom are affected by anterior uveitis.
  • the only therapeutic class approved by the FDA for treatment of uveitis is corticosteroids, which are noted for multiple side effects, such as hypertension, hyperglycemia, and hypercholesterolemia, and in the eye, glaucoma and cataract formation.
  • Conjunctivitis pink eye
  • Keratitis is an inflammation of the cornea (clear portion in the front of the eye) . Keratitis can be caused by an infection (bacterial, fungal, viral, parasite, etc. ) or a non-infectious agent (e.g., certain types of auto-immune diseases are associated with a variety of non-infectious keratitises) .
  • an infection bacterial, fungal, viral, parasite, etc.
  • a non-infectious agent e.g., certain types of auto-immune diseases are associated with a variety of non-infectious keratitises
  • Keratoconjunctivitis refers to an inflammation of the cornea and conjunctiva.
  • Vernal keratoconjunctivitis is a recurrent ocular inflammatory disease characterized by hard, elevated, cobblestone like bumps on the upper eyelid. There may also be swellings and thickening of the conjunctiva.
  • the conjunctiva is the outermost membrane which lines the eyelids as well as the exposed parts of the eye, except for the cornea.
  • Atopic keratoconjunctivitis is the result of a condition called atopy.
  • Atopy is a genetic condition whereby the immune system produces higher than normal antibodies in response to a given allergen.
  • Systemic immune mediated diseases such as cicatrizing conjunctivitis and other autoimmune disorders of the ocular surface represent a clinically heterogeneous group of conditions where acute and chronic autoreactive mechanisms can cause significant damage to the eye.
  • cicatrization can ensue, leading to significant mechanical alterations as a result of the fibrosis.
  • These conditions though generally infrequent, can be the cause of profound pathology and visual disability.
  • Blepharitis is a common condition that causes inflammation of the eyelids.
  • Scleritis is a serious inflammatory disease that affects the white outer coating of the eye, known as the sclera.
  • Age-related macular degeneration is a disease associated with aging that gradually destroys sharp, central vision. AMD affects the macula, which is located at the center of the retina. AMD occurs in two forms: wet and dry.
  • Wet AMD occurs when abnormal blood vessels behind the retina start to grow under the macula. These new blood vessels tend to be very fragile and often leak blood and fluid. The blood and fluid raise the macula from its normal place at the back of the eye. Damage to the macula occurs rapidly.
  • Dry AMD occurs when the light-sensitive cells in the macula slowly break down, gradually blurring central vision in the affected eye.
  • Diabetic retinopathy is a complication of diabetes that results from damage to the blood vessels of the light-sensitive tissue at the back of the eye (the retina) .
  • the retina the blood vessels of the light-sensitive tissue at the back of the eye
  • DME Diabetic macular edema
  • Ocular neovascularization is the abnormal or excessive formation of blood vessels in the eye. Ocular neovascularization has been shown in diabetic retinopathy and age-related macular degeneration (AMD) .
  • AMD age-related macular degeneration
  • PVR Proliferative vitreoretinopathy
  • CMV cytomegalovirus
  • HAV disease
  • organ or bone marrow transplant or chemotherapy
  • CMV virus can cause damage and disease to the eye and the rest of the body.
  • CMV affects the eye in about 30%of the cases by causing damage to the retina. This is called CMV retinitis.
  • Optic neuritis occurs when the optic nerve becomes inflamed and the myelin sheath becomes damaged or is destroyed. Nerve damage that occurs in the section of the optic nerve located behind the eye, is called retrobulbar neuritis, which is another term sometimes used for optic neuritis.
  • Epiretinal membrane (macular pucker) is a scar-tissue like membrane that forms over the macula. It typically progresses slowly and affects central vision by causing blurring and distortion. As it progresses, the pulling of the membrane on the macula may cause swelling.
  • retinitis pigmentosa SAMD11, EMC1, DHDDS, RP59, POMGNT1, MDDGA3, MDDGB3, MDDGC3, RP76, RPE65, LCA2, RP20
  • NPHP4 or SLSN4 recessive Senior-Loken syndrome
  • EPN or DFNB36 recessive Usher syndrome
  • NMNAT1, LCA9, or PNAT1 recessive Leber congenital amaurosis
  • NMNAT1, LCA9, or PNAT1 dominant optic atrophy with neuropathy and myopathy or dominant Charcot-Marie-Tooth disease
  • MFN2, CMT6, CMT2A2, or MARF recessive benign fleck retina
  • PLA2G5 dominant optic atrophy, deafness, ichthyosis and neuronal disorders
  • ELOVL1 recessive Stargardt disease, juvenile and late onset, recessive macular dystrophy, recessive retinitis pigmentosa, reces
  • treatable retinal diseases and the responsible genes include, without limitation: achromatopsia (CNGA3, CNGB3) , choroideremia (REP1) , Leber congenital amaurosis (CEP290, GUCY2D, RPE65) , Leber hereditary optic neuropathy (ND4) , Retinoschisis (RS1) , Retinitis pigmentosa (PDE6B, RHO, RPE65, USH2A, RLBP1) , Usher syndrome (MYO7A, USH2A) , X-linked RP (RPGR) , and age-related macular degeneration (ABCA4, ARMS2, C2, C3, CFB, CFH, ERCC6, FBLN5, HMCN1, HTRA1, RAX2, TLR3, TLR4, anti-VEGF antibodies) .
  • achromatopsia CNGA3, CNGB3
  • REP1 choroideremia
  • CEP290 Leber congenital amaurosis
  • the rAAV viral particle comprising the modified AAV capsid of the invention is administered to a patient to treat neurological disorders, including CNS diseases or disorders, in the patient.
  • the treatment of neurological disorders with modern medical and surgical approaches remains difficult for many reasons, such as the complexity of the CNS, the limited regenerative capacity of the tissue, and the difficulty in conveying conventional drugs to the organ due to the blood–brain barrier (BBB) .
  • BBB blood–brain barrier
  • Gene therapy allowing the delivery of genetic materials that encodes potential therapeutic molecules, represents an attractive option. Gene therapy can result in a stable or inducible expression of transgene (s) , and can allow a nearly specific expression in target cells. Not only considered for rare inherited disorders, gene therapy may also open treatment opportunities for more challenging and complex diseases such as Alzheimer’s or Parkinson’s disease.
  • gene therapy using viral vectors –encoding a therapeutic gene or inhibitory RNA into a viral capsid and supplying it to the nervous system has emerged as a clinically viable option for therapy of neurological disorders. Indeed, AAV vectors have been shown to mediate safe and long-term gene transfer to the brains of rodents, monkeys, and humans.
  • AAV vectors based on AAV2 were too inefficient for many applications that require more widespread gene transfer in the brain.
  • second generation vectors such as the human isolate AAV9, are substantially more efficient and show potential for expanding the applications of CNS gene transfer to diseases that impact the entire CNS.
  • AAV9 can cross the BBB to transduce cells within the CNS after intravenous delivery, an approach which has already shown promise in infants with SMA (FDA approved drug: Zolgensma) .
  • SMA FDA approved drug: Zolgensma
  • trans-BBB AAV9 delivery is efficient in mice, the inefficiency of this approach when scaled to larger animals necessitates extremely large vector doses. These doses result in high levels of transduction in peripheral organs with potential associated toxicity, and face manufacturing limitations that may preclude clinical applications beyond the treatment of infants.
  • CSF cerebrospinal fluid
  • the optimal route of vector administration into the CSF is determined.
  • the rAAV viral particle comprising the modified AAV capsid of the invention is administered into cerebrospinal fluid (CSF) .
  • CSF cerebrospinal fluid
  • lumbar puncture is used as a minimally invasive way for administration of the rAAV viral particles comprising the modified AAV capsid of the invention.
  • the rAAV is administered via intravitreal injection.
  • the rAAV is administered via subretinal injection.
  • the rAAV is administered via intrathecal injection, such as lumbar puncture-intrathecal injection.
  • intrathecal administration refers to the administration of an agent, e.g., a composition comprising a rAAV, into the spinal canal.
  • intrathecal administration may comprise injection in the cervical region of the spinal canal, in the thoracic region of the spinal canal, or in the lumbar region of the spinal canal.
  • intrathecal administration is performed by injecting an agent, e.g., a composition comprising the rAAV viral particle of the invention, into the subarachnoid cavity (subarachnoid space) of the spinal canal, which is the region between the arachnoid membrane and pia mater of the spinal canal.
  • the subarchnoid space is occupied by spongy tissue consisting of trabecula (delicate connective tissue filaments that extend from the arachnoid mater and blend into the pia mater) and intercommunicating channels in which the cerebrospinal fluid is contained.
  • intrathecal administration is not administration into the spinal vasculature.
  • the rAAV viral particle comprising the modified AAV capsid of the invention is administered to a patient to treat CNS diseases or disorders, in the patient.
  • a “CNS-related disorder” is a disease or condition of the central nervous system.
  • the treatable CNS-related disorder affects the spinal cord (e.g., a myelopathy) , brain (e.g., a encephalopathy) or tissues surrounding the brain and spinal cord.
  • the treatable CNS-related disorder is of a genetic origin, either inherited or acquired through a somatic mutation.
  • the treatable CNS-related disorder is a psychological condition or disorder, e.g., Attention Deficient Hyperactivity Disorder, Autism Spectrum Disorder, Mood Disorder, Schizophrenia, Depression, Rett Syndrome, etc.
  • the treatable CNS-related disorder is an autoimmune disorder.
  • the treatable CNS-related disorder is a cancer of the CNS, e.g., brain or spinal cord cancer and/or tumors.
  • the treatable CNS-related disorder is a cancer that may be a primary cancer of the CNS, e.g., an astrocytoma, glioblastomas, etc., or may be a cancer that has metastasized to CNS tissue, e.g., a lung cancer that has metastasized to the brain.
  • treatable CNS-related disorders include Parkinson's Disease, Lysosomal Storage Disease, Ischemia, Neuropathic Pain, Amyotrophic lateral sclerosis (ALS) , Multiple Sclerosis (MS) , and Canavan disease (CD) .
  • the CNS disease or disorder is Alzheimer’s disease (AD) , Lewy body dementia, frontotemporal dementia, Huntington’s disease, stroke, and traumatic brain injury.
  • AD Alzheimer’s disease
  • Lewy body dementia Lewy body dementia
  • frontotemporal dementia Huntington’s disease
  • stroke stroke
  • traumatic brain injury traumatic brain injury
  • the CNS disease or disorder brain or spinal cord injury Bell's palsy, Cerebral palsy, cervical spondylosis, carpal tunnel syndrome, Huntington's disease, Motor neuron disease (MND) , Neurofibromatosis, peripheral neuropathy, Guillain-Barré syndrome, dementia, headache, epilepsy, dizziness, and neuralgia.
  • MND Motor neuron disease
  • treatable CNS disease-responsible genes include, without limitation: apolipoprotein E (ApoE) , apoE2, survival motor neuron 1 (SMN1) , acid alpha-glucosidase (GAA) , CLN3, aspartoacylase protein (ASPA) , Aromatic L-amino acid decarboxylase (AADC) , lysosomal tripeptidyl peptidase I (TPP1) , GLB1, N-sulfoglycosamine sulfohydrolase (SGSH) , alpha-N-acetylglucosaminidase (NAGLU) , iduronate 2-sulfatase (IDS) , NPC1, frataxin (FXN) , GAN, Glial cell line-derived neurotrophic factor (GDNF) , CLN6 Transmembrane ER Protein, alpha-L-iduronidase (IDUA) ,
  • the GOI of the invention to be encompassed by the AAV vector genome encapsidated with the modified AAV capsids of the invention includes any one of the known target genes (such as the ones disclosed herein) responsible for any of the CNS disorders disclosed herein, e.g., target genes the expression of which, as the GOI carried by the AAV vectors of the invention, alleviates at least one symptom of the respective CNS disorders.
  • the GOI of the invention to be encompassed by the AAV vector genome encapsidated with the modified AAV capsids of the invention includes an agent that antagonizes the function /expression of any one of the known target genes responsible for any of the CNS disorders disclosed herein, e.g., target genes the expression of which is associated with or causative of at least one symptom of the CNS disorders, and the down-regulation of the expression of which by the agent (that antagonizes the function /expression of the known target genes) alleviates at least one symptom of the CNS disorders.
  • antagonizing agents include any one or more of: ZFN, TALEN, or CRISPR system nucleases (that targets the dominant disease genes, and/or be used as tools for correcting genes or modulating gene expression) ; antibodies or antigen binding fragments thereof (that neutralize a gene product of the dominant disease genes, such as anti-VEGF antibody) ; RNAi reagents (siRNA, shRNA, miRNA etc) , antisense polynucleotides, or other non-coding polynucleotides (that down-regulate the expression of the dominant disease genes) , etc.
  • Another aspect of the invention provides an AAV viral vector comprising the GOI-containing polynucleotide that can be encapsidated into a capsid shell comprising the modified AAV capsid of the invention.
  • the invention further provides a vector (such as plasmids, HSV based vector, or baculovirus vector) that can be used for producing the subject AAV viral vector.
  • a vector such as plasmids, HSV based vector, or baculovirus vector
  • the vector comprises a polynucleotide encoding any one of the modified AAV capsid of the invention.
  • the vector is an HSV vector comprising a coding sequence for a rep and a cap gene of AAV, which cap gene encodes any one of the modified AAV capsid of the invention.
  • HSV vector may be used with another HSV vector comprising a GOI flanked by an pair of AAV ITR sequence coding sequences, to co-infect a producer cell to generate AAV viral particles comprising the modified AAV capsid of the invention encapsidating the ITR-flanked GOI.
  • the vector is baculoviral vector comprising a coding sequence for a rep and a cap gene of AAV, which cap gene encodes any one of the modified AAV capsid of the invention.
  • baculoviral vector may be used with another baculoviral vector comprising a GOI flanked by an pair of AAV ITR sequence coding sequences, to co-infect an insect producer cell (such as Sf9) to generate AAV viral particles comprising the modified AAV capsid of the invention encapsidating the ITR-flanked GOI.
  • a “vector” generally refers to a composition of matter which comprises an isolated nucleic acid (DNA or RNA) and which can be used to deliver the isolated nucleic acid to the interior of a cell.
  • the vector may be an expression vector.
  • “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
  • An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
  • Expression vectors include all those known in the art, such as cosmids, plasmids, bacmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
  • vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses.
  • vector includes an autonomously replicating plasmid or a virus.
  • the term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like.
  • viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.
  • the invention provides an isolated rAAV viral particle comprising a GOI-containing polynucleotide encapsidated in any one of the modified AAV capsid of the invention described herein.
  • the rAAV genome may be either a single-stranded (ss) nucleic acid or a double stranded (ds) , self-complementary (sc) nucleic acid.
  • a related aspect of the invention also provides a population of isolated rAAV viral particle of the invention.
  • the population of rAAV particles contain a plurality of rAAV viral particle of the invention, wherein about 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%or more of the rAAV particles within the population have encapsidated GOI-containing polynucleotide sequence of the invention.
  • Packaging cells are used to form virus particles that are capable of infecting a host cell.
  • Such cells include HEK293, HEK293T and Sf9 cells, which can be used to package AAV and adenovirus.
  • Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle.
  • the vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable) , other viral sequences being replaced by an expression cassette encoding the protein to be expressed.
  • the missing viral functions can be supplied in trans by the packaging cell line, usually as a result of expression of these viral functions /proteins (such as the rep and cap genes for AAV) either as transgenes integrated into the packaging cell, or as transgenes on a second viral vector or expression vector introduced into the packaging cell.
  • AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome.
  • Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
  • the cell line is also infected with adenovirus as a helper.
  • the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
  • the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
  • recombinant AAVs may be produced using the triple transfection method (described in detail in U.S. Pat. No. 6,001,650) .
  • the recombinant AAVs are produced by transfecting a host cell with an recombinant AAV vector (comprising a gene of interest) to be packaged into AAV particles, an AAV helper function vector, and an accessory function vector.
  • An AAV helper function vector encodes the “AAV helper function” sequences (e.g., rep and cap) , which function in trans for productive AAV replication and encapsidation.
  • the AAV helper function vector supports efficient AAV vector production without generating any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes) .
  • the accessory function vector encodes nucleotide sequences for non-AAV derived viral and/or cellular functions upon which AAV is dependent for replication (e.g., “accessory functions” ) .
  • the accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly.
  • Viral- based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1) , and vaccinia virus.
  • the subject rAAV is produced using a baculovirus expression system packaged in insect cells such as Sf9 cells.
  • insect cells such as Sf9 cells.
  • a baculovirus expression system packaged in insect cells such as Sf9 cells. See, for example, WO2007046703, WO2007148971, WO2009014445, WO2009104964, WO2013036118, WO2011112089, WO2016083560, WO2015137802, and WO2019016349, all incorporated herein by reference.
  • the vector titers are usually expressed as viral genomes per ml (vg/ml) .
  • viral titers is above 1x10 9 , above 5x10 10 , above 1x10 11 , above 5x10 11 , above 1x10 12 , above 5x10 12 , or above 1x10 13 vg/ml.
  • the second generation vector AAV9 has a more general distribution of expression throughout the body in a mice model, and it also shows potential for crossing the blood-brain barrier (BBB) to transduce central nervous system (CNS) .
  • BBB blood-brain barrier
  • CNS central nervous system
  • AAV9 could also efficiently infect retinal cells (including RPE, muller, PR cells, especially cones) in both mice and NHPs. Therefore, AAV9 is an ideal parental AAV vector to be modified or optimized to obtain novel AAV vectors with improved properties.
  • the transgene plasmid AAV-CAG-tdTomato vector, was used to offer a reporter gene to be packaged into the indicated AAV capsids.
  • pAAV-rep2/cap9 and pAAV-rep2/cap9-variants were synthesized in BBI Life Sciences Corporation.
  • pHelper was a helper plasmid containing AdV genes that serve helper function for AAV virus generation.
  • Recombinant AAVs were generated by triple transfection of 293T cells using polyethylenimine (PEI) .
  • Viral particles were harvested from the media at 72 hrs post transfection and from the cells and media at 120 hrs.
  • Cell pellets were resuspended in 10 mM Tris with 10 mM MgCl 2 and 150 mM sodium chloride, pH 7.6, freeze-thawed three times, and treated with 125 U/mL Benzonase (Sigma) at 37°C for at least 1 hr.
  • Viral media was concentrated by precipitation with 10%polyethylene glycol 8000 (Sigma-Aldrich) with 625 mM sodium chloride, resuspended in PBS with 0.001%Pluronic TM F-68 Non-ionic
  • Virus titers were determined by measuring the number of DNase I resistant vector genomes using qPCR with linearized genome plasmid as a standard.
  • C57BL/6J animals were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and housed in on-site animal facility on 12 hr: 12 hr light/dark cycle with ad libitum food and water intake. All experimental protocols were approved by the Animal Care and Use Committee.
  • mice were randomly assigned to groups. Eight-week-old C57B1/6 mice were injected with 1 ⁇ L (5E10 8 vg) rAAVs into the subretinal space of the eye. Four (4) weeks after injection, the mice were sacrificed and organs were collected.
  • mice were randomly assigned to groups. Eight-week-old C57B1/6 mice were intravitreally injected with 1 ⁇ L (1E10 9 vg) rAAVs. Four (4) weeks after injection, the mice were sacrificed and organs were collected.
  • Neonatal (P0-P2) C57B1/6 mice were injected with 3 ⁇ L (3E10 9 vg) rAAVs into the lumbar space of spinal cord.
  • 3E10 9 vg mice were sacrificed and organs were collected.
  • mice Four weeks after AAV injection, mice were anesthetized and transcardially perfused with PBS at room temperature (RT) at pH 7.4 and then with freshly prepared, ice-cold 4%paraformaldehyde (PFA) in PB.
  • Organs (eyes, spinal cords and brains) were post-fixed in 4%PFA overnight. Brains and spinal cords were embedded with OCT for frozen section after dehydration.
  • OCT For the retina complex, a knife cut was made on the cornea before the dehydration step and the lens was removed before embedding.
  • Organs or tissues were sectioned at 20 ⁇ m thickness using a freezing microtome (Leica CM1950) and sections were mounted to the slide directly. The slides were baked at 60°C for 1-2 hours followed by incubating with DAPI (1: 1000) for 1 hour. Afterward, images were captured with Nikon Ni-E Motorized Upright Fluorescence Microscope or Nikon C2si+ Confocal Microscope.
  • the novel AAVs exhibit greater infectivity of retinal cells when administered via intravitreal injection or subretinal injection compared to wild type AAV.
  • the retinal cell can be a PR (e.g., rods; cones) , a retinal ganglion cell (RGC) , a muller cell (a muller glial cell) , a bipolar cell, an amacrine cell, a horizontal cell, or a RPE cell.
  • PR e.g., rods; cones
  • RRC retinal ganglion cell
  • a muller cell a muller glial cell
  • AAV9-M5 AAV9-M6 and AAV9-M8 were compared with the parental AAV9.
  • vg 2E9 vector genomes
  • Confocal scans of retinal cross sections revealed that AAV9-treated eyes had only limited tdTomato signal mainly at the choriod, with only sparse tdTomato-positive cells in the ganglion cell layer.
  • a relative low dose 5E 8 vg per eye, was used to better distinguish the transduction efficiency of viral vectors, since AAV9 already has a good transduction ability in mouse retina via subretinal injection.
  • retinal sections were analyzed by direct fluorescence evaluation to assess AAV vector tropism. As shown in FIGs. 3A and 3B, all vectors could efficiently transduce the RPE.
  • the retinas that received AAV9-M5, AAV9-M6 and AAV9-M8 showed much stronger tdTomato expression in PRs located in ONL.
  • AAV9-M8 and, in particular, AAV9-M6 could also reach the inner part of the retina, strongly transduce INL and RGC.
  • the overall retina transduction efficiency of AAV9 variants are much better, especially AAV9-M6.
  • AAV9-M5 AAV9-M6 and AAV9-M8 were compared with the parental AAV9.
  • AAV9 variants and AAV9 were used to package a single-stranded (ss) tdTomato reporter driven by the ubiquitous CAG promoter (ss-CAG-tdTomato) .
  • ss-CAG-tdTomato ubiquitous CAG promoter
  • About 3E 9 vg of each vector were administered to neonatal mice (P0-P2) by intrathecal injection, and tdTomato expression was assessed 4 weeks later.
  • the AAV9-M5 and, in particular, AAV9-M8 appeared to transduce the CNS more efficiently than AAV9 as judged by microscopy on thin sections from the brain and the spinal cord (FIGs. 4A and 4B) .

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne de nouvelles capsides AAV pour un tropisme amélioré vers des tissus neuronaux et l'œil, pour générer des vecteurs viraux AAV recombinants.
PCT/CN2021/106935 2021-07-16 2021-07-16 Capside aav modifiée pour thérapie génique et méthodes associées WO2023283962A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
PCT/CN2021/106935 WO2023283962A1 (fr) 2021-07-16 2021-07-16 Capside aav modifiée pour thérapie génique et méthodes associées
CN202280054384.8A CN117858891A (zh) 2021-07-16 2022-07-15 用于基因疗法的经修饰aav衣壳及其方法
PCT/CN2022/106118 WO2023284879A1 (fr) 2021-07-16 2022-07-15 Capside aav modifiée pour thérapie génique et méthodes associées

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2021/106935 WO2023283962A1 (fr) 2021-07-16 2021-07-16 Capside aav modifiée pour thérapie génique et méthodes associées

Publications (1)

Publication Number Publication Date
WO2023283962A1 true WO2023283962A1 (fr) 2023-01-19

Family

ID=77563860

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/CN2021/106935 WO2023283962A1 (fr) 2021-07-16 2021-07-16 Capside aav modifiée pour thérapie génique et méthodes associées
PCT/CN2022/106118 WO2023284879A1 (fr) 2021-07-16 2022-07-15 Capside aav modifiée pour thérapie génique et méthodes associées

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/106118 WO2023284879A1 (fr) 2021-07-16 2022-07-15 Capside aav modifiée pour thérapie génique et méthodes associées

Country Status (2)

Country Link
CN (1) CN117858891A (fr)
WO (2) WO2023283962A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117850367A (zh) * 2023-12-29 2024-04-09 淮阴工学院 一种基于多生产线的vmd分解与生产线优化系统

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112020012336A2 (pt) 2017-12-19 2021-03-30 Akouos, Inc. Administração de anticorpos terapêuticos mediada por aav para o ouvido interno

Citations (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1995013365A1 (fr) 1993-11-09 1995-05-18 Targeted Genetics Corporation Production de titres eleves de vecteurs d'aav recombinants
WO1995013392A1 (fr) 1993-11-09 1995-05-18 Medical College Of Ohio Lignees cellulaires stables aptes a exprimer le gene de replication du virus adeno-associe
WO1996017947A1 (fr) 1994-12-06 1996-06-13 Targeted Genetics Corporation Lignees cellulaires d'encapsidation utilisees pour la generation de titres hauts de vecteurs aav recombinants
WO1997006243A1 (fr) 1995-08-10 1997-02-20 Pasteur Merieux Serums Et Vaccins Procede de purification de virus par chromatographie
WO1997008298A1 (fr) 1995-08-30 1997-03-06 Genzyme Corporation Purification d'adenovirus et de virus adeno-associe (aav) par voie chromatographique
WO1997009441A2 (fr) 1995-09-08 1997-03-13 Genzyme Corporation Vecteurs aav ameliores pour la therapie genique
WO1997021825A1 (fr) 1995-12-15 1997-06-19 Systemix, Inc. Procede de production de lignees de cellules d'encapsidation retrovirales generant un surnageant retroviral a efficacite de transduction elevee
US5786211A (en) 1994-06-06 1998-07-28 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5871982A (en) 1994-10-28 1999-02-16 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
WO1999011764A2 (fr) 1997-09-05 1999-03-11 Targeted Genetics Corporation Procedes de generation de preparations de vecteurs de aav recombinants dont le titre est eleve et qui sont exemptes de virus assistant
US6001650A (en) 1995-08-03 1999-12-14 Avigen, Inc. High-efficiency wild-type-free AAV helper functions
US6156303A (en) 1997-06-11 2000-12-05 University Of Washington Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
WO2007046703A2 (fr) 2005-10-20 2007-04-26 Amsterdam Molecular Therapeutics B.V. Vecteurs aav ameliores produits dans des cellules d'insecte
WO2007148971A2 (fr) 2006-06-21 2007-12-27 Amsterdam Molecular Therapeutics B.V. Vecteurs aav avec séquences de codage rep ameliorées pour une production dans des cellules d'insecte
WO2009014445A2 (fr) 2007-07-26 2009-01-29 Amsterdam Molecular Therapeutics B.V. Vecteurs baculoviraux comprenant des séquences codantes répétées avec des erreurs systématiques de codon différentiel
WO2009104964A1 (fr) 2008-02-19 2009-08-27 Amsterdam Molecular Therapeutics B.V. Optimisation de l'expression de protéines rep et cap parvovirales dans des cellules d'insectes
US7588772B2 (en) 2006-03-30 2009-09-15 Board Of Trustees Of The Leland Stamford Junior University AAV capsid library and AAV capsid proteins
WO2011112089A2 (fr) 2010-03-11 2011-09-15 Amsterdam Molecular Therapeutics (Amt) Ip B.V. Séquences codant une protéine rep mutée destinées à être utilisées dans la production de vaa
WO2013036118A1 (fr) 2011-09-08 2013-03-14 Uniqure Ip B.V. Élimination de virus contaminants à partir de préparations de virus adéno-associés (vaa)
WO2015121501A1 (fr) 2014-02-17 2015-08-20 King's College London Vecteur viral adéno-associé
WO2015137802A1 (fr) 2014-03-10 2015-09-17 Uniqure Ip B.V. Vecteurs aav encore améliorés produits dans des cellules d'insectes
WO2016083560A1 (fr) 2014-11-28 2016-06-02 Uniqure Ip B.V. Impuretés de type adn dans une composition comprenant un virion de parvovirus
US9818600B2 (en) 2014-03-21 2017-11-14 Hitachi Kokusai Electric, Inc. Substrate processing apparatus and method of manufacturing semiconductor device
US20180066279A9 (en) 2014-04-25 2018-03-08 University Of Massachusetts Recombinant aav vectors useful for reducing immunity against transgene products
WO2019016349A1 (fr) 2017-07-20 2019-01-24 Uniqure Ip B.V. Production de capsides de vaa améliorées dans des cellules d'insectes
WO2020077165A1 (fr) * 2018-10-12 2020-04-16 Voyager Therapeutics, Inc. Compositions et procédés pour l'administration d'aav

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FI3445773T3 (fi) * 2016-05-13 2023-03-30 4D Molecular Therapeutics Inc Adenoassosioituneen viruksen kapsidimuunnoksia ja niiden käyttömenetelmiä
EP3813845A4 (fr) * 2018-05-15 2022-10-26 President And Fellows Of Harvard College Vecteurs viraux présentant des propriétés d'insertion de gènes améliorées
TW202102526A (zh) * 2019-04-04 2021-01-16 美商銳進科斯生物股份有限公司 重組腺相關病毒及其用途
IL291944A (en) * 2019-10-10 2022-06-01 Solid Biosciences Inc Modified aav capsids and uses thereof
WO2021073568A1 (fr) * 2019-10-16 2021-04-22 Wuxi Apptec (Shanghai) Co., Ltd. Nouveau variant d'aav

Patent Citations (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
US5658776A (en) 1993-11-09 1997-08-19 Targeted Genetics Corporation Generation of high titers of recombinant AAV vectors
WO1995013365A1 (fr) 1993-11-09 1995-05-18 Targeted Genetics Corporation Production de titres eleves de vecteurs d'aav recombinants
WO1995013392A1 (fr) 1993-11-09 1995-05-18 Medical College Of Ohio Lignees cellulaires stables aptes a exprimer le gene de replication du virus adeno-associe
US5786211A (en) 1994-06-06 1998-07-28 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5871982A (en) 1994-10-28 1999-02-16 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
WO1996017947A1 (fr) 1994-12-06 1996-06-13 Targeted Genetics Corporation Lignees cellulaires d'encapsidation utilisees pour la generation de titres hauts de vecteurs aav recombinants
US6001650A (en) 1995-08-03 1999-12-14 Avigen, Inc. High-efficiency wild-type-free AAV helper functions
WO1997006243A1 (fr) 1995-08-10 1997-02-20 Pasteur Merieux Serums Et Vaccins Procede de purification de virus par chromatographie
WO1997008298A1 (fr) 1995-08-30 1997-03-06 Genzyme Corporation Purification d'adenovirus et de virus adeno-associe (aav) par voie chromatographique
WO1997009441A2 (fr) 1995-09-08 1997-03-13 Genzyme Corporation Vecteurs aav ameliores pour la therapie genique
WO1997021825A1 (fr) 1995-12-15 1997-06-19 Systemix, Inc. Procede de production de lignees de cellules d'encapsidation retrovirales generant un surnageant retroviral a efficacite de transduction elevee
US6156303A (en) 1997-06-11 2000-12-05 University Of Washington Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom
WO1999011764A2 (fr) 1997-09-05 1999-03-11 Targeted Genetics Corporation Procedes de generation de preparations de vecteurs de aav recombinants dont le titre est eleve et qui sont exemptes de virus assistant
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
WO2007046703A2 (fr) 2005-10-20 2007-04-26 Amsterdam Molecular Therapeutics B.V. Vecteurs aav ameliores produits dans des cellules d'insecte
US7588772B2 (en) 2006-03-30 2009-09-15 Board Of Trustees Of The Leland Stamford Junior University AAV capsid library and AAV capsid proteins
WO2007148971A2 (fr) 2006-06-21 2007-12-27 Amsterdam Molecular Therapeutics B.V. Vecteurs aav avec séquences de codage rep ameliorées pour une production dans des cellules d'insecte
WO2009014445A2 (fr) 2007-07-26 2009-01-29 Amsterdam Molecular Therapeutics B.V. Vecteurs baculoviraux comprenant des séquences codantes répétées avec des erreurs systématiques de codon différentiel
WO2009104964A1 (fr) 2008-02-19 2009-08-27 Amsterdam Molecular Therapeutics B.V. Optimisation de l'expression de protéines rep et cap parvovirales dans des cellules d'insectes
WO2011112089A2 (fr) 2010-03-11 2011-09-15 Amsterdam Molecular Therapeutics (Amt) Ip B.V. Séquences codant une protéine rep mutée destinées à être utilisées dans la production de vaa
WO2013036118A1 (fr) 2011-09-08 2013-03-14 Uniqure Ip B.V. Élimination de virus contaminants à partir de préparations de virus adéno-associés (vaa)
WO2015121501A1 (fr) 2014-02-17 2015-08-20 King's College London Vecteur viral adéno-associé
WO2015137802A1 (fr) 2014-03-10 2015-09-17 Uniqure Ip B.V. Vecteurs aav encore améliorés produits dans des cellules d'insectes
US9818600B2 (en) 2014-03-21 2017-11-14 Hitachi Kokusai Electric, Inc. Substrate processing apparatus and method of manufacturing semiconductor device
US20180066279A9 (en) 2014-04-25 2018-03-08 University Of Massachusetts Recombinant aav vectors useful for reducing immunity against transgene products
WO2016083560A1 (fr) 2014-11-28 2016-06-02 Uniqure Ip B.V. Impuretés de type adn dans une composition comprenant un virion de parvovirus
WO2019016349A1 (fr) 2017-07-20 2019-01-24 Uniqure Ip B.V. Production de capsides de vaa améliorées dans des cellules d'insectes
WO2020077165A1 (fr) * 2018-10-12 2020-04-16 Voyager Therapeutics, Inc. Compositions et procédés pour l'administration d'aav

Non-Patent Citations (27)

* Cited by examiner, † Cited by third party
Title
CARTER, CURRENT OPINIONS IN BIOTECHNOLOGY, 1992, pages 1533 - 539
CHAPMANROSSMANN: "Structure, sequence, and function correlations among parvoviruses", VIROLOGY, vol. 194, 1993, pages 491 - 508, XP002924108, DOI: 10.1006/viro.1993.1288
CHOI ET AL., MOL BRAIN, vol. 7, 2014, pages 17
CLARK ET AL., GENE THERAPY, vol. 3, 1996, pages 1124 - 1132
DATABASE Geneseq [online] 11 June 2020 (2020-06-11), MURLIDHARAN G ET AL: "Adeno-associated virus capsid protein (VOY701), SEQ 1829.", XP055874308, retrieved from EBI accession no. GSP:BHQ85729 Database accession no. BHQ85729 *
DEVERMAN ET AL., NATURE BIOTECHNOLOGY, vol. 34, no. 2, 2016, pages 204 - 209
GOODWINROTTMAN, J BIOL CHEM., vol. 267, no. 23, 15 August 1992 (1992-08-15), pages 16330 - 4
GRIMM ET AL., JOURNAL OF VIROLOGY, vol. 82, no. 12, 2008, pages 5887 - 5911
HANEN K ET AL: "Insight into the mechanisms of enhanced retinal transduction by the engineered AAV2 capsid variant -7m8", BIOTECHNOLOGY AND BIOENGINEERING, JOHN WILEY, HOBOKEN, USA, vol. 113, no. 12, 30 June 2016 (2016-06-30), pages 2712 - 2724, XP071165912, ISSN: 0006-3592, DOI: 10.1002/BIT.26031 *
HERMONAT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6466
KALEV-ZYLINSKA, J NEUROSCI, vol. 27, 2007, pages 10456 - 10467
LEBKOWSKI ET AL., MOL. CELL. BIOL, vol. 7, 1988, pages 349
LIU ET AL., GENE THER, vol. 20, 2013, pages 308 - 317
LU ET AL., HUM GENE THER, vol. 28, no. 1, 2017, pages 125 - 134
LU, M / GENET GENOMICS, vol. 279, 2008, pages 563 - 572
MCLAUGHLIN ET AL., J. VIROL, vol. 62, 1988, pages 1963
MUZYCZKA, CURR. TOPICS IN MICROBIAL, AND IMMUNOL, vol. 158, 1992, pages 97 - 129
PARR ET AL., NAT. MED., vol. 3, 1997, pages 1145 - 9
PAUL ET AL., HUMAN GENE THERAPY, vol. 4, 1993, pages 609 - 615
PERRIN ET AL., VACCINE, vol. 13, 1995, pages 1244 - 1250
PULICHERLA ET AL., MOLECULAR THERAPY, vol. 19, no. 6, 2011, pages 1070 - 1078
RATSCHIN ET AL., MOL. CELL. BIOL., vol. 4, 1984, pages 2072
SAMULSKI ET AL., J. VIROL, vol. 63, 1989, pages 3822 - 3828
SNYDER ET AL., HUM GENE THER, vol. 8, 1997, pages 1891 - 1900
TRATSCHIN ET AL., MOL. CELL. BIOL., vol. 5, 1985, pages 3251
TSAO, SCIENCE, vol. 251, 1991, pages 1456 - 1464
XIE, PROC. NATL. ACAD. SCI. USA., vol. 99, 2002, pages 10405 - 10410

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117850367A (zh) * 2023-12-29 2024-04-09 淮阴工学院 一种基于多生产线的vmd分解与生产线优化系统

Also Published As

Publication number Publication date
WO2023284879A1 (fr) 2023-01-19
CN117858891A (zh) 2024-04-09

Similar Documents

Publication Publication Date Title
US20220387560A1 (en) Adeno-Associated Virus-Mediated CRISPR-Cas9 Treatment of Ocular Disease
JP6994140B2 (ja) 非ウイルス的遺伝子導入のための閉鎖型直鎖状二重鎖ｄｎａ
JP7237843B2 (ja) 修飾されたａａｖキャプシドタンパク質およびその使用
JP2022008560A (ja) 無カプシドａａｖベクター、組成物ならびにベクター製造および遺伝子運搬のための方法
JP7385282B2 (ja) 環状ｒｎａ分子のための方法及び組成物
US9724429B2 (en) Promoters, expression cassettes, vectors, kits, and methods for the treatment of achromatopsia and other diseases
IL296365A (en) Genetic editing of deep intronic mutations
Ortolano et al. Present and future of adeno associated virus based gene therapy approaches
US20240141378A1 (en) Controlled expression of viral proteins
US20210301305A1 (en) Engineered untranslated regions (utr) for aav production
KR102522273B1 (ko) 로돕신 전사체에 특이적인 트랜스-스플라이싱 라이보자임 및 이의 용도
WO2023284879A1 (fr) Capside aav modifiée pour thérapie génique et méthodes associées
JP2024508696A (ja) Ｒｎａアデノ随伴ウイルス（ｒａａｖ）ベクター及びその用途
TW202305124A (zh) 具有腦特異性靶向模體的新穎構成物及含有其之組成物
KR102396200B1 (ko) 로돕신 전사체에 특이적인 트랜스-스플라이싱 라이보자임 및 이의 용도
WO2023030541A1 (fr) Traitement de maladies et de troubles oculaires associés à rpe65
WO2023230657A1 (fr) Protéines de capside de virus adéno-associé modifiées et procédés associés
JP2022523050A (ja) 合理的設計により増強された新規なａａｖウイルスによる網膜における高効率の形質導入および側方への広がり

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21762998

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE