Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
  • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P13/00—Preparation of nitrogen-containing organic compounds
  • C12P13/04—Alpha- or beta- amino acids
  • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
  • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
  • C12N9/1096—Transferases (2.) transferring nitrogenous groups (2.6)
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
  • C12R2001/00—Microorganisms ; Processes using microorganisms
  • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
  • C12R2001/15—Corynebacterium
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
  • C12R2001/00—Microorganisms ; Processes using microorganisms
  • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
  • C12R2001/265—Micrococcus
  • C12R2001/28—Micrococcus glutamicus ; Corynebacterium glutamicum

Definitions

• the present invention relates to the NCgl2747 gene mutant and its application in the preparation of L-lysine in the field of biotechnology.
• L-lysine has physiological effects such as promoting development, enhancing immunity, and improving the function of central nervous tissue. It is one of the eight basic amino acids that humans and animals cannot synthesize by themselves and are essential for growth. At present, L-lysine is the second largest amino acid species in the world, and the main production method is fermentation. Among them, Corynebacterium glutamicum (Corynebacterium glutamicum) is an important lysine-producing strain. About 90% of L-lysine's industrial production is used as a nutritional supplement in the feed industry, 10% is used as a flavoring agent and sweetener in the food industry, and as a drug intermediate in the pharmaceutical industry.
• Improvements in the production of L-lysine by fermentation can involve fermentation techniques such as stirring and supply of oxygen; or the composition of the nutrient medium, such as sugar concentration during fermentation; or the processing of the fermentation broth into a suitable product form, e.g. By drying and pelleting fermentation broth or ion exchange chromatography; or may involve inherent performance properties of the microorganism itself.
• Methods used to improve the performance properties of these microorganisms include mutagenesis, mutant selection and screening. Strains obtained in this way are resistant to anti-metabolites or auxotrophic for metabolites of regulatory importance and produce L-lysine.
• the object of the present invention is to provide a protein that can produce L-lysine and its related biological materials.
• NCgl2747 A955T is the following A1) or A):
• amino acid sequence is the protein of SEQ ID No.4;
• A2 A fusion protein obtained by connecting a tag to the N-terminus or/and C-terminus of A1).
• the tag shown in the table below can be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 4.
• the present invention also provides biological materials related to NCgl2747 A955T , and the biological materials are any one of the following B1) to B4):
• B2 An expression cassette containing the nucleic acid molecule described in B1);
• B3 A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);
• B4 A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).
• nucleic acid molecules described in B1) may be the following b11) or b12) or b13):
• b13) A genomic DNA molecule that hybridizes to the nucleotide sequence defined by b11) or b12) under stringent conditions and encodes NCgl2747 A955T .
• the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.
• nucleotide sequence encoding the NCgl2747 A955T protein of the present invention can easily mutate the nucleotide sequence encoding the NCgl2747 A955T protein of the present invention using known methods, such as directed evolution and point mutation.
• Those nucleotides that have been artificially modified and have 75% or higher identity with the nucleotide sequence of the NCgl2747 A955T protein of the present invention are derived from the present invention as long as they encode the NCgl2747 A955T protein and have the function of the NCgl2747 A955T protein.
• identity refers to sequence similarity to a native nucleic acid sequence. “Identity” includes 75% or higher, or 85% or higher, or 90% or higher, or 75% or higher, or 90% or higher with the nucleotide sequence encoding the protein consisting of the amino acid sequence shown in SEQ ID No. 4 of the present invention. Nucleotide sequences with 95% or greater identity. Identity can be assessed with the naked eye or with computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
• the stringent conditions can be as follows: 50°C, hybridization in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO 4 and 1mM EDTA, 2 ⁇ SSC at 50°C, Rinse in 0.1% SDS; alternatively: 50°C, hybridize in a mixed solution of 7% SDS, 0.5M NaPO 4 and 1mM EDTA, rinse in 50°C, 1 ⁇ SSC, 0.1% SDS; alternatively: 50 °C, hybridize in a mixed solution of 7% SDS, 0.5M NaPO 4 and 1mM EDTA, rinse in 50°C, 0.5 ⁇ SSC, 0.1% SDS; also: 50°C, in 7% SDS, 0.5M NaPO 4 Hybridize in a mixed solution of 1mM EDTA and 50°C, rinse in 0.1 ⁇ SSC, 0.1% SDS; alternatively: 50°C, hybridize in a mixed solution of 7% SDS, 0.5M NaPO
• the above-mentioned 75% or above identity may be 80%, 85%, 90% or 95% or above identity.
• the expression cassette containing the nucleic acid molecule encoding the NCgl2747 A955T protein refers to the DNA that can express the NCgl2747 A955T protein in the host cell.
• the DNA can not only include initiating NCgl2747
• the promoter for transcription of the A955T gene may also include a terminator for terminating the transcription of the NCgl2747 A955T gene.
• the expression cassette may also include an enhancer sequence.
• the expression cassette described in B2) can specifically be the DNA molecule shown in SEQ ID No. 8.
• Existing expression vectors can be used to construct a recombinant vector containing the NCgl2747 A955T gene expression cassette.
• the vector can be a plasmid, cosmid, phage or viral vector.
• the plasmid may specifically be pK18mobsacB vector or pXMJ19 vector.
• the recombinant vector can be the recombinant vector pK18-NCgl2747 A955T , pK18-NCgl2747 A955T OE or pXMJ19-NCgl2747 A955T .
• the recombinant vector pK18-NCgl2747 A955T replaces the fragment (small fragment) between the Xbal I and BamHI recognition sites of the pK18mobsacB vector with the DNA fragment shown in SEQ ID No. 5 in the sequence list, while maintaining other sequences of the pK18mobsacB vector The recombinant vector obtained unchanged.
• the recombinant vector pK18-NCgl2747 A955T contains the mutation site (AT) of the mutant gene NCgl2747 A955T shown in SEQ ID No. 3.
• the pK18-NCgl2747 A955T OE is a recombinant vector obtained by inserting the expression cassette described in B2) between the recognition sequences of Xbal I and BamHI of pK18mobsacB.
• the pXMJ19-NCgl2747 A955T is a recombinant vector obtained by inserting the expression cassette described in B2) into the pXMJ19 vector.
• the microorganism may be yeast, bacteria, algae or fungi.
• the bacteria may be Corynebacterium glutamicum, Escherichia coli, Pantoea ananatis, Bacillus brevis or Brevis lactobacillus.
• the Corynebacterium glutamicum is Corynebacterium glutamicum YP097158 or Corynebacterium glutamicum ATCC13032.
• the recombinant microorganism is a recombinant microorganism obtained by replacing the NCgl2747 gene in the microorganism containing the NCgl2747 gene shown in SEQ ID No. 1 with the nucleic acid molecule described in B1), or introducing the nucleic acid molecule described in B1) into the microorganism and The recombinant microorganism obtained by expression is obtained.
• the recombinant microorganism is recombinant bacteria YPL-NCgl2747-1, recombinant bacteria L2747-1, recombinant bacteria YPL-NCgl2747-3, recombinant bacteria L2747-3, recombinant bacteria YPL-NCgl2747-5 or recombinant bacteria Bacterium L2747-5.
• the recombinant strain YPL-NCgl2747-1 is a strain obtained by replacing the NCgl2747 gene of Corynebacterium glutamicum YP097158 with the NCgl2747 A955T gene while keeping other sequences unchanged.
• the recombinant strain L2747-1 replaces the NCgl2747 gene of ATCC13032 with NCgl2747 A955T. gene and keep other sequences unchanged.
• the recombinant bacterium YPL-NCgl2747-3 replaces the spacer region of the upper homology arm NCgl1741 and the lower homology arm NCgl1742 in the genome of Corynebacterium glutamicum YP097158 with the NCgl2747 A955T gene and its promoter (i.e. SEQ ID in the sequence list No. 8), a recombinant strain obtained by keeping other nucleotides in the genome of Corynebacterium glutamicum YP097158 unchanged.
• the recombinant bacterium L2747-3 replaces the spacer region of the upper homology arm NCgl1741 and the lower homology arm NCgl1742 in the genome of Corynebacterium glutamicum ATCC13032 with the NCgl2747 A955T gene and its promoter (i.e., SEQ ID No. in the sequence listing. 8), a recombinant strain obtained by keeping other nucleotides in the genome of Corynebacterium glutamicum ATCC13032 unchanged.
• the recombinant bacterium YPL-NCgl2747-5 is a recombinant bacterium obtained by introducing the pXMJ19-NCgl2747 A955T into Corynebacterium glutamicum YP097158.
• the recombinant strain L2747-5 is a recombinant strain obtained by introducing the pXMJ19-NCgl2747 A955T into Corynebacterium glutamicum ATCC13032.
• the invention also provides a method for preparing L-lysine, which method includes: expressing NCgl2747 A955T in recipient biological cells, or increasing the content or activity of NCgl2747 A955T in the recipient biological cells, or increasing the level of NCgl2747 A955T in the recipient biological cells.
• the content or activity of the protein shown in SEQ ID No. 2 in the cells is used to obtain recombinant biological cells; the recombinant biological cells are cultured to obtain L-lysine.
• the biological cells may be yeast, bacteria, algae, fungi, plant cells or animal cells capable of synthesizing L-lysine.
• the bacterium is Corynebacterium glutamicum, such as Corynebacterium glutamicum YP097158.
• Bacteria of the present invention include but are not limited to Corynebacterium glutamicum. Any gene containing the NCgl2747 gene shown in SEQ ID No. 1 in the sequence list and can synthesize L-lysine can utilize SEQ ID No. of the present invention.
• the NCgl2747 mutant protein shown in .4 and its related biological materials are used to produce L-lysine, such as bacteria such as Corynebacterium glutamicum, Escherichia coli, and Pantoea ananatis. Bacillus brevis or Brevis lactobacillus.
• the above method can be achieved by introducing the gene encoding NCgl2747 A955T into the recipient biological cell and allowing it to be expressed, or introducing the gene encoding the protein shown in SEQ ID No. 2 into the recipient biological cell and allowing it to be obtained. express realization;
• the recipient biological cell contains the DNA molecule shown in SEQ ID No. 1, and the method replaces the DNA molecule shown in SEQ ID No. 1 in the recipient biological cell with SEQ ID No. 3
• the DNA molecule shown is realized.
• culturing the recombinant biological cells can be carried out using a medium capable of growing the recombinant biological cells;
• culturing the recombinant biological cells is carried out using conditions that enable the growth of the recombinant biological cells.
• the recombinant biological cell may be a recombinant microorganism as described above.
• the present invention also provides a product for preparing L-lysine, which product contains (or whose active ingredient is) NCgl2747 A955T or the biological material.
• NCgl2747 A955T or the biological material of the present invention can be used to produce a variety of products, including but not limited to lysine in the embodiments.
• the amino acids produced can also be glutamic acid, valine, glycine, and alanine. , leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine , aspartic acid, arginine and histidine, shikimic acid, protocatechuic acid, succinic acid, alpha-ketoglutaric acid, citric acid, ornithine, citrulline.
• the production of the target products can be achieved by placing the NCgl2747 A955T of the present invention in the target product synthesis pathway.
• the experimental methods in the following examples are all conventional methods unless otherwise specified.
• the materials, reagents, instruments, etc. used in the following examples can all be obtained from commercial sources unless otherwise specified.
• the quantitative experiments in the following examples were repeated three times, and the results were averaged.
• the first position of each nucleotide sequence in the sequence list is the 5' terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal core of the corresponding DNA/RNA. glycosides.
• Example 1 Construction of a recombinant vector containing the coding region of the NCgl2747 gene with point mutations
• NCgl2747 gene shown in SEQ ID No. 1 encodes the amino acid sequence of the NCgl2747 protein of SEQ ID No. 2.
• NCgl2747 A955T gene shown in SEQ ID No. 3 encodes a mutant protein whose amino acid sequence is SEQ ID No. 4 (ie, NCgl2747 A955T protein).
• the phenylalanine (F) at position 319 in the amino acid sequence of the NCgl2747 I319F protein (SEQ ID No. 4) is mutated from the isoleucine (I) at position 319 of the NCgl2747 protein.
• the recombinant vector is constructed using NEBuilder assembly technology.
• the primers are designed as follows (synthesized by Shanghai Invitrogen Company). The nucleotides in bold font are the mutation positions:
• P4 5′- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC TTGTTCTACGAATGCCCAC-3′ (the underlined nucleotide sequence is the sequence on pK18) (SEQ ID No. 18).
• NCgl2747 Up and NCgl2747 Down DNA fragments of the region (NCgl2747 Up and NCgl2747 Down).
• NCgl2747 Up and NCgl2747 Down were separated and purified by agarose gel electrophoresis, and then used with the purified pK18mobsacB plasmid (Addgene Company) after enzyme digestion (Xbal I and BamHI) using NEBuilder enzyme (NEB Company). Ligate at 50°C for 30 minutes.
• the single clone grown after the ligation product is transformed into E. coli DH5a uses primers M13F/M13R (M13F: 5′-TGTAAAACGACGGCCAGT-3′ (SEQ ID No. 19), M13R: 5′-CAGGAAACAGCTATGACC-3′ ( SEQ ID No.
• the size of the NCgl2747 A955T Up-Down DNA in this recombinant vector pK18-NCgl2747 A955T is 1296bp (SEQ ID No. 5) and contains a mutation site (AT), which will lead to position 955 of the NCgl2747 gene coding region in the strain Corynebacterium glutamicum YP097158.
• Adenine (A) mutates to thymine (T), ultimately causing the isoleucine (I) at position 319 of the encoded protein to change to phenylalanine (F).
• the recombinant vector pK18-NCgl2747 A955T replaces the fragment (small fragment) between the Xbal I and BamHI recognition sites of the pK18mobsacB vector with the DNA fragment shown in SEQ ID No. 5 in the sequence list, keeping other sequences of the pK18mobsacB vector unchanged.
• Recombinant vector pK18-NCgl2747 A955T contains the mutation site (AT) of the mutant gene NCgl2747 A955T shown in SEQ ID No. 3.
• the allelic replacement plasmid (pK18-NCgl2747 A955T ) in Example 1 was transformed into the L-lysine-producing bacterium Corynebacterium glutamicum YP097158 by electroporation (for its construction method, please refer to WO2014121669A1; the strain was confirmed by sequencing The wild-type NCgl2747 gene coding region is retained on the chromosome) and the wild-type Corynebacterium glutamicum strain ATCC13032 was cultured on solid culture plates containing kanamycin (see Table 1 for medium composition and culture conditions).
• the single colonies produced by culture were identified by primer P1 and universal primer M13R in Example 1, and the strain that could amplify a 1384 bp band was a positive strain.
• the positive strains were cultured on a medium containing 15% sucrose (the medium was obtained by increasing the concentration of sucrose in the medium in Table 1 to 15g/L). Culture on namycin and kanamycin-free media, and select strains that grow on kanamycin-free media but do not grow on kanamycin-containing media using the following primers ( Synthesized by Shanghai Invitrogen Company) for PCR amplification:
• P5 5′-TCTATCCAAGGCATACCGC-3′ (SEQ ID No. 21);
• P6 5′-TCCCATTGGTTTCACACAG-3′ (SEQ ID No. 22).
• the obtained DNA fragment (280bp) was processed (denatured at high temperature at 95°C for 10 minutes, quickly ice bathed for 5 minutes) and then subjected to SSCP (Single-Strand Conformation Polymorphis) electrophoresis (using the amplified fragment of plasmid pK18-NCgl2747 A1089C as a positive control, glutamic acid rod
• SSCP Single-Strand Conformation Polymorphis electrophoresis
• the amplified fragment of Bacillus ATCC13032 was used as a negative control, and water was used as a blank control). Please refer to Table 2 for the preparation and electrophoresis conditions of PAGE for SSCP electrophoresis.
• strains whose electrophoresis positions are inconsistent with the position of the negative control fragment and consistent with the position of the positive control fragment are strains with successful allelic substitution.
• the positive strain NCgl2747 A955T gene fragment was again amplified by primer P5/P6 and connected to the PMD19-T vector for sequencing. Through sequence comparison, the strain with a mutation (AT) in the base sequence was a positive strain with successful allelic substitution.
• the positive strains obtained from Corynebacterium glutamicum YP097158 and the wild-type Corynebacterium glutamicum strain ATCC13032 were named YPL-NCgl2747-1 and L2747-1 respectively.
• the recombinant bacteria YPL-NCgl2747-1 and L2747-1 both contain the mutated gene NCgl2747 A955T shown in SEQ ID No. 3, and both can express the protein shown in SEQ ID No. 4.
• the only difference between the recombinant strain YPL-NCgl2747-1 and Corynebacterium glutamicum YP097158 is that YPL-NCgl2747-1 replaces the NCgl2747 gene of Corynebacterium glutamicum YP097158 with the NCgl2747 A955T gene, and
• the only difference between the strain obtained by keeping other sequences unchanged and the recombinant strain L2747-1 and ATCC13032 is that: L2747-1 is a strain obtained by replacing the NCgl2747 gene of ATCC13032 with the NCgl2747 A955T gene and keeping other sequences unchanged.
• NCBI Corynebacterium glutamicum ATCC13032
• three pairs of primers were designed and synthesized to amplify the upstream and downstream homology arm fragments and the NCgl2747 or NCgl2747 A955T gene coding region and promoter region.
• the NCgl2747 or NCgl2747 A955T gene was inserted into Corynebacterium glutamicum YP097158 and wild Corynebacterium glutamicum ATCC13032.
• the primers are designed as follows (synthesized by Shanghai Invitrogen Company):
• P12 5′- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCTATGACACCTTCAACGGATC-3′ (the underlined nucleotide sequence is the sequence on pK18) (SEQ ID No. 28).
• positions 1-331 are the promoter of the NCgl1741 gene, and positions 332-1645 are the NCgl1741 gene.
• PCR amplification was performed with primers P7/P8, P9/P10, and P11/P12 to obtain an upstream homology arm fragment of 763 bp (corresponding to Corynebacterium glutamicum ATCC13032 NCgl1740 Part of the coding region and the NCgl1741 gene and its promoter region (the sequence is shown in SEQ ID No. 6), the NCgl2747 A955T gene and its promoter fragment 1645 bp (the sequence is shown in SEQ ID No.
• positions 1-331 are the promoter of the NCgl2747 A955T gene, and positions 332-1645 are the NCgl2747 A955T gene.
• the correctly sequenced integrated plasmids (pK18-NCgl2747OE, pK18-NCgl2747 A955T OE) were electrotransformed into Corynebacterium glutamicum strain YP097158 and wild-type Corynebacterium glutamicum ATCC13032 respectively, and cultured in the culture medium.
• the culture medium components and culture The conditions are shown in Table 1.
• the single colony produced by culture was identified by PCR with P13/P14 primers.
• the PCR amplification contained a sequence of 1959bp (sequence such as SEQ ID No. 10 The fragments shown) are positive strains, and the fragments that cannot be amplified are original bacteria.
• the positive strains were streaked and cultured on a solid culture plate containing 15% sucrose (the culture medium was obtained by increasing the concentration of sucrose in the culture medium in Table 1 to 15g/L), and the single colonies produced by the culture were further analyzed.
• P15/P16 primers were used for PCR identification, and the amplified bacterium with a size of 1600 bp (the sequence is shown in SEQ ID No. 11) was NCgl2747 or NCgl2747 A1089C gene and its promoter integrated into the homology arm of the Corynebacterium glutamicum genome.
• the positive strains on the spacer region of NCgl1741 and the lower homology arm NCgl1742 were named YPL-NCgl2747-2 (without mutation points) and YPL-NCgl2747-3 (from Corynebacterium glutamicum YP097158 as the starting strain). containing mutation points), the strains obtained using Corynebacterium glutamicum ATCC13032 as the starting strain were named L2747-2 (without mutation points) and L2747-3 (with mutation points) respectively.
• the recombinant strain YPL-NCgl2747-2 contains double copies of the NCgl2747 gene shown in SEQ ID No. 1; specifically, the recombinant strain YPL-NCgl2747-2 is a combination of the upper homology arm NCgl1741 and the lower homology arm NCgl1741 in the genome of Corynebacterium glutamicum YP097158.
• the spacer region of the homology arm NCgl1742 was replaced with the NCgl2747 gene and its promoter (i.e., positions 1-331 of SEQ ID No. 7 in the sequence listing), keeping other nucleotides in the genome of Corynebacterium glutamicum YP097158 unchanged.
• the recombinant bacteria obtained. Recombinant bacteria containing double copies of the NCgl2747 gene can significantly and stably increase the expression of the NCgl2747 gene.
• the recombinant strain L2747-2 contains double copies of the NCgl2747 gene shown in SEQ ID No. 1; specifically, the recombinant strain L2747-2 is the upper homology arm NCgl1741 and the lower homology arm NCgl1742 of the genome of Corynebacterium glutamicum ATCC13032.
• the spacer region is replaced with the NCgl2747 gene and its promoter (i.e., positions 1-331 of SEQ ID No. 7 in the sequence listing), and the other nucleotides in the genome of Corynebacterium glutamicum ATCC13032 are kept unchanged.
• Recombinant bacteria containing double copies of the NCgl2747 gene can significantly and stably increase the expression of the NCgl2747 gene.
• the recombinant strain YPL-NCgl2747-3 contains the mutated NCgl2747 A955T gene shown in SEQ ID No. 3; specifically, the recombinant strain YPL-NCgl2747-3 is a combination of the upper homology arm NCgl1741 and the lower homology arm NCgl1741 in the genome of Corynebacterium glutamicum YP097158.
• the spacer region of the homology arm NCgl1742 was replaced with the NCgl2747 A955T gene and its promoter (i.e., positions 1-331 of SEQ ID No. 8 in the sequence listing), keeping other nucleotides in the genome of Corynebacterium glutamicum YP097158 intact. recombinant bacteria.
• the recombinant strain L2747-3 contains the mutated NCgl2747 A955T gene shown in SEQ ID No. 3; specifically, the recombinant strain L2747-3 is the upper homology arm NCgl1741 and the lower homology arm NCgl1742 in the genome of Corynebacterium glutamicum ATCC13032.
• the spacer is replaced with the NCgl2747 A955T gene and its promoter (i.e., positions 1-331 of SEQ ID No. 8 in the sequence listing), and the other nucleotides in the genome of Corynebacterium glutamicum ATCC13032 are kept unchanged. bacteria.
• the PCR identification primers are as follows:
• P16 5′-TGGTCGTTGGAATCTTGC-3′ (corresponding to the outside of the lower homology arm NCgl1742) (SEQ ID No. 32).
• the single clone grown after the transformation of the ligation product was identified by PCR with the M13 primer to obtain the positive overexpression plasmids pXMJ19-NCgl2747 (containing the NCgl2747 gene) and pXMJ19-NCgl2747.
• A955T (containing NCgl2747 A955T gene), send the positive plasmid for sequencing. Because the plasmid contains a chloramphenicol resistance marker, chloramphenicol can be used to screen whether the plasmid has been transformed into the strain.
• positions 37-367 are the promoter of the NCgl2747 gene, and positions 368-1681 are the NCgl2747 gene.
• positions 37-367 are the promoter of the NCgl2747 A955T gene, and positions 368-1681 are the NCgl2747 A955T gene.
• the correctly sequenced pXMJ19-NCgl2747 and pXMJ19-NCgl2747 A955T plasmids were electrotransformed into Corynebacterium glutamicum YP097158 and wild-type Corynebacterium glutamicum ATCC13032 respectively, and cultured in the culture medium. See Table 1 for the composition of the culture medium and culture conditions.
• the single colonies produced by culture were identified by PCR with primers M13R(-48)/P18 (M13R(-48):AGCGGATAACAATTTCACACAGGA).
• the strains obtained using Corynebacterium glutamicum YP097158 as the starting strain were named YPL-NCgl2747-4 (containing plasmid pXMJ19-NCgl2747) and YPL-NCgl2747-5 (containing plasmid pXMJ19-NCgl2747 A955T ).
• the strains obtained by ATCC13032 as the starting strain were named L2747-4 (containing plasmid pXMJ19-NCgl2747) and L2747-5 (containing plasmid pXMJ19-NCgl2747 A955T ).
• Recombinant strains YPL-NCgl2747-4 and L2747-4 contain NCgl2747 shown in SEQ ID No.1 Gene plasmid;
• Recombinant bacteria YPL-NCgl2747-5 and L2747-5 contain plasmids carrying the mutated NCgl2747 A955T gene shown in SEQ ID No. 3.
• P20 5′-AGAAGATGAAGGACGTGGGTAACTTCCTGTCCACT-3′ (SEQ ID No.36),
• P21 5′-AGTGGACAGGAAGTTACCCACGTCCTTCATCTTCTCCGAC-3′ (SEQ ID No. 37),
• P22 5′- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC ACGCAACACTTGATGGAGT-3′ (the underlined nucleotide sequence is the sequence on pK18) (SEQ ID No. 38).
• the single clone grown after the transformation of the ligation product is identified by PCR with M13 primer to obtain the positive knockout vector pK18- ⁇ NCgl2747.
• This plasmid contains the entire knockout NCgl2747 homology arm fragment 1400bp (the sequence is shown in SEQ ID No. 14 ) and kanamycin resistance were used as selection markers, and the plasmid was sent for sequencing.
• the correctly sequenced knockout plasmid pK18- ⁇ NCgl2747 was electrotransformed into Corynebacterium glutamicum YP097158 and wild-type Corynebacterium glutamicum ATCC13032, and cultured in the culture medium. See Table 1 for the culture medium composition and culture conditions. Single colonies were identified by PCR using primers P19/P22: strains that simultaneously amplified 1400bp and 2549bp bands were positive strains, and strains that only amplified 2549bp bands were original bacteria. The positive strains were screened on 15% sucrose solid medium and then cultured on medium containing kanamycin and without kanamycin.
• the strains were selected to grow on the medium without kanamycin, and those containing The strains that did not grow on the kanamycin medium were further identified by PCR using primers P19/P22, and the strain with a 1400 bp band amplified was a positive strain with the NCgl2747 gene coding region deleted.
• the NCgl2747 fragment of the positive strain was again amplified by PCR with P19/P22 primers and connected to the pMD19-T vector for sequencing.
• the correctly sequenced strain was named YPL-NCgl2747-6 (the NCgl2747 gene on the genome of Corynebacterium glutamicum YP097158 was knocked out (except) and L2747-6 (the NCgl2747 gene on the genome of wild-type Corynebacterium glutamicum ATCC13032 was knocked out).
• the strains constructed in Examples 1-5 and the original strains of Corynebacterium glutamicum YP097158 and ATCC13032 were used in a BLBIO-5GC-4-H fermentation tank (Shanghai Bailun Biotechnology Co., Ltd.) with the culture medium shown in Table 3
• the fermentation experiment was carried out with the control process shown in Table 4.
• the ninhydrin colorimetric method was used to detect the L-lysine production, and the OD (660nm) was measured with a spectrophotometer. Each strain was repeated three times, and the results are shown in Table 5.
• SEQ ID No.1 NCgl2747 gene wild-type ORF (CDS) sequence (nucleotide sequence 1314bp)
• SEQ ID No.2 NCgl2747 protein sequence (i.e. amino acid sequence 438aa encoded by sequence 1)
• SEQ ID No.3 Gene mutant NCgl2747 A955T ORF (CDS) sequence (nucleotide sequence 1437bp)
• SEQ ID No.4 Gene mutant NCgl2747 I319F protein sequence (i.e. amino acid sequence 479aa encoded by sequence 3)
• SEQ ID No.6 Homology arm sequence of genome-integrated P7/P8NCgl2747 (763bp)
• SEQ ID No.7 Genomic integrated P9/P10NCgl2747 and its promoter sequence (1645bp)
• SEQ ID No.8 Genomic integrated P9/P10NCgl2747 A955T and its promoter sequence (1645bp)
• SEQ ID No.9 Genome integrated P11/P12 homology arm sequence of NCgl2747 (596bp)
• SEQ ID No.10 Identification primer P13 and P14 amplified fragment (size 1959bp)
• SEQ ID No.11 Identification primer P15 and P16 amplified fragment (size 1600bp)
• SEQ ID No.12 P17 and P18 amplified pXMJ19 plasmid overexpresses NCgl2747 and its promoter sequence (size 1715bp)
• SEQ ID No.13 P17 and P18 amplified pXMJ19 plasmid overexpresses NCgl2747 A955T and its promoter sequence (size 1715bp)
• SEQ ID No.14 Homology arm sequence of knockout NCgl2747 (size 1400bp)
• the present invention carries out point mutation NCgl2747 I319F and overexpression of NCgl2747 gene coding region in Corynebacterium glutamicum, which helps to increase L-lysine production and growth rate, while weakening or knocking out the gene is not conducive to L-lysine production and growth rate. -The accumulation of lysine will also reduce the growth rate of the strain. It shows that NCgl2747 I319F and its encoding gene of the present invention can be used to prepare L-lysine and have good application prospects.

Landscapes

• Chemical & Material Sciences (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Biotechnology (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• Biophysics (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Medicinal Chemistry (AREA)
• Gastroenterology & Hepatology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Peptides Or Proteins (AREA)

Priority Applications (3)

Applications Claiming Priority (2)

Publications (1)

Family

ID=82572342

Family Applications (1)

Country Status (5)

Cited By (2)

Families Citing this family (4)

Citations (6)

Family Cites Families (5)

• 2022
  • 2022-06-01 CN CN202210616402.9A patent/CN114835783B/zh active Active
• 2023
  • 2023-03-30 KR KR1020247043577A patent/KR20250019107A/ko active Pending
  • 2023-03-30 JP JP2024571087A patent/JP2025518814A/ja active Pending
  • 2023-03-30 WO PCT/CN2023/084970 patent/WO2023231547A1/zh not_active Ceased
  • 2023-03-30 EP EP23814743.3A patent/EP4534550A4/en active Pending

Patent Citations (6)

Non-Patent Citations (2)

Also Published As

Similar Documents

Legal Events