WO2023229365A1 - 피부 유래 균주 및 그의 피부 상태 개선 용도 - Google Patents

피부 유래 균주 및 그의 피부 상태 개선 용도 Download PDF

Info

Publication number
WO2023229365A1
WO2023229365A1 PCT/KR2023/007055 KR2023007055W WO2023229365A1 WO 2023229365 A1 WO2023229365 A1 WO 2023229365A1 KR 2023007055 W KR2023007055 W KR 2023007055W WO 2023229365 A1 WO2023229365 A1 WO 2023229365A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
expression
skin
streptococcus
seq
Prior art date
Application number
PCT/KR2023/007055
Other languages
English (en)
French (fr)
Inventor
허영목
조형우
김혜빈
백채윤
이동걸
강승현
박명삼
Original Assignee
코스맥스 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220068519A external-priority patent/KR20230168063A/ko
Priority claimed from KR1020230064487A external-priority patent/KR20230164583A/ko
Priority claimed from KR1020230064485A external-priority patent/KR20240014025A/ko
Priority claimed from KR1020230064481A external-priority patent/KR20240014021A/ko
Priority claimed from KR1020230064490A external-priority patent/KR20230168266A/ko
Priority claimed from KR1020230064486A external-priority patent/KR20240014026A/ko
Priority claimed from KR1020230064489A external-priority patent/KR20230168265A/ko
Priority claimed from KR1020230064480A external-priority patent/KR20240014020A/ko
Priority claimed from KR1020230064484A external-priority patent/KR20240014024A/ko
Priority claimed from KR1020230064482A external-priority patent/KR20240014022A/ko
Priority claimed from KR1020230064478A external-priority patent/KR20240014018A/ko
Priority claimed from KR1020230064491A external-priority patent/KR102609656B1/ko
Priority claimed from KR1020230064488A external-priority patent/KR20230164584A/ko
Priority claimed from KR1020230064492A external-priority patent/KR20230168267A/ko
Priority claimed from KR1020230064479A external-priority patent/KR20240014019A/ko
Priority claimed from KR1020230064483A external-priority patent/KR20240014023A/ko
Priority claimed from KR1020230064493A external-priority patent/KR20230168268A/ko
Priority claimed from KR1020230065227A external-priority patent/KR20240016185A/ko
Priority claimed from KR1020230065215A external-priority patent/KR20240016180A/ko
Priority claimed from KR1020230065222A external-priority patent/KR20240002687A/ko
Priority claimed from KR1020230065220A external-priority patent/KR20240002685A/ko
Priority claimed from KR1020230065218A external-priority patent/KR20240016182A/ko
Priority claimed from KR1020230065224A external-priority patent/KR20240002688A/ko
Priority claimed from KR1020230065221A external-priority patent/KR20240002686A/ko
Priority claimed from KR1020230065225A external-priority patent/KR20240016183A/ko
Priority claimed from KR1020230065223A external-priority patent/KR102609657B1/ko
Priority claimed from KR1020230065214A external-priority patent/KR20240016179A/ko
Priority claimed from KR1020230065219A external-priority patent/KR20240002684A/ko
Priority claimed from KR1020230065226A external-priority patent/KR20240016184A/ko
Priority claimed from KR1020230065216A external-priority patent/KR102609655B1/ko
Priority claimed from KR1020230065217A external-priority patent/KR20240016181A/ko
Application filed by 코스맥스 주식회사 filed Critical 코스맥스 주식회사
Publication of WO2023229365A1 publication Critical patent/WO2023229365A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/99—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/44—Staphylococcus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/46—Streptococcus ; Enterococcus; Lactococcus

Definitions

  • It relates to novel microorganisms, their lysate, culture medium, and extract of the culture medium, and their use for improving skin condition.
  • the skin ecosystem provides various types of habitats for microorganisms, and a wide range of microorganisms live there. They form a symbiotic relationship with their human hosts, and are known to have many positive effects on the host.
  • the skin constitutes various types of habitats, including indentations and specialized crevices, and helps a wide range of microorganisms to grow. Basically, the skin forms a physical membrane and helps defend against potential hazards and toxic substances from the outside.
  • the skin serves as a point of contact with the external environment and is also a home for various microorganisms (e.g. fungi, bacteria, viruses, and small larvae). Depending on the selection of physical and chemical functions, microorganisms adapt to specialized niches and establish habitats.
  • the skin remains cool, acidic, and dry.
  • the epidermis forms the skin barrier and plays an important role in blocking the penetration of microorganisms and toxins and maintaining moisture.
  • the uppermost layer of the epidermis is composed of the stratum corneum.
  • the epidermis has a form called a 'brick and mortar structure'.
  • the skin tissue goes through a continuous self-recovery process, and the scales (squames) that have completed the differentiation process constantly repeat the process of being shed from the skin tissue.
  • Probiotics are a general term for microorganisms that have beneficial effects on the human body. They refer to microorganisms that benefit our bodies. Most probiotics known to date are known as lactic acid bacteria. Probiotics have been reported to produce effective effects through various beneficial effects on the human body, but research on the relationship between skin flora and skin is insufficient.
  • One aspect is to provide novel skin-derived strains.
  • Another aspect is to provide a lysate, culture medium, or extract of the culture medium of the strain.
  • Another aspect is to provide a use of the strain, its lysate, culture medium, or extract of the culture medium.
  • Another aspect is to provide a composition containing the strain, its lysate, culture medium, extract of the culture medium, or a mixture thereof.
  • Another aspect is to provide a method of preventing, ameliorating, or treating a condition in a subject comprising administering an effective amount of the composition described above to the subject in need thereof.
  • One aspect provides a strain selected from:
  • the strain may be isolated.
  • isolated means something that does not exist in the natural world but can be artificially separated and used.
  • the strain may be isolated from human skin.
  • the strain may be a strain isolated by inoculating human skin cells into TSB (Tryptic Soy Broth) or R2A (Reasoner's 2A) medium and pure isolation and culturing of the cultured colonies.
  • the Staphylococcus capitis subsp. capitis strain may be a strain belonging to the genus Staphylococcus ( Staphylococcus sp.).
  • the Staphylococcus capitis subsp. capitis strain may be a strain deposited under deposit number KCCM13158P.
  • the strain may be Staphylococcus capitis subsp. capitis YJ-No2 strain.
  • the Staphylococcus capitis subsp. urealyticus strain may be a strain belonging to the genus Staphylococcus ( Staphylococcus sp.).
  • the Staphylococcus capitis subsp. urealyticus strain may be a strain deposited under deposit number KCCM13159P.
  • the strain may be Staphylococcus capitis subsp. urealyticus YM3 strain.
  • the Corynebacterium diphtheriae strain may be a strain belonging to the genus Corynebacterium ( Corynebacterium sp.).
  • the Corynebacterium diphtheriae strain may be a strain deposited under the deposit number KCCM13174P.
  • the strain may be Corynebacterium diphtheriae CM6 strain.
  • the Neisseria subflava strain may be a strain belonging to the Neisseria genus ( Corynebacterium sp.).
  • the Neisseria subflava strain may be a strain deposited under deposit number KCCM13173P.
  • the strain may be Neisseria subflava CM5 strain.
  • the Staphylococcus lugdunensis strain may be a strain belonging to the genus Staphylococcus ( Staphylococcus sp.).
  • the Staphylococcus lugdunensis strain may be a strain deposited under the deposit number KCCM13172P.
  • the strain may be Staphylococcus lugdunensis CM4 strain.
  • the Staphylococcus hominis strain may be a strain belonging to the genus Staphylococcus ( Staphylococcus sp.).
  • the Staphylococcus hominis strain may be a strain deposited under deposit number KCCM13171P.
  • the strain may be Staphylococcus hominis CM3 strain.
  • the Staphylococcus cohnii strain may be a strain belonging to the genus Staphylococcus ( Staphylococcus sp.).
  • the Staphylococcus cohnii strain may be a strain deposited under the deposit number KCCM13170P.
  • the strain may be Staphylococcus cohnii CM2 strain.
  • the Staphylococcus auricularis strain may be a strain belonging to the genus Staphylococcus ( Staphylococcus sp.).
  • the Staphylococcus auricularis strain may be a strain deposited under deposit number KCCM13169P.
  • the strain may be Staphylococcus auricularis CM1 strain.
  • the Streptococcus equinus strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus equinus strain may be a strain deposited under the deposit number KCCM13187P.
  • the strain may be Streptococcus equinus CX105 strain.
  • the Streptococcus anginosus strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus anginosus strain may be a strain deposited under the deposit number KCCM13188P.
  • the strain may be Streptococcus anginosus CX106 strain.
  • the Streptococcus pseudopneumoniae strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus pseudopneumoniae strain may be a strain deposited under the deposit number KCCM13189P.
  • the strain may be Streptococcus pseudopneumoniae CX107 strain.
  • the Streptococcus mutans strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus mutans strain may be a strain deposited under the deposit number KCCM13190P.
  • the strain may be Streptococcus mutans CX108 strain.
  • the Cutibacterium avidum strain may be a strain belonging to the genus Cutibacterium sp.
  • the Cutibacterium avidum strain may be a strain deposited under the deposit number KCCM13198P.
  • the strain may be Cutibacterium avidum YM-41 strain.
  • the Streptococcus lutetiensis strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus lutetiensis strain may be a strain deposited under the deposit number KCCM13183P.
  • the strain may be Streptococcus lutetiensis CX101 strain.
  • the Streptococcus australis strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus australis strain may be a strain deposited under the deposit number KCCM13184P.
  • the strain may be Streptococcus australis CX102 strain.
  • the Streptococcus halichoeri strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus halichoeri strain may be a strain deposited under the deposit number KCCM13185P.
  • the strain may be Streptococcus halichoeri CX103 strain.
  • the Streptococcus massiliensis strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus massiliensis strain may be a strain deposited under the deposit number KCCM13186P.
  • the strain may be Streptococcus massiliensis CX104 strain.
  • the Corynebacterium durum strain may be a strain belonging to the genus Corynebacterium ( Corynebacterium sp.).
  • the Corynebacterium durum strain may be a strain deposited under deposit number KCCM13194P.
  • the strain may be Corynebacterium durum CD18 strain.
  • the Corynebacterium glucuronolyticum strain may be a strain belonging to the genus Corynebacterium ( Corynebacterium sp.).
  • the Corynebacterium glucuronolyticum strain may be a strain deposited under the deposit number KCCM13197P.
  • the strain may be Corynebacterium glucuronolyticum CG19 strain.
  • the Corynebacterium propinquum strain may be a strain belonging to the genus Corynebacterium sp.
  • the Corynebacterium propinquum strain may be a strain deposited under the deposit number KCCM13196P.
  • the strain may be Corynebacterium propinquum CP33 strain.
  • the Corynebacterium striatum strain may be a strain belonging to the genus Corynebacterium ( Corynebacterium sp.).
  • the Corynebacterium striatum strain may be a strain deposited under deposit number KCCM13195P.
  • the strain may be Corynebacterium striatum CS96 strain.
  • the Corynebacterium xerosis strain may be a strain belonging to the genus Corynebacterium ( Corynebacterium sp.).
  • the Corynebacterium xerosis strain may be a strain deposited under deposit number KCCM13193P.
  • the strain may be Corynebacterium xerosis CX1 strain.
  • the Streptococcus parasanguinis strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus parasanguinis strain may be a strain deposited under the deposit number KCCM13204P.
  • the strain may be Streptococcus parasanguinis SP06 strain.
  • the Streptococcus downii strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus downii strain may be a strain deposited under the deposit number KCCM13209P.
  • the strain may be Streptococcus downii YM-11 strain.
  • the Streptococcus rubneri strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus rubneri strain may be a strain deposited under the deposit number KCCM13213P.
  • the strain may be Streptococcus rubneri YM-15 strain.
  • the Streptococcus vestibularis strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus vestibularis strain may be a strain deposited under the deposit number KCCM13217P.
  • the strain may be Streptococcus vestibularis YM-19 strain.
  • the Streptococcus sanguinis strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus sanguinis strain may be a strain deposited under the deposit number KCCM13215P.
  • the strain may be Streptococcus sanguinis YM-17 strain.
  • the Streptococcus sobrinus strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus sobrinus strain may be a strain deposited under the deposit number KCCM13216P.
  • the strain may be Streptococcus sobrinus YM-18 strain.
  • the Streptococcus oralis strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus oralis strain may be a strain deposited under the deposit number KCCM13211P.
  • the strain may be Streptococcus oralis YM-13 strain.
  • the Streptococcus intermedius strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus intermedius strain may be a strain deposited under the deposit number KCCM13210P.
  • the strain may be Streptococcus intermedius YM-12 strain.
  • the Streptococcus pyogenes strain may be a strain belonging to the Streptococcus genus ( Streptococcus sp.).
  • the Streptococcus pyogenes strain may be a strain deposited under the deposit number KCCM13212P.
  • the strain may be Streptococcus pyogenes YM-14 strain.
  • the strains (1) to (31) may each contain 16S rRNA of SEQ ID NOs: 1 to 31.
  • the strains (1) to (31) have SEQ ID NOs: 1 to 31 and about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, about 99.5% or more. or more, about 99.9% or more, 95% to 100%, 96% to 100%, 97% to 100%, 98% to 100%, 99% to 100%, 99.5% to 100%, or 99.9% to 100%. It may contain 16S rRNA with sequence identity.
  • sequence identity refers to the degree of identity of amino acid residues or bases between sequences after aligning both sequences to be as consistent as possible in a specific comparison region. Sequence identity can be confirmed according to methods known in the art. The percent sequence identity can be determined using known sequence comparison programs, examples of which include BLASTN (NCBI), CLC Main Workbench (CLC bio), MegAlignTM (DNASTAR Inc), etc.
  • the strain may have an effect of improving skin condition, improving skin beauty, or preventing, improving, or treating skin diseases.
  • the strain may have effects such as preventing skin aging (anti-aging), improving skin wrinkles (anti-wrinkle), improving skin elasticity, moisturizing skin, strengthening skin barrier, whitening skin, anti-inflammatory, or anti-allergy.
  • the strain may have the effect of preventing, treating, or improving diseases caused by impaired skin barrier function, melanin hyperpigmentation diseases, skin inflammatory diseases, or skin allergic diseases.
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, or promoting skin elasticity.
  • the strain may reduce or inhibit the expression of MMP-1 (Matrix metalloproteinase-1).
  • MMP-1 Microx metalloproteinase-1
  • the strain may reduce or suppress the expression of MMP-1 increased by ultraviolet rays.
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, improving skin elasticity, moisturizing the skin, or strengthening the skin barrier.
  • the strain may reduce or inhibit the expression of MMP-1.
  • the strain may reduce or suppress the expression of MMP-1 increased by ultraviolet rays.
  • the strain may increase the expression of hyaluronic acid synthase 3 (HAS3).
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of one or more of HAS3 and aquaporin (Aquaporin 3, AQP3).
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of one or more of filaggrin (FLN) and ABCA12 (ATP-binding cassette sub-family A member 12).
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, improving skin elasticity, moisturizing the skin, or strengthening the skin barrier.
  • the strain may reduce or inhibit the expression of MMP-1.
  • the strain may reduce or suppress the expression of MMP-1 increased by ultraviolet rays.
  • the strain may increase the expression of one or more of HAS3 and AQP3.
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, improving skin elasticity, moisturizing the skin, or strengthening the skin barrier.
  • the strain may reduce or inhibit the expression of MMP-1.
  • the strain may reduce or suppress the expression of MMP-1 increased by ultraviolet rays.
  • the strain may increase the expression of AQP3.
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, improving skin elasticity, moisturizing the skin, or strengthening the skin barrier.
  • the strain may reduce or inhibit the expression of MMP-1.
  • the strain may reduce or suppress the expression of MMP-1 increased by ultraviolet rays.
  • the strain may increase the expression of HAS3.
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, improving skin elasticity, moisturizing the skin, or strengthening the skin barrier.
  • the strain may reduce or inhibit the expression of MMP-1.
  • the strain may reduce or suppress the expression of MMP-1 increased by ultraviolet rays.
  • the strain may increase the expression of HAS3.
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, or promoting skin elasticity.
  • the strain may increase the expression of COL1A1 (Collagen type I alpha 1 chain).
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of filaggrin.
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of AQP3.
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of AQP3.
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of filaggrin.
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of one or more of HAS3 and AQP3.
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of one or more of HAS3 and AQP3.
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of HAS3.
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, or promoting skin elasticity.
  • the strain may reduce or inhibit the expression of MMP-1.
  • the strain may reduce or suppress the expression of MMP-1 increased by ultraviolet rays.
  • the strain may have a skin whitening effect.
  • the strain may reduce or inhibit melanin secretion.
  • the strain may have a skin whitening effect.
  • the strain may reduce or inhibit melanin secretion.
  • the strain may have a skin whitening effect.
  • the strain may reduce or inhibit melanin secretion.
  • the strain may have a skin whitening effect.
  • the strain may reduce or inhibit melanin secretion.
  • the strain may reduce or inhibit melanin production (or melanin synthesis).
  • the strain may have a skin whitening effect.
  • the strain may reduce or inhibit melanin secretion.
  • the strain may reduce or inhibit melanin production (or melanin synthesis).
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of filaggrin.
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of filaggrin.
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of filaggrin.
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, or promoting skin elasticity.
  • the strain may reduce or inhibit the expression of MMP-1.
  • the strain may reduce or suppress the expression of MMP-1 increased by ultraviolet rays.
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, or promoting skin elasticity.
  • the strain may increase the expression of COL1A1.
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, improving skin elasticity, moisturizing the skin, or strengthening the skin barrier.
  • the strain may reduce or inhibit the expression of MMP-1.
  • the strain may reduce or suppress the expression of MMP-1 increased by ultraviolet rays.
  • the strain may increase the expression of HAS3.
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of filaggrin.
  • the strain may have the effect of preventing skin aging, improving skin wrinkles, or promoting skin elasticity.
  • the strain may reduce or inhibit the expression of MMP-1.
  • the strain may reduce or suppress the expression of MMP-1 increased by ultraviolet rays.
  • the strain may have a skin moisturizing or skin barrier strengthening effect.
  • the strain may increase the expression of HAS3.
  • Another aspect provides a lysate, culture fluid, or extract of the culture fluid of the strain.
  • lysate may be used interchangeably with “lysate” and may refer to a product obtained by breaking the cell wall of a strain by chemical or physical force.
  • the lysate may include the lysate itself, its concentrate, or its freeze-dried product.
  • culture medium may be used interchangeably with “culture supernatant,” “conditioned culture medium,” or “conditioned medium,” and refers to a medium that can supply nutrients to enable the strain to grow and survive in vitro. It may refer to the entire medium containing the strain, its metabolites, extra nutrients, etc. obtained by culturing the strain for a certain period of time. Additionally, the culture medium may refer to a culture medium obtained by removing the bacterial cells from the bacterial culture medium obtained by culturing the strain.
  • the liquid from which the bacteria have been removed from the culture medium is also called “supernatant", and the supernatant is obtained by leaving the culture solution still for a certain period of time and taking only the upper liquid excluding the part that has settled in the lower layer, or by removing the bacteria through filtration, or by removing the culture liquid. It can be obtained by centrifuging to remove the sediment at the bottom and taking only the liquid at the top.
  • the "bacteria” refers to the strain itself of the present invention, and includes the strain itself isolated and selected from a skin sample, etc., or a strain isolated from the culture medium by culturing the strain.
  • the bacterial cells can be obtained by centrifuging the culture medium and taking the part that sinks to the lower layer. Alternatively, since they sink to the lower layer of the culture medium by gravity, they can be obtained by leaving them still for a certain period of time and then removing the upper liquid.
  • Culture media and culture conditions for cultivating the above strain can be appropriately selected or modified by those skilled in the art.
  • the culture medium is cultured by culturing the strain in an appropriate medium (e.g., R2A medium, TSA medium, or TSB medium) at an appropriate temperature (e.g., either above 10°C or below 40°C) for a certain period of time (e.g., 4 to 120 hours). ) may have been obtained by culturing for a period of time.
  • an appropriate medium e.g., R2A medium, TSA medium, or TSB medium
  • an appropriate temperature e.g., either above 10°C or below 40°C
  • a certain period of time e.g., 4 to 120 hours.
  • the culture medium may include the culture medium itself, its concentrate, or freeze-dried product obtained by culturing the strain.
  • the culture medium may include a culture supernatant obtained by removing the strain from the culture medium, a concentrate thereof, or a freeze-dried product.
  • the culture supernatant of the strain may be obtained by removing the strain by centrifuging or filtering the strain culture fluid.
  • the concentrate may be obtained by concentrating the strain culture itself or the supernatant obtained after centrifuging or filtering the culture.
  • culture extract refers to an extract from the culture medium or its concentrate, and may include extracts, diluted or concentrated extracts, dried products obtained by drying the extracts, crude or purified products thereof, and fractions thereof. You can.
  • the strain, its lysate, culture medium, or extract of the culture medium may be biologically pure.
  • the strain may be obtained by pure culture.
  • Another aspect provides the use of the strain, its lysate, culture, or extract of the culture.
  • a composition comprising the strain, its lysate, culture medium, extract of the culture medium, or a mixture thereof is provided.
  • the strain may be a strain according to the above aspect.
  • Uses of the strain may include improving skin condition, improving skin beauty, or preventing, improving or treating skin diseases.
  • the improvement of skin condition or skin beauty may include preventing skin aging (anti-aging), improving skin wrinkles (anti-wrinkle), improving skin elasticity, moisturizing skin, strengthening skin barrier, whitening skin, anti-inflammation, or anti-allergy.
  • skin aging refers to both tangible and intangible changes that occur in the skin as one ages. Skin aging includes, for example, a thinning of the epidermis, a decrease in the number of cells or blood vessels in the dermis, a decrease in the ability to repair DNA damage, an increase in the cell turnover cycle, a decrease in the ability to heal wounds, a weakening of the skin barrier function, a decrease in the moisture retention ability of the epidermis, These include reduced sweat secretion, reduced sebum secretion, reduced vitamin D production, reduced ability to defend against physical damage, reduced ability to eliminate chemicals, reduced immune response, weakened sensory function, and reduced body temperature regulation.
  • the prevention of skin aging may mean improving skin aging caused by extrinsic or endogenous factors.
  • the exogenous factors refer to various external factors, such as ultraviolet rays (light).
  • the endogenous factors are also referred to as chronological factors and mainly refer to factors that occur due to the passage of time.
  • the skin aging is specifically not only a symptom of premature aging induced by external stimuli such as ultraviolet rays, pollution, cigarette smoke, chemicals, etc., but also a natural aging phenomenon that occurs as the proliferation of skin cells decreases with age. It is a concept that includes wrinkles, loss of elasticity, skin sagging and dryness, etc.
  • wrinkles include stimulation caused by changes in internal and external factors that change the components that make up skin tissue, causing wrinkles.
  • the aging may be photoaging.
  • photoaging is a phenomenon caused by external environmental factors, the most representative factor being ultraviolet rays. Ultraviolet rays cause damage to biological components such as activation of proteolytic enzymes, chain cutting of matrix proteins, and abnormal cross-linking, and repetition of this mechanism causes skin aging that is evident in appearance.
  • wrinkle refers to a state in which the skin loses its elasticity and becomes loose, for example, the skin may be folded.
  • prevention or improvement of skin wrinkles may refer to any action that prevents or improves wrinkles by suppressing the expression of factors related to wrinkles, or increases the total amount of collagen.
  • promoting skin elasticity may refer to any action that improves the elasticity of loose skin.
  • skin moisturizing may refer to any action that maintains skin moisture or prevents moisture loss.
  • skin barrier strengthening may refer to any action that improves the function of the skin barrier, which is located on the outermost layer of the skin and prevents moisture and nutrition loss.
  • skin whitening may mean not only brightening skin tone by inhibiting the synthesis of melanin pigment, but also improving skin hyperpigmentation such as spots or freckles caused by ultraviolet rays, hormones, or genetics.
  • anti-inflammatory may be used interchangeably with “improvement of inflammation” and “inhibition of inflammation,” and may include, for example, all actions that inhibit the expression of inflammatory cytokines.
  • anti-allergy may be used interchangeably with “allergy improvement” and “allergy suppression,” for example, removing or suppressing allergens (antigens that cause allergic diseases) or alleviating allergic reactions caused by allergens. It can include all actions required.
  • the “skin disease” may be a disease caused by damage to the skin barrier function, skin aging, skin inflammatory disease, or skin allergic disease.
  • the damage to the skin barrier function may mean any change that appears in the skin due to decreased or damaged skin barrier function. For example, it may include increased skin wrinkles, dryness, dermatitis, atopic dermatitis, allergic dermatitis, acne, etc.
  • melanin hyperpigmentation is a broad concept that includes all melanin hyperpigmentation caused by various causes, and means that certain areas of the skin, fingernails, or toenails become darker than other areas due to an excessive increase in melanin pigment. .
  • the melanin hyperpigmentation disease includes freckles; melasma; chloasma; liver spots; nevus; solar lentigo; melanosis; and pelviz-jegher's syndrome; Chloasma gravidarum; Hyperpigmentation after drug use; and postinflammatory hyperpigmentation, but is not limited thereto.
  • the skin inflammatory disease may be any one selected from the group consisting of skin wounds, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, erythema, urticaria, psoriasis, drug rash, and acne.
  • the skin allergic disease may include atopic dermatitis, allergic dermatitis, urticaria, itching, rash, etc.
  • prevention includes suppressing the occurrence of a disease.
  • treatment includes inhibiting, alleviating, or eliminating the development of a disease.
  • improvement may refer to any action that results in at least reducing the severity of a parameter associated with the alleviation or treatment of a condition, such as symptoms.
  • the strain, its lysate, culture medium, or extract of the culture medium can reduce or inhibit the expression of MMP-1.
  • the strain, its lysate, culture medium, or extract of the culture medium can reduce or inhibit the expression of MMP-1 increased by ultraviolet rays. Accordingly, the strain, its lysate, culture medium, or extract of the culture medium may exhibit the effect of preventing skin aging, improving skin wrinkles, or improving skin elasticity.
  • the strain, its lysate, culture medium, or extract of the culture medium can increase the expression of COL1A1.
  • the strain, its lysate, culture medium, or extract of the culture medium can increase the expression of COL1A1 increased by ultraviolet rays. Accordingly, the strain, its lysate, culture medium, or extract of the culture medium may exhibit the effect of preventing skin aging, improving skin wrinkles, or improving skin elasticity.
  • the strain, its lysate, culture medium, or extract of the culture medium can increase the expression of one or more of HAS3, AQP3, filaggrin, and ABCA12. Therefore, the strain, its lysate, culture medium, or extract of the culture medium may exhibit a skin moisturizing or skin barrier strengthening effect.
  • the strain, its lysate, culture medium, or extract of the culture medium may reduce or inhibit melanin secretion, or reduce or inhibit melanin production (or melanin synthesis). Therefore, the strain, its lysate, culture medium, or extract of the culture medium can exhibit a skin whitening effect.
  • the strains include other strains with skin improvement effects, such as Staphylococcus capitis subspecies strains, strains belonging to the genus Staphylococcus, strains belonging to the genus Corynebacterium, strains belonging to the genus Neisseria, strains belonging to the genus Streptococcus, and Cutibacterium. It can produce a synergistic effect when used with strains belonging to the genus.
  • Staphylococcus capitis subspecies strains belonging to the Staphylococcus genus include, for example, Staphylococcus capitis subsp. urealyticus , Staphylococcus capitis subsp. capitis ), etc.
  • Staphylococcus genus include, for example, Staphylococcus auricularis , Staphylococcus cohnii, Staphylococcus hominis , and Staphylococcus lugdunensis. ( Staphylococcus lugdunensis ), etc.
  • Corynebacterium genus include, for example, Corynebacterium aurimucosum , Corynebacterium diphtheria, Corynebacterium durum , Corynebacterium Corynebacterium glucuronolyticum , Corynebacterium matruchotii, Corynebacterium propinquum , Corynebacterium striatum , Corynebacterium xerosis ( Corynebacterium xerosis ), Corynebacterium avidum ( Cutibacterium avidum ), etc.
  • Strains belonging to the Neisseria genus include, for example, Neisseria flava .
  • Streptococcus genus include, for example, Streptococcus equinus , Streptococcus australis, Streptococcus downii , Streptococcus halichoeri , and Streptococcus.
  • Streptococcus intermedius Streptococcus lutetiensis, Streptococcus massiliensis, Streptococcus mutans , Streptococcus oralis , Streptococcus para Sanguis ( Streptococcus parasanguinis ), Streptococcus anginosus , Streptococcus pseudopneumoniae , Streptococcus pyogenes, Streptococcus rubneri, Streptococcus salivarius ( Streptococcus salivarius ), Streptococcus sanguinis, Streptococcus sobrinus, Streptococcus vestibularis , Streptococcus rubneri , etc.
  • Cutibacterium includes, for example, Cutibacterium granulosum and Cutibacterium acnes .
  • the composition may include the strain, its lysate, culture medium, extract of the culture medium, or a mixture thereof as an active ingredient.
  • the term "included as an active ingredient” means that the strain of the present specification, its lysate, culture medium, or extract of the culture medium is added to the extent that it can exhibit the effects mentioned herein, and various ingredients are added for drug delivery and stabilization, etc. This means that it is formulated into various forms by adding as a secondary ingredient.
  • the strain, its lysate, culture medium, or extract of the culture medium is 0.0001% by weight to 99.9999% by weight, for example, 0.001% by weight to 80% by weight, 0.01% by weight to 60% by weight, 0.01% by weight, based on the total weight of the composition. to 40% by weight, 0.01% to 30% by weight, 0.01% to 20% by weight, 0.01% to 10% by weight, 0.01% to 5% by weight, 0.05% to 60% by weight, 0.05% to 40% by weight.
  • the content of the active ingredient can be selected by a person skilled in the art at an appropriate amount that can be formulated within a content range that can produce the effects mentioned in this specification.
  • the composition may be in a liquid state or a dry state. In one embodiment, the composition may be in dry powder form.
  • the drying method for preparing the composition in a dry state may be a method generally used in the art and is not particularly limited.
  • Non-limiting examples of the drying method include air drying method, natural drying method, spray drying method, freeze drying method, etc. These methods can be used alone or at least two methods can be used together.
  • the composition may contain an effective amount of additives sufficient to reduce deterioration of the strain, its lysate, culture medium, or extract of the culture medium.
  • the additive may be, for example, a binder, but is not limited thereto.
  • the composition may further include a cosmetically, pharmaceutically, or foodologically acceptable carrier.
  • the composition can be formulated with a carrier and provided as cosmetics, drugs, food additives, etc.
  • the composition may be a cosmetic composition.
  • the cosmetic composition may further include ingredients commonly used in cosmetic compositions, functional additives, etc., such as antioxidants, stabilizers, solubilizers, surfactants, dispersants, emulsifiers, and preservatives. , conventional auxiliaries such as vitamins, pigments, fragrances, etc., and carriers.
  • the cosmetic composition is not particularly limited to a specific formulation, and the formulation may be appropriately selected depending on the purpose.
  • the cosmetic composition may have, for example, a solubilized formulation, an emulsified formulation, or a dispersed formulation.
  • the cosmetic composition includes, for example, lotion, cream, essence, cleansing foam, cleansing water, pack, ampoule, body lotion, body oil, body gel, shampoo, rinse, hair conditioner, hair gel, foundation, lipstick, mascara, and makeup. It may have a base or skin-adhesive cosmetic formulation.
  • the skin-adhesive cosmetic formulation may be, for example, a mask pack, but is not limited thereto.
  • composition may be a composition for external skin application.
  • the external skin preparation may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal delivery patch, drug-containing bandage, lotion, or a combination thereof.
  • the skin external preparations include ingredients commonly used in external skin preparations such as cosmetics and medicines, such as aqueous ingredients, oil-based ingredients, powder ingredients, alcohols, moisturizers, thickeners, ultraviolet absorbers, whitening agents, preservatives, antioxidants, surfactants, and fragrances. , colorants, various skin nutrients, metal ion sequestrants, sugars, or combinations thereof may be appropriately mixed as needed.
  • the composition may be a pharmaceutical composition.
  • the pharmaceutical composition may additionally include a pharmaceutically acceptable diluent or carrier.
  • the diluent may be lactose, corn starch, soybean oil, microcrystalline cellulose, mannitol, or a combination thereof.
  • the carrier may be an excipient, disintegrant, binder, lubricant, or a combination thereof.
  • the excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof.
  • the disintegrant may be calcium carboxymethylcellulose, sodium starch glycolate, calcium monohydrogen phosphate anhydride, or a combination thereof.
  • the binder may be polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose, or a combination thereof.
  • the lubricant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.
  • the pharmaceutical composition may be formulated as an oral or parenteral dosage form.
  • Oral dosage forms may be granules, powders, solutions, tablets, capsules, dry syrup, etc.
  • Parenteral dosage forms may be injections, ointments, etc.
  • the composition may be a food composition.
  • the composition may be a health functional food composition. In this case, it can be formulated in the form of a typical health functional food known in the art.
  • the food composition may use the strain, its lysate, culture medium, or extract of the culture medium alone, or may be used together with other foods or food ingredients, and may be used appropriately according to conventional methods.
  • the mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention, health, or therapeutic treatment).
  • beverage compositions may contain various flavoring agents or natural carbohydrates as additional ingredients like ordinary beverages.
  • the natural carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; and polysaccharides such as dextrins and cyclodextrins; Sugar alcohols such as xylitol, sorbitol, and erythritol.
  • a sweetener natural sweeteners such as thaumatin and stevia extract or synthetic sweeteners such as saccharin and aspartame can be used.
  • the food composition is also used in nutritional supplements, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonated beverages. It may contain a carbonating agent, or a combination thereof.
  • the food composition may also contain pulp for the production of natural fruit juice, fruit juice beverage, vegetable beverage, or a combination thereof.
  • Another aspect provides a method of preventing, ameliorating, or treating a condition in a subject comprising administering an effective amount of the composition described above to the subject in need thereof.
  • the condition of the subject may be a condition related to the skin, and specifically, it may be a disease caused by damage to the skin barrier function, skin aging, melanin hyperpigmentation disease, skin inflammatory disease, or skin allergic disease.
  • administering As used herein, the terms “administering,” “introducing,” and “implanting” are used interchangeably and refer to an individual by a method or route that results in at least partial localization of the composition according to one embodiment to the desired site. It may refer to the arrangement of the composition according to one embodiment into the inner space.
  • Administration may be by methods known in the art.
  • the administration method such as administration route and administration frequency, can be appropriately selected by a person skilled in the art.
  • Administration may be administered directly to the subject by any means, such as, for example, intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal or subcutaneous administration. You can.
  • the administration may be administered systemically or locally.
  • the administration may include application to the skin.
  • the subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat.
  • the subject may be an entity in need of skin condition improvement, for example, an entity in need of anti-aging skin, improvement of skin wrinkles, enhancement of skin elasticity, skin moisturization, skin barrier strengthening, skin whitening, anti-inflammatory, or anti-allergy effect. You can.
  • the administration of the composition according to one embodiment is 0.1 mg to 1,000 mg per day, for example, 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1 mg. 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or 10 mg to 25 mg may be administered.
  • the dosage may be prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, gender, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity, and those skilled in the art will Taking these factors into consideration, the dosage can be adjusted appropriately.
  • the frequency of administration can be once a day or two or more times within the range of clinically acceptable side effects.
  • the administration site it can be administered at one or two or more locations, and the total number of administration days can be from 1 to 30 days for one treatment, either daily or at intervals of 2 to 5 days. If necessary, the same treatment can be repeated after an appropriate period.
  • the dosage per kg is the same as for humans, or the above dosage is converted into, for example, the volume ratio (e.g., average value) of the organs (heart, etc.) between the target animal and human.
  • One dose can be administered.
  • Another aspect provides the use of the strain, its lysate, culture, or extract of the culture for use in preparing a composition for improving skin condition.
  • Another aspect provides the use of said strain, its lysate, culture, or extract of the culture for use in preparing a medicament for the prevention or treatment of melanin hyperpigmentation disease, skin inflammatory disease, or skin allergic disease.
  • Redundant content is omitted in consideration of the complexity of the present specification, and terms not otherwise defined in the present specification have meanings commonly used in the technical field to which the present invention pertains.
  • the new skin-derived strain has the effect of improving skin conditions such as preventing skin aging, improving skin wrinkles, improving skin elasticity, moisturizing the skin, strengthening the skin barrier, and whitening the skin, so it can be usefully used in cosmetics, medicine, food, etc. You can.
  • Figure 1 is a graph showing the relative expression level of MMP-1. None (UV): UV irradiation + no medium or culture medium treatment, Control: UV irradiation + medium treatment (negative control), EGCG (1 uM): UV irradiation + EGCG treatment (positive control), S. capitis sub. capitis (1%): UV irradiation + YJ-No2 strain culture medium treatment group.
  • Figure 2A is a graph showing the relative expression level of MMP-1. None (UV): UV irradiation + no medium or culture medium treatment, Control: UV irradiation + medium treatment (negative control), EGCG (1 uM): UV irradiation + EGCG treatment (positive control), S. capitis sub. urealyticus (1%): UV irradiation + YM3 strain culture medium treatment group.
  • Figure 2B is a graph showing the relative expression level of HAS3. None: No medium or culture medium treatment, Control: Medium treatment (negative control), Retinoic acid (1 uM): Retinoic acid treatment (positive control), S. capitis sub. Urealyticus (1%): YM3 strain culture medium treatment group.
  • Figure 3A is a graph showing the relative expression level of HAS3. None: No medium or culture medium treatment, Control: Medium treatment (negative control), Retinoic acid (1 uM): Retinoic acid treatment (positive control), C. diphteriae (1%): CM6 strain culture medium treatment group.
  • Figure 3B is a graph showing the relative expression level of AQP3. None: No medium or culture medium treatment, Control: Medium treatment (negative control), Retinoic acid (1 uM): Retinoic acid treatment (positive control), C. diphteriae (1%): CM6 strain culture medium treatment group.
  • Figure 4A is a graph showing the relative expression level of filaggrin.
  • Control Medium treatment (negative control), Neisseria subflava Ferment Filtrate (1%): CM5 strain culture medium treatment group
  • Figure 4B is a graph showing the relative expression level of ABCA12.
  • Control Medium treatment (negative control), Neisseria subflava Ferment Filtrate (1%): CM5 strain culture medium treatment group
  • Figure 5A is a graph showing the relative expression level of MMP-1. None (UV): UV irradiation + no medium or culture medium treatment, Control: UV irradiation + medium treatment (negative control), EGCG (1 uM): UV irradiation + EGCG treatment (positive control), S. lugdunensis (1%): UV irradiation + CM4 strain culture treatment group.
  • Figure 5B is a graph showing the relative expression level of HAS3. None: No medium or culture medium treatment, Control: Medium treatment (negative control), Retinoic acid (1 uM): Retinoic acid treatment (positive control), S. lugdunensis (1%): CM4 strain culture medium treatment group.
  • Figure 5C is a graph showing the relative expression level of AQP3. None: No medium or culture medium treatment, Control: Medium treatment (negative control), Retinoic acid (1 uM): Retinoic acid treatment (positive control), S. lugdunensis (1%): CM4 strain culture medium treatment group.
  • Figure 6A is a graph showing the relative expression level of MMP-1. None (UV): UV irradiation + no medium or culture medium treatment, Control: UV irradiation + medium treatment (negative control), EGCG (1 uM): UV irradiation + EGCG treatment (positive control), S. hominis (1%): UV irradiation + CM3 strain culture treatment group.
  • Figure 6B is a graph showing the relative expression level of AQP3. None: medium or culture untreated, Control: medium treated (negative control), Retinoic acid (1 uM): retinoic acid treated (positive control), S. hominis (1%): CM3 strain culture treated group.
  • Figure 7A is a graph showing the relative expression level of MMP-1. None (UV): UV irradiation + no medium or culture medium treatment, Control: UV irradiation + medium treatment (negative control), EGCG (1 uM): UV irradiation + EGCG treatment (positive control), S. cohnii (1%): UV irradiation + CM2 strain culture treatment group.
  • Figure 7B is a graph showing the relative expression level of HAS3. None: No medium or culture medium treatment, Control: Medium treatment (negative control), Retinoic acid (1 uM): Retinoic acid treatment (positive control), S. cohnii (1%): CM2 strain culture medium treatment group.
  • Figure 8A is a graph showing the relative expression level of MMP-1. None (UV): UV irradiation + no medium or culture medium treatment, Control: UV irradiation + medium treatment (negative control), EGCG (1 uM): UV irradiation + EGCG treatment (positive control), S. auricularis (1%): UV irradiation + CM1 strain culture treatment group.
  • Figure 8B is a graph showing the relative expression level of HAS3. None: medium or culture untreated, Control: medium treated (negative control), Retinoic acid (1 uM): retinoic acid treated (positive control), S. auricularis (1%): CM1 strain culture treated group.
  • Figure 9 is a graph showing the relative expression level of COL1A1.
  • Negative control group UV irradiation + strain culture untreated group
  • Example 2 UV irradiation + CX105 strain culture treated group.
  • Figure 10 is a graph showing the relative expression level of filaggrin (FLG). Negative control group: medium treated + untreated group with strain culture, Example 2: group treated with CX106 strain culture.
  • Figure 11 is a graph showing the relative expression level of AQP3. Negative control: medium treated + untreated group with strain culture, RA: group treated with retinoic acid (positive control), Example 2: group treated with CX107 strain culture.
  • Figure 12 is a graph showing the relative expression level of AQP3. Negative control: medium treated + untreated group with strain culture, RA: group treated with retinoic acid (positive control), Example 2: group treated with CX108 strain culture.
  • Figure 13 is a graph showing the relative expression level of filaggrin (FLG).
  • Negative control group medium treated + untreated strain culture group
  • Example 2 YM-41 strain culture treated group.
  • Figure 14A is a graph showing the relative expression level of HAS3. Negative control: group treated with medium + untreated strain culture, RA: group treated with retinoic acid (positive control), Example 2: group treated with CX101 strain culture.
  • Figure 14B is a graph showing the relative expression level of AQP3. Negative control: group treated with medium + untreated strain culture, RA: group treated with retinoic acid (positive control), Example 2: group treated with CX101 strain culture.
  • Figure 15A is a graph showing the relative expression level of HAS3. Negative control: group treated with medium + untreated strain culture, RA: group treated with retinoic acid (positive control), Example 2: group treated with CX102 strain culture.
  • Figure 15B is a graph showing the relative expression level of AQP3.
  • Negative control group treated with medium + untreated strain culture
  • RA group treated with retinoic acid (positive control)
  • Example 2 group treated with CX102 strain culture.
  • Figure 16 is a graph showing the relative expression level of HAS3. Negative control: group treated with medium + untreated strain culture, RA: group treated with retinoic acid (positive control), Example 2: group treated with CX103 strain culture.
  • Figure 17 is a graph showing the relative expression level of MMP-1. Negative control group: group treated with UV irradiation + medium treatment + untreated strain culture, Example 2: group treated with UV irradiation + CX104 strain culture.
  • Figure 18 is a graph showing melanin secretion amount (%). None: ⁇ -MSH untreated + sample untreated group, Control: ⁇ -MSH treated + medium treated group (negative control), Arbutin (100 ppm): ⁇ -MSH treated + arbutin treated group (positive control), C. durum (1%): ⁇ -MSH treatment + CD18 strain culture medium treatment group.
  • Figure 19 is a graph showing melanin secretion amount (%). None: ⁇ -MSH untreated + sample untreated group, Control: ⁇ -MSH treated + medium treated group (negative control), Arbutin (100 ppm): ⁇ -MSH treated + arbutin treated group (positive control), C. glucoronolyticum (1%): ⁇ -MSH treatment + CG19 strain culture medium treatment group.
  • Figure 20 is a graph showing melanin secretion amount (%). None: ⁇ -MSH untreated + sample untreated group, Control: ⁇ -MSH treated + medium treated group (negative control), Arbutin (100 ppm): ⁇ -MSH treated + arbutin treated group (positive control), C. propinquum (1%): ⁇ -MSH treatment + CP33 strain culture medium treatment group.
  • Figure 21A is a graph showing melanin secretion amount (%). None: ⁇ -MSH untreated + sample untreated group, Control: ⁇ -MSH treated + medium treated group (negative control), Arbutin (100 ppm): ⁇ -MSH treated + arbutin treated group (positive control), C. striatum (1%): ⁇ -MSH treatment + CS96 strain culture medium treatment group.
  • Figure 21B is a graph showing the amount of melanin produced (%). None: ⁇ -MSH untreated + sample untreated group, Control: ⁇ -MSH treated + medium treated group (negative control), Arbutin (100 ppm): ⁇ -MSH treated + arbutin treated group (positive control), C. striatum (1%): ⁇ -MSH treatment + CS96 strain culture medium treatment group.
  • Figure 22A is a graph showing melanin secretion amount (%). None: ⁇ -MSH untreated + sample untreated group, Control: ⁇ -MSH treated + medium treated group (negative control), Arbutin (100 ppm): ⁇ -MSH treated + arbutin treated group (positive control), C. xerosis (1%): ⁇ -MSH treatment + CX1 strain culture medium treatment group.
  • Figure 22B is a graph showing the amount of melanin produced (%). None: ⁇ -MSH untreated + sample untreated group, Control: ⁇ -MSH treated + medium treated group (negative control), Arbutin (100 ppm): ⁇ -MSH treated + arbutin treated group (positive control), C. xerosis (1%): ⁇ -MSH treatment + CX1 strain culture medium treatment group.
  • Figure 23 is a graph showing the relative expression level of filaggrin (FLG). None: Group untreated with medium and strain culture (negative control), S. parasanguinis (1%): Group treated with SP06 strain culture.
  • Figure 24 is a graph showing the relative expression level of filaggrin (FLG). None: untreated control group, YM-11: YM-11 strain culture medium treated group.
  • Figure 25 is a graph showing the relative expression level of filaggrin (FLG). None: untreated control group, YM-15: YM-15 strain culture medium treated group.
  • Figure 26 is a graph showing the relative expression level of MMP-1.
  • UV UV irradiation + medium untreated + strain culture untreated group
  • Control UV irradiation + medium treated + strain culture untreated group (negative control)
  • EGCG-1 (1 uM) UV irradiation + EGCG-1 treated group (positive control)
  • YM-19 UV irradiation + YM-19 strain culture treatment group.
  • Figure 27 is a graph showing the relative expression level of COL1A1.
  • UV UV irradiation + medium untreated + strain culture untreated group
  • Control UV irradiation + medium treated + strain culture untreated group (negative control)
  • EGCG-1 (1 uM) UV irradiation + EGCG-1 treated group (positive control)
  • YM-17 YM-17 strain culture medium treatment group.
  • Figure 28A is a graph showing the relative expression level of MMP-1.
  • UV UV irradiation + medium or culture medium untreated group
  • Control UV irradiation + medium treated group (negative control)
  • EGCG-1 (1 uM) UV irradiation + EGCG treated group (positive control)
  • YM-18 UV irradiation + YM-18 strain culture medium treatment group.
  • Figure 28B is a graph showing the relative expression level of HAS3.
  • Control medium or culture untreated group
  • Retinoic acid (1 uM) retinoic acid treated group (positive control)
  • Media medium treated group (negative control)
  • YM-18 YM-18 strain culture treated group.
  • Figure 29 is a graph showing the relative expression level of filaggrin (FLG). None: untreated control group, YM-13: YM-13 strain culture medium treated group.
  • Figure 30 is a graph showing the relative expression level of MMP-1.
  • UV UV irradiation + medium untreated + strain culture untreated group
  • Control UV irradiation + medium treated + strain culture untreated group (negative control)
  • EGCG-1 (1 uM) UV irradiation + EGCG-1 treated group (positive control)
  • YM-12 UV irradiation + YM-12 strain culture medium treatment group.
  • Figure 31 is a graph showing the relative expression level of HAS3.
  • Control medium untreated + strain culture untreated group, Retinoic acid (1 uM): retinoic acid treated group (positive control), Media: medium treated + strain culture untreated group (negative control), YM-14: YM-14 strain culture treated. army.
  • a new strain was isolated and identified from the skin of a healthy woman.
  • the cheeks, tip of the nose, and alar border of a healthy woman were swabbed two to three times with a sterile cotton swab soaked in PBS (phosphate buffer saline).
  • a cotton swab was placed in a tube containing PBS and vortexed for 10 seconds. 10-fold, 100-fold, and 1,000-fold dilutions of the sample were prepared, and 100 ⁇ L each was added to 0.1X TSB (Tryptic Soy Broth) and 0.5X R2A (Reasoner's 2A) agar medium and spread with a spreader.
  • 0.1X TSB Troptic Soy Broth
  • 0.5X R2A Reasoner's 2A
  • PCR amplification was performed in 30 cycles of 95°C for 1 minute, 55°C for 1 minute, and 75°C for 1 minute and 30 seconds, and was finally treated at 72°C for 8 minutes and stored at 4°C. After the PCR reaction was completed, the DNA sequences of the isolated and cultured species were determined using ABI-3730XL (ABI, USA).
  • NCBI National Center for Biotechnology Information
  • the selected strains were deposited at the Korean Culture Center of Microorganisms (KCCM) and given an accession number.
  • the accession numbers, 16S rRNA sequences (complementary DNA), and NCBI BLAST results of the 31 selected strains are shown in Table 1 below.
  • urealyticus YM3 strain KCCM13159P (2022.04.19) SEQ ID NO: 2 97.78% (3) Corynebacterium diphtheriae ( Corynebacterium diphtheriae ) CM6 strain KCCM13174P (2022.05.04) SEQ ID NO: 3 97.78% (4) Neisseria subflava CM5 strain KCCM13173P (2022.05.04) SEQ ID NO: 4 97.78% (5) Staphylococcus lugdunensis CM4 strain KCCM13172P (2022.05.04) SEQ ID NO: 5 97.78% (6) Staphylococcus hominis CM3 strain KCCM13171P (2022.05.04) SEQ ID NO: 6 97.78% (7) Staphylococcus cohnii CM2 strain KCCM13170P (2022.05.04) SEQ ID NO: 7 97.78% (8) Staphylococcus auricularis CM1 strain
  • Example 1 the strain isolated in Example 1 was cultured in TSB (Tryptic Soy Broth) medium. Bacterial cells were removed through centrifugation, and a strain culture solution was prepared through supernatant recovery and filtration.
  • TSB Transptic Soy Broth
  • MMP-1 (Matrix metalloproteinase-1) breaks down collagen in the skin. Therefore, reducing or suppressing the expression of MMP-1 inhibits the breakdown of collagen in the skin, thereby improving skin elasticity and improving skin wrinkles, thereby preventing or improving skin aging (eg, photoaging).
  • COL1A1 (Collagen type I alpha 1 chain) is a factor related to improving skin wrinkles and improving skin elasticity, so increased expression of COL1A1 can have an anti-aging effect on the skin.
  • the human dermal fibroblast (Hs68) cell line was cultured in DMEM medium (Dulbecco's modified Eagle's Medium, Gibco 1210-0038) containing 10% fetal bovin serum, and all cultures were performed at 37°C and 5% CO 2. It was performed in an incubator. Afterwards, the medium was removed, DPBS (Dulbecco's phosphate-buffered saline) was added, and UVB of 12 mJ/cm 2 was irradiated or not. Immediately after UVB irradiation, DPBS was removed and medium changed to FBS (Fetal Bovine Serum)-free medium, then treated with 1% (w/w) of strain culture medium and further cultured for 24 hours. As a positive control, 1 uM of epigallocatechin gallate (EGCG) was used, and as a negative control, a group untreated with UV light and strain culture was used.
  • DMEM medium Dulbecco's modified Eagle's Medium, Gibco
  • RT-PCR used Step One Plus (Applied Biosystems, USA), and Cybergreen (SYBR Green supermix, Applied Biosystems, USA) was added together with primers (primer for MMP-1 or primer for COL1A1) and cDNA and incubated at 94°C.
  • HAS3, AQP3, filaggrin, and ABCA12 were analyzed.
  • HAS3 Hydrophilicity and fibroblast growth factor 3
  • AQP3 Amphobic protein 3
  • Filaggrin Filaggrin
  • ABCA12 ATP-binding cassette sub-family A member 12
  • HaCaT cells a human keratinocyte cell line, were cultured in DMEM medium (Dulbecco's modified Eagle's Medium, Gibco 1210-0038) containing 10% fetal bovin serum, and all cultures were performed at 37°C and 5% CO 2 It was performed in an incubator. The cultured cell line was treated with 1% (w/w) of the strain culture medium and further cultured for 24 hours. As a positive control, 1 uM of retinoic acid (RA) was used.
  • DMEM medium Dulbecco's modified Eagle's Medium, Gibco 1210-003082
  • RA retinoic acid
  • Gene expression level was analyzed in the same manner as in Experimental Method 1-2 above, except that primers for HAS3, AQP3, filaggrin, or ABCA12 were used.
  • melanin secretion When melanin secretion is suppressed and melanin content decreases, it can have a skin whitening effect. In addition, when melanin production is suppressed and melanin content is reduced, a skin whitening effect can be achieved.
  • B16-F10 (Murine Melanoma) cells which are mouse pigment cells, were suspended in 2 ml of DMEM medium (Dulbecco's modified Eagle's Medium, Gibco 1210-0038) containing 10% FBS and incubated at 1 x 10 5 cells/well for 6- Inoculated into well plate. Then, the cells were cultured in a 5% CO 2 incubator at 37°C for 24 hours until 40-50% of the cells were attached to the bottom of the well. Afterwards, melanin production was induced by treating ⁇ -MSH at a concentration of 100 nM. Next, it was treated with 1% (w/w) of the above strain culture medium and further cultured for 3 days.
  • DMEM medium Dulbecco's modified Eagle's Medium
  • the culture medium of Experimental Method 3-1 was recovered and centrifuged at 1,000 rpm for 10 minutes to obtain a supernatant.
  • the absorbance of the supernatant was measured three times at 490 nm using a microplate reader (Microlpate reader, Victor 3) to evaluate the ability to inhibit melanin secretion.
  • the ability to inhibit melanin secretion was evaluated by calculating the melanin content according to the following calculation formula 1.
  • the culture medium of Experimental Method 3-1 was washed with phosphate buffered saline (PBS) (WELGENE) and recovered with trypsin (Gibco). Next, the cells were counted using a hematocytometer (MARIENFELD), the same number of cells (1 ⁇ 10 6 cells/mL) was collected for each treatment group, and centrifuged at 1000 rpm for 10 minutes to obtain only the cells. After the recovered cells were dried at 60°C for 1 hour, 100 ⁇ L of 1M NaOH solution (Sigma aldrich) containing 10% DMSO was added to obtain a solution containing melanin in the cells. The absorbance of this solution was measured at 490 nm using a microplate reader (victor3) to evaluate the melanin production inhibition rate. The melanin production inhibition rate was evaluated by calculating the melanin content according to Equation 1 above.
  • PBS phosphate buffered saline
  • WELGENE phosphate buffered saline
  • the YJ-No2 strain has the effect of preventing skin aging (eg, photoaging), improving skin wrinkles, and enhancing skin elasticity.
  • the YM3 strain has the effect of preventing skin aging (for example, photoaging), improving skin wrinkles, enhancing skin elasticity, moisturizing the skin, and strengthening the skin barrier.
  • Corynebacterium diphtheria CM6 strain increased the expression of HAS3 and AQP3.
  • CM6 strain had skin moisturizing and skin barrier strengthening effects.
  • the Neisseria subflava CM5 strain was confirmed to increase the expression of filaggrin and ABCA12.
  • CM5 strain had skin moisturizing and skin barrier strengthening effects.
  • the Staphylococcus lugdunensis CM4 strain was confirmed to reduce the expression of MMP-1, which was increased by ultraviolet irradiation. Additionally, the CM4 strain was confirmed to increase the expression of HAS3 and AQP3.
  • the CM4 strain has the effect of preventing skin aging (e.g., photoaging), improving skin wrinkles, enhancing skin elasticity, moisturizing the skin, and strengthening the skin barrier.
  • the Staphylococcus hominis CM3 strain was confirmed to reduce the expression of MMP-1, which was increased by ultraviolet irradiation. Additionally, it was confirmed that the CM3 strain increased the expression of AQP3.
  • the CM3 strain has the effect of preventing skin aging (e.g., photoaging), improving skin wrinkles, enhancing skin elasticity, moisturizing the skin, and strengthening the skin barrier.
  • the CM2 strain has the effect of preventing skin aging (e.g., photoaging), improving skin wrinkles, enhancing skin elasticity, moisturizing the skin, and strengthening the skin barrier.
  • the CM1 strain had the effect of preventing skin aging (e.g., photoaging), improving skin wrinkles, enhancing skin elasticity, moisturizing the skin, and strengthening the skin barrier.
  • the CX105 strain has the effect of preventing skin aging (eg, photoaging), improving skin wrinkles, and improving skin elasticity.
  • the CX104 strain has the effect of preventing skin aging (eg, photoaging), improving skin wrinkles, and enhancing skin elasticity.
  • Corynebacterium durum CD18 strain reduces or suppresses melanin secretion.
  • the CD18 strain had a skin whitening effect.
  • the SP06 strain had skin moisturizing and skin barrier strengthening effects.
  • the YM-19 strain has the effect of preventing skin aging (eg, photoaging), improving skin wrinkles, and enhancing skin elasticity.
  • the YM-17 strain has the effect of preventing skin aging (eg, photoaging), improving skin wrinkles, and enhancing skin elasticity.
  • the YM-18 strain has the effect of preventing skin aging (for example, photoaging), improving skin wrinkles, enhancing skin elasticity, moisturizing the skin, and strengthening the skin barrier.
  • the YM-12 strain has the effect of preventing skin aging (eg, photoaging), improving skin wrinkles, and enhancing skin elasticity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Nutrition Science (AREA)
  • Dermatology (AREA)
  • Virology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Birds (AREA)
  • Food Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Polymers & Plastics (AREA)
  • Cosmetics (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

신규한 피부 유래 균주, 그의 파쇄액, 배양액, 배양액의 추출물, 및 이들의 피부 상태 개선 용도에 관한 것이다. 상기 균주는 피부 상태 개선 효과를 가지므로, 화장품, 의약품, 식품 등에 유용하게 사용될 수 있다.

Description

피부 유래 균주 및 그의 피부 상태 개선 용도
신규한 미생물, 그의 파쇄액, 배양액, 배양액의 추출물, 및 이들의 피부 상태 개선 용도에 관한 것이다.
피부의 생태계는 미생물에게 다양한 형태의 서식처를 제공하며, 광범위한 미생물들이 살고 있다. 이들은 숙주인 인간과 공생관계를 이루고 있으며, 숙주에 많은 긍정적인 영향을 미친다고 알려져 있다. 피부는 함입부, 특화 되어있는 틈새 등 다양한 형태의 서식처를 구성하고 있으며, 넓은 분포의 미생물이 자랄 수 있도록 돕는다. 기본적으로 피부는 물리적인 막을 형성하며, 외부로부터 잠재적인 위험요소 및 독성물질들로부터 방어를 하도록 도와준다. 피부는 외부환경과의 접속 지점이 되며, 다양한 미생물들(예: 진균, 세균, 바이러스 및 작은 유충)의 집합소이기도 하다. 물리적, 화학적 기능의 선택에 맞게 미생물들은 특화된 틈새에 적응하여 서식처를 마련한다. 일반적으로 피부는 차갑고, 산성 성질을 나타내며, 건조된 상태로 유지된다. 구조적으로 표피(epidermis)는 피부 장벽을 이루고 있으며, 미생물과 독소가 침투하는 것을 차단하고, 수분을 유지하는 중요한 역할을 한다. 표피의 최상위층은 각질층(stratum corneum)으로 구성되어 있다. 표피는 일명 '벽돌과 몰탈 구조'라고 불리는 형태를 띠고 있는데, 피부 조직은 계속적인 자가 회복 과정을 거치고, 분화 과정의 마지막을 거친 비늘(squames)은 끊임없이 피부조직에서 탈락되는 과정을 반복하게 된다.
프로바이오틱스(Probiotics)는 인체에 유익한 작용을 하는 미생물을 총칭하는 말로 우리 몸에 유익(benefit)을 주는 미생물을 말한다. 현재까지 알려진 대부분의 프로바이오틱스는 유산균으로 알려져 있다. 프로바이오틱스는 인체에 여러 가지 유익 작용을 통해 효과적인 효능이 발생되는 것으로 보고되었지만, 피부상재균과 피부의 상호관계에 대한 연구는 미비한 실정이다.
이에, 피부 관련된 상태에 유용하게 사용될 수 있는 피부상재균의 개발이 필요한 실정이다.
일 양상은 신규한 피부 유래 균주를 제공하는 것이다.
다른 양상은 상기 균주의 파쇄액, 배양액, 또는 배양액의 추출물을 제공하는 것이다.
또 다른 양상은 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물의 용도를 제공하는 것이다.
또 다른 양상은 상기 균주, 그의 파쇄액, 배양액, 배양액의 추출물, 또는 이들의 혼합물을 포함하는 조성물을 제공하는 것이다.
또 다른 양상은 유효량의 상기한 조성물을 그를 필요로 하는 개체에 투여하는 단계를 포함하는 개체의 상태를 예방, 개선, 또는 치료하는 방법을 제공하는 것이다.
일 양상은 하기 중 선택되는 균주를 제공한다:
(1) 스타필로코커스 캐피티스 아종 캐피티스(Staphylococcus capitis subsp. capitis) 균주;
(2) 스타필로코커스 캐피티스 아종 유레알리티쿠스(Staphylococcus capitis subsp. urealyticus) 균주;
(3) 코리네박테리움 디프테리아(Corynebacterium diphtheriae) 균주;
(4) 나이세리아 서브플라바(Neisseria subflava) 균주;
(5) 스타필로코커스 루그두넨시스(Staphylococcus lugdunensis) 균주;
(6) 스타필로코커스 호미니스(Staphylococcus hominis) 균주;
(7) 스타필로코커스 코흐니(Staphylococcus cohnii) 균주;
(8) 스타필로코커스 아우리큘라리스(Staphylococcus auricularis) 균주;
(9) 스트렙토코커스 이퀴너스(Streptococcus equinus) 균주;
(10) 스트렙토코커스 엔지노서스(Streptococcus anginosus) 균주;
(11) 스트렙토코커스 슈도뉴모니에(Streptococcus pseudopneumoniae) 균주;
(12) 스트렙토코커스 뮤탄스(Streptococcus mutans) 균주;
(13) 큐티박테리움 아비둠(Cutibacterium avidum) 균주;
(14) 스트렙토코커스 루테티엔시스(Streptococcus lutetiensis) 균주;
(15) 스트렙토코커스 오우스트랄리스(Streptococcus australis) 균주;
(16) 스트렙토코커스 할리코에리(Streptococcus halichoeri) 균주;
(17) 스트렙토코커스 마실리엔시스(Streptococcus massiliensis) 균주;
(18) 코리네박테리움 두룸(Corynebacterium durum) 균주;
(19) 코리네박테리움 글루쿠로노리티쿰(Corynebacterium glucuronolyticum) 균주;
(20) 코리네박테리움 프로핀큠(Corynebacterium propinquum) 균주;
(21) 코리네박테리움 스트리아툼(Corynebacterium striatum) 균주;
(22) 코리네박테리움 제로시스(Corynebacterium xerosis) 균주;
(23) 스트렙토코커스 파라상귀니스(Streptococcus parasanguinis) 균주;
(24) 스트렙토코커스 도우니(Streptococcus downii) 균주;
(25) 스트렙토코커스 룹네리(Streptococcus rubneri) 균주;
(26) 스트렙토코커스 베스티불라리스(Streptococcus vestibularis) 균주;
(27) 스트렙토코커스 상귀니스(Streptococcus sanguinis) 균주;
(28) 스트렙토코커스 소브리너스(Streptococcus sobrinus) 균주;
(29) 스트렙토코커스 오랄리스(Streptococcus oralis) 균주;
(30) 스트렙토코커스 인터메디어스(Streptococcus intermedius) 균주; 및
(31) 스트렙토코커스 파이오제네스(Streptococcus pyogenes) 균주.
상기 균주는 분리된 것일 수 있다. 본 명세서에서 용어 "분리된(isolated)"이란 자연계에 존재하는 것이 아닌 인위적으로 분리하여 이용가능한 것을 의미한다. 상기 균주는 인간 피부로부터 분리된 것일 수 있다. 상기 균주는 인간 피부 세포를 TSB(Tryptic Soy Broth) 또는 R2A(Reasoner's 2A) 배지에 접종하여 배양된 콜로니를 순수 분리 배양하는 방법에 의해 분리된 균주일 수 있다.
상기 균주 (1)의 일 구체예에서, 상기 스타필로코커스 캐피티스 아종 캐피티스(Staphylococcus capitis subsp. capitis) 균주는 스타필로코커스 속(Staphylococcus sp.)에 속하는 균주일 수 있다. 상기 스타필로코커스 캐피티스 아종 캐피티스(Staphylococcus capitis subsp. capitis) 균주는 기탁번호 KCCM13158P로 기탁된 균주일 수 있다. 상기 균주는 스타필로코커스 캐피티스 아종 캐피티스(Staphylococcus capitis subsp. capitis) YJ-No2 균주일 수 있다.
상기 균주 (2)의 일 구체예에서, 상기 스타필로코커스 캐피티스 아종 유레알리티쿠스(Staphylococcus capitis subsp. urealyticus) 균주는 스타필로코커스 속(Staphylococcus sp.)에 속하는 균주일 수 있다. 상기 스타필로코커스 캐피티스 아종 유레알리티쿠스(Staphylococcus capitis subsp. urealyticus) 균주는 기탁번호 KCCM13159P로 기탁된 균주일 수 있다. 상기 균주는 스타필로코커스 캐피티스 아종 유레알리티쿠스(Staphylococcus capitis subsp. urealyticus) YM3 균주일 수 있다.
상기 균주 (3)의 일 구체예에서, 상기 코리네박테리움 디프테리아(Corynebacterium diphtheriae) 균주는 코리네박테리움 속(Corynebacterium sp.)에 속하는 균주일 수 있다. 상기 코리네박테리움 디프테리아(Corynebacterium diphtheriae) 균주는 기탁번호 KCCM13174P로 기탁된 균주일 수 있다. 상기 균주는 코리네박테리움 디프테리아(Corynebacterium diphtheriae) CM6 균주일 수 있다.
상기 균주 (4)의 일 구체예에서, 상기 나이세리아 서브플라바(Neisseria subflava) 균주는 나이세리아 속(Corynebacterium sp.)에 속하는 균주일 수 있다. 상기 나이세리아 서브플라바(Neisseria subflava) 균주는 기탁번호 KCCM13173P로 기탁된 균주일 수 있다. 상기 균주는 나이세리아 서브플라바(Neisseria subflava) CM5 균주일 수 있다.
상기 균주 (5)의 일 구체예에서, 스타필로코커스 루그두넨시스(Staphylococcus lugdunensis) 균주는 스타필로코커스 속(Staphylococcus sp.)에 속하는 균주일 수 있다. 상기 스타필로코커스 루그두넨시스(Staphylococcus lugdunensis) 균주는 기탁번호 KCCM13172P로 기탁된 균주일 수 있다. 상기 균주는 스타필로코커스 루그두넨시스(Staphylococcus lugdunensis) CM4 균주일 수 있다.
상기 균주 (6)의 일 구체예에서, 상기 스타필로코커스 호미니스(Staphylococcus hominis) 균주는 스타필로코커스 속(Staphylococcus sp.)에 속하는 균주일 수 있다. 상기 스타필로코커스 호미니스(Staphylococcus hominis) 균주는 기탁번호 KCCM13171P로 기탁된 균주일 수 있다. 상기 균주는 스타필로코커스 호미니스(Staphylococcus hominis) CM3 균주일 수 있다.
상기 균주 (7)의 일 구체예에서, 상기 스타필로코커스 코흐니(Staphylococcus cohnii) 균주는 스타필로코커스 속(Staphylococcus sp.)에 속하는 균주일 수 있다. 상기 스타필로코커스 코흐니(Staphylococcus cohnii) 균주는 기탁번호 KCCM13170P로 기탁된 균주일 수 있다. 상기 균주는 스타필로코커스 코흐니(Staphylococcus cohnii) CM2 균주 일 수 있다.
상기 균주 (8)의 일 구체예에서, 상기 스타필로코커스 아우리큘라리스(Staphylococcus auricularis) 균주는 스타필로코커스 속(Staphylococcus sp.)에 속하는 균주일 수 있다. 상기 스타필로코커스 아우리큘라리스(Staphylococcus auricularis) 균주는 기탁번호 KCCM13169P로 기탁된 균주일 수 있다. 상기 균주는 스타필로코커스 아우리큘라리스(Staphylococcus auricularis) CM1 균주일 수 있다.
상기 균주 (9)의 일 구체예에서, 상기 스트렙토코커스 이퀴너스(Streptococcus equinus) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 이퀴너스(Streptococcus equinus) 균주는 기탁번호 KCCM13187P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 이퀴너스(Streptococcus equinus) CX105 균주일 수 있다.
상기 균주 (10)의 일 구체예에서, 상기 스트렙토코커스 엔지노서스(Streptococcus anginosus) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 엔지노서스(Streptococcus anginosus) 균주는 기탁번호 KCCM13188P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 엔지노서스(Streptococcus anginosus) CX106 균주일 수 있다.
상기 균주 (11)의 일 구체예에서, 상기 스트렙토코커스 슈도뉴모니에(Streptococcus pseudopneumoniae) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 슈도뉴모니에(Streptococcus pseudopneumoniae) 균주는 기탁번호 KCCM13189P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 슈도뉴모니에(Streptococcus pseudopneumoniae) CX107 균주일 수 있다.
상기 균주 (12)의 일 구체예에서, 상기 스트렙토코커스 뮤탄스(Streptococcus mutans) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 뮤탄스(Streptococcus mutans) 균주는 기탁번호 KCCM13190P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 뮤탄스(Streptococcus mutans) CX108 균주일 수 있다.
상기 균주 (13)의 일 구체예에서, 상기 큐티박테리움 아비둠(Cutibacterium avidum) 균주는 큐티박테리움 속(Cutibacterium sp.)에 속하는 균주일 수 있다. 상기 큐티박테리움 아비둠(Cutibacterium avidum) 균주는 기탁번호 KCCM13198P로 기탁된 균주일 수 있다. 상기 균주는 큐티박테리움 아비둠(Cutibacterium avidum) YM-41 균주일 수 있다.
상기 균주 (14)의 일 구체예에서, 상기 스트렙토코커스 루테티엔시스(Streptococcus lutetiensis) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 루테티엔시스(Streptococcus lutetiensis) 균주는 기탁번호 KCCM13183P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 루테티엔시스(Streptococcus lutetiensis) CX101 균주일 수 있다.
상기 균주 (15)의 일 구체예에서, 상기 스트렙토코커스 오우스트랄리스(Streptococcus australis) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 오우스트랄리스(Streptococcus australis) 균주는 기탁번호 KCCM13184P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 오우스트랄리스(Streptococcus australis) CX102 균주일 수 있다.
상기 균주 (16)의 일 구체예에서, 상기 스트렙토코커스 할리코에리(Streptococcus halichoeri) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 할리코에리(Streptococcus halichoeri) 균주는 기탁번호 KCCM13185P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 할리코에리(Streptococcus halichoeri) CX103 균주일 수 있다.
상기 균주 (17)의 일 구체예에서, 상기 스트렙토코커스 마실리엔시스(Streptococcus massiliensis) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 마실리엔시스(Streptococcus massiliensis) 균주는 기탁번호 KCCM13186P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 마실리엔시스(Streptococcus massiliensis) CX104 균주일 수 있다.
상기 균주 (18)의 일 구체예에서, 상기 코리네박테리움 두룸(Corynebacterium durum) 균주는 코리네박테리움 속(Corynebacterium sp.)에 속하는 균주일 수 있다. 상기 코리네박테리움 두룸(Corynebacterium durum) 균주는 기탁번호 KCCM13194P로 기탁된 균주일 수 있다. 상기 균주는 코리네박테리움 두룸(Corynebacterium durum) CD18 균주일 수 있다.
상기 균주 (19)의 일 구체예에서, 상기 코리네박테리움 글루쿠로노리티쿰(Corynebacterium glucuronolyticum) 균주는 코리네박테리움 속(Corynebacterium sp.)에 속하는 균주일 수 있다. 상기 코리네박테리움 글루쿠로노리티쿰(Corynebacterium glucuronolyticum) 균주는 기탁번호 KCCM13197P로 기탁된 균주일 수 있다. 상기 균주는 코리네박테리움 글루쿠로노리티쿰(Corynebacterium glucuronolyticum) CG19 균주일 수 있다.
상기 균주 (20)의 일 구체예에서, 상기 코리네박테리움 프로핀큠(Corynebacterium propinquum) 균주는 코리네박테리움 속(Corynebacterium sp.)에 속하는 균주일 수 있다. 상기 코리네박테리움 프로핀큠(Corynebacterium propinquum) 균주는 기탁번호 KCCM13196P로 기탁된 균주일 수 있다. 상기 균주는 코리네박테리움 프로핀큠(Corynebacterium propinquum) CP33 균주일 수 있다.
상기 균주 (21)의 일 구체예에서, 상기 코리네박테리움 스트리아툼(Corynebacterium striatum) 균주는 코리네박테리움 속(Corynebacterium sp.)에 속하는 균주일 수 있다. 상기 코리네박테리움 스트리아툼(Corynebacterium striatum) 균주는 기탁번호 KCCM13195P로 기탁된 균주일 수 있다. 상기 균주는 코리네박테리움 스트리아툼(Corynebacterium striatum) CS96 균주일 수 있다.
상기 균주 (22)의 일 구체예에서, 상기 코리네박테리움 제로시스(Corynebacterium xerosis) 균주는 코리네박테리움 속(Corynebacterium sp.)에 속하는 균주일 수 있다. 상기 코리네박테리움 제로시스(Corynebacterium xerosis) 균주는 기탁번호 KCCM13193P로 기탁된 균주일 수 있다. 상기 균주는 코리네박테리움 제로시스(Corynebacterium xerosis) CX1 균주일 수 있다.
상기 균주 (23)의 일 구체예에서, 상기 스트렙토코커스 파라상귀니스(Streptococcus parasanguinis) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 파라상귀니스(Streptococcus parasanguinis) 균주는 기탁번호 KCCM13204P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 파라상귀니스(Streptococcus parasanguinis) SP06 균주일 수 있다.
상기 균주 (24)의 일 구체예에서, 상기 스트렙토코커스 도우니(Streptococcus downii) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 도우니(Streptococcus downii) 균주는 기탁번호 KCCM13209P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 도우니(Streptococcus downii) YM-11 균주일 수 있다.
상기 균주 (25)의 일 구체예에서, 상기 스트렙토코커스 룹네리(Streptococcus rubneri) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 룹네리(Streptococcus rubneri) 균주는 기탁번호 KCCM13213P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 룹네리(Streptococcus rubneri) YM-15 균주일 수 있다.
상기 균주 (26)의 일 구체예에서, 상기 스트렙토코커스 베스티불라리스(Streptococcus vestibularis) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 베스티불라리스(Streptococcus vestibularis) 균주는 기탁번호 KCCM13217P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 베스티불라리스(Streptococcus vestibularis) YM-19 균주일 수 있다.
상기 균주 (27)의 일 구체예에서, 상기 스트렙토코커스 상귀니스(Streptococcus sanguinis) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 상귀니스(Streptococcus sanguinis) 균주는 기탁번호 KCCM13215P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 상귀니스(Streptococcus sanguinis) YM-17 균주일 수 있다.
상기 균주 (28)의 일 구체예에서, 상기 스트렙토코커스 소브리너스(Streptococcus sobrinus) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 소브리너스(Streptococcus sobrinus) 균주는 기탁번호 KCCM13216P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 소브리너스(Streptococcus sobrinus) YM-18 균주일 수 있다.
상기 균주 (29)의 일 구체예에서, 상기 스트렙토코커스 오랄리스(Streptococcus oralis) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 오랄리스(Streptococcus oralis) 균주는 기탁번호 KCCM13211P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 오랄리스(Streptococcus oralis) YM-13 균주일 수 있다.
상기 균주 (30)의 일 구체예에서, 상기 스트렙토코커스 인터메디어스(Streptococcus intermedius) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 인터메디어스(Streptococcus intermedius) 균주는 기탁번호 KCCM13210P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 인터메디어스(Streptococcus intermedius) YM-12 균주일 수 있다.
상기 균주 (31)의 일 구체예에서, 상기 스트렙토코커스 파이오제네스(Streptococcus pyogenes) 균주는 스트렙토코커스 속(Streptococcus sp.)에 속하는 균주일 수 있다. 상기 스트렙토코커스 파이오제네스(Streptococcus pyogenes) 균주는 기탁번호 KCCM13212P로 기탁된 균주일 수 있다. 상기 균주는 스트렙토코커스 파이오제네스(Streptococcus pyogenes) YM-14 균주일 수 있다.
상기 균주 (1) 내지 (31)은 각각 서열번호 1 내지 31의 16S rRNA를 포함하는 것일 수 있다. 일 구체예에서, 상기 균주 (1) 내지 (31)은 각각 서열번호 1 내지 31과 약 95% 이상, 약 96% 이상, 약 97% 이상, 약 98% 이상, 약 99% 이상, 약 99.5% 이상, 약 99.9% 이상, 95% 내지 100%, 96% 내지 100%, 97% 내지 100%, 98% 내지 100%, 99% 내지 100%, 99.5% 내지 100%, 또는 99.9% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 것일 수 있다.
본 명세서에서 사용된 용어 "서열 동일성(sequence identity)"은 특정 비교 영역에서 양 서열을 최대한 일치되도록 얼라인시킨 후 서열간의 아미노산 잔기 또는 염기의 동일한 정도를 의미한다. 서열 동일성은 당업계에 공지된 방법에 따라 확인될 수 있다. 상기 서열 동일성의 퍼센트는 공지의 서열 비교 프로그램을 사용하여 결정될 수 있으며, 일례로 BLASTN(NCBI), CLC Main Workbench (CLC bio), MegAlignTM(DNASTAR Inc) 등을 들 수 있다.
상기 균주는 피부 상태 개선 효과, 피부 미용 개선 효과, 또는 피부 질환의 예방, 개선 또는 치료 효과를 갖는 것일 수 있다. 예를 들면, 상기 균주는 피부 노화 방지(항노화), 피부 주름 개선(항주름), 피부 탄력 증진, 피부 보습, 피부 장벽 강화, 피부 미백, 항염증, 또는 항알레르기 효과를 갖는 것일 수 있다. 또한, 상기 균주는 피부 장벽 기능 손상에 의한 질환, 멜라닌 색소 과다 침착 질환, 피부 염증 질환, 또는 피부 알레르기 질환의 예방, 치료 또는 개선 효과를 갖는 것일 수 있다.
상기 균주 (1)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선 또는 피부 탄력 증진 효과를 갖는 것일 수 있다. 상기 균주는 MMP-1(Matrix metalloproteinase-1)의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 자외선에 의해 증가된 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다.
상기 균주 (2)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 자외선에 의해 증가된 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 히알루론산 합성 효소 3(Hyaluronan synthase 3, HAS3)의 발현을 증가시키는 것일 수 있다.
상기 균주 (3)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 HAS3 및 아쿠아포린(Aquaporin 3, AQP3) 중 1종 이상의 발현을 증가시키는 것일 수 있다.
상기 균주 (4)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 필라그린(Filaggrin, FLN) 및 ABCA12(ATP-binding cassette sub-family A member 12) 중 1종 이상의 발현을 증가시키는 것일 수 있다.
상기 균주 (5)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 자외선에 의해 증가된 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 HAS3 및 AQP3 중 1종 이상의 발현을 증가시키는 것일 수 있다.
상기 균주 (6)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 자외선에 의해 증가된 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 AQP3의 발현을 증가시키는 것일 수 있다.
상기 균주 (7)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 자외선에 의해 증가된 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 HAS3의 발현을 증가시키는 것일 수 있다.
상기 균주 (8)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 또는 피부 장벽 강화 효과를 갖는 것일 수 있다.
상기 균주는 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 자외선에 의해 증가된 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 HAS3의 발현을 증가시키는 것일 수 있다.
상기 균주 (9)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선 또는 피부 탄력 증진 효과를 갖는 것일 수 있다. 상기 균주는 COL1A1(Collagen type I alpha 1 chain)의 발현을 증가시키는 것일 수 있다.
상기 균주 (10)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 필라그린의 발현을 증가시키는 것일 수 있다.
상기 균주 (11)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 AQP3의 발현을 증가시키는 것일 수 있다.
상기 균주 (12)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 AQP3의 발현을 증가시키는 것일 수 있다.
상기 균주 (13)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 필라그린의 발현을 증가시키는 것일 수 있다.
상기 균주 (14)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 HAS3 및 AQP3 중 1종 이상의 발현을 증가시키는 것일 수 있다.
상기 균주 (15)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 HAS3 및 AQP3 중 1종 이상의 발현을 증가시키는 것일 수 있다.
상기 균주 (16)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 HAS3의 발현을 증가시키는 것일 수 있다.
상기 균주 (17)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선 또는 피부 탄력 증진 효과를 갖는 것일 수 있다. 상기 균주는 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 자외선에 의해 증가된 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다.
상기 균주 (18)의 일 구체예에서, 상기 균주는 피부 미백 효과를 갖는 것일 수 있다. 상기 균주는 멜라닌 분비를 감소 또는 억제시키는 것일 수 있다.
상기 균주 (19)의 일 구체예에서, 상기 균주는 피부 미백 효과를 갖는 것일 수 있다. 상기 균주는 멜라닌 분비를 감소 또는 억제시키는 것일 수 있다.
상기 균주 (20)의 일 구체예에서, 상기 균주는 피부 미백 효과를 갖는 것일 수 있다. 상기 균주는 멜라닌 분비를 감소 또는 억제시키는 것일 수 있다.
상기 균주 (21)의 일 구체예에서, 상기 균주는 피부 미백 효과를 갖는 것일 수 있다. 상기 균주는 멜라닌 분비를 감소 또는 억제시키는 것일 수 있다. 상기 균주는 멜라닌 생성(또는 멜라닌 합성)을 감소 또는 억제시키는 것일 수 있다.
상기 균주 (22)의 일 구체예에서, 상기 균주는 피부 미백 효과를 갖는 것일 수 있다. 상기 균주는 멜라닌 분비를 감소 또는 억제시키는 것일 수 있다. 상기 균주는 멜라닌 생성(또는 멜라닌 합성)을 감소 또는 억제시키는 것일 수 있다.
상기 균주 (23)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 필라그린의 발현을 증가시키는 것일 수 있다.
상기 균주 (24)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 필라그린의 발현을 증가시키는 것일 수 있다.
상기 균주 (25)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 필라그린의 발현을 증가시키는 것일 수 있다.
상기 균주 (26)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선 또는 피부 탄력 증진 효과를 갖는 것일 수 있다. 상기 균주는 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 자외선에 의해 증가된 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다.
상기 균주 (27)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선 또는 피부 탄력 증진 효과를 갖는 것일 수 있다. 상기 균주는 COL1A1의 발현을 증가시키는 것일 수 있다.
상기 균주 (28)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 자외선에 의해 증가된 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 HAS3의 발현을 증가시키는 것일 수 있다.
상기 균주 (29)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 필라그린의 발현을 증가시키는 것일 수 있다.
상기 균주 (30)의 일 구체예에서, 상기 균주는 피부 노화 방지, 피부 주름 개선 또는 피부 탄력 증진 효과를 갖는 것일 수 있다. 상기 균주는 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다. 상기 균주는 자외선에 의해 증가된 MMP-1의 발현을 감소 또는 억제시키는 것일 수 있다.
상기 균주 (31)의 일 구체예에서, 상기 균주는 피부 보습 또는 피부 장벽 강화 효과를 갖는 것일 수 있다. 상기 균주는 HAS3의 발현을 증가시키는 것일 수 있다.
다른 양상은 상기 균주의 파쇄액, 배양액, 또는 배양액의 추출물을 제공한다.
상기 균주의 상세는 전술한 바와 같다.
본 명세서에서 용어 "파쇄액"은 "용해물"과 상호교환적으로 사용될 수 있으며, 화학적 또는 물리적 힘에 의하여 균주의 세포벽을 파쇄하여 얻은 산물을 의미할 수 있다. 상기 파쇄액은 파쇄액 자체, 그의 농축물 또는 동결건조물을 포함할 수 있다.
본 명세서에서 용어 "배양액"은 "배양 상층액", "조건 배양액" 또는 "조정 배지"와 상호교환적으로 사용될 수 있고, 상기 균주가 시험관 내에서 성장 및 생존할 수 있도록 영양분을 공급할 수 있는 배지에 상기 균주를 일정기간 배양하여 얻는 상기 균주, 이의 대사물, 여분의 영양분 등을 포함하는 전체 배지를 의미할 수 있다. 또한, 상기 배양액은 균주를 배양하여 얻은 균체 배양액에서 균체를 제거한 배양액을 의미할 수 있다. 　한편, 상기　배양액　중 균체를 제거한 액체를 "상층액"이라고도 하며,　상기 상층액은 배양액을 일정시간 가만히 두어 하층에 가라앉은 부분을 제외한 상층의 액체만을 취하거나, 여과를 통해 균체를 제거하거나,　배양액을 원심분리하여 하부의 침전을 제거하고 상부의 액체만을 취하여 획득할 수 있다. 상기 "균체"는 본 발명의　균주　자체를 의미하는 것으로 피부 샘플 등으로부터 분리하여 선별한　균주　자체 또는 상기　균주를 배양하여　배양액으로부터 분리한　균주를 포함한다. 상기 균체는　배양액을 원심분리하여 하층에 가라앉은 부분을 취하여 획득할 수 있고, 또는 중력에 의해　배양액의 하층으로 가라앉으므로 일정 시간 동안 가만히 두었다가 상부의 액체를 제거함으로써 획득할 수 있다.
상기 균주를 배양하기 위한 배양용 배지 및 배양 조건은 통상의 지식을 가진 자가 적절하게 선택하거나 변형하여 이용할 수 있다. 예를 들어, 상기 배양액은 균주를 적절한 배지(예: R2A 배지, TSA 배지 또는 TSB 배지)에서 적절한 온도(예: 10℃ 초과 또는 40℃ 미만 중 어느 온도)에서 일정 시간(예: 4 내지 120시간) 동안 배양하여 수득된 것일 수 있다.
상기 배양액은 균주를 배양하여 수득된 배양액 자체, 그의 농축물 또는 동결건조물을 포함할 수 있다. 상기 배양액은 배양액로부터 균주를 제거하여 수득된 배양 상층액, 그의 농축물 또는 동결건조물을 포함할 수 있다.
일 구체예에서, 균주의 배양 상층액은 균주 배양액을 원심분리 또는 여과시켜 균주를 제거하는 단계에 의해 수득될 수 있다.
다른 구체예에서, 농축물은 상기 균주 배양액 자체, 또는 상기 배양액을 원심분리 또는 여과한 후 수득된 상층액을 농축하는 단계에 의해 수득될 수 있다.
본 명세서에서 용어 "배양액 추출물"은 상기 배양액 또는 그의 농축액로부터 추출한 것을 의미하며, 추출액, 추출액의 희석액 또는 농축액, 추출액을 건조하여 얻어지는 건조물, 또는 이들 조정제물 또는 정제물, 이를 분획한 분획물을 포함할 수 있다.
상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 생물학적으로 순수한 것일 수 있다. 상기 균주는 순수배양(pure culture)에 의해 얻은 것일 수 있다.
또 다른 양상은 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물의 용도를 제공한다. 상세하게는, 상기 균주, 그의 파쇄액, 배양액, 배양액의 추출물 또는 이들의 혼합물을 포함하는 조성물을 제공한다.
상기 용도 또는 조성물에 있어서, 상기 균주는 상기 일 양상에 따른 균주일 수 있다.
상기 균주의 용도는 피부 상태 개선, 피부 미용 개선, 또는 피부 질환의 예방, 개선 또는 치료를 포함할 수 있다.
상기 피부 상태 개선 또는 피부 미용 개선은 피부 노화 방지(항노화), 피부 주름 개선(항주름), 피부 탄력 증진, 피부 보습, 피부 장벽 강화, 피부 미백, 항염증, 또는 항알레르기일 수 있다.
본 명세서에서 용어 "피부 노화"란 나이가 들어가면서 피부에 나타나게 되는 유형과 무형상의 변화를 통틀어 말한다. 피부 노화는 예컨대 표피 두께가 얇아지는 현상, 진피의 세포 수나 혈관 수의 감소, DNA 손상 복구 능력의 감소, 세포교체주기의 증가, 상처 회복 능력 감소, 피부 장벽기능 약화, 표피의 수분 유지 능력 감소, 땀분비 감소, 피지분비 감소, 비타민D 생산 감소, 물리적 손상 방어 능력 감소, 화학물질 제거능력 감소, 면역반응 감소, 감각 기능 약화, 체온조절의 감소 등을 포함한다.
상기 피부 노화 방지는 외인성 요인 또는 내인성 요인에 의해 유발되는 피부 노화를 개선하는 것일 수 있다. 상기 외인성 요인은 여러 가지 외부 요인, 예컨대 자외선(광)을 말한다. 상기 내인성 요인은 연대기적 요인이라고도 지칭되며 주로 시간의 흐름에 의해 발생하는 요인을 말한다. 즉, 상기 피부 노화는 구체적으로는 자외선, 공해, 담배연기, 화학물질 등에 의한 외부 자극에 의해 유도되는 조기 노화 증상뿐만 아니라, 나이가 들어감에 의해 피부세포의 증식이 감소함에 따라 발생하는 자연노화 현상을 포함하며, 주름 및 탄력 감소, 피부 처짐 및 건조 현상 등을 모두 포함하는 개념이다. 또한 주름은 내ㆍ외부 요인의 변화에 의한 자극이 피부조직을 구성하고 있는 성분을 변화시켜 주름을 유발하는 것을 포함한다.
상기 노화는 광노화일 수 있다. 용어 "광노화(Photoaging)"는 외부 환경적인 요인에 의해 유발되는 현상으로, 가장 대표적인 인자로는 자외선이 있다. 자외선은 단백질 분해효소의 활성화와 기질단백질의 사슬절단 및 비정상적인 교차결합 등의 생체 구성 성분들의 손상을 가져오고, 이러한 메커니즘의 반복은 외관상으로도 확연한 피부노화를 초래하게 된다.
용어 "주름"은 피부의 탄력성이 상실되어 느슨해진 상태를 의미하며, 예를 들면 피부가 접히는 것일 수 있다. "피부 주름 예방 또는 개선"이란 주름과 관련된 인자의 발현을 억제하여 주름을 방지 또는 개선하거나, 콜라겐 총량을 증가시키는 모든 작용을 의미할 수 있다.
상기 "피부 탄력 증진"은 느슨해진 피부의 탄력성을 증진시키는 모든 작용을 의미할 수 있다.
상기 "피부 보습"은 피부 수분을 유지하거나 수분 손실을 방지하는 모든 작용을 의미할 수 있다.
상기 "피부 장벽 강화"는 피부 가장 바깥쪽에 위치하여 수분과 영양 손실을 막아주는 피부 장벽의 기능이 증진되는 모든 작용을 의미할 수 있다.
상기 "피부 미백"은 멜라닌 색소의 합성을 저해함으로써 피부 톤을 밝게 할 뿐만 아니라, 자외선, 호르몬 또는 유전에 기인한 기미나 주근깨 등의 피부 과색소 침착을 개선하는 것을 의미할 수 있다.
상기 "항염증"이란 "염증 개선", "염증 억제"과 혼용될 수 있으며, 예를 들어 염증성 사이토카인의 발현이 억제되는 모든 작용을 포함할 수 있다.
상기 "항알레르기"란 "알레르기 개선", "알레르기 억제"과 혼용될 수 있으며, 예를 들어 알레르겐(알레르기성 질환의 원인이 되는 항원)을 제거 또는 억제하거나, 알레르겐에 의해 유발된 알레르기 반응을 완화시키는 모든 작용을 포함할 수 있다.
상기 "피부 질환"은 피부 장벽 기능 손상에 의한 질환, 피부 노화, 피부 염증 질환, 또는 피부 알레르기 질환일 수 있다.
상기 피부 장벽 기능 손상은 피부 장벽의 기능이 저하되거나 손상되어 피부에 나타나는 모든 변화를 의미할 수 있다. 예를 들어, 피부 주름 증가, 건조, 피부염, 아토피 피부염, 알레르기성 피부염, 여드름 등을 포함할 수 있다.
상기 "멜라닌 색소 과다 침착"이란 다양한 원인에 의해서 발생한 멜라닌 색소 과다 침착을 모두 포함하는 광범위한 개념이며, 피부 또는 손톱, 발톱의 특정 부위에서 멜라닌 색소의 과도한 증가로 인해 다른 부위에 비해 어둡게 되는 것을 의미한다.
상기 멜라닌 색소 과다 침착 질환은 주근깨(freckle); 기미(melasma); 간반(chloasma); 검버섯(liver spot); 모반(nevus); 일광흑자(solar lentigo); 흑피증(melanosis); 포이츠-예거 증후군(peutz-jegher's syndrome); 임신성 갈색반(chloasma gravidarum); 약물 사용 후 과다색소침착; 및 염증 후 과다색소침착(postinflammatory hyperpigmentation) 중에서 선택된 어느 하나일 수 있으나, 이에 제한되지 않는다.
상기 피부 염증 질환은 피부 상처, 피부염, 아토피 피부염, 소양증, 습진성 피부질환, 건성 습진, 홍반, 두드러기, 건선, 약발진, 및 여드름으로 이루어진 군으로부터 선택된 어느 하나인 것일 수 있다.
상기 피부 알레르기 질환은 아토피 피부염, 알레르기성 피부염, 두드러기, 소양증, 발진 등을 포함할 수 있다.
용어, "예방"은 질병의 발생을 억제하는 것을 포함한다. 용어, "치료"는 질병의 발전의 억제, 경감, 또는 제거를 포함한다. 용어 "개선"은 상태의 완화 또는 치료와 관련된 파라미터, 예를 들면 증상의 정도를 적어도 감소시키는 모든 행위를 의미할 수 있다.
일 구체예에서, 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 MMP-1의 발현을 감소 또는 억제시킬 수 있다. 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 자외선에 의해 증가된 MMP-1의 발현을 감소 또는 억제시킬 수 있다. 따라서, 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 피부 노화 방지, 피부 주름 개선 또는 피부 탄력 증진 효과를 나타낼 수 있다.
일 구체예에서, 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 COL1A1의 발현을 증가시킬 수 있다. 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 자외선에 의해 증가된 COL1A1의 발현을 증가시킬 수 있다. 따라서, 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 피부 노화 방지, 피부 주름 개선 또는 피부 탄력 증진 효과를 나타낼 수 있다.
일 구체예에서, 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 HAS3, AQP3, 필라그린, 및 ABCA12 중 1종 이상의 발현을 증가시킬 수 있다. 따라서, 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 피부 보습 또는 피부 장벽 강화 효과를 나타낼 수 있다.
일 구체예에서, 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 멜라닌 분비를 감소 또는 억제시키거나, 멜라닌 생성(또는 멜라닌 합성)을 감소 또는 억제시킬 수 있다. 따라서, 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 피부 미백 효과를 나타낼 수 있다.
상기 균주는 피부 개선 효과를 갖는 다른 균주, 예컨대 스타필로코커스 캐피티스 아종 균주, 스타필로코커스 속에 속하는 균주, 코리네박테리움 속에 속하는 균주, 나이세리아 속에 속하는 균주, 스트렙토코커스 속에 속하는 균주, 큐티박테리움 속에 속하는 균주 등과 함께 사용되어 시너지 효과를 나타낼 수 있다.
상기 스타필로코커스 속에 속하는 스타필로코커스 캐피티스 아종 균주는 예를 들어, 스타필로코커스 캐피티스 아종 유레알리티쿠스(Staphylococcus capitis subsp. urealyticus), 스타필로코커스 캐피티스 아종 캐피티스(Staphylococcus capitis subsp. capitis) 등이 있다.
상기 스타필로코커스 속에 속하는 균주는 예를 들어, 스타필로코커스 아우리큘라시스(Staphylococcus auricularis), 스타필로코커스 코흐니(Staphylococcus cohnii), 스타필로코커스 호미니스(Staphylococcus hominis), 스타필로코커스 루그두넨시스(Staphylococcus lugdunensis) 등이 있다.
상기 코리네박테리움 속에 속하는 균주는 예를 들어, 코리네박테리움 아우리무코섬(Corynebacterium　aurimucosum), 코리네박테리움 디프테리아(Corynebacterium　diphtheria), 코리네박테리움 두룸(Corynebacterium　durum), 코리네박테리움 글루쿠로놀리쿰(Corynebacterium　glucuronolyticum), 코리네박테리움 마트루코티이(Corynebacterium　matruchotii), 코리네박테리움 프로핀쿰(Corynebacterium　propinquum), 코리네박테리움 스트리아툼(Corynebacterium　striatum), 코리네박테리움 제로시스(Corynebacterium　xerosis), 코리네박테리움 아비듐(Cutibacterium　avidum) 등이 있다.
상기 나이세리아 속에 속하는 균주는 예를 들어, 나이세리아 플라바(Neisseria　flava) 등이 있다.
상기 스트렙토코커스 속에 속하는 균주는 예를 들어, 스트렙토코커스 이퀴너스(Streptococcus　equinus), 스트렙토코커스 오우스트랄리스 (Streptococcus　australis), 스트렙토코커스 다우니(Streptococcus　downii), 스트렙토코커스 할리코에리(Streptococcus　halichoeri), 스트렙토코커스 인터메디우스(Streptococcus　intermedius), 스트렙토코커스 루테티엔시스(Streptococcus　lutetiensis), 스트렙토코커스 마실리엔시스(Streptococcus　massiliensis), 스트렙토코커스 뮤탄스(Streptococcus　mutans), 스트렙토코커스 오랄리스(Streptococcus　oralis), 스트렙토코커스 파라상귀스(Streptococcus　parasanguinis), 스트렙토코커스 엔지노서스(Streptococcus　anginosus), 스트렙토코커스 슈도뉴모니에(Streptococcus　pseudopneumoniae), 스트렙토코커스 표게네스(Streptococcus　pyogenes), 스트렙토코커스 루브네리(Streptococcus　rubneri), 스트렙토코커스 살리바리우스(Streptococcus　salivarius), 스트렙토코커스 산구이스(Streptococcus　sanguinis), 스트렙토코커스 소브리누스(Streptococcus　sobrinus), 스트렙토코커스 베스티불라시스(Streptococcus　vestibularis), 스트렙토코커스 룹네리(Streptococcus　rubneri) 등이 있다.
상기 큐티박테리움 속에 속하는 균주는 예를 들어, 큐티박테리움 그래뉼로섬(Cutibacterium granulosum), 큐티박테리움 아크네스(Cutibacterim acnes) 등이 있다.
상기 조성물은 상기 균주, 그의 파쇄액, 배양액, 배양액의 추출물, 또는 이들의 혼합물을 유효성분으로 포함할 수 있다.
상기 "유효성분으로 포함"은 본 명세서에서 언급한 효과를 나타낼 수 있는 정도로 본 명세서의 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물이 첨가되는 것을 의미하고, 약물전달 및 안정화 등을 위하여 다양한 성분을 부성분으로 첨가하여 다양한 형태로 제형화(formulation)되는 것을 포함하는 의미이다.
상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물은 조성물 총 중량에 대하여 0.0001 중량% 내지 99.9999 중량%, 예를 들면, 0.001 중량% 내지 80 중량%, 0.01 중량% 내지 60 중량%, 0.01 중량% 내지 40 중량%, 0.01 중량% 내지 30 중량%, 0.01 중량% 내지 20 중량%, 0.01 중량% 내지 10 중량%, 0.01 중량% 내지 5 중량%, 0.05 중량% 내지 60 중량%, 0.05 중량% 내지 40 중량%, 0.05 중량% 내지 30 중량%, 0.05 중량% 내지 20 중량%, 0.05 중량% 내지 10 중량%, 0.05 중량% 내지 5 중량%, 0.1 중량% 내지 60 중량%, 0.1 중량% 내지 40 중량%, 0.1 중량% 내지 30 중량%, 0.1 중량% 내지 20 중량%, 0.1 중량% 내지 10 중량%, 또는 0.1 중량% 내지 5 중량%로 포함될 수 있으나, 특별히 이에 제한되지 않는다. 유효성분의 함량은 통상의 기술자가 본 명세서에서 언급한 효과를 나타낼 수 있을 정도의 함량 범위 내에서, 제형화 가능한 적절한 함량을 선택할 수 있다.
상기 조성물은 액체 상태 또는 건조 상태인 것일 수 있다. 일 구체예에서, 상기 조성물은 건조 분말 형태일 수 있다.
상기 조성물을 건조 상태로 제조하는 건조 방법은 당업계에서 일반적으로 사용되는 방법을 사용할 수 있으며, 특별히 제한되지 않는다. 상기 건조 방법의 비제한적인 예는, 공기 건조 방법, 자연 건조 방법, 분무 건조 방법, 동결 건조 방법 등이 있다. 이들 방법은 단독으로 사용하거나 적어도 두 가지 방법을 함께 사용할 수 있다.
상기 조성물은 상기 균주, 그의 파쇄액, 배양액 또는 배양액의 추출물의 열화(deterioration)를 감소시키기에 충분한 유효량의 첨가제를 포함할 수 있다. 상기 첨가제는 예를 들어 결합제일 수 있으나, 이에 제한되지 않는다.
상기 조성물은 화장품학적으로, 약학적으로 또는 식품학적으로 허용가능한 담체를 더 포함할 수 있다. 상기 조성물은 담체와 함께 제형화되어 화장품, 약품, 식품 첨가제 등으로 제공될 수 있다.
상기 조성물은 화장료 조성물일 수 있다.
상기 화장료 조성물은 본 명세서에 개시된 유효성분 이외에 화장료 조성물에 통상적으로 이용되는 성분들, 기능성 첨가물 등을 추가로 포함할 수 있으며, 예컨대 항산화제, 안정화제, 용해화제, 계면활성제, 분산제, 유화제, 방부제, 비타민, 안료, 향료 등과 같은 통상적인 보조제, 그리고 담체를 포함할 수 있다.
상기 화장료 조성물은 특정 제형에 특별히 한정되지 않으며, 목적하는 바에 따라 제형을 적절히 선택할 수 있다. 상기 화장료 조성물은, 예를 들어, 가용화 제형, 유화 제형, 또는 분산 제형을 갖는 것일 수 있다. 상기 화장료 조성물은 예를 들면, 화장수, 크림, 에센스, 클렌징 폼, 클렌징 워터, 팩, 앰플, 바디 로션, 바디 오일, 바디 젤, 샴푸, 린스, 헤어 컨디셔너, 헤어 젤, 파운데이션, 립스틱, 마스카라, 메이크업 베이스, 또는 피부 점착 타입의 화장료 제형을 갖는 것일 수 있다. 상기 피부 점착 타입의 화장료 제형은 예를 들어, 마스크팩일 수 있으나, 이에 제한되지 않는다.
또한, 상기 조성물은 피부외용제용 조성물일 수 있다.
상기 피부외용제는 크림, 겔, 연고, 피부 유화제, 피부 현탁액, 경피전달성 패치, 약물 함유 붕대, 로션, 또는 그 조합일 수 있다. 상기 피부외용제는 통상 화장품이나 의약품 등의 피부외용제에 사용되는 성분, 예를 들면 수성성분, 유성성분, 분말성분, 알코올류, 보습제, 증점제, 자외선흡수제, 미백제, 방부제, 산화방지제, 계면활성제, 향료, 색제, 각종 피부 영양제, 금속이온봉쇄제, 당류, 또는 이들의 조합과 필요에 따라서 적절하게 배합될 수 있다.
상기 조성물은 약학적 조성물일 수 있다.
상기 약학적 조성물은 약제학적으로 허용가능한 희석제 또는 담체를 추가적으로 포함할 수 있다. 상기 희석제는 유당, 옥수수 전분, 대두유, 미정질 셀룰로오스, 만니톨, 또는 그 조합일 수 있다. 상기 담체는 부형제, 붕해제, 결합제, 활택제, 또는 그 조합일 수 있다. 상기 부형제는 미결정 셀룰로오즈, 유당, 저치환도 히드록시셀룰로오즈, 또는 그 조합일 수 있다. 상기 붕해제는 카르복시메틸셀룰로오스 칼슘, 전분글리콜산 나트륨, 무수인산일수소 칼슘, 또는 그 조합일 수 있다. 상기 결합제는 폴리비닐피롤리돈, 저치환도 히드록시프로필셀룰로오즈, 히드록시프로필셀룰로오즈, 또는 그 조합일 수 있다. 상기 활택제는 스테아린산 마그네슘, 이산화규소, 탈크, 또는 그 조합일 수 있다.
상기 약학적 조성물은 경구 또는 비경구 투여 제형으로 제형화될 수 있다. 경구 투여 제형은 과립제, 산제, 액제, 정제, 캅셀제, 건조시럽제 등일 수 있다. 비경구 투여 제형은 주사제, 연고제 등일 수 있다.
상기 조성물은 식품 조성물일 수 있다. 상기 조성물은 건강기능식품 조성물일 수 있다. 이 경우, 당해 기술분야에 공지되어 있는 통상적인 건강기능식품의 제형으로 제제화될 수 있다.
상기 식품 조성물은 상기 균주, 그의 파쇄액, 배양액 또는 배양액의 추출물 단독을 사용하거나, 또는 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합 양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 상기 건강기능식품의 종류에는 특별한 제한은 없다. 건강기능식품의 종류 중 음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상기 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드; 말토스, 슈크로스와 같은 디사카라이드; 및 덱스트린, 사이클로덱스트린과 같은 폴리사카라이드; 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 식품 조성물은 또한 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제, 또는 그 조합을 함유할 수 있다. 상기 식품 조성물은 또한, 천연 과일쥬스, 과일쥬스 음료, 야채 음료의 제조를 위한 과육, 또는 그 조합을 함유할 수 있다.
다른 양상은 유효량의 상기한 조성물을 그를 필요로 하는 개체에 투여하는 단계를 포함하는 개체의 상태를 예방, 개선, 또는 치료하는 방법을 제공한다.
상기 개체의 상태는 피부와 관련된 상태일 수 있고, 구체적으로, 피부 장벽 기능 손상에 의한 질환, 피부 노화, 멜라닌 색소 과다 침착 질환, 피부 염증 질환, 또는 피부 알레르기 질환일 수 있다.
용어 "유효량"이란 상기에서 언급한 효과를 나타낼 수 있을 정도로 유효한 양을 의미한다.
본 명세서에서 용어, "투여하는", "도입하는", 및 "이식하는"은 상호교환적으로 사용되고, 일 구체예에 따른 조성물의 원하는 부위로의 적어도 부분적 국소화를 초래하는 방법 또는 경로에 의한 개체 내로의 일 구체예에 따른 조성물의 배치를 의미할 수 있다.
투여는 당업계에 알려진 방법에 의한 것일 수 있다. 투여 경로, 투여 횟수 등의 투여 방법은 통상의 기술자가 적절히 선택할 수 있다. 투여는 예를 들면, 정맥내, 근육내, 경구, 경피(transdermal), 점막, 코안(intranasal), 기관내(intratracheal) 또는 피하 투여와 같은 경로로, 임의의 수단에 의하여 개체로 직접적으로 투여될 수 있다. 상기 투여는 전신적으로 또는 국부적으로 투여될 수 있다. 상기 투여는 피부에의 도포를 포함할 수 있다.
상기 개체는 포유동물, 예를 들면, 사람, 소, 말, 돼지, 개, 양, 염소, 또는 고양이일 수 있다. 상기 개체는 피부 상태 개선을 필요로 하는 개체, 예를 들어 피부 노화 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화, 피부 미백, 항염증, 또는 항알레르기 효과를 필요로 하는 개체일 수 있다.
상기 투여는 일 구체예에 따른 조성물을 개체당 일당 0.1 mg 내지 1,000 mg, 예를 들면, 0.1 mg 내지 500 mg, 0.1 mg 내지 100 mg, 0.1 mg 내지 50 mg, 0.1 mg 내지 25 mg, 1 mg 내지 1,000 mg, 1 mg 내지 500 mg, 1 mg 내지 100 mg, 1 mg 내지 50 mg, 1 mg 내지 25 mg, 5mg 내지 1,000 mg, 5 mg 내지 500 mg, 5 mg 내지 100 mg, 5 mg 내지 50 mg, 5 mg 내지 25 mg, 10mg 내지 1,000 mg, 10 mg 내지 500 mg, 10 mg 내지 100 mg, 10 mg 내지 50 mg, 또는 10 mg 내지 25 mg을 투여하는 것일 수 있다. 다만, 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성별, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있고, 당업자라면 이러한 요인들을 고려하여 투여량을 적절히 조절할 수 있다. 투여 횟수는 1일 1회 또는 임상적으로 용인가능한 부작용의 범위 내에서 2회 이상이 가능하다. 투여 부위에 대해서도 1개소 또는 2개소 이상에 투여할 수 있으며, 매일 또는 2 내지 5일 간격으로 총 투여 일수는 한번 치료 시 1일에서 30일까지 투여될 수 있다. 필요한 경우, 적정 시기 이후에 동일한 치료를 반복할 수 있다. 인간 이외의 동물에 대해서도, kg당 인간과 동일한 투여량으로 하거나, 또는 예를 들면 목적의 동물과 인간과의 기관(심장 등)의 용적비(예를 들면, 평균값) 등으로 상기의 투여량을 환산한 양을 투여할 수 있다.
다른 양상은 피부 상태 개선용 조성물을 제조하는 데 사용하기 위한, 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물의 용도를 제공한다.
다른 양상은 멜라닌 색소 과다 침착 질환, 피부 염증 질환 또는 피부 알레르기 질환의 예방 또는 치료용 약제를 제조하는 데 사용하기 위한, 상기 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물의 용도를 제공한다.
중복되는 내용은 본 명세서의 복잡성을 고려하여 생락하며, 본 명세서에서 달리 정의되지 않은 용어들은 본 발명이 속하는 기술분야에서 통상적으로 사용되는 의미를 갖는 것이다.
일 양상에 따른 신규 피부 유래 균주에 의하면, 피부 노화 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화, 피부 미백 등의 피부 상태 개선 효과가 있으므로, 화장품, 의약품, 식품 등에 유용하게 사용될 수 있다.
도 1은 MMP-1의 상대적 발현 수준을 나타낸 그래프이다. None (UV): UV 조사 + 배지 또는 배양액 비처리, Control: UV 조사 + 배지 처리(음성 대조군), EGCG (1 uM): UV 조사 + EGCG 처리(양성 대조군), S. capitis sub. capitis (1%): UV 조사 + YJ-No2 균주 배양액 처리군.
도 2A는 MMP-1의 상대적 발현 수준을 나타낸 그래프이다. None (UV): UV 조사 + 배지 또는 배양액 비처리, Control: UV 조사 + 배지 처리(음성 대조군), EGCG (1 uM): UV 조사 + EGCG 처리(양성 대조군), S. capitis sub. urealyticus (1%): UV 조사 + YM3 균주 배양액 처리군.
도 2B는 HAS3의 상대적 발현 수준을 나타낸 그래프이다. None: 배지 또는 배양액 비처리, Control: 배지 처리(음성 대조군), Retinoic acid (1 uM): 레티노산 처리(양성 대조군), S. capitis sub. Urealyticus (1%): YM3 균주 배양액 처리군.
도 3A는 HAS3의 상대적 발현 수준을 나타낸 그래프이다. None: 배지 또는 배양액 비처리, Control: 배지 처리(음성 대조군), Retinoic acid (1 uM): 레티노산 처리(양성 대조군), C. diphteriae (1%): CM6 균주 배양액 처리군.
도 3B는 AQP3의 상대적 발현 수준을 나타낸 그래프이다. None: 배지 또는 배양액 비처리, Control: 배지 처리(음성 대조군), Retinoic acid (1 uM): 레티노산 처리(양성 대조군), C. diphteriae (1%): CM6 균주 배양액 처리군.
도 4A는 필라그린의 상대적 발현 수준을 나타낸 그래프이다. Control: 배지 처리(음성 대조군), Neisseria subflava Ferment Filtrate (1%): CM5 균주 배양액 처리군
도 4B는 ABCA12의 상대적 발현 수준을 나타낸 그래프이다. Control: 배지 처리(음성 대조군), Neisseria subflava Ferment Filtrate (1%): CM5 균주 배양액 처리군
도 5A는 MMP-1의 상대적 발현 수준을 나타낸 그래프이다. None (UV): UV 조사 + 배지 또는 배양액 비처리, Control: UV 조사 + 배지 처리(음성 대조군), EGCG (1 uM): UV 조사 + EGCG 처리(양성 대조군), S. lugdunensis (1%): UV 조사 + CM4 균주 배양액 처리군.
도 5B는 HAS3의 상대적 발현 수준을 나타낸 그래프이다. None: 배지 또는 배양액 비처리, Control: 배지 처리(음성 대조군), Retinoic acid (1 uM): 레티노산 처리(양성 대조군), S. lugdunensis (1%): CM4 균주 배양액 처리군.
도 5C은 AQP3의 상대적 발현 수준을 나타낸 그래프이다. None: 배지 또는 배양액 비처리, Control: 배지 처리(음성 대조군), Retinoic acid (1 uM): 레티노산 처리(양성 대조군), S. lugdunensis (1%): CM4 균주 배양액 처리군.
도 6A는 MMP-1의 상대적 발현 수준을 나타낸 그래프이다. None (UV): UV 조사 + 배지 또는 배양액 비처리, Control: UV 조사 + 배지 처리(음성 대조군), EGCG (1 uM): UV 조사 + EGCG 처리(양성 대조군), S. hominis (1%): UV 조사 + CM3 균주 배양액 처리군.
도 6B는 AQP3의 상대적 발현 수준을 나타낸 그래프이다. None: 배지 또는 배양액 비처리, Control: 배지 처리(음성 대조군), Retinoic acid (1 uM): 레티노산 처리(양성 대조군), S. hominis (1%): CM3 균주 배양액 처리군.
도 7A는 MMP-1의 상대적 발현 수준을 나타낸 그래프이다. None (UV): UV 조사 + 배지 또는 배양액 비처리, Control: UV 조사 + 배지 처리(음성 대조군), EGCG (1 uM): UV 조사 + EGCG 처리(양성 대조군), S. cohnii (1%): UV 조사 + CM2 균주 배양액 처리군.
도 7B는 HAS3의 상대적 발현 수준을 나타낸 그래프이다. None: 배지 또는 배양액 비처리, Control: 배지 처리(음성 대조군), Retinoic acid (1 uM): 레티노산 처리(양성 대조군), S. cohnii (1%): CM2 균주 배양액 처리군.
도 8A는 MMP-1의 상대적 발현 수준을 나타낸 그래프이다. None (UV): UV 조사 + 배지 또는 배양액 비처리, Control: UV 조사 + 배지 처리(음성 대조군), EGCG (1 uM): UV 조사 + EGCG 처리(양성 대조군), S. auricularis (1%): UV 조사 + CM1 균주 배양액 처리군.
도 8B는 HAS3의 상대적 발현 수준을 나타낸 그래프이다. None: 배지 또는 배양액 비처리, Control: 배지 처리(음성 대조군), Retinoic acid (1 uM): 레티노산 처리(양성 대조군), S. auricularis (1%): CM1 균주 배양액 처리군.
도 9는 COL1A1의 상대적 발현 수준을 나타낸 그래프이다. 음성 대조군: UV 조사 + 균주 배양액 미처리군, 실시예 2: UV 조사 + CX105 균주 배양액 처리군.
도 10은 필라그린(FLG)의 상대적 발현 수준을 나타낸 그래프이다. 음성 대조군: 배지 처리 + 균주 배양액 미처리군, 실시예 2: CX106 균주 배양액 처리군.
도 11은 AQP3의 상대적 발현 수준을 나타낸 그래프이다. 음성 대조군: 배지 처리 + 균주 배양액 미처리군, RA: 레티노산(Retinoic acid) 처리군(양성 대조군), 실시예 2: CX107 균주 배양액 처리군.
도 12는 AQP3의 상대적 발현 수준을 나타낸 그래프이다. 음성 대조군: 배지 처리 + 균주 배양액 미처리군, RA: 레티노산(Retinoic acid) 처리군(양성 대조군), 실시예 2: CX108 균주 배양액 처리군.
도 13은 필라그린(FLG)의 상대적 발현 수준을 나타낸 그래프이다. 음성 대조군: 배지 처리 + 균주 배양액 미처리군, 실시예 2: YM-41 균주 배양액 처리군.
도 14A는 HAS3의 상대적 발현 수준을 나타낸 그래프이다. 음성 대조군: 배지 처리 + 균주 배양액 미처리군, RA: 레티노산(Retinoic acid) 처리군(양성 대조군), 실시예 2: CX101 균주 배양액 처리군.
도 14B는 AQP3의 상대적 발현 수준을 나타낸 그래프이다. 음성 대조군: 배지 처리 + 균주 배양액 미처리군, RA: 레티노산(Retinoic acid) 처리군(양성 대조군), 실시예 2: CX101 균주 배양액 처리군.
도 15A는 HAS3의 상대적 발현 수준을 나타낸 그래프이다. 음성 대조군: 배지 처리 + 균주 배양액 미처리군, RA: 레티노산(Retinoic acid) 처리군(양성 대조군), 실시예 2: CX102 균주 배양액 처리군.
도 15B는 AQP3의 상대적 발현 수준을 나타낸 그래프이다. 음성 대조군: 배지 처리 + 균주 배양액 미처리군, RA: 레티노산(Retinoic acid) 처리군(양성 대조군), 실시예 2: CX102 균주 배양액 처리군.
도 16은 HAS3의 상대적 발현 수준을 나타낸 그래프이다. 음성 대조군: 배지 처리 + 균주 배양액 미처리군, RA: 레티노산(Retinoic acid) 처리군(양성 대조군), 실시예 2: CX103 균주 배양액 처리군.
도 17은 MMP-1의 상대적 발현 수준을 나타낸 그래프이다. 음성 대조군: UV 조사 + 배지 처리 + 균주 배양액 미처리군, 실시예 2: UV 조사 + CX104 균주 배양액 처리군.
도 18은 멜라닌 분비량(%)을 나타낸 그래프이다. None: α-MSH 무처리 + 시료 무처리군, Control: α-MSH 처리 + 배지 처리군(음성 대조군), Arbutin (100 ppm): α-MSH 처리 + 알부틴 처리군(양성 대조군), C. durum (1%): α-MSH 처리 + CD18 균주 배양액 처리군.
도 19는 멜라닌 분비량(%)을 나타낸 그래프이다. None: α-MSH 무처리 + 시료 무처리군, Control: α-MSH 처리 + 배지 처리군(음성 대조군), Arbutin (100 ppm): α-MSH 처리 + 알부틴 처리군(양성 대조군), C. glucoronolyticum (1%): α-MSH 처리 + CG19 균주 배양액 처리군.
도 20은 멜라닌 분비량(%)을 나타낸 그래프이다. None: α-MSH 무처리 + 시료 무처리군, Control: α-MSH 처리 + 배지 처리군(음성 대조군), Arbutin (100 ppm): α-MSH 처리 + 알부틴 처리군(양성 대조군), C. propinquum (1%): α-MSH 처리 + CP33 균주 배양액 처리군.
도 21A는 멜라닌 분비량(%)을 나타낸 그래프이다. None: α-MSH 무처리 + 시료 무처리군, Control: α-MSH 처리 + 배지 처리군(음성 대조군), Arbutin (100 ppm): α-MSH 처리 + 알부틴 처리군(양성 대조군), C. striatum (1%): α-MSH 처리 + CS96 균주 배양액 처리군.
도 21B는 멜라닌 생성량(%)을 나타낸 그래프이다. None: α-MSH 무처리 + 시료 무처리군, Control: α-MSH 처리 + 배지 처리군(음성 대조군), Arbutin (100 ppm): α-MSH 처리 + 알부틴 처리군(양성 대조군), C. striatum (1%): α-MSH 처리 + CS96 균주 배양액 처리군.
도 22A는 멜라닌 분비량(%)을 나타낸 그래프이다. None: α-MSH 무처리 + 시료 무처리군, Control: α-MSH 처리 + 배지 처리군(음성 대조군), Arbutin (100 ppm): α-MSH 처리 + 알부틴 처리군(양성 대조군), C. xerosis (1%): α-MSH 처리 + CX1 균주 배양액 처리군.
도 22B는 멜라닌 생성량(%)을 나타낸 그래프이다. None: α-MSH 무처리 + 시료 무처리군, Control: α-MSH 처리 + 배지 처리군(음성 대조군), Arbutin (100 ppm): α-MSH 처리 + 알부틴 처리군(양성 대조군), C. xerosis (1%): α-MSH 처리 + CX1 균주 배양액 처리군.
도 23은 필라그린(FLG)의 상대적 발현 수준을 나타낸 그래프이다. None: 배지 및 균주 배양액 미처리군(음성 대조군), S. parasanguinis (1%): SP06 균주 배양액 처리군.
도 24는 필라그린(FLG)의 상대적 발현 수준을 나타낸 그래프이다. None: 무처리 대조군, YM-11: YM-11 균주 배양액 처리군.
도 25는 필라그린(FLG)의 상대적 발현 수준을 나타낸 그래프이다. None: 무처리 대조군, YM-15: YM-15 균주 배양액 처리군.
도 26은 MMP-1의 상대적 발현 수준을 나타낸 그래프이다. UV: UV 조사 + 배지 미처리 + 균주 배양액 미처리군, Control: UV 조사 + 배지 처리 + 균주 배양액 미처리군(음성 대조군), EGCG-1 (1 uM): UV 조사 + EGCG-1 처리군(양성 대조군), YM-19: UV 조사 + YM-19 균주 배양액 처리군.
도 27은 COL1A1의 상대적 발현 수준을 나타낸 그래프이다. UV: UV 조사 + 배지 미처리 + 균주 배양액 미처리군, Control: UV 조사 + 배지 처리 + 균주 배양액 미처리군(음성 대조군), EGCG-1 (1 uM): UV 조사 + EGCG-1 처리군(양성 대조군), YM-17: YM-17 균주 배양액 처리군.
도 28A는 MMP-1의 상대적 발현 수준을 나타낸 그래프이다. UV: UV 조사 + 배지 또는 배양액 비처리군, Control: UV 조사 + 배지 처리군(음성 대조군), EGCG-1 (1 uM): UV 조사 + EGCG 처리군(양성 대조군), YM-18: UV 조사 + YM-18 균주 배양액 처리군.
도 28B는 HAS3의 상대적 발현 수준을 나타낸 그래프이다. Control: 배지 또는 배양액 비처리군, Retinoic acid (1 uM): 레티노산 처리군(양성 대조군), Media: 배지 처리군(음성 대조군), YM-18: YM-18 균주 배양액 처리군.
도 29는 필라그린(FLG)의 상대적 발현 수준을 나타낸 그래프이다. None: 무처리 대조군, YM-13: YM-13 균주 배양액 처리군.
도 30은 MMP-1의 상대적 발현 수준을 나타낸 그래프이다. UV: UV 조사 + 배지 미처리 + 균주 배양액 미처리군, Control: UV 조사 + 배지 처리 + 균주 배양액 미처리군(음성 대조군), EGCG-1 (1 uM): UV 조사 + EGCG-1 처리군(양성 대조군), YM-12: UV 조사 + YM-12 균주 배양액 처리군.
도 31은 HAS3의 상대적 발현 수준을 나타낸 그래프이다. Control: 배지 미처리 + 균주 배양액 미처리군, Retinoic acid (1 uM): 레티노산 처리군(양성 대조군), Media: 배지 처리 + 균주 배양액 미처리군(음성 대조군), YM-14: YM-14 균주 배양액 처리군.
이하 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
[실시예]
실시예 1. 균주의 분리 및 동정
건강한 여성의 피부에서 신규 균주를 분리 및 동정하였다.
구체적으로, 건강한 여성의 뺨, 코끝, 콧볼 경계부 등을 PBS(phosphate buffer saline)에 적신 멸균 면봉으로 2~3차례씩 스왑하였다. PBS가 담긴 튜브에 면봉을 넣고, 10초 동안 볼텍싱(vortexing)하였다. 샘플의 10배, 100배, 1,000배 희석액을 제작하고, 0.1X TSB(Tryptic Soy Broth), 0.5X R2A(Reasoner's 2A) 한천 배지에 각각 100 μL씩 가하여 스프레더로 도말하였다. 플레이트를 30℃ 또는 37℃에서 배양한 뒤 형성된 집락 100개를 순수 분리 배양하여, 48시간 동안 28℃ 인큐베이터에서 재배양 하였다. 배양이 완료된 집락은 16S rRNA 유전자 서열 동정을 실시하였다. 이때 사용된 프라이머는 박테리아에만 반응하여 증폭하도록 고안되었으며, 프라이머 서열은 다음과 같다. 27F, 정방향 프라이머: 5'-AGAGTTTGATCCTGGCTCAG-3' (서열번호 32); 1492R, 역방향 프라이머: 5'-GGTTACCTTGTTACGACTT-3 (서열번호 33). PCR 증폭은 95℃ 1분, 55℃ 1분, 75℃ 1분30초씩 30 사이클로 실시하였으며, 마지막으로 72℃에서 8분간 처리한 후 4℃에서 보관하였다. PCR 반응이 끝난 뒤 분리 배양된 종들의 DNA 서열은 ABI-3730XL(ABI, USA)를 이용하여 결정하였다.
미국 국립생물정보센터(NCBI, National Center for Biotechnology Information) 홈페이지에서 제공되는 BLAST 프로그램을 사용하여, 분리 배양된 미생물 집락 중 결정된 16S rRNA 부위의 염기서열을 NCBI에 등록된 다른 균주들과 비교 분석하였다. 그중 신규 균주 31종을 선별하였다.
선별된 균주는 한국미생물보존센터(Korean Culture Center of Microorganisms, KCCM)에 기탁하여 기탁번호를 부여받았다. 선별된 31종의 균주의 기탁번호, 16S rRNA 서열(complementary DNA), 및 NCBI BLAST 결과를 하기 표 1에 나타내었다.
No. 균주 기탁번호
(기탁일) 		16S rRNA 서열 NCBI BLAST 결과
(1) 스타필로코커스 캐피티스 아종 캐피티스(Staphylococcus capitis subsp. capitis) YJ-No2 균주 KCCM13158P (2022.04.19) 서열번호 1 97.78%
(2) 스타필로코커스 캐피티스 아종 유레알리티쿠스(Staphylococcus capitis subsp. urealyticus) YM3 균주 KCCM13159P (2022.04.19) 서열번호 2 97.78%
(3) 코리네박테리움 디프테리아(Corynebacterium diphtheriae) CM6 균주 KCCM13174P (2022.05.04) 서열번호 3 97.78%
(4) 나이세리아 서브플라바(Neisseria subflava) CM5 균주 KCCM13173P (2022.05.04) 서열번호 4 97.78%
(5) 스타필로코커스 루그두넨시스(Staphylococcus lugdunensis) CM4 균주 KCCM13172P (2022.05.04) 서열번호 5 97.78%
(6) 스타필로코커스 호미니스(Staphylococcus hominis) CM3 균주 KCCM13171P (2022.05.04) 서열번호 6 97.78%
(7) 스타필로코커스 코흐니(Staphylococcus cohnii) CM2 균주 KCCM13170P (2022.05.04) 서열번호 7 97.78%
(8) 스타필로코커스 아우리큘라리스(Staphylococcus auricularis) CM1 균주 KCCM13169P (2022.05.04) 서열번호 8 97.78%
(9) 스트렙토코커스 이퀴너스(Streptococcus equinus) CX105 균주 KCCM13187P (2022.05.19) 서열번호 9 99.78%
(10) 스트렙토코커스 엔지노서스(Streptococcus anginosus) CX106 균주 KCCM13188P (2022.05.19) 서열번호 10 99.78%
(11) 스트렙토코커스 슈도뉴모니에(Streptococcus pseudopneumoniae) CX107 균주 KCCM13189P (2022.05.19) 서열번호 11 99.78%
(12) 스트렙토코커스 뮤탄스(Streptococcus mutans) CX108 균주 KCCM13190P(2022.05.19) 서열번호 12 99.78%
(13) 큐티박테리움 아비둠(Cutibacterium avidum) YM-41 균주 KCCM13198P (2022.05.24) 서열번호 13 99.78%
(14) 스트렙토코커스 루테티엔시스(Streptococcus lutetiensis) CX101 균주 KCCM13183P(2022.05.19) 서열번호 14 99.78%
(15) 스트렙토코커스 오우스트랄리스(Streptococcus australis) CX102 균주 KCCM13184P (2022.05.19) 서열번호 15 99.78%
(16) 스트렙토코커스 할리코에리(Streptococcus halichoeri) CX103 균주 KCCM13185P (2022.05.19) 서열번호 16 99.78%
(17) 스트렙토코커스 마실리엔시스(Streptococcus massiliensis) CX104 균주 KCCM13186P (2022.05.19) 서열번호 17 99.78%
(18) 코리네박테리움 두룸(Corynebacterium durum) CD18 균주 KCCM13194P (2022.05.19) 서열번호 18 99.47%
(19) 코리네박테리움 글루쿠로노리티쿰(Corynebacterium glucuronolyticum) CG19 균주 KCCM13197P (2022.05.19) 서열번호 19 99.33%
(20) 코리네박테리움 프로핀큠(Corynebacterium propinquum) CP33 균주 KCCM13196P (2022.05.19) 서열번호 20 99.85%
(21) 코리네박테리움 스트리아툼(Corynebacterium striatum) CS96 균주 KCCM13195P(2022.05.19) 서열번호 21 99.98%
(22) 코리네박테리움 제로시스(Corynebacterium xerosis) CX1 균주 KCCM13193P (2022.05.19) 서열번호 22 98.87%
(23) 스트렙토코커스 파라상귀니스(Streptococcus parasanguinis) SP06 균주 KCCM13204P(2022.06.07) 서열번호 23 99.86%
(24) 스트렙토코커스 도우니(Streptococcus downii) YM-11 균주 KCCM13209P (2022.06.17) 서열번호 24 99%
(25) 스트렙토코커스 룹네리(Streptococcus rubneri) YM-15 균주 KCCM13213P (2022.06.17) 서열번호 25 99%
(26) 스트렙토코커스 베스티불라리스(Streptococcus vestibularis) YM-19 균주 KCCM13217P (2022.06.17) 서열번호 26 99%
(27) 스트렙토코커스 상귀니스(Streptococcus sanguinis) YM-17 균주 KCCM13215P (2022.06.17) 서열번호 27 99%
(28) 스트렙토코커스 소브리너스(Streptococcus sobrinus) YM-18 균주 KCCM13216P (2022.06.17) 서열번호 28 99%
(29) 스트렙토코커스 오랄리스(Streptococcus oralis) YM-13 균주 KCCM13211P (2022.06.17) 서열번호 29 99%
(30) 스트렙토코커스 인터메디어스(Streptococcus intermedius) YM-12 균주 KCCM13210P (2022.06.17) 서열번호 30 99%
(31) 스트렙토코커스 파이오제네스(Streptococcus pyogenes) YM-14 균주 KCCM13212P (2022.06.17) 서열번호 31 99%
실시예 2. 균주 배양액의 제조
실시예 1에서 분리한 31종 균주의 배양액을 각각 제조하였다.
구체적으로, 상기 실시예 1에서 분리한 균주를 TSB(Tryptic Soy Broth) 배지에서 배양하였다. 원심분리를 통해 균체를 제거하고 상등액 회수 및 여과를 통해 균주 배양액을 제조하였다.
[실험방법]
실험방법 1. 피부 항노화, 피부 주름 개선, 피부 탄력 증진 효능 확인
상기 균주 배양액의 피부 항노화, 피부 주름 개선, 피부 탄력 증진 효능을 확인하기 위해, MMP-1 및 COL1A1의 발현 수준을 분석하였다.
MMP-1(Matrix metalloproteinase-1)은 피부의 콜라겐을 분해한다. 따라서, MMP-1의 발현을 감소 또는 억제시키면, 피부의 콜라겐 분해가 억제되므로, 피부 탄력이 증진되고, 피부 주름이 개선되어, 피부 노화(예: 광노화)를 예방 또는 개선할 수 있다.
COL1A1(Collagen type I alpha 1 chain)은 피부 주름 개선, 피부 탄력 증진과 관련된 인자이므로, COL1A1의 발현이 증가하면 피부 노화 방지 효과를 나타낼 수 있다.
1-1. 세포배양 및 시료 처리
인간 섬유아세포 세포주(human dermal fibroblast, Hs68)를 10% 우혈청(fetal bovin serum)을 포함한 DMEM 배지(Dulbecco's modified Eagle's Medium, Gibco 1210-0038)에서 배양하였고, 배양은 모두 37℃, 5% CO2 배양기에서 수행하였다. 이후 배지를 제거하고 DPBS(Dulbecco's phosphate-buffered saline)를 넣은 후 12 mJ/cm2의 UVB를 조사하거나 조사하지 않았다. UVB 조사 직후 DPBS를 제거하고 FBS(Fetal Bovine Serum)가 없는 배지로 갈아준 후, 균주 배양액 1%(w/w)를 처리하고 24시간 동안 추가 배양하였다. 양성 대조군으로는 에피갈로카테킨 갈레이트(Epigallocatechin gallate, EGCG) 1 uM을 사용하였으며, 음성 대조군으로 자외선 처리 및 균주 배양액 비처리군을 사용하였다.
1-2. 유전자 발현 수준 분석
배양체를 회수하여 트리졸(RNA iso, DAKARA, 일본) 1 ㎖을 첨가하여 RNA를 분리하고, Nanodrop 2000 (Thermo, USA)를 이용해 RNA를 정량한 후, 42℃에서 55분, 70℃에서 15분 동안 반응시켜 cDNA를 합성하였다(Reverse Transcriptase Mix, ELPIS biotech, 한국). RT-PCR은 Step One Plus(Applied Biosystems, 미국)를 이용하였고, 사이버그린(SYBR Green supermix, Applied Biosystems, 미국)을 프라이머(MMP-1용 프라이머 또는 COL1A1용 프라이머) 및 cDNA와 함께 첨가하여 94℃에서 5분 동안 중합효소를 활성화한 후, 95℃ 30초, 54℃ 1분, 72℃ 1분간 40초 사이클로 중합반응하였다. 유전자의 발현량은 β-actin 유전자에 대한 보정을 통해 최종적으로 분석하였다.
실험방법 2. 피부 보습, 피부 장벽 강화 효능 확인
상기 균주 배양액의 피부 보습, 피부 장벽 강화 효능을 확인하기 위해, HAS3, AQP3, 필라그린, 및 ABCA12의 발현 수준을 분석하였다.
HAS3(Hyaluronan synthase 3), AQP3(Aquaporin 3), 필라그린(Filaggrin), 및 ABCA12(ATP-binding cassette sub-family A member 12)는 피부 보습 및 피부 장벽 강화와 관련된 인자이다.
2-1. 세포배양 및 시료 처리
인간 각질형성 세포주(human keratinocyte)인 HaCaT 세포를 10% 우혈청(fetal bovin serum)을 포함한 DMEM 배지(Dulbecco's modified Eagle's Medium, Gibco 1210-0038)에서 배양하였고, 배양은 모두 37℃, 5% CO2 배양기에서 수행하였다. 상기 배양된 세포주에 균주 배양액 1%(w/w)를 처리하고 24시간 동안 추가 배양하였다. 양성 대조군으로는 레티노산(Retinoic acid, RA) 1 uM을 사용하였다.
2-2. 유전자 발현 수준 분석
HAS3용 프라이머, AQP3용 프라이머, 필라그린용 프라이머, 또는 ABCA12용 프라이머를 사용한 것을 제외하고는 상기 실험방법 1-2와 동일한 방법으로 유전자 발현량을 분석하였다.
실험방법 3. 피부 미백 효능 확인
멜라닌 분비가 억제되어 멜라닌 함량이 감소하면 피부 미백 효과를 나타낼 수 있다. 또한, 멜라닌 생성이 억제되어 멜라닌 함량이 감소하면 피부 미백 효과를 나타낼 수 있다.
3-1. 세포배양 및 시료 처리
마우스의 색소 세포인 B16-F10(Murine Melanoma) 세포(ATCC)를 10% FBS를 포함하는 DMEM 배지(Dulbecco's modified Eagle's Medium, Gibco 1210-0038) 2 ㎖에 현탁시켜 1 x 105 세포/웰로 6-웰 플레이트에 접종하였다. 그 다음, 상기 세포가 웰 바닥에 40~50% 부착될 때까지 37℃, 5% CO2 배양기에서 24시간 동안 배양하였다. 이후, α-MSH를 100 nM 농도로 처리하여 멜라닌 생성을 유도하였다. 다음으로 상기 균주 배양액 1%(w/w)를 처리하여 3일 동안 추가 배양하였다.
한편, 미생물 배지에 대한 영향을 확인하기 위해 대조군으로 배양 배지(culture medium) 1%(w/w)를 처리하여 3일 동안 추가 배양하였다. 양성대조군으로는 알부틴(100 ppm, Sigma aldrich)을 사용하였다.
3-2. 멜라닌 분비 억제능 평가
상기 실험방법 3-1의 배양액을 회수하여 1,000 rpm에서 10분간 원심분리하여 상등액을 얻었다. 상등액에 대해 마이크로플레이트 리더(Microlpate reader, Victor 3)를 사용하여 490 ㎚에서 흡광도를 3회 측정하여 멜라닌 분비 억제능을 평가하였다. 멜라닌 분비 억제능은 하기 계산식 1에 의해 멜라닌 함량을 계산함으로써 평가하였다.
[계산식 1]
멜라닌 함량(Extracellular melanin contents, %)=(각 시료 처리군의 평균 흡광도)/(α-MSH 처리군의 평균 흡광도) x 100(%)
3-3. 멜라닌 생성 억제능 평가
상기 실험방법 3-1의 배양액을 인산완충생리식염수(PBS: phosphate buffered saline, WELGENE)로 세척하고, 트립신(trypsin, Gibco)으로 회수하였다. 그 다음, 혈구계(hematocytometer, MARIENFELD)로 계수하여, 각 처리 그룹별로 동일한 세포 수(1Х106 세포/mL)를 모아 1000 rpm에서 10 분간 원심분리하여 세포만 얻었다. 회수된 세포를 60℃에서 1시간 건조시킨 후, 10% DMSO가 포함된 1M NaOH 용액(Sigma aldrich) 100 μL를 넣어 세포 내의 멜라닌을 포함하는 용액을 얻었다. 이 용액을 마이크로플레이트 리더(Microplate reader, victor3)를 이용하여 490 nm에서 흡광도를 측정하여, 멜라닌 생성 저해율을 평가하였다. 멜라닌 생성 저해율은 상기 계산식 1에 의해 멜라닌 함량을 계산함으로써 평가하였다.
상기 실험방법들에서 사용된 프라이머 정보를 하기 표 2에 나타내었다.
타겟 유전자 방향 서열(5'→3') 서열번호
MMP-1 정방향 AAGCGTGTGACAGTAAGCTA 34
역방향 AACCGGACTTCATCTCTG 35
COL1A1 정방향 GAGGGCCAAGACGAAGACATC 36
역방향 CAGATCACGTCATCGCACAAC 37
HAS3 정방향 AGCACCTTCTCGTGCATCATGC 38
역방향 TCCTCCAGGACTCGAAGCATCT 39
AQP3 정방향 GTCACTCTGGGCATCCTCAT 40
역방향 CTATTCCAGCACCCAAGAAGG 41
필라그린 정방향 GCTGAAGGAACTTCTGGAAAAGG 42
역방향 GTTGTGGTCTATATCCAAGTGATC 43
ABCA12 정방향 ACAGGAATGGCCTTCATCAC 44
역방향 AACATGGTGCCCTGAGAAAC 45
β-actin 정방향 GGCCATCTCTTGCTCGAAGT 46
역방향 GAGACCTTCAACACCCCAGC 47
[실험결과]
실험예 1. YJ-No2 균주의 피부 상태 개선 효과
도 1에 나타낸 바와 같이, 스타필로코커스 캐피티스 아종 캐피티스 YJ-No2 균주는 자외선 조사에 의하여 증가된 MMP-1의 발현을 감소시킴을 확인하였다.
따라서, YJ-No2 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진 효과를 가짐을 알 수 있었다.
실험예 2. YM3 균주의 피부 상태 개선 효과
도 2A 및 도 2B에 나타낸 바와 같이, 스타필로코커스 캐피티스 아종 유레알리티쿠스 YM3 균주는 자외선 조사에 의하여 증가된 MMP-1의 발현을 감소시킴을 확인하였다. 또한, YM3 균주는 HAS3의 발현을 증가시킴을 확인하였다.
따라서, YM3 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 3. CM6 균주의 피부 상태 개선 효과
도 3A 및 도 3B에 나타낸 바와 같이, 코리네박테리움 디프테리아 CM6 균주는 HAS3 및 AQP3의 발현을 증가시킴을 확인하였다.
따라서, CM6 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 4. CM5 균주의 피부 상태 개선 효과
도 4A 및 도 4B에 나타낸 바와 같이, 나이세리아 서브플라바 CM5 균주는 필라그린 및 ABCA12의 발현을 증가시킴을 확인하였다.
따라서, CM5 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 5. CM4 균주의 피부 상태 개선 효과
도 5A, 도 5B, 및 도 5C에 나타낸 바와 같이, 스타필로코커스 루그두넨시스 CM4 균주는 자외선 조사에 의하여 증가된 MMP-1의 발현을 감소시킴을 확인하였다. 또한, CM4 균주는 HAS3 및 AQP3의 발현을 증가시킴을 확인하였다.
따라서, CM4 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 6. CM3 균주의 피부 상태 개선 효과
도 6A 및 도 6B에 나타낸 바와 같이, 스타필로코커스 호미니스 CM3 균주는 자외선 조사에 의하여 증가된 MMP-1의 발현을 감소시킴을 확인하였다. 또한, CM3 균주는 AQP3의 발현을 증가시킴을 확인하였다.
따라서, CM3 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 7. CM2 균주의 피부 상태 개선 효과
도 7A 및 도 7B에 나타낸 바와 같이, 스타필로코커스 코흐니 CM2 균주는 자외선 조사에 의하여 증가된 MMP-1의 발현을 감소시킴을 확인하였다. 또한, CM2 균주는 HAS3의 발현을 증가시킴을 확인하였다.
따라서, CM2 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 8. CM1 균주의 피부 상태 개선 효과
도 8A 및 도 8B에 나타낸 바와 같이, 스타필로코커스 아우리큘라리스 CM1 균주는 자외선 조사에 의하여 증가된 MMP-1의 발현을 감소시킴을 확인하였다. 또한, CM1 균주는 HAS3의 발현을 증가시킴을 확인하였다.
따라서, CM1 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 9. CX105 균주의 피부 상태 개선 효과
도 9에 나타낸 바와 같이, 스트렙토코커스 이퀴너스 CX105 균주는 COL1A1의 발현을 증가시킴을 확인하였다.
따라서, CX105 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진 효과를 가짐을 알 수 있었다.
실험예 10. CX106 균주의 피부 상태 개선 효과
도 10에 나타낸 바와 같이, 스트렙토코커스 엔지노서스 CX106 균주는 필라그린의 발현을 증가시킴을 확인하였다.
따라서, CX106 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 11. CX107 균주의 피부 상태 개선 효과
도 11에 나타낸 바와 같이, 스트렙토코커스 슈도뉴모니에 CX107 균주는 AQP3의 발현을 증가시킴을 확인하였다.
따라서, CX107 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 12. CX108 균주의 피부 상태 개선 효과
도 12에 나타낸 바와 같이, 스트렙토코커스 뮤탄스 CX108 균주는 AQP3의 발현을 증가시킴을 확인하였다.
따라서, CX108 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 13. YM-41 균주의 피부 상태 개선 효과
도 13에 나타낸 바와 같이, 큐티박테리움 아비둠 YM-41 균주는 필라그린의 발현을 증가시킴을 확인하였다.
따라서, YM-41 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 14. CX101 균주의 피부 상태 개선 효과
도 14A 및 도 14B에 나타낸 바와 같이, 스트렙토코커스 루테티엔시스 CX101 균주는 HAS3 및 AQP3의 발현을 증가시킴을 확인하였다.
따라서, CX101 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 15. CX102 균주의 피부 상태 개선 효과
도 15A 및 도 15B에 나타낸 바와 같이, 스트렙토코커스 오우스트랄리스 CX102 균주는 HAS3 및 AQP3의 발현을 증가시킴을 확인하였다.
따라서, CX102 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 16. CX103 균주의 피부 상태 개선 효과
도 16에 나타낸 바와 같이, 스트렙토코커스 할리코에리 CX103 균주는 HAS3의 발현을 증가시킴을 확인하였다.
따라서, CX103 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 17. CX104 균주의 피부 상태 개선 효과
도 17에 나타낸 바와 같이, 스트렙토코커스 마실리엔시스 CX104 균주는 자외선 조사에 의하여 증가된 MMP-1의 발현을 감소시킴을 확인하였다.
따라서, CX104 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진 효과를 가짐을 알 수 있었다.
실험예 18. CD18 균주의 피부 상태 개선 효과
도 18에 나타낸 바와 같이, 코리네박테리움 두룸 CD18 균주는 멜라닌 분비를 감소 또는 억제시킴을 확인하였다.
따라서, CD18 균주는 피부 미백 효과를 가짐을 알 수 있었다.
실험예 19. CG19 균주의 피부 상태 개선 효과
도 19에 나타낸 바와 같이, 코리네박테리움 글루쿠로노리티쿰 CG19 균주는 멜라닌 분비를 감소 또는 억제시킴을 확인하였다.
따라서, CG19 균주는 피부 미백 효과를 가짐을 알 수 있었다.
실험예 20. CP33 균주의 피부 상태 개선 효과
도 20에 나타낸 바와 같이, 코리네박테리움 프로핀큠 CP33 균주는 멜라닌 분비를 감소 또는 억제시킴을 확인하였다.
따라서, CP33 균주는 피부 미백 효과를 가짐을 알 수 있었다.
실험예 21. CS96 균주의 피부 상태 개선 효과
도 21A 및 도 21B에 나타낸 바와 같이, 코리네박테리움 스트리아툼 CS96 균주는 멜라닌 분비를 감소 또는 억제시킬뿐만 아니라 멜라닌 생성을 감소 또는 억제시킴을 확인하였다.
따라서, CS96 균주는 피부 미백 효과를 가짐을 알 수 있었다.
실험예 22. CX1 균주의 피부 상태 개선 효과
도 22A 및 도 22B에 나타낸 바와 같이, 코리네박테리움 제로시스 CX1 균주는 멜라닌 분비를 감소 또는 억제시킬뿐만 아니라 멜라닌 생성을 감소 또는 억제시킴을 확인하였다.
따라서, CX1 균주는 피부 미백 효과를 가짐을 알 수 있었다.
실험예 23. SP06 균주의 피부 상태 개선 효과
도 23에 나타낸 바와 같이, 스트렙토코커스 파라상귀니스 SP06 균주는 필라그린의 발현을 증가시킴을 확인하였다.
따라서, SP06 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 24. YM-11 균주의 피부 상태 개선 효과
도 24에 나타낸 바와 같이, 스트렙토코커스 도우니 YM-11 균주는 필라그린의 발현을 증가시킴을 확인하였다.
따라서, YM-11 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 25. YM-15 균주의 피부 상태 개선 효과
도 25에 나타낸 바와 같이, 스트렙토코커스 룹네리 YM-15 균주는 필라그린의 발현을 증가시킴을 확인하였다.
따라서, YM-15 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 26. YM-19 균주의 피부 상태 개선 효과
도 26에 나타낸 바와 같이, 스트렙토코커스 베스티불라리스 YM-19 균주는 자외선 조사에 의하여 증가된 MMP-1의 발현을 감소시킴을 확인하였다.
따라서, YM-19 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진 효과를 가짐을 알 수 있었다.
실험예 27. YM-17 균주의 피부 상태 개선 효과
도 27에 나타낸 바와 같이, 스트렙토코커스 상귀니스 YM-17 균주는 COL1A1의 발현을 증가시킴을 확인하였다.
따라서, YM-17 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진 효과를 가짐을 알 수 있었다.
실험예 28. YM-18 균주의 피부 상태 개선 효과
도 28에 나타낸 바와 같이, 스트렙토코커스 소브리너스 YM-18 균주는 자외선 조사에 의하여 증가된 MMP-1의 발현을 감소시킴을 확인하였다. 또한, YM-18 균주는 HAS3의 발현을 증가시킴을 확인하였다.
따라서, YM-18 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 29. YM-13 균주의 피부 상태 개선 효과
도 29에 나타낸 바와 같이, 스트렙토코커스 오랄리스 YM-13 균주는 필라그린의 발현을 증가시킴을 확인하였다.
따라서, YM-13 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
실험예 30. YM-12 균주의 피부 상태 개선 효과
도 30에 나타낸 바와 같이, 스트렙토코커스 인터메디어스 YM-12 균주는 자외선 조사에 의하여 증가된 MMP-1의 발현을 감소시킴을 확인하였다.
따라서, YM-12 균주는 피부 노화(예를 들면, 광노화) 방지, 피부 주름 개선, 피부 탄력 증진 효과를 가짐을 알 수 있었다.
실험예 31. YM-14 균주의 피부 상태 개선 효과
도 31에 나타낸 바와 같이, 스트렙토코커스 파이오제네스 YM-14 균주는 HAS3의 발현을 증가시킴을 확인하였다.
따라서, YM-14 균주는 피부 보습, 피부 장벽 강화 효과를 가짐을 알 수 있었다.
Figure PCTKR2023007055-appb-img-000001
Figure PCTKR2023007055-appb-img-000002
Figure PCTKR2023007055-appb-img-000003
Figure PCTKR2023007055-appb-img-000004
Figure PCTKR2023007055-appb-img-000005
Figure PCTKR2023007055-appb-img-000006
Figure PCTKR2023007055-appb-img-000007
Figure PCTKR2023007055-appb-img-000008
Figure PCTKR2023007055-appb-img-000009
Figure PCTKR2023007055-appb-img-000010
Figure PCTKR2023007055-appb-img-000011
Figure PCTKR2023007055-appb-img-000012
Figure PCTKR2023007055-appb-img-000013
Figure PCTKR2023007055-appb-img-000014
Figure PCTKR2023007055-appb-img-000015
Figure PCTKR2023007055-appb-img-000016
Figure PCTKR2023007055-appb-img-000017
Figure PCTKR2023007055-appb-img-000018
Figure PCTKR2023007055-appb-img-000019
Figure PCTKR2023007055-appb-img-000020
Figure PCTKR2023007055-appb-img-000021
Figure PCTKR2023007055-appb-img-000022
Figure PCTKR2023007055-appb-img-000023
Figure PCTKR2023007055-appb-img-000024
Figure PCTKR2023007055-appb-img-000025
Figure PCTKR2023007055-appb-img-000026
Figure PCTKR2023007055-appb-img-000027
Figure PCTKR2023007055-appb-img-000028
Figure PCTKR2023007055-appb-img-000029
Figure PCTKR2023007055-appb-img-000030
Figure PCTKR2023007055-appb-img-000031

Claims (11)

  1. 하기 중 선택되는 균주:
    (1) 스타필로코커스 캐피티스 아종 캐피티스(Staphylococcus capitis subsp. capitis) 균주;
    (2) 스타필로코커스 캐피티스 아종 유레알리티쿠스(Staphylococcus capitis subsp. urealyticus) 균주;
    (3) 코리네박테리움 디프테리아(Corynebacterium diphtheriae) 균주;
    (4) 나이세리아 서브플라바(Neisseria subflava) 균주;
    (5) 스타필로코커스 루그두넨시스(Staphylococcus lugdunensis) 균주;
    (6) 스타필로코커스 호미니스(Staphylococcus hominis) 균주;
    (7) 스타필로코커스 코흐니(Staphylococcus cohnii) 균주;
    (8) 스타필로코커스 아우리큘라리스(Staphylococcus auricularis) 균주;
    (9) 스트렙토코커스 이퀴너스(Streptococcus equinus) 균주;
    (10) 스트렙토코커스 엔지노서스(Streptococcus anginosus) 균주;
    (11) 스트렙토코커스 슈도뉴모니에(Streptococcus pseudopneumoniae) 균주;
    (12) 스트렙토코커스 뮤탄스(Streptococcus mutans) 균주;
    (13) 큐티박테리움 아비둠(Cutibacterium avidum) 균주;
    (14) 스트렙토코커스 루테티엔시스(Streptococcus lutetiensis) 균주;
    (15) 스트렙토코커스 오우스트랄리스(Streptococcus australis) 균주;
    (16) 스트렙토코커스 할리코에리(Streptococcus halichoeri) 균주;
    (17) 스트렙토코커스 마실리엔시스(Streptococcus massiliensis) 균주;
    (18) 코리네박테리움 두룸(Corynebacterium durum) 균주;
    (19) 코리네박테리움 글루쿠로노리티쿰(Corynebacterium glucuronolyticum) 균주;
    (20) 코리네박테리움 프로핀큠(Corynebacterium propinquum) 균주;
    (21) 코리네박테리움 스트리아툼(Corynebacterium striatum) 균주;
    (22) 코리네박테리움 제로시스(Corynebacterium xerosis) 균주;
    (23) 스트렙토코커스 파라상귀니스(Streptococcus parasanguinis) 균주;
    (24) 스트렙토코커스 도우니(Streptococcus downii) 균주;
    (25) 스트렙토코커스 룹네리(Streptococcus rubneri) 균주;
    (26) 스트렙토코커스 베스티불라리스(Streptococcus vestibularis) 균주;
    (27) 스트렙토코커스 상귀니스(Streptococcus sanguinis) 균주;
    (28) 스트렙토코커스 소브리너스(Streptococcus sobrinus) 균주;
    (29) 스트렙토코커스 오랄리스(Streptococcus oralis) 균주;
    (30) 스트렙토코커스 인터메디어스(Streptococcus intermedius) 균주; 및
    (31) 스트렙토코커스 파이오제네스(Streptococcus pyogenes) 균주.
  2. 청구항 1에 있어서, 상기 균주는 하기 중 선택되는 것인 균주:
    기탁번호 KCCM13158P로 기탁된 균주 (1);
    기탁번호 KCCM13159P로 기탁된 균주 (2);
    기탁번호 KCCM13174P로 기탁된 균주 (3);
    기탁번호 KCCM13173P로 기탁된 균주 (4);
    기탁번호 KCCM13172P로 기탁된 균주 (5);
    기탁번호 KCCM13171P로 기탁된 균주 (6);
    기탁번호 KCCM13170P로 기탁된 균주 (7);
    기탁번호 KCCM13169P로 기탁된 균주 (8);
    기탁번호 KCCM13187P로 기탁된 균주 (9);
    기탁번호 KCCM13188P로 기탁된 균주 (10);
    기탁번호 KCCM13189P로 기탁된 균주 (11);
    기탁번호 KCCM13190P로 기탁된 균주 (12);
    기탁번호 KCCM13198P로 기탁된 균주 (13);
    기탁번호 KCCM13183P로 기탁된 균주 (14);
    기탁번호 KCCM13184P로 기탁된 균주 (15);
    기탁번호 KCCM13185P로 기탁된 균주 (16);
    기탁번호 KCCM13186P로 기탁된 균주 (17);
    기탁번호 KCCM13194P로 기탁된 균주 (18);
    기탁번호 KCCM13197P로 기탁된 균주 (19);
    기탁번호 KCCM13196P로 기탁된 균주 (20);
    기탁번호 KCCM13195P로 기탁된 균주 (21);
    기탁번호 KCCM13193P로 기탁된 균주 (22);
    기탁번호 KCCM13204P로 기탁된 균주 (23);
    기탁번호 KCCM13209P로 기탁된 균주 (24);
    기탁번호 KCCM13213P로 기탁된 균주 (25);
    기탁번호 KCCM13217P로 기탁된 균주 (26);
    기탁번호 KCCM13215P로 기탁된 균주 (27);
    기탁번호 KCCM13216P로 기탁된 균주 (28);
    기탁번호 KCCM13211P로 기탁된 균주 (29);
    기탁번호 KCCM13210P로 기탁된 균주 (30); 및
    기탁번호 KCCM13212P로 기탁된 균주 (31).
  3. 청구항 1에 있어서, 상기 균주는 하기 중 선택되는 것인 균주:
    서열번호 1과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (1);
    서열번호 2와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (2);
    서열번호 3과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (3);
    서열번호 4와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (4);
    서열번호 5와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (5);
    서열번호 6과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (6);
    서열번호 7과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (7);
    서열번호 8과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (8);
    서열번호 9와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (9);
    서열번호 10과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (10);
    서열번호 11과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (11);
    서열번호 12와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (12);
    서열번호 13과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (13);
    서열번호 14와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (14);
    서열번호 15와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (15);
    서열번호 16과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (16);
    서열번호 17과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (17);
    서열번호 18과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (18);
    서열번호 19와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (19);
    서열번호 20과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (20);
    서열번호 21과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (21);
    서열번호 22와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (22);
    서열번호 23과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (23);
    서열번호 24와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (24);
    서열번호 25와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (25);
    서열번호 26과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (26);
    서열번호 27과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (27);
    서열번호 28과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (28);
    서열번호 29와 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (29);
    서열번호 30과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (30); 및
    서열번호 31과 97% 내지 100%의 서열 동일성을 갖는 16S rRNA를 포함하는 균주 (31).
  4. 청구항 1에 있어서, 상기 균주는 하기 중 선택되는 것인 균주:
    MMP-1의 발현을 감소 또는 억제시키는 것인 균주 (1);
    MMP-1의 발현을 감소 또는 억제시키거나, 또는 HAS3의 발현을 증가시키는 것인 균주 (2);
    HAS3 및 AQP3 중 1종 이상의 발현을 증가시키는 것인 균주 (3);
    필라그린 및 ABCA12 중 1종 이상의 발현을 증가시키는 것인 균주 (4);
    MMP-1의 발현을 감소 또는 억제시키거나, 또는 HAS3 및 AQP3 중 1종 이상의 발현을 증가시키는 것인 균주 (5);
    MMP-1의 발현을 감소 또는 억제시키거나, 또는 AQP3의 발현을 증가시키는 것인 균주 (6);
    MMP-1의 발현을 감소 또는 억제시키거나, 또는 HAS3의 발현을 증가시키는 것인 균주 (7);
    MMP-1의 발현을 감소 또는 억제시키거나, 또는 HAS3의 발현을 증가시키는 것인 균주 (8);
    COL1A1의 발현을 증가시키는 것인 균주 (9);
    필라그린의 발현을 증가시키는 것인 균주 (10);
    AQP3의 발현을 증가시키는 것인 균주 (11);
    AQP3의 발현을 증가시키는 것인 균주 (12);
    필라그린의 발현을 증가시키는 것인 균주 (13);
    HAS3 및 AQP3 중 1종 이상의 발현을 증가시키는 것인 균주 (14);
    HAS3 및 AQP3 중 1종 이상의 발현을 증가시키는 것인 균주 (15);
    HAS3의 발현을 증가시키는 것인 균주 (16);
    MMP-1의 발현을 감소 또는 억제시키는 것인 균주 (17);
    멜라닌 분비를 감소 또는 억제시키는 것인 균주 (18);
    멜라닌 분비를 감소 또는 억제시키는 것인 균주 (19);
    멜라닌 분비를 감소 또는 억제시키는 것인 균주 (20);
    멜라닌 분비를 감소 또는 억제시키거나, 또는 멜라닌 생성을 감소 또는 억제시키는 것인 균주 (21);
    멜라닌 분비를 감소 또는 억제시키거나, 또는 멜라닌 생성을 감소 또는 억제시키는 것인 균주 (22);
    필라그린의 발현을 증가시키는 것인 균주 (23);
    필라그린의 발현을 증가시키는 것인 균주 (24);
    필라그린의 발현을 증가시키는 것인 균주 (25);
    MMP-1의 발현을 감소 또는 억제시키는 것인 균주 (26);
    COL1A1의 발현을 증가시키는 것인 균주 (27);
    균주는 MMP-1의 발현을 감소 또는 억제시키거나, 또는 HAS3의 발현을 증가시키는 것인 균주 (28);
    필라그린의 발현을 증가시키는 것인 균주 (29);
    MMP-1의 발현을 감소 또는 억제시키는 것인 균주 (30); 및
    HAS3의 발현을 증가시키는 것인 균주 (31).
  5. 청구항 1의 균주의 배양액.
  6. 청구항 1의 균주, 그의 파쇄액, 배양액, 배양액의 추출물 또는 이들의 혼합물을 포함하는 화장료 조성물.
  7. 청구항 6에 있어서, 피부 상태 개선용인 것인 화장료 조성물.
  8. 청구항 7에 있어서, 상기 피부 상태 개선은 항노화, 항주름, 피부 탄력 증진, 피부 보습, 피부 장벽 강화, 또는 피부 미백인 것인 화장료 조성물.
  9. 청구항 1의 균주, 그의 파쇄액, 배양액, 배양액의 추출물 또는 이들의 혼합물을 포함하는 피부외용제 조성물.
  10. 청구항 1의 균주, 그의 파쇄액, 배양액, 배양액의 추출물 또는 이들의 혼합물을 포함하는 식품 조성물.
  11. 피부 상태 개선용 조성물을 제조하는 데 사용하기 위한, 청구항 1의 균주, 그의 파쇄액, 배양액, 또는 배양액의 추출물의 용도.
PCT/KR2023/007055 2022-05-24 2023-05-24 피부 유래 균주 및 그의 피부 상태 개선 용도 WO2023229365A1 (ko)

Applications Claiming Priority (122)

Application Number Priority Date Filing Date Title
KR20220063595 2022-05-24
KR10-2022-0063440 2022-05-24
KR10-2022-0063595 2022-05-24
KR20220063440 2022-05-24
KR10-2022-0068522 2022-06-03
KR20220068518 2022-06-03
KR10-2022-0068519 2022-06-03
KR20220068521 2022-06-03
KR20220068520 2022-06-03
KR20220068522 2022-06-03
KR10-2022-0068518 2022-06-03
KR10-2022-0068521 2022-06-03
KR10-2022-0068523 2022-06-03
KR1020220068519A KR20230168063A (ko) 2022-06-03 2022-06-03 나이세리아 서브플라바 균주 및 그의 피부 상태 개선 용도
KR10-2022-0068520 2022-06-03
KR20220068523 2022-06-03
KR10-2022-0079287 2022-06-28
KR20220079287 2022-06-28
KR20220079285 2022-06-28
KR20220079288 2022-06-28
KR20220079284 2022-06-28
KR10-2022-0079289 2022-06-28
KR10-2022-0079285 2022-06-28
KR10-2022-0079286 2022-06-28
KR20220079286 2022-06-28
KR20220079289 2022-06-28
KR10-2022-0079284 2022-06-28
KR10-2022-0079288 2022-06-28
KR10-2022-0090597 2022-07-21
KR20220090601 2022-07-21
KR10-2022-0090598 2022-07-21
KR20220090602 2022-07-21
KR20220090606 2022-07-21
KR10-2022-0090600 2022-07-21
KR10-2022-0090603 2022-07-21
KR10-2022-0090602 2022-07-21
KR10-2022-0090601 2022-07-21
KR20220090599 2022-07-21
KR10-2022-0090596 2022-07-21
KR20220090597 2022-07-21
KR20220090598 2022-07-21
KR10-2022-0090606 2022-07-21
KR20220090600 2022-07-21
KR10-2022-0090599 2022-07-21
KR20220090603 2022-07-21
KR20220090596 2022-07-21
KR10-2022-0093385 2022-07-27
KR10-2022-0093389 2022-07-27
KR20220093381 2022-07-27
KR20220093382 2022-07-27
KR20220093387 2022-07-27
KR20220093389 2022-07-27
KR20220093386 2022-07-27
KR10-2022-0093381 2022-07-27
KR20220093383 2022-07-27
KR20220093385 2022-07-27
KR10-2022-0093388 2022-07-27
KR20220093388 2022-07-27
KR10-2022-0093382 2022-07-27
KR10-2022-0093386 2022-07-27
KR10-2022-0093383 2022-07-27
KR10-2022-0093387 2022-07-27
KR1020230064481A KR20240014021A (ko) 2022-07-21 2023-05-18 스트렙토코커스 뮤탄스 균주 및 그의 피부 상태 개선 용도
KR10-2023-0064478 2023-05-18
KR10-2023-0064491 2023-05-18
KR10-2023-0064492 2023-05-18
KR10-2023-0064487 2023-05-18
KR10-2023-0064482 2023-05-18
KR1020230064490A KR20230168266A (ko) 2022-06-03 2023-05-18 스타필로코커스 루그두넨시스 균주 및 그의 피부 상태 개선 용도
KR1020230064486A KR20240014026A (ko) 2022-07-21 2023-05-18 스트렙토코커스 마실리엔시스 균주 및 그의 피부 상태 개선 용도
KR10-2023-0064481 2023-05-18
KR1020230064489A KR20230168265A (ko) 2022-06-03 2023-05-18 코리네박테리움 디프테리아 균주 및 그의 피부 상태 개선 용도
KR10-2023-0064480 2023-05-18
KR10-2023-0064479 2023-05-18
KR1020230064485A KR20240014025A (ko) 2022-07-21 2023-05-18 스트렙토코커스 할리코에리 균주 및 그의 피부 상태 개선 용도
KR1020230064484A KR20240014024A (ko) 2022-07-21 2023-05-18 스트렙토코커스 오우스트랄리스 균주 및 그의 피부 상태 개선 용도
KR1020230064482A KR20240014022A (ko) 2022-07-21 2023-05-18 큐티박테리움 아비둠 균주 및 그의 피부 상태 개선 용도
KR1020230064478A KR20240014018A (ko) 2022-07-21 2023-05-18 스트렙토코커스 이퀴너스 균주 및 그의 피부 상태 개선 용도
KR1020230064491A KR102609656B1 (ko) 2022-06-03 2023-05-18 스타필로코커스 호미니스 균주 및 그의 피부 상태 개선 용도
KR10-2023-0064488 2023-05-18
KR10-2023-0064485 2023-05-18
KR10-2023-0064486 2023-05-18
KR1020230064488A KR20230164584A (ko) 2022-05-24 2023-05-18 스타필로코커스 캐피티스 아종 유레알리티쿠스 균주 및 그의 피부 상태 개선 용도
KR1020230064492A KR20230168267A (ko) 2022-06-03 2023-05-18 스타필로코커스 코흐니 균주 및 그의 피부 상태 개선 용도
KR10-2023-0064490 2023-05-18
KR10-2023-0064484 2023-05-18
KR10-2023-0064483 2023-05-18
KR1020230064479A KR20240014019A (ko) 2022-07-21 2023-05-18 스트렙토코커스 엔지노서스 균주 및 그의 피부 상태 개선 용도
KR1020230064483A KR20240014023A (ko) 2022-07-21 2023-05-18 스트렙토코커스 루테티엔시스 균주 및 그의 피부 상태 개선 용도
KR1020230064487A KR20230164583A (ko) 2022-05-24 2023-05-18 스타필로코커스 캐피티스 아종 캐피티스 균주 및 그의 피부 상태 개선 용도
KR1020230064480A KR20240014020A (ko) 2022-07-21 2023-05-18 스트렙토코커스 슈도뉴모니에 균주 및 그의 피부 상태 개선 용도
KR1020230064493A KR20230168268A (ko) 2022-06-03 2023-05-18 스타필로코커스 아우리큘라리스 균주 및 그의 피부 상태 개선 용도
KR10-2023-0064489 2023-05-18
KR10-2023-0064493 2023-05-18
KR10-2023-0065222 2023-05-19
KR10-2023-0065221 2023-05-19
KR1020230065222A KR20240002687A (ko) 2022-06-28 2023-05-19 코리네박테리움 스트리아툼 균주 및 그의 피부 상태 개선 용도
KR10-2023-0065226 2023-05-19
KR1020230065220A KR20240002685A (ko) 2022-06-28 2023-05-19 코리네박테리움 글루쿠로노리티쿰 균주 및 그의 피부 상태 개선 용도
KR10-2023-0065218 2023-05-19
KR10-2023-0065219 2023-05-19
KR10-2023-0065225 2023-05-19
KR1020230065218A KR20240016182A (ko) 2022-07-27 2023-05-19 스트렙토코커스 파이오제네스 균주 및 그의 피부 상태 개선 용도
KR1020230065224A KR20240002688A (ko) 2022-06-28 2023-05-19 스트렙토코커스 파라상귀니스 균주 및 그의 피부 상태 개선 용도
KR1020230065221A KR20240002686A (ko) 2022-06-28 2023-05-19 코리네박테리움 프로핀큠 균주 및 그의 피부 상태 개선 용도
KR10-2023-0065214 2023-05-19
KR1020230065215A KR20240016180A (ko) 2022-07-27 2023-05-19 스트렙토코커스 상귀니스 균주 및 그의 피부 상태 개선 용도
KR10-2023-0065224 2023-05-19
KR1020230065223A KR102609657B1 (ko) 2022-06-28 2023-05-19 코리네박테리움 제로시스 균주 및 그의 피부 상태 개선 용도
KR10-2023-0065223 2023-05-19
KR1020230065214A KR20240016179A (ko) 2022-07-27 2023-05-19 스트렙토코커스 베스티불라리스 균주 및 그의 피부 상태 개선 용도
KR10-2023-0065216 2023-05-19
KR1020230065219A KR20240002684A (ko) 2022-06-28 2023-05-19 코리네박테리움 두룸 균주 및 그의 피부 상태 개선 용도
KR1020230065226A KR20240016184A (ko) 2022-07-27 2023-05-19 스트렙토코커스 룹네리 균주 및 그의 피부 상태 개선 용도
KR10-2023-0065220 2023-05-19
KR1020230065216A KR102609655B1 (ko) 2022-07-27 2023-05-19 스트렙토코커스 소브리너스 균주 및 그의 피부 상태 개선 용도
KR1020230065227A KR20240016185A (ko) 2022-07-27 2023-05-19 스트렙토코커스 오랄리스 균주 및 그의 피부 상태 개선 용도
KR10-2023-0065215 2023-05-19
KR1020230065217A KR20240016181A (ko) 2022-07-27 2023-05-19 스트렙토코커스 인터메디어스 균주 및 그의 피부 상태 개선 용도
KR10-2023-0065227 2023-05-19
KR1020230065225A KR20240016183A (ko) 2022-07-27 2023-05-19 스트렙토코커스 도우니 균주 및 그의 피부 상태 개선 용도
KR10-2023-0065217 2023-05-19

Publications (1)

Publication Number Publication Date
WO2023229365A1 true WO2023229365A1 (ko) 2023-11-30

Family

ID=88919746

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/007055 WO2023229365A1 (ko) 2022-05-24 2023-05-24 피부 유래 균주 및 그의 피부 상태 개선 용도

Country Status (1)

Country Link
WO (1) WO2023229365A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101925135B1 (ko) * 2018-08-23 2018-12-04 주식회사 지놈앤컴퍼니 신규의 큐티박테리움 아비덤 균주, 및 이러한 균주 또는 이의 배양물을 포함하는 아토피 피부염 예방 또는 치료용 조성물
JP2021001133A (ja) * 2019-06-21 2021-01-07 ポーラ化成工業株式会社 スタフィロコッカス・ホミニス（Ｓｔａｐｈｙｌｏｃｏｃｃｕｓ ｈｏｍｉｎｉｓ）を有効成分とする肌状態改善剤

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101925135B1 (ko) * 2018-08-23 2018-12-04 주식회사 지놈앤컴퍼니 신규의 큐티박테리움 아비덤 균주, 및 이러한 균주 또는 이의 배양물을 포함하는 아토피 피부염 예방 또는 치료용 조성물
JP2021001133A (ja) * 2019-06-21 2021-01-07 ポーラ化成工業株式会社 スタフィロコッカス・ホミニス（Ｓｔａｐｈｙｌｏｃｏｃｃｕｓ ｈｏｍｉｎｉｓ）を有効成分とする肌状態改善剤

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE Nucleotide 13 November 2015 (2015-11-13), ANONYMOUS : "Streptococcus sobrinus gene for 16S ribosomal RNA, partial sequence, strain: JCM 5176", XP093111944, retrieved from NCBI Database accession no. LC096204.1 *
DATABASE Nucleotide 2 March 2019 (2019-03-02), ANONYMOUS : "Staphylococcus hominis subsp. novobiosepticus strain FCu1 16S ribosoma RNA gene, partial sequence ", XP093111942, retrieved from NCBI Database accession no. MK560019.1 *
DATABASE Nucleotide 24 May 2020 (2020-05-24), ANONYMOUS : "Corynebacterium xerosis strain BP10 16S ribosomal RNA gene, partial sequence", XP093111943, retrieved from NCBI Database accession no. MT482629.1 *

Similar Documents

Publication Publication Date Title
WO2018124508A1 (ko) 3,5-디카페오일퀴닉에시드 또는 국화 추출물을 함유하는 근육 질환 예방 및 치료용 또는 근 기능 개선용 조성물
WO2021221405A1 (ko) 식물 추출물을 유효성분으로 포함하는 기능성 화장료 조성물 및 이의 제조방법
WO2016076520A1 (ko) 신규 유사세라마이드 화합물 및 이를 포함하는 피부 외용제 조성물 {novel pseudoceramide compound and skin topical composition comprising it}
WO2021137677A1 (ko) 식물 추출물을 함유하는 조성물
WO2018004224A2 (ko) 신규 스포리치아과 미생물 및 그의 용도
WO2020235932A1 (ko) 신규한 펩타이드 화합물 또는 이의 약제학적으로 허용 가능한 염
WO2019221513A1 (ko) 신규한 브롬화 퓨라논 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 약학적 조성물
WO2017123066A1 (ko) Pgc-1알파의 발현을 증가시키는 조성물
WO2014027832A1 (ko) 대장염 예방 또는 치료용 조성물
WO2023229365A1 (ko) 피부 유래 균주 및 그의 피부 상태 개선 용도
WO2023075431A1 (ko) 큐티박테리움 속 균주를 포함하는 염증성 피부질환의 예방 또는 개선용 화장료 조성물
WO2021235713A1 (ko) 유산균을 함유하는 미세먼지 자극에 의한 호흡기 질환 또는 염증 질환 치료용 조성물
WO2018186643A1 (ko) 신코닌 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2018186644A1 (ko) 자스몬 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2014168433A2 (ko) 발모 및 흰머리 멜라닌 색소 재생과 피부 재생 촉진용 물질 조성물
WO2019059668A2 (ko) 유산균의 유크림 발효액을 유효성분으로 포함하는 피부용 조성물
WO2020085826A1 (ko) 육두구 추출물 또는 메이스리그난을 유효성분으로 함유하는 환경오염인자로부터 유도되는 피부자극 완화 및 피부보호용 조성물
WO2017119756A1 (ko) 주름개선, 노화방지, 미백, 항염증 기능성 신규 펩티드 및 이를 포함하는 조성물
WO2018186639A1 (ko) 요놀 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2020050462A1 (ko) 결명 새싹 유래 나프토파이론 유도체를 포함하는 신경세포 보호용 조성물
WO2021006511A1 (ko) 저색소 질환의 예방 또는 치료용 조성물
WO2023075430A1 (ko) 큐티박테리움 속 균주를 포함하는 염증성 피부질환의 예방, 개선, 또는 치료용 조성물
WO2024085700A1 (ko) 고려엉겅퀴, 냉이 또는 삼백초 추출물을 유효성분으로 함유하는 심근 손상의 개선, 예방 또는 치료용 조성물
WO2020218890A1 (ko) 개다래 추출물을 포함하는 피부 손상 개선용 또는 피부 보습용 조성물
WO2023113431A1 (ko) 신규한 균주 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23812139

Country of ref document: EP

Kind code of ref document: A1