WO2023200256A1 - Il-32쎄타 뮤턴트를 포함하는 조성물 내지 이의 용도 - Google Patents

Il-32쎄타 뮤턴트를 포함하는 조성물 내지 이의 용도 Download PDF

Info

Publication number
WO2023200256A1
WO2023200256A1 PCT/KR2023/004968 KR2023004968W WO2023200256A1 WO 2023200256 A1 WO2023200256 A1 WO 2023200256A1 KR 2023004968 W KR2023004968 W KR 2023004968W WO 2023200256 A1 WO2023200256 A1 WO 2023200256A1
Authority
WO
WIPO (PCT)
Prior art keywords
mutant
cancer
cells
interleukin
seq
Prior art date
Application number
PCT/KR2023/004968
Other languages
English (en)
French (fr)
Inventor
윤도영
박효민
박재영
Original Assignee
건국대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 건국대학교 산학협력단 filed Critical 건국대학교 산학협력단
Publication of WO2023200256A1 publication Critical patent/WO2023200256A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating cancer and/or inflammatory diseases, including IL-32 ⁇ mutant, and its use.
  • IL-32 previously known as NK4, is expressed on activated human T cells and NK cells after stimulation with mitogens or IL-2.
  • NK4 induces pro-inflammatory cytokines such as IL-8, TNF- ⁇ , and MIP-2 in several immune cells through classical cytokine signaling pathways, but lacks sequence homology with other cytokines. showed. Therefore, its name was changed to IL-32, a member of the interleukin family. Numerous studies have reported that IL-32 is associated with cancer growth and development, viral infections, and chronic inflammatory diseases such as Crohn's disease, inflammatory bowel disease, and rheumatoid arthritis, indicating the ability of IL-32 to function as a cytokine.
  • the IL-32 gene contains eight exons and has several splice variants with different structures.
  • IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ and IL-32 ⁇ were first discovered in NK cells, and IL-32 ⁇ has the longest sequence among IL-32 isoforms.
  • IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ , and IL-32sm were additionally identified, and a total of 9 isoforms were reported.
  • Early studies on IL-32 suggest that it is a proinflammatory cytokine. However, further study of individual isoforms shows that they play different roles.
  • IL-32 ⁇ one of the IL-32 isoforms, is the only isoform other than IL-32sm with exon 6 deleted. Previous studies on IL-32 ⁇ were limited to overexpression, and its specific receptor was not clearly identified. IL-32 ⁇ and IL-32 ⁇ have been reported to bind to integrin ⁇ V ⁇ 3 and integrin ⁇ V ⁇ 6.
  • breast cancer is one of the most prevalent cancers worldwide (11.7% of all deaths) and a leading cause of death (6.9% of all deaths). It is the most frequently diagnosed cancer in women (24.5%) and was one of the leading causes of cancer-related deaths (15.5%) in 2020. While the global incidence of breast cancer increased rapidly in the 1980s and 1990s, the incidence decreased in the early 2000s due to advances in menopausal hormone therapy. However, breast cancer subtypes are identified by the absence or presence of three types of receptors: estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2. Because these receptors are expressed on the surface of breast cancer cells, triple-negative breast cancer (TNBC) reduces the success of hormonal therapy, indicating the need to develop alternative treatment strategies.
  • TNBC triple-negative breast cancer
  • TAMs tumor-associated macrophages
  • TAMs tumor-associated macrophages
  • Tumor-infiltrating immune cells stimulate several inflammatory molecules in cancer. Since its discovery as an inflammatory cytokine in 2005, several isoforms of IL-32 have been shown to play different non-canonical roles in various cancers and inflammatory and immune diseases, such as allergies, obesity, and brain diseases.
  • IL-32 ⁇ a new isoform
  • EMT epithelial-mesenchymal transition
  • Cardiovascular disease is a leading cause of death worldwide, causing 16.7 million deaths each year, and it is predicted that 23.6 million people will die from CVD each year by 2030.
  • Coronary artery disease (CAD) and cerebrovascular disease the most common form of coronary artery disease, are recognized as a social problem beyond individual health.
  • Atherosclerosis a chronic inflammatory disease, was identified as the root cause. Atherosclerosis is caused by inflammation and damage to endothelial cells and accumulation of oxidized low-density lipoprotein (ox-LDL), and is characterized by fibrosis of surrounding tissues and the formation of plaques composed of vascular endothelial cells, smooth muscle cells, and foam cells. Known as lipid-laden macrophages.
  • TEM trans-endothelial migration
  • IMM-1 ⁇ and TNF- ⁇ inflammatory cytokines
  • VCAM-1 vascular cell adhesion molecule-1
  • cell adhesion molecules such as Free-floating and blood monocytes adjacent to the vascular endothelium are captured by ICAM-1 and VCAM-1 expressed on endothelial cells. These adhesion molecules promote monocyte-endothelial adhesion through their respective interactions with lymphocyte function-related antigen 1 (LFA-1) and very late antigen-4 (VLA-4) expressed on monocytes, ultimately promoting TEM. Monocytes passing through the vascular endothelium differentiate into macrophages, and the macrophages generate foam cells through uptake of ox-LDL, ultimately leading to the pathogenesis of atherosclerosis and plaque development. Previous studies have reported that IL-32 ⁇ and IL-32 ⁇ act as proinflammatory cytokines involved in the upregulation of ICAM-1 and VCAM-1. However, the function of IL-32 ⁇ or its mutations in CVD is still unknown.
  • Patent Document 1 KR 10-2019-0118813 (2019-09-26)
  • the present inventors have made diligent efforts to provide a cytokine that can effectively suppress cancer and/or inflammatory diseases.
  • the IL-32 theta mutant of the present invention suppresses inflammatory responses and inhibits cancer and/or inflammatory diseases through immune action. It was confirmed that the disease could be suppressed and the present invention was completed.
  • an object of the present invention is to provide a pharmaceutical composition containing interleukin-32theta mutant (IL-32 ⁇ mutant) for preventing or treating cancer and/or inflammatory diseases, as well as its use.
  • IL-32 ⁇ mutant interleukin-32theta mutant
  • the present invention relates to a pharmaceutical composition for preventing or treating cancer containing interleukin-32theta mutant (IL-32 ⁇ mutant).
  • the interleukin-32 theta mutant contains the amino acid sequence of SEQ ID NO: 1.
  • the interleukin-32 theta mutant is encoded by the base sequence of SEQ ID NO: 2.
  • the interleukin-32 theta mutant is encoded by the base sequence of SEQ ID NO: 3.
  • the cancer is any one or more selected from the group consisting of stomach cancer, lung cancer, liver cancer, pancreatic cancer, colon cancer, prostate cancer, and breast cancer.
  • the present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases containing interleukin-32theta mutant (IL-32 ⁇ mutant).
  • the inflammatory diseases include arthritis, rheumatoid joints, gout, hepatitis, asthma, keratitis, gastritis, enteritis, nephritis, tuberculosis, bronchitis, pleurisy, peritonitis, spondylitis, pancreatitis, inflammatory pain, urethritis, It is one or more selected from the group consisting of cystitis, arteriosclerosis, sepsis, dermatitis, periodontitis, and gingivitis.
  • the present invention provides an immunotherapy composition for anticancer containing interleukin-32theta mutant (IL-32 ⁇ mutant).
  • the present invention provides an anti-inflammatory immunotherapy composition containing interleukin-32theta mutant (IL-32 ⁇ mutant).
  • the present invention provides a recombinant vector for expressing interleukin-32theta mutant (IL-32 ⁇ mutant) containing the base sequence of SEQ ID NO: 3.
  • the present invention provides the use of interleukin-32theta mutant (IL-32 ⁇ mutant) for use in cancer treatment.
  • the present invention provides the use of interleukin-32theta mutant (IL-32 ⁇ mutant) for use in treating inflammatory diseases.
  • IL-32 ⁇ mutant interleukin-32theta mutant
  • the present invention provides a cancer treatment method comprising administering a composition containing interleukin-32theta mutant (IL-32 ⁇ mutant) to a cancer patient.
  • a cancer treatment method comprising administering a composition containing interleukin-32theta mutant (IL-32 ⁇ mutant) to a cancer patient.
  • the present invention provides a method of treating inflammatory disease comprising administering a composition containing interleukin-32theta mutant (IL-32 ⁇ mutant) to a patient with inflammatory disease.
  • IL-32 ⁇ mutant interleukin-32theta mutant
  • IL-1 ⁇ , IL-8, COX-2 inflammatory factors
  • vimentin, N-cadherin mesenchymal markers
  • PCNA proliferation-related factors
  • Inflammation is an immune system response to harmful stimuli, including bacterial and viral infections. However, many diseases are caused by inflammation. Various inflammatory factors have been found to promote tumor formation. IL-1 ⁇ is a major cytokine of the IL-1 family that initiates tumor proliferation, angiogenesis, and migration in breast cancer. IL-6 is a functional cytokine involved in inflammatory responses, angiogenesis, inhibition of apoptosis, cancer stem cell formation, and migration of breast cancer. Likewise, IL-8 is associated with angiogenesis, tumor growth, proliferation, and metastasis. COX-2 induces the conversion of arachidonic acid into prostaglandin H2 (PGH2), the precursor of prostaglandin E2 (PGE2).
  • PSH2 prostaglandin H2
  • PGE2 prostaglandin E2
  • PGE2 is involved in tumorigenesis, tumor progression, angiogenesis and migration of breast cancer.
  • the transcription factor NF- ⁇ B has been reported to induce inflammatory factors such as IL-1 ⁇ , IL-6, IL-8, and COX-2.
  • I ⁇ B ⁇ is an NF- ⁇ B binding protein that regulates NF- ⁇ B translocation through protein-protein interactions. Nuclear translocation of NF- ⁇ B is triggered by degradation of I ⁇ B ⁇ through AKT phosphorylation.
  • MDA-MB-231 a highly aggressive triple-negative breast cancer cell line, was selected. RT-qPCR analysis showed that the mRNA levels of inflammatory factors were suppressed by IL-32 ⁇ (281T) in MDA-MB-231 cells ( Figure 4B).
  • EMT is a transition step regulated and determined by various proteins.
  • Mesenchymal cells express high levels of vimentin and fibronectin, which are associated with the cytoskeleton.
  • intercellular adhesion mediators (E-cadherin, N-cadherin) are essential proteins in determining epithelial and mesenchymal types. These factors are regulated by inflammatory factors through several signaling pathways.
  • the present inventors investigated whether IL-32 ⁇ (281T) can regulate the migration of breast cancer cells. Compared with EV transfected cells, migration speed was significantly reduced in IL-32 ⁇ (281T)-expressing breast cancer cells ( Figures 6A, 6B).
  • ⁇ -Catenin nuclear translocation of ⁇ -catenin induces transcription of mesenchymal and inflammatory factors in cancer.
  • ⁇ -Catenin degradation and translocation is regulated by interaction with glycogen synthase kinase 3 ⁇ (GSK3 ⁇ ).
  • the FAK/PI3K/AKT pathway induces the degradation of GSK3 ⁇ through phosphorylation. Additionally, it has been reported that the FAK pathway is regulated by IL-32 through protein-protein interactions.
  • Western blot analysis showed that FAK expression and phosphorylation were reduced by IL-32 ⁇ (281T). Additionally, phosphorylation of PI3K and AKT was inhibited by IL-32 ⁇ (281T) through FAK inhibition. Finally, the degradation of ⁇ -catenin was increased by IL-32 ⁇ (281T) through inhibition of GSK3 ⁇ degradation ( Figure 8).
  • AKT is a well-known regulator of cell proliferation and survival in cancer.
  • CDK and cyclin complexes induce proliferation through regulation of cell cycle checkpoints. In particular, downregulation of the cyclin A/CDK2 complex induces S phase and G2/M phase cell cycle arrest.
  • PCNA is a DNA clamp that supports DNA replication.
  • Cyclin-dependent kinase inhibitor 1 (p21) binds to the CDK/cyclin complex and inhibits the cell cycle.
  • IL-32 ⁇ (281T) can regulate the proliferation of breast cancer cells.
  • IL-32 ⁇ (281T)-expressing cells showed reduced cell proliferation than EV-transfected cells (Figure 9A).
  • IL-32 ⁇ (281T) of the present invention can be used in a potential therapeutic strategy to inhibit the progression of breast cancer due to its effects on inflammation, EMT and cell cycle arrest.
  • IL-32 ⁇ (281T) in which cytosine is replaced with thymine at position 281 (281T) of IL-32 ⁇
  • HAVEC human umbilical vein endothelial cells
  • Recombinant human IL-32 ⁇ (281T) was expressed, isolated, and purified using Ni-NTA and IL-32 mAb(KU32-52)-coupled agarose column.
  • IL-32 ⁇ (A94V) can bind to integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6, suggesting that integrins act as cell surface receptors for IL-32 ⁇ (A94V).
  • IL-32 ⁇ (A94V) induces intracellular cell adhesion molecule-1 (ICAM-1) and vascular cells in tumor necrosis factor (TNF)- ⁇ -stimulated HUVEC.
  • ICM-1 intracellular cell adhesion molecule-1
  • TNF tumor necrosis factor
  • IL-32 ⁇ (A94V) also reduced TNF- ⁇ -induced phosphorylation of protein kinase B (AKT) and c-jun N-terminal kinase (JNK) by inhibiting the phosphorylation of focal adhesion kinase (FAK).
  • AKT protein kinase B
  • JNK c-jun N-terminal kinase
  • IL-32 ⁇ (A94V) regulated the nuclear translocation of nuclear factor kappa B (NF- ⁇ B) and activator protein 1 (AP-1), which are involved in ICAM-1 and VCAM-1 expression.
  • Monocyte-endothelial adhesion mediated by ICAM-1 and VCAM-1 is an important early step in atherosclerosis, a major cause of cardiovascular disease.
  • the present invention suggests that IL-32 ⁇ (A94V) attenuates monocyte-endothelial adhesion by binding to the cell surface receptors integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6 and inhibiting the expression of ICAM-1 and VCAM-1 in HUVECs stimulated with TNF- ⁇ . do.
  • IL-32 ⁇ (A94V) can act as an anti-inflammatory cytokine in chronic inflammatory diseases such as arteriosclerosis.
  • the present inventors designed a recombinant vector using Nde1 and Age1 restriction enzymes (FIG. 11).
  • the vector was transformed into Rosetta, one of the E. coli strains, using the heat shock method.
  • the inserted DNA contains a His-tag for purification.
  • Pure IL-32 ⁇ (A94V) was obtained using sequential purification of a Ni-NTA column and a CNBr-activated Sepharose 4B column coupled with IL-32 mAb KU32-52.
  • the purified protein was confirmed by SDS-PAGE and Western blot (Figure 12).
  • IL-32 isoforms, including IL-32 ⁇ (281T), have an RGD motif, and integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6 are known to bind to the RGD motif. Additionally, these integrins have been reported to bind IL-32 ⁇ and IL-32 ⁇ . Therefore, we hypothesized that IL-32 ⁇ (A94V) would also bind to these integrins. In protein-protein binding predictions, IL-32 showed a higher docking score with integrin ⁇ V ⁇ 6 than with integrin ⁇ V ⁇ 3 ( Figure 13). However, no significant differences were identified in the IL-32 ⁇ (A94V)-integrin binding analysis.
  • IL-32 ⁇ (A94V) was found to bind both integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6 in a dose-dependent manner (Figure 14A), suggesting that these integrins may act as receptors for IL-32 ⁇ (A94V).
  • the interaction was not blocked by cyclo-(RGDfV) containing the short RGD peptide, indicating that, contrary to expectations, IL-32 ⁇ (A94V)-integrin binding is not mediated by the RGD motif ( Figure 14b).
  • Extracellular matrices such as fibronectin, vitronectin, and growth factors contained in FBS are known to bind to integrins. They can bind to integrins and block the integrin-IL-32 ⁇ (A94V) interaction. As expected, we observed a decrease in interaction in medium containing 10% FBS compared to serum-free medium ( Figure 14c).
  • RT-PCR analysis confirmed the expression of integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6 in HUVEC cells, but not in THP-1 human monocyte cells.
  • ICAM-1 and VCAM-1 expression induced by TNF- ⁇ was significantly reduced in IL-32 ⁇ (A94V)-pretreated HUVEC ( Figures 15 and 16). These results show the opposite role of IL-32 ⁇ (A94V) compared to IL-32 ⁇ and IL-32 ⁇ , which are known to induce the expression of these cell adhesion molecules.
  • FAK is a well-known integrin-mediated signaling molecule that is closely involved in intracellular signaling induced by various cytokines and growth factors. Phosphorylated FAK induced by these molecules activates the AKT and JNK signaling pathways. Activation of AKT induces phosphorylation of I ⁇ B, which promotes nuclear translocation of NF- ⁇ B. JNK also causes nuclear translocation of AP-1. Expression of ICAM-1 and VCAM-1 in HUVEC is accelerated by the transcription factors AP-1 and NF- ⁇ B. IL-32 ⁇ (A94V) downregulates this signaling pathway by inhibiting TNF- ⁇ -induced phosphorylation of FAK upstream of JNK and AKT, thereby attenuating ICAM-1 and VCAM-1 expression.
  • IL-32 ⁇ (A94V) of the present invention attenuated monocyte-endothelial adhesion by suppressing the expression of ICAM-1 and VCAM-1, key factors of atherosclerosis, through integrin-mediated signaling in HUVEC ( Figure 17 ). This evidence demonstrates a potential role for IL-32 ⁇ (A94V) in the treatment of chronic inflammatory diseases such as atherosclerosis.
  • the present invention can provide a pharmaceutical composition for preventing or treating cancer containing interleukin-32theta mutant (IL-32 ⁇ mutant).
  • the IL-32 ⁇ mutant may contain part or all of the amino acid sequence of SEQ ID NO: 1.
  • the gene of the interleukin-32 theta mutant of the present invention has a partial nucleotide sequence of the existing interleukin-32 theta deleted, preferably a partial nucleotide sequence of exon 6, and more preferably 144 of exon 6.
  • Base number 203 from base number 203 may be deleted.
  • the IL-32 ⁇ mutant may be encoded by the base sequence of SEQ ID NO: 2.
  • the IL-32 ⁇ mutant may be encoded by the base sequence of SEQ ID NO: 3.
  • the base sequence of SEQ ID NO: 3 can be used to manufacture or express recombinant IL-32 ⁇ mutant protein more efficiently than the base sequence of SEQ ID NO: 2.
  • the cancer may be any one or more selected from the group consisting of stomach cancer, lung cancer, liver cancer, pancreatic cancer, colon cancer, prostate cancer, and breast cancer.
  • 'Prevention' of the present invention refers to all actions that suppress or delay the onset of diseases related to cancer or inflammatory diseases due to the interleukin-32 theta mutant of the present invention.
  • 'Improvement' or 'treatment' of the present invention refers to all actions that improve or benefit parameters related to cancer or inflammatory disease-related diseases, such as the degree of symptoms, due to the interleukin-32 theta mutant of the present invention.
  • the pharmaceutical composition of the present invention may be in various parenteral dosage forms.
  • buffering agents e.g. saline or PBS
  • antioxidants e.g. saline or PBS
  • bacteriostatic agents e.g. EDTA or glutathione
  • fillers e.g., extenders, binders
  • adjuvants e.g. , aluminum hydroxide
  • suspending agents thickening agents, wetting agents, disintegrants or surfactants, diluents or excipients.
  • Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, or suppositories.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate.
  • injectable ester such as ethyl oleate.
  • As a base for suppositories witepsol, macrogol, tween 61, cacao, laurel, glycerol, gelatin, etc. can be used.
  • composition of the present invention can be administered orally or parenterally, and when administered parenterally, it is formulated according to a method known in the art in the form of an injection for external use on the skin, intraperitoneal, rectal, intravenous, muscle, subcutaneous or intracerebrovascular injection. You can get angry.
  • suitable carriers include, but are not limited to, solvents or dispersion media including water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), mixtures thereof, and/or vegetable oils. You can. More preferably, suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol, and 5% dextrose. etc. can be used.
  • solvents or dispersion media including water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), mixtures thereof, and/or vegetable oils. You can. More preferably, suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, or isotonic solutions such as
  • the injection may additionally contain various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. Additionally, in most cases, the injection may additionally contain an isotonic agent such as sugar or sodium chloride.
  • composition of the present invention is administered in a pharmaceutically effective amount.
  • a pharmaceutically effective amount refers to an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level refers to the type of patient's disease, severity, activity of the drug, sensitivity to the drug, and administration time. , route of administration and excretion rate, duration of treatment, factors including concurrently used drugs, and other factors well known in the field of medicine.
  • the composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times.
  • the total effective amount of the composition of the present invention can be administered to the patient in a single dose, or by a fractionated treatment protocol in which multiple doses are administered over a long period of time. . Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.
  • composition of the present invention can be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response modifiers.
  • the present invention can provide a pharmaceutical composition for preventing or treating inflammatory diseases containing the IL-32 ⁇ mutant.
  • the interleukin-32 theta mutant and the pharmaceutical composition are the same as the concept used in the pharmaceutical composition for preventing or treating cancer, the description is replaced with the description.
  • the inflammatory diseases include arthritis, rheumatoid arthritis, gout, hepatitis, asthma, keratitis, gastritis, enteritis, nephritis, tuberculosis, bronchitis, pleurisy, peritonitis, spondylitis, pancreatitis, inflammatory pain, urethritis, and cystitis.
  • it may be any one or more selected from the group consisting of arteriosclerosis, sepsis, dermatitis, periodontitis, and gingivitis.
  • the present invention can provide an anti-cancer immunotherapy composition or an anti-inflammatory immunotherapy composition containing interleukin-32theta mutant (IL-32 ⁇ mutant).
  • IL-32 ⁇ mutant interleukin-32theta mutant
  • the immunotherapy agent may refer to a treatment that treats a disease by promoting or suppressing the body's immune response while minimizing side effects by utilizing the characteristics of the body's immune cells.
  • the interleukin-32 theta mutant of the present invention is a new anti-inflammatory cytokine with a completely new function that is differentiated from other IL-32s, and can be used as an immunotherapy agent to prevent and treat various cancers and inflammatory diseases.
  • the cancer may be any one or more selected from the group consisting of stomach cancer, lung cancer, liver cancer, pancreatic cancer, colon cancer, prostate cancer, and breast cancer.
  • the above inflammatory diseases include arthritis, rheumatoid joints, gout, hepatitis, asthma, keratitis, gastritis, enteritis, nephritis, tuberculosis, bronchitis, pleurisy, peritonitis, spondylitis, pancreatitis, inflammatory pain, urethritis, cystitis, arteriosclerosis, sepsis, dermatitis, and periodontitis. And it may be any one or more selected from the group consisting of gingivitis.
  • the interleukin-32 theta mutant is the same as the concept used in the pharmaceutical composition for preventing or treating cancer, the description is replaced with the description.
  • the present invention can provide a recombinant vector for expressing interleukin-32theta mutant (IL-32 ⁇ mutant) containing the base sequence of SEQ ID NO: 3.
  • the base sequence of SEQ ID NO: 3 can be used to manufacture or express recombinant IL-32 ⁇ mutant protein more efficiently than the base sequence of SEQ ID NO: 2.
  • the interleukin-32 theta mutant is the same as the concept used in the pharmaceutical composition for preventing or treating cancer, the description is replaced with the description.
  • the present invention can provide the use of interleukin-32theta mutant (IL-32 ⁇ mutant) for use in cancer treatment.
  • the interleukin-32 theta mutant is the same as the concept used in the pharmaceutical composition for preventing or treating cancer, the description is replaced with the description.
  • the cancer may be any one or more selected from the group consisting of stomach cancer, lung cancer, liver cancer, pancreatic cancer, colon cancer, prostate cancer, and breast cancer.
  • the present invention can provide the use of interleukin-32theta mutant (IL-32 ⁇ mutant) for use in treating inflammatory diseases.
  • IL-32 ⁇ mutant interleukin-32theta mutant
  • the interleukin-32 theta mutant is the same as the concept used in the pharmaceutical composition for preventing or treating cancer, the description is replaced with the description.
  • the inflammatory diseases include arthritis, rheumatoid arthritis, gout, hepatitis, asthma, keratitis, gastritis, enteritis, nephritis, tuberculosis, bronchitis, pleurisy, peritonitis, spondylitis, pancreatitis, inflammatory pain, urethritis, and cystitis.
  • it may be any one or more selected from the group consisting of arteriosclerosis, sepsis, dermatitis, periodontitis, and gingivitis.
  • the present invention can provide a cancer treatment method comprising administering a composition containing interleukin-32theta mutant (IL-32 ⁇ mutant) to a cancer patient.
  • a cancer treatment method comprising administering a composition containing interleukin-32theta mutant (IL-32 ⁇ mutant) to a cancer patient.
  • the interleukin-32 theta mutant is the same as the concept used in the pharmaceutical composition for preventing or treating cancer, the description is replaced with the description.
  • the cancer may be any one or more selected from the group consisting of stomach cancer, lung cancer, liver cancer, pancreatic cancer, colon cancer, prostate cancer, and breast cancer.
  • the present invention can provide a method of treating inflammatory diseases comprising the step of administering a composition containing interleukin-32theta mutant (IL-32 ⁇ mutant) to a patient with inflammatory diseases.
  • a composition containing interleukin-32theta mutant IL-32 ⁇ mutant
  • the interleukin-32 theta mutant is the same as the concept used in the pharmaceutical composition for preventing or treating cancer, the description is replaced with the description.
  • the inflammatory diseases include arthritis, rheumatoid arthritis, gout, hepatitis, asthma, keratitis, gastritis, enteritis, nephritis, tuberculosis, bronchitis, pleurisy, peritonitis, spondylitis, pancreatitis, inflammatory pain, urethritis, and cystitis.
  • it may be any one or more selected from the group consisting of arteriosclerosis, sepsis, dermatitis, periodontitis, and gingivitis.
  • the interleukin-32theta mutant of the present invention ⁇ IL-32 ⁇ mutant, IL-32 ⁇ (281T) or IL-32 ⁇ (A94V) ⁇ regulates the NF- ⁇ B pathway to suppress the expression of inflammatory factors and the FAK/PI3K/AKT pathway. It is possible to control the progression of cancer, especially breast cancer, by suppressing EMT markers and cell cycle-related factors.
  • IL-32 ⁇ (281T) binds to the cell surface receptors integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6 and inhibits the expression of ICAM-1 and VCAM-1 in HUVECs stimulated with TNF- ⁇ , thereby weakening monocyte-endothelial adhesion, thereby preventing atherosclerosis. It may provide anti-inflammatory effects in chronic inflammatory diseases. It can also be used as research material for various cancers and/or inflammatory diseases.
  • Figure 1 shows some RT-PCR results for mRNA expression of IL-32 ⁇ and IL-32 ⁇ in breast cancer tissues (tissue numbers 65 to 80).
  • Primers targeting the sequence from exon 5 to exon 7 (forward primer: 5'-ACGTGGACAGGTGATGTCGA-3, SEQ ID NO: 7'; reverse primer: 5'-GAGCAGCAGAAACTCTGGAA-3', SEQ ID NO: 8) detect IL-32 ⁇ . It was designed to do this (297 bp).
  • Figure 2B shows the sequences of wild-type IL-32 ⁇ (SEQ ID NO:4) and mutant IL-32 ⁇ (281T) (SEQ ID NO:2). Mutation points are highlighted in red.
  • GenBank GenBank
  • Figure 4A shows the modulatory effect of IL-32 ⁇ (281T) on the mRNA levels of inflammatory factors in MDA-MB-231 cells.
  • A Lipofectamine was used to establish EV- and IL-32 ⁇ (281T)-overexpressing MDA-MB-231 cells.
  • B Shows cell morphological changes in transfected MDA-MB-231 cells. Scale bar, 50 ⁇ m.
  • Figure 4B shows the modulatory effect of IL-32 ⁇ (281T) on the mRNA levels of inflammatory factors in MDA-MB-231 cells.
  • Figure 5A shows the regulatory effect of IL-32 ⁇ (281T) on cytokine expression and nuclear translocation of NF- ⁇ B.
  • A Secretion levels of IL-1 ⁇ , IL-6, and IL-8 were analyzed by ELISA using supernatants obtained from MDA-MB-231 cells stimulated with CM.
  • B, C Protein levels of COX-2 were analyzed by Western blotting in MDA-MB-231 cells stimulated with CM. Intensity was quantified using ImageJ.
  • Figure 5b shows the regulatory effect of IL-32 ⁇ (281T) on cytokine expression and nuclear translocation of NF- ⁇ B.
  • Figure 6A shows the regulatory effect of IL-32 ⁇ (281T) on breast cancer cell migration.
  • MDA-MB-231 cells 1.5 x 10 5 cells/well
  • MDA-MB-468 cells 3 x 10 5 cells/well
  • Plates were scraped using a sterile 200 ⁇ L pipette tip, washed with PBS, and serum-free medium with or without CM was added for 24 h.
  • Scale bar 200 ⁇ m. Wound area was quantified using Image J.
  • Figure 6b shows the regulatory effect of IL-32 ⁇ (281T) on breast cancer cell migration.
  • MDA-MB-231 cells 1.5 x 10 5 cells/well
  • MDA-MB-468 cells 3 x 10 5 cells/well
  • Plates were scraped using a sterile 200 ⁇ L pipette tip, washed with PBS, and serum-free medium with or without CM was added for 24 h.
  • Figure 7a shows the regulatory effect of IL-32 ⁇ (281T) on epithelial-mesenchymal transition markers of breast cancer cells.
  • Expression of epithelial-mesenchymal transition-related proteins (fibronectin, N-cadherin, vimentin, E-cadherin) was analyzed by Western blotting.
  • Figure 7b shows the regulatory effect of IL-32 ⁇ (281T) on epithelial-mesenchymal transition markers in breast cancer cells. E-cadherin and N-cadherin expression was analyzed by immunofluorescence.
  • Figure 8 shows the results of Western blotting analysis of the regulatory effect of IL-32 ⁇ (281T) on signaling pathways (FAK, PI3K, AKT, GSK3 ⁇ , ⁇ -catenin) in breast cancer cells.
  • EV- and IL-32 ⁇ transfected breast cancer cells (2 ⁇ 10 5 cells/ml) were seeded in 60pi dishes and cultured for 48 hours.
  • Figure 9A shows the regulatory effect of IL-32 ⁇ (281T) on the proliferation of breast cancer cells.
  • A Shows the results of time-dependent cell viability analysis of EV- and IL-32 ⁇ (281T)-transfected breast cancer cells.
  • B Shows the results of cell proliferation analysis of EV- and IL-32 ⁇ (281T)-transfected breast cancer cells.
  • EV- and IL-32 ⁇ (281T)-transfected breast cancer cells were cultured for 72 h.
  • C Shows the effect of IL-32 ⁇ (281T) on the expression of cell cycle-related factors (cyclin A, Cdk2, PCNA, p21) in breast cancer cells measured by Western blotting.
  • Figure 9b shows the regulatory effect of IL-32 ⁇ (281T) on the proliferation of breast cancer cells.
  • Figure 10 shows a schematic diagram of the regulatory effect of mutated IL-32 ⁇ (281T) on intracellular pathways.
  • IL-32 ⁇ (281T) inhibits phosphorylation of FAK and I ⁇ B ⁇ .
  • IL-32 ⁇ (281T) inhibits the expression and translocation of ⁇ -catenin by inhibiting phosphorylated FAK.
  • NF- ⁇ B is inhibited by IL-32 ⁇ (281T) through inhibition of phosphorylated I ⁇ B ⁇ . Therefore, IL-32 ⁇ (281T) reduces breast cancer migration, proliferation, and inflammation through FAK-PI3K-GSK3 and NF- ⁇ B pathways.
  • FIG 11 shows a schematic diagram of mutant IL-32 ⁇ (281T) expression vector and IL-32 ⁇ (281T) purification.
  • TEVSH with pTH24 as the backbone was used as the protein expression vector.
  • a His tag was included for purification.
  • Recombinant DNA was constructed using Nde1 and Age1 restriction enzymes.
  • Figure 12 shows the results of expression and purification of IL-32 ⁇ (281T) using SDS-PAGE (A) and Western blot using KU32-52 mAb (B) or anti-His tag mAb (C).
  • Mutant IL-32 ⁇ (281T) was purified twice on a Ni-NTA column followed by IL-32mAb (KU32-52) coupled CNBr-activated Sepharose 4B.
  • IL-32 ⁇ (281T) bound to the Ni-NTA column was eluted with 500mM imidazole, and IL-32 mAb (KU32-52)-coupled was eluted using low pH Tris-glycine buffer (pH 3.0).
  • CNBr-activated Sepharose 4B L, lysate of E. coli containing the IL-32 ⁇ (281T) expression vector; FT, flow through; W, washing flow; E, elution; E2 -E13, eluted using low pH Tris-glycine buffer (pH 3.0).
  • Figure 13 shows the 3D structural modeling results of IL-32 ⁇ (A94V) and IL-32 ⁇ (A94V)-integrin binding prediction.
  • Protein-protein binding was predicted by the HDOCK server (IL-32 ⁇ (A94V): yellow, integrin: orange).
  • the tertiary structure of IL-32 ⁇ (A94V) was constructed by I-TASSER and the integrin was provided by PDB.
  • Figure 14A shows IL-32 ⁇ (A94V) binding to recombinant ⁇ V ⁇ 3 and ⁇ V ⁇ 6 integrins.
  • IL-32 ⁇ (A94V) binds to recombinant ⁇ V ⁇ 3 and ⁇ V ⁇ 6 integrins.
  • Binding of IL-32 ⁇ (A94V) to integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6 was assessed using IL-32 mAb (KU32-52). Results represent the mean ⁇ standard deviation of three experiments (*p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001, ****p ⁇ 0.0001 by one-way ANOVA).
  • Figure 14B shows IL-32 ⁇ (A94V) binding to recombinant ⁇ V ⁇ 3 and ⁇ V ⁇ 6 integrins.
  • the effect of cyclo-(RGDfV) on the binding of IL-32 ⁇ (A94V) to recombinant ⁇ V ⁇ 3 and ⁇ V ⁇ 6 integrins is shown.
  • Binding of IL-32 ⁇ (A94V) to integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6 was assessed using IL-32 mAb (KU32-52). Results represent the mean ⁇ standard deviation of three experiments (*p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001, ****p ⁇ 0.0001 by one-way ANOVA).
  • Figure 14C shows IL-32 ⁇ (A94V) binding to recombinant ⁇ V ⁇ 3 and ⁇ V ⁇ 6 integrins.
  • the effect of FBS on the binding of IL-32 ⁇ (A94V) to recombinant ⁇ V ⁇ 3 and ⁇ V ⁇ 6 integrins is shown.
  • Binding of IL-32 ⁇ (A94V) to integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6 was assessed using IL-32 mAb (KU32-52). Results represent the mean ⁇ standard deviation of three experiments (*p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001, ****p ⁇ 0.0001 by one-way ANOVA).
  • FIG. 15 shows the effect of IL-32 ⁇ (A94V) on mRNA expression of ICAM-1 and VCAM-1 in TNF- ⁇ stimulated human umbilical vein endothelial cells (HUVEC).
  • HUVECs were pretreated with IL-32 ⁇ (A94V) (100 ng/mL) for 1 h and stimulated with TNF- ⁇ (10 ng/mL) for 4 h.
  • mRNA expression of adhesion molecules was detected by RT-PCR (A) and RT-qPCR (B) analysis. Results represent the mean ⁇ SD of three experiments (** p ⁇ 0.01, *** p ⁇ 0.001, **** p ⁇ 0.0001 by one-way ANOVA).
  • Figure 16 shows the effect of IL-32 ⁇ (A94V) on protein expression of ICAM-1 and VCAM-1 in TNF- ⁇ stimulated human umbilical vein endothelial cells (HUVEC).
  • HUVECs were pretreated with IL-32 ⁇ (A94V) (100 ng/mL) for 1 h and stimulated with TNF- ⁇ (10 ng/mL) for 6 h.
  • Protein expression of adhesion molecules was analyzed by immunofluorescence using specific antibodies.
  • FIG. 17 IL-32 ⁇ (A94V) attenuates monocyte adhesion to HUVEC.
  • A Shows a fluorescent picture of calcein 665 AM-labeled THP-1 cells (green) adhesion to HUVEC. HUVECs were pretreated with IL-32 ⁇ (A94V) (100 ng/ml) for 1 hour and then stimulated with TNF- ⁇ for 6 hours. Then, HUVECs were incubated with calcein-AM-labeled THP-1 for 30 min.
  • B Quantified THP-1-HUVEC adhesion results were normalized to the control group. Fluorescence was measured using Image J software. The scale bar in each image represents 650 ⁇ m. Results represent the mean ⁇ standard deviation of three experiments (**** p ⁇ 0.0001 by one-way ANOVA).
  • Figure 18 shows the effect of IL-32 ⁇ (A94V) on the phosphorylation levels of FAK, JNK and AKT in HUVEC cells.
  • HUVECs were pretreated with IL-32 ⁇ (A94V) (100 ng/mL) for 1 hour and then stimulated with TNF- ⁇ for 10 minutes (FAK) or 15 minutes (JNK, AKT).
  • TNF- ⁇ 10 minutes
  • JNK, AKT 15 minutes
  • Phosphorylation levels of FAK, AKT, and JNK were confirmed by Western blot, and band intensities were quantified using Image J software. Results represent the mean ⁇ SD of three experiments (*p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001 by one-way ANOVA).
  • Figure 19 shows the effect of IL-32 ⁇ (A94V) on the phosphorylation level of I ⁇ B and nuclear translocation of NF- ⁇ B (p65/p50) and AP-1 (c-Fos/c-Jun) in HUVEC cells.
  • HUVEC cells were incubated with IL-32 ⁇ (A94V) for 1 h and then stimulated with TNF- ⁇ (10 ng/ml) for 10 min (I ⁇ B) or 30 min (transcription factor).
  • TNF- ⁇ 10 ng/ml
  • Harvested cells were subjected to nuclear fractionation.
  • Phosphorylation and translocation levels were analyzed by Western blot and band intensities were quantified using ImageJ software. Results represent the mean ⁇ SD of three experiments (*p ⁇ 0.05, ***p ⁇ 0.001 by one-way ANOVA).
  • Figure 20 shows a schematic diagram of signaling pathways involved in TNF- ⁇ induced ICAM-1 and VCAM-1 expression and integrin-IL-32 ⁇ (A94V) binding effect.
  • TNF- ⁇ -induced phosphorylation of FAK, AKT, and JNK and nuclear translocation of NF- ⁇ B and AP-1 promote the expression of ICAM-1 and VCAM-1.
  • IL-32 ⁇ (A94V) inhibits the expression of ICAM-1 and VCAM-1 by inhibiting these intracellular signaling pathways.
  • Biological samples from breast cancer patients used in the present invention were provided by Chonnam National University Hwasun Hospital Biobank (Hwasun-gun, Korea) and Korea University Guro Hospital (Seoul, Korea). This study was approved by the Konkuk University Institutional Review Board (7001355-201704-E-047), and all subjects gave informed consent.
  • mRNA was extracted from frozen tissue using a homogenizer and TRI Reagent® (Ambion, Austin, TX, USA), and cDNA was extracted using M-MuLV reverse transcriptase (New England Biolabs, Beverly, MA, USA) according to the manufacturer's instructions. It was synthesized accordingly.
  • the mRNA expression of IL-32 ⁇ in tissues of breast cancer patients was confirmed using specific primer sets based on size differences ( Figure 1).
  • the present inventors used a primer set that can distinguish isotypes depending on the size of the PCR product.
  • Robust expression of genes at Bionics (Seoul, Korea) using the Sanger method with ABI 3730XL (Thermo Fisher Scientific, Waltham, MA, USA) and BigDye®Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific) Sequencing of IL-32 ⁇ was performed in samples (n 34).
  • a point mutation was detected in the IL-32 ⁇ sequence ( Figure 2a). The point mutation was located between exons 7 and 8 of IL-32 ⁇ , outside the splice site.
  • Inflammatory factors IL-1 ⁇ , IL-6, IL-8, COX-2
  • mesenchymal markers vimentin, N-cadherin
  • proliferation factors The mRNA levels of PCNA, CDK2
  • Breast tumor tissues were divided into two groups according to IL-32 ⁇ (281T) expression obtained by RT-PCR (Table 1).
  • RT-qPCR was performed with a relative quantification protocol using the BioFactTM2X Real-time PCR Kit (BioFact, Daejeon, Korea) and Rotor-Gene 6000 series software 1.7 (Qiagen, Venlo, Netherlands). Primer sequences are listed in [Table 2]. Transcript levels were calculated using the ⁇ Ct or ⁇ Ct method.
  • MDA-MB-231 ATCC®HTB-26TM, Manassas, VA, USA
  • DMEM Dulbecco's Modified Eagle's Medium
  • MDA-MB-468 cells ATCC® HTB-132TM were cultured in RPMI-1640 (HyClone Laboratories). Both media were supplemented with 10% heat-inactivated fetal bovine serum (Gibco BRL Life Technologies, Rockville, MD, USA), 100 U/mL penicillin, and 100 ⁇ g/mL streptomycin at 37°C and 5% CO 2 .
  • breast cancer cells were transfected with pcDNA3.1(+)-6x Myc empty vector (EV) and pcDNA3.1(+)-6x Myc IL-32 ⁇ (281T) vector.
  • the pcDNA3.1(+)-6x Myc IL-32 ⁇ (281T) vector was prepared from the wild-type Myc-IL-32 ⁇ vector using the Muta-DirectTMSite-Directed Mutagenesis Kit (iNtRON Biotechnology). Briefly, cells were seeded in 60 Pi dishes (3 ⁇ 10 5 cells/well) and transfected with 3 ⁇ g of vector using Lipofectamine®2000 (Invitrogen, Carlsbad, CA, USA). Afterwards, breast cancer cells were selected for 2 weeks using medium containing 900 ⁇ g/mL G-418 (Duchefa Biochemie BV, Haarlem, The Netherlands). Only G-418 resistant colonies were cultured.
  • CM conditioned medium
  • THP-1 cells were seeded in T-75 flasks (3 ⁇ 10 6 cells) and stimulated with 100 nM PMA (Millipore Sigma, Burlington, MA) for 72 h. After treatment with PMA for 24 h, cells were incubated with 20 ng/mL of IL-4 (PeproTech, Philadelphia, PA) and IL-13 (PeproTech) for another 48 h to induce M2-polarized THP-1 macrophages. Then, the cells were washed with PBS (phosphate-buffered saline), and new culture medium was added after 24 hours. CM was collected and centrifuged to remove remaining cells.
  • PMA Millipore Sigma, Burlington, MA
  • MDA-MB-231 cells were cultured with CM for 24 hours, then the culture medium was replaced with new culture medium and cultured for an additional 24 hours.
  • Cell culture supernatants were collected and analyzed using ELISA kits (R&D systems) for human IL-1 ⁇ , IL-6, IL-8 and PGE2 (GE Healthcare, Buckinghamshire, UK) according to the manufacturer's instructions.
  • RT-qPCR analysis showed that the mRNA levels of inflammatory factors were suppressed by IL-32 ⁇ (281T) in MDA-MB-231 cells (C in Figure 4b).
  • CM-treated MDA-MB-231 cells revealed that increased mRNA levels of inflammatory factors were suppressed by IL-32 ⁇ (281T) ( Figure 4B, D).
  • the secreted protein levels of IL-1 ⁇ , IL-6, IL-8, and prostaglandin E2 (PGE2) were determined by ELISA, and IL-32 ⁇ (281T) was detected in MDA-MB-231 cells stimulated with CM. -6, demonstrated inhibition of IL-8 and PGE2 levels ( Figure 5a).
  • IL-32 ⁇ (281T) Regulatory effect of IL-32 ⁇ (281T) on migration of human breast cancer cells.
  • Inflammatory factors were found to be inhibited by IL-32 ⁇ (281T). We sought to determine whether IL-32 ⁇ (281T) affects the migration of breast cancer cells.
  • IF immunofluorescence
  • breast cancer cells were seeded on cell culture slides (SPL, Pocheon, Korea) and cultured overnight. Attached cells were fixed, permeabilized with paraformaldehyde and methanol, and blocked with 1% bovine serum albumin (BSA) in PBS at room temperature. Primary antibodies (1:200 diluted in 1% BSA) were added to the slides and incubated overnight at 4°C. After washing with PBS, slides were incubated with secondary antibodies (1:400 dilution). Antibodies are listed in [Table 3] above. Nuclear staining was performed by exposing cells to 4,6-diamidino-2-phenylindole (1:1000 dilution in PBS) (Millipore Sigma) for 15 seconds. Cells were visualized using the EVOS M7000 Imaging System (Thermo Fisher Scientific).
  • breast cancer cells (1.5 x 10 5 cells/well) were seeded in 24-well plates and cultured until 100% confluence. The plate was scraped using a sterile 200 ⁇ L pipette tip, washed with PBS to remove detached cells, and fresh serum-free medium was added after 24 h. Plates were photographed under a microscope at 0 and 24 hours. Cell migration was measured using the scratch area with ImageJ.
  • Intracellular signaling pathway of IL-32 ⁇ (281T) in human breast cancer cells Intracellular signaling pathway of IL-32 ⁇ (281T) in human breast cancer cells.
  • the present invention shows that inflammatory factors and EMT markers are regulated by IL-32 ⁇ (281T). Additionally, it was revealed that NF- ⁇ B translocation was inhibited by IL-32 ⁇ (281T). The present inventors confirmed whether IL-32 ⁇ (281T) affects the intracellular signaling pathway of breast cancer cells.
  • the FAK/PI3K/AKT pathway was found to be inhibited by IL-32 ⁇ (281T).
  • MTS and BrdU assays were performed ( Figure 9A).
  • Cell viability was assessed using CellTiter 96®One Solution Cell Proliferation Assay (Promega, Madison, WI, USA). Breast cancer cells (1 ⁇ 10 4 cells/well) were seeded in 96-well plates and incubated every hour and washed with fresh medium.
  • the cells were then incubated with 100 ⁇ L of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium(3- (4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxy phenyl)-2-(4-sulfophenyl)-2H-tetrazolium) and the electronic coupling reagent phenazine methosulfate for 1 hour. cultured. Optical density (OD) was measured at 492 nm. Relative viability was quantified by normalization to control OD.
  • cell proliferation was determined based on BrdU (5'-bromo-2'-deoxyuridine) incorporation into DNA using Cell Proliferation Assay Kits (Cell Signaling Technology) according to the manufacturer's protocol.
  • BrdU 5'-bromo-2'-deoxyuridine
  • Cell Proliferation Assay Kits Cell Signaling Technology
  • Breast cancer cells (5 ⁇ 10 2 cells/well) were seeded in 96-well plates, cultured for 72 h, and labeled with BrdU for 24 h. Cells were fixed, and detection antibodies and HRP-linked antibodies were used to detect BrdU. Color was developed using TMB (3,3',5,5'-tetramethylbenzidine), an HRP substrate, and OD was measured at 450 nm.
  • MDA-MB-231 (2 ⁇ 10 5 cells/mL) and MDA-MB-468 (4 ⁇ 10 5 cells/mL) cells were seeded in 60 pi dishes for 48 hours. Cells were then washed with PBS and fixed with 70% ethyl alcohol for 30 min. Cells were then washed with PBS and supplemented with PBS containing propidium iodide for 30 min. Fluorescence emission was measured and analyzed using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA).
  • IL-32 ⁇ (281T)-expressing breast cancer cells had significantly slower growth than EV transfected cells ( Figure 9A).
  • Regulatory cell cycle (CDK2, cyclin A) and proliferating cell nuclear antigen (PCNA) proteins were inhibited by IL-32 ⁇ (281T) ( Figure 9A, C).
  • the antiproliferative protein p21 was upregulated by IL-32 ⁇ (281T) in breast cancer cells ( Figure 9A, C).
  • PI staining was performed using flow cytometry. Flow cytometry results showed that the rate of S phase and G2/M phase arrest was higher in breast cancer cells expressing IL-32 ⁇ (281T) than in EV-transfected breast cancer cells ( Fig. 9B ).
  • Student's t-test was used to compare groups in the analysis of breast patient samples.
  • One-way analysis of variance (ANOVA) with Student's t-test and Tukey's honest test was used to compare groups in in vitro experiments.
  • Statistical analyzes were performed using GraphPad Prism software version 9.0. Results represent the mean ⁇ SD of three experiments. All p-values were two-sided and were *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001 and ****p ⁇ 0.0001.
  • a TEVSH vector was used to express IL-32 ⁇ (A94V), and recombinant IL-32 ⁇ (281T) DNA was inserted into the vector using Nde1 and Age1 restriction enzymes.
  • the TEVSH vector contains a His tag for protein purification.
  • a schematic diagram of the recombinant vector is shown in [Figure 11].
  • the IL-32 ⁇ (281T) coding sequence (SEQ ID NO: 3) was synthesized by Bioneer (Daejeon, Korea) using HT-oligo TM synthesis to improve protein expression efficiency.
  • the synthesized DNA sequence was cloned into pTH24-based TEVSH vector (Addgene, Watertown, MA, USA) using NdeI and AgeI restriction sites and a rapid DNA ligation kit (Thermo Fisher Scientific, Waltham, MA, USA).
  • TEVSH was provided by Helena Berglund (Addgene plasmid #125194; http://n2t.net/addgene:125194; RRID:Addgene 125194) and confirmed by DNA sequencing (Bionics, Seoul, Korea).
  • the recombinant TEVSH vector was transformed into DH5 ⁇ by heat shock and purified using a mini prep kit (Intron Biotechnology, Sungnam, Korea).
  • the IL-32 ⁇ (281T) expression vector was transformed into the Rosetta strain of E. coli by heat shock transformation. Successfully transformed single colonies were picked and cultured in Luria-Bertani (LB) medium containing ampicillin (100 ⁇ g/mL) at 37°C in a 200-rpm incubator for 4 h. The cultured mixture was transferred to 2.4 L of fresh LB medium containing ampicillin (100 ⁇ g/mL) and grown in a 200 rpm incubator at 37°C until OD600 reached 0.6.
  • IL-32 ⁇ (A94V) was induced by adding 0.5mM IPTG. Cells were grown in a 200 rpm incubator for 16 hours at 16°C.
  • IL-32 ⁇ (A94V) Serial purification was performed to improve the purity of IL-32 ⁇ (A94V).
  • IL-32 ⁇ (A94V) was separated by binding to a Ni-NTA column and His tag, and the separated IL-32 ⁇ (281T) was purified once more using a CNBr-activated Sepharose 4B column combined with IL-32mAb KU32.
  • lysis buffer 50mM Tris-HCl pH 8.0, 10% glycerol , 0.1% Triton Cells lysed for 30 min were sonicated (amplitude 35%, 10 s on, 10 s off) for 1 min using a sonicator (Sonics & Materials, Inc., Newtown, CT, USA). The lysed cells were centrifuged at 13,000 rpm for 30 minutes at 4°C, and the supernatant was collected.
  • Ni-NTA resin (Thermo Fisher Scientific) was loaded onto a PD-10 column and balanced with equilibration buffer (20mM Tris-HCl pH 8.0, 200mM NaCl). The lysate was mixed with 10 mL of equilibration buffer, loaded onto the column, and washed with wash buffer (20mM Tris-HCl pH 8.0, 200mM NaCl, 25mM imidazole). After washing, the elution buffer (20mM Tris-HCl pH 8.0, 500mM NaCl, 500mM imidazole) was loaded on the column, and the flow-through buffer containing IL-32 ⁇ was loaded on a CNBr-activated Sepharose 4B column (Sigma- Aldrich, St.
  • IL-32mAb (KU32-52)-coupled CNBr-activated Sepharose 4B column prepared using the monoclonal antibody IL-32 mAb KU32-52.
  • Tris pH 8.0
  • IL-32 ⁇ (A94V) was eluted with 100mM glycine (pH 3.0).
  • the tube receiving the eluted solution contained 1M Tris (pH 8.0), which was one-tenth of the total volume.
  • Purified IL-32 ⁇ (A94V) was dialyzed three times for 2 hours each with PBS (phosphate-buffered saline) using a spectra/Por membrane (Spectrum Laboratories, Piscataway, NJ, USA). The absence of endotoxin was assessed using polymyxin B (Sigma-Aldrich).
  • IL-32 ⁇ (A94V) was analyzed using SDS-PAGE ( Figure 12A) and Western blot ( Figures 12B, 11C).
  • SDS-PAGE SDS-PAGE analysis
  • no other notable protein bands were detected in the eluate from the Ni-NTA column except for IL-32 ⁇ (A94V), but several other proteins were observed through western blotting.
  • These off-target proteins were removed by further purification using a CNBr-activated Sepharose 4B column coupled to KU32-52.
  • highly pure IL-32 ⁇ (A94V) protein was obtained with almost no other proteins.
  • IL-32 ⁇ (A94V) The binding of IL-32 ⁇ (A94V) to integrins was predicted using the HDOCK server. In addition to structure-based binding predictions, we also performed IL-32 ⁇ (A94V)-integrin binding analysis.
  • I-TASSER Intelligent Threading ASSEmbly Refinement
  • I-TASSER identifies structural templates with full-length models constructed from template-based fragment assembly simulations.
  • the 3D model is then re-threaded through a protein function database to derive functional insights for the target.
  • Protein-protein docking prediction was performed using the model with the highest reliability among the models derived from I-TASSER (34-36).
  • Integrin-IL-32 ⁇ (A94V) binding was analyzed using the HDOCK server (http://hdock.phys.hust.edu.cn), a protein-protein binding prediction tool.
  • HDOCK uses a hybrid docking strategy to predict binding complexes between two proteins.
  • the extracellular segment structures of integrins ⁇ V ⁇ 3 (PDB ID: 1JV2) and ⁇ V ⁇ 6 (PDB ID: 5FFG) were provided in the Protein Data Bank (PDB).
  • IL-32 ⁇ (A94V) is shown as a yellow molecule containing a helical structure, and the extracellular domains of integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6 provided by PDB are shown as orange molecules.
  • the binding score of IL-32 ⁇ (A94V)-integrin ⁇ V ⁇ 3 was -304.56, and the reliability score was 0.9565.
  • the binding score of IL-32 ⁇ (A94V)-integrin ⁇ V ⁇ 6 was -358.20, and the confidence score was 0.9847, which was higher than that of IL-32 ⁇ (A94V)-integrin ⁇ V ⁇ 3 ( Figure 13).
  • IL-32 ⁇ (A94V)-integrin binding assay For the IL-32 ⁇ (A94V)-integrin binding assay, a 96-well plate was coated with integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6, and then IL-32 ⁇ (A94V) was added at the concentration shown in [FIG. 14A]. Cyclo-RGDfV, known to bind to the RGD binding site of integrin, was pretreated in a 96-well plate, and PBS was used as a control. Additionally, wells were coated with integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6. IL-32 ⁇ (A94V) was treated at the concentration shown in [FIG. 14B]. In other groups, medium containing 10% FBS was pretreated in 96-well plates. Then, integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6 were added, and the control group was pretreated with serum-free medium. IL-32 ⁇ (A94V) was treated at the concentrations shown in [FIG.
  • the cells were incubated with cyclo-RGDfV peptide (Peptide Institute Inc, Osaka, Japan) or 10% fetal bovine serum (FBS) and the remainder with PBS for 1 hour at 37°C.
  • FBS fetal bovine serum
  • the wells were incubated for 1 h at 37°C with or without various concentrations of mutant IL-32 ⁇ (A94V), 10 ⁇ M cyclo-(RGDfV), or 10% FBS diluted in PBS.
  • Wells were washed three times with wash buffer and incubated with IL-32 mAb KU32-52 diluted in PBS at a concentration of 0.2 ⁇ g/mL for 1 hour at 25°C.
  • HUVEC cells were grown in Dulbecco modified culture medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum (Hyclone Laboratories, Logan, UT, USA), penicillin (100 U/mL), and streptomycin (100 ⁇ g/mL). Cultured in Eagle medium (Welgene Incorporation, Daegu, Korea). Cells were cultured in a chamber containing 5% CO 2 at 37°C.
  • HUVEC cells (3 ⁇ 10 5 cells/well) were cultured in a 6-well plate for 24 hours and starved in serum-free medium for 4 hours. Cells were then pretreated with IL-32 ⁇ (A94V) (100 ng/ml) for 1 hour and treated with TNF- ⁇ (10ng/mL) for an additional 4 hours. Treated cells were collected and lysed using the easy-BLUETM Total RNA Extraction Kit (iNtRon Biotechnology, Seoul, South Korea) according to the manufacturer's instructions.
  • IL-32 ⁇ (A94V) 100 ng/ml
  • TNF- ⁇ 10ng/mL
  • RNA (1 ⁇ g) was reverse transcribed into cDNA using oligo(dT) primers and M-MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA).
  • the synthesized cDNA was amplified using PCR Thermal Cycler Dice equipment (Takara, Otsu, Shiga, Japan).
  • RT-qPCR HUVECs were obtained after treatment with or without IL-32 ⁇ (A94V) and TNF- ⁇ . mRNA extraction and cDNA synthesis were performed as previously described. RT-PCR was performed with a relative quantification protocol using Rotor-Gene 6000 series software 1.7 (Qiagen, Hilden, Germany) and Sensi FASTTM SYBR NO-ROX Kit (BIOLINE, London, UK). Expression of all target genes was normalized to the expression of the housekeeping gene GAPDH.
  • Each sample contained ICAM-1, 5'-AGCGGCTGACGTGTGCAGTAAT-3' (forward, SEQ ID NO: 31), 5'-TCTGAGACCTCT GGCTTCGTCA-3' (reverse, SEQ ID NO: 32); VCAM-1, 5'-GATTCTGTGCCCACAGTAAGGC-3' (forward, SEQ ID NO: 33), 5'-TGGTCACAGAGCCACCTTCTTG-3' (reverse, SEQ ID NO: 34); GAPDH, 5'-AGAACATCATCCCTGCCTCT-3' (forward, SEQ ID NO: 5), 5'-CTGCTTCACCACCTTCTTGA-3' (reverse, SEQ ID NO: 6). GAPDH was used as an internal control. Using the comparative Ct method, the mRNA level of each gene was calculated relative to the relative level of GAPDH, an internal reference.
  • HUVEC cells (3 ⁇ 10 cells/well) were seeded in 6 -well plates for 24 h, pretreated with IL-32 ⁇ (A94V) (100 ng/mL) for 1 h, and then incubated with TNF- ⁇ (10 ng/mL) was treated. Cells were incubated at 4°C for 2 hours in 50mM Tris (pH 7.4), 150mM NaCl, 1% NP-40, 0.1% sodium dodecyl sulfate (SDS), 0.25% sodium deoxycholate, 1mM ethylene diamine tetraacetic acid (EDTA).
  • Tris pH 7.4
  • 150mM NaCl 150mM NaCl
  • NP-40 1% NP-40
  • SDS sodium dodecyl sulfate
  • EDTA 1mM ethylene diamine tetraacetic acid
  • Membranes were blocked with 5% skim milk for 1 hour at 25°C and incubated with IL-32, His-tag (Sigma-Aldrich), FAK (Thermo Fisher Scientific), AKT (Cell Signaling, Danvers, MA, USA) for 1 hour at 25°C. ), JNK (Cell Signaling), I ⁇ B (Cell Signaling), p65 (Cell Signaling), p50 (Cell Signaling), PARP (Cell Signaling), c-Jun (Santa Cruz Biotechnology, Dallas, TX, USA), c-Fos (Santa Cruz Biotechnology).
  • HUVEC cells 1.0 ⁇ 10 cells/well were seeded in 8-well slide chambers for 24 h, starved overnight, and incubated with IL-32 ⁇ (A94V) (100 ng/mL) and TNF- ⁇ for 6 h. (10ng/mL). After treatment, cells were fixed using 4% paraformaldehyde for 10 min, then incubated with ice-cold methanol and blocked using 1% BSA in PBS for 1 h at 25°C. Cells were then incubated overnight at 4°C with primary antibodies against ICAM-1 and VCAM-1 (Beijing Solarbio Science & Technology Co., Beijing, China) and secondary antibodies conjugated to Cy3 (Merck Millipore, Darmstadt).
  • DAPI staining after 1 hour at 25°C. Two washing steps with PBS were performed between each step. Afterwards, cells were mounted in mounting buffer (Sigma-Aldrich) and observed under a fluorescence microscope.
  • ICAM-1 and VCAM-1 expressed in endothelial cells stimulated by proinflammatory cytokines such as TNF- ⁇ , play an important role in monocyte-endothelial cell adhesion, a step in vascular inflammation.
  • HUVEC cells (1.5 ⁇ 10 cells/well) were seeded in 4-well slide chambers for 24 h, starved overnight, and incubated with IL-32 ⁇ (A94V) (100 ng/mL). After pretreatment for 6 hours, the cells were treated with TNF- ⁇ (10ng/mL).
  • THP-1 cells were labeled with 5 ⁇ M calcein-AM (Molecular Probes, Eugene, OR, USA) for 30 min in RPMI-1640 without FBS. THP-1 cells labeled with calcein-AM were added to 4-well slide chambers containing HUVECs and cultured in RPMI-1640 containing 10% FBS for 30 min. Then, unbound monocytes were removed by washing three times with PBS. The remaining monocytes were determined using fluorescence microscopy. Fluorescence intensity was measured using ImageJ software version 1.5.
  • IL-32 ⁇ (A94V) inhibited the expression of monocyte-endothelial cell adhesion molecules in endothelial cells, thereby reducing monocyte-endothelial cell adhesion ( Figures 15 to 17).
  • Adhesion of calcein-AM-labeled THP-1 (green) to HUVEC was increased by TNF- ⁇ in co-cultures of HUVEC and THP-1 cells.
  • Adhesion between HUVEC and THP-1 cells was significantly reduced by IL-32 ⁇ (A94V) ( Figure 17A). Fluorescence was measured using Image J software ( Figure 17B).
  • IL-32 ⁇ (A94V) inhibits the expression of ICAM-1 and VCAM-1 in HUVECs stimulated with TNF- ⁇ .
  • IL-32 ⁇ (A94V) significantly reduced the phosphorylation level of TNF- ⁇ -induced focal adhesion kinase (FAK), a well-known integrin-mediated signaling molecule that is an upstream molecule of protein kinase B (AKT) and c-Jun. N-terminal kinase (JNK).
  • FAK TNF- ⁇ -induced focal adhesion kinase
  • AKT protein kinase B
  • JNK N-terminal kinase
  • TNF- ⁇ stimulation activates the FAK/AKT signaling pathway, leading to nuclear translocation of NF- ⁇ B (p65/p50) through phosphorylation of I ⁇ B. Additionally, activation of JNK accelerates the nuclear translocation of AP-1 (c-fos/c-jun). These transcription factors promote the expression of ICAM-1 and VCAM-1.
  • AP-1 c-fos/c-jun
  • HUVEC cells 2.5 ⁇ 10 cells/well were seeded in cell culture dishes for 24 h, pretreated with IL-32 ⁇ (A94V) (100 ng/mL) for 1 h, and then as described by the manufacturer.
  • Cells were treated with TNF- ⁇ (10 ng/mL) for 30 min before harvesting and fractionation using NE-PER nuclear and cytoplasmic extraction reagent (Thermo Fisher Scientific) according to the instructions.
  • Equal amounts of proteins from this extract 50 ⁇ g were separated by SDS-polyacrylamide gel electrophoresis and transferred to PVDF membranes. Subsequent steps in the procedure were followed as described for Western blotting above.
  • PARP was used as a nuclear protein marker.
  • IL-32 ⁇ (A94V) slightly attenuated TNF- ⁇ -induced I ⁇ B phosphorylation ( Figure 19A).
  • Nuclear translocation of AP-1 (c-Fos/c-Jun) and NF- ⁇ B (p65/p50) was increased by TNF- ⁇ stimulation and inhibited by IL-32 ⁇ (A94V) ( Figure 19B).
  • IL-32 ⁇ (A94V) regulates the nuclear translocation of AP-1 (c-Fos/c-Jun) and NF- ⁇ B (p65/p50) in HUVECs stimulated with TNF- ⁇ , resulting in ICAM- 1 and VCAM-1 expression are attenuated.
  • the interleukin-32theta mutant (IL-32 ⁇ (281T)) of the present invention regulates the NF- ⁇ B pathway to suppress the expression of inflammatory factors, and EMT markers and cell cycle through the FAK/PI3K/AKT pathway. It has industrial applicability as it can control the progression of cancer, especially breast cancer, by inhibiting related factors.
  • IL-32 ⁇ (281T) binds to the cell surface receptors integrins ⁇ V ⁇ 3 and ⁇ V ⁇ 6 and inhibits the expression of ICAM-1 and VCAM-1 in HUVECs stimulated with TNF- ⁇ , thereby weakening monocyte-endothelial adhesion, thereby preventing atherosclerosis. It has industrial applicability as it can provide anti-inflammatory effects in chronic inflammatory diseases. In addition, it can be used as a research material for various cancers and/or inflammatory diseases, so it has industrial applicability.
  • SEQ ID NO: 1 represents the amino acid sequence of IL-32 ⁇ (A94V).
  • SEQ ID NO: 2 represents the base sequence of IL-32 ⁇ (281T).
  • SEQ ID NO: 3 represents the base sequence of IL-32 ⁇ (281T) for increasing protein expression efficiency.
  • SEQ ID NO: 4 represents the wild type sequence of IL-32 ⁇ (281T).
  • SEQ ID NO: 5 represents the forward primer sequence for GAPDH.
  • SEQ ID NO: 6 represents the reverse primer sequence for GAPDH.
  • SEQ ID NO: 7 represents the forward primer sequence for IL-32 ⁇ .
  • SEQ ID NO: 8 represents the reverse primer sequence for IL-32 ⁇ .
  • SEQ ID NO: 9 represents the forward primer sequence for IL-1 ⁇ .
  • SEQ ID NO: 10 represents the reverse primer sequence for IL-1 ⁇ .
  • SEQ ID NO: 11 represents the forward primer sequence for IL-6.
  • SEQ ID NO: 12 represents the reverse primer sequence for IL-6.
  • SEQ ID NO: 13 represents the forward primer sequence for IL-8.
  • SEQ ID NO: 14 represents the reverse primer sequence for IL-8.
  • SEQ ID NO: 15 represents the forward primer sequence for COX-2.
  • SEQ ID NO: 16 represents the reverse primer sequence for COX-2.
  • SEQ ID NO: 17 represents the forward primer sequence for N-cadherin.
  • SEQ ID NO: 18 represents the reverse primer sequence for N-cadherin.
  • SEQ ID NO: 19 represents the forward primer sequence for Vimentin.
  • SEQ ID NO: 20 represents the reverse primer sequence for Vimentin.
  • SEQ ID NO: 21 represents the forward primer sequence for PCNA.
  • SEQ ID NO: 22 represents the reverse primer sequence for PCNA.
  • SEQ ID NO: 23 represents the forward primer sequence for CDK2.
  • SEQ ID NO: 24 represents the reverse primer sequence for CDK2.
  • SEQ ID NO: 25 represents the forward primer sequence for integrin ⁇ V.
  • SEQ ID NO: 26 represents the reverse primer sequence for integrin ⁇ V.
  • SEQ ID NO: 27 represents the forward primer sequence for integrin ⁇ 3.
  • SEQ ID NO: 28 represents the reverse primer sequence for integrin ⁇ 3.
  • SEQ ID NO: 29 represents the forward primer sequence for integrin ⁇ 6.
  • SEQ ID NO: 30 represents the reverse primer sequence for integrin ⁇ 6.
  • SEQ ID NO: 31 represents the forward primer sequence for ICAM-1.
  • SEQ ID NO: 32 represents the reverse primer sequence for ICAM-1.
  • SEQ ID NO: 33 represents the forward primer sequence for VCAM-1.
  • SEQ ID NO: 34 represents the reverse primer sequence for VCAM-1.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 IL-32θ 뮤턴트(mutant)를 포함하는 염증성 질환 및/또는 암 예방 또는 치료용 약학적 조성물 내지 이의 용도에 대한 것이다. 본 발명의 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)는 염증성 사이토카인 및 케모카인, 염증 매개인자의 및 암의 전이와 증식을 세포 내 경로를 통해서 억제하고, 인간 제대정맥 내피세포 (HUVEC)의 세포내 접착 분자-1(ICAM-1) 및 혈관세포 접착분자-1(VCAM-1)의 발현을 억제하여 단핵구-혈관 내피세포의 접착 저해를 통한 죽상동맥경화증과 같은 염증성 질환의 예방 및 치료 목적으로 활용될 수 있다. 또한 각종 암 및/또는 염증성 질환에 대한 연구 재료로도 활용될 수 있다.

Description

IL-32쎄타 뮤턴트를 포함하는 조성물 내지 이의 용도
본 출원은 2022년 04월 15일 출원된 대한민국 특허출원 제 10-2022-0046961호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 IL-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 암 및/또는 염증성 질환 예방 또는 치료용 약학적 조성물 내지 이의 용도에 대한 것이다.
본 발명은 대한민국 과학기술정보통신부의 지원으로 과제번호 2021R1A2C3014577 (1711129001) 에 의해 완성되었다.
이전에 NK4로 알려진 IL-32는 미토겐(mitogen) 또는 IL-2에 의한 자극 후 활성화된 인간 T 세포 및 NK 세포에서 발현된다. 이전 연구에서는 NK4가 고전적인 사이토카인 신호 전달 경로를 통해 여러 면역 세포에서 IL-8, TNF-α 및 MIP-2와 같은 전염증성 사이토카인을 유도했지만 다른 사이토카인과의 서열 상동성이 결여되어 있음을 보여주었다. 따라서 인터루킨 계열 중 하나인 IL-32로 이름이 변경되었다. 수많은 연구에서 IL-32가 암 성장 및 발달, 바이러스 감염, 크론병, 염증성 장질환, 류마티스 관절염과 같은 만성 염증성 질환과 관련이 있다고 보고했으며, 이는 IL-32가 사이토카인으로서 기능하는 능력을 나타냈다. IL-32 유전자는 8개의 엑손을 포함하며 구조가 다른 몇 가지 스플라이스 변이체가 있다. IL-32α, IL-32β, IL-32γ 및 IL-32δ는 NK 세포에서 처음 발견되었으며 IL-32γ 는 IL-32 이소형 중에서 가장 긴 서열을 가지고 있다. IL-32ε, IL-32ζ, IL-32η, IL-32θ, IL-32sm이 추가로 동정되었으며 총 9종의 이소형이 보고되었다. IL-32에 대한 초기 연구는 그것이 전염증성 사이토카인 임을 시사한다. 그러나 개별 이소형에 대한 추가 연구는 그들이 다른 역할을 한다는 것을 보여준다.
IL-32 이소형 중 하나인 IL-32θ는 IL-32sm을 제외하고 엑손 6이 결실된 유일한 이소형이다. IL-32θ에 대한 이전 연구는 과발현에 국한되었고, 그 특정 수용체가 명확하게 확인되지 않았다. IL-32α 및 IL-32β는 인테그린 αVβ3 및 인테그린 αVβ6 에 결합하는 것으로 보고되었다.
유방암은 전 세계적으로 가장 널리 퍼진 암(전체의 11.7%) 중 하나이며 사망의 주요 원인(모든 사망 원인의 6.9%)으로 나타났다. 이는 여성(24.5%)에서 가장 자주 진단되는 암이며 2020년에 암 관련 사망(15.5%)의 주요 원인 중 하나였다. 유방암의 세계적 발생률은 1980년대와 1990년대에 급격히 증가한 반면, 폐경기 호르몬 요법의 발달로 인해 2000년대 초반에는 발생률이 감소하였다. 그러나 유방암 아형은 세 종류의 수용체, 즉 에스트로겐 수용체, 프로게스테론 수용체 및 인간 표피 성장인자 수용체 2의 부재 또는 존재에 의해 식별된다. 이러한 수용체가 유방암 세포의 표면에서 발현되기 때문에 삼중 음성 유방암(TNBC)은 호르몬 요법의 성공을 감소시키며 이는 대체 치료 전략을 개발할 필요성을 나타낸다. 암 면역학은 암 치료에서 가장 흥미로운 연구 주제 50개 중 하나로 부상했다. 여러 사이토카인, 케모카인 및 암 진행에서 염증 매개체의 역할이 염증, 혈관신생, 항 아폽토시스, 이동 및 증식과 관련하여 연구되었다. 특히, 종양 미세환경에서 가장 풍부한 세포 중 하나인 종양 관련 대식세포(TAM)는 혈관신생, 전이 및 증식을 유도한다. 종양 침윤 면역 세포는 암에서 여러 염증 분자를 자극한다. 2005년 염증성 사이토카인으로 발견된 이후 IL-32의 여러 이소형은 알레르기, 비만, 뇌 질환과 같은 다양한 암과 염증 및 면역 질환에서 서로 다른 비정규적 역할을 하는 것으로 나타났다. 특히, 새로운 이소형인 IL-32θ는 전염증성 사이토카인과 케모카인뿐만 아니라 EMT(epithelial-mesenchymal transition) 마커를 상당히 억제하는 것으로 보고되었다. IL-32에 대한 수많은 연구가 전 세계적으로 수행되었지만 유방암에서 IL-32 이소형의 기능은 아직 알려지지 않았다.
심혈관 질환(CVD, Cardiovascular disease)은 매년 1,670만 명이 사망하는 전 세계적으로 주요 사망 원인이며, 2030년까지 매년 2,360만 명이 CVD로 사망할 것으로 예측된다. 관상동맥질환(CAD)과 관상동맥질환의 가장 흔한 형태인 뇌혈관질환은 개인의 건강을 넘어 사회적 문제로 인식되고 있다. 만성 염증성 질환인 죽상동맥경화증이 근본 원인으로 확인되었다. 죽상동맥경화증은 내피세포의 염증과 손상 및 산화된 저밀도 지단백(ox-LDL)의 축적으로 인해 발생하며, 주변 조직의 섬유화와 혈관 내피세포, 평활근 세포 및 거품 세포로 구성된 플라크 형성을 특징으로 한다. 지질 함유 대식세포로 알려져 있다. 플라크 발달은 신체 여러 부위의 혈관에서 혈류를 방해하여 치명적인 질병을 초래한다. 죽상동맥경화성 병변 형성 초기 단계에서 가장 중요한 단계는 TEM(trans-endothelial migration)으로 단핵구나 백혈구와 같은 면역세포가 내피세포에 부착되어 내피세포 사이로 침투하여 조직으로 이동하는 것을 말한다. 혈관 내피 손상 및 그에 따른 염증 반응은 IL-1β 및 TNF-α 과 같은 염증성 사이토카인에 의해 내피 세포에서 세포내 접착 분자-1(ICAM-1) 및 혈관세포 접착분자-1(VCAM-1)과 같은 세포 접착 분자의 발현을 증가시킨다. 자유 부동 및 혈관 내피 인접 혈액 단핵구는 내피 세포에서 발현되는 ICAM-1 및 VCAM-1에 의해 붙잡힌다. 이러한 접착 분자는 단핵구에서 발현되는 림프구 기능 관련 항원 1(LFA-1) 및 VLA-4(very late antigen-4)와의 각각의 상호작용에 의해 단핵구-내피 접착을 촉진하여 결과적으로 TEM을 촉진한다. 혈관 내피를 통과한 단핵구는 대식세포로 분화되고 대식세포는 ox-LDL의 흡수를 통해 거품 세포를 생성하여 궁극적으로 죽상동맥경화증 및 플라크 발달의 발병기전으로 이어진다. 이전 연구에서는 IL-32β와 IL-32γ가 ICAM-1과 VCAM-1의 상향 조절에 관여하는 전염증성 사이토카인으로 작용한다고 보고된 바 있다. 그러나, CVD 에서 IL-32θ 또는 이의 돌연변이의 기능은 아직 알려지지 않았다.
[선행기술문헌]
[특허문헌]
(특허문헌 1) KR 10-2019-0118813 (2019-09-26)
이에 본 발명자들은 효과적으로 암 및/또는 염증성 질환 억제 효과를 제공할 수 있는 사이토카인을 제공하고자 예의 노력한 결과, 본 발명의 IL-32쎄타 뮤턴트는 염증 반응을 억제하고 면역작용에 의해 암 및/또는 염증성 질환을 억제할 수 있음을 확인하고 본 발명을 완성하였다.
따라서, 본 발명의 목적은 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 암 및/또는 염증성 질환 예방 또는 치료용 약학적 조성물 내지 이의 용도를 제공하는 것이다.
본 발명은 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 암 예방 또는 치료용 약학적 조성물에 대한 것이다.
본 발명의 바람직한 실시예에 따르면, 상기 인터루킨-32쎄타 뮤턴트는 서열번호 1의 아미노산 서열을 포함하는 것이다.
본 발명의 바람직한 일실시예에 따르면, 상기 인터루킨-32쎄타 뮤턴트는 서열번호 2의 염기서열로 암호화되는 것이다.
본 발명의 바람직한 일실시예에 따르면, 상기 인터루킨-32쎄타 뮤턴트는 서열번호 3의 염기서열로 암호화되는 것이다.
본 발명의 바람직한 일실시예에 따르면, 상기 암은 위암, 폐암, 간암, 췌장암, 대장암, 전립선암 및 유방암으로 이루어진 군에서 선택되는 어느 하나 이상인 것이다.
또한, 본 발명은 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 염증성 질환 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 바람직한 일실시예에 따르면, 상기 염증성 질환은 관절염, 류마티스 관절, 통풍, 간염, 천식, 각막염, 위염, 장염, 신장염, 결핵, 기관지염, 흉막염, 복막염, 척추염, 췌장염, 염증성 통증, 요도염, 방광염, 동맥경화증, 패혈증, 피부염, 치주염 및 치은염으로 이루어진 군에서 선택되는 어느 하나 이상인 것이다.
또한, 본 발명은 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 항암용 면역치료제 조성물을 제공한다.
또한, 본 발명은 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 항염증용 면역치료제 조성물을 제공한다.
또한, 본 발명은 서열번호 3의 염기서열을 포함하는 인터루킨-32쎄타 뮤턴트(IL-32θ mutant) 발현용 재조합 벡터를 제공한다.
또한, 본 발명은 암 치료에 사용하기 위한 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)의 용도를 제공한다.
또한, 본 발명은 염증성 질환 치료에 사용하기 위한 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)의 용도를 제공한다.
또한, 본 발명은 암 환자에 인터루킨-32쎄타 뮤턴트(IL-32θ mutant) 를 포함하는 조성물을 투여하는 단계를 포함하는 암 치료방법을 제공한다.
또한, 본 발명은 염증성 질환 환자에 인터루킨-32쎄타 뮤턴트(IL-32θ mutant) 를 포함하는 조성물을 투여하는 단계를 포함하는 염증성 질환 치료방법을 제공한다.
1. 항암 효과
본 발명에서는 생어(Sanger) 시퀀싱을 사용하여 유방암 환자(n = 34)의 조직에서 281번째 점 돌연변이(C에서 T로)를 발견했다(IL-32θ(281T)). 생어 시퀀싱의 한계로 인해 시퀀싱을 위해 PCR 밴드의 강도를 기반으로 선별된 환자의 조직에서 34개의 IL-32θ RT-PCR 제품을 사용했다. 선택된 모든 RT-PCR 생성물 서열은 94번째 코돈에서 알라닌을 발린으로 변형시키는 281번째 C에서 T로의 점 돌연변이를 보유하였다(281C>T, Ala94Val; 도 2a). 또한 IL-32θ(281T)가 종양 염증 및 유방암 진행에 미치는 영향을 조사하기 위해 종양 조직에서 RT-qPCR 결과를 재배열했다. 특히 염증인자(IL-1β, IL-8, COX-2), 중간엽 표지자(vimentin, N-cadherin), 증식 관련 인자(PCNA, CDK2)는 IL-32θ(281T)발현 종양 조직에서 유의하게 억제되었다. 이러한 결과는 IL-32θ(281T)가 종양 진행 및 발달을 억제함을 시사한다(도 3).
염증은 세균 및 바이러스 감염을 포함한 유해한 자극에 대한 면역계 반응이다. 그러나 염증에 의해 여러 질병이 유발된다. 다양한 염증 인자가 종양 형성을 진행시키는 것으로 밝혀졌다. IL-1β는 유방암에서 종양 증식, 혈관신생 및 이동을 시작하는 IL-1 계열의 주요 사이토카인이다. IL-6는 염증 반응, 혈관신생, 세포사멸 억제, 암 줄기세포 형성 및 유방암의 이동과 관련된 기능적 사이토카인이다. 마찬가지로 IL-8은 혈관신생, 종양 성장, 증식 및 전이와 관련이 있다. COX-2는 아라키돈산을 프로스타글란딘 E2(PGE2)의 전구체인 프로스타글란딘 H2(PGH2)로 전이하도록 유도한다. PGE2는 종양 형성, 종양 진행, 혈관신생 및 유방암의 이동에 관여한다. 전사 인자 NF-κB는 IL-1β, IL-6, IL-8 및 COX-2와 같은 염증 인자를 유도하는 것으로 보고되었다. IκBα는 단백질-단백질 상호작용을 통해 NF-κB의 전위를 조절하는 NF-κB 결합 단백질이다. NF-κB의 핵 전위는 AKT 인산화를 통한 IκBα의 분해에 의해 유발된다. 임상 결과를 바탕으로 매우 공격적인 삼중 음성 유방암 세포주인 MDA-MB-231을 선택했다. RT-qPCR 분석은 염증 인자의 mRNA 수준이 MDA-MB-231 세포에서 IL-32θ(281T)에 의해 억제됨을 보여주었다(도 4b). 또한, COX-2의 단백질 발현량은 웨스턴 블롯팅으로 확인하였고, IL-1β, IL-6, IL-8, PGE2 등의 분비 단백질 발현량은 각각의 ELISA 키트를 이용하여 확인하였다(도 5a의 A, B, C). 이러한 결과는 IL-32θ(281T)가 EV 형질감염된 세포와 비교하여 CM-자극된 MDA-MB-231 세포에서 염증인자 및 PGE2의 수준을 감소시킴을 입증하였다(도 5a의 D). 또한, IL-32θ(281T)는 CM으로 자극된 MDA-MB-231 세포의 핵으로의 NF-κB의 전위를 억제하였다(도 5b). 이러한 데이터는 종양 진행 및 공격성과 관련된 염증 인자가 유방암 세포에서 IL-32θ(281T)에 의해 억제됨을 시사한다.
EMT는 다양한 단백질에 의해 조절되고 결정되는 전이 단계이다. 중간엽 세포는 세포골격과 관련된 높은 수준의 비멘틴과 피브로넥틴을 발현한다. 또한 세포 간 접착 매개체(E-cadherin, N-cadherin)는 상피 및 중간엽 유형을 결정하는 데 필수적인 단백질이다. 이러한 인자는 여러 신호 경로를 통해 염증 인자에 의해 조절된다. 본 발명자들은 IL-32θ(281T)가 유방암 세포의 이동을 조절할 수 있는지 여부를 조사했다. EV 형질감염된 세포와 비교하여, IL-32θ(281T)-발현 유방암 세포에서 이동 속도가 유의하게 감소하였다(도 6a, 6b). 또한, 웨스턴 블롯 분석은 중간엽 마커(N-cadherin, vimentin, fibronectin)가 IL-32θ(281T)에 의해 하향 조절되는 반면(도 7a, 7b), 상피 마커(E-cadherin)는 IL-32θ(281T)에 의해 상향 조절됨을 보여주었다. 또한, IF 분석은 세포 표면에서 IL-32θ(281T)에 의해 E-카데린이 증가한 반면 N-카데린은 감소되었음을 입증하였다(도 7a, 7b). 이러한 결과는 IL-32θ(281T)가 유방암 세포의 중간엽 전이를 억제한다는 사실을 뒷받침한다.
β-카테닌의 핵 전위는 암에서 간엽 및 염증 인자의 전사를 유도한다. β-카테닌 분해 및 전위는 글리코겐 신타제 키나아제 3β(GSK3β)와의 상호작용에 의해 조절된다. FAK/PI3K/AKT 경로는 인산화를 통해 GSK3β의 분해를 유도한다. 또한, FAK 경로는 단백질-단백질 상호작용을 통해 IL-32에 의해 조절된다고 보고되었다. 본 발명에서 웨스턴 블롯 분석은 FAK의 발현과 인산화가 IL-32θ(281T)에 의해 감소됨을 보여주었다. 또한 PI3K와 AKT의 인산화는 FAK 억제를 통해 IL-32θ(281T)에 의해 억제되었다. 마지막으로, β-카테닌의 분해는 GSK3β 분해의 억제를 통해 IL-32θ(281T)에 의해 증가되었다(도 8).
AKT는 암에서 세포 증식 및 생존의 잘 알려진 조절인자이다. CDK와 사이클린 복합체는 세포 주기 체크 포인트의 조절을 통해 증식을 유도한다. 특히, 사이클린 A/CDK2 복합체의 하향 조절은 S기 및 G2/M기 세포 주기 정지를 유도한다. PCNA는 DNA 복제를 지원하는 DNA 클램프이다. 사이클린 의존성 키나아제 억제제 1(p21)은 CDK/사이클린 복합체에 결합하여 세포주기를 억제한다. IL-32θ(281T)가 유방암 세포의 증식을 조절할 수 있는지 여부를 조사했다. IL-32θ(281T)-발현 세포는 EV 형질감염된 세포보다 감소된 세포 증식을 보였다(도 9a). 또한, 웨스턴 블롯팅 분석 결과 세포주기 관련인자(PCNA, cyclin A, cdk2, p21)가 FAK/PI3K/AKT 경로를 통해 IL-32θ(281T)에 의해 조절됨이 밝혀졌다(도 9a 의 C). Flow cytometry 분석은 또한 유방암 세포에서 IL-32θ(281T)에 의해 S기 및 G2/M기 세포 주기 정지가 유도됨을 보여주었다. 이러한 데이터는 IL-32θ(281T)가 FAK/PI3K/AKT 경로를 통해 유방암 세포에서 세포 주기 관련 인자(PCNA, cyclin A, cdk2 및 p21)를 억제함으로써 유방암 증식을 억제한다는 생각을 뒷받침한다.
결론적으로 본 발명자들은 세포 내 NF-κB(p65/p50) 및 FAK/PI3K/AKT 경로를 조절하여 염증, EMT 및 유방암 세포 주기를 억제하는 IL-32θ의 새로운 돌연변이를 확인하였다(도 10). 본 발명의 IL-32θ(281T)는 염증, EMT 및 세포 주기 정지에 미치는 영향으로 인해 유방암의 진행을 억제하기 위한 잠재적인 치료 전략에 사용될 수 있다.
2. 항염증 효과
본 발명에서는 IL-32θ의 위치 281(281T)에서 시토신(cytosine)이 티민(thymine)으로 대체된 IL-32θ(281T)의 세포 표면 수용체를 조사하고 인간 제대정맥 내피세포(HUVEC)에 미치는 영향을 평가했다. 재조합 인간 IL-32θ(281T)는 Ni-NTA 및 IL-32 mAb(KU32-52)-커플링된 아가로스 컬럼을 사용하여 발현, 분리 및 정제되었다. 본 발명자들은 IL-32θ(A94V)가 인테그린 αVβ3 및 αVβ6에 결합할 수 있음을 관찰했으며, 이는 인테그린이 IL-32θ(A94V)에 대한 세포 표면 수용체로 작용함을 시사한다. IL-32θ(A94V)는 IL-32β 및 IL-32γ와 같은 다른 이소형과 대조적으로 종양괴사인자(TNF)-α-자극된 HUVEC에서 세포내 세포접착분자-1(ICAM-1)과 혈관세포접착분자-1(VCAM-1)의 발현을 억제하여 단핵구-내피접착을 유의하게 약화시켰다. IL-32θ(A94V)는 또한 FAK(focal adhesion kinase)의 인산화를 억제함으로써 단백질 키나아제 B(AKT) 및 c-jun N-말단 키나아제(JNK)의 TNF-α 유도 인산화를 감소시켰다. 또한 IL-32θ(A94V)는 ICAM-1 및 VCAM-1 발현에 관여하는 NF-κB(nuclear factor kappa B) 및 AP-1(activator protein 1)의 핵 전위를 조절했다. ICAM-1 및 VCAM-1에 의해 매개되는 단핵구-내피 접착은 심혈관 질환의 주요 원인인 죽상동맥경화증의 중요한 초기 단계이다. 본 발명은 IL-32θ(A94V)가 세포 표면 수용체인 인테그린 αVβ3 및 αVβ6에 결합하고 TNF-α로 자극된 HUVEC에서 ICAM-1 및 VCAM-1의 발현을 억제함으로써 단핵구-내피 접착을 약화시킨다는 것을 시사한다. 이러한 결과는 IL-32θ(A94V)가 동맥경화증과 같은 만성 염증성 질환에서 항염증성 사이토카인으로 작용할 수 있음을 입증한다.
구체적으로, 본 발명자들은 Nde1과 Age1 제한 효소를 사용하여 재조합 벡터를 설계했다(도 11). 벡터를 열충격법으로 E.coli 균주 중 하나인 Rosetta에 형질전환시켰다. 삽입 DNA에는 정제를 위한 His-tag가 포함되어 있다. Ni-NTA 컬럼과 IL-32 mAb KU32-52 결합 CNBr-활성화 Sepharose 4B 컬럼의 순차 정제를 사용하여 순수한 IL-32θ(A94V)를 얻었다. 정제된 단백질은 SDS-PAGE와 웨스턴 블롯으로 확인하였다(도 12).
IL-32θ(281T)를 포함한 대부분의 IL-32 이소형은 RGD 모티프를 가지며 인테그린 αVβ3 및 αVβ6은 RGD 모티프에 결합하는 것으로 알려져 있다. 또한, 이들 인테그린은 IL-32α 및 IL-32β와 결합하는 것으로 보고되었다. 따라서 IL-32θ(A94V)도 이러한 인테그린에 결합할 것이라는 가설을 세웠다. 단백질-단백질 결합 예측에서, IL-32는 인테그린 αVβ3보다 인테그린 αVβ6에서 더 높은 도킹 점수를 보였다(도 13). 그러나 IL-32θ(A94V)-인테그린 결합 분석에서는 유의한 차이가 확인되지 않았다. IL-32θ(A94V)는 용량 의존적 방식으로 인테그린 αVβ3 및 αVβ6 모두에 결합하는 것으로 밝혀졌으며(도 14a), 이러한 인테그린이 IL-32θ(A94V)에 대한 수용체로 작용할 수 있음을 시사한다. 그러나 상호작용은 짧은 RGD 펩타이드를 포함하는 cyclo-(RGDfV)에 의해 차단되지 않았으며 이는 예상과 달리 IL-32θ(A94V)-인테그린 결합이 RGD 모티프에 의해 매개되지 않음을 나타낸다(도 14b). FBS에 포함된 파이브로넥틴(fibronectin), 비트로넥틴(vitronectin), 성장인자와 같은 세포외 기질은 인테그린에 결합하는 것으로 알려져 있다. 이들은 인테그린에 결합하여 인테그린-IL-32θ(A94V) 상호작용을 차단할 수 있다. 예상대로 무혈청 배지와 비교하여 10% FBS 함유 배지에서 상호작용이 감소하는 것을 관찰했다(도 14c).
RT-PCR 분석은 HUVEC 세포에서 인테그린 αVβ3 및 αVβ6의 발현을 확인했지만 THP-1 인간 단핵구 세포에서는 발현하지 않았다. 본 발명자들은 또한 IL-32θ(A94V)-전처리된 HUVEC에서 TNF-α에 의해 유도된 ICAM-1 및 VCAM-1 발현의 상향조절이 유의하게 감소하였음을 입증하였다(도 15, 도 16). 이러한 결과는 이러한 세포 부착 분자의 발현을 유도하는 것으로 알려진 IL-32β 및 IL-32γ와 비교하여 IL-32θ(A94V)의 반대 역할을 보여준다.
본 발명자들은 이러한 세포 접착 분자에 의해 매개되는 단핵구-내피 접착이 IL-32θ(A94V)에 의해 약화되는지 여부를 조사했다. THP-1 단핵구는 형광 염료 calcein-AM으로 염색하고 HUVEC와 공동 배양했다. 몇 번의 세척 후, TNF-α 처리된 THP-1 세포의 녹색 염색 형광 강도는 상당히 강화된 반면, 단핵구의 형광 강도는 IL-32θ(A94V)에 의해 감소되었다(도 17). 이러한 결과는 IL-32θ(A94V)가 TNF-α로 자극된 HUVEC에서 세포 부착 분자인 ICAM-1 및 VCAM-1의 발현을 억제함으로써 단핵구 내피 부착을 약화시킨다는 것을 입증했다.
FAK는 잘 알려진 인테그린 매개 신호 분자로 다양한 사이토카인과 성장 인자에 의해 유도되는 세포 내 신호에 밀접하게 관여한다. 이들 분자에 의해 유도된 인산화된 FAK는 AKT 및 JNK 신호 경로를 활성화시킨다. AKT의 활성화는 NF-κB의 핵 전위를 촉진하는 IκB의 인산화를 유도한다. JNK는 또한 AP-1의 핵 전위를 유발한다. HUVEC에서 ICAM-1 및 VCAM-1의 발현은 전사 인자 AP-1 및 NF-κB에 의해 가속화된다. IL-32θ(A94V)는 JNK 및 AKT의 상류에 있는 FAK의 TNF-α 유도 인산화를 억제함으로써 이 신호 전달 경로를 하향 조절하여 ICAM-1 및 VCAM-1 발현을 약화시킨다.
종합하면, 본 발명의 IL-32θ(A94V)는 HUVEC에서 인테그린-매개 신호전달을 통해 죽상경화증의 핵심 인자인 ICAM-1 및 VCAM-1의 발현을 억제함으로써 단핵구-내피 유착을 약화시켰다(도 17). 이 증거는 죽상경화증과 같은 만성 염증성 질환의 치료에서 IL-32θ(A94V)의 잠재적인 역할을 입증한다.
따라서, 본 발명은 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 암 예방 또는 치료용 약학적 조성물을 제공할 수 있다.
본 발명의 바람직한 실시예에 따르면, 상기 IL-32θ뮤턴트는 서열번호 1의 아미노산 서열을 일부 또는 전부 포함하는 것일 수 있다.
본 발명의 인터루킨-32쎄타 뮤턴트의 유전자는 기존의 인터루킨-32 쎄타의 일부 염기서열이 결실되고, 바람직하게는 6번 엑손의 일부 염기서열이 결실되며, 보다 바람직하게는 상기 6번 엑손의 144번 염기부터 203번 염기가 결실되어 있을 수 있다.
본 발명의 바람직한 실시예에 따르면, 상기 IL-32θ뮤턴트는 서열번호 2의 염기서열로 암호화되는 것일 수 있다.
본 발명의 바람직한 실시예에 따르면, 상기 IL-32θ뮤턴트는 서열번호 3의 염기서열로 암호화되는 것일 수 있다.
상기 서열번호 3의 염기서열은 서열번호 2의 염기서열보다 효율적으로 재조합 IL-32θ뮤턴트 단백질을 제조 내지 발현시키는데 사용될 수 있다.
본 발명의 바람직한 일실시예에 따르면, 상기 암은 위암, 폐암, 간암, 췌장암, 대장암, 전립선암 및 유방암으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다.
본 발명의 '예방'이란, 본 발명의 인터루킨-32쎄타 뮤턴트로 인해 암 내지 염증성 질환 관련 질환이 억제되거나 그 발병이 지연되도록 하는 모든 행위를 의미한다.
본 발명의 '개선' 또는 '치료'란, 본 발명의 인터루킨-32쎄타 뮤턴트로 인해 암 내지 염증성 질환 관련 질환과 관련된 파라미터, 예를 들면 증상의 정도가 호전되거나 이롭게 되도록 하는 모든 행위를 의미한다.
본 발명의 약학적 조성물은 비경구의 여러 가지 제형일 수 있다. 상기 조성물을 제형화 할 경우에는 하나 이상의 완충제(예를 들어, 식염수 또는 PBS), 항산화제, 정균제, 킬레이트화제(예를 들어, EDTA 또는 글루타치온), 충진제, 증량제, 결합제, 아쥬반트(예를 들어, 알루미늄 하이드록사이드), 현탁제, 농후제 습윤제, 붕해제 또는 계면활성제, 희석제 또는 부형제를 사용하여 조제될 수 있다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁용제, 유제, 동결건조제제 또는 좌제 등이 포함된다. 비수성용제 및 현탁용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세롤, 젤라틴 등이 사용될 수 있다.
본 발명의 조성물은 경구 또는 비경구로 투여될 수 있으며, 비경구 투여 시 피부외용, 복강내, 직장, 정맥, 근육, 피하 또는 뇌혈관내 주사하는 주사제의 형태로 당업계에 공지된 방법에 따라 제형화 할 수 있다.
상기 주사제의 경우에는 반드시 멸균되어야 하며 박테리아 및 진균과 같은 미생물의 오염으로부터 보호되어야 한다. 주사제의 경우 적합한 담체의 예로는 이에 한정되지는 않으나, 물, 에탄올, 폴리올(예를 들어, 글리세롤, 프로필렌 글리콜 및 액체 폴리에틸렌 글리콜 등), 이들의 혼합물 및/또는 식물유를 포함하는 용매 또는 분산매질 일 수 있다. 보다 바람직하게는, 적합한 담체로는 행크스 용액, 링거 용액, 트리에탄올 아민이 함유된 PBS (phosphate buffered saline) 또는 주사용 멸균수, 10% 에탄올, 40% 프로필렌 글리콜 및 5% 덱스트로즈와 같은 등장 용액 등을 사용할 수 있다. 상기 주사제를 미생물 오염으로부터 보호하기 위해서는 파라벤, 클로로부탄올, 페놀, 소르빈산, 티메로살 등과 같은 다양한 항균제 및 항진균제를 추가로 포함할 수 있다. 또한, 상기 주사제는 대부분의 경우 당 또는 나트륨 클로라이드와 같은 등장화제를 추가로 포함할 수 있다.
본 발명의 조성물은 약제학적으로 유효한 양으로 투여한다. 약제학적으로 유효한 양은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 즉, 본 발명의 조성물의 총 유효량은 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)으로 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
본 발명의 조성물은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
또한, 본 발명은 IL-32θ뮤턴트(mutant)를 포함하는 염증성 질환 예방 또는 치료용 약학적 조성물을 제공할 수 있다.
상기 인터루킨-32쎄타 뮤턴트 및 상기 약학적 조성물은 상기 암 예방 또는 치료용 약학적 조성물에서 사용된 개념과 동일하므로 설명은 그 기재로 대신한다.
본 발명의 바람직한 실시예에 따르면, 상기 염증성 질환은 관절염, 류마티스 관절염, 통풍, 간염, 천식, 각막염, 위염, 장염, 신장염, 결핵, 기관지염, 흉막염, 복막염, 척추염, 췌장염, 염증성 통증, 요도염, 방광염, 동맥경화증, 패혈증, 피부염, 치주염 및 치은염으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다.
또한, 본 발명은 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 항암용 면역치료제 조성물 또는 항염증용 면역치료제 조성물을 제공할 수 있다.
상기 면역치료제는 체내 면역세포의 특성을 이용해 부작용을 최대로 줄이면서 인체의 면역반응을 증진 또는 억제해 질병을 치료하는 치료제를 의미할 수 있다.
본 발명의 인터루킨-32쎄타 뮤턴트는 다른 IL-32들과는 차별화된 전혀 새로운 기능을 가지는 새로운 염증 억제성 사이토카인으로서, 각종 암 내지 염증성 질환을 예방 및 치료하는 면역치료제로서 사용될 수 있다. 상기 암은 위암, 폐암, 간암, 췌장암, 대장암, 전립선암 및 유방암으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다.
상기 염증성 질환에는 관절염, 류마티스 관절, 통풍, 간염, 천식, 각막염, 위염, 장염, 신장염, 결핵, 기관지염, 흉막염, 복막염, 척추염, 췌장염, 염증성 통증, 요도염, 방광염, 동맥경화증, 패혈증, 피부염, 치주염 및 치은염으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다.
상기 인터루킨-32쎄타 뮤턴트는 상기 암 예방 또는 치료용 약학적 조성물에서 사용된 개념과 동일하므로 설명은 그 기재로 대신한다.
또한, 본 발명은 서열번호 3의 염기서열을 포함하는 인터루킨-32쎄타 뮤턴트(IL-32θ mutant) 발현용 재조합 벡터를 제공할 수 있다.
상기 서열번호 3의 염기서열은 서열번호 2의 염기서열보다 효율적으로 재조합 IL-32θ뮤턴트 단백질을 제조 내지 발현시키는데 사용될 수 있다.
상기 인터루킨-32쎄타 뮤턴트는 상기 암 예방 또는 치료용 약학적 조성물에서 사용된 개념과 동일하므로 설명은 그 기재로 대신한다.
또한, 본 발명은 암 치료에 사용하기 위한 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)의 용도를 제공할 수 있다.
상기 인터루킨-32쎄타 뮤턴트는 상기 암 예방 또는 치료용 약학적 조성물에서 사용된 개념과 동일하므로 설명은 그 기재로 대신한다.
본 발명의 바람직한 일실시예에 따르면, 상기 암은 위암, 폐암, 간암, 췌장암, 대장암, 전립선암 및 유방암으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다.
또한, 본 발명은 염증성 질환 치료에 사용하기 위한 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)의 용도를 제공할 수 있다.
상기 인터루킨-32쎄타 뮤턴트는 상기 암 예방 또는 치료용 약학적 조성물에서 사용된 개념과 동일하므로 설명은 그 기재로 대신한다.
본 발명의 바람직한 실시예에 따르면, 상기 염증성 질환은 관절염, 류마티스 관절염, 통풍, 간염, 천식, 각막염, 위염, 장염, 신장염, 결핵, 기관지염, 흉막염, 복막염, 척추염, 췌장염, 염증성 통증, 요도염, 방광염, 동맥경화증, 패혈증, 피부염, 치주염 및 치은염으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다.
또한, 본 발명은 암 환자에 인터루킨-32쎄타 뮤턴트(IL-32θ mutant) 를 포함하는 조성물을 투여하는 단계를 포함하는 암 치료방법을 제공할 수 있다.
상기 인터루킨-32쎄타 뮤턴트는 상기 암 예방 또는 치료용 약학적 조성물에서 사용된 개념과 동일하므로 설명은 그 기재로 대신한다.
본 발명의 바람직한 일실시예에 따르면, 상기 암은 위암, 폐암, 간암, 췌장암, 대장암, 전립선암 및 유방암으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다.
상기 투여는 상기 암 예방 또는 치료용 약학적 조성물에서 사용된 개념과 동일하므로 설명은 그 기재로 대신한다.
또한, 본 발명은 염증성 질환 환자에 인터루킨-32쎄타 뮤턴트(IL-32θ mutant) 를 포함하는 조성물을 투여하는 단계를 포함하는 염증성 질환 치료방법을 제공할 수 있다.
상기 인터루킨-32쎄타 뮤턴트는 상기 암 예방 또는 치료용 약학적 조성물에서 사용된 개념과 동일하므로 설명은 그 기재로 대신한다.
본 발명의 바람직한 실시예에 따르면, 상기 염증성 질환은 관절염, 류마티스 관절염, 통풍, 간염, 천식, 각막염, 위염, 장염, 신장염, 결핵, 기관지염, 흉막염, 복막염, 척추염, 췌장염, 염증성 통증, 요도염, 방광염, 동맥경화증, 패혈증, 피부염, 치주염 및 치은염으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다.
상기 투여는 상기 암 예방 또는 치료용 약학적 조성물에서 사용된 개념과 동일하므로 설명은 그 기재로 대신한다.
본 발명의 인터루킨-32쎄타 뮤턴트{IL-32θ mutant, IL-32θ(281T) 또는 IL-32θ(A94V)}는 NF-κB 경로를 조절하여 염증 인자의 발현을 억제하고, FAK/PI3K/AKT 경로를 통해 EMT 마커 및 세포 주기 관련 인자를 억제함으로써 암, 특히 유방암의 진행을 조절할 수 있다. 또한 IL-32θ(281T) 가 세포 표면 수용체인 인테그린 αVβ3 및 αVβ6 에 결합하고 TNF-α로 자극된 HUVEC에서 ICAM-1 및 VCAM-1의 발현을 억제함으로써 단핵구-내피 접착을 약화시킴으로써 동맥경화증과 같은 만성 염증성 질환에서 항염증 효과를 제공할 수 있다. 또한 각종 암 및/또는 염증성 질환에 대한 연구 재료로도 활용될 수 있다.
도 1은 유방암 조직(조직번호 65~80)에서 IL-32θ및 IL-32β의 mRNA 발현에 대한 RT-PCR 결과 일부를 나타낸다. 엑손 5에서 엑손 7까지의 서열을 표적으로 하는 프라이머(정방향 프라이머: 5'-ACGTGGACAGGTGATGTCGA-3, 서열번호 7'; 역방향 프라이머: 5'-GAGCAGCAGAAACTCTGGAA-3', 서열번호 8)는 IL-32θ를 검출하도록 설계되었다(297 bp).
도 2a는 유방암 및 주변 정상 조직에서의 생어(Sanger) 시퀀싱 데이터 중 하나를 나타낸다. IL-32θ의 점 돌연변이는 유방 종양 조직(n = 16)과 인접한 정상 조직(n = 18)의 무작위로 선택된 34개의 샘플에서 발견되었다. IL-32θ mRNA를 RT-PCR로 증폭하고 겔 추출 키트를 사용하여 DNA를 분리하였다.
도 2b는 야생형 IL-32θ(서열번호 4) 및 돌연변이 IL-32θ(281T)(서열번호 2)의 서열을 나타낸다. 돌연변이 지점은 빨간색으로 강조 표시된다. 야생형 서열은 GenBank(FJ985780.1)에서 검색되었다.
도 3은 유방 종양 조직에서 IL-32θ(281T) 발현 유무에 따른 염증성 인자(IL-1β, IL-6, IL-8, COX-2), EMT 인자(N-cadherin, vimentin) 및 증식인자(CDK2, PCNA)의 RT-qPCR 결과를 나타낸다. 상자를 가로지르는 선은 중앙값을 나타낸다. 통계적 유의성은 Student's t-test를 이용하여 분석하였다(*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 501 0.0001, n = 90).
도 4a는 MDA-MB-231 세포에서 염증 인자의 mRNA 수준에 대한 IL-32θ(281T)의 조절 효과를 나타낸다. (A) 리포펙타민을 사용하여 EV- 및 IL-32θ(281T)-과발현 MDA-MB-231 세포를 확립하였다. (B) 형질감염된 MDA-MB-231 세포의 세포 형태학적 변화를 나타낸다. 스케일 바, 50μm.
도 4b는 MDA-MB-231 세포에서 염증 인자의 mRNA 수준에 대한 IL-32θ(281T)의 조절 효과를 나타낸다. (C, D) 염증 인자의 mRNA 수준은 암 유래 마크로파지(Tumor-associated macrophage) 유사 M2 마크로파지 분비 조절 배지(CM) 유무에 관계없이 RT-qPCR에 의해 확인되었다. 결과는 세 가지 실험의 평균 ± SD를 나타낸다(Student's t-test 및 Tukey's honest test 를 통한 One-way ANOVA *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n = 3).
도 5a는 IL-32θ(281T)의 사이토카인 발현 및 NF-κB의 핵 전위에 대한 조절 효과를 나타낸다. (A) IL-1β, IL-6 및 IL-8의 분비 수준은 CM으로 자극된 MDA-MB-231 세포로부터 얻은 상등액을 사용하여 ELISA로 분석하였다. (B, C) COX-2의 단백질 수준은 CM으로 자극된 MDA-MB-231 세포에서 웨스턴 블롯팅에 의해 분석되었다. 강도는 ImageJ를 사용하여 정량화되었다. (D) 경쟁 ELISA에 의해 PGE2 수준을 정량화하였다. 막대 그래프는 각 샘플에 대한 내부 통제로 정규화한 후 웨스턴 블롯팅 밴드의 강도를 보여준다. 결과는 세 가지 실험의 평균 ± 표준편차를 나타낸다(Tukey's honest test 를 통한 One-way ANOVA *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n = 3).
도 5b는 IL-32θ(281T)의 사이토카인 발현 및 NF-κB의 핵 전위에 대한 조절 효과를 나타낸다. (E, F) 웨스턴 블롯 분석으로 얻은 NF-κB의 핵 전위에 대한 IL-32θ(281T)의 조절 효과를 나타낸다. 막대 그래프는 각 샘플에 대한 내부 통제로 정규화한 후 웨스턴 블롯팅 밴드의 강도를 보여준다. 강도는 Image J를 사용하여 정량화되었다. 결과는 세 가지 실험의 평균 ± 표준편차를 나타낸다(Tukey's honest test 를 통한 One-way ANOVA *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n = 3).
도 6a는 유방암 세포 이동에 대한 IL-32θ(281T)의 조절 효과를 나타낸다. 상처 치유 분석을 위해 MDA-MB-231 세포(1.5 x 105 세포/웰) 및 MDA-MB-468 세포(3 x 105 세포/웰)를 24-웰 플레이트에 시딩했다. 멸균 200 μL 피펫 팁을 사용하여 플레이트를 긁고 PBS로 세척하고 CM이 있거나 없는 무혈청 배지를 24시간 동안 첨가했다. 스케일 바, 200μm. 상처 부위는 Image J를 사용하여 정량화되었다.
도 6b는 유방암 세포 이동에 대한 IL-32θ(281T)의 조절 효과를 나타낸다. 상처 치유 분석을 위해 MDA-MB-231 세포(1.5 x 105 세포/웰) 및 MDA-MB-468 세포(3 x 105 세포/웰)를 24-웰 플레이트에 시딩했다. 멸균 200 μL 피펫 팁을 사용하여 플레이트를 긁고 PBS로 세척하고 CM이 있거나 없는 무혈청 배지를 24시간 동안 첨가했다. 상처 부위는 Image J를 사용하여 정량화되었다. 결과는 세 가지 실험의 평균 ± 표준 편차를 나타낸다(Tukey's honest test 를 통한 One-way ANOVA *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n=3).
도 7a는 IL-32θ(281T)가 유방암 세포의 상피-중간엽 전이 표지자에 미치는 조절 효과를 나타낸다. 상피-중간엽 전이 관련 단백질(fibronectin, N-cadherin, vimentin, E-cadherin) 발현을 웨스턴 블롯팅으로 분석하였다.
도 7b는 IL-32θ(281T)가 유방암 세포의 상피-중간엽 전이 표지자에 미치는 조절 효과를 나타낸다. E-카데린 및 N-카데린 발현을 면역형광으로 분석하였다.
도 8은 IL-32θ(281T)가 유방암 세포 내 신호 전달 경로(FAK, PI3K, AKT, GSK3β, β-카테닌)에 미치는 조절 효과의 웨스턴 블롯팅 분석결과를 나타낸다. EV- 및 IL-32θ형질감염된 유방암 세포(2 × 105개 세포/ml)를 60pi 접시에 파종하고 48시간 동안 배양하였다.
도 9a는 유방암 세포의 증식에 대한 IL-32θ(281T)의 조절 효과를 나타낸다. (A) EV- 및 IL-32θ(281T)-형질감염된 유방암 세포의 시간 의존적 세포 생존능 분석 결과를 나타낸다. (B) EV- 및 IL-32θ(281T)-형질감염된 유방암 세포의 세포 증식 분석 결과를 나타낸다. EV- 및 IL-32θ(281T)-형질감염된 유방암 세포를 72시간 동안 배양하였다. (C) 웨스턴 블롯팅으로 측정한 유방암 세포에서 세포 주기 관련 인자(cyclin A, Cdk2, PCNA, p21)의 발현에 대한 IL-32θ(281T)의 영향을 나타낸다.
도 9b는 유방암 세포의 증식에 대한 IL-32θ(281T)의 조절 효과를 나타낸다. (D) PI 염색 및 유동 세포 계측법으로 분석한 세포주기 정지를 나타낸다. 결과는 세 가지 실험의 평균 ± SD를 나타낸다(Student's t-test *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n=3).
도 10은 돌연변이된 IL-32θ(281T)가 세포 내 경로에 미치는 조절 효과의 개략도를 나타낸다. IL-32θ(281T)는 FAK 및 IκBα의 인산화를 억제한다. IL-32θ(281T)는 인산화된 FAK를 억제하여 β-카테닌의 발현 및 전위를 억제한다. 또한 NF-κB는 인산화된 IκBα의 억제를 통해 IL-32θ(281T)에 의해 억제된다. 따라서 IL-32θ(281T)는 FAK-PI3K-GSK3 및 NF-κB 경로를 통해 유방암의 이동, 증식 및 염증을 감소시킨다.
도 11은 돌연변이 IL-32θ(281T) 발현 벡터 및 IL-32θ(281T) 정제의 개략도를 나타낸다. 단백질 발현벡터로는 pTH24를 백본으로 하는 TEVSH를 사용하였다. His 태그는 정화를 위해 포함되었다. Nde1, Age1 제한 효소를 사용하여 재조합 DNA를 구성하였다.
도 12는 SDS-PAGE(A) 및 KU32-52 mAb(B) 또는 항-His 태그 mAb(C)를 사용한 웨스턴 블롯을 사용하여 IL-32θ(281T)의 발현 및 정제를 수행한 결과를 나타낸다. 돌연변이 IL-32θ(281T)를 Ni-NTA 컬럼에 이어 IL-32mAb(KU32-52) 결합 CNBr-활성화 세파로스 4B로 2회 정제했다. Ni-NTA 컬럼에 결합된 IL-32θ(281T)를 500mM 이미다졸(imidazole)로 용출하고, 낮은 pH 트리스-글리신 완충액(pH 3.0)을 사용하여 IL-32 mAb(KU32-52)-커플링된 CNBr-활성화 세파로스 4B에 의해 추가 정제를 수행하였다(L, IL-32θ(281T) 발현 벡터를 포함하는 대장균의 용해물; FT, flow through; W, washing flow; E, 용출(elution); E2-E13, 낮은 pH 트리스-글리신 완충액(pH 3.0)을 사용하여 용출됨).
도 13은 IL-32θ(A94V) 및 IL-32θ(A94V)-인테그린 결합 예측의 3D 구조 모델링 결과를 나타낸다. 단백질-단백질 결합은 HDOCK 서버(IL-32θ(A94V): 노란색, 인테그린: 주황색)에 의해 예측되었다. IL-32θ(A94V)의 3차 구조는 I-TASSER에 의해 구축되었고 인테그린은 PDB에 의해 제공되었다.
도 14a는 재조합 αVβ3 및 αVβ6 인테그린에 대한 IL-32θ(A94V) 결합을 나타낸다. IL-32θ(A94V)는 재조합 αVβ3 및 αVβ6 인테그린에 결합한다. 인테그린 αVβ3 및 αVβ6 에 대한 IL-32θ(A94V)의 결합을 IL-32 mAb(KU32-52)를 사용하여 평가하였다. 결과는 세 가지 실험의 평균 ± 표준 편차를 나타낸다(*p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 by one-way ANOVA).
도 14b는 재조합 αVβ3 및 αVβ6 인테그린에 대한 IL-32θ(A94V) 결합을 나타낸다. 재조합 αVβ3 및 αVβ6 인테그린에 대한 IL-32θ(A94V)의 결합에 대한 cyclo-(RGDfV) 의 효과를 나타낸다. 인테그린 αVβ3 및 αVβ6에 대한 IL-32θ(A94V)의 결합을 IL-32 mAb(KU32-52)를 사용하여 평가하였다. 결과는 세 가지 실험의 평균 ± 표준 편차를 나타낸다(*p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 by one-way ANOVA).
도 14c는 재조합 αVβ3 및 αVβ6 인테그린에 대한 IL-32θ(A94V) 결합을 나타낸다. 재조합 αVβ3 및 αVβ6 인테그린에 대한 IL-32θ(A94V)의 결합에 대한 FBS의 효과를 나타낸다. 인테그린 αVβ3 및 αVβ6 에 대한 IL-32θ(A94V)의 결합을 IL-32 mAb(KU32-52)를 사용하여 평가하였다. 결과는 세 가지 실험의 평균 ± 표준 편차를 나타낸다(*p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 by one-way ANOVA).
도 15는 TNF-α 자극 인간 제대정맥 내피세포(HUVEC)에서 ICAM-1 및 VCAM-1의 mRNA 발현에 대한 IL-32θ(A94V)의 효과를 나타낸다. 인테그린 αV, β3 및 β6 서브유닛의 발현은 HUVEC 세포에서 RT-PCR에 의해 확인되었지만 THP-1 인간 단핵구 세포에서는 그렇지 않았다(A). HUVEC를 IL-32θ(A94V)(100ng/mL)로 1시간 동안 전처리하고 TNF-α(10ng/mL)로 4시간 동안 자극했다. 부착 분자의 mRNA 발현은 RT-PCR(A) 및 RT-qPCR(B) 분석에 의해 검출되었다. 결과는 세 가지 실험의 평균 ± SD를 나타낸다(** p < 0.01, *** p < 0.001, **** p < 0.0001 by one-way ANOVA).
도 16은 TNF-α 자극 인간 제대 정맥 내피세포(HUVEC)에서 ICAM-1 및 VCAM-1의 단백질 발현에 대한 IL-32θ(A94V)의 효과를 나타낸다. HUVEC를 IL-32θ(A94V)(100ng/mL)로 1시간 동안 전처리하고 TNF-α(10ng/mL)로 6시간 동안 자극했다. 접착 분자의 단백질 발현은 특정 항체를 이용한 면역형광으로 분석하였다.
도 17은 IL-32θ(A94V)는 HUVEC에 대한 단핵구 부착을 약화시킨다. (A) HUVEC에 대한 calcein 665 AM 표지 THP-1 세포(녹색) 부착의 형광 사진을 나타낸다. HUVEC는 IL-32θ(A94V)(100ng/ml)로 1시간 동안 전처리한 후 TNF-α로 6시간 동안 자극했다. 그런 다음, HUVEC를 calcein-AM-labeled THP-1과 함께 30분 동안 배양하였다. (B) 정량화된 THP-1-HUVEC 접착 결과를 대조군으로 정규화 했다. Image J 소프트웨어를 사용하여 형광을 측정했다. 각 이미지의 눈금 막대는 650μm를 나타낸다. 결과는 세 가지 실험의 평균 ± 표준 편차를 나타낸다(**** p < 0.0001 by one-way ANOVA).
도 18은 HUVEC 세포에서 FAK, JNK 및 AKT의 인산화 수준에 대한 IL-32θ(A94V)의 효과를 나타낸다. HUVEC를 IL-32θ(A94V)(100ng/mL)로 1시간 동안 전처리한 후 TNF-α로 10분(FAK) 또는 15분(JNK, AKT) 자극했다. FAK, AKT 및 JNK의 인산화 수준은 웨스턴 블롯으로 확인하였고, 밴드 강도는 Image J 소프트웨어를 사용하여 정량화 하였다. 결과는 세 가지 실험의 평균 ± SD를 나타낸다(*p < 0.05, ** p < 0.01, *** p < 0.001 by one-way ANOVA).
도 19는 HUVEC 세포에서 IκB의 인산화 수준과 NF-κB(p65/p50), AP-1(c-Fos/c-Jun)의 핵 전위에 대한 IL-32θ(A94V)의 효과를 나타낸다. HUVEC 세포를 IL-32θ(A94V)와 함께 1시간 동안 배양한 다음 TNF-α(10 ng/ml)로 10분(IκB) 또는 30분(전사 인자) 동안 자극했다. 수확된 세포를 핵분획화하였다. 인산화 및 전위 수준은 웨스턴 블롯으로 분석하고 밴드 강도는 ImageJ 소프트웨어를 사용하여 정량화했다. 결과는 세 가지 실험의 평균 ± SD를 나타낸다(*p < 0.05, *** p < 0.001 by one-way ANOVA).
도 20은 TNF-α 유도 ICAM-1 및 VCAM-1 발현과 인테그린-IL-32θ(A94V) 결합 효과에 관련된 신호전달 경로의 개략도를 나타낸다. FAK, AKT, JNK의 TNF-α 유도 인산화 및 NF-κB, AP-1의 핵 전위는 ICAM-1 및 VCAM-1의 발현을 촉진한다. IL-32θ(A94V)는 이러한 세포내 신호 전달 경로를 억제함으로써 ICAM-1 및 VCAM-1의 발현을 억제한다.
1. 항암효과
[실시예 1]
환자 샘플
본 발명의 생체 표본에는 유방 종양(n = 90)과 인접한 정상 조직(n = 90)이 포함되었다. 본 발명에 사용된 유방암 환자의 생체 시료는 전남대학교 화순병원 바이오뱅크(Hwasun-gun, Korea)와 고려대학교 구로병원(Seoul, Korea)에서 제공받았다. 이 연구는 건국대학교 임상심사위원회(Institutional Review Board, 7001355-201704-E-047)의 승인을 받았으며, 모든 피험자는 정보에 입각한 동의를 받았다. mRNA는 homogenizer와 TRI Reagent®(Ambion, Austin, TX, USA)를 사용하여 동결된 조직에서 추출되었고 cDNA는 M-MuLV 역전사 효소(New England Biolabs, Beverly, MA, USA)를 사용하여 제조업체의 지침에 따라 합성되었다.
[실시예 2]
유방 조직에서 돌연변이된 IL-32θ의 발견
유방암 환자의 조직에서 IL-32θ의 mRNA 발현은 크기 차이에 기초한 특정 프라이머 세트를 사용하여 확인되었다(도 1). 본 발명자들은 PCR 산물의 크기에 따라 동형을 구별할 수 있는 프라이머 세트를 사용했다. ABI 3730XL(Thermo Fisher Scientific, Waltham, MA, USA) 및 BigDye®Terminator v3.1 주기 시퀀싱 키트(Thermo Fisher Scientific)와 함께 생어(Sanger) 방법을 사용하여 Bionics(Seoul, Korea)에서 유전자를 강력하게 발현하는 샘플에서 IL-32θ의 시퀀싱을 수행했다(n = 34). IL-32θ서열에서 점 돌연변이를 검출했다(도 2a). 점 돌연변이는 스플라이스 부위 외부의 IL-32θ의 엑손 7과 8 사이에 위치했다. 점돌연변이 부위는 개시코돈부터 세어보니 94번째 코돈이었다(도 2b). 또한 IL-32θ의 무작위로 선택된 34개 샘플의 시퀀싱 데이터는 94번째 아미노산이 알라닌에서 발린으로 돌연변이된 것으로 나타났다. 따라서 본 발명자들은 이 돌연변이를 IL-32θ(281T)또는 IL-32θ(A94V) 라고 명명했다(n = 34).
[실시예 3]
종양 조직에서 염증, 이동 및 증식 인자의 mRNA 발현
RT-qPCR(Reverse transcription quantitative PCR)을 이용하여 유방 종양 조직 내 염증인자(IL-1β, IL-6, IL-8, COX-2), 중간엽표지자(vimentin, N-cadherin), 증식인자(PCNA, CDK2)의 mRNA 수준을 측정하였다. RT-PCR로 얻은 IL-32θ(281T) 발현에 따라 유방 종양 조직을 두 그룹으로 나누었다(표 1).
IL-32θ 발현 여부 유방 종양 조직(n=90) 정상 조직(n=90)
IL-32θ- 50 40
IL-32θ+ 40 50
구체적으로, RT-qPCR은 BioFact™2X Real-time PCR Kit(BioFact, Daejeon, Korea)와 Rotor-Gene 6000 시리즈 소프트웨어 1.7(Qiagen, Venlo, Netherlands)을 사용하여 상대 정량화 프로토콜로 수행되었다. 프라이머 서열은 [표 2]에 나열되어 있다. 전사 수준은 ΔΔCt 또는 ΔCt 방법을 사용하여 계산되었다.
유전자 방향 프라이머 서열(5'→3') 서열번호
GAPDH 정방향 AGAACATCATCCCTGCCTCT 5
6
역방향 CTGCTTCACCACCTTCTTGA
IL-32θ 정방향 ACGTGGACAGGTGATGTCGA 7
8
역방향 GAGCAGCAGAAACTCTGGAA
IL-1β 정방향 CGACAGACCTTCCAGGAGAATC 9
10
역방향 GTGCAGTTCAGT GATCGTACACC
IL-6 정방향 AGACAGCCACTCACCTCTTCAG 11
12
역방향 TTCTGCCAGTGCCTCTTTGCTG
IL-8 정방향 GGTCTGTGTGAAGGTGCAGT 13
14
역방향 GTTTTCCTTGGGGTCCAGAC
COX-2 정방향 CGGTGAAACTCTGGCTAGACAG 15
16
역방향 GCAAACCGTAGATGCTCAGGGA
N-cadherin 정방향 CCT CCA GAG TTT ACT GCC ATG AC 17
18
역방향 GTA GGA TCT CCG CCA CTG ATT C
Vimentin 정방향 AGGCAAAGCAGGAGTCCACTGA 19
20
역방향 ATCTGGCGTTCCAGGGACTCAT
PCNA 정방향 CAAGTAATGTCGATAAAGAGGAGG 21
22
역방향 GTGTCACCGTTGAAGAGAGTGG
CDK2 정방향 ATGGATGCCTCTGCTCTCACTG 23
24
역방향 CCCGATGAGAATGGCAGAAAGC
그 결과, mRNA 수준은 IL-6을 제외한 IL-32θ(281T)-발현(IL-32θ+) 유방 종양 조직에서 유의하게 감소하였다(도 3).
[실시예 4]
IL-32θ(281T)가 염증 인자 발현에 미치는 영향
인간 유방암 세포의 염증 인자 수준에 대한 IL-32θ(281T)의 효과를 확인하기 위해 EV와 IL-32θ(281T)로 형질감염된 MDA-MB-231 유방암 세포를 사용했다. 과발현된 세포주는 리포펙타민을 사용하여 평가하였다(도 4a 의 A). MDA-MB-231 세포를 발현하는 IL-32θ(281T)의 형태학적 변화를 [도 4a 의 B]에 나타내었다.
구체적으로, 세포 배양은 MDA-MB-231(ATCC®HTB-26™, Manassas, VA, USA)을 Dulbecco's Modified Eagle's Medium(DMEM; HyClone Laboratories, Logan, UT, USA)에서 배양했다. MDA-MB-468 세포(ATCC® HTB-132™)를 RPMI-1640 (HyClone Laboratories)에서 배양했다. 두 배지 모두 37℃ 및 5% CO2에서 10% 열 불활성화 태아 소 혈청(Gibco BRL Life Technologies, Rockville, MD, USA), 100 U/mL 페니실린 및 100 μg/mL 스트렙토마이신으로 보충되었다.
IL-32 과발현 세포의 생성을 위해서, 유방암 세포는 pcDNA3.1(+)-6x Myc 빈 벡터(EV) 및 pcDNA3.1(+)-6x Myc IL-32θ(281T) 벡터로 형질감염되었다. pcDNA3.1(+)-6x Myc IL-32θ(281T) 벡터는 야생형 Myc-IL-32θ 벡터로부터 Muta-Direct™Site-Directed Mutagenesis Kit (iNtRON Biotechnology)를 사용하여 준비되었다. 간략하게, 세포를 60 Pi 접시(3 x 105 세포/웰)에 시딩하고 Lipofectamine®2000 (Invitrogen, Carlsbad, CA, USA)을 사용하여 3 μg의 벡터로 형질감염시켰다. 그 후, 유방암 세포를 900 μg/mL G-418 (Duchefa Biochemie BV, Haarlem, The Netherlands)이 포함된 배지를 사용하여 2주 동안 선별하였다. G-418 내성 콜로니만 배양하였다.
컨디셔닝 배지(CM)의 경우 THP-1 세포를 T-75 플라스크(3 x 106 세포)에 시딩하고 100nM PMA (Millipore Sigma, Burlington, MA)로 72시간 동안 자극했다. 24시간 동안 PMA로 처리한 후, 세포를 20ng/mL의 IL-4 (PeproTech, Philadelphia, PA) 및 IL-13 (PeproTech)으로 48시간 더 배양하여 M2-분극 THP-1 대식세포를 유도했다. 그런 다음 세포를 PBS (phosphate-buffered saline)로 세척하고 24시간 후에 새로운 배양 배지를 첨가하였다. CM을 수집하고 원심분리하여 나머지 세포를 제거했다.
웨스턴 블로팅은 전체 세포 용해물을 1X 완전 프로테아제 억제제 칵테일 및 1X PhosSTOP (Roche Diagnostics, Mannheim, Germany)을 함유하는 방사면역침전 분석(RIPA) 완충액(iNtRON Biotechnology)에서 제조하였다. 핵 및 세포질 단백질을 얻기 위해 제조사의 지침에 따라 세포를 수집하고 NE-PER 키트(Thermo Fisher Scientific)를 사용하여 핵 분획화했다. 샘플을 나트륨 도데실 설페이트-폴리아크릴아미드 겔 전기영동에 적용한 후 0.2 μm 폴리비닐리덴 디플루오라이드 막(Amersham Biosciences, Amersham, UK)으로 옮겼다. 멤브레인은 4℃에서 밤새 적절한 1차 항체와 혼성화되었다. 항체는 [표 3]에 나열되어 있다. 웨스턴 블롯팅은 chemiluminescence detection kit (Advanstar, Cleveland, OH, USA)를 이용하여 수행하였고 단백질 밴드는 EZ-capture MG protein imaging system (ATTO, Tokyo, Japan)을 이용하여 캡쳐하였다. 웨스턴 블롯팅 밴드는 Image J 오픈 소스 소프트웨어(National Institutes of Health, Bethesda, MD)를 사용하여 정량화되었다.
항체 종 희석 Cat# 구입처
Myc-tag 사람 1:5000 05-724 Millipore
β-catenin 사람 1:5000 C2206
p-FAK 사람 1:5000 700255 Invitrogen
PARP 사람 1:5000 9542s Cell Signaling Technology
p50 사람 1:5000 3035s
p-PI3K 사람 1:5000 4228s
p-GSK3 사람 1:5000 9331s
p-IκBα 사람 1:5000 2859s
IκBα 사람 1:5000 4812s
p-AKT 사람 1:5000 9271s
p21 사람 1:5000 2947T
PCNA 사람 1:5000 2856s
CDK2 사람 1:5000 2546T
COX-2 사람 1:5000 AF4198 R&D Systems
GAPDH 사람 1:5000 sc-47724 Santa Cruz Biotechnology
p65 사람 1:5000 sc-8008
α-tubulin 사람 1:5000 sc-5286
Fibronectin 사람 1:5000 sc-9068
Vimentin 사람 1:5000 sc-66002
Cyclin A 사람 1:5000 sc-751
N-cadherin 사람 1:5000 ab18203 Abcam
E-cadherin 사람 1:5000 ab1416
효소면역측정법(ELISA)은 MDA-MB-231 세포를 CM으로 24시간 동안 배양한 후, 배양 배지를 새로운 배양배지로 교체하여 24시간 더 배양하였다. 세포 배양 상청액을 수집하고 인간 IL-1β, IL-6, IL-8 및 PGE2 (GE Healthcare, Buckinghamshire, UK) 용 ELISA 키트(R&D systems)를 사용하여 제조업체의 지침에 따라 분석했다.
그 결과, RT-qPCR 분석은 염증 인자의 mRNA 수준이 MDA-MB-231 세포에서 IL-32θ(281T)에 의해 억제됨을 보여주었다(도 4b 의 C). CM 처리된 MDA-MB-231 세포는 IL-32θ(281T)에 의해 염증 인자의 증가된 mRNA 수준이 억제됨을 밝혔다(도 4b 의 D). IL-1β, IL-6, IL-8 및 프로스타글란딘 E2 (PGE2)의 분비 단백질 수준을 ELISA로 확인하여, IL-32θ(281T)가 CM으로 자극된 MDA-MB-231 세포에서 IL-1β, IL-6, IL-8 및 PGE2 수준을 억제함을 입증했다(도 5a). 핵 분획 후 웨스턴 블롯 분석은 IL-32θ(281T)가 CM으로 자극된 MDA-MB-231 세포에서 핵으로의 NF-κB 전위를 억제함을 보여주었다(도 5b 의 E). 또한, 면역형광(IF) 분석은 핵 NF-κB 가 CM으로 자극된 IL-32θ(281T)-발현 MDA-MB-231 세포에서 약화됨을 입증했다(도 5b 의 F).
[실시예 5]
인간 유방암 세포의 이동에 대한 IL-32θ(281T)의 조절 효과
염증 인자는 IL-32θ(281T)에 의해 억제됨이 밝혀졌다. IL-32θ(281T)가 유방암 세포의 이동에 영향을 미치는지 확인하고자 하였다.
면역형광(IF) 분석을 위해, 유방암 세포를 세포 배양 슬라이드(SPL, Pocheon, Korea)에 파종하고 밤새 배양하였다. 부착된 세포를 고정하고, 파라포름알데히드 및 메탄올로 투과화한 다음 실온에서 PBS 중 1% 소 혈청 알부민(BSA)으로 차단하였다. 1차 항체(1% BSA로 희석된 1:200)를 슬라이드에 추가하고 4℃에서 밤새 배양했다. PBS로 세척한 후 슬라이드를 2차 항체(1:400 희석)와 함께 배양했다. 항체는 상기 [표 3]에 나열되어 있다. 세포를 4,6-디아미디노-2-페닐인돌(PBS로 1:1000 희석) (Millipore Sigma)에 15초 동안 노출시켜 핵 염색을 수행하였다. EVOS M7000 이미징 시스템(Thermo Fisher Scientific)을 사용하여 세포를 시각화했다.
상처 치유 분석(Wound healing assay)을 위해 유방암 세포(1.5 x 105개 세포/웰)를 24웰 플레이트에 시딩하고 100% 컨플루언스까지 배양했다. 멸균 200 μL 피펫 팁을 사용하여 플레이트를 긁고, 분리된 세포를 제거하기 위해 PBS로 세척하고, 24시간 후에 새로운 무혈청 배지를 첨가했다. 플레이트를 0 및 24시간에 현미경으로 촬영하였다. ImageJ로 스크래치 영역을 사용하여 세포 이동을 측정했다.
상처 치유 분석은 EV로 형질감염된 세포와 비교하여 IL-32θ(281T)-발현 유방암 세포의 이동에서 현저한 감소를 나타냈다(도 6a, 6b). 또한, 웨스턴 블롯 분석은 IL-32θ(281T) 가 중간엽 마커(피브로넥틴(fibronectin), 비멘틴(vimentin), N-카데린(N-cadherin))를 억제하고 유방암 세포에서 상피 마커 E-카데린을 상향조절함을 보여주었다(도 7a). IF 분석은 E-카데린의 형광이 IL-32θ(281T)-발현 세포에서 증가한 반면, N-카데린의 형광은 IL-32θ(281T)-발현 세포에서 감소되었음을 보여주었다(도 7b).
[실시예 6]
인간 유방암 세포에서 IL-32θ(281T)의 세포내 신호 전달 경로
본 발명은 염증 인자와 EMT 마커가 IL-32θ(281T)에 의해 조절된다는 것을 보여준다. 또한, NF-κB전위가 IL-32θ(281T)에 의해 억제됨을 밝혔다. 본 발명자들은 IL-32θ(281T)가 유방암 세포의 세포내 신호 전달 경로에 영향을 미치는지 여부를 확인했다.
웨스턴 블롯 분석은 IL-32θ(281T)가 EV 형질감염된 유방암 세포와 비교하여 p-FAK, p-PI3K, p-AKT 및 p-GSK3를 억제함을 보여주었다. 또한, β-카테닌의 분해는 유방암 세포에서 IL-32θ(281T)에 의해 유도되었다(도 8).
[실시예 7]
IL-32θ(281T)의 세포 주기 정지를 통한 인간 유방암 세포의 증식 억제
본 발명에서 FAK/PI3K/AKT 경로는 IL-32θ(281T)에 의해 억제되는 것으로 밝혀졌다. IL-32θ(281T)가 증식에 미치는 영향을 확인하기 위해 MTS 및 BrdU 분석을 수행했다(도 9a).
세포 생존율 분석은, CellTiter 96®One Solution Cell Proliferation Assay(Promega, Madison, WI, USA)를 사용하여 세포 생존력을 평가했다. 유방암 세포(1 x 104개 세포/웰)를 96-웰 플레이트에 시딩하고 매 시간 배양하고 신선한 배지로 세척했다. 그런 다음 세포를 100 μL의 3-(4,5-디메틸티아졸-2-일)-5-(3-카르복시메톡시페닐)-2-(4-설포페닐)-2H-테트라졸륨(3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxy phenyl)-2-(4-sulfophenyl)-2H-tetrazolium) 및 전자 커플링 시약 페나진 메토설페이트(phenazine methosulfate)로 1시간 동안 배양했다. 광학 밀도(OD)는 492nm에서 측정되었다. 대조군 OD로 정규화하여 상대적 생존력을 정량화했다.
세포증식 분석은, 세포 증식은 제조업체의 프로토콜에 따라 Cell Proliferation Assay Kits (Cell Signaling Technology)를 사용하여 DNA에 BrdU (5'-bromo-2'-deoxyuridine) 통합을 기반으로 결정되었다. 유방암 세포(5 × 102 세포/웰)를 96-웰 플레이트에 시딩하고, 72시간 동안 배양하고, 24시간 동안 BrdU로 표지하였다. 세포를 고정하고 검출 항체 및 HRP 연결 항체를 BrdU 검출에 사용하였다. 발색은 HRP 기질인 TMB (3,3',5,5'-tetramethylbenzidine)을 이용하여 발색하였으며 450 nm에서 OD를 측정하였다.
유세포분석을 위해 MDA-MB-231(2 × 105개 세포/mL) 및 MDA-MB-468(4 × 105개 세포/mL) 세포를 60 pi 접시에 48시간 동안 시딩하였다. 그런 다음 세포를 PBS로 세척하고 70% 에틸 알코올로 30분 동안 고정시켰다. 이어서, 세포를 PBS로 세척하고 요오드화 프로피듐을 함유하는 PBS를 30분 동안 보충하였다. FACSCalibur 유세포 분석기(BD Biosciences, San Jose, CA, USA)를 사용하여 형광 방출을 측정하고 분석했다.
세포 생존력 및 증식분석은 IL-32θ(281T)-발현 유방암 세포가 EV 형질감염된 세포보다 상당히 더 느린 성장을 가짐을 나타냈다(도 9a). 조절 세포주기(CDK2, 사이클린 A) 및 증식세포 핵 항원(PCNA) 단백질은 IL-32θ(281T)에 의해 억제되었다(도 9a 의 C). 더욱이, 증식억제 단백질 p21은 유방암 세포에서 IL-32θ(281T)에 의해 상향조절되었다(도 9a 의 C). IL-32θ(281T)가 세포주기 정지에 미치는 영향을 밝히기 위해 유세포 분석법을 사용하여 PI 염색을 수행했다. 유세포분석 결과는 EV 형질감염 유방암 세포보다 IL-32θ(281T)를 발현하는 유방암 세포에서 S기 및 G2/M기 정지의 비율이 더 높다는 것을 보여주었다(도 9b).
[통계 분석]
Student's t-test는 유방 환자 샘플 분석에서 그룹을 비교하는 데 사용되었다. Student's t-test 및 Tukey's honest test를 사용한 일원분산 분석(ANOVA)을 사용하여 시험관 내 실험에서 그룹을 비교했다. GraphPad Prism 소프트웨어 버전 9.0을 사용하여 통계 분석을 수행했다. 결과는 세 가지 실험의 평균 ± SD를 나타낸다. 모든 p-값은 양면이었고 *p<0.05, **p<0.01, ***p<0.001 및 ****p<0.0001이었다.
2. 항염증 효과
[실시예 8]
재조합 인간 IL-32θ(A94V)의 발현 및 정제
<8-1> 인간 IL-32θ(A94V)의 발현
IL-32θ(A94V)의 발현을 위해 TEVSH 벡터를 사용하였고 재조합 IL-32θ(281T) DNA를 Nde1 및 Age1 제한 효소에 의해 벡터에 삽입하였다. TEVSH 벡터에는 단백질 정제를 위한 His 태그가 포함되어 있다. 재조합 벡터의 개략도는 [도 11]에 나와 있다.
구체적으로, HT-oligoTM 합성을 사용하여 Bioneer (Daejeon, Korea)에 의해 단백질 발현 효율 제고용으로 IL-32θ(281T) 코딩 서열(서열번호 3)을 합성하였다. 합성된 DNA 서열을 NdeⅠ 및 AgeⅠ 제한 부위와 신속한 DNA 결찰 키트(Thermo Fisher Scientific, Waltham, MA, USA)를 사용하여 pTH24 기반 TEVSH 벡터(Addgene, Watertown, MA, USA)에 클로닝하였다. TEVSH는 Helena Berglund (Addgene 플라스미드 #125194; http://n2t.net/addgene:125194; RRID:Addgene 125194)로 부터 제공받았으며 DNA 시퀀싱(Bionics, Seoul, Korea)으로 확인되었다. 재조합 TEVSH 벡터는 열충격에 의해 DH5α로 형질전환되었고, mini prep kit (Intron Biotechnology, Sungnam, Korea)를 사용하여 정제되었다. IL-32θ(281T) 발현 벡터를 열 충격 형질전환에 의해 대장균의 로제타 균주로 형질전환시켰다. 성공적으로 형질전환된 단일 콜로니를 픽업하여 암피실린(100 μg/mL)이 포함된 Luria-Bertani (LB) 배지에서 200-rpm 인큐베이터에서 4시간 동안 37℃에서 배양했다. 배양된 혼합물을 암피실린(ampicillin, 100 μg/mL)이 포함된 2.4 L의 신선한 LB 배지에 옮기고 OD600이 0.6이 될 때까지 37℃에서 200 rpm 배양기에서 성장시켰다. 0.5mM IPTG를 첨가하여 IL-32θ(A94V)를 유도하였다. 세포는 16℃에서 16시간 동안 200rpm 인큐베이터에서 성장시켰다.
<8-2> Ni-NTA 및 CNBr-활성 세파로스 4B 컬럼을 사용한 IL-32θ(A94V)의 정제
IL-32θ(A94V)의 순도를 향상시키기 위해 연속 정제를 수행했다. IL-32θ(A94V)는 Ni-NTA 컬럼과 His tag에 결합하여 분리하고, 분리된 IL-32θ(281T)를 IL-32mAb KU32와 결합된 CNBr-활성화된 Sepharose 4B 컬럼으로 한 번 더 정제하였다.
구체적으로, 16시간 후, 4℃에서 10분 동안 8,000 rpm으로 원심분리하여 세포를 수확하였다. 상청액을 버리고 펠릿을 용해 완충액(50mM Tris-HCl pH 8.0, 10% 글리세롤, 0.1% Triton X-100, 1X 프로테아제 억제제 칵테일, 2mM MgCl2, 0.1mg 라이소자임)을 사용하여 용해하고 얼음 위에서 배양했다. 30분 동안 용해된 세포를 초음파 처리기(Sonics & Materials, Inc., Newtown, CT, USA)를 사용하여 1분 동안 초음파 처리(진폭 35%, 10초 켜기, 10초 끄기)했다. 용해된 세포를 4℃에서 30분 동안 13,000 rpm으로 원심분리하고 상등액을 모았다. Ni-NTA 수지(Thermo Fisher Scientific)를 PD-10 컬럼에 넣고 평형 완충액(20mM Tris-HCl pH 8.0, 200mM NaCl)으로 균형을 맞췄다. 용해물을 10mL의 평형 완충액과 혼합하고 컬럼에 로딩하고 세척 완충액(20mM Tris-HCl pH 8.0, 200mM NaCl, 25mM 이미다졸)으로 세척했다. 세척 후 용출 버퍼(20mM Tris-HCl pH 8.0, 500mM NaCl, 500mM 이미다졸)를 컬럼에 로딩하고 IL-32θ를 포함하는 플로우-쓰루 버퍼(flow-through buffer)를 CNBr-활성화 Sepharose 4B 컬럼(Sigma-Aldrich, St. Louis, MO, United States) 및 단클론 항체 IL-32 mAb KU32-52를 사용하여 제조된 IL-32mAb(KU32-52)-커플링된 CNBr-활성화 Sepharose 4B 컬럼에 다시 로딩했다. Tris(pH 8.0)로 여러 번 세척한 후 IL-32θ(A94V)를 100mM 글리신(pH 3.0)으로 용출했다. 용출된 용액을 받는 튜브는 전체 부피의 10분의 1인 1M의 트리스(pH 8.0)를 함유하였다. 정제된 IL-32θ(A94V)를 spectra/Por 멤브레인(Spectrum Laboratories, Piscataway, NJ, USA)을 사용하여 PBS (phosphate-buffered saline)로 2시간씩 3회 투석하였다. 폴리믹신 B(Sigma-Aldrich)를 사용하여 내독소의 부재를 평가하였다.
정제된 IL-32θ(A94V)를 SDS-PAGE(도 12A) 및 웨스턴 블롯(도 12B, 11C)을 사용하여 분석하였다. SDS-PAGE 분석에서는 Ni-NTA 컬럼의 용출액에서 IL-32θ(A94V)를 제외하고는 눈에 띄는 다른 단백질 밴드가 검출되지 않았으나 western blotting을 통해 다른 여러 단백질이 관찰되었다. 이러한 비표적 단백질은 KU32-52에 결합된 CNBr-활성화 Sepharose 4B 컬럼을 사용한 추가 정제에 의해 제거되었다. 결국, 고순도 IL-32θ(A94V) 단백질은 다른 단백질이 거의 없이 얻어졌다.
[실시예 9]
인테그린 αVβ3 및 αVβ6에 대한 IL-32θ(A94V)의 결합
HDOCK 서버를 사용하여 IL-32θ(A94V)와 인테그린의 결합을 예측했다. 구조 기반 결합 예측 외에도 IL-32θ(A94V)-인테그린 결합 분석도 수행했다.
구체적으로, IL-32θ(A94V)의 3차 구조는 단백질 구조 예측 및 구조 기반 기능 주석에 대한 계층적 접근 방식인 I-TASSER (Iterative Threading ASSEmbly Refinement)에 의해 분석되었다. I-TASSER는 템플릿 기반 조각 조립 시뮬레이션으로 구성된 전체 길이 모델로 구조 템플릿을 식별한다. 그런 다음 단백질 기능 데이터베이스를 통해 3D 모델을 다시 스레드하여 대상의 기능 통찰력을 도출한다. 단백질-단백질 도킹 예측은 I-TASSER(34-36)에서 도출된 모델 중 신뢰도가 가장 높은 모델을 이용하여 수행하였다. 인테그린-IL-32θ(A94V) 결합은 단백질-단백질 결합예측 도구인 HDOCK 서버(http://hdock.phys.hust.edu.cn)를 이용하여 분석하였다. HDOCK은 하이브리드 도킹 전략을 사용하여 두 단백질 간의 결합 복합체를 예측한다. 인테그린 αVβ3 (PDB ID: 1JV2) 및 αVβ6 (PDB ID: 5FFG)의 세포외 세그먼트 구조는 단백질 데이터 뱅크(PDB)에서 제공되었다.
IL-32θ(A94V)는 나선 구조를 포함하는 노란색 분자로 표시하였고, PDB에서 제공하는 인테그린 αVβ3 및 αVβ6의 세포외 도메인은 주황색 분자로 표시하였다. IL-32θ(A94V)-인테그린 αVβ3의 결합 점수는 -304.56이었고, 신뢰도 점수는 0.9565였다. IL-32θ(A94V)-인테그린 αVβ6의 결합점수는 -358.20이었고, confidence score는 0.9847로 IL-32θ(A94V)-integrin αVβ3보다 높았다(도 13). 이러한 결과는 IL-32θ(A94V)가 이들 인테그린과의 결합 가능성 및 인테그린 αVβ3보다 인테그린 αVβ6과 더 강한 상호작용을 갖는다는 것을 시사한다.
IL-32θ(A94V)-인테그린 결합 검정을 위하여, 인테그린 αVβ3 및 αVβ6으로 96-웰 플레이트를 코팅한 후, IL-32θ(A94V)를 [도 14a]에 나타낸 농도로 첨가하였다. 인테그린의 RGD 결합부위에 결합하는 것으로 알려진 Cyclo-RGDfV를 96-웰 플레이트에서 전처리하고 PBS를 대조군으로 사용하였다. 또한, 웰을 인테그린 αVβ3 및 αVβ6으로 코팅하였다. IL-32θ(A94V)를 [도 14b]에 나타낸 농도로 처리하였다. 다른 그룹에서는 10% FBS를 포함하는 배지를 96-웰 플레이트에서 전처리하였다. 이어서 인테그린 αVβ3 및 αVβ6을 첨가하고 대조군을 무혈청 배지로 전처리하였다. IL-32θ(A94V)를 [도 14c]에 나타낸 농도로 처리하였다.
구체적으로, MaxiSorp 평평한 바닥 96-웰 플레이트(Nunc, Roskilde, Denmark)를 PBS에 희석된 1 μg/mL의 재조합 αVβ3 및 αVβ6 인테그린(R&D Systems, Minneapolis, MN, USA)으로 코팅하고 4℃에서 밤새 배양했다. 다음으로 웰을 37℃에서 1시간 동안 PBS에 녹인 1% BSA(Invitrogen, Waltham, MA, USA)로 차단한 후 0.05% Tween 20을 포함하는 PBS로 세 번 세척했다. cyclo-RGDfV 펩타이드(Peptide Institute Inc, Osaka, Japan) 또는 10% fetal bovine serum(FBS), 나머지는 PBS와 함께 37℃에서 1시간 동안 배양하였다. 다음으로, 웰을 PBS에 희석된 다양한 농도의 돌연변이 IL-32θ(A94V), 10 μM cyclo-(RGDfV) 또는 10% FBS를 포함하거나 포함하지 않고 37℃에서 1시간 동안 인큐베이션하였다. 웰을 세척 완충액으로 3회 세척하고 PBS에 희석된 IL-32 mAb KU32-52와 0.2 μg/mL 농도로 25℃에서 1시간 동안 배양했다. 배양 후, 웰을 세척 완충액으로 3회 세척하고 HRP에 접합된 마우스-IgGκ 경쇄 결합 단백질(m-IgGκ BP-HRP)(BETHYL, Waltham, MA USA)과 함께 25℃에서 1시간 동안 배양하였다. 다음으로, 웰을 세척 완충액으로 3회 세척하고 TMB 기질과 함께 25℃에서 20분 동안 인큐베이션하고, 발색 반응을 2.5 N H2SO4로 중지시켰다. 마이크로플레이트 판독기(Apollo LB 9110, Berthold Technologies GmbH, Bad Wildbad, Germany)를 사용하여 450 nm에서 흡광도/광학 밀도를 측정하였다.
인테그린이 있는 경우 흡광도는 IL-32θ(A94V)의 농도 의존적으로 증가했지만 BSA에서는 그렇지 않았고(도 14a), IL-32θ(A94V)가 다른 이소형과 유사한 인테그린 αVβ3 및 αVβ6에도 결합함을 나타낸다. 인테그린 αVβ3 및 αVβ6 모두에서, 인테그린-IL-32θ(A94V) 결합은 cyclo(RGDfV)에 의해 유의하게 감소되지 않았으며(도 14b), 이는 IL-32θ(A94V)가 비-RGD 결합 부위에 결합함을 시사한다. cyclo-(RGDfV)와 대조적으로, 인테그린-IL-32θ(A94V) 결합은 FBS에 의해 상당히 억제되었다(도 14c). 이러한 결과는 IL-32β와 같은 다른 이소형과 유사하게 IL-32θ(A94V)가 인테그린 αVβ3 및 αVβ6의 비-RGD 결합 부위에 결합하고 이러한 인테그린이 IL-32θ(A94V)에 대한 세포 표면 수용체로 작용할 수 있음을 시사한다.
[실시예 10]
IL-32θ(A94V)가 TNF-α로 자극된 HUVEC 세포에서 ICAM-1 및 VCAM-1의 발현에 미치는 영향
IL-32θ(A94V)가 세포에 미치는 영향을 평가하기 위해 HUVEC에서 인테그린의 발현을 확인했다. THP-1 단핵구는 표면에 인테그린 αVβ3 및 αVβ6을 발현하지 않는 음성 대조군으로 사용되었다(도 15A). 그리고 IL-32θ(A94V)가 TNF-α로 자극된 HUVEC 세포에서 ICAM-1과 VCAM-1의 발현에 미치는 영향을 조사하였다. HUVEC는 FBS에 의한 간섭을 최소화하기 위해 4시간 동안 기아처리하였고, IL-32θ(A94V)는 1시간 동안 전처리하고 4시간 또는 6시간 동안 TNF-α로 자극하였다. ICAM-1 및 VCAM-1의 mRNA 수준은 RT-PCR(도 15B) 및 RT-qPCR(도 15C)을 사용하여 측정하였다.
구체적으로, HUVEC 세포는 10%(v/v) 열 불활성화 태아 소 혈청(Hyclone Laboratories, Logan, UT, USA), 페니실린(100 U/mL) 및 스트렙토마이신(100μg/mL)이 보충된 Dulbecco modified Eagle 배지(Welgene Incorporation, Daegu, Korea)에서 배양되었다. 세포는 37℃의 5% CO2 함유 챔버에서 배양되었다.
그 후, RNA 추출 및 RT-PCR을 위하여 HUVEC 세포(3 × 105개 세포/웰)를 6-웰 플레이트에서 24시간 동안 배양하고 무혈청 배지에서 4시간 동안 기아처리(starve) 하였다. 이어서, 세포를 IL-32θ(A94V) (100 ng/ml)로 1시간 동안 전처리하고, TNF-α (10ng/mL)로 4시간 더 처리하였다. 제조사의 지침에 따라 easy-BLUE™ Total RNA 추출 키트(iNtRon Biotechnology, Seoul, South Korea)를 사용하여 처리된 세포를 수집하고 용해시켰다. 역전사(RT) 폴리머라제 연쇄 반응(PCR)을 위해 올리고(dT) 프라이머와 M-MuLV 역전사효소(New England Biolabs, Ipswich, MA, USA)를 사용하여 RNA(1μg)를 cDNA로 역전사했다. 합성된 cDNA는 PCR Thermal Cycler Dice 장비(Takara, Otsu, Shiga, Japan)를 사용하여 증폭되었다. 다음 프라이머 세트가 사용되었다: 인테그린 αV, 5'-AGGAGAAGGTGCCTACGAAGCT-3'(정방향, 서열번호 25) 및 5'-GCACAGGAAAGTCTTGCTAAGGC-3'(역방향, 서열번호 26); 인테그린 β3, 5'-CATGGATTCCAGCAATGTCCTCC-3'(정방향, 서열번호 27) 및 5'-TTGAGGCAGGTGGCATTGAAGG-3'(역방향, 서열번호 28); 인테그린 β6, 5'-TCTCCTGCGTGAGACACAAAGG-3'(정방향, 서열번호 29) 및 5'-GAGCACTCCATCTTCAGAGACG-3'(역방향, 서열번호 30); ICAM-1, 5'-AGCGGCTGACGTGTGCAGTAAT-3'(정방향, 서열번호 31), 5'-TCTGAGACCTCTGGCTTCGTCA-3'(역방향, 서열번호 32); VCAM-1, 5'-GATTCTGTGCCCACAGTAAGGC-3'(정방향, 서열번호 33) 및 5'-TGGTCACAGAGC CACCTTCTTG-3'(역방향, 서열번호 34); 글리세르알데하이드 3-인산 탈수소효소(GAPDH), 5'-AGAACATCATCCCTGCCTCT-3'(정방향, 서열번호 5), 5'-CTGCTTCACCACCTTCTTGA-3'(역방향, 서열번호 6). GAPDH는 내부 대조군으로 사용되었다. PCR 산물은 2% 아가로스 겔에서 분리하였다.
RT-qPCR 을 위하여, HUVEC는 IL-32θ(A94V) 및 TNF-α의 유무에 관계없이 처리 후 수득되었다. mRNA 추출 및 cDNA 합성은 전술한 바와 같이 수행하였다. RT-PCR은 Rotor-Gene 6000 시리즈 소프트웨어 1.7(Qiagen, Hilden, Germany) 및 Sensi FAST™ SYBR NO-ROX Kit (BIOLINE, London, UK)를 사용하여 상대 정량화 프로토콜로 수행되었다. 모든 표적 유전자의 발현은 하우스키핑 유전자인 GAPDH의 발현으로 정상화되었다. 각 샘플은 ICAM-1, 5'-AGCGGCTGACGTGTGCAGTAAT-3'(정방향, 서열번호 31), 5'-TCTGAGACCTCT GGCTTCGTCA-3'(역방향, 서열번호 32); VCAM-1, 5'-GATTCTGTGCCCACAGTAAGGC-3'(정방향, 서열번호 33), 5'-TGGTCACAGAGCCACCTTCTTG-3'(역방향, 서열번호 34); GAPDH, 5'-AGAACATCATCCCTGCCTCT-3'(정방향, 서열번호 5), 5'-CTGCTTCACCACCTTCTTGA-3'(역방향, 서열번호 6). GAPDH는 내부 대조군으로 사용되었다. 비교 Ct 방법을 사용하여 각 유전자의 mRNA 수준을 내부 참조인 GAPDH의 상대적 수준으로 계산했다.
면역블롯팅은, HUVEC 세포(3 × 105개 세포/웰)를 6웰 플레이트에 24시간 동안 시딩하고 IL-32θ(A94V)(100ng/mL)로 1시간 동안 전처리한 후 TNF-α(10 ng/mL) 처리하였다. 세포를 4℃에서 2시간 동안 50mM Tris(pH 7.4), 150mM NaCl, 1% NP-40, 0.1% SDS(sodium dodecyl sulfate), 0.25% 소듐 디옥시콜레이트(sodium deoxycholate), 1mM EDTA(ethylene diamine tetraacetic acid), 1mM 에틸렌 글리콜 테트라아세트산(ethylene glycol tetraacetic acid), 1mM 오르토바나데이트(orthovanadate), 아프로티닌(aprotinin, 10μg/mL) 및 0.4mM PMSF(phenyl methylsulfonyl fluoride)를 포함하는 버퍼로 용해되었다. 세포를 용해시키고 단백질 함량을 Bradford 분석 시약(Bio-Rad Laboratories, Hercules, CA, USA) 및 UV 분광광도계를 사용하여 추정하였다. 단백질(30μg)을 10% SDS-폴리아크릴아미드 겔에서 분리하고 PVDF 멤브레인으로 옮겼다. 막을 25℃에서 1시간 동안 5% 탈지유로 차단하고, 25℃에서 1시간 동안 IL-32, His-tag (Sigma-Aldrich), FAK (Thermo Fisher Scientific), AKT (Cell Signaling, Danvers, MA, USA), JNK (Cell Signaling), IκB (Cell Signaling), p65 (Cell Signaling), p50 (Cell Signaling), PARP (Cell Signaling), c-Jun (Santa Cruz Biotechnology, Dallas, TX, USA), c-Fos (Santa Cruz Biotechnology)에 대한 1차 항체와 함께 배양했다. 배양 후, 막을 25℃에서 1시간 동안 2차 항체(항토끼 또는 항마우스 IgG 항체)(BETHYL)와 함께 배양하였다. 마지막으로, 강화된 화학발광 웨스턴 블롯팅 검출 키트(Advansta, San Jose, CA USA)를 사용하여 단백질 밴드를 가시화하였다.
면역형광은, HUVEC 세포(1.0 × 105개 세포/웰)를 8웰 슬라이드 챔버에 24시간 동안 시딩하고 밤새 기아처리한 후 IL-32θ(A94V)(100 ng/mL) 및 6 h TNF-α(10ng/mL)로 처리하였다. 처리 후, 세포를 4% 파라포름알데하이드를 사용하여 10분 동안 고정한 다음 얼음처럼 차가운 메탄올로 인큐베이션하고 PBS 중 1% BSA를 사용하여 25℃에서 1시간 동안 차단했다. 그런 다음 세포를 ICAM-1 및 VCAM-1에 대한 1차 항체(Beijing Solarbio Science & Technology Co., Beijing, China)와 함께 4℃에서 밤새 배양하고, Cy3에 접합된 2차 항체(Merck Millipore, Darmstadt, Germany)와 함께 세포를 배양하였다. 25℃에서 1시간 후 DAPI 염색. 각 단계 사이에 PBS로 두 번의 세척 단계를 수행했다. 그 후 세포를 마운팅 버퍼(시그마-알드리치)에 마운팅하고 형광현미경으로 관찰하였다.
그 결과, ICAM-1 및 VCAM-1의 mRNA 발현 수준은 TNF-α에 의해 증가되었고 IL-32θ(A94V)에 의해 상당히 감소되었다. 단백질 발현은 또한 면역형광을 사용하여 분석하였다. ICAM-1과 VCAM-1의 형광 강도는 예상대로 TNF-α 자극 시 증가했으며 IL-32θ(A94V)에 의해 억제되었다(도 16).
[실시예 11]
IL-32θ(A94V)가 단핵구-내피세포 부착에 미치는 영향
TNF-α와 같은 전염증성 사이토카인에 의해 자극된 내피세포에서 발현되는 ICAM-1과 VCAM-1은 혈관 염증의 한 단계인 단핵구-내피세포 부착에 중요한 역할을 한다.
단핵구-내피 세포 부착 검정을 위해, HUVEC 세포(1.5 × 104 세포/웰)를 4-웰 슬라이드 챔버에 24시간 동안 시딩하고 밤새 기아처리하여 IL-32θ(A94V)(100 ng/mL)로 1시간 동안 전처리한 후 6시간 동안 TNF-α(10ng/mL)로 처리하였다. THP-1 세포를 FBS 없이 RPMI-1640에서 30분 동안 5 μM calcein-AM(Molecular Probes, Eugene, OR, USA)으로 표지하였다. calcein-AM으로 표지된 THP-1 세포를 HUVEC가 들어 있는 4-웰 슬라이드 챔버에 추가하고 10% FBS를 포함하는 RPMI-1640에서 30분 동안 배양했다. 이어서, 미결합 단핵구를 PBS로 3회 세척하여 제거하였다. 나머지 단핵구는 형광 현미경을 사용하여 결정되었다. ImageJ 소프트웨어 버전 1.5를 사용하여 형광 강도를 측정했다.
그 결과, IL-32θ(A94V)는 내피세포에서 단핵구-내피세포 부착 분자의 발현을 억제하여 단핵구-내피세포 부착을 감소시켰다(도 15 ~ 도 17). calcein-AM-표지된 THP-1(녹색)의 HUVEC에 대한 부착은 HUVEC와 THP-1 세포의 공동 배양에서 TNF-α에 의해 증가되었다. HUVEC와 THP-1 세포 사이의 부착은 IL-32θ(A94V)에 의해 상당히 감소하였다(도 17A). Image J 소프트웨어를 사용하여 형광을 측정했다(도 17B).
[실시예 12]
TNF-α 로 자극된 HUVEC 세포에서 FAK, AKT 및 JNK의 인산화 수준에 대한 IL-32θ(A94V)의 영향
본 발명자들은 IL-32θ(A94V)가 TNF-α로 자극된 HUVEC에서 ICAM-1 및 VCAM-1의 발현을 억제한다는 것을 밝혔다. 본 발명자들은 IL-32θ (A94V)에 의해 매개되는 ICAM-1 및 VCAM-1 발현의 조절의 기본이 되는 세포내 신호전달 경로를 확인하기 위해 웨스턴 블롯을 수행했다.
그 결과, IL-32θ(A94V)는 단백질 키나아제 B(AKT) 및 c-Jun의 업스트림 분자인 잘 알려진 인테그린 매개 신호 분자인 TNF-α 유도 초점 접착 키나아제(FAK)의 인산화 수준을 유의하게 감소시켰다. N-말단 키나제(JNK). IL-32θ(A94V)도 예상대로 FAK를 억제함으로써 AKT와 JNK의 인산화 수준을 하향 조절했다(도 18).
[실시예 13]
TNF-α 로 자극된 HUVEC 세포에서 NF-κB 및 AP-1의 핵 전위에 대한 IL-32θ(A94V)의 효과
TNF-α 자극은 FAK/AKT 신호 전달 경로를 활성화하여 IκB의 인산화를 통해 NF-κB (p65/p50)의 핵 전위를 유도한다. 또한 JNK의 활성화는 AP-1 (c-fos/c-jun)의 핵 전위를 가속화한다. 이러한 전사 인자는 ICAM-1 및 VCAM-1의 발현을 촉진한다. 본 발명자들은 IκB의 인산화 수준과 NF-κB (p65/p50) 및 AP-1 (c-Fos/c-Jun)의 핵 전위를 확인했다.
세포질 및 핵 추출물을 제조하고자, HUVEC 세포(2.5 × 105개 세포/웰)를 24시간 동안 세포 배양 접시에 시딩하고 IL-32θ(A94V)(100ng/mL)로 1시간 동안 전처리한 다음 제조업체의 지침에 따라 NE-PER 핵 및 세포질 추출 시약(Thermo Fisher Scientific)을 사용하여 수확 및 분획하기 전 TNF-α(10ng/mL)로 30분 동안 처리했다. 이 추출물(50μg)에서 동량의 단백질을 SDS-폴리아크릴아미드 겔 전기영동으로 분리하고 PVDF 멤브레인으로 옮겼다. 절차의 후속 단계는 위의 웨스턴 블롯팅에 대해 설명된 대로 따랐다. PARP는 핵 단백질 마커로 사용되었다.
그 결과, IL-32θ(A94V)는 TNF-α 유도 IκB 인산화를 약간 약화시켰다(도 19A). AP-1 (c-Fos/c-Jun) 및 NF-κB (p65/p50)의 핵 전위는 TNF-α 자극에 의해 증가되었고 IL-32θ(A94V)에 의해 억제되었다(도 19B). 이러한 결과는 IL-32θ(A94V)가 TNF-α로 자극된 HUVEC에서 AP-1 (c-Fos/c-Jun) 및 NF-κB (p65/p50)의 핵 전위를 조절하고, 결과적으로 ICAM-1 및 VCAM-1 발현이 감쇠한다는 것을 보여준다.
본 발명의 인터루킨-32쎄타 뮤턴트(IL-32θ mutant, IL-32θ(281T))는 NF-κB 경로를 조절하여 염증 인자의 발현을 억제하고, FAK/PI3K/AKT 경로를 통해 EMT 마커 및 세포 주기 관련 인자를 억제함으로써 암, 특히 유방암의 진행을 조절할 수 있어 산업상 이용가능성이 있다. 또한 IL-32θ(281T)가 세포 표면 수용체인 인테그린 αVβ3 및 αVβ6 에 결합하고 TNF-α로 자극된 HUVEC에서 ICAM-1 및 VCAM-1의 발현을 억제함으로써 단핵구-내피 접착을 약화시킴으로써 동맥경화증과 같은 만성 염증성 질환에서 항염증 효과를 제공할 수 있어 산업상 이용가능성이 있다. 또한 각종 암 및/또는 염증성 질환에 대한 연구 재료로도 활용될 수 있어 산업상 이용가능성이 있다.
서열번호 1 은 IL-32θ(A94V)의 아미노산 서열을 나타낸다.
서열번호 2 는 IL-32θ(281T)의 염기서열을 나타낸다.
서열번호 3 은 단백질 발현 효율 증가를 위한 IL-32θ(281T)의 염기서열을 나타낸다.
서열번호 4 는 IL-32θ(281T)의 야생형 서열을 나타낸다.
서열번호 5 는 GAPDH 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 6 은 GAPDH 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 7 은 IL-32θ 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 8 은 IL-32θ 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 9 는 IL-1β 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 10 은 IL-1β 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 11 은 IL-6 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 12 는 IL-6 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 13 은 IL-8 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 14 는 IL-8 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 15 는 COX-2 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 16 은 COX-2 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 17 은 N-cadherin 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 18 은 N-cadherin 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 19 는 Vimentin 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 20 은 Vimentin 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 21 은 PCNA 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 22 는 PCNA 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 23 은 CDK2 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 24 는 CDK2 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 25 는 인테그린 αV 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 26 은 인테그린 αV 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 27 은 인테그린 β3 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 28 은 인테그린 β3 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 29 는 인테그린 β6 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 30 은 인테그린 β6 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 31 은 ICAM-1 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 32 는 ICAM-1 에 대한 역방향 프라이머 서열을 나타낸다.
서열번호 33 은 VCAM-1 에 대한 정방향 프라이머 서열을 나타낸다.
서열번호 34 는 VCAM-1 에 대한 역방향 프라이머 서열을 나타낸다.

Claims (14)

  1. 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 암 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서, 상기 인터루킨-32쎄타 뮤턴트는 서열번호 1의 아미노산 서열을 포함하는 것을 특징으로 하는 약학적 조성물.
  3. 제2항에 있어서, 상기 인터루킨-32쎄타 뮤턴트는 서열번호 2의 염기서열로 암호화되는 것을 특징으로 하는 약학적 조성물.
  4. 제2항에 있어서, 상기 인터루킨-32쎄타 뮤턴트는 서열번호 3의 염기서열로 암호화되는 것을 특징으로 하는 약학적 조성물.
  5. 제1항에 있어서, 상기 암은 위암, 폐암, 간암, 췌장암, 대장암, 전립선암 및 유방암으로 이루어진 군에서 선택되는 어느 하나 이상인 것을 특징으로 하는 약학적 조성물.
  6. 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 염증성 질환 예방 또는 치료용 약학적 조성물.
  7. 제6항에 있어서, 상기 염증성 질환은 관절염, 류마티스 관절염, 통풍, 간염, 천식, 각막염, 위염, 장염, 신장염, 결핵, 기관지염, 흉막염, 복막염, 척추염, 췌장염, 염증성 통증, 요도염, 방광염, 동맥경화증, 패혈증, 피부염, 치주염 및 치은염으로 이루어진 군에서 선택되는 어느 하나 이상인 것을 특징으로 하는 약학적 조성물.
  8. 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 항암용 면역치료제 조성물.
  9. 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)를 포함하는 항염증용 면역치료제 조성물.
  10. 서열번호 3의 염기서열을 포함하는 인터루킨-32쎄타 뮤턴트(IL-32θ mutant) 발현용 재조합 벡터.
  11. 암 치료에 사용하기 위한 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)의 용도.
  12. 염증성 질환 치료에 사용하기 위한 인터루킨-32쎄타 뮤턴트(IL-32θ mutant)의 용도.
  13. 암 환자에 인터루킨-32쎄타 뮤턴트(IL-32θ mutant) 를 포함하는 조성물을 투여하는 단계를 포함하는 암 치료방법.
  14. 염증성 질환 환자에 인터루킨-32쎄타 뮤턴트(IL-32θ mutant) 를 포함하는 조성물을 투여하는 단계를 포함하는 염증성 질환 치료방법.
PCT/KR2023/004968 2022-04-15 2023-04-12 Il-32쎄타 뮤턴트를 포함하는 조성물 내지 이의 용도 WO2023200256A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0046961 2022-04-15
KR20220046961 2022-04-15

Publications (1)

Publication Number Publication Date
WO2023200256A1 true WO2023200256A1 (ko) 2023-10-19

Family

ID=88329977

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/004968 WO2023200256A1 (ko) 2022-04-15 2023-04-12 Il-32쎄타 뮤턴트를 포함하는 조성물 내지 이의 용도

Country Status (2)

Country Link
KR (1) KR20230149241A (ko)
WO (1) WO2023200256A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160028465A (ko) * 2013-07-03 2016-03-11 이뮤노큐어 아게 인간 항-il-32 항체
KR20180136191A (ko) * 2017-06-14 2018-12-24 연세대학교 산학협력단 암 환자의 치료 반응성을 예측하는 방법
CN113621690A (zh) * 2021-07-26 2021-11-09 山西医科大学 白细胞介素32作为靶点在筛选靶向治疗食管鳞癌药物中的应用

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102716178B1 (ko) 2018-04-11 2024-10-14 삼성전자주식회사 사용자 발화를 처리하는 시스템 및 그 시스템의 제어 방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160028465A (ko) * 2013-07-03 2016-03-11 이뮤노큐어 아게 인간 항-il-32 항체
KR20180136191A (ko) * 2017-06-14 2018-12-24 연세대학교 산학협력단 암 환자의 치료 반응성을 예측하는 방법
CN113621690A (zh) * 2021-07-26 2021-11-09 山西医科大学 白细胞介素32作为靶点在筛选靶向治疗食管鳞癌药物中的应用

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BAI XIYUAN, SHANG SHAOBIN, HENAO-TAMAYO MARCELA, BASARABA RANDALL J., OVRUTSKY ALIDA R., MATSUDA JENNIFER L., TAKEDA KATSUYUKI, CH: "Human IL-32 expression protects mice against a hypervirulent strain of Mycobacterium tuberculosis", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, vol. 112, no. 16, 21 April 2015 (2015-04-21), pages 5111 - 5116, XP093099654, ISSN: 0027-8424, DOI: 10.1073/pnas.1424302112 *
TAKAGI KOHJI, SHIMOMURA AKIKO, IMURA JOHJI, MORI HISASHI, NOGUCHI AKIRA, TANAKA SHINICHI, MINAMISAKA TAKASHI, NISHIDA TAKESHI, HAT: "Interleukin‑32 regulates downstream molecules and promotes the invasion of pancreatic cancer cells", ONCOLOGY LETTERS, SPANDIDOS PUBLICATIONS, GR, vol. 23, no. 1, 11 November 2021 (2021-11-11), GR , pages 14, XP093099240, ISSN: 1792-1074, DOI: 10.3892/ol.2021.13132 *

Also Published As

Publication number Publication date
KR20230149241A (ko) 2023-10-26

Similar Documents

Publication Publication Date Title
WO2013169077A1 (ko) 악액질 예방 또는 치료용 조성물
WO2015076621A1 (ko) 혈관 신생 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
WO2017022962A1 (ko) Ripk 억제제를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물
WO2018030789A1 (ko) 세포투과성이 향상된 펩티드 핵산 복합체 및 이를 포함하는 약학적 조성물
WO2012026712A2 (ko) Ｎｏｄ２의 아고니스트를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
WO2011142514A1 (ko) Pias3을 유효성분으로 포함하는 암 또는 면역질환의 예방 또는 치료용 조성물
WO2017023138A1 (ko) 키메라 항원 수용체 및 키메라 항원 수용체가 발현된 t 세포
WO2023096126A1 (ko) Mdsc 활성 저해 약물의 선별 방법
WO2011052883A2 (ko) Ｓｏｃｓ２ 유전자의 발현을 조절하여 자연 살해 세포를 활성화시키는 방법
WO2011115456A2 (ko) 자가 면역 질환 예방 및 치료용 ＴＮＦ－α와 ＴＷＥＡＫ 이중 길항제
WO2019045477A1 (ko) 비멘틴 유래 펩타이드에 특이적으로 결합하는 물질을 포함하는 피부질환 예방 및 치료용 조성물
WO2023200256A1 (ko) Il-32쎄타 뮤턴트를 포함하는 조성물 내지 이의 용도
WO2021158091A2 (ko) 케모카인 억제제, 콜로니 자극 인자 억제제 및 면역항암제를 포함하는 암의 예방 또는 치료용 조성물 및 병용 요법
WO2018026212A2 (ko) 섬유증 질환 모델의 제조방법 및 섬유증 질환 모델의 용도
WO2015046783A1 (en) Pharmaceutical composition for treatment of radiation- or drug-resistant cancer comprising hrp-3 inhibitor
WO2017171373A2 (ko) Egfr 표적 제제에 대한 저항성을 억제하기 위한 조성물
WO2021033973A1 (ko) Mitf 억제제를 유효성분으로 함유하는 골수-유래 억제세포 저해용 조성물
WO2016111523A2 (ko) HNF4-α 길항제 및 이의 용도
WO2022119349A1 (ko) Kras 억제제에 대한 내성 억제용 조성물
WO2015023165A1 (ko) 염증조절복합체 및 ｓｔａｔ３ 신호분자 차단을 통한 면역조절능 최적화된 안정화 중간엽줄기세포
WO2011155643A1 (ko) 포그 ２ 다섯 번째 징크 핑거 도메인을 포함하는 포스파티딜이노시톨３키나아제 활성 조절제
WO2020117017A1 (ko) 항 c-met 아고니스트 항체 및 이의 용도
WO2016204515A1 (ko) STAT3 유전자 특이적 siRNA, 그러한 siRNA를 포함하는 이중나선 올리고 RNA 구조체, 이를 포함하는 조성물 및 이의 용도
WO2020117019A1 (ko) 항 c-met 아고니스트 항체 및 이의 용도
WO2017164486A1 (ko) Tesk1 억제제를 포함하는 항암제 내성 억제용 조성물 및 tesk1 억제제의 스크리닝 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23788605

Country of ref document: EP

Kind code of ref document: A1