WO2023185231A1 - Arn de recrutement adar modifiés et procédés d'utilisation pour le syndrome d'usher - Google Patents

Arn de recrutement adar modifiés et procédés d'utilisation pour le syndrome d'usher Download PDF

Info

Publication number
WO2023185231A1
WO2023185231A1 PCT/CN2023/073623 CN2023073623W WO2023185231A1 WO 2023185231 A1 WO2023185231 A1 WO 2023185231A1 CN 2023073623 W CN2023073623 W CN 2023073623W WO 2023185231 A1 WO2023185231 A1 WO 2023185231A1
Authority
WO
WIPO (PCT)
Prior art keywords
rna
target
sequence
nucleotides
adenosine
Prior art date
Application number
PCT/CN2023/073623
Other languages
English (en)
Inventor
Pengfei YUAN
Zexuan YI
Ying Zhao
Huayuan XU
Original Assignee
Edigene Therapeutics (Beijing) Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Edigene Therapeutics (Beijing) Inc. filed Critical Edigene Therapeutics (Beijing) Inc.
Publication of WO2023185231A1 publication Critical patent/WO2023185231A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04004—Adenosine deaminase (3.5.4.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present application relates to methods and compositions for editing RNAs using engineered linear or circular RNA capable of recruiting an adenosine deaminase to deaminate one or more adenosines in target RNAs.
  • Genome editing is a powerful tool for biomedical research and development of therapeutics for diseases. Editing technologies using engineered nucleases, such as zinc finger nucleases (ZFNs) , transcription activator-like effector nucleases (TALENs) , and Cas proteins of CRISPR system have been applied to manipulate the genome in a myriad of organisms. Recently, taking advantage of the deaminase proteins, such as Adenosine Deaminase Acting on RNA (ADAR) , new tools were developed for RNA editing. In mammalian cells, there are three types of ADAR proteins, Adar1 (two isoforms, p110 and p150) , Adar2 and Adar3 (catalytically inactive) .
  • ADAR proteins Adar1 (two isoforms, p110 and p150)
  • Adar2 and Adar3 catalytically inactive) .
  • the catalytic substrate of ADAR protein is double-stranded RNA, and ADAR can remove the -NH2 group from an adenosine (A) nucleobase, changing A to inosine (I) .
  • (I) is recognized as guanosine (G) and paired with cytidine (C) during subsequent cellular transcription and translation processes.
  • the ADAR protein or its catalytic domain was fused with a ⁇ N peptide, a SNAP-tag or a Cas protein (dCas13b) , and a guide RNA was designed to recruit the chimeric ADAR protein to the target site.
  • overexpressing ADAR1 or ADAR2 proteins together with an R/G motif-bearing guide RNA was also reported to enable targeted RNA editing.
  • ADAR-mediated RNA editing technologies have certain limitations.
  • the most effective in vivo delivery for gene therapy is through viral vectors, but the highly desirable adeno-associated virus (AAV) vectors are limited with the cargo size ( ⁇ 4.5 kb) , making it challenging for accommodating both the protein and the guide RNA.
  • AAV adeno-associated virus
  • over-expression of ADAR1 has recently been reported to confer oncogenicity in multiple myelomas due to aberrant hyper-editing on RNAs, and to generate substantial global off-targeting edits.
  • ectopic expression of proteins or their domains of non-human origin has potential risk of eliciting immunogenicity.
  • pre-existing adaptive immunity and p53-mediated DNA damage response may compromise the efficacy of the therapeutic protein, such as Cas9.
  • Usher syndrome also known as hereditary deafness -retinitis pigmentosa syndrome, was described and named by Charles Howard Usher in 1914. It a rare autosomal recessive disease, caused by a genetic mutation, which results in either congenital or progressive loss of vision and/or hearing. It is estimated that more than half of the 16,000 blind and deaf people in the United States suffer from Usher syndrome. There are tens of thousands or even hundreds of thousands of patients in the world who are in urgent need of treatment.
  • Usher syndrome in accordance with the severity, can be categorized into types I, II, III, and IV.
  • type I has an early onset, with severe congenital deafness and early visual impairment, leaving a very small window for intervention; while types III and IV are relatively rare and with mild syndromes.
  • Patients with type II Usher syndrome begins to experience gradual vision loss starting from the age of 10 to 20. The initial stage of the onset is night blindness and eventually proceeds to loss of vision. This allows us to have a longer therapeutic intervention window and hopefully terminate the gradual loss of vision in patients with type II Usher syndrome.
  • USHER syndrome type II there are two main directions for research and development on the treatment of USHER syndrome type II through gene therapy.
  • One is to mediate the re-expression of the full-length USH2A gene in the eye by means of viruses.
  • the protein sequence of USH2A gene is very long, accounting for more than 6000 amino acids, which results in a corresponding coding region sequence with more than 18000 base pairs, while the usual viral vectors have limitations on the length of a genetic payload.
  • lentiviruses can be used to deliver payloads with no more than 10,000 base pairs, while adeno-associated viruses deliver payloads with no more than 4, 500 base pairs. This makes delivery of the full-length USH2A gene by viral vectors difficult to achieve.
  • USH2A gene therapy Another common direction for USH2A gene therapy is through exon skipping. Since some USH2A gene mutations are caused by frame shift or nonsense mutation of a certain exon, as long as the exon can be specifically skipped in the process of RNA splicing, the sequence following the exon can be translated normally. It is common practice to introduce a short stretch of antisense nucleotides (Anti-Sense Oligo, ASO) to specifically skip the exon targeted by the translated nucleotide during splicing. This method is similar to the previous method-because the mutated exon is skipped, a full-length Usherin still cannot be obtained in the end.
  • Anti-Sense Oligo ASO
  • Boya Jiyin disclosed in CN113122577A a method for targeted editing of target RNAs containing G to A mutations in USH2A gene transcripts based on linear LEAPER technology (Leaper 1.0) , including the use of adenosine for editing target RNAs.
  • a deaminase recruiting RNA (arRNA) or a construct encoding the arRNA is introduced into the cell, wherein the arRNA comprises a complementary RNA sequence that hybridizes to the target RNA, and wherein the arRNA is capable of recruiting adenosine deaminase (ADAR) to deaminate target adenosines in target RNA, thereby safely and effectively perform in vivo base editing from “A” to “I” bases on RNA, allowing the repair of disease-causing mutation sites, and achieving the goal of treatment of diseases such as Usher syndrome.
  • ADAR adenosine deaminase
  • the present application provides methods for editing a target adenosine in a target RNA encoding a mutant Usher 2A protein and comprising a target adenosine in a host cell, comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises one or more mismatch regions, and wherein the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence. Further provided herein are methods for treating or preventing a disease or condition in an individual comprising editing a target RNA associated with the
  • RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 5 nucleotides to 85 nucleotides upstream of the target adenosine; and/or (b) a second mismatch
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 5 nucleotides to 25 nucleotides upstream of the target adenosine; and/or wherein the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 20 nucleotides to 45 nucleotides downstream of the target adenosine.
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 5 nucleotides to 15 nucleotides upstream of the target adenosine; and/or wherein the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 20 nucleotides to 45 nucleotides downstream of the target adenosine.
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine; and/or wherein the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 25 nucleotides to 45 nucleotides downstream of the target adenosine.
  • the first mismatch region and/or the second mismatch region comprise one or more non-complementary nucleotides (mismatch) in the targeting RNA sequence.
  • dRNAs for editing a target RNA comprising a targeting RNA sequence that is that is capable of hybridizing to the target RNA to form a RNA duplex
  • the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex
  • the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA
  • ADAR adenosine deaminase acting on RNA
  • the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 5 nucleotides to 85 nucleotides upstream of the target adenosine; and/or (b) a second mismatch region relative to the target RNA sequence at 20 nucleotides to 85 nucleotides downstream of the target adenosine; and wherein the dRNA comprises
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 5 nucleotides to 25 nucleotides upstream of the target adenosine; and/or wherein the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 20 nucleotides to 45 nucleotides downstream of the target adenosine.
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 5 nucleotides to 15 nucleotides upstream of the target adenosine; and/or wherein the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 20 nucleotides to 45 nucleotides downstream of the target adenosine.
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine; and/or wherein the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 25 nucleotides to 45 nucleotides downstream of the target adenosine.
  • the first mismatch region and/or the second mismatch region comprise one or more non-complementary nucleotides (mismatch) in the targeting RNA sequence.
  • the first mismatch region and/or the second mismatch region comprise deletion of one or more nucleotides from the targeting RNA. In some embodiments, the first mismatch region and/or the second mismatch region comprise insertion of one or more nucleotides into the targeting RNA. In some embodiments, the first mismatch region and/or the second mismatch region comprise at least one group of consecutive non-complementary nucleotides (mismatch) in the targeting RNA. In some embodiments, the first mismatch region and/or the second mismatch region comprise deletion of at least one group of consecutive nucleotides from the targeting RNA.
  • the first mismatch region and/or the second mismatch region comprise insertion of at least one group of consecutive nucleotides from the targeting RNA.
  • the first mismatch region is 1-50 nucleotides in length.
  • the second mismatch region is 1-50 nucleotides in length.
  • the first mismatch region is 1-10 nucleotides in length, wherein the first mismatch region comprises 1-10 consecutive non-complementary nucleotides in the targeting RNA or deletion of 1-10 consecutive nucleotides from the targeting RNA.
  • the second mismatch region is 1-10 nucleotides in length, wherein the second mismatch region comprises 1-10 consecutive non-complementary nucleotides in the targeting RNA or deletion of 1-10 consecutive nucleotides from the targeting RNA.
  • the first mismatch region is 4 nucleotides in length.
  • the second mismatch region is 4 nucleotides in length.
  • the first mismatch region is 4 nucleotides in length, wherein the first mismatch region comprises 4 consecutive non-complementary nucleotides in the targeting RNA or deletion of 4 consecutive nucleotides from the targeting RNA.
  • the second mismatch region is 4 nucleotides in length, wherein the second mismatch region comprises 4 consecutive non-complementary nucleotides in the targeting RNA or deletion of 4 consecutive nucleotides from the targeting RNA.
  • a non-complementary nucleotide in the targeting RNA results in a bubble in the RNA duplex.
  • a nucleotide deletion in the targeting RNA results in a bulge in the RNA duplex.
  • a nucleotide insertion in the targeting RNA results in a bulge in the RNA duplex.
  • a group of consecutive non-complementary nucleotides in the targeting RNA results in a bubble in the RNA duplex. In some embodiments, deletion of a group of consecutive nucleotides in the targeting RNA results in a bulge in the RNA duplex. In some embodiments, insertion of a group of consecutive nucleotides in the targeting RNA results in a bulge in the RNA duplex.
  • the mutant Usher 2A protein comprises a missense mutation, a nonsense mutation and/or a frameshift mutation. In some embodiments, the mutant Usher 2A protein comprises a Trp3955Ter mutation. In some embodiments, the target RNA encoding mutant Usher 2A comprises a G to A mutation with reference to a target RNA that encodes wild-type Usher 2A. In some embodiments, the target RNA encoding mutant Usher 2A comprises a 11864G>A mutation with reference to a target RNA that encodes wild-type Usher 2A.
  • the RNA duplex further comprises a third mismatch region relative to the target RNA, wherein the third mismatch region is located between the first mismatch region and the second mismatch region relative to the target RNA.
  • the third mismatch region comprises one or two non-complementary nucleotides in the targeting RNA and/or deletion of one or both nucleotides from the targeting RNA sequence.
  • the third mismatch region relative to the target RNA sequence is at 7 and/or 8 nucleotides downstream of the target adenosine; optionally wherein the target RNA comprises adenosine at the 7th and/or the 8th nucleotide downstream of the target adenosine.
  • the target RNA comprises the sequence of “AA” at 7 and 8 nucleotides downstream of the target adenosine, wherein the targeting RNA sequence comprises any one of: A, AA, U, C, CC, G, GG, or an absence of nucleotides ( “X” ) opposite to the target RNA at 7 and 8 nucleotides downstream of the target adenosine.
  • the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 27 nucleotides to 30 nucleotides upstream of the target adenosine; and (b) a second mismatch region relative to the target RNA sequence at 31 nucleotides to 43 nucleotides downstream of the target adenosine.
  • the second mismatch region relative to the target RNA sequence is at 36 nucleotides to 39 nucleotides downstream of the target adenosine; optionally wherein the first mismatch region is 4 nucleotides in length and the second mismatch region is 4 nucleotides in length.
  • the first mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence and wherein the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence.
  • the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 21 nucleotides to 30 nucleotides upstream of the target adenosine; and (b) a second mismatch region relative to the target RNA sequence at 36 nucleotides to 39 nucleotides downstream of the target adenosine; optionally wherein the first mismatch region is 10 nucleotides in length and the second mismatch region is 4 nucleotides in length.
  • the first mismatch region comprises a deletion of ten consecutive nucleotides from the targeting RNA sequence and wherein the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence.
  • the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 21 nucleotides to 30 nucleotides upstream of the target adenosine; and (b) a second mismatch region relative to the target RNA sequence at 40 nucleotides to 43 nucleotides downstream of the target adenosine; optionally wherein the first mismatch region is 10 nucleotides in length and the second mismatch region is 4 nucleotides in length.
  • the first mismatch region comprises a deletion of ten consecutive nucleotides from the targeting RNA sequence and wherein the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence.
  • the dRNA is circular. In some embodiments, the dRNA is linear and/or capable of being circularized. In some embodiments, the dRNA further comprises one or more RNA recruiting domains, optionally wherein the RNA recruiting domain is a stem-loop structure. In some embodiments, the linker nucleic acid sequence is about 5 nucleotides (nt) to about 500 nt in length.
  • the linker nucleic acid sequence is less than or equal to 70nt in length, optionally wherein the length of linker nucleic acid sequence is any integer between 10nt-50nt, 10nt-40nt, 10nt-30nt, 10nt-20nt, 20nt-50nt, 20nt-40nt, 20nt-30nt, 30nt-50nt, 30nt-40nt or 40nt-50nt.
  • the linker nucleic acid sequence is about 20 nt to about 60 nt in length; optionally wherein the linker nucleic acid sequence is about 30nt in length, or about 50nt in length.
  • At least about any one of: 50%, 60%, 70%, 80%, 85%, 90%, or 95%of the linker nucleic acid sequence comprises adenosine or cytidine. In some embodiments, at least 50%of the linker nucleic acid sequence comprises adenosine.
  • the method has increased level of editing of the target adenosine as compared to a corresponding method wherein the RNA duplex does not comprise the one or more mismatch regions or wherein the dRNA does not comprise the linker nucleic acid sequence.
  • the method has reduced level of (bystander) editing of one or more non-target adenosines as compared to a corresponding method wherein the RNA duplex does not comprise the one or more mismatch regions or wherein the dRNA does not comprise the linker nucleic acid sequence.
  • the non-target adenosine is within one or more of the mismatch regions. In some embodiments, the non-target adenosine is outside of the mismatch regions.
  • the dRNA comprises a first linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence and a second linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence.
  • the first linker nucleic acid sequence is identical to the second linker nucleic acid sequence.
  • the first linker nucleic acid sequence is different from the second linker nucleic acid sequence.
  • the dRNA is a circular RNA, and wherein the linker nucleic acid sequence connects the 5’ end of the targeting RNA sequence and the 3’ end of the targeting RNA sequence.
  • the dRNA is a circular RNA, wherein the dRNA further comprises a 3’ exon sequence recognizable by a 3’ catalytic Group I intron fragment flanking the 5’ end of the targeting RNA sequence, and a 5’ exon sequence recognizable by a 5’ catalytic Group I intron fragment flanking the 3’ end of the targeting RNA sequence.
  • the dRNA further comprises a 3’ ligation sequence and a 5’ ligation sequence.
  • the 3’ ligation sequence and the 5’ ligation sequence are at least partially complementary to each other.
  • the 3’ ligation sequence and the 5’ ligation sequence are about 20 to about 75 nucleotides in length.
  • the dRNA is circularized by RNA ligase RtcB. In some embodiments, the dRNA is circularized by T4 RNA ligase 1 (Rnl1) or RNA ligase 2 (Rnl2) .
  • the method comprises introducing a construct comprising a nucleic acid sequence encoding the dRNA into the host cell.
  • the construct further comprises a promoter operably linked to the nucleic acid sequence encoding the dRNA.
  • the promoter is a polymerase II promoter ( “Pol III promoter” ) .
  • the promoter is a polymerase III promoter ( “Pol III promoter” ) .
  • the construct is a viral vector or a plasmid.
  • the construct is an adeno-associated viral (AAV) vector.
  • the construct is a self-complementary AAV (scAAV) vector.
  • the ADAR is endogenously expressed by the host cell.
  • the host cell is a retinal cell.
  • the targeting RNA sequence is more than 50 nt long. In some embodiments, the targeting RNA sequence is about 100 to about 200 nt long. In some embodiments, the targeting RNA sequence comprises a cytidine, adenosine or uridine directly opposite the target adenosine in the target RNA. In some embodiments, the targeting RNA sequence comprises a cytidine mismatch directly opposite the target adenosine in the target RNA.
  • the cytidine mismatch is located at least 20 nucleotides away from the 3’ end of the targeting RNA sequence, and at least 5 nucleotides away from the 5’ end of the targeting RNA sequence.
  • the 5’ nearest neighbor of the target adenosine in the target RNA is a nucleotide selected from U, C, A and G with the preference U>C ⁇ A>G and the 3’ nearest neighbor of the target adenosine in the target RNA is a nucleotide selected from G, C, A and U with the preference G>C>A ⁇ U.
  • the target adenosine is in a three-base motif of UAG, and wherein the targeting RNA comprises an A directly opposite the uridine in the three-base motif, a cytidine directly opposite the target adenosine, and a cytidine, guanosine or uridine directly opposite the guanosine in the three-base motif.
  • the target RNA is an RNA selected from the group consisting of a pre-messenger RNA, a messenger RNA, a ribosomal RNA, a transfer RNA, a long non-coding RNA and a small RNA, optionally wherein the target RNA is a pre-messenger RNA.
  • the method further comprises introducing an inhibitor of ADAR3 and/or a stimulator of interferon into the host cell.
  • the method comprises introducing a plurality of dRNAs or constructs each targeting a different target RNA into the host cell.
  • the efficiency of editing the target RNA is at least 40%.
  • the method further comprises introducing an ADAR into the host cell.
  • deamination of the target adenosine in the target RNA results in a missense mutation, an early stop codon, aberrant splicing, or alternative splicing in the target RNA, or reversal of a missense mutation, an early stop codon, aberrant splicing, or alternative splicing in the target RNA.
  • deamination of the target adenosine in the target RNA results in point mutation, truncation, elongation and/or misfolding of the protein encoded by the target RNA, or a functional, full-length, correctly-folded and/or wild-type protein by reversal of a missense mutation, an early stop codon, aberrant splicing, or alternative splicing in the target RNA.
  • the host cell is a eukaryotic cell, optionally wherein the host cell is a mammalian cell. In some embodiments, the host cell is a human or mouse cell. Also provided are edited RNAs and host cells having an edited RNA produced by any one of the methods described herein.
  • a disease or condition in an individual comprising editing a target RNA encoding a mutant Usher 2A protein comprising a target adenosine associated with the disease or condition in a cell of the individual according to any one of the methods of editing described above, or according to the use of any one of the dRNAs described above.
  • the disease or condition is a hereditary genetic disease or a disease or condition associated with one or more acquired genetic mutations.
  • the disease or condition is a monogenetic or a polygenetic disease or condition.
  • RNA has a G to A mutation.
  • the individual has TYPE II usher syndrome.
  • the individual has no loss of vision, or wherein the individual has mild to moderate loss of invention.
  • the host cell is a retinal cell, optionally wherein the host cell is a rod cell and/or a cone cell.
  • the dRNA or the construct encoding the dRNA is introduced into the subretinal space and/or the vitreous space.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of vision as compared to a corresponding individual not introduced with the dRNA nor the construct.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of vision as compared to a corresponding individual introduced with a corresponding dRNA or a construct encoding a corresponding dRNA that does not comprise the one or more mismatch regions and/or the one or more linker nucleic acid sequences.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of retinal cells as compared to a corresponding individual not introduced with the dRNA nor the construct. In some embodiments, an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of retinal cells as compared to a corresponding individual introduced with a corresponding dRNA or a construct encoding a corresponding dRNA that does not comprise the one or more mismatch regions and/or the one or more linker nucleic acid sequences.
  • a host cell comprising any one of the constructs or dRNAs described above.
  • a kit comprising any one of the constructs or dRNAs described above, wherein the kit further comprises instructions for editing a target RNA comprising a target adenosine in a host cell.
  • FIG. 1A shows the sequence of amplified PCR product from full-length coding sequence of USH2A with introduction of G>A mutations through mutagenesis PCR.
  • FIG. 1B shows a schematic of genetically encoding arRNA by U6 or CMV promoter.
  • the 151-nt arRNA targeting fluorescence Reporter-1 was expressed under human U6 or CMV promoter.
  • mCherry and EGFP genes were linked by sequences containing 3 ⁇ GGGGS (SEQ ID NO: 375) -coding region and an in-frame UAG stop codon.
  • the reporter-expressed cells only produced mCherry protein, while targeted editing on the UAG stop codon of the reporter transcript could convert the UAG to UIG and thus to permit the downstream EGFP expression.
  • FIG. 2 shows the percentage of each adenosine in target RNA sequence in the USH2A reporter cell line that was edited after introduction of a linear arRNA with a 151-nt targeting RNA sequence (Linear-151) or a circular arRNA with a 151-nt (Circular-151) targeting RNA sequence, as measured by sequencing.
  • Position 0 indicates the target adenosine
  • “-” indicates upstream positions
  • “+” indicates downstream positions in the target RNA.
  • FIG. 3 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of linear or circular arRNAs with targeting RNA sequence length as indicated on x-axis, as compared to untreated (UT) or mock-transfection, as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • FIG. 4 shows the non-target adenosine in USH2A that is upstream of the editing site (upper panel) or downstream of the editing site (lower panel) .
  • FIG. 5 shows a schematic of using non-complementary base pairs ( “4bp mismatch” ) as well as deletions from targeting RNA sequence ( “4bp deletion” ) to generate mismatch regions in the arRNA design.
  • FIG. 6 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of USHER-171 arRNA, untargeted arRNA, or the arRNAs with mismatch regions as described in Table 1, as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 7 shows the percentage of each adenosine in target RNA sequence in the USH2A reporter cell line that was edited after introduction of USHER-171 arRNA, untargeted arRNA, or the arRNAs with mismatch regions as described in Table 1, as measured by sequencing.
  • Position 0 indicates the target adenosine
  • “-” indicates upstream positions
  • “+” indicates downstream positions in the target RNA.
  • FIG. 8A shows a schematic of using deletions from targeting RNA sequence at positions upstream of the target adenosine (relative to target RNA) to generate mismatch regions in the arRNA design.
  • FIG. 8B shows a schematic of using deletions from targeting RNA sequence at positions downstream of the target adenosine (relative to target RNA) to generate mismatch regions in the arRNA design.
  • FIG. 9 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of USHER-171 arRNA, untargeted arRNA, or the arRNAs with mismatch regions as described in Table 2, as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 10 shows the percentage of each adenosine in target RNA sequence in the USH2A reporter cell line that was edited after introduction of USHER-171 arRNA, untargeted arRNA, or the arRNAs with mismatch regions as described in Table 2, as measured by sequencing.
  • Position 0 indicates the target adenosine
  • “-” indicates upstream positions
  • “+” indicates downstream positions in the target RNA.
  • FIG. 11 is a schematic depicting the use of flexible linkers either flanking 5’ ( “left” flexible linker, or L-flexible linker) of the targeting RNA sequence of the arRNA (upper panel) or 3’ ( “right” flexible linker, or R-flexible linker) of the targeting RNA sequence of the arRNA (lower panel) .
  • FIG. 12 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of arRNAs comprising L-flexible linkers (L) or R-flexible linkers (R) described in FIG. 11, with linker length indicated in x-axis (10-nt, 20-nt, 30-nt) , as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • L L-flexible linkers
  • R R-flexible linkers
  • FIG. 13 shows the percentage of each adenosine in target RNA sequence in the USH2A reporter cell line that was edited after introduction of arRNAs comprising L-flexible linkers (L) or R-flexible linkers (R) of the indicated linker length (10-nt, 20-nt, 30-nt) , as measured by sequencing.
  • Position 0 indicates the target adenosine
  • “-” indicates upstream positions
  • “+” indicates downstream positions in the target RNA.
  • FIG. 14A is a schematic depicting a circular arRNA with 10bp deletion upstream of target adenosine (-26x-21x) , 4bp deletion downstream of target adenosine (+35x or +39x) , and further deletion of nucleotides opposite to non-target adenosines downstream from target adenosine (+d7/8) , (all positions relative to the target RNA) from targeting RNA sequence.
  • FIG. 14A is a schematic depicting a circular arRNA with 10bp deletion upstream of target adenosine (-26x-21x) , 4bp deletion downstream of target adenosine (+35x or +39x) , and further deletion of nucleotides opposite to non-target adenosines downstream from target adenosine (+d7/8) , (all positions relative to the target RNA) from targeting RNA sequence.
  • FIG. 14A is a schematic depicting a circular arRNA with 10bp deletion upstream
  • 14B is a schematic depicting a circular arRNA with 10bp deletion upstream of target adenosine (-26x-21x) , 4bp deletion downstream of target adenosine (+35x or +39x) , and further deletion of nucleotides opposite to non-target adenosines downstream from target adenosine (+d7/8) , (all positions relative to the target RNA) from targeting RNA sequence, wherein the targeting RNA sequence is further flanked with a 3’ flexible linker ( “right” flexible linker, or R-flexible linker) .
  • a 3’ flexible linker “right” flexible linker, or R-flexible linker
  • FIG. 15 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of USHER-171 arRNA, untargeted arRNA, or the arRNAs with mismatch regions with or without the AC-linker (at 10-nt, 20-nt, 30-nt, 40-nt, 50-nt) as described in FIG. 14, as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 16 shows the percentage of each adenosine in target RNA sequence in the USH2A reporter cell line that was edited after introduction of USHER-171 arRNA, untargeted arRNA, or the arRNAs with mismatch regions with or without the AC-linker (at 10-nt, 20-nt, 30-nt, 40-nt, 50-nt) as described in FIG. 14, as measured by sequencing.
  • Position 0 indicates the target adenosine
  • “-” indicates upstream positions
  • “+” indicates downstream positions in the target RNA.
  • FIG. 17 is a schematic depicting the further refinement in mismatch of bases (originally “UU” ) opposite to non-target adenosines downstream from target adenosine (+8 and +7) .
  • FIG. 18 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of USHER-171 arRNA, untargeted arRNA, or the arRNAs with the described mismatch regions (+39x--21x or +35x-21x, see FIG. 14) and with bases (originally “UU” ) opposite to non-target adenosines downstream from target adenosine (+8 and +7) changed to that as indicated on the X axis (A, AA, U, UU, C, CC, G, GG, or “X” ) , as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 19 shows the percentages of target adenosine (0) and non-target adenosines (+7, +8) in target RNA sequence in the USH2A reporter cell line that were edited after introduction of USHER-171 arRNA, or the arRNAs with the described mismatch regions (+39x-21x or +35x-21x, see FIG. 14) and with bases (originally “UU” ) opposite to non-target adenosines downstream from target adenosine (+7/8) changed to that as indicated on the X axis (A, AA, U, UU, C, CC, G, GG, or “X” ) , as measured by sequencing.
  • Position 0 indicates the target adenosine
  • “-” indicates upstream positions
  • “+” indicates downstream positions in the target RNA.
  • FIG. 20 is a schematic depicting the further refinement in mismatch of bases (originally “UU” ) opposite to non-target adenosines downstream from target adenosine (+d7/8) .
  • FIG. 21 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of the arRNAs with the described mismatch regions (+35x-21x-FlexLinker30 or +35x) and with bases (originally “UU” ) opposite to non-target adenosines downstream from target adenosine (+8 and +7) changed to that as indicated on the X axis, as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 22 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of the arRNAs with the described mismatch regions (+35x-21x-FlexLinker50) and with bases (originally “UU” ) opposite to non-target adenosines downstream from target adenosine (+8 and +7) changed to that as indicated on the X axis, as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 23 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of the arRNAs with the described mismatch regions (+35x-21x-FlexLinker50) and with bases (originally “UU” ) opposite to non-target adenosines downstream from target adenosine (+8 and +7) changed to that as indicated on the X axis, as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 24 is a schematic depicting the deletion of bases from targeting RNA sequence in regions upstream (-26) or downstream (+35) of the target adenosine, relative to the target RNA.
  • FIG. 25 is a schematic depicting the insertion of bases into targeting RNA sequence in regions upstream (-26) or downstream (+35) of the target adenosine, relative to the target RNA.
  • FIG. 26 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of the arRNAs with the described deletion or insertion (1, 2, 3, 4, 7, 10 nt in length) in the described upstream or downstream regions relative to target RNA (-26+35) , as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 27 is a schematic depicting the deletion of bases from targeting RNA in regions downstream (+35) of the target adenosine, relative to the target RNA.
  • FIG. 28 shows with solid bars (left) the on-target editing efficiency in the USH2A reporter cell line after introduction of the arRNAs with the described deletion (0, 4, 10, 20, 30, 40, or 50 nt in length) in the described downstream region relative to target RNA (+35) , as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 29 is a schematic depicting the deletion of bases from targeting RNA in regions upstream (-26) of the target adenosine, relative to the target RNA.
  • FIG. 30 shows with solid bars (left) the on-target editing efficiency in the USH2A reporter cell line after introduction of the arRNAs with the described deletion (0, 4, 10, 20, 30, 40, or 50 nt in length) in the described upstream region relative to target RNA (-26) , as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 30 further shows with hollow bars (right) the on-target editing efficiency in the USH2A reporter cell line after introduction of the arRNAs with the described deletion (0, 4, 10, 20, 30, 40, or 50 nt in length) in the described upstream region relative to target RNA (-26) and with a further 4nt deletion in the described downstream region relative to target RNA (+35) , as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 31 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of the arRNAs with the described deletions (0, 4, 10, 20, 30, 40, or 50 nt in length) in the both the described upstream region relative to target RNA (-26) and the described downstream region relative to target RNA (+35) , as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 32 shows the sequences and length of the flexible linkers used for flanking targeting RNA sequences.
  • FIG. 33 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of the arRNAs with the described mismatch regions (+35x-21X, +35x-21X+d78 or control arRNA) and flanked by the flexible linkers described in FIG. 32, as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 34 shows the previously reported on-target editing efficiency of arRNAs at various lengths of targeting RNA sequence and comprising the illustrated stem loops and/or circularization.
  • FIG. 35 is a schematic depicting the addition of stem loops (GluR, U6+27, Alu) to an arRNA.
  • FIG. 36 shows the on-target editing efficiency in the USH2A reporter cell line after introduction of the USHER-171 arRNAs (85-c-85) , or USHER-171 with the described mismatch regions and linkers (-21x+35x-R-flexlinker30 and -21+35x-R-flexlinker50) with or without the further modification of the stem loops described in FIG. 34 (GluR, U6+27, Alu) , as measured by mean fluorescence intensity (MFI) of GFP reporter.
  • MFI mean fluorescence intensity
  • FIG. 37 shows the on-target and bystander editing patterns in Rhesus monkey kidney cells with Ush2A reporter (lower panel) subsequent to transfection of Ush2A-targeting arRNA, as compared to the editing patterns in Rhesus monkey eyes subsequent to subretinal injection of AAV packaged with the Ush2A-targeting arRNA.
  • FIG. 38 shows the on-target and bystander editing patterns of USH2A in Rhesus monkey kidney cells subsequent to introduction of a USH2A-specific arRNA with the described deletion (4 in length) in the described upstream or downstream regions from target adenosine.
  • FIG. 39 shows the on-target and bystander editing patterns of USH2A in Rhesus monkey kidney cells subsequent to introduction of a USH2A-specific arRNA with two deletions (4 in length) in the described upstream or downstream regions from target adenosine.
  • FIG. 40 shows the on-target and bystander editing patterns of USH2A in Rhesus monkey kidney cells subsequent to introduction of a USH2A-specific arRNA or the corresponding arRNA with flexible linker of the indicated length (10, 20, 30, 40, 50nt) flanking the targeting RNA sequence at 5’ (L-10, L-20, L-30, L-40, L-50) or 3’ (R-10, R-20, R-40, R-50) .
  • FIG. 41 shows the on-target and bystander editing patterns of USH2A in Rhesus monkey kidney cells subsequent to introduction of a USH2A-specific arRNA with the indicated combinations of mismatch regions downstream and upstream of target adenosine relative to the target RNA as well as a flexible linker at both 5’ and 3’.
  • FIG. 42 shows the on-target and bystander editing patterns of USH2A in Rhesus monkey kidney cells subsequent to introduction of a USH2A-specific arRNA before optimization, after optimization by first deleting 4 bp in the both the described upstream region relative to target RNA (-26) and the described downstream region relative to target RNA (+35) , and additionally including a 20bp linker flanking the targeting RNA sequence at the 3’ end and a 30bp linker flanking the targeting RNA sequence at the 5’ end.
  • FIG. 43 shows the on-target and bystander editing patterns of USH2A in Rhesus monkey kidney cells subsequent to introduction of a USH2A-specific arRNA with the indicated combinations of mismatch regions downstream and upstream of target adenosine relative to the target RNA as well as a flexible linker at both 5’ and 3’ in addition to more or more deletions of uracil.
  • the present application provides improved RNA editing methods and specially designed RNAs, referred herein as deaminase-recruiting RNAs ( “dRNAs” ) or ADAR-recruiting RNAs ( “arRNAs” ) or constructs comprising nucleic acids encoding these arRNAs, to edit target RNAs comprising a target adenosine in a host cell.
  • dRNAs deaminase-recruiting RNAs
  • arRNAs ADAR-recruiting RNAs
  • LEAPER Leveraging Endogenous ADAR for Programmable Editing on RNA
  • LEAPER method was described in WO2021/008447 and PCT/CN2021/071292, which are incorporated herein by reference in their entirety.
  • a targeting RNA that is partially complementary to the target transcript was used to recruit native or exogenously introduced ADAR1 or ADAR2 to change adenosine to inosine at a specific site in a target RNA.
  • RNA editing can be achieved in certain systems without ectopic or overexpression of the ADAR proteins in the host cell.
  • the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex comprises one or more mismatch regions that are upstream and/or downstream of the target adenosine; and wherein the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence, wherein the linker nucleic acid sequence in some embodiments does not hybridize with the target RNA and does not substantially form a secondary structure.
  • the mismatch regions may comprise one or more non-complementary bases or deletion of one or more bases in the targeting RNA.
  • the methods described herein have been successfully used to correct pathogenic point mutations, such as USH2A mutations.
  • the improved LEAPER methods may provide broad applicability for both therapeutics and biomedical research.
  • one aspect of the present application provides a method for editing a target adenosine in a target RNA encoding a mutant Usher 2A protein in a host cell, comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine; and/or (b) a second mismatch region relative to the target RNA sequence at 25 nucleotides to
  • a method for editing a target adenosine in a target RNA in a host cell comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises a first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine, and wherein the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not hybridize with the
  • a method for editing a target adenosine in a target RNA in a host cell comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises a second mismatch region relative to the target RNA sequence at 25 nucleotides to 45 nucleotides downstream of the target adenosine; and wherein the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not hybridize with the target
  • dRNA deamin
  • a method for editing a target adenosine in a target RNA in a host cell comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine; and (b) a second mismatch region relative to the target RNA sequence at 25 nucleotides to 45 nucleotides downstream of the target adenos
  • RNA duplex comprises: (a) a first mismatch region comprising a deletion of about four to about ten consecutive nucleotides from the targeting RNA relative to the target RNA sequence at 21 nucleotides to 37 nucleotides upstream of the target adenosine;
  • the term “bulge” refers to an asymmetric bubble region in a nucleic acid duplex formed due to one or more unpaired nucleotides (e.g., a non-target adenosine) in one strand of the nucleic acid duplex.
  • a bulge described herein may have a fully unpaired region in one strand that does not have any corresponding complementary region in the opposite strand.
  • a bulge described herein may be formed by two non-complementary regions (one in each strand) having different number of nucleotides, which may further contain mismatched nucleotides that do not form Watson-Crick base pairs.
  • the longer of the two non-complementary regions has at least one nucleotide (e.g., a non-target adenosine) that is not paired with any nucleotides in the non-complementary region of the opposite strand, i.e., the opposite strand comprises nucleic acid sequence (s) complementary to nucleic acid sequence (s) flanking the bulge but the opposite strand does not contain at least one nucleotide opposite a nucleotide (e.g., a non-target adenosine) in the bulge.
  • nucleotide e.g., a non-target adenosine
  • a “bulge” described herein does not encompass a fully mispaired region of nucleotides located within one strand of a nucleic acid duplex, i.e., the opposite strand contains a nucleotide that is non-complementary for each of the nucleotides in the bulge, which results in a symmetric bubble in the nucleic acid duplex.
  • the bulge contain 1, 2, 3, 4, 5, or greater than 5 nucleotides in the strand having the unpaired nucleotides.
  • a first nucleoside in the first nucleic acid strand that base-pair with a second nucleoside in the second nucleic acid strand are described herein as being “opposite” with respect to each other, or “corresponding” to each other, i.e., the first nucleoside is opposite to the second nucleoside, and the second nucleoside is opposite to the first nucleoside.
  • nucleic acid refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
  • RNA deaminase-recruiting RNA, ” “dRNA, ” “ADAR-recruiting RNA” and “arRNA” are used herein interchangeably to refer to an engineered RNA capable of recruiting an ADAR to deaminate a target adenosine in an RNA.
  • Group I intron and “Group I catalytic intron” are used interchangeably to refer to a self-splicing ribozyme that can catalyze its own excision from an RNA precursor.
  • Group I introns comprise two fragments, the 5’ catalytic Group I intron fragment and the 3’ catalytic Group I intron fragment, which retain their folding and catalytic function (i.e., self-splicing activity) .
  • the 5’ catalytic Group I intron fragment is flanked at its 5’ end by a 5’ exon, which comprises a 5’ exon sequence that is recognized by the 5’ catalytic Group I intron fragment; and the 3’ catalytic Group I intron fragment is flanked at its 3’ end by a 3’ exon, which comprises a 3’ exon sequence that is recognized by the 3’ catalytic Group I intron fragment.
  • the terms “5’ exon sequence” and “3’ exon sequence” used herein are labeled according to the order of the exons with respect to the Group I intron in its natural environment.
  • nucleobases refer to the nucleobases as such.
  • adenosine, ” “guanosine, ” “cytidine, ” “thymidine, ” “uridine” and “inosine, ” refer to the nucleobases linked to the ribose or deoxyribose sugar moiety.
  • nucleoside refers to the nucleobase linked to the ribose or deoxyribose.
  • nucleotide refers to the respective nucleobase-ribosyl-phosphate or nucleobase-deoxyribosyl-phosphate.
  • adenosine and adenine with the abbreviation, “A” )
  • guanosine and guanine with the abbreviation, “G”
  • cytosine and cytidine with the abbreviation, “C”
  • uracil and uridine with the abbreviation, “U” )
  • thymine and thymidine with the abbreviation, “T”
  • inosine and hypo-xanthine with the abbreviation, “I”
  • nucleobase, nucleoside and nucleotide are used interchangeably, unless the context clearly requires differently.
  • the term “functional protein” refers to a naturally-occurring protein, functional variants thereof, or an engineered derivative thereof that is functional in treating a genetic disease or condition.
  • the disease or condition may be caused in whole or in part by a change, such as a mutation, in the wildtype, naturally-occurring protein corresponding to the functional protein.
  • a region is “at x to y nucleotides upstream of target adenosine” refers to a region that can start at any one of the nucleotides within “x to y nucleotides upstream of target adenosine” .
  • the mismatch region when a mismatch region is 4 nucleotides in length and at 21 nucleotides to 30 nucleotides upstream of the target adenosine relative to the target RNA, the mismatch region can run from any one of: 21nt to 25nt, 22nt to 26nt, 23nt to 27nt, 24nt to 28nt, 25 nt to 29nt, 26nt to 30nt, 27nt to 31nt, 28nt to 32nt, 29nt to 33nt, or 30nt to 34nt upstream of the adenosine relative to the target RNA.
  • a region is “at x to y nucleotides downstream of target adenosine” refers to a region that can start at any one of the nucleotides within “x to y nucleotides downstream of target adenosine” .
  • the mismatch region when a mismatch region is 10 nucleotides in length and at 31 nucleotides to 43 nucleotides downstream of the target adenosine relative to the target RNA, the mismatch region can run from any one of: 31nt to 40nt, 32nt to 41nt, 33nt to 42nt, 34nt to 43nt, 35nt to 44nt, 36nt to 45nt, 37nt to 46nt, 38nt to 47nt, 39nt to 48nt, 40nt to 49nt, 41nt to 50nt, 42nt to 51nt, or 43nt to 52nt downstream of the adenosine relative to the target RNA.
  • compositions that are polynucleotide or polypeptide based, including variants and derivatives. These include, for example, substitutional, insertional, deletion and covalent variants and derivatives.
  • derivative is synonymous with the term “variant” and generally refers to a molecule that has been modified and/or changed in any way relative to a reference molecule or a starting molecule.
  • introducing means delivering one or more polynucleotides, such as dRNAs or one or more constructs including vectors as described herein, one or more transcripts thereof, to a host cell.
  • the invention serves as a basic platform for enabling targeted editing of RNA, for example, pre-messenger RNA, a messenger RNA, a ribosomal RNA, a transfer RNA, a long non-coding RNA and a small RNA (such as miRNA) .
  • the methods of the present application can employ many delivery systems, including but not limited to, viral, liposome, electroporation, microinjection and conjugation, to achieve the introduction of the dRNA or construct as described herein into a host cell.
  • Non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a construct described herein) , naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome.
  • Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes for delivery to the host cell.
  • target RNA refers to an RNA sequence to which a deaminase-recruiting RNA sequence is designed to have perfect complementarity or substantial complementarity, and hybridization between the target sequence and the dRNA forms a double stranded RNA (dsRNA) region containing a target adenosine, which recruits an adenosine deaminase acting on RNA (ADAR) that deaminates the target adenosine.
  • dsRNA double stranded RNA
  • ADAR adenosine deaminase acting on RNA
  • the ADAR is naturally present in a host cell, such as a eukaryotic cell (such as a mammalian cell, e.g., a human cell) .
  • the ADAR is introduced into the host cell.
  • operably linked when referring to a first nucleic acid sequence that is operably linked with a second nucleic acid sequence, means a situation when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter is operably linked to a coding sequence if the promoter effects the transcription of the coding sequence.
  • the coding sequence of a signal peptide is operably linked to the coding sequence of a polypeptide if the signal peptide effects the extracellular secretion of that polypeptide.
  • operably linked nucleic acid sequences are contiguous and, where necessary to join two protein coding regions, the open reading frames are aligned.
  • connect refers to linking of nucleic acid sequences, either directly or indirectly, for example, via an intervening nucleic acid sequence.
  • complementarity refers to the ability of a nucleic acid to form hydrogen bond (s) with another nucleic acid by traditional Watson-Crick base-pairing.
  • a percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (i.e., Watson-Crick base pairing) with a second nucleic acid (e.g., about 5, 6, 7, 8, 9, 10 out of 10, being about 50%, 60%, 70%, 80%, 90%, and 100%complementary respectively) .
  • Perfectly complementary means that all the contiguous residues of a nucleic acid sequence form hydrogen bonds with the same number of contiguous residues in a second nucleic acid sequence.
  • substantially complementary refers to a degree of complementarity that is at least about any one of 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%over a region of about 40, 50, 60, 70, 80, 100, 150, 200, 250 or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
  • stringent conditions for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993) , Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay, ” Elsevier, N, Y.
  • Hybridization or “hybridize” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
  • the hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner.
  • a sequence capable of hybridizing with a given sequence is referred to as the "complement" of the given sequence.
  • a “subject, ” “patient, ” or “individual” includes a mammal, such as a human or other animal, and typically is human.
  • the subject e.g., patient, to whom the therapeutic agents and compositions are administered, is a mammal, typically a primate, such as a human.
  • the primate is a monkey or an ape.
  • the subject can be male or female and can be any suitable age, including infant, juvenile, adolescent, adult, and geriatric subjects.
  • the subject is a non-primate mammal, such as a rodent, a dog, a cat, a farm animal, such as a cow or a horse, etc.
  • treatment refers to clinical intervention designed to have beneficial and desired effects to the natural course of the individual or cell being treated during the course of clinical pathology.
  • desirable effects of treatment include, without limitation, decreasing the rate of disease progression, ameliorating or palliating the disease state, and remission or improved prognosis.
  • an individual is successfully “treated” if one or more symptoms associated with a progressive disease (e.g. Usher’s syndrome) are mitigated or eliminated, including, but are not limited to, reducing the loss of host cells (e.g.
  • reducing loss of rod cells decreasing symptoms resulting from the disease, preventing spread of diseases, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the disease, delaying or halting the progression of the disease (e.g. delaying or halting loss of vision) , and/or prolonging survival of individuals.
  • an effective amount or “therapeutically effective amount” of a substance is at least the minimum concentration required to effect a measurable improvement or prevention of a particular disorder.
  • An effective amount herein may vary according to factors such as the disease state, age, sex, and weight of the patient, and the ability of the substance to elicit a desired response in the individual.
  • An effective amount is also one in which any toxic or detrimental effects of the treatment are outweighed by the therapeutically beneficial effects.
  • an effective amount comprises an amount sufficient to prevent or delay progression of the disease (such as to prevent further loss of cells) or to prevent or delay development of symptoms of the disease (such as to prevent loss of vision) .
  • an effective amount is an amount sufficient to delay progression of disease (such as but not limited to delaying loss of retinal cells) . In some embodiments, an effective amount is an amount sufficient to delay development of disease symptoms (such as but not limited to delaying loss of vision) . In reference to cancer, an effective amount comprises an amount sufficient to cause a tumor to shrink and/or to decrease the growth rate of the tumor (such as to suppress tumor growth) or to prevent or delay other unwanted cell proliferation in cancer. In some embodiments, an effective amount is an amount sufficient to delay development of cancer. In some embodiments, an effective amount is an amount sufficient to prevent or delay recurrence. In some embodiments, an effective amount is an amount sufficient to reduce recurrence rate in the individual.
  • An effective amount can be administered in one or more administrations.
  • the effective amount of the drug or composition may: (i) reduce the number of cancer cells; (ii) reduce tumor size; (iii) inhibit, retard, slow to some extent and preferably stop cancer cell infiltration into peripheral organs; (iv) inhibit (i.e., slow to some extent and preferably stop) tumor metastasis; (v) inhibit tumor growth; (vi) prevent or delay occurrence and/or recurrence of tumor; (vii) reduce recurrence rate of tumor, and/or (viii) relieve to some extent one or more of the symptoms associated with the cancer.
  • An effective amount can be administered in one or more administrations.
  • an effective amount of drug, compound, or pharmaceutical composition is an amount sufficient to accomplish prophylactic or therapeutic treatment either directly or indirectly.
  • an effective amount of a drug, compound, or pharmaceutical composition may or may not be achieved in conjunction with another drug, compound, or pharmaceutical composition.
  • an “effective amount” may be considered in the context of administering one or more therapeutic agents, and a single agent may be considered to be given in an effective amount if, in conjunction with one or more other agents, a desirable result may be or is achieved.
  • wild type is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.
  • a “host cell” as described herein refers to any cell type that can be used as a host cell provided it can be modified as described herein.
  • the host cell may be a host cell with endogenously expressed adenosine deaminase acting on RNA (ADAR) , or may be a host cell into which an adenosine deaminase acting on RNA (ADAR) is introduced by a known method in the art.
  • the host cell may be a prokaryotic cell, a eukaryotic cell or a plant cell.
  • the host cell is derived from a pre-established cell line, such as mammalian cell lines including human cell lines or non-human cell lines.
  • the host cell is derived from an individual, such as a human individual.
  • a “recombinant AAV vector (rAAV vector) ” refers to a polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequence not of AAV origin) that are flanked by at least one, and in embodiments two, AAV inverted terminal repeat sequences (ITRs) .
  • Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus (or that is expressing suitable helper functions) and that is expressing AAV rep and cap gene products (i.e. AAV Rep and Cap proteins) .
  • a rAAV vector When a rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection) , then the rAAV vector may be referred to as a “pro-vector” which can be “rescued” by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions.
  • a rAAV vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated in a viral particle, particularly an AAV particle.
  • a rAAV vector can be packaged into an AAV virus capsid to generate a “recombinant adeno-associated viral particle (rAAV particle) ” .
  • An “AAV inverted terminal repeat (ITR) ” sequence is an approximately 145-nucleotide sequence that is present at both termini of the native single-stranded AAV genome.
  • the outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, leading to heterogeneity between different AAV genomes and between the two ends of a single AAV genome.
  • the outermost 125 nucleotides also contains several shorter regions of self-complementarity (designated A, A', B, B', C, C' and D regions) , allowing intrastrand base-pairing to occur within this portion of the ITR.
  • sequence tags or amino acids such as one or more lysines
  • Sequence tags can be used for peptide detection, purification or localization.
  • Lysines can be used to increase peptide solubility or to allow for biotinylation.
  • amino acid residues located at the carboxy and amino terminal regions of the amino acid sequence of a peptide or protein may optionally be deleted providing for truncated sequences.
  • Certain amino acids e.g., C-terminal residues or N-terminal residues
  • amino acids alternatively may be deleted depending on the use of the sequence, as for example, expression of the sequence as part of a larger sequence that is soluble, or linked to a solid support.
  • nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
  • expression refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene product. ” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
  • a “carrier” includes pharmaceutically acceptable carriers, excipients, or stabilizers that are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed.
  • the physiologically acceptable carrier is an aqueous pH buffered solution.
  • physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEEN TM , polyethylene glycol (PEG) , and PLURONICS TM .
  • buffers such as phosphate, citrate, and other organic acids
  • antioxidants including ascorbic acid
  • proteins
  • package insert is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, combination therapy, contraindications and/or warnings concerning the use of such therapeutic products.
  • An “article of manufacture” is any manufacture (e.g., a package or container) or kit comprising at least one reagent, e.g., a medicament for treatment of a disease or condition.
  • the manufacture or kit is promoted, distributed, or sold as a unit for performing the methods described herein.
  • reference to “not” a value or parameter generally means and describes "other than” a value or parameter.
  • the method is not used to treat disease of type X means the method is used to treat disease of types other than X.
  • any phrase such as “Aand/or B” is intended to include both A and B; A or B; A (alone) ; and B (alone) .
  • the term “and/or” as used herein a phrase such as “A, B, and/or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone) ; B (alone) ; and C (alone) .
  • RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises one or more mismatch regions relative to the target RNA, and wherein the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not hybridize with the target RNA and does not substantially form a secondary structure.
  • dRNA deaminase-recruiting RNA
  • the dRNA may be any one of the dRNAs described in section III ( “dRNAs, constructs and libraries” ) below.
  • the dRNA is linear.
  • the dRNA is circular.
  • the dRNA is a linear RNA capable of forming a circular RNA.
  • the method uses a construct comprising a nucleic acid sequence encoding the dRNA.
  • the construct may be any one of the constructs described in section III below.
  • a method for editing a target adenosine in a target RNA comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 5 nucleotides to 85 nucleotides upstream of the target adenosine; and/or (b) a second mismatch region relative to the target RNA sequence at
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at: 5 nucleotides to 25 nucleotides upstream of the target adenosine, or 5 nucleotides to 15 nucleotides upstream of the target adenosine, or 20 nucleotides to 40 nucleotides upstream of the target adenosine.
  • the RNA duplex comprises the second mismatch region relative to the target RNA sequence at: 20 nucleotides to 65 nucleotides downstream of the target adenosine, or 20 nucleotides to 45 nucleotides downstream of the target adenosine, or 25 nucleotides to 45 nucleotides downstream of the target adenosine.
  • the first mismatch region is 1-50 nucleotides in length; and/or the second mismatch region is 1-50 nucleotides in length.
  • the linker nucleic acid sequence is about 5 nucleotides (nt) to about 500 nt in length.
  • the editing rate of the non-target adenosine is reduced by at least about 20%, 30%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a method using a dRNA comprising a targeting RNA sequence that is complementary to the target RNA.
  • the editing efficiency of the target adenosine is increased by at least about any of 50%, 60%, 70%, 80%, 90%, 95%, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold or more compared to a method using a dRNA that does not comprise the linker nucleic acid sequence.
  • a method for editing a target adenosine in a target RNA comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine; and/or (b) a second mismatch region relative to the target RNA sequence at
  • the first mismatch region is 1-50 nucleotides in length; and/or the second mismatch region is 1-50 nucleotides in length.
  • the linker nucleic acid sequence is about 5 nucleotides (nt) to about 500 nt in length.
  • the editing rate of the non-target adenosine is reduced by at least about 20%, 30%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a method using a dRNA comprising a targeting RNA sequence that is complementary to the target RNA.
  • the editing efficiency of the target adenosine is increased by at least about any of 50%, 60%, 70%, 80%, 90%, 95%, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold or more compared to a method using a dRNA that does not comprise the linker nucleic acid sequence.
  • a method for reducing editing of a non-target adenosine (also referred herein as “bystander editing” ) in a target RNA (such as a target RNA encoding a mutant Usher 2A protein) in a host cell, comprising: introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine
  • the first mismatch region is 1-50 nucleotides in length; and/or the second mismatch region is 1-50 nucleotides in length.
  • the linker nucleic acid sequence is about 5 nt to about 500 nt in length.
  • the editing rate of the non-target adenosine is reduced by at least about 20%, 30%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a method using a dRNA comprising a targeting RNA sequence that is complementary to the target RNA.
  • a method for increasing editing efficiency of a target adenosine in a target RNA comprising: introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine; and/or (b) a second mismatch region relative to the target
  • the RNA duplex comprises a mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine. In some embodiments, the RNA duplex comprises a mismatch region relative to the target RNA sequence at 26 nucleotides upstream of the target adenosine. In some embodiments, the RNA duplex comprises a mismatch region relative to the target RNA sequence at 30 nucleotides upstream of the target adenosine. In some embodiments, the RNA duplex comprises a mismatch region relative to the target RNA sequence at 34 nucleotides upstream of the target adenosine.
  • the RNA duplex comprises a mismatch region relative to the target RNA sequence at 25 nucleotides to 45 nucleotides downstream of the target adenosine. In some embodiments, the RNA duplex comprises a mismatch region relative to the target RNA sequence at 31 nucleotides downstream of the target adenosine. In some embodiments, the RNA duplex comprises a mismatch region relative to the target RNA sequence at 35 nucleotides downstream of the target adenosine. In some embodiments, the RNA duplex comprises a mismatch region relative to the target RNA sequence at 39 nucleotides downstream of the target adenosine.
  • the RNA duplex comprises a mismatch region relative to the target RNA sequence at 40 nucleotides downstream of the target adenosine. In some embodiments, the RNA duplex comprises a mismatch region relative to the target RNA sequence at 41 nucleotides downstream of the target adenosine. In some embodiments, the first mismatch region is 1-50 nucleotides in length; and/or the second mismatch region is 1-50 nucleotides in length.
  • the editing efficiency of the target adenosine is increased by at least about any of 50%, 60%, 70%, 80%, 90%, 95%, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold or more compared to a method using a dRNA that does not comprise the linker nucleic acid sequence.
  • the first mismatch region comprises: (a) one or more non-complementary nucleotides (mismatch) in the targeting RNA; and/or (b) deletion of one or more nucleotides from the targeting RNA; and/or (c) insertion of one or more nucleotides into the target RNA.
  • the second mismatch region comprises: (a) one or more non-complementary nucleotides (mismatch) in the targeting RNA; and/or (b) deletion of one or more nucleotides from the targeting RNA; and/or (c) insertion of one or more nucleotides into the target RNA.
  • the first mismatch region comprises: (a) at least one group of consecutive non-complementary nucleotides (mismatch) in the targeting RNA; and/or (b) deletion of at least one group of consecutive nucleotides from the targeting RNA; and/or (c) insertion of at least one group of consecutive nucleotides from the targeting RNA.
  • the second mismatch region comprises: (a) at least one group of consecutive non-complementary nucleotides (mismatch) in the targeting RNA; and/or (b) deletion of at least one group of consecutive nucleotides from the targeting RNA; and/or (c) insertion of at least one group of consecutive nucleotides from the targeting RNA.
  • a non-complementary nucleotide in the targeting RNA results in a bubble in the RNA duplex.
  • a nucleotide deletion in the targeting RNA results in a bulge in the RNA duplex.
  • a nucleotide insertion in the targeting RNA results in a bulge in the RNA duplex.
  • a group of consecutive non-complementary nucleotides in the targeting RNA results in a bubble in the RNA duplex.
  • deletion of a group of consecutive nucleotides in the targeting RNA results in a bulge in the RNA duplex.
  • insertion of a group of consecutive nucleotides in the targeting RNA results in a bulge in the RNA duplex.
  • the first mismatch region is 1-50 nucleotides in length. In some embodiments, the second mismatch region is 1-50 nucleotides in length. In some embodiments, the first mismatch region is any one of about: 1-10, 10-20, 20-30, 30-40, or 40-50 nucleotides in length. In some embodiments, the first mismatch region is any one of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in length. In some embodiments, the second mismatch region is any one of about: 1-10, 10-20, 20-30, 30-40, or 40-50 nucleotides in length. In some embodiments, the second mismatch region is any one of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in length.
  • the first mismatch region is 1-10 nucleotides in length; and/or the second mismatch region is 1-10 nucleotides in length.
  • the first mismatch region comprises 1-10 consecutive non-complementary nucleotides in the targeting RNA.
  • the first mismatch region comprises a deletion of 1-10 consecutive nucleotides from the targeting RNA.
  • the second mismatch region comprises 1-10 consecutive non-complementary nucleotides in the targeting RNA.
  • the second mismatch region comprises a deletion of 1-10 consecutive nucleotides from the targeting RNA.
  • the first mismatch region is 4 nucleotides in length; and/or the second mismatch region is 4 nucleotides in length.
  • the first mismatch region comprises 4 consecutive non-complementary nucleotides in the targeting RNA.
  • the first mismatch region comprises a deletion of 4 consecutive nucleotides from the targeting RNA.
  • the second mismatch region comprises 4 consecutive non-complementary nucleotides in the targeting RNA.
  • the second mismatch region comprises a deletion of 4 consecutive nucleotides from the targeting RNA.
  • the first mismatch region is any one of: 20 to 23, 21 to 24, 22 to 25, 23 to 26, 24 to 27, 25 to 28, 26 to 29, 27 to 30, 28 to 31, 29 to 32, 30 to 33, 31 to 34, 32 to 35, 33 to 36, 34 to 37, 35 to 38, 36 to 39, or 37 to 40 nucleotides upstream of the target adenosine, relative to the target RNA.
  • the second mismatch region is any one of: 25 to 28, 26 to 29, 27 to 30, 28 to 31, 29 to 32, 30 to 33, 31 to 34, 32 to 35, 33 to 36, 34 to 37, 35 to 38, 36 to 39, 37 to 40, 38 to 41, 39 to 42, 40 to 43, 41 to 44, or 42 to 45 nucleotides downstream of the target adenosine, relative to the target RNA.
  • the dRNA is circular. In some embodiments, the dRNA is linear. In some embodiments, the dRNA is capable of being circularized (e.g. forming a circular RNA) .
  • the target RNA encodes a mutant Usher 2A protein.
  • the mutant Usher 2A protein comprises a missense mutation, a nonsense mutation and/or a frameshift mutation.
  • the mutant Usher 2A protein is a truncated Usher 2A protein.
  • the target RNA encodes a mutant Usher 2A protein comprising Trp3955Ter mutation.
  • the target RNA encoding mutant Usher 2A comprises a G to A mutation with reference to a target RNA that encodes wild-type Usher 2A.
  • the target RNA encoding mutant Usher 2A comprises a 11864G>A mutation with reference to a target RNA that encodes wild-type Usher 2A.
  • the target RNA is endogenously expressed.
  • a method for editing a target RNA encoding a mutant Usher 2A in a host cell comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine; and/or (b) a second mismatch region relative to the target RNA sequence at 25 nucleotides to 45 nucleotides downstream of the target aden
  • the target RNA encodes a mutant Usher 2A protein comprising Trp3955Ter mutation.
  • the target RNA encoding mutant Usher 2A comprises a G to A mutation with reference to a target RNA that encodes wild-type Usher 2A.
  • the target RNA encoding mutant Usher 2A comprises a 11864G>A mutation with reference to a target RNA that encodes wild-type Usher 2A.
  • the target adenosine is at position 101 with reference to SEQ ID NO: 3.
  • the RNA duplex further comprises a third mismatch region relative to the target RNA.
  • the third mismatch region is located between the first mismatch region and the second mismatch region relative to the target RNA.
  • the third mismatch region comprises one or two non-complementary nucleotides in the targeting RNA and/or deletion of one or both nucleotides from the targeting RNA sequence.
  • the third mismatch region relative to the target RNA sequence is at 7 and/or 8 nucleotides downstream of the target adenosine.
  • the target RNA comprises adenosine at the 7th and/or the 8th nucleotide downstream of the target adenosine.
  • the target RNA comprises the sequence of “AA” at 7 and 8 nucleotides downstream of the target adenosine, wherein the targeting RNA sequence comprises any one of: A, AA, U, C, CC, G, GG, or an absence of nucleotides ( “X” ) opposite to the target RNA at 7 and 8 nucleotides downstream of the target adenosine.
  • the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence within at 27 nucleotides to 30 nucleotides (such as 27 nucleotides) upstream of the target adenosine; and (b) a second mismatch region relative to the target RNA sequence at 31 nucleotides to 43 nucleotides downstream of the target adenosine.
  • the second mismatch region relative to the target RNA sequence is at 32 nucleotides to 35 nucleotides (such as 32 nucleotides) downstream of the target adenosine. In some embodiments, the second mismatch region relative to the target RNA sequence is at 36 nucleotides to 39 nucleotides (such as 36 nucleotides) downstream of the target adenosine. In some embodiments, the second mismatch region relative to the target RNA sequence is at 40 nucleotides to 43 nucleotides (such as 40 nucleotides) downstream of the target adenosine. In some embodiments, the first mismatch region is 4 nucleotides in length.
  • the first mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA.
  • the second mismatch region is 4 nucleotides in length. In some embodiments, the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA.
  • the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 21 nucleotides to 30 nucleotides upstream of the target adenosine; and (b) a second mismatch region relative to the target RNA sequence at 36 nucleotides to 43 nucleotides downstream of the target adenosine.
  • the second mismatch region relative to the target RNA sequence is at 36 nucleotides to 39 nucleotides downstream of the target adenosine.
  • the second mismatch region relative to the target RNA sequence is at 40 nucleotides to 43 nucleotides downstream of the target adenosine.
  • the first mismatch region is 10 nucleotides in length.
  • the first mismatch region comprises a deletion of ten consecutive nucleotides from the targeting RNA.
  • the second mismatch region is 4 nucleotides in length.
  • the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA.
  • the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 26 nucleotides to 35 nucleotides upstream of the target adenosine; and (b) a second mismatch region relative to the target RNA sequence at 35 nucleotides to 44 nucleotides downstream of the target adenosine.
  • the first mismatch region is 1 nucleotide in length and the second mismatch region is 1 nucleotide in length.
  • the first mismatch region is 2 nucleotides in length and the second mismatch region is 2 nucleotides in length. In some embodiments, the first mismatch region is 3 nucleotides in length and the second mismatch region is 3 nucleotides in length. In some embodiments, the first mismatch region is 4 nucleotides in length and the second mismatch region is 4 nucleotides in length. In some embodiments, the first mismatch region is 7 nucleotides in length and the second mismatch region is 7 nucleotides in length. In some embodiments, the first mismatch region is 10 nucleotides in length and the second mismatch region is 10 nucleotides in length.
  • the first mismatch region comprises an insertion of one nucleotide to the targeting RNA and the second mismatch region comprises an insertion of one nucleotide to the targeting RNA. In some embodiments, the first mismatch region comprises an insertion of two consecutive nucleotides to the targeting RNA and the second mismatch region comprises an insertion of two consecutive nucleotides to the targeting RNA. In some embodiments, the first mismatch region comprises an insertion of three consecutive nucleotides to the targeting RNA and the second mismatch region comprises an insertion of three consecutive nucleotides to the targeting RNA.
  • the first mismatch region comprises an insertion of four consecutive nucleotides to the targeting RNA and the second mismatch region comprises an insertion of four consecutive nucleotides to the targeting RNA. In some embodiments, the first mismatch region comprises an insertion of seven consecutive nucleotides to the targeting RNA and the second mismatch region comprises an insertion of seven consecutive nucleotides to the targeting RNA. In some embodiments, the first mismatch region comprises an insertion of ten consecutive nucleotides to the targeting RNA and the second mismatch region comprises an insertion of ten consecutive nucleotides to the targeting RNA.
  • the RNA duplex comprises: a mismatch region relative to the target RNA sequence at 26 nucleotides to 37 nucleotides upstream of the target adenosine.
  • the mismatch region relative to the target RNA sequence is at 26 nucleotides to 29 nucleotides downstream of the target adenosine.
  • the mismatch region relative to the target RNA sequence is at 30 nucleotides to 33 nucleotides downstream of the target adenosine.
  • the mismatch region relative to the target RNA sequence is at 34 nucleotides to 37 nucleotides downstream of the target adenosine. In some embodiments, the mismatch region is 4 nucleotides in length. In some embodiments, the mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA.
  • the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 26 nucleotides to 37 nucleotides upstream of the target adenosine; and (b) a second mismatch region relative to the target RNA sequence at 31 nucleotides to 39 nucleotides downstream of the target adenosine.
  • the first mismatch region relative to the target RNA sequence is at 26 nucleotides to 29 nucleotides downstream of the target adenosine.
  • the first mismatch region relative to the target RNA sequence is at 30 nucleotides to 33 nucleotides downstream of the target adenosine. In some embodiments, the first mismatch region relative to the target RNA sequence is at 34 nucleotides to 37 nucleotides downstream of the target adenosine. In some embodiments, the second mismatch region relative to the target RNA sequence is at 31 nucleotides to 34 nucleotides downstream of the target adenosine. In some embodiments, the second mismatch region relative to the target RNA sequence is at 35 nucleotides to 38 nucleotides downstream of the target adenosine.
  • the second mismatch region relative to the target RNA sequence is at 39 nucleotides to 42 nucleotides downstream of the target adenosine.
  • the first mismatch region is 4 nucleotides in length.
  • the first mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA.
  • the second mismatch region is 4 nucleotides in length.
  • the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA.
  • the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 26 nucleotides to 29 nucleotides upstream of the target adenosine; and (b) a second mismatch region relative to the target RNA sequence at 35 nucleotides to 38 nucleotides downstream of the target adenosine.
  • the first mismatch region is 4 nucleotides in length.
  • the first mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA.
  • the second mismatch region is 4 nucleotides in length. In some embodiments, the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA. In some embodiments, the RNA duplex further comprises a third mismatch region relative to the target RNA sequence at 5 nucleotides upstream of the target adenosine and a fourth mismatch region relative to the target RNA sequence at 3 nucleotides downstream of the target adenosine. In some embodiments, the third mismatch region comprises a deletion of one uracil from the targeting RNA. In some embodiments, the fourth mismatch region comprises a deletion of one uracil from the targeting RNA.
  • the RNA duplex further comprises a third mismatch region relative to the target RNA sequence at 5 nucleotides upstream of the target adenosine and a fourth mismatch region relative to the target RNA sequence at 13 nucleotides downstream of the target adenosine.
  • the third mismatch region comprises a deletion of one uracil from the targeting RNA.
  • the fourth mismatch region comprises a deletion of one uracil from the targeting RNA.
  • the RNA duplex further comprises a third mismatch region relative to the target RNA sequence at 3 nucleotides downstream of the target adenosine and a fourth mismatch region relative to the target RNA sequence at 13 nucleotides downstream of the target adenosine.
  • the third mismatch region comprises a deletion of one uracil from the targeting RNA.
  • the fourth mismatch region comprises a deletion of one uracil from the targeting RNA.
  • the RNA duplex further comprises a third mismatch region relative to the target RNA sequence at 5 nucleotides upstream of the target adenosine, a fourth mismatch region relative to the target RNA sequence at 3 nucleotides downstream of the target adenosine, and a fifth mismatch region relative to the target RNA sequence at 13 nucleotides downstream of the target adenosine.
  • the third mismatch region comprises a deletion of one uracil from the targeting RNA.
  • the fourth mismatch region comprises a deletion of one uracil from the targeting RNA.
  • the fifth mismatch region comprises a deletion of one uracil from the targeting RNA.
  • the linker nucleic acid sequence is about 5 nucleotides (nt) to about 500 nt in length. In some embodiments, the linker nucleic acid sequence is any one of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nt in lengths, or any lengths therebetween. In some embodiments, the linker nucleic acid sequence is less than or equal to 70nt in length.
  • the length of the linker nucleic acid sequence is any integer between 10nt-50nt, 10nt-40nt, 10nt-30nt, 10nt-20nt, 20nt-50nt, 20nt-40nt, 20nt-30nt, 30nt-50nt, 30nt-40nt or 40nt-50nt.
  • the linker nucleic acid sequence is about 20 nt to about 60 nt in length. In some embodiments, the linker nucleic acid sequence is about 30nt in length. In some embodiments, the linker nucleic acid sequence is about 50nt in length.
  • At least about any one of: 50%, 60%, 70%, 80%, 85%, 90%, or 95%of the linker nucleic acid sequence comprises adenosine or cytidine. In some embodiments, about any one of 50%to 60%, 60%to 70%, 70%to 80%, 80%to 85%, 85%to 90%, 90%to 95%or 95%to 99%the linker nucleic acid sequence comprises adenosine or cytidine. In some embodiments, all nucleic acid sequence in the linker comprises adenosine or cytidine. In some embodiments, at least about 50%of the linker nucleic acid comprises adenosine.
  • At least about any one of: 50%, 60%, 70%, 80%, 85%, or 90%of the linker nucleic acid sequence comprises adenosine. In some embodiments, about any one of 30%to 40%, 40%to 50%, 50%to 60%, 60%to 70%, 70%to 80%, 80%to 85%, 85%to 90%, or 90%to 95%the linker nucleic acid sequence comprises adenosine.
  • the method has increased level of editing of the target adenosine as compared to a corresponding method wherein the RNA duplex does not comprise the one or more mismatch regions and/or wherein the dRNA does not comprise the linker nucleic acid sequence.
  • the method shows a level of editing of the target adenosine that is increased by at least about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, or 100-fold or more as compared to a corresponding method wherein the RNA duplex does not comprise the one or more mismatch regions and/or wherein the dRNA does not comprise the linker nucleic acid sequence.
  • the method has reduced level of (bystander) editing of one or more non-target adenosines as compared to a corresponding method wherein the RNA duplex does not comprise the one or more mismatch regions and/or wherein the dRNA does not comprise the linker nucleic acid sequence.
  • the method shows a level of editing of one or more non-target adenosines that is decreased by at least about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, or 100-fold or more as compared to a corresponding method wherein the RNA duplex does not comprise the one or more mismatch regions and/or wherein the dRNA does not comprise the linker nucleic acid sequence.
  • the non-target adenosine is within one or more of the mismatch regions. In some embodiments, the non-target adenosine is outside of the mismatch regions.
  • the dRNA comprises a linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence. In some embodiments, the dRNA comprises a linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence and a second linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence.
  • the first linker nucleic acid sequence is identical to the second linker nucleic acid sequence. In some embodiments, the first linker nucleic acid sequence is different from the second linker nucleic acid sequence. In some embodiments, the dRNA further comprises a 3’ exon sequence recognizable by a 3’ catalytic Group I intron fragment flanking the 5’ end of the targeting RNA sequence, and a 5’ exon sequence recognizable by a 5’ catalytic Group I intron fragment flanking the 3’ end of the targeting RNA sequence. In some embodiments, the dRNA further comprises a 3’ ligation sequence and a 5’ ligation sequence. In some embodiments, the duplex RNA comprises a bulge at each non-target adenosine in the target RNA (such as a target RNA encoding a mutant Usher 2A protein) .
  • the targeting RNA sequence is more than 50 nt long. In some embodiments, the targeting RNA sequence in the dRNA is about 100 nt to about 200 nt long. In some embodiments, the targeting RNA sequence in the dRNA is about 150 to about 220 nt long. In some embodiments, the targeting RNA sequence in the dRNA is about 70 nt (e.g., 71 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 120 nt (e.g., 121 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 150 nt (e.g., 151 nt) long.
  • the targeting RNA sequence in the dRNA is about 170 nt (e.g., 171 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 200 nt (e.g., 201 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 220 nt (e.g., 221 nt) long.
  • a method for editing a target RNA encoding a mutant Usher 2A in a host cell comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region comprising a deletion of four consecutive nucleotides from the targeting RNA relative to the target RNA sequence at 27 nucleotides to 30 nucleotides upstream of the target adenosine; and (b) a second mismatch region comprising a deletion of four consecutive nucleotides
  • the dRNA comprises a first linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence and a second linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence.
  • the linker nucleic acid sequence is about 30nt to about 50nt in length.
  • the dRNA is circular or capable of being circularized.
  • the target RNA encodes a mutant Usher 2A protein comprising Trp3955Ter mutation.
  • a method for editing a target RNA encoding a mutant Usher 2A in a host cell comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region comprising a deletion of ten consecutive nucleotides from the targeting RNA relative to the target RNA sequence at 21 nucleotides to 30 nucleotides upstream of the target adenosine; and (b) a second mismatch region comprising a deletion of four consecutive nucleotides
  • the dRNA comprises a first linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence and a second linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence.
  • the linker nucleic acid sequence is about 30nt to about 50nt in length.
  • the dRNA is circular or capable of being circularized.
  • the target RNA encodes a mutant Usher 2A protein comprising Trp3955Ter mutation.
  • a method for editing a target RNA encoding a mutant Usher 2A in a host cell comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region comprising a deletion of four consecutive nucleotides from the targeting RNA relative to the target RNA sequence at 26 nucleotides to 29 nucleotides upstream of the target adenosine, or at 30 nucleotides to 33 nucleotides upstream of the target adeno
  • dRNA de
  • the dRNA comprises a first linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence and a second linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence.
  • the linker nucleic acid sequence is about 20 nt to about 50 nt in length.
  • the dRNA is circular or capable of being circularized.
  • the target RNA encodes a mutant Usher 2A protein comprising Trp3955Ter mutation.
  • a method for editing a target RNA encoding a mutant Usher 2A in a host cell comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises a mismatch region comprising a deletion of four consecutive nucleotides from the targeting RNA relative to the target RNA sequence at 26 nucleotides to 29 nucleotides upstream of the target adenosine, or at 30 nucleotides to 33 nucleotides upstream of the target adenosine, at 34
  • dRNA de
  • a method for editing a target RNA encoding a mutant Usher 2A in a host cell comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises a mismatch region comprising a deletion of four consecutive nucleotides from the targeting RNA relative to the target RNA sequence at 31 nucleotides to 34 nucleotides downstream of the target adenosine, or at 35 nucleotides to 38 nucleotides downstream of the target adenosine, or at 39 nu
  • a method for editing a target RNA encoding a mutant Usher 2A in a host cell comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA.
  • dRNA deaminase-recruiting RNA
  • ADAR adenosine deaminase acting on RNA
  • the dRNA comprises a linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence. In some embodiments, the dRNA comprises a linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence. In some embodiments, the linker nucleic acid sequence is about 10 nt to about 50 nt in length. In some embodiments, the dRNA is circular or capable of being circularized. In some embodiments, the target RNA encodes a mutant Usher 2A protein comprising Trp3955Ter mutation.
  • a method for editing a target RNA encoding a mutant Usher 2A in a host cell comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region comprising a deletion of four consecutive nucleotides from the targeting RNA relative to the target RNA sequence at 26 nucleotides to 29 nucleotides upstream of the target adenosine, (b) a second mismatch region comprising a deletion of four consecutive nucleotides from the
  • the dRNA comprises a first linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence and a second linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence.
  • the linker nucleic acid sequence is about 20 nt to about 50 nt in length.
  • the dRNA is circular or capable of being circularized.
  • the target RNA encodes a mutant Usher 2A protein comprising Trp3955Ter mutation.
  • the targeting RNA sequence comprises a cytidine, adenosine or uridine directly opposite the target adenosine residue in the target RNA (such as a target RNA encoding a mutant Usher 2A protein) .
  • the targeting RNA sequence comprises a cytidine mismatch directly opposite the target adenosine residue in the target RNA.
  • the cytidine mismatch is located at least 5 nucleotides, e.g., at least 10, 15, 20, 25, 30, or more nucleotides, away from the 5’ end of the targeting RNA sequence.
  • the cytidine mismatch is located at least 20 nucleotides, e.g., at least 25, 30, 35, or more nucleotides, away from the 3’ end of the complementary RNA sequence.
  • the 5’ nearest neighbor of the target adenosine residue is a nucleotide selected from U, C, A and G with the preference U>C ⁇ A>G and the 3’ nearest neighbor of the target adenosine residue is a nucleotide selected from G, C, A and U with the preference G>C>A ⁇ U.
  • the 5’ nearest neighbor of the target adenosine residue is U.
  • the 5’ nearest neighbor of the target adenosine residue is C or A.
  • the 3’ nearest neighbor of the target adenosine residue is G.
  • the 3’ nearest neighbor of the target adenosine residue is C.
  • the target adenosine residue is in a three-base motif selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA and GAU in the target RNA (such as a target RNA encoding a mutant Usher 2A protein) .
  • the three-base motif is UAG
  • the dRNA comprises an A directly opposite the U in the three-base motif, a C directly opposite the target A, and a C, G or U directly opposite the G in the three-base motif.
  • the three-base motif is UAG in the target RNA, and the dRNA comprises ACC, ACG or ACU that is opposite the UAG of the target RNA. In certain embodiments, the three-base motif is UAG in the target RNA, and the dRNA comprises ACC that is opposite the UAG of the target RNA.
  • the present application provides a method for editing a plurality of target RNAs (e.g., at least about 2, 3, 4, 5, 10, 20, 50, 100, 1000 or more) in host cells by introducing a plurality of the dRNAs, or one or more constructs encoding the dRNAs, into the host cells.
  • a plurality of target RNAs e.g., at least about 2, 3, 4, 5, 10, 20, 50, 100, 1000 or more
  • the host cell is a prokaryotic cell. In some embodiments, the host cell is a eukaryotic cell. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a human cell. In some embodiments, the host cell is a murine cell.
  • the host cell is a cell line, such as HEK293T, HT29, A549, HepG2, RD, SF268, SW13 and HeLa cell.
  • the host cell is a primary cell, such as fibroblast, epithelial, or immune cell.
  • the host cell is a T cell.
  • the host cell is a post-mitosis cell.
  • the host cell is a cell of the central nervous system (CNS) , such as a brain cell, e.g., a cerebellum cell.
  • the cell is a nerve cell.
  • the nerve cell is a sensory nerve cell.
  • the sensory nerve cell is selected from: an optic nerve cells and an auditory nerve cell.
  • the optic nerve cells are cone cells and/or rod cells.
  • the host cell is a cell in or adjacent to the vitreous space. In some embodiments, the host cell is a cell in or adjacent the subretinal space. In some embodiments, the host cell is in the retinal epithelium. In some embodiments, the host cell is a retinal cell.
  • the ADAR is endogenous to the host cell.
  • the adenosine deaminase acting on RNA (ADAR) is naturally or endogenously present in the host cell, for example, naturally or endogenously present in the eukaryotic cell.
  • the ADAR is endogenously expressed by the host cell.
  • the ADAR is an endogenously encoded ADAR of the host cell, wherein introduction of the ADAR comprises over-expressing the ADAR in the host cell.
  • the ADAR is exogenously introduced into the host cell.
  • the ADAR is exogenous to the host cell.
  • the construct comprising a nucleic acid encoding the ADAR is a vector, such as a plasmid, or a viral vector (e.g., an AAV such as a scAAV) .
  • the ADAR is ADAR1 and/or ADAR2.
  • the ADAR is one or more ADARs selected from the group consisting of hADAR1, hADAR2, mouse ADAR1 and ADAR2.
  • the ADAR is ADAR1, such as p110 isoform of ADAR1 ( “ADAR1 p110 ” ) and/or p150 isoform of ADAR1 ( “ADAR1 p150 ” ) .
  • the ADAR is ADAR2.
  • the ADAR is an ADAR2 expressed by the host cell, e.g., ADAR2 expressed by cerebellum cells.
  • the ADAR is an ADAR exogenous to the host cell. In some embodiments, the ADAR is a hyperactive mutant of a naturally occurring ADAR. In some embodiments, the ADAR is ADAR1 comprising an E1008Q mutation. In some embodiments, the ADAR is not a fusion protein comprising a binding domain. In some embodiments, the ADAR does not comprise an engineered double-strand nucleic acid-binding domain. In some embodiments, the ADAR does not comprise a MCP domain that binds to MS2 hairpin that is fused to the complementary RNA sequence in the dRNA.
  • the host cell has high expression level of ADAR1 (such as ADAR1 p110 and/or ADAR1 p150 ) , e.g., at least about any one of 10%, 20%, 50%, 100%, 2-fold, 3-fold, 5-fold, or more relative to the protein expression level of ⁇ -tubulin.
  • the host cell has high expression level of ADAR2, e.g., at least about any one of 10%, 20%, 50%, 100%, 2-fold, 3-fold, 5-fold, or more relative to the protein expression level of ⁇ -tubulin.
  • the host cell has low expression level of ADAR3, e.g., no more than about any one of 5-fold, 3-fold, 2-fold, 100%, 50%, 20%or less relative to the protein expression level of ⁇ -tubulin.
  • the method does not induce immune response, such as innate immune response. In some embodiments, the method does not induce interferon and/or interleukin expression in the host cell. In some embodiments, the method does not induce IFN- ⁇ and/or IL-6 expression in the host cell.
  • nucleic acids including dRNAs, constructs thereof, and nucleic acids encoding ADAR may be delivered using any known methods in the art, including viral delivery or non-viral delivery.
  • Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid: nucleic acid conjugates, electroporation, nanoparticles, exosomes, microvesicles, or gene-gun, naked DNA and artificial virions.
  • RNA or DNA viral based systems for the delivery of nucleic acids has high efficiency in targeting a virus to specific cells and trafficking the viral payload to the cellular nuclei.
  • the method comprises introducing a viral vector (such as an AAV, e.g., scAAV, or a lentiviral vector) encoding the dRNA into the host cell.
  • a viral vector such as an AAV, e.g., scAAV, or a lentiviral vector
  • the construct described herein may be any one of the viral vectors described in section III “dRNAs, constructs and libraries” below.
  • the method comprises introducing a plasmid encoding the dRNA into the host cell.
  • the method comprises electroporation of the dRNA (e.g., synthetic dRNA) into the host cell.
  • the method comprises transfection of the dRNA into the host cell.
  • the efficiency of editing of the target RNA is at least about 10%, such as at least about any one of 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or higher. In some embodiments, the efficiency of editing of the target RNA is at least about 40%. In some embodiments, the efficiency of editing is determined by Sanger sequencing. In some embodiments, the efficiency of editing is determined by next-generation sequencing. In some embodiments, the efficiency of editing is determined by assessing expression of a reporter gene, such as a fluorescence reporter, e.g., EGFP.
  • a reporter gene such as a fluorescence reporter, e.g., EGFP.
  • the method has low off-target editing rate. In some embodiments, the method has lower than about 1% (e.g., no more than about any one of 0.5%, 0.1%, 0.05%, 0.01%, 0.001%or lower) editing efficiency on non-target As in the target RNA (such as a target RNA encoding a mutant Usher 2A protein) . In some embodiments, the method does not edit non-target As in the target RNA. In some embodiments, the method has lower than about 0.1% (e.g., no more than about any one of 0.05%, 0.01%, 0.005%, 0.001%, 0.0001%or lower) editing efficiency on As in non-target RNA.
  • the method has lower than about 0.1% (e.g., no more than about any one of 0.05%, 0.01%, 0.005%, 0.001%, 0.0001%or lower) editing efficiency on As in non-target RNA.
  • modification of the target RNA and/or the protein encoded by the target RNA can be determined using different methods depending on the positions of the targeted adenosines in the target RNA. For example, in order to determine whether “A” has been edited to “I” in the target RNA, RNA sequencing methods known in the art can be used to detect the modification of the RNA sequence.
  • the RNA editing may cause changes to the amino acid sequence encoded by the mRNA. For example, point mutations may be introduced to the mRNA of an innate or acquired point mutation in the mRNA may be reversed to yield wild-type gene product (s) because of the conversion of “A” to “I” .
  • Amino acid sequencing by methods known in the art can be used to find any changes of amino acid residues in the encoded protein.
  • Modifications of a stop codon may be determined by assessing the presence of a functional, elongated, truncated, full-length and/or wild-type protein. For example, when the target adenosine is located in a UGA, UAG, or UAA stop codon, modification of the target adenosine residue (UGA or UAG) or As (UAA) may create a read-through mutation and/or an elongated protein, or a truncated protein encoded by the target RNA may be reversed to create a functional, full-length and/or wild-type protein.
  • Editing of a target RNA may also generate an aberrant splice site, and/or alternative splice site in the target RNA, thus leading to an elongated, truncated, or misfolded protein, or an aberrant splicing or alternative splicing site encoded in the target RNA may be reversed to create a functional, correctly-folding, full-length and/or wild-type protein.
  • the present application contemplates editing of both innate and acquired genetic changes, for example, missense mutation, early stop codon, aberrant splicing or alternative splicing site encoded by a target RNA. Using known methods to assess the function of the protein encoded by the target RNA can find out whether the RNA editing achieves the desired effects.
  • identification of the deamination into inosine may provide assessment on whether a functional protein is present, or whether a disease or drug resistance-associated RNA caused by the presence of a mutated adenosine is reversed or partly reversed.
  • identification of the deamination into inosine may provide a functional indication for identifying a cause of disease or a relevant factor of a disease.
  • target adenosine include, for example, point mutation, early stop codon, aberrant splice site, alternative splice site and misfolding of the resulting protein.
  • These effects may induce structural and functional changes of RNAs and/or proteins associated with diseases, whether they are genetically inherited or caused by acquired genetic mutations, or may induce structural and functional changes of RNAs and/or proteins associated with occurrence of drug resistance.
  • the dRNAs, the constructs encoding the dRNAs, and the RNA editing methods of present application can be used in prevention or treatment of hereditary genetic diseases or conditions, or diseases or conditions associated with acquired genetic mutations by changing the structure and/or function of the disease-associated RNAs and/or proteins.
  • the target RNA is a pre-messenger RNA. In some embodiments, the target RNA is a messenger RNA. In some embodiments, the target RNA is a regulatory RNA. In some embodiments, the target RNA a ribosomal RNA, a transfer RNA, a long non-coding RNA or a small RNA (e.g., miRNA, pri-miRNA, pre-miRNA, piRNA, siRNA, snoRNA, snRNA, exRNA or scaRNA) .
  • miRNA miRNA, pri-miRNA, pre-miRNA, piRNA, siRNA, snoRNA, snRNA, exRNA or scaRNA
  • the effects of deamination of the target adenosines include, for example, structural and functional changes of the ribosomal RNA, transfer RNA, long non-coding RNA or small RNA (e.g., miRNA) , including changes of three-dimensional structure and/or loss of function or gain of function of the target RNA.
  • deamination of the target adenosines in the target RNA changes the expression level of one or more downstream molecules (e.g., protein, RNA and/or metabolites) of the target RNA. Changes of the expression level of the downstream molecules can be increase or decrease in the expression level.
  • Some embodiments of the present application involve multiplex editing of target RNAs in host cells, which are useful for editing different variants of a target gene or different genes in the host cells.
  • the method comprises introducing a plurality of dRNAs to the host cells, at least two of the dRNAs of the plurality of dRNAs have different sequences and/or have different target RNAs.
  • each dRNA has a different sequence and/or different target RNA.
  • the method generates a plurality (e.g., at least 2, 3, 5, 10, 50, 100, 1000 or more) of modifications in a single target RNA in the host cells.
  • the method generates a modification in a plurality (e.g., at least 2, 3, 5, 10, 50, 100, 1000 or more) of target RNAs in the host cells.
  • the method comprises editing a plurality of target RNAs in a plurality of populations of host cells.
  • each population of host cells receive a different dRNA or a dRNAs having a different target RNA from the other populations of host cells.
  • the edited RNA comprises an inosine.
  • the host cell comprises a target RNA (such as a target RNA encoding a mutant Usher 2A protein) having a missense mutation, an early stop codon, an alternative splice site, or an aberrant splice site.
  • the host cell comprises a mutant, truncated, or misfolded protein.
  • the method restores the function of the target RNA.
  • the present application further provides dRNAs, constructs encoding dRNAs and libraries comprising a plurality of dRNAs or constructs thereof, which can be used in any one of the methods of RNA editing or methods of treatment described herein. It is intended that any of the features and parameters described herein for dRNAs or constructs can be combined with each other, as if each and every combination is individually described.
  • the present application provides a dRNA for editing a target RNA, comprising a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises one or more mismatch regions relative to the target RNA, and wherein the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not hybridize with the target RNA and does not substantially form a secondary structure.
  • a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex
  • the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA
  • ADAR
  • the dRNA may be any one of the dRNAs described in section III ( “dRNAs, constructs and libraries” ) below.
  • the dRNA is linear.
  • the dRNA is circular.
  • the dRNA is a linear RNA capable of forming a circular RNA.
  • the method uses a construct comprising a nucleic acid sequence encoding the dRNA.
  • the construct may be any one of the constructs described in section III below.
  • a dRNA for editing a target RNA (such as a target RNA encoding a mutant Usher 2A protein) , comprising a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 5 nucleotides to 85 nucleotides upstream of the target adenosine; and/or (b) a second mismatch region relative to the target RNA sequence at 20 nucleotides to 85 nucleotides downstream of the target adenosine; wherein the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence, and wherein the linker nucleic acid sequence does not
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at: 5 nucleotides to 25 nucleotides upstream of the target adenosine, or 5 nucleotides to 15 nucleotides upstream of the target adenosine, or 20 nucleotides to 40 nucleotides upstream of the target adenosine.
  • the RNA duplex comprises the second mismatch region relative to the target RNA sequence at: 20 nucleotides to 65 nucleotides downstream of the target adenosine, or 20 nucleotides to 45 nucleotides downstream of the target adenosine, or 25 nucleotides to 45 nucleotides downstream of the target adenosine.
  • the first mismatch region is 1-50 nucleotides in length; and/or the second mismatch region is 1-50 nucleotides in length.
  • the linker nucleic acid sequence is about 5 nucleotides (nt) to about 500 nt in length.
  • a dRNA for editing a target RNA (such as a target RNA encoding a mutant Usher 2A protein) , comprising a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine; and/or (b) a second mismatch region relative to the target RNA sequence at 25 nucleotides to 45 nucleotides downstream of the target adenosine; and wherein the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not
  • the first mismatch region is 1-50 nucleotides in length; and/or the second mismatch region is 1-50 nucleotides in length.
  • the linker nucleic acid sequence is about 5 nucleotides (nt) to about 500 nt in length.
  • the first mismatch region comprises: (a) one or more non-complementary nucleotides (mismatch) in the targeting RNA; and/or (b) deletion of one or more nucleotides from the targeting RNA; and/or (c) insertion of one or more nucleotides into the target RNA.
  • the second mismatch region comprises: (a) one or more non-complementary nucleotides (mismatch) in the targeting RNA; and/or (b) deletion of one or more nucleotides from the targeting RNA; and/or (c) insertion of one or more nucleotides into the target RNA.
  • the first mismatch region comprises: (a) at least one group of consecutive non-complementary nucleotides (mismatch) in the targeting RNA; and/or (b) deletion of at least one group of consecutive nucleotides from the targeting RNA; and/or (c) insertion of at least one group of consecutive nucleotides from the targeting RNA.
  • the second mismatch region comprises: (a) at least one group of consecutive non-complementary nucleotides (mismatch) in the targeting RNA; and/or (b) deletion of at least one group of consecutive nucleotides from the targeting RNA; and/or (c) insertion of at least one group of consecutive nucleotides from the targeting RNA.
  • a non-complementary nucleotide in the targeting RNA results in a bubble in the RNA duplex.
  • a nucleotide deletion in the targeting RNA results in a bulge in the RNA duplex.
  • a nucleotide insertion in the targeting RNA results in a bulge in the RNA duplex.
  • a group of consecutive non-complementary nucleotides in the targeting RNA results in a bubble in the RNA duplex.
  • deletion of a group of consecutive nucleotides in the targeting RNA results in a bulge in the RNA duplex.
  • insertion of a group of consecutive nucleotides in the targeting RNA results in a bulge in the RNA duplex.
  • the first mismatch region is 1-50 nucleotides in length. In some embodiments, the second mismatch region is 1-50 nucleotides in length. In some embodiments, the first mismatch region is any one of about: 1-10, 10-20, 20-30, 30-40, or 40-50 nucleotides in length. In some embodiments, the first mismatch region is any one of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in length. In some embodiments, the second mismatch region is any one of about: 1-10, 10-20, 20-30, 30-40, or 40-50 nucleotides in length. In some embodiments, the second mismatch region is any one of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in length.
  • the first mismatch region is 1-10 nucleotides in length; and/or the second mismatch region is 1-10 nucleotides in length.
  • the first mismatch region comprises 1-10 consecutive non-complementary nucleotides in the targeting RNA.
  • the first mismatch region comprises a deletion of 1-10 consecutive nucleotides from the targeting RNA.
  • the second mismatch region comprises 1-10 consecutive non-complementary nucleotides in the targeting RNA.
  • the second mismatch region comprises a deletion of 1-10 consecutive nucleotides from the targeting RNA.
  • the first mismatch region is 4 nucleotides in length; and/or the second mismatch region is 4 nucleotides in length.
  • the first mismatch region comprises 4 consecutive non-complementary nucleotides in the targeting RNA.
  • the first mismatch region comprises a deletion of 4 consecutive nucleotides from the targeting RNA.
  • the second mismatch region comprises 4 consecutive non-complementary nucleotides in the targeting RNA.
  • the second mismatch region comprises a deletion of 4 consecutive nucleotides from the targeting RNA.
  • the dRNA is circular. In some embodiments, the dRNA is linear. In some embodiments, the dRNA is capable of being circularized (e.g. forming a circular RNA) .
  • the target RNA encodes a mutant Usher 2A protein.
  • the mutant Usher 2A protein comprises a missense mutation, a nonsense mutation and/or a frameshift mutation.
  • the mutant Usher 2A protein is a truncated Usher 2A protein.
  • the target RNA encodes a mutant Usher 2A protein comprising Trp3955Ter mutation.
  • the target RNA encoding mutant Usher 2A comprises a G to A mutation with reference to a target RNA that encodes wild-type Usher 2A.
  • the target RNA encoding mutant Usher 2A comprises a 11864G>A mutation with reference to a target RNA that encodes wild-type Usher 2A.
  • a dRNA for editing a target RNA comprising a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the target RNA encodes a mutant Usher 2A protein, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine; and/or (b) a second mismatch region relative to the target RNA sequence at 25 nucleotides to 45 nucleotides downstream of the target adenosine; and wherein the dRNA comprises a link
  • the target RNA encodes a mutant Usher 2A protein comprising Trp3955Ter mutation.
  • the target RNA encoding mutant Usher 2A comprises a G to A mutation with reference to a target RNA that encodes wild-type Usher 2A.
  • the target RNA encoding mutant Usher 2A comprises a 11864G>A mutation with reference to a target RNA that encodes wild-type Usher 2A.
  • the target adenosine is at position 101 with reference to SEQ ID NO: 3.
  • the RNA duplex further comprises a third mismatch region relative to the target RNA.
  • the third mismatch region is located between the first mismatch region and the second mismatch region relative to the target RNA.
  • the third mismatch region comprises one or two non-complementary nucleotides in the targeting RNA and/or deletion of one or both nucleotides from the targeting RNA sequence.
  • the third mismatch region relative to the target RNA sequence is at 7 and/or 8 nucleotides downstream of the target adenosine.
  • the target RNA comprises adenosine at the 7th and/or the 8th nucleotide downstream of the target adenosine.
  • the target RNA comprises the sequence of “AA” at 7 and 8 nucleotides downstream of the target adenosine, wherein the targeting RNA sequence comprises any one of: A, AA, U, C, CC, G, GG, or an absence of nucleotides ( “X” ) opposite to the target RNA at 7 and 8 nucleotides downstream of the target adenosine.
  • the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 27 nucleotides to 30 nucleotides upstream of the target adenosine; and (b) a second mismatch region relative to the target RNA sequence at 31 nucleotides to 43 nucleotides downstream of the target adenosine.
  • the second mismatch region relative to the target RNA sequence is at 32 nucleotides to 35 nucleotides downstream of the target adenosine.
  • the second mismatch region relative to the target RNA sequence is at 36 nucleotides to 39 nucleotides downstream of the target adenosine. In some embodiments, the second mismatch region relative to the target RNA sequence is at 40 nucleotides to 43 nucleotides downstream of the target adenosine. In some embodiments, the first mismatch region is 4 nucleotides in length. In some embodiments, the first mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA. In some embodiments, the second mismatch region is 4 nucleotides in length. In some embodiments, the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA.
  • the RNA duplex comprises: (a) a first mismatch region relative to the target RNA sequence at 21 nucleotides to 30 nucleotides upstream of the target adenosine; and (b) a second mismatch region relative to the target RNA sequence at 36 nucleotides to 43 nucleotides downstream of the target adenosine.
  • the second mismatch region relative to the target RNA sequence is at 36 nucleotides to 39 nucleotides downstream of the target adenosine.
  • the second mismatch region relative to the target RNA sequence is at 40 nucleotides to 43 nucleotides downstream of the target adenosine.
  • the first mismatch region is 10 nucleotides in length.
  • the first mismatch region comprises a deletion of ten consecutive nucleotides from the targeting RNA.
  • the second mismatch region is 4 nucleotides in length.
  • the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA.
  • the dRNA is circular. In some embodiments, the dRNA is capable of being circularized. In some embodiments, the dRNA is encoded in a construct comprising any one of the sequences in Table A (any one of SEQ ID NOs: 15-314) . In some embodiments, the dRNA is encoded in a construct comprising a variant of any one of sequences in Table A (any one of SEQ ID NOs: 15-314) , wherein the variant differs from the parent sequence by no more than any one of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides.
  • the circularized dRNA comprises nucleotides encoded by any one of the Circularized Sequences in Table A (non-underlined sequence in any one of SEQ ID NOs: 15-314) .
  • the circularized dRNA comprises nucleotides encoded by a variant of any one of the Circularized Sequences in Table A (non-underlined sequence in any one of SEQ ID NO: 15-314) , wherein the variant differs from the non-underlined sequence by no more than any one of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides.
  • the targeting RNA sequence is encoded by any one of the Targeting Sequences in Table A (sequence in small capital letters in any one of SEQ ID NOs: 15-314) .
  • the targeting RNA sequence is encoded by a variant of any one of the Targeting Sequences in Table A (sequence in small capital letters in any one of SEQ ID NOs: 15-314) , wherein the variant differs from the parent sequence by no more than any one of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides.
  • the linker nucleic acid sequence is about 5 nucleotides (nt) to about 500 nt in length. In some embodiments, the linker nucleic acid sequence is any one of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nt in lengths, or any lengths therebetween. In some embodiments, the linker nucleic acid sequence is less than or equal to 70nt in length.
  • the length of the linker nucleic acid sequence is any integer between 10nt-50nt, 10nt-40nt, 10nt-30nt, 10nt-20nt, 20nt-50nt, 20nt-40nt, 20nt-30nt, 30nt-50nt, 30nt-40nt or 40nt-50nt.
  • the linker nucleic acid sequence is about 20 nt to about 60 nt in length. In some embodiments, the linker nucleic acid sequence is about 30nt in length. In some embodiments, the linker nucleic acid sequence is about 50nt in length.
  • At least about any one of: 50%, 60%, 70%, 80%, 85%, 90%, or 95%of the linker nucleic acid sequence comprises adenosine or cytidine. In some embodiments, about any one of 50%to 60%, 60%to 70%, 70%to 80%, 80%to 85%, 85%to 90%, 90%to 95%or 95%to 99%the linker nucleic acid sequence comprises adenosine or cytidine. In some embodiments, all nucleic acid sequence in the linker comprises adenosine or cytidine. In some embodiments, at least about 50%of the linker nucleic acid comprises adenosine.
  • At least about any one of: 50%, 60%, 70%, 80%, 85%, or 90%of the linker nucleic acid sequence comprises adenosine. In some embodiments, about any one of 30%to 40%, 40%to 50%, 50%to 60%, 60%to 70%, 70%to 80%, 80%to 85%, 85%to 90%, or 90%to 95%the linker nucleic acid sequence comprises adenosine.
  • the dRNA comprises a linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence. In some embodiments, the dRNA comprises a linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence and a second linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence.
  • the first linker nucleic acid sequence is identical to the second linker nucleic acid sequence. In some embodiments, the first linker nucleic acid sequence is different from the second linker nucleic acid sequence. In some embodiments, the dRNA further comprises a 3’ exon sequence recognizable by a 3’ catalytic Group I intron fragment flanking the 5’ end of the targeting RNA sequence, and a 5’ exon sequence recognizable by a 5’ catalytic Group I intron fragment flanking the 3’ end of the targeting RNA sequence. In some embodiments, the dRNA further comprises a 3’ ligation sequence and a 5’ ligation sequence. In some embodiments, the duplex RNA comprises a bulge at each non-target adenosine in the target RNA.
  • the targeting RNA sequence is more than 50 nt long. In some embodiments, the targeting RNA sequence in the dRNA is about 100 to about 200 nt long. In some embodiments, the targeting RNA sequence in the dRNA is about 150 to about 220 nt long. In some embodiments, the targeting RNA sequence in the dRNA is about 70 nt (e.g., 71 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 120 nt (e.g., 121 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 150 nt (e.g., 151 nt) long.
  • the targeting RNA sequence in the dRNA is about 170 nt (e.g., 171 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 200 nt (e.g., 201 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 220 nt (e.g., 221 nt) long.
  • a dRNA for editing a target RNA comprising a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the target RNA encodes a mutant Usher 2A protein, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex comprises: (a) a first mismatch region comprising a deletion of ten consecutive nucleotides from the targeting RNA relative to the target RNA sequence at 21 nucleotides to 30 nucleotides upstream of the target adenosine; and (b) a second mismatch region comprising a deletion of four consecutive nucleotides from the targeting RNA relative to the target RNA sequence at
  • the dRNA comprises a first linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence and a second linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence.
  • the dRNA is circular or capable of being circularized.
  • the target RNA encodes a mutant Usher 2A protein comprising Trp3955Ter mutation.
  • a dRNA for editing a target RNA comprising a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, wherein the target RNA encodes a mutant Usher 2A protein, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form a RNA duplex, wherein the RNA duplex comprises: (a) a first mismatch region comprising a deletion of ten consecutive nucleotides from the targeting RNA relative to the target RNA sequence at 21 nucleotides to 30 nucleotides upstream of the target adenosine; and (b) a second mismatch region comprising a deletion of four consecutive nucleotides from the targeting RNA relative to the target RNA sequence at
  • the dRNA comprises a first linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence and a second linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence.
  • the dRNA is circular or capable of being circularized.
  • the target RNA encodes a mutant Usher 2A protein comprising Trp3955Ter mutation.
  • the present application provides a dRNA for editing a target RNA (such as a target RNA encoding a mutant Usher 2A protein) comprising a targeting RNA sequence that is capable of hybridizing to the target RNA to form a duplex RNA, wherein the duplex RNA comprises a bulge comprising a non-target adenosine in the target RNA.
  • the targeting RNA sequence has deletion of one or more uridine residues opposite one or more non-target adenosines in a sequence complementary to the target RNA.
  • the dRNA is a linear RNA.
  • the dRNA is a circular RNA.
  • the dRNA is a linear RNA capable of forming a circular RNA.
  • the linker nucleic acid sequence is about 5 nt to about 500 nt long, such as about 50 nt to 200 nt long.
  • the linker nucleic acid sequence comprises a polyadenosine (polyA) , polyguanosine (polyG) , or polycytosine (polyC) sequence.
  • the linker nucleic acid sequence comprises a dinucleotide repeat sequence, such as (AT) n , wherein n is an integer greater or equal to 3.
  • the linker nucleic acid sequence comprises any one of SEQ ID NOs: 8 to 14.
  • the dRNA is a circular RNA.
  • the dRNA comprises a first linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence and a second linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence.
  • the present application provides a library comprising a plurality of the dRNAs or a plurality of the constructs described herein.
  • the present application provides a composition or a host cell comprising any one of the deaminase-recruiting RNAs or the constructs described herein.
  • the host cell is a prokaryotic cell or a eukaryotic cell.
  • the host cell is a mammalian cell. In some embodiments, the host cell is a human cell.
  • the dRNA of the present application comprises a targeting RNA sequence that hybridizes to the target RNA.
  • the targeting RNA sequence is substantially complementarity to the target RNA to allow hybridization of the targeting RNA sequence to the target RNA.
  • the targeting RNA sequence is at least about any one of 70%, 80%, 85%, 90%, or 95%, 96%, 97%, 98%, or 99%or more complementary to over a continuous stretch of at least about any one of 20, 40, 60, 80, 100, 150, 200, or more nucleotides in the target RNA.
  • the dsRNA formed by hybridization between the targeting RNA sequence and the target RNA has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) non-Watson-Crick base pairs (i.e., mismatches) .
  • the dsRNA (also referred herein as “duplex RNA” or “RNA duplex” ) formed by hybridization between the targeting RNA sequence and the target RNA has one or more unpaired (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotides.
  • the dsRNA formed hybridization between the targeting RNA sequence and the target RNA has one or more non-target adenosines in the target RNA that are unpaired.
  • the dRNA lacks one or more nucleotides opposite one or more non-target adenosines in the target RNA.
  • the targeting RNA sequence in the dRNA lacks the nucleotide opposite each non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence in the dRNA has a deletion of two or more (e.g., 2, 3, 4, or more) consecutive nucleotides opposite a region comprising a non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence in the dRNA is substantially complementary to the target RNA while lacking one or more nucleotides opposite one or more non-target adenosines in the target RNA. In some embodiments, the targeting RNA sequence in the dRNA is substantially complementary to the target RNA while lacking a nucleotide opposite each non-target adenosine in the target RNA.
  • Unpaired nucleotides in a dsRNA give rise to a bulge.
  • the target RNA hybridizes with the dRNA to form a dsRNA comprising a bulge comprising a non-target adenosine in the target RNA.
  • the bulge in the dsRNA formed by hybridization of the dRNA with the target RNA comprises a non-target adenosine in the target RNA.
  • the bulge maybe single nucleotide bulge, i.e., containing an unpaired non-target adenosine, or multi-nucleotide bulge, i.e., containing additional unpaired or mismatched nucleotides that flank the unpaired non-target adenosine.
  • the bulge may contain more than one (e.g., 2, 3, 4, 5 or more) unpaired nucleotides in the target RNA, i.e., the bulge is made of unpaired nucleotides that directly flanking the 5’ and/or the 3’ side of the non-target adenosine residue.
  • the bulge may contain one or more (e.g., 2, 3, 4, 5 or more) mismatched nucleotides directly flanking the 5’ and/or the 3’ side of the non-target adenosine residue.
  • the bulge comprises an unpaired non-target adenosine, one or more unpaired nucleotides flanking the 5’ and/or the 3’ side of the non-target adenosine residue, and one or more mismatched nucleotides flanking the 5’ and/or the 3’ side of the non-target adenosine residue.
  • the bulge is 1 nt, 2nt, 3nt, or longer.
  • the duplex RNA comprises two or more bulges, such as any one of 2, 3, 4, 5, 6, or more bulges, wherein each bulge comprises a non-target adenosine in the target RNA. In some embodiments, the duplex RNA comprises a bulge at each non-target adenosine in the target RNA.
  • the dsRNA formed by hybridization between the dRNA and the target RNA comprises one or more, such as any one of 1, 2, 3, 4, 5, 6, 7 or more mismatches (e.g., the same type of different types of mismatches) .
  • the dsRNA formed by hybridization between the dRNA and the target RNA comprises one or more kinds of mismatches, for example, 1, 2, 3, 4, 5, 6, 7 kinds of mismatches selected from the group consisting of G-A, C-A, U-C, A-A, G-G, C-C and U-U.
  • the targeting RNA sequence may further comprise one or more guanosine (s) , such as 1, 2, 3, 4, 5, 6, or more Gs, that is each directly opposite a non-target adenosine in the target RNA.
  • the targeting RNA sequence in addition to the mismatch region (s) , may further comprise two or more consecutive mismatch nucleotides (e.g., 2, 3, 4, 5, or more mismatch nucleotides) opposite a non-target adenosine in the target RNA.
  • the dRNA comprises a single linker nucleic acid sequence. In some embodiments, the dRNA comprises a linker nucleic acid sequence at the 5’ end of the targeting RNA sequence. In some embodiments, the dRNA comprises a linker nucleic acid sequence at the 3’ end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence at the 5’ end of the targeting RNA sequence, and a second linker nucleic acid sequence at the 3’ end of the targeting RNA sequence. In some embodiments, the dRNA is a circular RNA comprising a linker nucleic acid sequence connecting directly or indirectly the 5’ end and the 3’ end of the targeting RNA sequence. The first linker nucleic acid sequence and the second linker nucleic acid sequence may have the same or different sequences.
  • the linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) is at least about any one of 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nt long. In some embodiments, the linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) is no more than about any one of 500, 450, 400, 350, 300, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, or 5 nt long.
  • the linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) is about any one of 5-10, 10-20, 20-50, 5-50, 10-100, 5-50, 50-100, 100-200, 200-300, 300-400, 400-500, 5-100, 5-200, 5-300, 5-400, 5-500, 50-200, 50-300, 50-400 or 50-500 nt long.
  • the linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) is about 50 nt long.
  • the first linker nucleic acid sequence and the second linker nucleic acid sequence have the same length. In some embodiments, the first linker nucleic acid sequence and the second linker nucleic acid sequence have different lengths.
  • the linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) does not substantially form any secondary structure with any part of the dRNA. Computational tools are known in the art to predict the secondary structure of RNAs, including, for example, RNAfold.
  • the linker nucleic acid sequence does not form a duplex region with a portion of the targeting RNA sequence that is more than about any one of 3, 4, 5, 6, or more basepairs long.
  • the linker nucleic acid sequence does not contain complementary regions having more than 3, 4, 5, or 6 nucleotides long.
  • the first linker nucleic acid sequence does not have a complementary region having more than 3, 4, 5, or 6 nucleotides long with respect to the second linker nucleic acid sequence.
  • the linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) could be a mononucleotide or dinucleotide repeat sequence, or a random sequence.
  • the linker nucleic acid sequence comprises a polyadenosine (polyA) , polyguanosine (polyG) , or polycytosine (polyC) sequence.
  • the linker nucleic acid sequence comprises a dinucleotide repeat sequence, such as an AC or CA repeat sequence.
  • the linker nucleic acid sequence comprises (AC) n , wherein n is an integer greater or equal to 3.
  • the linker nucleic acid sequence serves as a ligation sequence that connects the 5’ end and the 3’ end of the targeting RNA sequence in a circular dRNA.
  • ADAR for example, human ADAR enzymes edit double stranded RNA (dsRNA) structures with varying specificity, depending on a number of factors.
  • dsRNA double stranded RNA
  • One important factor is the degree of complementarity of the two strands making up the dsRNA sequence.
  • Perfect complementarity of between the dRNA and the target RNA usually causes the catalytic domain of ADAR to deaminate adenosines in a non-discriminative manner.
  • the specificity and efficiency of ADAR can be modified by introducing mismatches in the dsRNA region. For example, A-C mismatch is preferably recommended to increase the specificity and efficiency of deamination of the adenosine to be edited.
  • the dRNA sequence or single-stranded RNA region thereof has at least about any one of 70%, 80%, 85%, 90%, or 95%of sequence complementarity to the target RNA, when optimally aligned.
  • Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner) .
  • the nucleotides neighboring the target adenosine also affect the specificity and efficiency of deamination.
  • the 5’ nearest neighbor of the target adenosine to be edited in the target RNA sequence has the preference U>C ⁇ A>G and the 3’ nearest neighbor of the target adenosine to be edited in the target RNA sequence has the preference G >C>A ⁇ U in terms of specificity and efficiency of deamination of adenosine.
  • the target adenosine when the target adenosine may be in a three-base motif selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA and GAU in the target RNA, the specificity and efficiency of deamination of adenosine are higher than adenosines in other three-base motifs.
  • the target adenosine to be edited is in the three-base motif UAG, UAC, UAA, UAU, CAG, CAC, AAG, AAC or AAA
  • the efficiency of deamination of adenosine is much higher than adenosines in other motifs.
  • different designs of dRNA may also lead to different deamination efficiency.
  • the dRNA comprises cytidine (C) directly opposite the target adenosine to be edited, adenosine (A) directly opposite the uridine, and cytidine (C) , guanosine (G) or uridine (U) directly opposite the guanosine
  • the efficiency of deamination of the target adenosine is higher than that using other dRNA sequences.
  • the editing efficiency of the A in the UAG of the target RNA may reach about 25%-90% (e.g., about 25%-80%, 25%-70%, 25%-60%, 25%-50%, 25%-40%, or 25%-30%) .
  • non-target A adenosines in the target RNA
  • a first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nucleotides upstream of the target adenosine; and/or a second mismatch region relative to the target RNA sequence at 25 nucleotides to 45 nucleotides downstream of the target adenosine, which results in bulges and/or bubbles at the mismatch regions, wherein editing of the target adenosine could be increased while off-target editing at the non-target adenosine (s) could be decreased.
  • the dRNA may further contain one or more unpaired nucleotides and/or one or more mismatched nucleotides that directly flank the 5’ or 3’ side of a non-target adenosine.
  • mismatch refers to a nucleotide in a first strand of a duplex nucleic acid that does not basepair with any nucleotide in a second strand of the duplex nucleic acid.
  • guanosine is directly opposite an adenosine in the target RNA, the deamination efficiency is significantly decreased.
  • dRNAs can be designed to have deletion of one or more nucleotides (e.g., U) opposite a first non-target adenosine, and/or to have a guanosine directly opposite a second non-target adenosine to be edited in the target RNA.
  • U nucleotides
  • mismatch can refer to opposing nucleotides in a double stranded RNA (dsRNA) which do not form perfect base pairs according to the Watson-Crick base pairing rules. Mismatch base pairs include, for example, G-A, C-A, U-C, A-A, G-G, C-C, U-U base pairs.
  • a dRNA is designed to comprise a C opposite the A to be edited, generating an A-C mismatch in the dsRNA formed by hybridization between the target RNA and dRNA.
  • mismatch can also refer to a deletion of nucleotides from one strand in a double stranded RNA (dsRNA) , therefore resulting in no pairing on the nucleotide (s) on the strand opposite to the deleted nucleotide (s) .
  • the dRNAs described herein comprise a targeting RNA sequence that is at least partially complementary to the target RNA.
  • the targeting RNA sequence in the dRNA comprises at least about any one of 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 nucleotides (nt) long.
  • the targeting RNA sequence in the dRNA comprises no more than about any one of 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 nucleotides.
  • the targeting RNA sequence in the dRNA is about any one of 40-260, 45-250, 50-240, 60-230, 65-220, 70-220, 70-210, 70-200, 70-190, 70-180, 70-170, 70-160, 70-150, 70-140, 70-130, 70-120, 70-110, 70-100, 70-90, 70-80, 75-200, 80-190, 85-180, 90-170, 95-160, 100-200, 100-150, 100-175, 110-200, 110-160, 110-175, 110-150, 140-160, 105-140, or 105-155 nucleotides in length.
  • the targeting RNA sequence in the dRNA is about 100 to about 200 nt long. In some embodiments, the targeting RNA sequence in the dRNA is about 70 nt (e.g., 71 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 120 nt (e.g., 121 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 150 nt (e.g., 151 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 170 nt (e.g., 171 nt) long.
  • the targeting RNA sequence in the dRNA is about 200 nt (e.g., 201 nt) long. In some embodiments, the targeting RNA sequence in the dRNA is about 220 nt (e.g., 221 nt) long.
  • the targeting RNA sequence comprises a cytidine, adenosine or uridine directly opposite the target adenosine residue in the target RNA (such as a target RNA encoding a mutant Usher 2A protein) .
  • the targeting RNA sequence comprises a cytidine mismatch directly opposite the target adenosine residue in the target RNA.
  • the cytidine mismatch is located at least 5 nucleotides, e.g., at least 10, 15, 20, 25, 30, or more nucleotides, away from the 5’ end of the targeting RNA sequence.
  • the cytidine mismatch is located at least 20 nucleotides, e.g., at least 25, 30, 35, or more nucleotides, away from the 3’ end of the complementary RNA sequence. In some embodiments, the cytidine mismatch is not located within 20 (e.g., 15, 10, 5 or fewer) nucleotides away from the 3’ end of the targeting RNA sequence.
  • the cytidine mismatch is located at least 20 nucleotides (e.g., at least 25, 30, 35, or more nucleotides) away from the 3’ end and at least 5 nucleotides (e.g., at least 10, 15, 20, 25, 30, or more nucleotides) away from the 5’ end of the targeting RNA sequence.
  • the cytidine mismatch is located in the center of the targeting RNA sequence. In some embodiments, the cytidine mismatch is located within 20 nucleotides (e.g., 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide) of the center of the targeting sequence in the dRNA.
  • the 5’ nearest neighbor of the target adenosine residue is a nucleotide selected from U, C, A and G with the preference U>C ⁇ A>G and the 3’ nearest neighbor of the target adenosine residue is a nucleotide selected from G, C, A and U with the preference G>C>A ⁇ U.
  • the 5’ nearest neighbor of the target adenosine residue is U.
  • the 5’ nearest neighbor of the target adenosine residue is C or A.
  • the 3’ nearest neighbor of the target adenosine residue is G.
  • the 3’ nearest neighbor of the target adenosine residue is C.
  • the target adenosine residue is in a three-base motif selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA and GAU in the target RNA (such as a target RNA encoding a mutant Usher 2A protein) .
  • the three-base motif is UAG
  • the dRNA comprises an A directly opposite the U in the three-base motif, a C directly opposite the target A, and a C, G or U directly opposite the G in the three-base motif.
  • the three-base motif is UAG in the target RNA, and the dRNA comprises ACC, ACG or ACU that is opposite the UAG of the target RNA. In certain embodiments, the three-base motif is UAG in the target RNA, and the dRNA comprises ACC that is opposite the UAG of the target RNA.
  • the targeting RNA sequence in the dRNA is single-stranded or substantially single-stranded.
  • the dRNA may be entirely single-stranded or have one or more (e.g., 1, 2, 3, or more) double-stranded regions and/or one or more stem loop regions.
  • the dRNA apart from the targeting RNA sequence, further comprises regions for stabilizing the dRNA, for example, one or more double-stranded regions and/or stem loop regions.
  • the double-stranded region or stem loop region of the dRNA comprises no more than about any one of 200, 150, 100, 50, 40, 30, 20, 10 or fewer base-pairs.
  • RNA-editing oligonucleotides comprising double-stranded regions, and/or stem loop regions are disclosed in WO 2016/097212, WO2018/161032, WO2020/051555, WO2021/113264, WO2021/211894, US20190093098, US20220073915 and Katrekar et al., Efficient in vitro and in vivo RNA editing via recruitment of endogenous ADARs using circular guide RNAs, Nature Biotechnology (2022) , the contents of which are incorporated herein by reference in their entireties.
  • the dRNA does not comprise a stem loop or double-stranded region.
  • the dRNA comprises an ADAR-recruiting domain.
  • the dRNA does not comprise an ADAR-recruiting domain.
  • the dRNA may comprise one or more modifications.
  • the dRNA has one or more modified nucleotides, including nucleobase modification and/or backbone modification.
  • modified nucleotides including nucleobase modification and/or backbone modification.
  • exemplary modifications to the dRNA include, but are not limited to, phosphorothioate backbone modification, 2’-substitutions in the ribose (such as 2’-O-methyl and 2’-fluoro substitutions) , LNA, and L-RNA.
  • Chemical modifications may in some embodiments increase the stability and efficacy of editing facilitated by the dRNA.
  • the dRNA does not comprise chemical modifications.
  • the dRNA does not comprise a chemically modified nucleotide, such as 2’-O-methyl nucleotide, 2’-fluoro nucleotide or a nucleotide having a phosphorothioate linkage.
  • the dRNA does not comprise a chemically modified nucleotide. In some embodiments, the dRNA does not comprise a 2’-fluoro nucleotide. In some embodiments, the dRNA does not comprise a 2’-O-methyl nucleotide. In some embodiments, the dRNA does not comprise a nucleotide having a phosphorothioate linkage. In some embodiments, the dRNA does not comprise any one of: 2’-fluoro nucleotide, 2’-O-methyl nucleotide or nucleotide having a phosphorothioate linkage. In some embodiments, the dRNA comprises one or more chemical modifications.
  • the dRNA comprises one or more chemically modified nucleotides. In some embodiments, the dRNA comprises one or more 2’-fluoro nucleotides. In some embodiments, the dRNA comprises one or more 2’-O-methyl nucleotides. In some embodiments, the dRNA comprises one or more nucleotides having a phosphorothioate linkage. In some embodiments, the dRNA comprises 2’-O-methyl and phosphorothioate linkage modifications only at the first three and last three residues. In some embodiments, the dRNA is not an antisense oligonucleotide (ASO) .
  • ASO antisense oligonucleotide
  • the dRNA may further comprise one or more additional expression elements that facilitate expression and/or circularization of the dRNA.
  • the dRNA further comprises a 3’ exon sequence recognizable by a 3’ catalytic Group I intron fragment flanking the 5’ end of the targeting RNA sequence, and a 5’ exon sequence recognizable by a 5’ catalytic Group I intron fragment flanking the 3’ end of the targeting RNA sequence.
  • the Group I catalytic intron of the T4 phage Td gene is bisected in such a way to preserve structural elements critical for ribozyme folding.
  • Exon fragment 2 is then ligated upstream of exon fragment 1, and a targeting RNA sequence (optionally with linker nucleic acid sequence (s) flanking the 5’ and/or the 3’ ends) is inserted between the exon-exon junction.
  • the dRNA is a linear RNA that is capable of forming a circular RNA.
  • the circulation is performed using the Tornado expression system ( “Twister-optimized RNA for durable overexpression” ) as described in Litke, J.L. &Jaffrey, S.R. Highly efficient expression of circular RNA aptamers in cells using autocatalytic transcripts. Nat Biotechnol 37, 667-675 (2019) , which is hereby incorporated herein by reference in its entirety.
  • Tornado-expressed transcripts contain an RNA of interest flanked by Twister ribozymes.
  • a twister ribozyme is any catalytic RNA sequences that are capable of self-cleavage. The ribozymes rapidly undergo autocatalytic cleavage, leaving termini that are ligated by an RNA ligase.
  • the dRNA comprises a targeting RNA sequence flanked (directly or indirectly) by a 5’ and/or 3’ ligation sequences. In some embodiments, the dRNA comprises a 3’ ligation sequence. In some embodiments, the dRNA comprises a 5’ ligation sequence. In some embodiments, the dRNA comprises a 3’ ligation sequence and a 5’ ligation sequence. In some embodiments, the 3’ ligation sequence and the 5’ ligation sequence are at least partially complementary to each other.
  • the 3’ ligation sequence and the 5’ ligation sequence are at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%or at least about 99%complementary to each other.
  • the 3’ ligation sequence and the 5’ ligation sequence are fully complementary to each other.
  • the 5’ and/or 3’ ligation sequences are further flanked by the 5’-Twister ribozyme and/or 3’-Twister ribozymes, respectively.
  • the dRNA is a linear RNA capable of forming a circular RNA, wherein the dRNA comprises, from the 5’ to the 3’ : a 5’ ligation sequence, a first linker nucleic acid sequence, a targeting RNA sequence, a second linker nucleic acid sequence, and a 3’ ligation sequence.
  • the dRNA is a linear RNA capable of forming a circular RNA, wherein the dRNA comprises, from the 5’ to the 3’ : a 5’ ligation sequence, a linker nucleic acid sequence, a targeting RNA sequence, and a 3’ ligation sequence.
  • the dRNA is a linear RNA capable of forming a circular RNA, wherein the dRNA comprises, from the 5’ to the 3’ : a 5’ ligation sequence, a targeting RNA sequence, a linker nucleic acid sequence, and a 3’ ligation sequence.
  • the dRNA is a linear RNA capable of forming a circular RNA, wherein the dRNA comprises, from the 5’ to the 3’ : a 5’ ligation sequence, a targeting RNA sequence, and a 3’ ligation sequence.
  • the 3’ ligation sequence comprises the sequence of CTGCCATCAGTCGGCGTGGACTGTAG.
  • the 5’ ligation sequence comprises the sequence of AACCATGCCGACTGATGGCAG.
  • the dRNA is a circular RNA comprising a ligation sequence connecting directly or indirectly the 5’ end and the 3’ end of the targeting RNA sequence.
  • the ligation sequence comprises a 5’ ligation sequence and a 3’ ligation sequence that are ligated to each other via a ligase, e.g., T4 RNA ligase such as Rnl1 or Rnl2.
  • the dRNA is a circular RNA comprising in a clockwise direction: a ligation sequence, a first linker nucleic acid sequence, the targeting RNA sequence, and a second linker nucleic acid sequence, wherein the ligation sequence directly connects the 5’ end of the first linker nucleic acid sequence to the 3’ end of the second linker nucleic acid sequence.
  • the dRNA is a circular RNA comprising in a clockwise direction: a ligation sequence, a linker nucleic acid sequence, the targeting RNA sequence, wherein the ligation sequence directly connects the 5’ end of the linker nucleic acid sequence to the 3’ end of the targeting RNA sequence.
  • the dRNA is a circular RNA comprising in a clockwise direction: a ligation sequence, the targeting RNA sequence, and a linker nucleic acid sequence, wherein the ligation sequence directly connects the 5’ end of the targeting RNA sequence to the 3’ end of the linker nucleic acid sequence.
  • the dRNA is a circular RNA comprising a ligation sequence and the targeting RNA sequence, wherein the ligation sequence directly connects the 5’ end of the targeting RNA sequence to the 3’ end of the targeting RNA sequence.
  • the 3’ ligation sequence and the 5’ ligation sequence are independently at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides or at least about 100 nucleotides in length.
  • the 3’ ligation sequence and the 5’ ligation sequence are independently about 20-30 nucleotides, about 30-40 nucleotides, about 40-50 nucleotides, about 50-60 nucleotides, about 60-70 nucleotides, about 70-80 nucleotides, about 80-90 nucleotides, about 90-100 nucleotides, about 100-125 nucleotides, about 125-150 nucleotides, about 20-50 nucleotides, about 50-100 nucleotides or about 100-150 nucleotides in length.
  • the dRNA is circularized by an RNA ligase.
  • RNA ligase include: RtcB, T4 RNA Ligase 1 (Rnl1) , T4 RNA Ligase 2 (Rnl2) , Rnl3 and Trl1.
  • the RNA ligase is expressed endogenously in the host cell.
  • the RNA ligase is RNA ligase RtcB.
  • the method further comprises introducing an RNA ligase (e.g., RtcB) into the host cell.
  • the dRNA is circularized before being introduced to the host cell.
  • the dRNA is chemically synthesized.
  • the dRNA is circularized through in vitro enzymatic ligation (e.g., using RNA or DNA ligase) or chemical ligation (e.g., using cyanogen bromide or a similar condensing agent) .
  • the dRNAs described herein do not comprise a tracrRNA, crRNA or gRNA used in a CRISPR/Cas system.
  • the dRNA does not comprise an ADAR-recruiting domain.
  • the dRNA does comprise an ADAR-recruiting domain.
  • ADAR-recruiting domain can be a nucleotide sequence or structure that binds at high affinity to ADAR, or a nucleotide sequence that binds to a binding partner fused to ADAR in an engineered ADAR construct.
  • ADAR-recruiting domains include, but are not limited to, GluR-2, GluR-B (R/G) , GluR-B (Q/R) , GluR-6 (R/G) , 5HT2C, and FlnA (Q/R) domain; see, for example, Wahlstedt, Helene, and Marie, “Site-selective versus promiscuous A-to-I editing. ” Wiley Interdisciplinary Reviews: RNA 2.6 (2011) : 761-771, which is incorporated herein by reference in its entirety.
  • the dRNA does not comprise a double-stranded portion.
  • the dRNA does not comprise a hairpin, such as MS2 stem loop.
  • the dRNA comprises a hairpin, such as MS2 stem loop.
  • the dRNA is single stranded.
  • the dRNA comprises a snoRNA sequence linked to the 5’ end of the targeting RNA sequence ( “5’ snoRNA sequence” ) . In some embodiments, the dRNA comprises a snoRNA sequence linked to the 3’ end of the targeting RNA sequence ( “3’ snoRNA sequence” ) . In some embodiments, the dRNA comprises a snoRNA sequence linked to the 5’ end of the targeting RNA sequence ( “5’ snoRNA sequence” ) and a snoRNA sequence linked to the 3’ end of the targeting RNA sequence ( “3’ snoRNA sequence” ) .
  • the snoRNA sequence is at least about 50 nucleotides, at least about 60 nucleotides, at least about 70 nucleotides, at least about 80 nucleotides, at least about 90 nucleotides, at least about 100 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides, at least about 130 nucleotides, at least about 140 nucleotides, at least about 150 nucleotides, at least about 160 nucleotides, at least about 170 nucleotides, at least about 180 nucleotides, at least about 190 nucleotides or at least about 200 nucleotides in length.
  • the snoRNA sequence is about 50-75 nucleotides, about 75-100 nucleotides, about 100-125 nucleotides, about 125-150 nucleotides, about 150-175 nucleotides, about 175-200 nucleotides, about 50-100 nucleotides, about 100-150 nucleotides, about 150-200 nucleotides, about 125-175 nucleotides, or about 100-200 nucleotides in length.
  • the snoRNA sequence is a C/D Box snoRNA sequence.
  • the snoRNA sequence is an H/ACA Box snoRNA sequence.
  • the snoRNA sequence is a composite C/D Box and H/ACA Box snoRNA sequence.
  • the snoRNA sequence is an orphan snoRNA sequence.
  • Small nucleolar RNAs are small non-coding RNA molecules that are known to guide chemical modifications of other RNAs such as ribosomal RNAs, transfer RNAs, and small nuclear RNAs.
  • RNA binding proteins RBPs
  • accessory proteins RNA binding proteins
  • snoRNP small nucleolar ribonucleoprotein
  • snoRNAs include, for example, composite H/ACA and C/D box snoRNA and orphan snoRNAs.
  • the snoRNA sequence described herein can comprise a naturally-occurring snoRNA, a portion thereof, or a variant thereof.
  • the present application provides constructs encoding the dRNAs and/or ADAR.
  • a construct e.g., vector, such as viral vector
  • a construct comprising a nucleotide sequence encoding the dRNA.
  • a construct comprising a nucleotide sequence encoding the ADAR.
  • a construct comprising a first nucleotide sequence encoding the dRNA and a second nucleotide sequence encoding the ADAR.
  • the first nucleotide sequence and the second nucleotide sequence are operably linked to the same promoter.
  • the first nucleotide sequence and the second nucleotide sequence are operably linked to different promoters.
  • the promoter is inducible.
  • the construct does not encode for the ADAR.
  • the vector further comprises nucleic acid sequence (s) encoding an inhibitor of ADAR3 (e.g., ADAR3 shRNA or siRNA) and/or a stimulator of interferon (e.g., IFN- ⁇ ) .
  • construct refers to DNA or RNA molecules that comprise a coding nucleic acid sequence that can be transcribed into RNAs or expressed into proteins.
  • the construct contains one or more regulatory elements operably linked to the nucleic acid sequence encoding the RNA or protein.
  • the construct is introduced into a host cell, under suitable conditions, the coding nucleic acid sequence in the construct can be transcribed or expressed.
  • the constructs described herein may comprise a promoter that is operably linked to the nucleic acid sequence encoding the dRNA, such that the promoter controls the transcription or expression of the coding nucleotide sequence.
  • the promoter may be positioned 5’ (upstream) of a coding nucleotide sequence under its control.
  • the distance between the promoter and the coding sequence may be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variation in this distance may be accommodated without loss of promoter function.
  • the construct comprises a 5’ UTR and/or a 3’ UTR that regulates the transcription or expression of the coding nucleotide sequence.
  • the promoter is driving expression of two or more dRNAs.
  • the promoter may be a polymerase II promoter ( “Pol II promoter” ) or a polymerase III promoter ( “Pol III promoter” ) .
  • the construct comprises a Pol II promoter operably linked to a nucleic acid sequence encoding the dRNA.
  • Non-limiting examples of Pol II promoters include: CMV, SV40, EF-1 ⁇ , CAG and RSV.
  • the Pol II promoter is a CMV promoter.
  • the construct comprises a Pol III promoter.
  • the promoter is a U6 promoter.
  • the U6 promoter comprises the nucleic acid sequence of gagggcctatttccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaaga tattagtacaaaatacgtgacgtagaaagtaataatttcttgggtattttgcagttttttaaaattatgtttttaaaatggactatcatatgcttaccg taacttgaaagtatttcgatttcttggcttttatatatcttgtggaaaggacgaacaccg.
  • the construct is a vector encoding any one of the dRNAs disclosed in the present application.
  • the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular) ; nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art.
  • vector refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors) .
  • Other vectors e.g., non-episomal mammalian vectors
  • certain vectors are capable of directing the transcription or expression of coding nucleotide sequences to which they are operatively linked. Such vectors are referred to herein as “expression vectors” .
  • the construct is a viral vector. In some embodiments, the construct is lentivirus vector. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector. Use of any AAV serotype is considered within the scope of the present disclosure.
  • rAAV recombinant adeno-associated virus
  • the rAAV vector is a vector derived from an AAV serotype, including without limitation, AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV capsid serotype or the like.
  • the construct is flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the construct is flanked by two AAV ITRs.
  • the AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV serotype ITRs.
  • the AAV ITRs are AAV2 ITRs.
  • the vector further comprises a stuffer nucleic acid.
  • the stuffer nucleic acid is located upstream or downstream of the nucleic acid encoding the dRNA.
  • the vector is a self-complementary rAAV vector.
  • the vector comprises first nucleic acid sequence encoding the dRNA and a second nucleic acid sequence encoding a complement of the dRNA, wherein the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length.
  • the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and comprises a mutation of the terminal resolution sequence.
  • the vector is encapsidated in a rAAV particle.
  • the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2/2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV2 V708K, AAV2-HBKO, AAVDJ8, AAVPHP.
  • B AAVPHP.
  • the construct further comprises a 3’ twister ribozyme sequence linked to the 3’ end of the nucleic acid encoding the dRNA. In some embodiments, the construct further comprises a 5’ twister ribozyme sequence linked to the 5’ end of the nucleic acid sequence encoding the dRNA. In some embodiments, the construct further comprises a 3’ twister ribozyme sequence linked to the 3’ end of the nucleic acid sequence encoding the dRNA and a 5’ twister ribozyme sequence linked to the 5’ end of the nucleic acid encoding the dRNA. In some embodiments, the 3’ twister sequence is twister P3 U2A and the 5’ twister sequence is twister P1.
  • the 5’ twister sequence is twister P3 U2A and the 3’ twister sequence is twister P1.
  • the dRNA undergoes autocatalytic cleavage.
  • the catalyzed dRNA product comprises a 5′-hydroxyl group and a 2′, 3′-cyclic phosphate at the 3′terminus.
  • the dRNAs described herein may be prepared using any known methods in the art, including chemical synthesis and in vitro transcription. Circular dRNAs may be prepared by chemical ligation, enzymatic ligation, or ribozyme autocatalysis of linear RNAs. In some embodiments, the circular dRNA is prepared by circularizing a linear RNA in vitro.
  • the present application provides a linear RNA capable of forming the circular dRNA of any one of the embodiments described above.
  • the linear RNA can circularized by chemical circularization methods using cyanogen bromide or a similar condensing agent.
  • the linear RNA can be circularized by autocatalysis of a Group I intron comprising a 5’ catalytic Group I intron fragment and a 3’ catalytic Group I intron fragment.
  • the linear RNA can be circularized by a ligase.
  • the linear RNA can be circularized by a T4 RNA ligase.
  • the linear RNA can be circularized by a DNA ligase.
  • Suitable ligases include, but are not limited to a T4 DNA ligase (T4 Dnl) , a T4 RNA ligase 1 (T4 Rnl1) and a T4 RNA ligase 2 (T4 Rnl2) .
  • T4 Dnl T4 DNA ligase
  • T4 Rnl1 T4 RNA ligase 1
  • T4 Rnl2 T4 RNA ligase 2
  • the circular dRNA may be purified using known methods in the art, for example, by gel-purification or by high-performance liquid chromatography (HPLC) .
  • a linear RNA can be circularized by chemical methods to provide a circular dRNA.
  • the 5’-end and the 3’-end of the nucleic acid e.g., a linear circular polyribonucleotide
  • the 5’-end and the 3’-end of the nucleic acid includes chemically reactive groups that, when close together, may form a new covalent linkage between the 5’-end and the 3’-end of the molecule.
  • the 5’-end may contain an NHS ester reactive group and the 3’-end may contain a 3’-amino terminated nucleotide such that in an organic solvent the 3’-amino-terminated nucleotide on the 3’-end of a linear RNA molecule will undergo a nucleophilic attack on the 5’-NHS-ester moiety forming a new 5’-/3’-amide bond.
  • a circular dRNA can be obtained by circularizing a linear RNA by ribozyme autocatalysis.
  • the linear RNA is circularized in vitro.
  • circularization by ribozyme autocatalysis comprises (a) subjecting the linear RNA to a condition that activates autocatalysis of the Group I intron (or 5’ and 3’ catalytic Group I intron fragments thereof) to provide a circularized RNA product; and (b) isolating the circularized RNA product, thereby providing the circular dRNA.
  • the method comprises a step of obtaining the linear RNA by first cloning the sequence encoding the linearized RNAs into a plasmid vector, and then linearizing the recombinant plasmids.
  • the recombinant plasmids are linearized by restriction enzyme digestion.
  • the recombinant plasmids are linearized by PCR amplification.
  • the method further comprises performing in vitro transcription with the linearized plasmid template.
  • the in vitro transcription is driven by a T7 promoter.
  • the method further comprises purifying the linear RNA transcripts.
  • the linear RNAs are purified by gel purification.
  • the present application provides a method of cyclizing a linear RNA (e.g., purified linear RNA) by ribozyme autocatalysis of the Group I intron.
  • a linear RNA e.g., purified linear RNA
  • the 3′hydroxyl group of a guanosine nucleotide engages in a transesterification reaction at the 5′splice site.
  • the 5′intron half is excised, and the freed hydroxyl group at the end of the intermediate engages in a second transesterification at the 3′splice site, resulting in circularization of the intervening region and excision of the 3′intron.
  • the condition that activates autocatalysis of the Group I intron or 5’ and 3’ catalytic Group I intron fragments is the addition of GTPs and Mg 2+ .
  • the method further comprises treating with RNase R to digest the linear RNA transcripts.
  • the method further comprises isolating the circular dRNA.
  • the step of isolating the circular dRNA comprises gel-purifying the circular dRNA.
  • a circular dRNA can be obtained by circularizing a linear RNA using a ligase such as a RNA ligase.
  • the linear RNA is circularized in vitro.
  • the linear RNA can be circularized by a T4 RNA ligase.
  • the linear RNA comprises a 5’ ligation sequence at the 5’ end of the targeting RNA sequence, and a 3’ ligation sequence at the 3’ end of the targeting RNA sequence, wherein the 5’ ligation sequence and the 3’ ligation sequence can be ligated to each other via the RNA ligase.
  • the linear RNA can be circularized by a ligase such as a T4 DNA ligase (T4 Dnl) , T4 RNA ligase 1 (T4 Rnl1) , and T4 RNA ligase 2 (T4 Rnl2) .
  • the linear RNA may be circularized with or without the presence of a single stranded nucleic acid adaptor, e.g., a splint DNA.
  • a DNA or RNA ligase may be used to enzymatically link a 5’-phosphorylated nucleic acid molecule (e.g., a linear RNA) to the 3’-hydroxyl group of a nucleic acid (e.g., a linear nucleic acid) forming a new phosphodiester linkage .
  • a linear circular RNA is incubated at 37°C for 1 hour with 1-10 units of T4 RNA ligase (New England Biolabs, Ipswich, Mass . ) according to the manufacturer’s protocol.
  • the ligation reaction may occur in the presence of a linear nucleic acid capable of base –pairing with both the 5’-and 3’-region in juxtaposition to assist the enzymatic ligation reaction.
  • the ligation is splint ligation.
  • a splint ligase like ligase, can be used for splint ligation.
  • a single stranded polynucleotide (splint) like a single stranded RNA, can be designed to hybridize with both termini of a linear polyribonucleotide, so that the two termini can be juxtaposed upon hybridization with the single-stranded splint.
  • Splint ligase can thus catalyze the ligation of the juxtaposed two termini of the linear polyribonucleotide, generating a circular polyribonucleotide.
  • a DNA or RNA ligase may be used in the synthesis of a circular dRNA.
  • the ligase may be a circ ligase or circular ligase.
  • RNA editing methods and compositions described herein may be used to treat or prevent a disease or condition in an individual, including, but not limited to hereditary genetic diseases and drug resistance.
  • a method of editing a target RNA (such as a target RNA encoding a mutant Usher 2A protein) in a cell of an individual (e.g., human individual) ex vivo, comprising editing the target RNA using any one of the methods of RNA editing described herein.
  • a method of treating or preventing a disease or condition in an individual comprising editing a target RNA associated with the disease or condition in a cell of the individual using any one of the methods of RNA editing described herein, wherein the dRNA comprises a targeting RNA sequence that hybridizes to a target RNA associated with the disease or condition.
  • the method comprises introducing the dRNA or the construct comprising a nucleic acid encoding the dRNA into an isolated cell of the individual ex vivo.
  • the method comprises comprising administering an effective amount of the dRNA or the construct comprising a nucleic acid encoding the dRNA to the individual.
  • the target RNA is associated with a disease or condition of the individual.
  • the disease or condition is a hereditary genetic disease, or a disease or condition associated with one or more acquired genetic mutations (e.g., drug resistance) .
  • the method further comprises obtaining the cell from the individual.
  • the ADAR is an endogenously expressed ADAR in the isolated cell.
  • the method comprises introducing the ADAR or a construct comprising a nucleic acid encoding the ADAR to the isolated cell.
  • the method comprises introducing the ADAR or a construct comprising a nucleic acid encoding the ADAR to a cell of the individual.
  • the method further comprises culturing the cell having the edited RNA. In some embodiments, the method further comprises administering the cell having the edited RNA to the individual.
  • the disease or condition is a hereditary genetic disease, or a disease or condition associated with one or more acquired genetic mutations (e.g., drug resistance) .
  • Diseases and conditions suitable for treatment using the methods of the present application include diseases associated with a mutation, such as a G to A mutation, e.g., a G to A mutation that results in missense mutation, early stop codon, aberrant splicing, or alternative splicing in an RNA transcript.
  • the disease or condition is a cancer.
  • the disease or condition is hepatocellular carcinoma, lung cancer, pancreatic adenocarcinoma, endometrial carcinoma, esophageal squamous cell carcinoma, or melanoma.
  • the disease or condition is a monogenetic disease.
  • the disease or condition is a polygenetic disease.
  • a method of treating a cancer associated with a target RNA such as a target RNA encoding a mutant Usher 2A protein having a mutation (e.g., G to A mutation) in an individual, comprising editing the target RNA in a cell of the individual using any one of the methods of RNA editing described herein.
  • a method of ameliorating symptoms of Usher syndrome in an individual comprising editing a target RNA associated with Usher syndrome in a cell of the individual according to any one of the methods of editing described herein.
  • a method of ameliorating symptoms of Usher syndrome in an individual comprising editing a target RNA associated with Usher syndrome in a cell of the individual according to use of any one of the dRNAs described herein.
  • the target RNA encoding mutant Usher 2A comprises a G to A mutation with reference to a target RNA that encodes wild-type Usher 2A.
  • the target RNA encoding mutant Usher 2A comprises a 11864G>A mutation with reference to a target RNA that encodes wild-type Usher 2A.
  • the target adenosine is at position 101 with reference to SEQ ID NO: 3.
  • the USH2A gene mutation is NM_206933.2 (USH2A) _c. 11864G>A (p. Trp3955Ter) .
  • the dRNA is introduced into a nerve cell.
  • the nerve cell is a sensory nerve cell.
  • the sensory nerve cell is selected from: an optic nerve cells and an auditory nerve cell.
  • the optic nerve cells are cone cells and/or rod cells.
  • dRNA is introduced into a host cell that is in or adjacent to the vitreous space.
  • dRNA is introduced into a host cell that is in or adjacent the subretinal space.
  • the host cell is in the retinal epithelium.
  • the host cell is a retinal cell.
  • the dRNA is introduced into the subretinal space and/or the vitreous space.
  • the individual suffers from Type I, Type II, Type III, or TYPE IV Usher syndrome. In some embodiments, the individual suffers from Type II Usher syndrome. In some embodiments, the individual is about 10 years old to about 50 years old. In some embodiments, the individual is about any one of: 0 to 10, 10 to 20, 20 to 30, 30 to 40 or 40 to 50 years old. In some embodiments, the individual is about any one of: 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 35, or 40 years old. In some embodiments, the individual has moderate to severe congenital deafness. In some embodiments, the individual has suffered moderate loss of hearing. In some embodiments, the individual has suffered severe loss of hearing.
  • the individual suffers from retinitis pigmentosa. In some embodiments, the individual has mild retinitis pigmentosa. In some embodiments, the individual has moderate retinitis pigmentosa. In some embodiments, the individual has severe retinitis pigmentosa. In some embodiments, the individual exhibits gradual loss of vision. In some embodiments, the individual has not suffered loss of vision. In some embodiments, the individual has suffered mild loss of vision. In some embodiments, the individual has suffered moderate loss of vision. In some embodiments, the individual has suffered severe loss of vision. In some embodiments, the individual exhibits gradual loss of peripheral vision and/or vision in low light. In some embodiments, the individual has not suffered loss of peripheral vision and/or vision in low light.
  • the individual has suffered mild loss of peripheral vision and/or vision in low light. In some embodiments, the individual has suffered moderate loss of peripheral vision and/or vision in low light. In some embodiments, the individual has suffered severe loss of peripheral vision and/or vision in low light. In some embodiments, the individual exhibits gradual loss of cone cells and/or rod cells. In some embodiments, the individual has not suffered loss of cone cells and/or rod cells. In some embodiments, the individual has suffered mild loss of cone cells and/or rod cells. In some embodiments, the individual has suffered moderate loss of cone cells and/or rod cells. In some embodiments, the individual has suffered severe loss of cone cells and/or rod cells.
  • a method of ameliorating symptoms of Usher syndrome in an individual comprising editing a target RNA associated with Usher syndrome in a cell of the individual comprising the use of a dRNA, wherein the dRNA is encoded in a construct comprising any one of the sequences set forth in SEQ ID NOs: 15-293, 317-354.
  • a method of ameliorating symptoms of Usher syndrome in an individual comprising editing a target RNA associated with Usher syndrome in a cell of the individual comprising the use of a dRNA, wherein the dRNA is encoded in a construct comprising a variant of any one of sequences in Table A (any one of SEQ ID NOs: 15-293) or Table B (any one of SEQ ID NOs: 317-354) , wherein the variant differs from the parent sequence by no more than any one of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides.
  • a method of ameliorating symptoms of Usher syndrome in an individual comprising editing a target RNA associated with Usher syndrome in a cell of the individual comprising the use of a dRNA, wherein the dRNA comprises nucleotides encoded by any one of the Circularized Sequences in Table A (non-underlined sequence in any one of SEQ ID NOs: 15-293) or Table B (SEQ ID NOs: 317-354) .
  • a method of ameliorating symptoms of Usher syndrome in an individual comprising editing a target RNA associated with Usher syndrome in a cell of the individual comprising the use of a dRNA, wherein the dRNA comprises nucleotides encoded by a variant of any one of the Circularized Sequences in Table A (non-underlined sequence in any one of SEQ ID NO: 15-293) or Table B (SEQ ID NOs: 317-354) , wherein the variant differs from the non-underlined sequence by no more than any one of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides.
  • the dRNA is linear.
  • the dRNA is circular, or capable of being circularized.
  • a method of ameliorating symptoms of Usher syndrome in an individual comprising editing a target RNA associated with Usher syndrome in a cell of the individual comprising the use of a dRNA with a targeting RNA that is encoded by any one of the Targeting Sequences in Table A (sequence in small capital letters in any one of SEQ ID NOs: 15-293) or Table B (SEQ ID NOs: 317-354) .
  • a method of ameliorating symptoms of Usher syndrome in an individual comprising editing a target RNA associated with Usher syndrome in a cell of the individual comprising the use of a dRNA with a targeting RNA sequence that is encoded by a variant of any one of the Targeting Sequences in Table A (sequence in small capital letters in any one of SEQ ID NOs: 15-293) or Table B (SEQ ID NOs: 317-354) , wherein the variant differs from the parent sequence by no more than any one of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides.
  • a method of ameliorating symptoms of Usher syndrome in an individual comprising introducing into a cell of the individual a dRNA, wherein the dRNA comprises nucleotides encoded by a variant of any one of the Circularized Sequences in Table A (non-underlined sequence in any one of SEQ ID NO: 15-293) or Table B (SEQ ID NOs: 317-354) .
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of hearing as compared to a corresponding individual not introduced with the dRNA nor the construct.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a loss of hearing that is reduced by at least 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, or 1000-fold as compared to a corresponding individual not introduced with the dRNA nor the construct.
  • the individual introduced with the dRNA or the construct encoding the dRNA does not exhibit further loss of hearing.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of hearing as compared to a corresponding individual introduced with a corresponding dRNA or a construct encoding a corresponding dRNA that does not comprise the one or more mismatch regions and/or the one or more linker nucleic acid sequences.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a loss of hearing that is reduced by at least 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, or 1000-fold as compared to a corresponding individual introduced with a corresponding dRNA or a construct encoding a corresponding dRNA that does not comprise the one or more mismatch regions and/or the one or more linker nucleic acid sequences.
  • hearing and loss of hearing is determined by an audiology evaluation, such as but not limited to auditory brainstem response and/or otoacoustic emissions.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of vision as compared to a corresponding individual not introduced with the dRNA nor the construct.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a loss of vision that is reduced by at least 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, or 1000-fold as compared to a corresponding individual not introduced with the dRNA nor the construct.
  • the individual introduced with the dRNA or the construct encoding the dRNA does not exhibit further loss of vision.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of vision as compared to a corresponding individual introduced with a corresponding dRNA or a construct encoding a corresponding dRNA that does not comprise the one or more mismatch regions and/or the one or more linker nucleic acid sequences.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a loss of vision that is reduced by at least 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, or 1000-fold as compared to a corresponding individual introduced with a corresponding dRNA or a construct encoding a corresponding dRNA that does not comprise the one or more mismatch regions and/or the one or more linker nucleic acid sequences.
  • the vision comprises vision in low light.
  • the vision comprises peripheral vision.
  • vision and loss of vision is determined by an optometry evaluation, such as but not limited to vision field test.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of retinal cells as compared to a corresponding individual not introduced with the dRNA nor the construct.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a loss of retinal cells that is reduced by at least 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, or 1000-fold as compared to a corresponding individual not introduced with the dRNA nor the construct.
  • the individual introduced with the dRNA or the construct encoding the dRNA does not exhibit further loss of retinal cells.
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a loss of retinal cells that is reduced by at least 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, or 1000-fold as compared to a corresponding individual introduced with a corresponding dRNA or a construct encoding a corresponding dRNA that does not comprise the one or more mismatch regions and/or the one or more linker nucleic acid sequences.
  • the retinal cells comprise rod cells and/or cone cells.
  • the vision comprises peripheral rod cells and/or cone cells.
  • dosages, schedules, and routes of administration of the compositions may be determined according to the size and condition of the individual, and according to standard pharmaceutical practice.
  • routes of administration include intravenous, intra-arterial, intraperitoneal, intrapulmonary, intravesicular, intramuscular, intra-tracheal, subcutaneous, intraocular, intrathecal, intratumoral, intraocular, or transdermal.
  • desirable effects of treatment include, without limitation, decreasing the rate of disease progression, ameliorating or palliating the disease state, and remission or improved prognosis.
  • an individual is successfully “treated” if one or more symptoms associated with cancer are mitigated or eliminated, including, but are not limited to, reducing the proliferation of (or destroying) cancerous cells, increasing cancer cell-killing, decreasing symptoms resulting from the disease, preventing spread of diseases, preventing recurrence of disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the disease, delaying the progression of the disease, and/or prolonging survival of individuals.
  • RNA editing methods of the present application not only can be used in animal cells, for example mammalian cells, but also may be used in modification of RNAs of plant or fungi, for example, in plants or fungi that have endogenously expressed ADARs.
  • the methods described herein can be used to generate genetically engineered plant and fungi with improved properties.
  • compositions comprising any one of the dRNAs, constructs, libraries, or host cells having edited RNA as described herein.
  • a pharmaceutical composition comprising any one of the dRNAs or constructs encoding the dRNA described herein, and a pharmaceutically acceptable carriers, excipients or stabilizers (Remington’s Pharmaceutical Sciences 16 th edition, Osol, A. Ed. (1980) ) .
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol) ; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as olyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, his
  • compositions to be used for in vivo administration must be sterile. This is readily accomplished by, e.g., filtration through sterile filtration membranes.
  • kits useful for any one of the methods of RNA editing or methods of treatment described herein comprising any one of the dRNAs, constructs, compositions, libraries, or edited host cells as described herein.
  • a kit for editing a target RNA (such as a target RNA encoding a mutant Usher 2A protein) in a host cell, comprising a dRNA or a construct comprising a nucleic acid encoding the dRNA, wherein the dRNA comprises a targeting RNA sequence that hybridizes to a target RNA associated with the disease or condition to form a RNA duplex, wherein the duplex RNA comprises one or more mismatch regions, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA.
  • the dRNA is circular.
  • the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence.
  • a kit for editing a target RNA (such as a target RNA encoding a mutant Usher 2A protein) in a host cell, comprising a dRNA or a construct comprising a nucleic acid encoding the dRNA, wherein the dRNA comprises a targeting RNA sequence that hybridizes to a target RNA associated with the disease or condition to form a RNA duplex, wherein the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not substantially form any secondary structure with any part of the dRNA, wherein the RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA, , and wherein the dRNA is a circular RNA or a linear RNA capable of forming a circular RNA.
  • ADAR adenosine deaminase acting on
  • the kit further comprises an ADAR or a construct comprising a nucleic acid encoding an ADAR. In some embodiments, the kit further comprises an inhibitor of ADAR3 or a construct thereof. In some embodiments, the kit further comprises a stimulator of interferon or a construct thereof. In some embodiments, the kit further comprises an instruction for carrying out any one of the RNA editing methods or methods of treatment described herein.
  • kits of the present application are in suitable packaging.
  • suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags) , and the like. Kits may optionally provide additional components such as transfection or transduction reagents, cell culturing medium, buffers, and interpretative information.
  • the present application thus also provides articles of manufacture.
  • the article of manufacture can comprise a container and a label or package insert on or associated with the container.
  • Suitable containers include vials (such as sealed vials) , bottles, jars, flexible packaging, and the like.
  • the container holds a pharmaceutical composition, and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle) .
  • the container holding the pharmaceutical composition may be a multi-use vial, which allows for repeat administrations (e.g. from 2-6 administrations) of the reconstituted formulation.
  • Package insert refers to instructions customarily included in commercial packages of therapeutic products that contain information about the indications, usage, dosage, administration, contraindications and/or warnings concerning the use of such products.
  • the article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI) , phosphate-buffered saline, Ringer’s solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
  • BWFI bacteriostatic water for injection
  • kits or article of manufacture may include multiple unit doses of the pharmaceutical compositions and instructions for use, packaged in quantities sufficient for storage and use in pharmacies, for example, hospital pharmacies and compounding pharmacies.
  • Embodiment 1 A method for editing a target adenosine in a target RNA encoding a mutant Usher 2A protein in a host cell, comprising introducing a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid encoding the dRNA into the host cell,
  • dRNA deaminase-recruiting RNA
  • the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form an RNA duplex
  • RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA,
  • ADAR adenosine deaminase acting on RNA
  • RNA duplex comprises:
  • the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not hybridize with the target RNA and does not substantially form a secondary structure.
  • Embodiment 2 The method according to any one of the preceding embodiments, wherein:
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 5 nt to 25 nt upstream of the target adenosine; and/or the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 20 nt to 45 nt downstream of the target adenosine; or
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 5 nt to 15 nt upstream of the target adenosine; and/or the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 20 nt to 45 nt downstream of the target adenosine; or
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 20 nt to 40 nt upstream of the target adenosine; and/or the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 25 nt to 45 nt downstream of the target adenosine.
  • Embodiment 3 The method according to any one of the preceding embodiments, wherein the first mismatch region and/or the second mismatch region comprise:
  • Embodiment 4 The method according to any one of the preceding embodiments, wherein the first mismatch region and/or the second mismatch region comprise:
  • Embodiment 5 The method according to any one of the preceding embodiments, wherein:
  • the first mismatch region is 1-50 nt in length, optionally wherein the first mismatch region is 4 nt in length;
  • the second mismatch region is 1-50 nt in length, optionally wherein the second mismatch region is 4 nt in length.
  • Embodiment 6 The method according to any one of the preceding embodiments, wherein:
  • the first mismatch region is 1-10 nt in length, wherein the first mismatch region comprises 1-10 consecutive non-complementary nucleotides in the targeting RNA sequence or deletion of 1-10 consecutive nucleotides from the targeting RNA sequence;
  • the second mismatch region is 1-10 nt in length, wherein the second mismatch region comprises 1-10 consecutive non-complementary nucleotides in the targeting RNA sequence or deletion of 1-10 consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 7 The method according to any one of the preceding embodiments, wherein:
  • the first mismatch region is 4 nt in length, wherein the first mismatch region comprises 4 consecutive non-complementary nucleotides in the targeting RNA sequence or deletion of 4 consecutive nucleotides from the targeting RNA sequence;
  • the second mismatch region is 4 nt in length, wherein the second mismatch region comprises 4 consecutive non-complementary nucleotides in the targeting RNA sequence or deletion of 4 consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 8 The method according to any one of the preceding embodiments, wherein:
  • Embodiment 9 The method according to any one of the preceding embodiments, wherein:
  • deletion of a group of consecutive nucleotides in the targeting RNA sequence results in a bulge in the RNA duplex
  • Embodiment 10 The method according to any one of the preceding embodiments, wherein the mutant Usher 2A protein comprises a missense mutation, a nonsense mutation, and/or a frameshift mutation.
  • Embodiment 11 The method according to any one of the preceding embodiments, wherein the mutant Usher 2A protein comprising a Trp3955Ter mutation.
  • Embodiment 12 The method according to any one of the preceding embodiments, where the target RNA encoding the mutant Usher 2A comprises a G to A mutation with reference to a target RNA that encodes a wild-type Usher 2A.
  • Embodiment 13 The method according to any one of the preceding embodiments, wherein the target RNA encoding the mutant Usher 2A comprises a 11864G>A mutation with reference to a target RNA that encodes a wild-type Usher 2A.
  • Embodiment 14 The method of any one of claims 1-13, wherein the RNA duplex further comprises a third mismatch region relative to the target RNA, wherein the third mismatch region is located between the first mismatch region and the second mismatch region relative to the target RNA.
  • Embodiment 15 The method according to any one of the preceding embodiments, wherein the third mismatch region comprises one or two non-complementary nucleotides in the targeting RNA sequence and/or deletion of one or two nucleotides from the targeting RNA sequence.
  • Embodiment 16 The method according to any one of the preceding embodiments, wherein the third mismatch region relative to the target RNA sequence is at 7 nt and/or 8 nt downstream of the target adenosine; optionally wherein the target RNA comprises adenosine at the 7th and/or the 8th nucleotide downstream of the target adenosine.
  • Embodiment 17 The method according to any one of the preceding embodiments, wherein the target RNA comprises the sequence of “AA” at 7 and 8 nucleotides downstream of the target adenosine, wherein
  • the targeting RNA sequence comprises any one of: A, AA, U, C, CC, G, GG, or an absence of nucleotides ( “X” ) opposite to the target RNA at 7 and 8 nucleotides downstream of the target adenosine.
  • Embodiment 18 The method according to any one of the preceding embodiments, wherein the RNA duplex comprises:
  • Embodiment 19 The method according to any one of the preceding embodiments, wherein:
  • the second mismatch region relative to the target RNA sequence is at 36 nt to 39 nt downstream of the target adenosine;
  • first mismatch region is 4 nt in length and the second mismatch region is 4 nt in length;
  • first mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence and wherein the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 20 The method according to any one of the preceding embodiments, wherein:
  • the second mismatch region relative to the target RNA sequence is at 40 nt to 43 nt downstream of the target adenosine;
  • first mismatch region is 4 nt in length and the second mismatch region is 4 nt in length;
  • first mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence and wherein the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 21 The method according to any one of the preceding embodiments, wherein the RNA duplex comprises:
  • first mismatch region is 10 nt in length and the second mismatch region is 4 nt in length;
  • first mismatch region comprises a deletion of ten consecutive nucleotides from the targeting RNA sequence and wherein the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 22 The method according to any one of the preceding embodiments, wherein the RNA duplex comprises:
  • first mismatch region is 10 nt in length and the second mismatch region is 4 nt in length;
  • first mismatch region comprises a deletion of ten consecutive nucleotides from the targeting RNA sequence and wherein the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 23 The method according to any one of the preceding embodiments, wherein the dRNA is:
  • Embodiment 24 The method according to any one of the preceding embodiments, wherein the dRNA further comprises one or more RNA recruiting domains, optionally wherein the RNA recruiting domain is a stem-loop structure.
  • Embodiment 25 The method according to any one of the preceding embodiments, wherein the linker nucleic acid sequence is about 5 nt to about 500 nt in length.
  • Embodiment 26 The method according to any one of the preceding embodiments, wherein the linker nucleic acid sequence is less than or equal to 70nt in length, optionally wherein the length of the linker nucleic acid sequence is any integer between 10nt-50nt, 10nt-40nt, 10nt-30nt, 10nt-20nt, 20nt-50nt, 20nt-40nt, 20nt-30nt, 30nt-50nt, 30nt-40nt, or 40nt-50nt.
  • Embodiment 27 The method according to any one of the preceding embodiments, wherein the linker nucleic acid sequence is about 20 nt to about 60 nt in length; optionally wherein the linker nucleic acid sequence is about 30nt in length, or about 50nt in length.
  • Embodiment 28 The method according to any one of the preceding embodiments, wherein at least about any one of: 50%, 60%, 70%, 80%, 85%, 90%, or 95%of the linker nucleic acid sequence comprises adenosine or cytidine; optionally wherein 100%of the linker nucleic acid sequence comprises adenosine or cytidine.
  • Embodiment 29 The method according to any one of the preceding embodiments, wherein at least about 50%of the linker nucleic acid sequence comprises adenosine.
  • Embodiment 30 The method according to any one of the preceding embodiments, wherein the method has increased level of editing of the target adenosine as compared to a corresponding method wherein the RNA duplex does not comprise the one or more mismatch regions or wherein the dRNA does not comprise the linker nucleic acid sequence.
  • Embodiment 31 The method according to any one of the preceding embodiments, wherein the method has reduced level of (bystander) editing of one or more non-target adenosines as compared to a corresponding method wherein the RNA duplex does not comprise the one or more mismatch regions or wherein the dRNA does not comprise the linker nucleic acid sequence.
  • Embodiment 32 The method according to any one of the preceding embodiments, wherein the non-target adenosine is within the one or more mismatch regions.
  • Embodiment 33 The method according to any one of the preceding embodiments, wherein the non-target adenosine is outside of the mismatch regions.
  • Embodiment 34 The method according to any one of the preceding embodiments, wherein the dRNA comprises a first linker nucleic acid sequence flanking the 5’ end of the targeting RNA sequence and a second linker nucleic acid sequence flanking the 3’ end of the targeting RNA sequence.
  • Embodiment 35 The method according to any one of the preceding embodiments, wherein the first linker nucleic acid sequence is identical to the second linker nucleic acid sequence.
  • Embodiment 36 The method according to any one of the preceding embodiments, wherein the first linker nucleic acid sequence is different from the second linker nucleic acid sequence.
  • Embodiment 37 The method according to any one of the preceding embodiments, wherein the dRNA is a circular RNA, and wherein the one or more linker nucleic acid sequences connect the 5’ end of the targeting RNA sequence and the 3’ end of the targeting RNA sequence.
  • Embodiment 38 The method according to any one of the preceding embodiments, wherein the dRNA is a circular RNA, wherein the dRNA further comprises a 3’ exon sequence recognizable by a 3’ catalytic Group I intron fragment flanking the 5’ end of the targeting RNA sequence, and a 5’ exon sequence recognizable by a 5’ catalytic Group I intron fragment flanking the 3’ end of the targeting RNA sequence.
  • Embodiment 39 The method according to any one of the preceding embodiments, wherein the dRNA further comprises a 3’ ligation sequence and a 5’ ligation sequence.
  • Embodiment 40 The method according to any one of the preceding embodiments, wherein the 3’ ligation sequence and the 5’ ligation sequence are at least partially complementary to each other.
  • Embodiment 41 The method according to any one of the preceding embodiments, wherein the 3’ ligation sequence and the 5’ ligation sequence are about 20 nt to about 75 nt in length.
  • Embodiment 42 The method according to any one of the preceding embodiments, wherein the dRNA is circularized by RNA ligase RtcB.
  • Embodiment 43 The method according to any one of the preceding embodiments, wherein the dRNA is circularized by T4 RNA ligase 1 (Rnl1) or RNA ligase 2 (Rnl2) .
  • Embodiment 44 The method according to any one of the preceding embodiments, wherein the method comprises introducing a construct comprising a nucleic acid sequence encoding the dRNA into the host cell.
  • Embodiment 45 The method according to any one of the preceding embodiments, wherein the construct further comprises a promoter operably linked to the nucleic acid sequence encoding the dRNA.
  • Embodiment 46 The method according to any one of the preceding embodiments, wherein the promoter is a polymerase II promoter ( “Pol III promoter” ) .
  • Embodiment 47 The method according to any one of the preceding embodiments, wherein the promoter is a polymerase III promoter ( “Pol III promoter” ) .
  • Embodiment 48 The method according to any one of the preceding embodiments, wherein the construct is a viral vector or a plasmid.
  • Embodiment 49 The method according to any one of the preceding embodiments, wherein the construct is an adeno-associated viral (AAV) vector.
  • AAV adeno-associated viral
  • Embodiment 50 The method according to any one of the preceding embodiments, wherein the construct is a self-complementary AAV (scAAV) vector.
  • scAAV self-complementary AAV
  • Embodiment 51 The method according to any one of the preceding embodiments, wherein the ADAR is endogenously expressed by the host cell.
  • Embodiment 52 The method according to any one of the preceding embodiments, wherein the host cell is a retinal cell.
  • Embodiment 53 The method according to any one of the preceding embodiments, wherein the targeting RNA sequence is more than 50 nt long.
  • Embodiment 54 The method according to any one of the preceding embodiments, wherein the targeting RNA sequence is about 100 to about 200 nt long.
  • Embodiment 55 The method according to any one of the preceding embodiments, wherein the targeting RNA sequence comprises a cytidine, an adenosine, or an uridine directly opposite the target adenosine in the target RNA.
  • Embodiment 56 The method according to any one of the preceding embodiments, wherein the targeting RNA sequence comprises a cytidine mismatch directly opposite the target adenosine in the target RNA.
  • Embodiment 57 The method according to any one of the preceding embodiments, wherein the cytidine mismatch is located at least 20 nt away from the 3’ end of the targeting RNA sequence, and at least 5 nt away from the 5’ end of the targeting RNA sequence.
  • Embodiment 58 The method according to any one of the preceding embodiments, wherein the 5’ nearest neighbor of the target adenosine in the target RNA is a nucleotide selected from U, C, A, and G with the preference U>C ⁇ A>G, and the 3’ nearest neighbor of the target adenosine in the target RNA is a nucleotide selected from G, C, A, and U with the preference G>C>A ⁇ U.
  • Embodiment 59 The method according to any one of the preceding embodiments, wherein the target adenosine is in a three-base motif of UAG, and wherein the targeting RNA sequence comprises an A directly opposite the uridine in the three-base motif, a cytidine directly opposite the target adenosine, and a cytidine, guanosine, or uridine directly opposite the guanosine in the three-base motif.
  • Embodiment 60 The method according to any one of the preceding embodiments, wherein the target RNA is an RNA selected from the group consisting of a pre-messenger RNA, a messenger RNA, a ribosomal RNA, a transfer RNA, a long non-coding RNA, and a small RNA, optionally wherein the target RNA is a pre-messenger RNA.
  • the target RNA is an RNA selected from the group consisting of a pre-messenger RNA, a messenger RNA, a ribosomal RNA, a transfer RNA, a long non-coding RNA, and a small RNA, optionally wherein the target RNA is a pre-messenger RNA.
  • Embodiment 61 The method according to any one of the preceding embodiments, further comprising introducing an inhibitor of ADAR3 and/or a stimulator of interferon into the host cell.
  • Embodiment 62 The method according to any one of the preceding embodiments, comprising introducing into the host cell a plurality of dRNAs or constructs encoding the dRNAs each targeting a different target RNA.
  • Embodiment 63 The method according to any one of the preceding embodiments, wherein the efficiency of editing the target adenosine in the target RNA is at least about 40%.
  • Embodiment 64 The method according to any one of the preceding embodiments, further comprising introducing an ADAR into the host cell.
  • Embodiment 65 The method according to any one of the preceding embodiments, wherein deamination of the target adenosine in the target RNA results in a missense mutation, an early stop codon, aberrant splicing, or alternative splicing in the target RNA, or reversal of a missense mutation, an early stop codon, aberrant splicing, or alternative splicing in the target RNA.
  • Embodiment 66 The method according to any one of the preceding embodiments, wherein deamination of the target adenosine in the target RNA results in point mutation, truncation, elongation, and/or misfolding of the protein encoded by the target RNA, or a functional, full-length, correctly-folded, and/or wild-type protein by reversal of a missense mutation, an early stop codon, aberrant splicing, or alternative splicing in the target RNA.
  • Embodiment 67 The method according to any one of the preceding embodiments, wherein the host cell is an eukaryotic cell, optionally wherein the host cell is a mammalian cell.
  • Embodiment 68 The method according to any one of the preceding embodiments, wherein the host cell is a human cell or a mouse cell.
  • Embodiment 69 An edited RNA or a host cell having an edited RNA produced by the method according to any one of the preceding embodiments.
  • Embodiment 70 A method for treating or preventing a disease or condition in an individual, comprising editing a target RNA associated with the disease or condition in a cell of the individual according to the method according to any one of the preceding embodiments.
  • Embodiment 71 The method according to any one of the preceding embodiments, wherein the disease or condition is a hereditary genetic disease or a disease or condition associated with one or more acquired genetic mutations.
  • Embodiment 72 The method according to any one of the preceding embodiments, wherein the disease or condition is a monogenetic or a polygenetic disease or condition.
  • Embodiment 73 A method for ameliorating one or more symptoms of Usher syndrome in an individual, comprising editing a target RNA associated with Usher syndrome in a cell of the individual according to the method according to any one of the preceding embodiments.
  • Embodiment 74 The method according to any one of the preceding embodiments, wherein the target RNA has a G to A mutation.
  • Embodiment 75 The method according to any one of the preceding embodiments, wherein the individual has TYPE II Usher syndrome.
  • Embodiment 76 The method according to any one of the preceding embodiments, wherein the individual has no loss of vision, or wherein the individual has mild to moderate loss of vision.
  • Embodiment 77 The method according to any one of the preceding embodiments, wherein the host cell is a retinal cell, optionally wherein the host cell is a rod cell and/or a cone cell.
  • Embodiment 78 The method according to any one of the preceding embodiments, wherein the dRNA or the construct encoding the dRNA is introduced into the subretinal space and/or the vitreous space.
  • Embodiment 79 The method according to any one of the preceding embodiments, wherein:
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of vision as compared to a corresponding individual not introduced with the dRNA nor the construct encoding the dRNA;
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of vision as compared to a corresponding individual introduced with a corresponding dRNA or a construct encoding a corresponding dRNA that does not comprise the one or more mismatch regions and/or the one or more linker nucleic acid sequences.
  • Embodiment 80 The method according to any one of the preceding embodiments, wherein:
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of retinal cells as compared to a corresponding individual not introduced with the dRNA nor the construct encoding the dRNA;
  • an individual introduced with the dRNA or the construct encoding the dRNA exhibits a decreased loss of retinal cells as compared to a corresponding individual introduced with a corresponding dRNA or a construct encoding a corresponding dRNA that does not comprise the one or more mismatch regions and/or the one or more linker nucleic acid sequences.
  • Embodiment 81 A dRNA for editing a target RNA encoding a mutant Usher 2A protein and comprising a target adenosine, wherein the dRNA comprises a targeting RNA sequence that is capable of hybridizing to the target RNA to form an RNA duplex,
  • RNA duplex is capable of recruiting an adenosine deaminase acting on RNA (ADAR) to deaminate the target adenosine in the target RNA,
  • ADAR adenosine deaminase acting on RNA
  • RNA duplex comprises:
  • the dRNA comprises a linker nucleic acid sequence flanking an end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not hybridize with the target RNA and does not substantially form a secondary structure.
  • Embodiment 82 The dRNA according to any one of the preceding embodiments, wherein:
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 5 nt to 25 nt upstream of the target adenosine; and/or the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 20 nt to 45 nt downstream of the target adenosine; or
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 5 nt to 15 nt upstream of the target adenosine; and/or the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 20 nt to 45 nt downstream of the target adenosine; or
  • the RNA duplex comprises the first mismatch region relative to the target RNA sequence at 20 nucleotides to 40 nt upstream of the target adenosine; and/or the RNA duplex comprises the second mismatch region relative to the target RNA sequence at 25 nt to 45 nt downstream of the target adenosine.
  • Embodiment 83 The dRNA according to any one of the preceding embodiments, wherein
  • the first mismatch region and/or the second mismatch region comprise:
  • Embodiment 84 The dRNA according to any one of the preceding embodiments, wherein
  • the first mismatch region and/or the second mismatch region comprise:
  • Embodiment 85 The dRNA according to any one of the preceding embodiments, wherein:
  • the first mismatch region is 1-50 nt in length, optionally wherein the first mismatch region is 4 nt in length;
  • the second mismatch region is 1-50 nt in length, optionally wherein the second mismatch region is 4 nt in length.
  • Embodiment 86 The dRNA according to any one of the preceding embodiments, wherein:
  • the first mismatch region is 1-10 nt in length, wherein the first mismatch region comprises 1-10 consecutive non-complementary nucleotides in the targeting RNA sequence or deletion of 1-10 consecutive nucleotides from the targeting RNA sequence;
  • the second mismatch region is 1-10 any one of claims 81-84 in length, wherein the second mismatch region comprises 1-10 consecutive non-complementary nucleotides in the targeting RNA sequence or deletion of 1-10 consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 87 The dRNA according to any one of the preceding embodiments, wherein:
  • the first mismatch region is 4 nt in length, wherein the mismatch region comprises 4 consecutive non-complementary nucleotides in the targeting RNA sequence or deletion of 4 consecutive nucleotides from the targeting RNA sequence;
  • the second mismatch region is 4 nt in length, wherein the mismatch region comprises 4 consecutive non-complementary nucleotides in the targeting RNA sequence or deletion of 4 consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 88 The dRNA according to any one of the preceding embodiments, wherein:
  • Embodiment 89 The dRNA according to any one of the preceding embodiments, wherein:
  • deletion of a group of consecutive nucleotides in the targeting RNA sequence results in a bulge in the RNA duplex
  • Embodiment 90 The dRNA according to any one of the preceding embodiments, wherein the mutant Usher 2A protein comprises a missense mutation, a nonsense mutation, and/or a frameshift mutation.
  • Embodiment 91 The dRNA according to any one of the preceding embodiments, wherein the mutant Usher 2A protein comprises a Trp3955Ter mutation.
  • Embodiment 92 The dRNA according to any one of the preceding embodiments, where the target RNA encoding the mutant Usher 2A comprises a G to A mutation with reference to a target RNA that encodes a wild-type Usher 2A.
  • Embodiment 93 The dRNA according to any one of the preceding embodiments, wherein the target RNA encoding the mutant Usher 2A comprises a 11864G>A mutation with reference to a target RNA that encodes a wild-type Usher 2A.
  • Embodiment 94 The dRNA according to any one of the preceding embodiments, wherein the RNA duplex further comprises a third mismatch region relative to the target RNA, wherein the third mismatch region is located between the first mismatch region and the second mismatch region relative to the target RNA.
  • Embodiment 95 The dRNA according to any one of the preceding embodiments, wherein the third mismatch region comprises one or two non-complementary nucleotides in the targeting RNA sequence and/or deletion of one or both nucleotides from the targeting RNA sequence sequence.
  • Embodiment 96 The dRNA according to any one of the preceding embodiments, wherein the third mismatch region relative to the target RNA sequence is at 7 nt and/or 8 nt downstream of the target adenosine; optionally wherein the target RNA comprises adenosine at the 7th and/or the 8th nucleotide downstream of the target adenosine.
  • Embodiment 97 The dRNA according to any one of the preceding embodiments, wherein the target RNA comprises the sequence of “AA” at 7 and 8 nucleotides downstream of the target adenosine, wherein
  • the targeting RNA sequence comprises any one of: A, AA, U, C, CC, G, GG, or an absence of nucleotides ( “X” ) opposite to the target RNA at 7 and 8 nucleotides downstream of the target adenosine.
  • Embodiment 98 The dRNA according to any one of the preceding embodiments, wherein the RNA duplex comprises:
  • Embodiment 99 The dRNA according to any one of the preceding embodiments, wherein:
  • the second mismatch region relative to the target RNA sequence is at 36 nt to 39 nt downstream of the target adenosine;
  • first mismatch region is 4 nt in length and the second mismatch region is 4 nt in length;
  • first mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence and wherein the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 100 The dRNA according to any one of the preceding embodiments, wherein:
  • the second mismatch region relative to the target RNA sequence is at 40 nt to 43 nt downstream of the target adenosine;
  • first mismatch region is 4 nt in length and the second mismatch region is 4 nt in length;
  • first mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence and wherein the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 101 The dRNA according to any one of the preceding embodiments, wherein the RNA duplex comprises:
  • first mismatch region is 10 nt in length and the second mismatch region is 4 nt in length;
  • first mismatch region comprises a deletion of ten consecutive nucleotides from the targeting RNA sequence and wherein the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 102 The dRNA according to any one of the preceding embodiments, wherein the RNA duplex comprises:
  • first mismatch region is 10 nt in length and the second mismatch region is 4 nt in length;
  • first mismatch region comprises a deletion of ten consecutive nucleotides from the targeting RNA sequence and wherein the second mismatch region comprises a deletion of four consecutive nucleotides from the targeting RNA sequence.
  • Embodiment 103 The dRNA according to any one of the preceding embodiments, wherein the dRNA is:
  • Embodiment 104 The dRNA according to any one of the preceding embodiments, wherein the dRNA further comprises one or more RNA recruiting domains, optionally wherein the RNA recruiting domain is a stem-loop structure.
  • Embodiment 105 The dRNA according to any one of the preceding embodiments, wherein the linker nucleic acid sequence is about 5 nt to about 500 nt in length.
  • Embodiment 106 The dRNA according to any one of the preceding embodiments, wherein the linker nucleic acid sequence is less than or equal to 70nt in length, optionally wherein the length of the linker nucleic acid sequence is any integer between 10nt-50nt, 10nt-40nt, 10nt-30nt, 10nt-20nt, 20nt-50nt, 20nt-40nt, 20nt-30nt, 30nt-50nt, 30nt-40nt, or 40nt-50nt.
  • Embodiment 107 The dRNA according to any one of the preceding embodiments, wherein the linker nucleic acid sequence is about 20 nt to about 60 nt in length; optionally wherein the linker nucleic acid sequence is about 30nt in length, or about 50nt in length.
  • Embodiment 108 The dRNA according to any one of the preceding embodiments, wherein at least about any one of: 50%, 60%, 70%, 80%, 85%, 90%, or 95%of the linker nucleic acid sequence comprises adenosine or cytidine; optionally wherein 100%of the linker nucleic acid sequence comprises adenosine or cytidine.
  • Embodiment 109 The dRNA according to any one of the preceding embodiments, wherein at least about 50%of the linker nucleic acid sequence comprises adenosine.
  • Embodiment 110 A construct comprising a nucleic acid sequence encoding the dRNA according to any one of the preceding embodiments.
  • Embodiment 111 The construct according to any one of the preceding embodiments, wherein the construct further comprises a promoter operably linked to the nucleic acid sequence encoding the dRNA, wherein the promoter is a Pol III promoter.
  • Embodiment 112. A host cell comprising the dRNA according to any one of the preceding embodiments or the construct according to any one of the preceding embodiments.
  • Embodiment 113 A kit comprising the dRNA according to any one of the preceding embodiments or the construct according to any one of the preceding embodiments, and an instruction for editing a target RNA encoding a mutant Usher 2A protein comprising a target adenosine in a host cell.
  • a cloning vector based on the PackGene vector that included the Twister P3 U2A, 5’ ligation sequence, 3’ligation sequence and Twister P148. (See Table A) . Then the sequences of arRNAs were synthesized and golden gate cloned into the autocatalytic circular RNA expression vector.
  • the arRNA sequences were flanked with spacer and/or linker sequences and then golden-gate cloned into the genetic encoded circ-arRNA-expressing vector.
  • nucleotide opposite select potential off-target adenosines were deleted and then cloned into the genetic encoded circ-arRNA-expressing vector.
  • DNA sequences ( NNNNNNNNNN ) as indicated in Table A were first synthesized in vitro and incorporated into a vector, and subsequently subjected to MiuI and KpnI digestion and then ligated to a plasmid backbone as indicated by SEQ ID NO: 2.
  • circRNAs The production of circRNAs is according to methods described in Abe, N. et al. “Preparation of Circular RNA In Vitro, ” Circular RNAs. Humana Press, New York, NY, 2018. 181-192; and Chen, H. et al. “Preferential production of RNA rings by T4 RNA ligase 2 without any splint through rational design of precursor strand, ” Nucleic Acids Research 48, e54–e54 (2020) . Briefly, circRNA precursors were synthesized via in vitro transcriptions (IVT) from the linearized circRNA plasmid templates with HISCRIBE TM T7 High Yield RNA Synthesis Kit (New England Biolabs, #E2040S) .
  • IVTT in vitro transcriptions
  • T4 Rnl cyclization T4 Rnl 1 (New England Biolabs, #M0239L) or T4 Rnl 2 (New England Biolabs, #M0204L) was added in the linear circRNA precursors and incubated at 37°C overnight after DNase I digestion.
  • group1 autocatalysis cyclization GTP was added into the reaction at a final concentration of 2 mM after DNase I digestion, and then reactions were incubated at 55°C for 15 min to catalyze cyclization of circRNAs.
  • cyclized circ-arRNA was column purified with Monarch RNA Cleanup Kit (New England Biolabs, #T2040L) . Then, column-purified RNA was heated at 65°C for 3 min and cooled on ice. Reactions were treated with RNase R (Epicenter, #RNR07250) at 37°C for 15 min to enrich circRNAs. The RNase R-treated RNA was column purified.
  • circ-arRNA was resolved using high-performance liquid chromatography (Agilent HPLC1260) 4.6 ⁇ 300 mm size-exclusion column with particle size of 5 ⁇ m and pore size of (Sepax Technologies, #215980P-4630) in RNase-free TE buffer.
  • the circ-arRNA enrich fractions were collected and then column purified (New England Biolabs, #T2040L) .
  • circ-arRNA were heated at 65°C for 3 min, cooled down on ice, and subsequently treated with the quick CIP phosphatase (New England Biolabs, #M0525S) .
  • circ-arRNA were column purified and concentrated with RNA Clean &Concentrator Kit (ZYMO, #R1018) .
  • the dual fluorescence reporter was cloned by PCR amplifying mCherry and EGFP (the EGFP first codon ATG was deleted) coding DNA, and the 3 ⁇ GS linker and targeting DNA sequence were added via primers during PCR. Then the PCR products were cleaved and linked by Type IIs restriction enzyme BsmB1 (Thermo) and T4 DNA ligase (NEB) , which then were inserted into a pLenti backbone.
  • BsmB1 Thermo
  • NEB DNA ligase
  • the mutant USH2A dual reporter plasmid was co-transfected into HEK293T-WT cells, together with two viral packaging plasmids, pR8.74 and pVSVG (Addgene) via the X- tremeGENE HP DNA transfection reagent. 72 hours later, the supernatant virus was collected and stored at -80°C.
  • the HEK293T-WT cells were infected with lenti-virus, 72 hours later, and the mCherry-positive cells were sorted via FACS, cultured, then clonally selected after limiting dilution to generate clonal cell lines stably expressing dual fluorescence reporter system with low EGFP background.
  • the mutant USH2A dual reporter construct was co-transfected into HEK293T cells, together with two viral packaging plasmids, pR8.74 and pVSVG. 72 hours later, the supernatant virus was collected and stored at -80°C.
  • the HEK293T cells were infected with lentivirus, then mCherry-positive cells were sorted via FACS and cultured, then clonally selected after limiting dilution to generate clonal cell lines stably expressing dual fluorescence reporter system without detectable EGFP background.
  • the HEK293T cell line was obtained from C. Zhang’s laboratory (Peking University) , and was cultured in Dulbecco’s Modified Eagle Medium (Hyclone SH30243.01) with 10%fetal bovine serum (Vistech SE100-011) , additionally supplemented with 1%penicillin–streptomycin under 5%CO 2 at 37°C.
  • HEK293T reporter cell line expressing the mutant USH2A dual reporter were seeded in 12-well plates (15,000 cells/well) (recorded as 0 hours) . 24 hours subsequent to plating, cells were transfected with 2.5 ⁇ g of arRNA plasmid (plasmid extracted by Qiagen #12945 and quantified by Nanodrop) into each well using Lipofectamine 3000, according to manufacturer’s protocol.
  • each well of cells was dissociated with trypsin (Invitrogen 25300054) , and one-sixth of the dissociated cells were used for analyzing the fluorescence intensity of mCherry and GFP by flow cytometry. All the remaining dissociated cells were collected with TRIzol reagent (Thermofisher 15596026) and RNA was extracted therefrom (Zymo Research R2052) , wherein 1 ⁇ g of the extracted RNA was reverse transcribed into cDNA (NEB E6560L) .
  • the raw data obtained by high-throughput sequencing was subjected to quality control using fastp (v0.19.6) , and the low-quality reads, the reads on adapter sequences as well as reads on sequences containing polyG, etc., were filtered out.
  • barcodes corresponding to the high-quality sequencing data obtained were split into each sample, and aligned with the sequence of the amplified target region (see below for the sequence) using the BWA (v0.7.17-r1188) software, to generate a BAM file through SAMtools (v1 . 9) format conversion.
  • the information obtained was statistically compared, re-ordered and indexed.
  • RNA editing sites were detected using REDItools (v1.2.1) software, with the following parameters: with python REDItoolDenovo. py -i -f -o , after filtering out high-frequency point mutations that appeared in both control and treated samples, “ (Average mutation frequency other than A -> G mutation) + 3SD” was used as the threshold, and the reads of frequency value of A -> G mutation at editing site above the threshold value was taken as the genuine frequency of target A to G mutation.
  • the reporter cell line comprising the Usher 2A with Trp3955Ter mutation (NM_206933.2 (USH2A) _c. 11864G>A)
  • the reporter cell line was transfected with a 151-nt linear arRNA (Linear-151, see table A) and a circular arRNA of the same length (Circular-151, see Table A) , using Lipofectamine 3000 as described above.
  • the on-target and off-target editing facilitated by Linear-151 was compared to that by Circular-151, using the NGS protocols described above.
  • a circularized arRNA (Circular-151) shows significantly higher editing efficiency on the target adenosine (indicated as position 0) than a corresponding linear arRNA (Linear-151) .
  • linear and circularized arRNAs with the targeting RNA sequence of different lengths were transfected in the mutant USH2A dual reporter 293T cell line, using Lipofectamine 3000 as described above.
  • the efficiency of target editing was measured by the mean fluorescence intensity of GFP as described above.
  • circularized arRNAs comprising a targeting RNA sequence of 121 to 151 nucleotides in length exhibited higher editing efficiency, as evidenced by a higher increase in mean fluorescence intensity of GFP.
  • the gene editing efficiency of circularized arRNAs could be further increased by using a circularized arRNA with a longer targeting RNA sequence (e.g. at 151 to 201 nucleotide-length) .
  • FIG. 4 further illustrates various non-target adenosines in USH2A mRNA.
  • a circular arRNA with an 171-nt targeting RNA sequence (USHER-171) was further modified at one or more sites opposite to the target RNA in regions downstream (+) or upstream (-) of the editing site: +31, +35, +39, or -26, -30, -34, , as described in the table below:
  • FIG. 5 shows exemplary designs of such mismatches or deletions on Usher-171 (see also Table A) .
  • the modification could include one or more of the following designs: (1) mutation in arRNA, resulting in mismatch and formation of a bubble; (2) deletion in arRNA, resulting in formation of a bubble at the corresponding region of the target RNA.
  • the mutant USH2A dual reporter cell line was transfected with the described arRNAs, using Lipofectamine 3000 as described above. The efficiency of target editing was measured by the mean fluorescence intensity of GFP as described above.
  • the on-target and off-target editing facilitated by the described arRNAs was determined using NGS protocols described above.
  • mismatches or deletions in the targeting RNA sequence at one or more sites relative to regions downstream (+) or upstream (-) of the editing site increased the editing efficiency of target adenosine as shown by a higher increase in mean fluorescence intensity of GFP.
  • the USHER-171 arRNAs with -26/+31, -26/+35 and -26+39 4bp deletions were further modified at one or more additional sites opposite to the target RNA in regions downstream (+) or upstream (-) of the editing site: +d7/8, or -21/22del, -21x, , as described in the table below:
  • FIG. 8A shows exemplary designs of such additional mismatch or deletion (upstream of target adenosine relative to target RNA) on USHER-171 arRNAs with -26/+31, -26/+35 and -26+39 4bp deletions (see also Table A) .
  • FIG. 8B shows exemplary designs of such additional mismatch or deletion (downstream of target adenosine relative to target RNA) on USHER-171 arRNAs with -26/+31, -26/+35 and -26+39 4bp deletions (see also Table A) .
  • the mutant USH2A dual reporter cell line was transfected with the described arRNAs, using Lipofectamine 3000 as described above. The efficiency of target editing was measured by the mean fluorescence intensity of GFP as described above.
  • the on-target and off-target editing facilitated by the described arRNAs was determined using NGS protocols described above.
  • mismatches or deletions in the targeting RNA sequence at one or more sites relative to regions downstream (+) or upstream (-) of the editing site increased the editing efficiency of target adenosine as shown by a higher increase in mean fluorescence intensity of GFP.
  • deletion of ten consecutive nucleotides (-26x-21x) in the targeting RNA sequence relative to 21 to 30 nt upstream (-) of the editing site increased the target editing most significantly (US+35x-26x-21x and US+39x-26x-21x) .
  • the mutant USH2A dual reporter cell line was transfected with the described arRNAs, using Lipofectamine 3000 as described above.
  • the efficiency of target editing was measured by the mean fluorescence intensity of GFP as described above.
  • the on-target and off-target editing facilitated by the described arRNAs was determined using NGS protocols described above.
  • FIG. 12 showed that arRNAs comprising L-flexible linkers and R-flexible linkers at 10-nt length to 30-nt length exhibited similar on-target editing, as indicated by comparable increase in mean fluorescence intensity of GFP.
  • Example 4 Refining editing efficiency by mismatches and/or deletions in targeting RNA opposite to non-target adenosine
  • the flexible linkers described in Example 3 could be used to reduce off-targeting editing by the USHER-171 arRNAs with mismatch regions described above in Example 2, the arRNAs (US+35x-26x-21x and US+39x-26x-21x) , were further modified with flanking flexible linker sequences (from 10nt to 50nt) either in addition to the targeting RNA sequence or replacing the end of the targeting RNA sequence.
  • the described arRNAs with mismatch regions (US+35x-26x-21x and US+39x-26x-21x) , either without the flexible sequences (0nt) or with the flexible linker sequences (10nt, 20nt, 30nt, 40nt, 50nt) were generated and transfected into the mutant USH2A dual reporter cell line, using Lipofectamine 3000 as described above.
  • the efficiency of target editing was measured by the mean fluorescence intensity of GFP as described above.
  • the on-target and off-target editing facilitated by the described arRNAs was determined using NGS protocols described above.
  • the arRNAs (US+35x-26x-21x and US+39x-26x-21x) described in Example 2 were modified to introduce mismatches (such as deletions) relative to the non-target adenosine at positions +7 and +8, as illustrated by FIG. 14A.
  • Such arRNAs were also further modified with flanking flexible linker sequences (from 10nt to 50nt) either in addition to the targeting RNA sequence or replacing the end of the targeting RNA sequence (as illustrated in FIG. 14B) .
  • the described arRNAs with mismatch regions (US+35x-26x-21x+D7/8 and US+39x-26x-21x+D7/8) , either without the flexible linker sequences (0nt) or with the flexible linker sequences (10nt, 20nt, 30nt, 40nt, 50nt) were generated and transfected into the mutant USH2A dual reporter cell line, using Lipofectamine 3000 as described above.
  • the efficiency of target editing was measured by the mean fluorescence intensity of GFP as described above.
  • the on-target and off-target editing facilitated by the described arRNAs was determined using NGS protocols described above.
  • mismatch non-complementarity or deletion
  • the arRNAs described above were transfected into the mutant USH2A dual reporter cell line, using Lipofectamine 3000 as described above.
  • the efficiency of target editing was measured by the mean fluorescence intensity of GFP as described above.
  • the on-target and off-target editing facilitated by the described arRNAs was determined using NGS protocols described above.
  • non-target AA non-target adenosines
  • mismatch regions US+35x-26x-21x, US+39x-26x-21x
  • flexible linker sequences (30nt, 40nt, 50nt)
  • Additional mismatch region (s) could also be introduced to address any remnant off-target editing (such as +D7/8 in the case for editing by USHER-171 arRNA) .
  • the USHER-171 arRNAs was modified at one or more sites opposite to the target RNA in the region downstream (+) or upstream (-) of the editing site: -26, +35, as described in the Table 3 and illustrated in FIGs. 24 and 25.
  • insertions or deletions of 1 to 10 nucleotides in the targeting RNA sequence at the indicated sites relative to regions downstream (+35) or upstream (-26) of the editing site increased the editing efficiency of target adenosine as shown by a higher increase in mean fluorescence intensity of GFP.
  • FIGs. 27 and 29 further illustrate the target RNA complementarity of a targeting RNA sequence with mismatch region (s) .
  • the targeting RNA sequence comprised no deletion, a 4nt deletion or a 50 nt deletion at the +35 position, there remained a total length of 171nt of complementarity with the target RNA (inclusive of on-target A/C mismatch) .
  • the 50-nt of complementary region furthest-downstream from the target adenosine started at the +35 position in the targeting RNA sequence for no deletion (Usher +35-B0) , at 4-nt away from the +35 position in the targeting RNA sequence with 4nt deletion (Usher +35-B4) or at 50-nt away from the +35 position in the targeting RNA sequence with a 50nt deletion (Usher +35-B50) .
  • Usher +35-B0 the +35 position in the targeting RNA sequence for no deletion
  • Usher +35-B4 4-nt away from the +35 position in the targeting RNA sequence with 4nt deletion
  • Usher +35-B50 50-nt away from the +35 position in the targeting RNA sequence with a 50nt deletion
  • the targeting RNA sequence comprised no deletion, a 4nt deletion or a 50 nt deletion at the -26 position, there remained a total length of 171nt of complementarity with the target RNA (inclusive of on-target A/C mismatch) .
  • the 59-nt of complementary region furthest-upstream from the target adenosine (relative to the target RNA) started at the -26 position in the targeting RNA sequence for no deletion (Usher -26-B0) , at 4-nt away from the -26 position in the targeting RNA sequence with 4nt deletion (Usher -26-B4) or at 50-nt away from the -26 position in the targeting RNA sequence with a 50nt deletion (Usher -26-B50) .
  • FIG. 28 (left panel) showed that deletion of 4 to 20 nucleotides in the targeting RNA sequence at the indicated region downstream (+35) of the editing site increased the editing efficiency of target adenosine as shown by a higher increase in mean fluorescence intensity of GFP.
  • FIG. 28 (right panel) further showed that deletion of 4 to 50 nucleotides in the targeting RNA sequence at the indicated region downstream (+35) of the editing site, and a further deletion of 4 nucleotides in the targeting RNA sequence at the indicated region upstream (-26) of the editing site appreciably increased the editing efficiency of target adenosine as shown by an higher increase in mean fluorescence intensity of GFP.
  • FIG. 30 (left panel) showed that deletion of 4 to 30 nucleotides in the targeting RNA sequence at the indicated region upstream (-26) of the editing site resulted in similar editing efficiency of target adenosine as shown by a comparable increase in mean fluorescence intensity of GFP.
  • FIG. 30 (right panel) further showed that deletion of 4 to 50 nucleotides in the targeting RNA sequence at the indicated region upstream (-26) of the editing site, and a further deletion of 4 nucleotides in the targeting RNA sequence at the indicated region downstream (+35) of the editing site appreciably increased the editing efficiency of target adenosine as shown by a higher increase in mean fluorescence intensity of GFP.
  • FIG. 31 showed that deletion of 4 to 20 nucleotides in the targeting RNA sequence at both of the indicated regions upstream (-26) and downstream (+35) of the editing site appreciably increased the editing efficiency of target adenosine as shown by a higher increase in mean fluorescence intensity of GFP.
  • off-target editing could be reduced by use of linkers that does not hybridize with the target RNA and does not substantially form a secondary structure to flank the targeting RNA sequence.
  • various flexible linkers 50-nt were added to the 3’ of the targeting RNA sequence (see FIG. 32) for indicated targeting RNA sequence (+35x-21x and +35x-21x+d7/8) , and the arRNAs were generated according to the protocol as described in the Materials and methods above (See Table A for relevant dRNA sequences) .
  • the mutant USH2A dual reporter cell line was transfected with the described arRNAs, using Lipofectamine 3000 as described above.
  • the efficiency of target editing was measured by the mean fluorescence intensity of GFP as described above.
  • the on-target and off-target editing facilitated by the described arRNAs was determined using NGS protocols described above.
  • arRNAs with the rest of the tested 50nt linkers exhibited similar on-target editing efficiencies, as shown by comparable increase in mean fluorescence intensity of GFP.
  • the mutant USH2A dual reporter cell line was transfected with the described arRNAs, using Lipofectamine 3000 as described above.
  • the efficiency of target editing was measured by the mean fluorescence intensity of GFP as described above.
  • the on-target and off-target editing facilitated by the described arRNAs was determined using NGS protocols described above.
  • stem loop structures GluR2, Alu, or U6+27
  • GluR2, Alu, or U6+27 resulted in decrease in on-target editing as compared to the arRNA without the stem loop structures (Control) , as indicated by lesser increase in mean fluorescence intensity of GFP.
  • Rhesus monkey kidney cell line LLC-MK2 cells (ATCC Number: CCL-7) were cultured using DMEM (Hyclone SH30243.01) containing 10%FBS (Vistech SE100-011) .
  • the mutant USH2A dual reporter was stably introduced into the LLC-MK2 cells.
  • LLC-MK2 cells expressing mutant USH2A were seeded in 12-well plates (15,000 cells/well) (recorded as 0 hours) . 24 hours subsequent to plating, cells were transfected with 2.5 ⁇ g of arRNA-encoding plasmid (SEQ ID NO: 4) (plasmid extracted by Qiagen #12945 and quantified by Nanodrop) into each well using Lipofectamine 3000, according to manufacturer’s protocol.
  • SEQ ID NO: 4 arRNA-encoding plasmid
  • each well of cells was dissociated with trypsin (Invitrogen 25300054) , and one-sixth of the dissociated cells were used for analyzing the fluorescence intensity of mCherry and GFP by flow cytometry. All the remaining dissociated cells were collected with TRIzol reagent (Thermofisher 15596026) and RNA was extracted therefrom (Zymo Research R2052) , wherein 1 ⁇ g of the extracted RNA was reverse transcribed into cDNA (NEB E6560L) .
  • the raw data obtained by high-throughput sequencing was subjected to quality control using fastp (v0.19.6) , and the low-quality reads, the reads on adapter sequences as well as reads on sequences containing polyG, etc., were filtered out. Subsequently, barcodes corresponding to the high-quality sequencing data obtained were split into each sample, and aligned with the sequence of the amplified target region (see below for the sequence) using the BWA (v0.7.17-r1188) software, to generate a BAM file through SAMtools (v1.9) format conversion. The information obtained was statistically compared, re-ordered and indexed.
  • RNA editing sites were detected using REDItools (v1.2.1) software, with the following parameters: with python REDItoolDenovo. py -i -f -o, after filtering out high-frequency point mutations that appeared in both control and treated samples, “ (Average mutation frequency other than A -> G mutation) + 3SD” was used as the threshold, and the reads of frequency value of A -> G mutation at editing site above the threshold value was taken as the genuine frequency of target A to G mutation.
  • mutant Rhesus monkey endogenously expressing mutant Ush2A with G->A mutation was subjected to editing by arRNA specific for mutant Ush2A.
  • the arRNA-encoding plasmid (SEQ ID NO: 5) was packaged into an adeno-associated virus of serotype AAV8 with a titer of 5 ⁇ 10 13 Genome Copy/mL by Guangzhou PackGene Biotech, LLC.
  • the AAV (packaged with the arRNA) or a control (NaCl) was injected through the subretinal space in both eyes of the Rhesus monkeys.
  • each monkey was injected with either: 20 ⁇ L %0.9 NaCl (NaCl) , solution with 1 ⁇ 10 11 Genome Copy of AAV (Low Dose) , solution with 3 ⁇ 10 11 Genome Copy of AAV (Medium Dose) , or solution with 1 ⁇ 10 12 Genome Copy of AAV (High Dose) .
  • RNA was extracted therefrom Zymo Research R2052 , wherein 1 ⁇ g of the extracted RNA was reverse transcribed into cDNA (NEB E6560L) .
  • 5 ⁇ L of the reverse transcribed cDNA was used as a template, and PCR amplification was carried out using primers ggagtgagtacggtgtgcCATCAAGCCCACCTGTTCGGATTA (SEQ ID NO: 379) and gagttggatgctggatggGAGCCCGTCACTGAAGATGTTGTAT (SEQ ID NO: 13) .
  • the sequencing analysis were same as described above for Rhesus monkey cell line.
  • monkey kidney cells expressing the mutant Ush2a dual reporter exhibited similar on-target editing and bystander editing patterns as in vivo monkey retinal cells endogenously expressing mutant Ush2A upon introduction of arRNA, thereby illustrating the suitability of using the Ush2A reporter for exploring mechanisms to improve on-target editing efficiency and specificity.
  • the first approach was to introduce a deletion at various sites opposite to the target RNA in regions downstream (+) or upstream (-) of the editing site.
  • the DNA sequences (NNNNNNNNNN) as indicated in Table B were first synthesized in vitro and incorporated into a vector, and subsequently subjected to MiuI and KpnI digestion and then ligated to a plasmid backbone as indicated by SEQ ID NO: 316.
  • deletions two different sites were combined.
  • a 4bp deletion at -26, -30, -34, +31, +35, or +39 reduced off-targeting editing compared to the circ-arRNA before optimization (SEQ ID NO: 317) .
  • the modifications did not reduce on-target (position 0) editing efficiency.
  • off-targeting editing was further reduced (FIG. 39) .
  • the second approach was to incorporate flexible linker of various lengths flanking 5’ ( “left” flexible linker, or LAC) or 3’ ( “right” flexible linker, or RAC) of the targeting RNA sequence of the circ-arRNA, as described above.
  • the circ-arRNA with linkers (SEQ ID NOs: 334-343) were compared to the circ-arRNA before optimization (SEQ ID NO: 333) .
  • addition of LAC linkers flanking the 5’ of the targeting RNA sequence decreased the off-target editing opposite to the 5’ targeting RNA sequence more significantly
  • RAC linkers flanking the 3’ of the targeting RNA sequence decreased the off-target editing opposite to the 3’ targeting RNA sequence more significantly.
  • a uracil at various positions was deleted, including -5, +3, and/or +13, on the basis of the circ-arRNA with 4bp deletions at -26 and +35, and a 20nt right linker and a 30nt left linker (SEQ ID NOs: 351-354) .
  • the deletion of three uracils at -5, +3, and +13 eliminated all residual editing at non-target adenosines.
  • SEQ ID NO: 1 PackGene plasmid backbone
  • Table A Sequences comprising targeting RNA sequence in linear RNA ( “Linear” below) and linear RNA capable of being circularized ( “Circular” below)
  • Table B Sequences comprising targeting RNA capable of being circularized.

Abstract

La présente invention concerne des procédés d'édition d'ARN par introduction d'un ARN de recrutement de désaminase dans une cellule hôte pour la désamination d'une adénosine dans un ARN cible codant pour une protéine Usher 2A mutante. La présente invention concerne en outre des ARN de recrutement de désaminase utilisés dans les procédés d'édition d'ARN et des compositions et des kits les comprenant.
PCT/CN2023/073623 2022-04-02 2023-01-28 Arn de recrutement adar modifiés et procédés d'utilisation pour le syndrome d'usher WO2023185231A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2022085144 2022-04-02
CNPCT/CN2022/085144 2022-04-02

Publications (1)

Publication Number Publication Date
WO2023185231A1 true WO2023185231A1 (fr) 2023-10-05

Family

ID=88199025

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2023/073623 WO2023185231A1 (fr) 2022-04-02 2023-01-28 Arn de recrutement adar modifiés et procédés d'utilisation pour le syndrome d'usher

Country Status (2)

Country Link
TW (1) TW202346596A (fr)
WO (1) WO2023185231A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113122577A (zh) * 2019-12-30 2021-07-16 博雅辑因（北京）生物科技有限公司 一种治疗Usher综合征的方法和其组合物
US20210310026A1 (en) * 2018-10-12 2021-10-07 Peking University Methods and compositions for editing rnas
WO2022007803A1 (fr) * 2020-07-06 2022-01-13 博雅辑因（北京）生物科技有限公司 Procédé d'édition d'arn amélioré

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210310026A1 (en) * 2018-10-12 2021-10-07 Peking University Methods and compositions for editing rnas
CN113122577A (zh) * 2019-12-30 2021-07-16 博雅辑因（北京）生物科技有限公司 一种治疗Usher综合征的方法和其组合物
WO2022007803A1 (fr) * 2020-07-06 2022-01-13 博雅辑因（北京）生物科技有限公司 Procédé d'édition d'arn amélioré

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SAMANTA ANANYA, STINGL KATARINA, KOHL SUSANNE, RIES JESSICA, LINNERT JOSHUA, NAGEL-WOLFRUM KERSTIN: "Ataluren for the Treatment of Usher Syndrome 2A Caused by Nonsense Mutations", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 20, no. 24, pages 6274, XP093096592, DOI: 10.3390/ijms20246274 *
SONG BRIAN, SHIROMOTO YUSUKE, MINAKUCHI MOEKO, NISHIKURA KAZUKO: "The role of RNA editing enzyme ADAR1 in human disease", WILEY INTERDISCIPLINARY REVIEWS: RNA, JOHN WILEY & SONS LTD, UNITED KINGDOM, vol. 13, no. 1, 1 January 2022 (2022-01-01), United Kingdom , XP093096573, ISSN: 1757-7004, DOI: 10.1002/wrna.1665 *

Also Published As

Publication number Publication date
TW202346596A (zh) 2023-12-01

Similar Documents

Publication Publication Date Title
US11661596B2 (en) Targeted RNA editing by leveraging endogenous ADAR using engineered RNAs
US11702658B2 (en) Methods and compositions for editing RNAs
IL263332B1 (en) RNA-editing single-stranded oligonucleotides
CA3115864A1 (fr) Procedes et compositions pour editer des arn
EP3234134A1 (fr) Édition ciblée d'arn
KR20170118755A (ko) 레베르 선천성 흑암시 치료용 올리고뉴클레오타이드
EP3548614A1 (fr) Systèmes et procédés pour le ciblage d'arn en une seule fois (ogarn) d'adn endogene et source
EP4137161A1 (fr) Méthode et médicament pour le traitement du syndrome de hurler
JP2023509179A (ja) Ｌｅａｐｅｒ技術に基づくｍｐｓ ｉｈの治療方法及び組成物
WO2012131365A1 (fr) Molécules thérapeutiques destinées à être utilisées dans la suppression de la maladie de parkinson
WO2022150974A1 (fr) Édition ciblée d'arn par exploitation d'adar endogène à l'aide d'arn modifiés
WO2023185231A1 (fr) Arn de recrutement adar modifiés et procédés d'utilisation pour le syndrome d'usher
WO2023143539A1 (fr) Arn de recrutement d'adar modifiés et leurs procédés d'utilisation
WO2023020574A1 (fr) Arn de recrutement d'adar modifiés et leurs procédés d'utilisation
WO2023143609A1 (fr) Procédés d'édition d'acides nucléiques pour modifier la fonction d'apoe4
WO2023196772A1 (fr) Nouvelles compositions d'édition de bases d'arn, systèmes, procédés et utilisations associés
JP2023550381A (ja) 真核生物遺伝子編集のためのベクター、システムおよび方法
AU2022245243A1 (en) Novel crispr enzymes, methods, systems and uses thereof
TW202411426A (zh) 經工程化的２類ｖ型ｃｒｉｓｐｒ系統

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23777610

Country of ref document: EP

Kind code of ref document: A1