WO2023177885A2 - Therapeutic adeno-associated virus using codon optimized nucleic acid encoding alpha-glucosidase (gaa) for treating pompe disease, with signal peptide modifications - Google Patents

Therapeutic adeno-associated virus using codon optimized nucleic acid encoding alpha-glucosidase (gaa) for treating pompe disease, with signal peptide modifications Download PDF

Info

Publication number
WO2023177885A2
WO2023177885A2 PCT/US2023/015531 US2023015531W WO2023177885A2 WO 2023177885 A2 WO2023177885 A2 WO 2023177885A2 US 2023015531 W US2023015531 W US 2023015531W WO 2023177885 A2 WO2023177885 A2 WO 2023177885A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
gaa
sequence
nucleic acid
signal peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2023/015531
Other languages
English (en)
French (fr)
Other versions
WO2023177885A3 (en
Inventor
Xavier ANGUELA
Lester SUAREZ
Scott Hammond
Anna Tretiakova
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
AskBio Inc
Original Assignee
Asklepios Biopharmaceutical Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to IL315711A priority Critical patent/IL315711A/en
Application filed by Asklepios Biopharmaceutical Inc filed Critical Asklepios Biopharmaceutical Inc
Priority to CA3254578A priority patent/CA3254578A1/en
Priority to AU2023235203A priority patent/AU2023235203A1/en
Priority to KR1020247032558A priority patent/KR20250005569A/ko
Priority to US18/848,389 priority patent/US20250213726A1/en
Priority to CN202380041220.6A priority patent/CN119213137A/zh
Priority to JP2024555349A priority patent/JP2025510017A/ja
Priority to EP23771464.7A priority patent/EP4493704A2/en
Publication of WO2023177885A2 publication Critical patent/WO2023177885A2/en
Publication of WO2023177885A3 publication Critical patent/WO2023177885A3/en
Priority to MX2024011396A priority patent/MX2024011396A/es
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/47Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405Glucanases
    • C12N9/2408Glucanases acting on alpha -1,4-glucosidic bonds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/0102Alpha-glucosidase (3.2.1.20)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/22Vectors comprising a coding region that has been codon optimised for expression in a respective host
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/42Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/50Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • the present invention relates to methods to treat Pompe disease by administering adeno- associated virus (AAV) particles, virions and vectors for expression of an alpha-glucosidase (GAA) polypeptide, where the nucleic acid encoding GAA can be codon optimized or truncated.
  • AAV adeno-associated virus
  • GAA alpha-glucosidase
  • the compositions as disclosed herein can be used in methods to treat Pompe disease, including without the clinical need for administration of long-term GAA enzyme replacement therapy (ERT) for an extended period of time.
  • Pompe disease (Glycogen storage disease type II; acid maltase deficiency; MIM 232300) is caused by recessive mutations of the GAA gene leading to complete or partial deficiency of the lysosomal enzyme acid a-glucosidase (GAA). Absence of GAA leads to the progressive accumulation of glycogen in the lysosomes of many tissues, particularly skeletal muscle and cardiomyocytes.
  • Impaired energy metabolism leads secondarily to severely disrupted muscle architecture, dysfunction, autophagy, and in adults, significant fatty replacement of skeletal muscle myocytes.
  • IOPD infantile-onset Pompe disease
  • LOPD late-onset Pompe disease
  • CK creatine kinase
  • MYOZYME® alglucosidase alfa was the first US approved product (2006) for the treatment of Pompe disease; LUMIZYME® (alglucosidase alfa) was approved in 2010 and is the current standard-of-care (SOC) treatment for infantile-onset and late-onset Pompe patients.
  • Alglucosidase alfa is administered intravenously every 2 weeks as an infusion at a dose of 20 mg/Kg (LUMIZYME Prescribing Information 2014). Alglucosidase alfa provides an exogenous source of GAA.
  • IgG Immunoglobulin G
  • ERT is known to provoke an antibody response in the form of both IgG and IgE and can also lead to infusion-associated reactions (Kishnani et al. 2007; Kishnani et al. 2010).
  • Current practice is to initiate immune modulation with ERT for patients with LOPD at risk for antibody formation.
  • ERT enzyme replacement therapy
  • MYOZYME®/LUMIZYME® alglucosidase alfa
  • IOPD infantile-onset Pompe disease
  • GAA is absent (CRIM negative) or minimal ( ⁇ 1% of normal) and causes rapidly progressive cardiorespiratory failure and death by the age of 2 years if left untreated (Parini et al. 2018).
  • LOPD Late-Onset Pompe disease
  • alglucosidase alfa ERT leaves a clear unmet medical need in both IOPD and LOPD.
  • Longitudinal data in subjects confirm that ERT does not lead to complete correction or normalization of patients with Pompe disease.
  • subjects typically still decline, albeit at a slower rate, delaying the inevitable progression to death (Kuperus et al. 2017; Parini et al. 2018).
  • alglucosidase alfa prolongs survival for subjects with both IOPD and LOPD (LUMIZYME Prescribing Information, 2014) the antibody responses to the GAA and decline in effect poses several drawbacks.
  • the technology described herein relates generally to a recombinant adenovirus associated (rAAV) vector comprising in its genome: (a) 5’ and 3’ AAV inverted terminal repeats (ITR) sequences, and (b) located between the 5’ and 3’ ITRs, a heterologous nucleic acid sequence encoding all or a portion of an endogenous GAA signal peptide, a heterologous signal peptide and an alpha- glucosidase (GAA) polypeptide, wherein the GAA polypeptide comprises amino acid residues 28-952 of SEQ ID NO: 1, 57-952 of SEQ ID NO: 1, or comprises a N-terminal GAA polypeptide fragment, such as comprising amino acids 28, 28-29, 28-30, 28-31, 28-32, or 28-33 of SEQ ID NO: 1 and a deletion of any number of amino acids from the next about 5 amino acids to about 40 amino acids after the N terminal GAA polypeptide fragment of SEQ ID NO: 1,
  • a recombinant adenovirus associated (rAAV) vector comprising in its genome: (a) 5’ and 3’ AAV inverted terminal repeats (ITR) sequences, and (b) located between the 5’ and 3’ ITRs, optionally, a heterologous nucleic acid sequence encoding all or a portion of an endogenous GAA signal peptide, a heterologous signal peptide and an alpha-glucosidase (GAA) polypeptide, wherein the GAA polypeptide comprises amino acid residues 28-952 of SEQ ID NO: 1, amino acids 57-952 of SEQ ID NO: 1, or comprises a N-terminal GAA polypeptide fragment, for example, comprising amino acids 28, 28-29, 28-30, 28-31, 28-32, or 28-33 of SEQ ID NO: 1 and a deletion can be any number of amino acids from about 5 amino acids to about 40 amino acids after the N terminal GAA polypeptide fragment of SEQ ID NO: 1, and wherein the heterolog
  • the heterologous signal peptide is optionally fused at position 57 of the remaining amino acids of the GAA polypeptide, and where the GAA polypeptide can extend to amino acid 952 of SEQ ID NO: 1, or a functional fragment thereof, and wherein the nucleic acid sequence encoding the GAA polypeptide can be wild-type or codon optimized, and wherein the heterologous nucleic acid is operatively linked to a liver-specific promoter.
  • the nucleic acid sequence that encodes an endogenous GAA-signal peptide encodes at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1- 24, or at least about 1-25, or at least about 1-26, or at least about 1-27 concecutive amino acids of the endogenous GAA signal peptide of SEQ ID NO: 59.
  • the nucleic acid sequence encoding an GAA-signal peptide encodes a modified GAA signal peptide that comprises a deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14, or at least 15, or at least 16, or at least 17, or at least 18, or at least 19, or at least 20 amino acids of SEQ ID NO: 59, where the deletions can be concecutive, or non-concecutive deletions.
  • the nucleic acid sequence that encodes a GAA-signal peptide encodes at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26, or at least about 1-27 concecutive amino acids of the endogenous GAA signal peptide.
  • codon optimized nucleic acid sequence encoding the GAA polypeptide is selected from the group consisting of SEQ ID NO: 1-18, or functional fragment thereofs.
  • the nucleic acid encoding SEQ ID NO: 3 is wildtype.
  • the vector comprises the nucleic acid sequence of SEQ ID NO: 23, or a functional variant thereof.
  • the heterologous nucleic acid sequence encodes a GAA protein comprising a signal peptide fused to the GAA polypeptide, wherein the signal peptide is an endogenous GAA signal peptide, or a heterologous signal peptide, or a combination thereof.
  • the AAV genome comprises, in the 5’ to 3’ direction: (a) a 5’ ITR, (b) a liver-specific promoter sequence, (c) an 5’ UTR sequence, (d) a nucleic acid encoding a portion or all of the endogenous GAA signal peptide, (e) a nucleic acid encoding a heterologous signal peptide or the N-terminal GAA polypeptide fragment, (f) a nucleic acid encoding an alpha-glucosidase (GAA) polypeptide, wherein the GAA polypeptide can be whole or a fragment thereof that is functionally active, (g) a poly A sequence, and (h) a reverse RNA pol II terminator sequence.
  • GAA alpha-glucosidase
  • the vector further comprises at least one of a UTR or a reverse RNA polll terminator sequence.
  • the UTR is 5’ or 3’.
  • the nucleic acid encoding the signal peptide encodes a signal sequence is selected from any of: an endogenous GAA signal peptide, a fibronectin signal peptide (FN1), a IL-2 wt signal peptide, modified IL-2 signal peptide, IL2(l-3) signal peptide, IgG signal peptide, a AAT signal peptide, a A2M signal peptide, or a PZP signal peptide, or an active fragment thereof having signal peptide activity.
  • the nucleic acid sequence encodes a GAA polypeptide having the amino acid sequence of SEQ ID NO: 1, or a polypeptide having at least 80% sequence identity to SEQ ID NO: 1 where amino acid residue 199 is a R (199R), amino acid residue 223 is a H (223H) and amino acid residue 780 is a I (7801).
  • the nucleic acid sequence encoding the GAA polypeptide is SEQ ID NO: 3, or a nucleic acid sequence having at least 80%, or at least 85%, or at least 90% sequence identity to SEQ ID NO: 3 that encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO: 1 where amino acid residue 199 is a R (199R), amino acid residue 223 is a H (223H) and amino acid residue 780 is a I (7801).
  • the 5’ UTR sequence comprises SEQ ID NO: 41, or a nucleic acid having at least 80% sequence identity to SEQ ID NO: 41.
  • the 5’ UTR sequence comprises SEQ ID NO: 40, or a nucleic acid having at least 80% sequence identity to SEQ ID NO: 40.
  • the vector further comprises an intron sequence located 5’ of the nucleic acid sequence encoding the signal peptide, and 3’ of the promoter.
  • the intron sequence is selected from the group consisting of: MVM sequence, a HBB2 sequence, an CMVIE intron sequence, or a UBC intron sequence or a SV40 sequence.
  • the GAA polypeptide is a N-terminal truncated GAA polypeptide selected from any disclosed in Table 1.
  • the vector further comprises at least one polyA sequence located 3’ of the nucleic acid encoding the GAA gene and 5’ of the 3’ ITR sequence.
  • the heterologous nucleic acid sequence further comprises a 3’ UTR sequence, wherein the 3’ UTR sequence is located 3’ of the nucleic acid encoding the GAA polypeptide and 5’ of the 3’ ITR sequence, or is located between the nucleic acid encoding a GAA polypeptide and the poly A sequence, and can also comprise a RNA pol II terminator sequence.
  • the heterologous nucleic acid sequence further comprises a 3’ intron sequence, wherein the 3’ intron sequence is located 3’ of the nucleic acid encoding the GAA polypeptide and 5’ of the 3’ ITR sequence, or is located between the nucleic acid encoding the GAA polypeptide and a poly A sequence and/or a RNA polll terminator sequence.
  • the ITR comprises an insertion, deletion or substitution.
  • the nucleic acid encoding the signal peptide is selected from any of the group consisting of: AAT signal peptide (e.g., SEQ ID NO: 67), or an active fragment thereof having secretory signal activity, e.g., a nucleic acid encoding an amino acid sequence that has at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 67; a fibronectin signal peptide (FN1) (e.g., SEQ ID NO: 73-75), or an active fragment thereof having secretory signal activity, e.g., a nucleic acid encoding an amino acid sequence that has at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO:
  • the nucleic acid encoding the GAA polypeptide is selected from SEQ ID NO: 3 or fragment thereof having functional GAA activity, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 3 which encodes a GAA polypeptide at least 85% sequence identity to SEQ ID NO: 1 where amino acid residue 199 is a R (199R), amino acid residue 223 is a H (223H) and amino acid residue 780 is a I (7801).
  • the nucleic acid encoding the GAA polypeptide encodes a GAA polypeptide beginning at any of amino acid residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793, or 796 of SEQ ID NO: 1 or a sequence 80% identical to SEQ ID NO: 1 where amino acid residue 199 is a R (199R), amino acid residue 223 is a H (223H) and amino acid residue 780 is a I (7801).
  • the GAA polypeptide has an endogenous GAA signal peptide or fragment thereof attached, and a heterologous signal peptide attached to or after the N- terminal of the GAA polypeptide, wherein the endogenous signal peptide has the amino acid sequence of SEQ ID NO: 59 or a sequence at least 80% sequence identity to SEQ ID NO: 59, and the heterologous signal peptide is selected from the group consisting of: SEQ ID NO: 60 (201 IgG signal peptide), or an IL2 wild type signal peptide (SEQ ID NO: 61), modified IL2 signal peptide (SEQ ID NO: 62), A2M signal peptide (SEQ ID NO: 63), or PZP signal peptide (SEQ ID NO: 64), or artificial signal peptide (SEQ ID NO: 65), or cathpetsin L signal peptide (SEQ ID NO: 66) or signal peptides at least 90% sequence identity to SEQ ID NO: 60 (201 IgG signal peptide
  • the liver specific promoter is selected from any of: SEQ ID NOS: 86, 88, 91-96, 146-150 or 439-441, or a liver specific promoter having at least 80% sequence identity to SEQ ID NOs: 86, 88, 91-96, 146-150 or 439-441.
  • the liver specific promoter is selected from any of: SEQ ID NOS: 98 or 99, or a liver specific promoter having at least 80% sequence identity to SEQ ID NOs: 98 or 99.
  • the liver specific promoter is SEQ ID NOS: 97, or a liver specific promoter having at least 80% sequence identity to SEQ ID NO: 97.
  • the recombinant vector is manufactured from the plasmid of SEQ ID NO: 27.
  • the nucleic acid comprises SEQ ID NO: 25, or a functional fragment thereof.
  • the recombinant AAV vector is a chimeric AAV vector, haploid AAV vector, a hybrid AAV vector or polyploid AAV vector.
  • the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or a AAV vector from any AAV serotypes.
  • the recombinant AAV vector is selected from the group consisting of: a AAVXL32 vector, a AAVXL32.1 vector, a AAV8 vector, or a haploid AAV8 vector comprising at least one AAV8 capsid protein.
  • the serotype is AAV3b.
  • the AAV3b serotype comprises one or mutations in a capsid protein selected from any of: 265D, 549 A, Q263Y.
  • the AAV3b serotype is selected from any of: AAV3b265D, AAV3b265D549A, AAV3b549A or AAV3bQ263Y, or AAV3bSASTG.
  • the poly A sequence is a full length HGF poly A sequence. Ine one embodiment, it can be a functional fragment of the hGH polyA sequence.
  • the poly A sequence is selected from SEQ ID NO: 42, 43 or 44, or a nucleic acid sequence at least 80% sequence identity to SEQ ID NOS: 42-44.
  • the reverse RNA pol II terminator sequence comprises SEQ ID NO: 45, or a nucleic acid sequence at least 80% sequence identity to SEQ ID NO: 45. In one embodiment, it is those sequences.
  • Another aspect described herein provides a pharmaceutical composition comprising any of the recombinant AAV vectors described herein in a pharmaceutically acceptable carrier.
  • Another aspect described herein provides a method to treat a subject with Pompe Disease, or a glycogen storage disease type II (GSD II, Acid Maltase Deficiency) or having a deficiency in alpha- glucosidase (GAA) polypeptide, comprising administering any of the recombinant AAV vector, or any of the rAAV genome or nucleic acid sequence described herein to the subject.
  • GSD II glycogen storage disease type II
  • GAA alpha- glucosidase
  • the AAV vector manufactured from the plasmid of SEQ ID NO: 27.
  • the recombinant AAV vector comprises the nucleic acid sequence of SEQ ID NO: 3, or a functional fragment thereof.
  • the recombinant AAV vector comprises the nucleic acid sequence of SEQ ID NO: 23, or a functional variant thereof.
  • the GAA polypeptide is secreted from the subject’s liver and there is uptake of the secreted GAA by skeletal muscle tissue, cardiac muscle tissue, diaphragm muscle tissue or a combination thereof, wherein uptake of the secreted GAA results in a reduction in lysosomal glycogen stores in the tissue(s).
  • the administering to the subject is selected from any of: intramuscular, sub-cutaneous, intraspinal, intracistemal, intrathecal, intravenous administration.
  • the recombinant AAV vector is a chimeric AAV vector, haploid AAV vector, a hybrid AAV vector or polyploid AAV vector.
  • the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or a AAV vector from any AAV serotypes.
  • the recombinant AAV vector is a AAVXL32 vector or a AAVXL32.1 vector or a AAV8 vector, or a haploid AAV8 vector comprising at least one AAV8 capsid protein.
  • the recombinant AAV vector is a AAV8 vector.
  • the recombinant AAV vector is administered at a dosage range of between 1.0E9vg/kg and 5.0E13 vg/kg.
  • 1.0E9vg/kg and 5.0E12 vg/kg 5.0E9vg/kg and 5.0E12 vg/kg
  • 5.0E9vg/kg and 1.0E12 vg/kg 5.0E9vg/kg and 5.0E11 vg/kg
  • the method further comprises receiving GAA protein enzyme replacement therapy, and withdrawing GAA protein enzyme replacement therapy (ERT) on the same day, a day after or, any time between day 1 and 26 weeks after administration of the recombinant AAV vector.
  • GAA protein enzyme replacement therapy ERT
  • nucleic acid construct comprising SEQ ID NO: 3, or a nucleic acid sequence at least 80% sequence identity to SEQ ID NOS: 3.
  • the expression of the nucleic acid sequence of SEQ ID NO: 3 or a nucleic acid having 80% sequence identity thereto encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO: 1 and wherein there is R at position 199, a H at position 223 and I at position 780.
  • nucleic acid construct comprising SEQ ID NO: 23, or a nucleic acid sequence at least 80% sequence identity to SEQ ID NO: 23.
  • the nucleic acid comprises SEQ ID NO: 3 or SEQ ID NO: 25, or a nucleic acid sequence at least 80% sequence identity to SEQ ID NOS: 3 or 25.
  • the expression of the nucleic acid sequence of SEQ ID NO: 3 or a nucleic acid having 80% sequence identity thereto encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO: 1 and wherein there is R at position 199, a H at position 223 and I at position 780.
  • Another aspect described herein provides a recombinant AAV comprising any of the nucleic acid constructs described herein.
  • the AAV lacks at least 1 amino acids of the GAA N terminus.
  • the AAV lacks at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 or mor amino acids of the GAA N terminus.
  • the heterologous signal peptide is inserted immediately after the endogenous GAA signal peptide or a potion thereof.
  • FIGs 1A-1D show serum GAA protein quantification by western blot densitometry. Serum GAA protein was measured by western blot densitometry at week 1 (Fig. 1 A), week 2 (Fig. IB), week 3 (Fig. 1C) and week 4 (cardiac serum) (Fig. ID). Serum GAA was normalized to total protein (A-D).
  • FIGs 2A-2D show serum GAA activity by 4MU assay. Serum GAA activity was measured by 4MU assay at week 1 (Fig. 2A), week 2 (Fig. 2B). week 3 (Fig. 2C) and week 4 (cardiac serum) (Fig. 2D).
  • FIGs 3A-3C show target organ GAA protein quantification by western blot densitometry.
  • GAA protein was measured 4 weeks post dosing by western blot densitometry in Heart (Fig. 3A), Diaphragm (Fig. 3B) and Liver (Fig. 3C). GAA was normalized to total protein.
  • FIGs 4A-4D show target organ GAA activity by 4MU assay.
  • GAA activity was measured by 4MU assay 4 weeks post dosing in Heart (Fig. 4A), Diaphragm (Fig. 4B), Quad (Fig. 4C) and Liver (Fig. 4D).
  • FIGs 5A-5D show target organ Glycogen content. Glycogen content was measured 4 weeks post dosing in Heart (Fig. 5A), Diaphragm (Fig. 5B), Quad (Fig. 5C) and Liver (Fig. 5D).
  • FIGs 6A-6C show serum GAA protein quantification by western blot densitometry for 3-week sacrifice animals. Serum GAA protein was measured by western blot densitometry at week 1 (Fig. 6A), week 2 (Fig. 6B) and week 3 (Fig. 6C). Serum GAA was normalized to total protein.
  • FIGs 7A-7C show serum GAA activity by 4MU assay for 3-week sacrifice animals. Serum GAA activity was measured by 4MU assay at week 1 (Fig. 7A), week 2 (Fig. 7B) and week 3 (Fig. 7C).
  • FIGs 8A-8C show target organ GAA activity by 4MU assay for 3-week sacrifice animals. GAA activity was measured by 4MU assay 3 weeks post dosing in Heart (Fig. 8A), Diaphragm (Fig. 8B) and Liver (Fig. 8C).
  • FIGs 9A-9C show target organ Glycogen content for 3-week sacrifice animals. Glycogen content was measured 3 weeks post dosing in Heart (Fig. 9A), Diaphragm (Fig. 9B) and Liver (Fig. 9C).
  • FIGs 10A-10H show serum GAA protein quantification by western blot densitometry for 8- week sacrifice animals.
  • Serum GAA protein was measured by western blot densitometry at week 1 (Fig. 10A), week 2 (Fig. 10B).
  • week 3 Fig. 10C
  • week 4 Fig. 10D
  • week 5 Fig. 10E
  • week 6 Fig. 10F
  • week 7 Fig. 10G
  • week 8 Fig. 10H
  • FIGs 11A-11H show serum GAA activity by 4MU assay for 8-week sacrifice animals. Serum GAA activity was measured by 4MU assay at week 1 (Fig. 11 A), week 2 (Fig. 1 IB), week 3 (Fig. 11C) and week 4 (Fig. 1 ID), week 5 (Fig. 1 IE), week 6 (Fig. 1 IF), week 7 (Fig. 11G), week 8 (Fig. 11H).
  • FIGs 12A-12C show target organ GAA protein quantification by western blot densitometry for 8-week sacrifice animals. GAA protein was measured 8 weeks post dosing by western blot densitometry in Heart (Fig. 12A), Diaphragm (Fig. 12B), and Liver (Fig. 12C).
  • FIGs 13A-13C show target organ GAA activity by 4MU assay for 8-week sacrifice animals. GAA activity was measured by 4MU assay 8 weeks post dosing in Heart (Fig. 13A), Diaphragm (Fig. 13B) and Liver (Fig. 13C).
  • FIGs 14A-14F show target organ Glycogen content for 8-week sacrifice animals. Glycogen content was measured 8 weeks post dosing in Heart (Figs 14A, 14D), Diaphragm (Figs 14B, 14E) and Liver (Figs 14C, 14F) and expressed normalized to dose per kg body weight (Figs 14D-14F).
  • FIG. 15 shows a schematic of the Actus, M3 and M4 constructs.
  • the Actus comprises the liver promoter of SEQ ID NO: 97
  • the M3 construct is similar to the M2 construct, with the M3 contruct comprsing the promoter of SEQ ID NO: 99
  • the M2 construction comprises the promter of SEQ ID NO: 98, which comprises mutations within the muscle transcription factor binding site.
  • the coding sequence in the M3 construct was modified to remove predicted alternative open reading frames and known immune stimulatory hexanucleotide CpG motifs.
  • In the M4 construct all CG dinucleotide were removed from the entire coding sequence. Alternative frames were not removed in selected M4 constructs.
  • Amino acid sequence is identical to sequence found in Actus 101 (myozyme/lumizyme amino acid sequence) across the M3 and M4 constructs.
  • FIGs 16A and 16B show analyses of hGAA target tissue uptake.
  • Fig. 16A shows expression of GAA activity (top graph) following administrations of M4 as compared to Actus 101 and a vehicle control (VC) in the liver, heart and diaphragm, as well as glycogen levels (bottom graph).
  • Fig. 16B shows expression of GAA activity (top graph) following administrations of M4 from two different lots as compared to Actus 101 and a vehicle control (VC) in the liver, heart and diaphragm, as well as glycogen levels (bottom graph).
  • FIGs 17A and 17B show analyses of serum hGAA expressed by Actus 101 and M4.
  • FIG. 17A shows protein expression of hGAA expressed from Actus 101, M4, and a vehicle control (VC).
  • hGAA protein is 2.48 fold higher when expressed from M4 as compared to Actus 101.
  • Fig. 17B shows total protein of hGAA activity present in the serum following administrations of M4 from two different lots as compared to Actus 101 and a vehicle control (VC) 4 weeks post injection.
  • VC vehicle control
  • FIGs 18A-18C show performance of wild type (pM3-NCBI) & Actus 101 hGAA proteins in mouse heart at 4 weeks post vector injection.
  • Fig. 18A is a bar graph showing the hGAA uptake following administration of the indicated constructs.
  • Fig. 18B is a bar graph showing the hGAA activity following administration of the indicated constructs.
  • Fig. 18C is a bar graph showing the glycogen levels following administration of the indicated constructs. Actus 101 performs better than the M3 construct in mouse hGAA activity (Fig. 18B) and glycogen reduction (Fig. 18C) in heart; this is in stark contrast to the M4 construct, which performs better than Actus 101.
  • FIG. 19 shows 4MU activity assay for hGAA activity at 4 weeks post transduction in mouse sera with the indicated construct. M4 performs better that Actus 101 in promoting GAA activity.
  • FIG. 20 shows liver retention observed following injection with saline (control), Actus 101, or M4. Liver retention appeared to be comparable between Actus 101 and M4.
  • FIGs 21A-21D show analyses of hGAA target tissue uptake.
  • Fig. 21 A shows expression of GAA activity following administrations of M4, Actus 101 and a saline control in the heart.
  • Fig. 2 IB shows expression of GAA activity following administrations of M4, Actus 101 and a saline control in the diaphragm.
  • Fig. 21C shows expression of GAA activity following administrations of M4, Actus 101 and a saline control in the quadriceps muscle.
  • Fig. 21D shows expression of GAA activity following administrations of M4, Actus 101 and a saline control in the soleus muscle.
  • FIG. 22 presents western blots showing the hGAA expression from vehicle control (VC), Actus 101, and various M4 constructs, Seql2 (SEQ ID NO: 30), Seq99 (SEQ ID NO: 29), Seq3 (SEQ ID NO:28), and SeqlOO (SEQ ID NO: 27) at 7, 14 and 21 days post infection.
  • Low and high doses were administered to GAA-KO mice. Levels were assessed at the days indicated.
  • SeqlOO results in a higher expression level that persists for a longer period of time as compared to VC, Actus 101 and the other indicated M4 constructs.
  • “H ST 1” and “H ST 2” refer to HIGH DOSE STUDY 1 and HIGH DOSE STUDY 2, respectively.
  • SEQ ID NO: 27, 28, 29, 30 are the plasmids for expression of the rAAV vectors expressing a GAA polypeptide having the sequence of SEQ ID NO: 1, where the rAAV vectors comprise codon optimized nucleic acid sequences selected from: SEQ ID NO: 3 (SeqlOO), SEQ ID NO: 4 (Seq3), SEQ ID NO:7 (Seql2), SEQ ID NO: 13 (Seq99).
  • FIG. 23 shows hGAA levels in GAA-KO mouse at 21 days post administration of the indicated constructs. SeqlOO results in a higher expression level of hGAA in the sera (top western blot) and liver (bottom western blot) at 21 days post administration as compared to VC, Actus 101 and the other indicated M4 constructs.
  • FIG. 24 shows normalized hGAA RNA levels in the liver of GAA-KO mice at 21 days post administration with the indicated constructs. SeqlOO results in a higher expression level of hGAA RNA in the sera at 21 days post administration as compared to VC, Actus 101 and the other indicated M4 constructs.
  • FIG. 25 presents a western blot showing GAA uptake in the indicated target tissue (i.e., heart or diaphragm) at 21 days post administration with the indicated constructs. SeqlOO results in a higher expression level of hGAA in each tissue at 21 days post administration as compared to VC, Actus 101 and the other indicated M4 constructs.
  • FIGs 26A and 26B present bar graphs showing GAA and glycogen levels in the indicated tissue of GAA-KO mice at 21 days post administration
  • FIG. 26A shows GAA activity in the indicated tissue of GAA-KO mice at 21 days post administration with the indicated constructs. SeqlOO results in a higher expression level of hGAA in each tissue at 21 days post administration as compared to VC, Actus 101 and the other indicated M4 constructs.
  • FIG. 26B shows glycogen in the indicated tissue of GAA-KO mice at 21 days post administration mice with the indicated constructs. SeqlOO results in a higher level of glycogen clearance in each tissue at 21 days post administration as compared to VC, Actus 101 and the other indicated M4 constructs.
  • FIG. 27 presents a western blot showing hGAA expression in GAA-KO mice over time. SeqlOO results in a higher expression level of hGAA in at day 7 and 14 post administration as compared to VC, Actus 101 and the other indicated M4 constructs.
  • FIG. 28 presents a bar graph showing the results of a 4MU assay in GAA-KO mice 21 days post administration. SeqlOO results in a higher expression level of hGAA in at day 21 post administration as compared to VC, Actus 101 and the other indicated M4 constructs.
  • FIG. 29 is a schematic that shows a number of modified GAAs, showing a construct comprising (i) a GAA-signal peptide, or portion thereof, and (ii) a heterologous signal peptide, attached to (iii) a GAA polypeptide.
  • a N-terminal truncated GAA polypeptide beginning at amino acid 57 is shown as an exemplary GAA polypeptide, however, any N-terminal truncated GAA polypeptide disclosed in Table 1 can be used.
  • FIG. 30 presents a western blot showing hGAA expression in GAA-KO mice 4 weeks following administration of the indicated constructs.
  • Balck arrow indicates GAA expression.
  • Gray triangle indicates a non-specific band.
  • FIG. 31 presents a bar graph showing total GAA protein in serum of GAA-KO mice 4 weeks following administration of the indicated constructs. Saline is used a control.
  • FIG. 32 presents a bar graph showing total GAA activity in serum of GAA-KO mice 4 weeks following administration of the indicated constructs. Saline is used a control. 4MU activity in the serum is consistent with GAA expression levels.
  • FIG. 33 presents a bar graph showing total GAA activity in the heart of GAA-KO mice 4 weeks following administration of the indicated constructs. Saline is used a control. 4MU activity in the heart is consistent with GAA expression levels and expression of the construct achieved wild-type levels.
  • FIG. 34 presents a bar graph showing total glycogen levels in the heart of GAA-KO mice 4 weeks following administration of the indicated constructs. Saline is used a control. Glycogen levels in the heart is consistent with GAA expression levels and expression of the construct achieved wild- type levels.
  • FIG. 35A presents a western blot showing total GAA activity in the liver of GAA-KO mice 4 weeks following administration of the indicated constructs.
  • FIG. 35B presents a bar graph showing total GAA activity in the heart of GAA-KO mice 4 weeks following administration of the indicated constructs. Saline is used a control. Reduced retention of modified GAA in the liver is observed.
  • FIG. 36 presents a table showing the level of GAA in serum, GAA activity in serum and heart, glycogen level in heart, and GAA levels retained in liver in mice following administration of indicated AAV (left column).
  • FIG. 37 presents a schematic of modified constructs.
  • Mod- Actus is the Actus construct modified to remove wtAAV DNA sequences 5’ and 3’ to the ITRs.
  • Mod-P072 is the P072 construct modified to replace the 5’UTR with a 5’UTR+intron sequence, remove the 3’UTR, and add a SV40 bi-directional polyA sequence.
  • Mod-P092 is the P092 construct modified to replace the 5’UTR with a 5’UTR+intron sequence, remove the 3’UTR, and add a SV40 bi-directional polyA sequence.
  • Mod- 072 and mod-092 are also modified to remove wtAAV DNA sequences 5’ and 3’ to the ITRs.
  • FIGs 38A and 38B present bar graphs showing GAA expression in huh7 cell culture for indicated AAVs.
  • FIG. 38A shows GAA activity in huh7 cell lysates.
  • FIG. 38B shows GAA activity in huh7 cell supernatants.
  • Mod-P072 secretes that highlest level of GAA into the supernatant.
  • Mod- Actus promotes that highest GAA activity in cells.
  • FIGs 39A-39C present data showing in vivo expression of indicated AAVs at various levels in wild type mice (C57BL/6J).
  • FIG. 39A is a graph showing GAA activity in serum at various weeks post administration in male mice.
  • FIG. 39B is a graph showing GAA activity in serum at various weeks post administraton in female mice.
  • FIG. 39C is a graph showing GAA activity in serum at various weeks post administraton in male and female mice (total). Mod-P072 achieves the highest GAA activity levels in serum of mice 4 weeks post administration.
  • FIGs 40A-40C present bar graphs representing semi-quantitative analysis of GAA level western blots in liver, heart and quadriceps tissue following in vivo expression of indicated AAVs at various levels in wild type mice (C57BL/6J).
  • FIG. 40A is a graph showing GAA levels in liver tissue in male and female mice.
  • FIG. 40B is a graph showing GAA levels in heart tissue in male and female mice.
  • FIG. 40C is a graph showing GAA levels in quadriceps tissue in male and female mice.
  • Mod- Actus achieves the highest GAA uptake in liver tissue post administration.
  • Mod-P072 achieves the highest GAA uptake in heart and quadriceps tissue post administration.
  • FIG. 41 present a bar graph glycogen levels in heart tissue following administration of Actus 101, pP110, and pP113 at the indicated dose. A greater reduction in glycogen in the cells was observed following administration of pP110 as compared to Actus 101 or pP113. Saline is used a control.
  • FIG. 42 present a bar graph glycogen levels in heart tissue following administration of M4, pP065, pP072 and pP092 at the indicated dose. Higher doses of pP065 and pP072 resulted in the greatest reduction of glycogen levels in the cell. Saline is used a control.
  • the technology described herein is directed to recombinant AAV (rAAV) vectors and constructs for rAAV for delivering a GAA polypeptide to a subject in the methods to treat Pompe Disease, where the heterologous nucleic acid encoding GAA polypeptide is codon optimized to reduce an immune response and for enhanced and improved efficiency of expression in human subjects.
  • rAAV recombinant AAV
  • the rAAV constructs described herein for delivering a GAA polypeptide to a subject comprise improvements, such as but not limited to, a codon optimized nucleic acid sequence encoding a GAA polypeptide, where the codon optimized nucleic acid sequence encoding the GAA polypeptide is modified include features for example, (i) enhanced expression in vivo, (ii) to reduce CpG islands and/or to eliminate CG dinucleotide content, (iii) modification of STOP sequences or elimination of alternative reading frames (ARF), and (iv) to reduce the innate immune response. Or using a wildtype GAA modified to enhance expression.
  • a codon optimized nucleic acid sequence encoding a GAA polypeptide where the codon optimized nucleic acid sequence encoding the GAA polypeptide is modified include features for example, (i) enhanced expression in vivo, (ii) to reduce CpG islands and/or to eliminate CG dinucleotide content, (iii) modification of ST
  • the rAAV constructs described herein for delivering a GAA polypeptide to a subject comprise improvements such as, e.g., incorporation of a 5’ UTR located between the nucleic acid expressing the GAA polypeptide and the liver specific promoter, and use of specific terminator sequences 3’ nucleic acid expressing the GAA polypeptide, such as, e.g., specific poly A sequences and/or terminator sequences, multiple polyA sequences, etc.
  • rAAV recombinant AAV
  • targeted viral vectors e.g., using rAAV vectors as an exemplary example, that comprise a nucleotide sequence containing inverted terminal repeats (ITRs), a liver specific promoter, a heterologous gene, a poly-A tail and potentially other regulator elements for use to treat Pompe disease, where the heterologous gene is human GAA, and wherein the vector, e.g., rAAV can be administered to a patient in a therapeutically effective dose that is delivered to the appropriate tissue and/ or organ for expression of the heterologous gene and treatment of the disease, e.g., Pompe disease.
  • ITRs inverted terminal repeats
  • a heterologous gene e.g., rAAV can be administered to a patient in a therapeutically effective dose that is delivered to the appropriate tissue and/ or organ for expression of the heterologous gene and treatment of the disease, e.g., Pompe disease.
  • AAV adenovirus associated vector comprising in its genome: (a) 5’ and 3’ AAV inverted terminal repeats (ITR) sequences, and (b) located between the 5’ and 3’ ITRs, a heterologous nucleic acid sequence encoding a polypeptide comprising an alpha-glucosidase (GAA) polypeptide, wherein the heterologous nucleic acid is operatively linked to a liver-specific promoter as disclosed herien.
  • ITR inverted terminal repeats
  • GAA alpha-glucosidase
  • the heterologous nucleic acid sequence encodes a GAA polypeptide comprising a secretory signal fused to the GAA polypeptide, wherein the secretory signal (also referred to herein as “signal peptide”) is the endogenous GAA polypeptide, or an exogenous GAA polypeptide.
  • the nucleic acid sequence encoding the GAA polypeptide is the human GAA gene or a human codon optimized GAA gene (coGAA) or a modified GAA nucleic acid sequence.
  • the nucleic acid encoding the human GAA protein is selected from any of SEQ ID NO: 1-18, or a functional variant having least 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 98% sequence identity to any of SEQ ID NO: 1-18.
  • GAA expressed that comprises at least a signal peptide that promotes secretion of GAA polypeptide from the liver is expressed as a fusion protein comprising at least a signal peptide that promotes secretion of the GAA polypeptide from the liver.
  • the liver specific promoter expresses the hGAA polypeptide preferentially in the liver.
  • the AAV vector comprises at least one capsid protein targeting the liver.
  • one aspect of the technology relates to a method to treat Pompe disease using a rAAV vector comprising a capsid, and within its capsid, a nucleotide sequence referred to as the “rAAV vector genome”.
  • the rAAV vector genome (also referred to as “rAAV genome) includes multiple elements, including, but not limited to two inverted terminal repeats (ITRs, e.g., the 5’-ITR and the 3 ’-ITR), and located between the ITRs are additional elements, including a promoter, a heterologous gene encoding a GAA polypeptide and a poly-A tail, where the heterologous gene encoding a GAA polypeptide is codon optimized, e.g., including but not limited to, reducing CpGs, reduced CpG islands, and minimizing or eliminating internal start codons.
  • ITRs inverted terminal repeats
  • additional elements including a promoter, a heterologous gene encoding a GAA polypeptide and a poly-A tail, where the heterologous gene encoding a GAA polypeptide is codon optimized, e.g., including but not limited to, reducing CpGs, reduced CpG islands, and minimizing or eliminating
  • the rAAV genome disclosed herein comprises a 5’ ITR and 3’ ITR sequence, and located between the 5 ’ITR and the 3’ ITR, a promoter, e.g., a liver specific promoter sequence as disclosed herein, which operatively linked to a heterologous nucleic acid encoding a nucleic acid encoding an alpha-glucosidase (GAA) polypeptide, where the heterologous nucleic acid is codon optimized as disclosed herein, and where there is a 5’ UTR located between the nucleic acid encoding a GAA polypeptide and the liver specific promoter sequence. In some instances, there is also a 3’ UTR.
  • a promoter e.g., a liver specific promoter sequence as disclosed herein, which operatively linked to a heterologous nucleic acid encoding a nucleic acid encoding an alpha-glucosidase (GAA) polypeptide, where the heterologous nucleic acid is cod
  • the UTR can contain an intron.
  • the heterologous nucleic acid sequence can optionally further comprise one or more of the following elements: an intron sequence, a nucleic acid encoding a secretory signal peptide, which can be an endogenous signal peptide (SP) or a heterologous SP as disclosed herein, a poly A sequence, and a terminator sequence.
  • the 5’ UTR sequence comprises SEQ ID NO: 41, or comprises SEQ ID NO: 40, or a sequence having at least 85%, or at least 90% or more sequence identity to SEQ ID NOs: 40 or 41.
  • the poly A sequence is a full length HGH poly A sequence comprising SEQ ID NO: 42, or a sequence having at least 85%, or at least 90% or more sequence identity to SEQ ID NO: 42.
  • the terminator sequence is a reverse RNA pol II terminator sequence.
  • a reverse RNA pol II terminator sequence comprises sequence SEQ ID NO: 45, or a sequence having at least 85%, or at least 90% or more sequence identity to SEQ ID NO: 45.
  • the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full-length GAA polypeptide, e.g., beginning at residue 28 of SEQ ID NO: 1.
  • the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a truncated GAA polypeptide, such as, for example, beginning at amino acid residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74 and/or a C-terminal truncation beginning at residues 779, 790, 791, 792, 793 and 796 of SEQ ID NO: 1, or a GAA polypeptide that has at least 80%, or at least 85%, or at least 90% or at least 95% sequence identity to SEQ ID NO: 1 over the amino acid residues 35-952, 40-952, 50-952, 57- 952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779-952, 790-952, 791-952, 792-952, 793-952 and 796-952 of SEQ ID NO: 1.
  • GAA alpha-glucosidas
  • the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full-length GAA polypeptide (e.g., residues 28-952 of SEQ ID NO: 1), or a truncated GAA polypeptide, e.g., a GAA polypeptide beginning at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74 of SEQ ID NO: 1 and/or a second truncation starting at residues 779, 790, 791, 792, 793 and 796 of SEQ ID NO: 1) that has an endogenous GAA signal peptide attached to the N-terminal of the GAA polypeptide, e.g., comprises endogenous signal peptide comprising residues of SEQ ID NO: 59.
  • GAA alpha-glucosidase
  • the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full- length GAA polypeptide (e.g., residues 28-952 of SEQ ID NO: 1), or a truncated GAA polypeptide, e.g., a GAA polypeptide beginning at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793 and 796 of SEQ ID NO: 1, that has a heterologous signal peptide attached to the N- terminal of the full-length, or truncated GAA polypeptide.
  • GAA alpha-glucosidase
  • the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full-length GAA polypeptide (e.g., residues 28-952 of SEQ ID NO: 1), or a N- terminal truncated GAA polypeptide, e.g., a GAA polypeptide beginning at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793 and 796 of SEQ ID NO: 1, and also encodes a GAA-signal peptide or a portion or fragment thereof, and a heterologous signal peptide attached to the N-terminal of the full-length, or truncated GAA polypeptide.
  • GAA alpha-glucosidase
  • the GAA polypeptide is a N-terminal truncated GAA polypeptide, with the truncation beginning at any amino acids 29-35 of SEQ ID NO: 1.
  • the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide comprises (i) a GAA-signal peptide, or a portion thereof, e.g., a N-terminal portion thereof, (ii) a portion of the GAA polypeptide, (e.g., any portion of residues 28-56 of SEQ ID NO: 1) (iii) a heterologous signal peptide as disclosed herein, and (iv) a GAA polypeptide, e.g., a N- terminal truncated GAA polypeptide, e.g., a GAA polypeptide beginning at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790
  • the GAA polypeptide can comprise a C-terminal truncation of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least between 5-10, or between 10-20, or between 20-30 amino residues at the C-termins of the GAA polypeptide.
  • Exemplary heterologous signal peptides are disclosed herein, including, but not limited to, signal peptides comprising amino acids selected from any of SEQ ID NO: 60-78.
  • GAA Alpha-glucosidase
  • the GAA gene (NM 000152.3) is approximately 18.3 kilobases (kb) long and contains 20 exons (Dasouki et al. 2014). Its complementary DNA has 2,859 nucleotides of coding sequence which encode the immature 952 amino acid enzyme. GAA is synthesized as a membrane bound, catalytically inactive (with respect to the natural substrate glycogen) precursor which is sequestered in the endoplasmic reticulum. It undergoes sugar chain modification in the Golgi complex, followed by transport into the (minor) secretory pathway, or into lysosomes where it is trimmed in a stepwise process at both the amino-and carboxyl-termini.
  • GAA catalyzes the hydrolysis of al— >4 glucosidic linkages in glycogen in the low potential hydrogen (pH) environment to glucose. Specificity for the natural substrate (glycogen) is gained during its maturation.
  • GAA1, GAA2, and GAA4 Many normal allelic variants exist in GAA and are responsible for the three known alloenzymes (GAA1, GAA2, and GAA4). More than 450 mutations in GAA have been reported in individuals with Pompe disease. Nonsense mutations, large and small gene rearrangements, and splicing defects have been observed with many mutations being potentially specific to families, geographic regions, or ethnicities. Combinations of mutations that result in either complete or nearly complete absence of GAA enzyme activity (typically ⁇ 1% of normal activity in skin fibroblasts) are seen more commonly in individuals with IOPD, whereas those combinations that allow partial enzyme activity (approximately 2-40% of normal activity in skin fibroblasts) typically have LOPD presentation.
  • GAA mutations result in messenger RNA instability and/or severely truncated acid a- glucosidase or an enzyme with markedly decreased activity. Dysfunction or absence of GAA leads to the accumulation of glycogen in lysosomes and in the cytoplasm in multiple tissues, resulting in the destruction of skeletal, smooth and cardiac muscle.
  • the effect of the enzyme deficiency may extend to vesicle systems that are linked to lysosomes and may also affect receptors, such as glucose transporter 4, that cycle through these organelles.
  • Evidence has also shown a failure of productive autophagy and the progressive accumulation of autophagosomes that disrupt the contractile apparatus in muscle fibers, which correlated with a lack of correction of skeletal muscle during ERT.
  • Alpha-glucosidase (GAA) polypeptide is a member of family 31 of glycoside hydrolyases. Human GAA is synthesized as a 110 kDal precursor (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The mature form of the enzyme is a mixture of monomers of 70 and 76 kDal (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The precursor enzyme has seven potential glycosylation sites and four of these are retained in the mature enzyme (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The proteolytic cleavage events which produce the mature enzyme occur in late endosomes or in the lysosome (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31).
  • the rAAV vector genome can encode a GAA polypeptide can include, for example, amino acid residues 40-952 of human GAA, or a smaller portion, such as amino acid residues 40-790.
  • the native GAA gene encodes a precursor polypeptide which possesses a signal sequence and an adjacent putative trans-membrane domain, a trefoil domain (PF AM PF00088) which is a cysteine-rich domain of about 45 amino acids containing 3 disulfide linkages (Thim (1989) FEBS Lett. 250:85), the domain defined by the mature 70/76 kDal polypeptide, and the C-terminal domain. It has been reported that both the trefoil domain and the C-terminal domain are required for the production of functional GAA, and that it is possible that the C-terminal domain interacts with the trefoil domain during protein folding perhaps facilitating appropriate disulfide bond formation in the trefoil domain.
  • the human GAA protein expressed by the AAV comprises amino acids of SEQ ID NO: 1, or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical to SEQ ID NO: 1.
  • the hGAA polypeptide comprises a signal peptide (SP).
  • SP signal peptide
  • the human GAA protein expressed by the AAV comprises amino acids of SEQ ID NO: 1, or fragments or variants thereof, for example a human GAA protein beginning at any of residues selected from: 40,50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 1.
  • the invention relates to a GAA protein, where the SP is fused to N-terminal amino acid 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of human GAA of SEQ ID NO: 1.
  • the GAA polypeptide expressed by the AAV vector disclosed herein has at least 80%, or at least 85%, or at least 90% or at least 95% sequence identity to amino acid residues selected from: 28-952, 35-952, 40-952, 50-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779- 952, 790-952, 791-952, 792-952, 793-952 and 796-952 of SEQ ID NO: 1, and can further comprise a N-terminal signal peptide, where the signal peptide can be an endogenous GAA signal peptide, or a heterologous signal peptide as disclosed herein.
  • the human GAA protein expressed by the AAV comprises amino acids is a human GAA protein beginning at any of residues selected from: 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 1, or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical thereto.
  • the modified human GAA protein comprises a polypeptide with at least one modification selected from: H199R, R223H, V780I or H201L of SEQ ID NO: 1, or a variant of at least 80%, 90%, 95%, or 99% homology to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 amino acids of SEQ ID NO: 1 having at least one of these modification.
  • the modified human GAA protein comprises a polypeptide comprises at least two modifications selected from: H199R, R223H, V780I or H201L of SEQ ID NO: 1, or a variant of at least 80%, 90%, 95%, or 99% homology to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 concsecutive amino acids of SEQ ID NO: 1 having at least two of these modifications.
  • the modified human GAA protein comprises a polypeptide with three modifications selected from: H199R, R223H, V780I and H201L of SEQ ID NO: 1 (GAA-H199R-H201L-R223H or GAA-H199R- H201L-V780I), or a variant of at least 80%, 90%, 95%, or 99% homology to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 concecutive amino acids of SEQ ID NO: 1 having these three modifications.
  • the human modified GAA protein expressed by the AAV comprises a GAA polypeptide of SEQ ID NO: 1 as modified above, or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical to SEQ ID NO: 1, or a nucleic acid encoding such a sequence (SEQ ID NO: 3), or a fragment of SEQ ID NO: 1, wherein the fragment begins at any of residues selected from: 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of any of SEQ ID NO: 1 (modGAA; H199R, R223H, V780I) or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical to SEQ ID NO: 1, where there is R at amino
  • GAA is modified to add or remove glycosylation sites such as N- linked glycosylation sites, O-linked glycosylation sites or both.
  • the addition or removal of glycosylation sites are achieved by N-terminal deletions, C-terminal deletions, internal deletions, random point mutagenesis, or, site directed mutagenesis.
  • the exemplary GAA modification involve addition of one or more Asparagine (Asn) residue/s or, one or more mutation to yield Asparagine (Asn) residue/s or, deletion of one or more Asparagine (Asn) residue/s.
  • the modified human GAA protein comprises a deletion of the stretch of amino acids between and inclusive of 29-56 of SEQ ID NO: 1. In one embodiment, a modified human GAA protein comprising a deletion of the stretch of amino acids between and inclusive of 29-56 of SEQ ID NO: 1 is no longer maintained within the cell.
  • the modified human GAA protein comprises a polypeptide with at least one modification selected from Table 12. Modifications listed on Table 12 are commonly identified GAA polymorphisms but are not associated with a disease, e.g., Pompe disease.
  • the nucleic acids encoding a GAA protein disclosed herein e.g., SEQ ID NOS: 1-18 that are codon optimized GAA nucleic acid sequence, for example, which have been modified from the NCBI GAA sequence of NM 00152.5 to include, any one or more of (i) enhanced expression in vivo, (ii) reduce CpG islands or reduction or elimination of CG dinucleotides, (iii) to reduce the innate immune response, and (iv) to reduce or eliminate alternative reading frames (ARF), or open reading frames (ORF).
  • SEQ ID NOS: 1-18 that are codon optimized GAA nucleic acid sequence, for example, which have been modified from the NCBI GAA sequence of NM 00152.5 to include, any one or more of (i) enhanced expression in vivo, (ii) reduce CpG islands or reduction or elimination of CG dinucleotides, (iii) to reduce the innate immune response, and (iv) to reduce or eliminate alternative reading frames (AR
  • Exemplary codon optimized GAA nucleic sequences encompassed for use in the methods and rAAV compositions as disclosed herein can be selected from any of: SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 or SEQ ID NO: 18 as disclosed herein, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NOS: 1-18, where SEQ ID NO: 1-18 or variants of at least 80% sequence identity thereto encode GAA polypeptide, where amino acid at position 199 is R (199R); amino acid at position 233 is H (233H), and amino acid at position 780 is I (7801).
  • codon optimized GAA nucleic sequences encompassed for use in the methods and rAAV compositions as disclosed herein can be selected from any of: SEQ ID NO: 3 or SEQ ID NO: 4, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 4.
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence encoding a signal peptide (SP) fused in frame to the 5' terminus of a GAA nucleic acid sequence that encodes a GAA polypeptide or N- terminal truncated GAA polypeptide, as disclosed herein.
  • SP signal peptide
  • heterologous nucleic acid sequence encoding a signal peptide is fused in frame to the 5' terminus of a GAA nucleic acid sequence that encodes the GAA polypeptide or N-terminal truncated GAA polypeptide, so that both polypeptides are expressed from the rAAV genome when the rAAV vector transduces a mammalian cell.
  • SP signal peptide
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence comprising SEQ ID NO: 3, or a portion of SEQ ID NO: 3, where expression of a portion of the nucleic acid of SEQ ID NO: 3 produces a functional hGAA protein, and where the functional hGAA protein can comprise a N- terminal deletion of SEQ ID NO: 1, or a N-terminal and C-terminal truncation of SEQ ID NO: 1 as disclosed herein.
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence comprising SEQ ID NO: 3, or a nucleotides 82-2859 of SEQ ID NO: 3 or a nucleic acid having at least 85% sequence identity thereto, where nucleotides 1-81 of SEQ ID NO: 3 (corresponding to SEQ ID NO: 53) which encodes for a codon optimized hGAA signal peptide are replaced with the nucleic acid encoding a heterologous signal peptide as disclosed herein, e.g., selected from any of SEQ ID NOS: 54-58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises one or more base pair deletions at the 5’ of SEQ ID NO: 3.
  • the heterologous nucleic acid sequence in the AAV genome can comprise nucleotides selected from any of: 82-2859 of SEQ ID NO: 3, 82-2859bp of SEQ ID NO: 3, 103-2859bp of SEQ ID NO: 3, 118-2859 of SEQ ID NO: 3, 148-2859bp of SEQ ID NO: 3, 169-2859bp of SEQ ID NO: 3, 199-2859bp of SEQ ID NO: 3, 205-2859bp of SEQ ID NO: 3, 208-2859bp of SEQ ID NO: 3, 214-2859bp of SEQ ID NO: 3, 220-2859bp of SEQ ID NO: 3, 265-2859bp of SEQ ID NO: 3, 2335-2859bp of SEQ ID NO: 3, 2368-2859bp of SEQ ID NO: 3, 2371-2859bp of SEQ ID NO: 3, 2374-2859bp of SEQ ID NO:
  • the heterologous nucleic acid sequence in the AAV genome can comprise nucleotides selected from any of: 82-2859 of SEQ ID NO: 3, 82-2859bp of SEQ ID NO: 3, 103-2859bp of SEQ ID NO: 3, 118-2859 of SEQ ID NO: 3, 148-2859bp of SEQ ID NO: 3, 169-2859bp of SEQ ID NO: 3, 199-2859bp of SEQ ID NO: 3, 205-2859bp of SEQ ID NO: 3, 208-2859bp of SEQ ID NO: 3, 214-2859bp of SEQ ID NO: 3, 220-2859bp of SEQ ID NO: 3, 265-2859bp of SEQ ID NO: 3, 2335-2859bp of SEQ ID NO: 3, 2368-2859bp of SEQ ID NO: 3, 2371-2859bp of SEQ ID NO: 3, 2374-2859bp of SEQ ID NO: 3, 2377
  • the truncated GAA can be wildtype or codon optimized.
  • exemplary 5’ deletions of SEQ ID NO: 3 are disclosed in Table 1 herein, which encode for N-terminal truncated GAA polypeptide.
  • the 5’ of the 5’ deletions of SEQ ID NO: 3 can be attached to the 3’ of a nucleic acid encoding a signal peptide as disclosed herein, e.g., any signal peptide selected from any of SEQ ID NOS: 53-58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.
  • Table 1 Table of exemplary N-terminal truncations of GAA polypeptide of SEQ ID NO:
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 103-2859 of SEQ ID NO: 3, where attached to the 5’ of said sequence, there is nucleic acid encoding a wildtype or codon optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53), or fragment thereof, or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any of SEQ ID NOS: 54-58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.
  • a wildtype or codon optimized hGAA signal peptide i.e., a nucleic acid comprising SEQ ID NO: 53
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 118-2859 of SEQ ID NO: 3, where attached to the 5’ of said sequence, there is nucleic acid encoding a wildtype or codon optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any of SEQ ID NOS: 54-58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.
  • a wildtype or codon optimized hGAA signal peptide i.e., a nucleic acid comprising SEQ ID NO: 53
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 148-2859 of SEQ ID NO: 3, where attached to the 5’ of said sequence, there is nucleic acid encoding a wildtype or codon optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any of SEQ ID NOS: 54-58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.
  • a wildtype or codon optimized hGAA signal peptide i.e., a nucleic acid comprising SEQ ID NO: 53
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 169-2859 of SEQ ID NO: 3, attached to the 5’ of said sequence, there is nucleic acid encoding, e.g., a codon optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any of SEQ ID NOS: 54-58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.
  • a codon optimized hGAA signal peptide i.e., a nucleic acid comprising SEQ ID NO: 53
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 199-2859 of SEQ ID NO: 3, where attached to the 5’ of said sequence, there is nucleic acid encoding a wildtype or codon optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53), or fragement thereof and/or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any of SEQ ID NOS: 54-58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.
  • a wildtype or codon optimized hGAA signal peptide i.e., a nucleic acid comprising SEQ ID NO
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 205-2859 or nucleotides 208-2859, or nucleotides 214-2859 of SEQ ID NO: 3, where attached to the 5’ of said sequence, there is nucleic acid encoding a wild-type or codon optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) and/or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any of SEQ ID NOS: 54-58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 220-2859 or nucleotides 208-2859, or nucleotides 214-2859 of SEQ ID NO: 3, where attached to the 5’ of said sequence, there is nucleic acid encoding a wild-type or codon optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) and/or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any of SEQ ID NOS: 54-58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises any of: nucleotides 265-2859 of SEQ ID NO: 3, or nucleotides 2335-2859 of SEQ ID NO: 3, or nucleotides 2368-2859 of SEQ ID NO: 3, or nucleotides 2371-2859bp of SEQ ID NO: 3, where attached to the 5’ of said sequence, there is nucleic acid encoding a wildtype or codon optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53), or fragment thereof, and/or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any of SEQ ID NOS: 54-58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that encodes a signal sequence as disclosed herein, and a GAA polypeptide or a N-terminal truncated GAA polypeptide, where the GAA polypeptide begins at amino acid residues selected from any of: 28, 35, 40, 50, 57, 57, 68, 69, 70, 72, 74, 89, 779, 790, 791, 792, 793 or 796, and optionally, where the GAA polypeptide also has a C-terminal deletion of at least about 10, or about 20, or about 30, or about 40, or about 50, or about 60, or about 70, or about 80, or about 90, or about 100, or about 110, or more than 110 amino acid residues from the C-terminus of SEQ ID NO: 1.
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that encodes a signal sequence as disclosed herein, and a GAA polypeptide or a N-terminal truncated GAA polypeptide, where the GAA polypeptide begins at amino acid residues selected from any of: 28, 35, 40, 50, 57, 57, 68, 69, 70, 72, 74, 89, 779, 790, 791, 792, 793 or 796, and where the C- terminal of the GAA polypeptide occurs at any residue after amino acid residue 500, 600, 700, 800, 842, 852, 862, 875, 885, 895, 900, 905, 915, 920, 925, 930, 935, 940, 945, 950, 951 of SEQ ID NO.
  • the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that (i) encodes a wildtype or codon optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53), or fragment thereof and/or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any of SEQ ID NOS: 54-58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity to SEQ ID NOS 53-58, 67, 72 or 65, and (ii) encodes a GAA polypeptide, the GAA polypeptide encoded by a nucleic acid sequence beginning at base pairs selected from any of: 82, 103,
  • SP Signal Peptide
  • the native GAA signal peptide is not cleaved in the ER thereby causing native GAA polypeptide to be membrane bound in the ER (Tsuji et al. (1987) Biochem. Int. 15(5):945-952). Disruption of the membrane association of GAA can be accomplished by replacing the endogenous GAA signal peptide (and optionally adjacent sequences) with an alternate signal peptide for GAA.
  • the rAAV vector and rAAV genome useful in the methods to treat Pompe disease as disclosed herein further comprises a heterologous nucleic acid encoding a GAA polypeptide to be transferred to a target cell, attached to a heterologous nucleic acid sequence that encodes a heterologus signal peptide in the place of the endogenous GAA signal peptide.
  • the heterologous nucleic acid encoding a GAA polypetide including N-terminal truncations of the GAA polypeptide, which is is operatively associated with the segment encoding the secretory signal peptide, such that upon transcription and translation a fusion polypeptide is produced containing the secretory signal sequence operably associated with (e.g., directing the secretion of) the GAA polypeptide or N-terminal truncated GAA polypeptide.
  • the endogenous signal peptide of hGAA i.e., amino acids 1-27 of SEQ ID NO: 1 (encoded by a codon optimized nucleic acid sequence corresponding to SEQ ID NO: 59)
  • a heterologous signal peptide also referred to herein as a “signal sequence” or “leader sequence” of SEQ ID NO: 60 (201 IgG signal peptide), or an IL2 wild type signal peptide (SEQ ID NO: 61), modified IL2 signal peptide (SEQ ID NO: 62), A2M signal peptide (SEQ ID NO: 63), or PZP signal peptide (SEQ ID NO: 64), or artificial signal peptide (SEQ ID NO: 65), or cathpetsin L signal peptide (SEQ ID NO: 66) or signal peptides at least 90% sequence identity to SEQ ID NOS: 60-66.
  • a heterologous signal peptide also referred to herein as a “signal sequence” or
  • the AAV vector encodes a GAA polypeptide that comprises the endogenous GAA signal peptide (e.g., amino acids 1-27 of SEQ ID NO: 1 (also referred to as “innate GAA” or “cognate GAA” signal peptide).
  • the AAV vector encodes a GAA polypeptide that comprises the endogenous GAA signal peptide (e.g., amino acids 1-27 of SEQ ID NO: 1, or a portions thereof) and an additional heterologous (i.e., non native) signal sequence.
  • the GAA polypeptide or N-terminal GAA polypeptide disclosed herein that lacks the endogenous signal peptide of amino acids 1-27 of GAA of SEQ ID NO: 1 is fused to a heterolous signal peptide (also referred to as “secretory signal peptide”).
  • the heterologous nucleic acid sequence encodes a GAA polypeptide comprising a signal peptide fused to the GAA polypeptide, wherein the signal peptide is a heterologous GAA polypeptide.
  • the heterologous nucleic acid encoding a GAA polypeptide fused to a heterologous (e.g., exogenous or non-GAA) signal peptide can further comprise, at the 5’ end, a nucleic acid sequence encoding a portion of the cognate (e.g., endogenous) GAA signal peptide, e.g., encoding at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26, or the entire GAA signal peptide, e.g., or at least about 1-27 concecutive amino acids of the endogenous GAA signal peptide.
  • a nucleic acid sequence encoding a portion of the cognate (e.g., endogenous) GAA signal peptide, e.g., encoding at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at
  • the heterologous nucleic acid sequence can comprise, in the 5’ to 3’ direction, a nucleic acid sequence encoding the entire GAA signal peptide of SEQ ID NO: 59 or a portion of the endogenous GAA signal peptide of SEQ ID NO: 59, a nucleic acid sequence encoding a heterologous signal peptide (e.g., non-GAA signal peptide) and a a nucleic acid sequence encoding a GAA polypeptide, sich as the wild-type nucleic acid sequences, or a sequence encoding at least 1-3 amino acid variants, or a codon-optimized nucleic acid sequence encoding a GAA polypeptide, including N-terminal GAA truncations.
  • the nucleic acid sequence encoding the GAA polypeptide encodes a N-terminal truncated GAA polypeptide, such as those disclosed in Table 1 herein.
  • the heterologous nucleic acid sequence can comprise, in the 5’ to 3’ direction, a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, the entire GAA signal peptide of SEQ ID NO: 59 or a portion of the endogenous GAA signal peptide of SEQ ID NO: 59 and a wildtype or codon-optimized nucleic acid sequence encoding a GAA polypeptide, including N- terminal GAA truncations.
  • GAA polypeptide there can be a portion of the GAA polypeptide, e.g., any 1 amino acid, or 2 amino acids or more than 2 concecutive amino acids located in the region of amino acids 28-56 of SEQ ID NO: 1) located between the GAA signal peptide (or portion thereof), and the heterologous signal peptide and upstream (e.g., N-terminal) of a N-terminal truncated GAA polypeptide.
  • the heterologous nucleic acid sequence can comprise, in the 5’ to 3’ direction, (i) the entire full length GAA signal peptide or a portion thereof as disclosed herein, (ii) a portion of at the the GAA polypeptide, e.g., amino acids 28- 35 of SEQ ID NO: 1 , amino acid 28 of SEQ ID NO: 1 , or amino acids 28-31 of SEQ ID NO: 1 , (iii) a heterologous signal peptide, and (iv) a GAA polypeptide, e.g., a N-terminal truncated GAA polypeptide beginning at amino acid 57 of SEQ ID NO: 1.
  • the portion of at the the GAA polypeptide located between the GAA polypeptide and the heterologous signal peptide can be any length, e.g., at least 1, 2, 3, 4,5 ,6, 7, 8, 9, 10, 10-12, 12,-14, 14,-16, 16-18, 18-20, or more than 20 amino acids of residues 28-56 of SEQ ID NO: 1, and the N-terminal GAA polypetide does not need to start at the next or sequential amino acid of the earlier GAA polypeptide portion. Certain of the amino acids in this 28-56 amino acid region can cause cellular retention. In one embodiment, those amino acids are removed or replaced.
  • the nucleic acid sequence that encodes a GAA-signal peptide encodes at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26, or at least about 1-27 concecutive amino acids (i.e., the full GAA signal peptide sequence), or non-concecutive amino acids of the endogenous GAA signal peptide of SEQ ID NO: 59.
  • the nucleic acid sequence encoding a GAA-signal peptide encodes a GAA signal peptide that comprises at least one deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14, or at least 15, or at least 16, or at least 17, or at least 18, or at least 19, or at least 20 amino acids of SEQ ID NO: 59, where the one or more deletions can be concecutive, or non-concecutive deletions.
  • the nucleic acid sequence that encodes a GAA-signal peptide can comprise the entire nucleic acid of SEQ ID NO: 57 (encoding GAA signal peptide comprising amino acids 1-27 of SEQ ID NO: 59).
  • the nucleic acid sequence that encodes a GAA-signal peptide can comprise a portion of the nucleic acid sequence of SEQ ID NO: 53, e.g., portions of SEQ ID NO: 53 that are selected from concecutive bases of SEQ ID NO: 53 having the length of any of: l-3bp, l-4bp, l-5bp, l-6bp, l-7bp, l-8bp, l-9bp, l-10bp, 1-1 Ibp, l-12bp, l-13bp, 1- 14bp, l-15bp, l-16bp, l-17bp, l-18bp, l-19bp, l-20bp, l-21bp, l-22bp, l-23bp, l-24bp, l-25bp, 1- 26bp, l-27bp, l-28bp, l-29bp, l-30bp, l-33
  • the GAA signal peptide can comprise a nucleic acid that is a 21bp portion of SEQ ID NO: 53, where the 21bp can be any 21-concenceutive base pairs of SEQ ID NO: 53.
  • a l-21bp portion beginning at base pair 1 of SEQ ID NO: 53 would encode for a GAA-signal peptide comprising amino acids 1-7 of SEQ ID NO: 59
  • a 1-2 Ibp portion beginning at base pair 15 of SEQ ID NO: 53 would encode for a GAA-signal peptide comprising amino acids 5-12 of SEQ ID NO: 59.
  • a portion of the GAA signal peptide of SEQ ID NO: 59 is the N- terminal portion of SEQ ID NO: 59 (i.e., has a deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14 or at least 15 amino acids, or more than 15 amino acids at the C-terminal of SEQ ID NO: 59).
  • the nucleic acid encoding a heterologous signal peptide as disclosed herein can be inserted into the nucleic acid sequence encoding a GAA-signal peptide.
  • the insertion can occur at any location in the l-81bp of SEQ ID NO: 53.
  • a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein is inserted in a portion of the nucleic acid encoding a GAA-signal peptide, e.g., generating a chimeric signal peptide comprising, for example, a 5’ nucleic acid sequence encoding a portion of a GAA signal peptide (e.g., a portion of SEQ ID NO: 53, as discussed above) and attached to the 3’ of said sequence, a nucleic acid encoding a heterologous signal peptide as disclosed herein.
  • a heterologous signal peptiode can be inserted immediately following the N-terminal amino acids, e.g., after position 28, 29, 30, 31, 32 or 33.
  • the signal peptides serve a general purpose of assisting the secretion of the GAA polypeptide from the liver cells into the blood, where it can travel and be targeted to the lysosomes of mammalian cells, for example, human cardiac and skeletal muscle cells, as described herein.
  • a heterologous signal peptide is selected from any of: a AAT signal peptide, a fibronectin signal peptide (FN1), 201 signal peptide, wtIL2 signal peptide, mutIL2 signal peptide, A2M signal peptide, PZP signal peptide, or an active fragment of AAT, FN1, 201, wtIL2, mutIL2, A2M or PZP signal peptide having secretory signal activity.
  • the signal peptide is heterologous to (i.e., foreign or exogenous to) the polypeptide of interest.
  • a heterologous signal peptide is a fibronectin secretory signal peptide
  • the polypeptide of interest is not fibronectin.
  • the signal peptide is selected from any of: FN1, 201 signal peptide, wtIL2 signal peptide, mutIL2 signal peptide, A2M signal peptide, PZP signal peptide having secretory signal activity.
  • the signal peptide is not heterologous to GAA, i.e., the signal peptide is the GAA signal peptide (i.e., residues 1-27 of SEQ ID NO: 1, which the endogenous GAA polypeptide).
  • the endogenous GAA signal sequence of amino acids 1-27 of SEQ ID NO: 1 i.e., MGVRHPPCSHRLLAVCALVSLATAALL, SEQ ID NO: 59
  • MGVRHPPCSHRLLAVCALVSLATAALL SEQ ID NO: 59
  • leader peptide a different signal peptide
  • the endogenous signal peptide of GAA can be replaced with any of: (i) an IgGl signal peptide (referred to herein as a “201 signal peptide” or “2011p” having an amino acid sequence of: MEFGLSWVFLVALLKGVQCE (SEQ ID NO: 60) encoded by nucleic acid sequence SEQ ID NO: 54, (ii) wtIL2 Ip: MYRMQLLSCIALSLALVTNS (SEQ ID NO: 61) encoded by nucleic acid sequence SEQ ID NO: 55, or (iii) mutIL2 Ip: MYRMQLLLL/ALSLALVTNS (SEQ ID NO: 62) encoded by nucleic acid sequence SEQ ID NO: 56, (iv) A2M signal peptide MGKNKLLHPSLVLLLLVLLPTDA (SEQ ID NO: 63) encoded by nucleic acid sequence SEQ ID NO: 57, (iv) PZ
  • the endogenous GAA signal peptide (SEQ ID NO: 59) or a fragment or portion thereof remains present, and an additional signal peptide is added, e.g., any one or more of signal peptides AAT, FN1, 201 signal peptide, wtIL2 signal peptide, mutIL2 signal peptide, A2M signal peptide, PZP signal peptide, as disclosed herein.
  • the endogenous GAA signal peptide of amino acids 1-27 of SEQ ID NO: 1 i.e., MGVRHPPCSHRLLAVCALVSLATAALL, SEQ ID NO: 59
  • SEQ ID NO: 59 is replaced with a different or heterologous signal peptide.
  • the endogenous signal peptide of GAA can be replaced with any of the heterologous signal peptides selected from: (i) an IgGl signal peptide (referred to herein as a “201 signal peptide” or “20 lip” having an amino acid sequence of: MEFGLSWVFLVALLKGVQCE (SEQ ID NO: 60) encoded by nucleic acid sequence SEQ ID NO: 54, (ii) wtIL2 Ip: MYRMQLLSCIALSLALVTNS (SEQ ID NO: 61) encoded by nucleic acid sequence SEQ ID NO: 55, or (iii) mutIL2 Ip: MYRMQLLLL/ALSLALVTNS (SEQ ID NO: 62) encoded by nucleic acid sequence SEQ ID NO: 56, (iv) A2M signal peptide MGKNKLLHPSLVLLLLVLLPTDA (SEQ ID NO: 63) encoded by nucleic acid sequence SEQ ID NO:
  • the nucleic acid sequences in the rAAV vector or rAAV genome is a sequence selected from SEQ ID NO: 470-515.
  • the nucleic acid sequences in the rAAV vector or rAAV genome comprises at least a portion of a sequence selected from SEQ ID NO: 470-515 (i.e., a sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the sequence of SEQ ID NO: 470-515).
  • exemplary nucleic acid sequences in the rAAV vector or rAAV genome as disclosed herein are shown in exemplary constructs provided herein below:
  • pP065 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]- [(LSP:Liver Specific Promoter)]-[5’UTR]-[l-28aa GAA-SP]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]- [R-ITR], See, e.g., SEQ ID NO: 470.
  • pP066, is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]- [(LSP:Liver Specific Promoter)]-[5’UTR]-[l-28aa GAA-SP]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]- [R-ITR], See, e.g., SEQ ID NO: 471.
  • pP067 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]- [(LSP:Liver Specific Promoter)]-[5’UTR]-[aal from GAA-SP]-[28-31aa GAA]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 472.
  • pP068 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]- [(LSP:Liver Specific Promoter)]-[5’UTR]-[aal from GAA-SP]-[28-31aa GAA]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 473.
  • pP069 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[aal from GAA-SP from seql00]-[28-31aa GAA from seq3]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of seq3]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[ITR- neighborhood]-[R-ITR], See, e.g., SEQ ID NO: 474.
  • pP070 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[aal from GAA-SP]-[28-31aa GAA]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 475.
  • pP071 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]- [(LSP:Liver Specific Promoter)]-[5’UTR]-[l-24aa GAA]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 476.
  • pP072 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-24aa GAA]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 477.
  • pP073 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-24aa GAA]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 478.
  • pP074 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-24aa GAA]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 479.
  • pP075 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-23aa GAA]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 480.
  • pP076, is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-23aa GAA]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 481.
  • pP077 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-23aa GAA]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal [R-ITR], See, e.g., SEQ ID NO: 482.
  • pP078 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-23aa GAA]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 483.
  • pP079 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-2aa GAA]-[IL-2 signal sequence (Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 484.
  • pP080 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-2aa GAA]-[201Ig(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 485.
  • pP081 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-2aa GAA]-[IL-2 signal sequence(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]- [RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 486.
  • pP082 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-2aa GAA]-[201Ig(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 487.
  • pP083 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-4aa GAA]-[IL-2 signal sequence(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]- [RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 488.
  • pP084 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-4aa GAA]-[201Ig(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID No: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 489.
  • pP085 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-4aa GAA]-[IL-2 signal sequence(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]- [RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 490.
  • pP086, is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-4aa GAA]-[201Ig(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID No: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 491.
  • pP087 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-10aa GAA]-[IL-2 signal sequence(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 492.
  • pP088, is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-10aa GAA]-[201Ig(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 493.
  • pP089 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-10aa GAA]-[IL-2 signal sequence(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 494.
  • pP090 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-10aa GAA]-[201Ig(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO;l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 495.
  • pP091 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-27aa GAA]-[IL-2 signal sequence(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 496.
  • pP092 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-27aa GAA]-[201Ig(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 497.
  • pP093 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-27aa GAA]-[IL-2 signal sequence(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[ITR-neighborhood]-[R-ITR], See, e.g., SEQ ID NO: 498.
  • pP094 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-27aa GAA]-[201Ig(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 499.
  • pP098 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-24aa GAA]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 500.
  • pP099 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[(LSP:Liver Specific Promoter)]-[5’UTR]-[l-24aa GAA]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal and Terminator]-[RNA polymerase II transcriptional pause signal]-[R-ITR], See, e.g., SEQ ID NO: 501.
  • pP110 is a plasmid comprising in the 5’ to 3’ direction: [ITR2]-[LSP]-[l-28aa GAA]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA]-[ITR2], See, e.g., SEQ ID NO: 502.
  • pPl 11 is a plasmid comprising in the 5’ to 3’ direction: [ITR2]-[LSP]-[l-24aa GAA]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA]-[ITR2], See, e.g., SEQ ID NO: 503.
  • pPl 12 is a plasmid comprising in the 5’ to 3’ direction: [ITR2]-[LSP]-[l-27aa GAA]- [2011p(Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]- [3’UTR]-[hGH polyA]-[ITR2], See, e.g., SEQ ID NO: 504.
  • pP113 is a plasmid comprising in the 5’ to 3’ direction: [ITR2]-[LSP]-[l-24aa GAA]- [2011p]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA]-[ITR2], See, e.g., SEQ ID NO: 505.
  • pPl 14 is a plasmid comprising in the 5’ to 3’ direction: [ITR2]-[LSP]-[l-2aa GAA]-[IL-2 signal sequence (Metl removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO:l]-[3’UTR]-[hGH polyA]-[ITR2], See, e.g., SEQ ID NO: 506.
  • ⁇ pP150 is a plasmid comprising in the 5’ to 3’ direction: [ITR2]-[LSP]-[l-24aa GAA]- [201Ip]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA]-[ITR2], See, e.g., SEQ ID NO: 507.
  • pP151 is a plasmid comprising in the 5’ to 3’ direction: [ITR2]-[LSP]-[5’UTR]-[l-24aa GAA]-[201Ip]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA]-[ITR2], See, e.g., SEQ ID NO: 508.
  • pP152 is a plasmid comprising in the 5’ to 3’ direction: [ITR2]-[LSP]-[l-24aa GAA]- [201Ip]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA]-[ITR2], See, e.g., SEQ ID NO: 509.
  • pP153 is a plasmid comprising in the 5’ to 3’ direction: [ITR2]-[LSP]-[5’UTR]-[l-24aa GAA]-[201Ip]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA]-[ITR2], See, e.g., SEQ ID NO: 510.
  • pP155 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[fragment of P5]-[LSP]-[1- 24aa GAA]-[201Ip]-[GAA polypeptide starting at amino acid 57 of Seq ID NO;1]-[3’UTR]- [hGH polyA]-[R-ITR], See, e.g., SEQ ID NO: 511.
  • pP157 is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]-[fragment of P5]-[LSP]-[1- 28aa GAA from ACTUS]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]- [3’UTR]-[hGH polyA]-[R-ITR], See, e.g., SEQ ID NO: 512.
  • the exemplary constructs have codon optimized GAA, including codon optimized GAA signal peptide, or portion thereof, e.g., the GAA and/or GAA signal peptide is encoded by seq 100 (SEQ ID NO:3), or seq3 (SEQ ID NO:4), or a fragment thereof.
  • the GAA and/or GAA signal peptides, or portion thereof in the exemplary constructs are not codon optimized, e.g., the GAA and/or GAA signal peptide is encoded by SEQ ID NO:2 or fragment thereof.
  • the exemplary constructs described herein can be in a plasmid DNA backbone, or in a close ended linear duplexed DNA backbone or a precursor plasmid of close ended linear duplexed DNA backbone.
  • the exemplary constructs described herein comprise 5’UTRs as described in the instant application including but not limited to SEQ ID NO:40 or SEQ ID NO:41.
  • the nucleic acid encoding GAA the invention including but not limited to exemplary constructs have 130 bp ITRs.
  • the nucleic acid encoding GAA of the invention including but not limited to exemplary constructs have 145 bp ITRs.
  • exemplary nucleic acid sequences in the rAAV vector or rAAV genome as disclosed herein are shown in Table 10.
  • Table 10 Exemplary constructs encoding in a 5’ to 3’ direction a GAA-signal peptide, or portion thereof, a heterologous signal peptide and a GAA polypeptide (see, e.g., FIG. 29).
  • a GAA polypeptide that begins at amino acid 57 of SEQ ID NO: 1 is shown for exemplary purposes, however, any GAA polypeptide is envisoned, including any N-terminal truncation disclosed in Table 1 herein, as well as wild type GAA polypeptide, codon-optimized GAA polypeptides, ACTUS-101 GAA polypeptide, and N-terminal truncations thereof.
  • Hetero-SP refers to a heterologous signal peptide as disclosed herein
  • GAA-SP refers to the endogenous (cognate) signal peptide of GAA of SEQ ID NO: 59, or a portion thereof).
  • the contracts described in Table 10 achieve the titers described in Table 11 following in vivo administration at 4 weeks-post administration.
  • “Serum GAA” descibes the level of GAA expression found in the serum of the injected mice 4 weeks post administration
  • “Serum 4MU” describes the level of GAA activity found in the serum of the injected mice 4 weeks post administration
  • “Heart 4MU” describes the level of GAA activity found in the heart of the injected mice 4 weeks post administration
  • “Heart glycogen” describes the level of glucose found in the heart of the injected mice 4 weeks post administration
  • “Liver retention” descibes the level of GAA expression found in the liver of the injected mice 4 weeks post administration.
  • the GAA-signal peptide and/or heterologous signal peptide will be at the amino- terminus (N-terminus) of the GAA polypeptide (i.e., the nucleic acid segment encoding the signal peptide is 5' to the heterologous nucleic acid encoding the GAA peptide in the rAAV vector or rAAV genome as disclosed herein).
  • the signal peptide may be at the carboxyl-terminus or embedded within the GAA polypeptide, as long as the signal peptide is operatively associated therewith and directs secretion of the GAA polypeptide or GAA fusion polypeptide of interest (either with or without cleavage of the signal peptide from the GAA polypeptide) from the cell.
  • the signal peptide is operatively associated with the GAA polypeptide, including N-terminal truncated GAA polypeptides as disclosed in Table 1 herein, is targeted to the secretory pathway.
  • the signal peptide is operatively associated with the GAA polypeptide such that the GAA-polypeptide is secreted from the cell at a higher level (i.e., a greater quantity) than in the absence of the secretory signal peptide.
  • the GAA-polypeptide typically at least about 20%, 30%, 40%, 50%, 70%, 80%, 85%, 90%, 95% or more of the GAA-polypeptide is secreted from the cell when a signal peptide is attached as compared to in the absence of the attachment of a secretory signal peptide. In other embodiments, essentially all of the detectable polypeptide (alone and/or in the form of the fusion polypeptide) is secreted from the cell.
  • the polypeptide may be secreted into any compartment (e.g., fluid or space) outside of the cell including but not limited to: the interstitial space, blood, lymph, cerebrospinal fluid, kidney tubules, airway passages (e.g., alveoli, bronchioles, bronchia, nasal passages, etc.), the gastrointestinal tract (e.g., esophagus, stomach, small intestine, colon, etc.), vitreous fluid in the eye, and the cochlear endolymph, and the like.
  • any compartment e.g., fluid or space
  • the interstitial space e.g., blood, lymph, cerebrospinal fluid, kidney tubules, airway passages (e.g., alveoli, bronchioles, bronchia, nasal passages, etc.), the gastrointestinal tract (e.g., esophagus, stomach, small intestine, colon, etc.), vitreous fluid in the eye, and the co
  • a AAV expressing GAA useful in the methods to treat Pompe Disease as disclosed herein comprises a 5’ ITR and 3’ ITR sequence, and located between the 5’ITR and the 3’ ITR, a liver specific promoter operatively linked to a heterologous nucleic acid encoding a secretory peptide and nucleic acid encoding an alpha-glucosidase (GAA) polypeptide (i.e., the heterologous nucleic acid encodes a GAA polypeptide or N-terminal GAA polypeptide comprising a signal peptide-GAA polypeptide).
  • GAA alpha-glucosidase
  • a AAV expressing GAA useful in the methods to treat Pompe Disease as disclosed herein comprises a 5’ ITR and 3’ ITR sequence, and located between the 5’ITR and the 3’ ITR, a promoter operatively linked to a heterologous nucleic acid encoding a secretory peptide and nucleic acid encoding an alpha-glucosidase (GAA) polypeptide.
  • GAA alpha-glucosidase
  • secretory signal peptides are cleaved within the endoplasmic reticulum and, in some embodiments, the signal peptide is cleaved from the GAA polypeptide prior to secretion. It is not necessary, however, that the signal peptide is cleaved as long as secretion of the GAA polypeptide from the cell is enhanced and the GAA polypeptide is functional. Thus, in some embodiments, the signal peptide is partially or entirely retained.
  • the rAAV genome, or an isolated nucleic acid as disclosed herein comprises a nucleic acid encoding a chimeric polypeptide comprising a GAA polypeptide operably linked to a secretory signal peptide, and the chimeric polypeptide is expressed and produced from a cell transduced with the rAAV vector and the GAA polypeptide is secreted from the cell.
  • the GAA polypeptide can be secreted after cleavage of all or part of the secretory signal peptide.
  • the GAA polypeptide can retain the signal peptide (i.e., the signal peptide is not cleaved).
  • the “GAA polypeptide” can be a chimeric polypeptide comprising the secretory peptide.
  • signal peptide as encompassed for use in the methods and compositions as disclosed herein.
  • signal peptide as encompassed for use in the methods and compositions as disclosed herein.
  • numerous secreted proteins and sequences that direct secretion from the cell are known in the art, are disclosed in US Patent 9,873,868, which is incorporated herein in its entirety by reference.
  • Exemplary secreted proteins include but are not limited to: erythropoietin, coagulation Factor IX, cystatin, lactotransferrin, plasma protease Cl inhibitor, apolipoproteins (e.g., APO A, C, E), MCP-1, a-2-HS-glycoprotein, a-l-microgolubilin, complement (e.g., C1Q, C3), vitronectin, lymphotoxin-a, azurocidin, VIP, metalloproteinase inhibitor 2, glypican- 1, pancreatic hormone, clusterin, hepatocyte growth factor, insulin, a- 1 -antichymotrypsin, growth hormone, type IV collagenase, guanylin, properdin, proenkephalin A, inhibin 0 (e.g., A chain), prealbumin, angiocenin, lutropin (e.g., 0 chain), insulin-like
  • the secretory signal peptide is not a secretory signal peptide of a-1- antitrypsin (e.g., amino acids 1-24 of a- 1 -antitrypsin), chymotrypsinogen B2 (e.g., amino acids 1-20 of chymotrypsinogen B2), iduronate-2-sulphatase (e.g., amino acids 1-25 of iduronate-2- sulphatase), or protease Cl inhibitor (e.g., amino acids 1-23 of protease CI inhibitor).
  • a-1- antitrypsin e.g., amino acids 1-24 of a- 1 -antitrypsin
  • chymotrypsinogen B2 e.g., amino acids 1-20 of chymotrypsinogen B2
  • iduronate-2-sulphatase e.g., amino acids 1-25 of iduronate-2- sulphatas
  • secretory signal peptides encoded by the rAAV genome and in the rAAV vector as disclosed herein can be selected from, but are not limited to, the signal peptide sequences from prepro-cathepsin L (e.g., GenBank Accession Nos. KHRTL, NP 037288;
  • prepro-alpha 2 type collagen e.g., GenBank Accession Nos. CAA98969, CAA26320, CGHU2S, NP_000080, BAA25383, P08123; the disclosures of which are incorporated by reference in their entireties herein
  • Exemplary signal peptide sequences include for preprocathepsin L (Rattus norvegicus, MTPLLLLAVLCLGTALA [SEQ ID NO: 77]; Accession No. CAA68691) and for prepro-alpha 2 type collagen (Homo sapiens, MLSFVDTRTLLLLAVTLCLATC [SEQ ID NO: 78]; Accession No. CAA98969). Also encompassed are longer amino acid sequences comprising the full-length signal peptide sequence from preprocathepsin L and prepro-alpha 2 type collagen or functional fragments thereof (as discussed above with respect to the fibronectin signal peptide sequence).
  • the signal peptide is derived in part or in whole from a secreted polypeptide that is produced by liver cells.
  • a signal peptide can further be in whole or in part synthetic or artificial.
  • Synthetic or artificial secretory signal peptides are known in the art, see e.g., Barash et al., “Human signal peptide description by hidden Markov model and generation of a strong artificial signal peptide for secreted protein expression,” Biochem. Biophys. Res. Comm. 294:835-42 (2002); the disclosure of which is incorporated herein in its entirety.
  • the signal peptide comprises, consists essentially of, or consists of the artificial secretory signal: MWWRLWWLLLLLLLLWPMVWA (SEQ ID NO: 65) or variations thereof having 1, 2, 3, 4, or 5 amino acid substitutions (optionally, conservative amino acid substitutions, conservative amino acid substitutions are known in the art).
  • Exemplary signal peptides for use in the methods and compositions as disclosed herein can be selected from any signal peptide disclosed in Table 2, or portions thereof or functional variants thereof.
  • Exemplary signal peptides are Fibronectin (FN1), or AAT.
  • the rAAV vector composition comprises the nucleic acid encoding a secretory signal peptide, e.g., encoding a signal peptide selected from an AAT signal peptide (e.g., SEQ ID NO: 67), a fibronectin signal peptide (FN1) (e.g., SEQ ID NO: 68-71), an hIGF2 signal peptide (e.g., SEQ ID NO: 72) or an active fragment thereof having secretory signal activity, e.g., a nucleic acid encoding an amino acid sequence that has at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NOs: 67-72.
  • a secretory signal peptide e.g., encoding a signal peptide selected from an AAT signal peptide (e.g., SEQ ID NO: 67), a fibronectin signal peptide (FN1) (
  • the nucleic acid encoding the signal peptide is selected from any of SEQ ID NO: 54-58, 67, 72-76 and 72, or a nucleic acid sequence at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to any of SEQ ID NOs: 54-58, 67, 72-76 and 72.
  • Fibronectin secretory signal peptide [00203] Fibronectin secretory signal peptide:
  • the signal peptide is a fibronectin secretory signal peptide or portions thereof or functional variants thereof, which term includes modifications of naturally occurring sequences (as described in more detail below).
  • the signal peptide is a fibronectin signal peptide, e.g., a signal sequence of human fibronectin or a signal sequence from rat fibronectin.
  • Fibronectin (FN1) signal sequences and modified FN1 signal peptides encompassed for use in the rAAV genome and rAAV vectors described herein are disclosed in US patent 7,071,172, which is incorporated herein in its entirety by reference, and in Table 3 of provisional application 62/937,556, filed on November 19, 2019 or International Application WO2021102107, which is incorporated herein in its reference.
  • Examples of exemplary fibronectin signal peptide sequences include, but are not limited to those listed in Table 1 of US patent 7,071,172, which is incorporated herein in its entirety by reference.
  • one or more exogenous peptidase cleavage site may be inserted into the signal peptide -GAA polypeptide, e.g., between the signal peptide and the GAA polypeptide.
  • an autoprotease e.g., the foot and mouth disease virus 2A autoprotease
  • a protease recognition site that can be controlled by addition of exogenous protease is employed (e.g., Lys — Arg recognition site for trypsin, the Lys — Arg recognition site of the Aspergillus KEX2-like protease, the recognition site for a metalloprotease, the recognition site for a serine protease, and the like).
  • Modification of the GAA polypeptide to delete or inactivate native protease sites is encompassed herein and disclosed in U.S. Provisional Application 62,937,556, filed on November 19, 2019 and International Application WO2021102107, which is incorporated herein in its reference.
  • GAA is expressed with a heterologous signal peptide
  • the signal peptide can be fused directly to the GAA polypeptide or can be separated from the GAA polypeptide by a linker.
  • An amino acid linker also referred to herein as a “spacer” incorporates one or more amino acids other than that appearing at that position in the natural protein. Spacers can be generally designed to be flexible or to interpose a structure, such as an a-helix, between the two protein moieties.
  • a recombinant AAV vector comprises a heterologous nucleic acid sequence encoding an GAA polypeptide, wherein the GAA protein further comprises a spacer comprising a nucleotide sequence of at least 1 amino acid in length, which is located N-terminal to the GAA polypeptide.
  • the spacer at least 50% identical to the sequence GGGTVGDDDDK.
  • a spacer or linker can be relatively short, e.g., at least 1, 2, 3, 4 or 5 amino acids, or such as the sequence Gly-Ala-Pro or Gly-Gly-Gly-Gly-Gly-Pro, or can be longer, such as, for example, 5-10 amino acids in length or 10-25 amino acids in length.
  • flexible repeating linkers of 3-4 copies of the sequence e.g., GGGGS
  • a-helical repeating linkers of 2-5 copies of the sequence e.g., EAAAK
  • a linker comprising GGGTVGDDDDK is also encompassed for use.
  • Linkers incorporating an a-helical portion of a human serum protein can be used to minimize immunogenicity of the linker region.
  • the spacer is encoded by nucleic acids GGCGCGCCG which encodes the amino acid spacer comprising amino acids GAP or Gly-Ala-Pro.
  • the site of a fusion junction in the GAA polypeptide to fuse with either the signal peptide should be selected with care to promote proper folding and activity of each polypeptide in the fusion protein and to prevent premature separation of a signal peptide from a GAA polypeptide.
  • a spacer has a helical structure. In another specific embodiment, a spacer is at least 50% identical to the sequence GGGTVGDDDDK.
  • a signal peptide can be fused, directly or by a spacer, to amino acids of the GAA polypeptide as disclosed in Table 1 herein, permitting expression of the GAA polypeptide or N-terminal truncated GAA polypeptiden, and proper secretion of the GAA polypeptide as described herein in the Examples.
  • GAA amino acid residues adjacent to the fusion junction can be modified.
  • the terminal GAA cysteine 952 can be deleted or substituted with serine to accommodate a C-terminal signal peptide.
  • the signal peptide can also be fused immediately preceding the final Cys952.
  • the penultimate cys938 can be changed to proline in conjunction with a mutation of the final Cys952 to serine.
  • LSP Liver Specific Promoters
  • the rAAV genotype comprises a liver specific promoter (LSP).
  • LSP enables expression of the operatively linked gene in the liver, and can in some embodiments, be and inducible LSP.
  • a LSP is located upstream 5’ and is operatively linked to the heterologous nucleic acid sequence encoding the GAA protein.
  • liver-specific promoters useful in the AAV to treat Pompe according to the method disclosed herien are disclosed in International W02020102645 and WO2021102107, which are incorporated herein in their entirity by reference.
  • any liver-specific promoters disclosed W02020102645 and WO2021102107 where the LSP has been improved.
  • a liver specific promoter useful in the rAAV vectors as disclosed herein is any LSP disclosed International W02020102645 and WO2021102107 which has been modified to replace the the sequence of SEQ ID NO: 450 (corresponding to as SEQ ID NO: 126 in WO2021102107 or referred to as CRE0052 or LVR_CRE_0052_G6PC sequence) in any of the LSP sequences in WO2021102107 with a sequence selected from SEQ ID NO: 40 or 41, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
  • SP131A1 (or LVR131 A1) promoter as an exemplary promoter, which is disclosed as SEQ ID NO: 94 in WO2021102107, in the current application the promoter has been modified to replace SEQ ID NO 450 (corresponding to SEQ ID NO: 126 in WO2021102107) with SEQ ID NO: 40 or 41, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
  • any promoter disclosed in WO2021102107 is encompased for use herein, wherein if the promoter comprises SEQ ID NO 450 (corresponding to SEQ ID NO: 126 in WO2021102107), it can be replaced with SEQ ID NO: 40 or 41, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
  • the promoter is a LP1 promoter (SEQ ID NO: 432), or a variant having at least sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
  • a synthetic liver-specific promoter useful in the AAV vector is any LSP promoter selected from SEQ ID NOS: 86, 88, 91-96, 146-150, 439-441 as disclosed herein, or any LSP selected from SEQ ID NO: 270-341 or 342-430 as disclosed herein, or a synthetic liver-specific promoter thereof which is able to promote liver-specific transgene expression and has an activity in liver cells which is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TTR promoter comprising SEQ ID NO: 431 as International Application WO2021102107, or a synthetic promoter which is disclosed in Table 4 of International Application WO2021102107, which is incorporated herein in its entirity by reference.
  • a synthetic liver specific promoter is selected from any of: SEQ ID NOS: 86, 88, 91-96, 146-150, or 270-430 as disclosed herein, or nucleic acid sequence that is at least 80%, or at least 90% or 95% identical thereto or to the source regulatory nucleic acid sequence.
  • a liver-specific promoter (LSP) in a AAV expressing a GAA polypeptide as disclosed herein and useful in the methods to treat Pompe disease as disclosed herien comprises a nucleic acid sequence selected from any promoter listed from SEQ ID NOS: 86 (CRM 0412), SEQ ID NO: 91 (SP0412) or SEQ ID NO: 92 (SP0422), SEQ ID NOS: 93 (SP0239), SEQ ID NO: 94 (SP0265), SEQ ID NO: 95 (SP0240) or SEQ ID NO: 96 (SP0246), or SEQ ID NO: 146 (SP0265-UTR), SEQ ID NO: 147 (SP0239-UTR), SEQ ID NO: 148 (SP0240-UTR), SEQ ID NO: 149 (SP0246-UTR) or SEQ ID NO: 150 (SP0131-A1- UTR), SEQ ID NO: 439 (LVR_0243); SEQ ID NO:
  • a synthetic liver-specific promoter is selected from any or any LSP promoter selected from SEQ ID NOS: 86 (CRM 0412), SEQ ID NO: 91 (SP0412) or SEQ ID NO: 92 (SP0422), SEQ ID NOS: 93 (SP0239), SEQ ID NO: 94 (SP0265), SEQ ID NO: 95 (SP0240) or SEQ ID NO: 96 (SP0246), or SEQ ID NO: 146 (SP0265-UTR), SEQ ID NO: 147 (SP0239-UTR), SEQ ID NO: 148 (SP0240-UTR), SEQ ID NO: 149 (SP0246-UTR) or SEQ ID NO: 150 (SP0131-A1- UTR), SEQ ID NO: 439 (LVR_0243); SEQ ID NO: 440 (LVR 0412) and SEQ ID NO: 441 (Al Promoter), or any LSP selected from SEQ ID NOS: 86 (CRM 0412), SEQ ID NO:
  • a synthetic liver-specific promoter is selected from any or any LSP promoter selected from any of SEQ ID NO: 97, SEQ ID NO: 98 or SEQ ID NO: 99, or a variant having at least sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
  • a synthetic liver- specific promoter is selected from any or any LSP promoter selected from SEQ ID NO: 97, SEQ ID NO: 98 or SEQ ID NO: 99, or a variant having at least sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto, where the synthetic liver-specific promoter is able to promote liver-specific transgene expression and has an activity in liver cells which is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%,
  • the rAAV genotype comprises a liver specific promoter (LSP).
  • LSP enables expression of the operatively linked gene in the liver, and can in some embodiments, be and inducible LSP.
  • a LSP is located upstream 5’ and is operatively linked to the heterologous nucleic acid sequence encoding the GAA protein.
  • Exemplary liver-specific promoters are disclosed herein, and include for example, the M3 liver specific promoter comprising a sequence of SEQ ID NO: 99, or a functional variant have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of SEQ ID NO: 99.
  • the liver promoter is a promoter that has some expression in the liver.
  • the promoter that has some expression in the liver is the M2 liver promoter comprising a sequence of SEQ ID NO: 98, or a functional variant have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of SEQ ID NO: 98.
  • the synthetic liver specific promoter comprises SEQ ID NO: 99, or nucleic acid sequence that is at least 50%, preferably 60%, 70%, 80%, 90% or 95% identical to the source regulatory nucleic acid sequence.
  • a synthetic liver specific promoter comprises SEQ ID NO: 99, or nucleic acid sequence that is at least 80%, or at least 90% or 95% identical to nucleotides 1-26 of SEQ ID NO: 99.
  • a synthetic liver specific promoter that is at least 50%, 60%, 70%, 80%, 90% or 95% identical to SEQ ID NO: 99 comprises a nucleic acid sequence where 2% or 1% or fewer of the nucleotides of SEQ ID NO: 99 are altered.
  • a synthetic liver- specific promoter useful in the methods and compositions as disclosed herein is the same length, or not substantially altered, or 1, 2, 3, 4, 5, or 6 nucleotides longer or 1, 2, 3, 4, 5, or 6 shorter than the length of SEQ ID NO: 99.
  • no nucleotides have been deleted when compared to SEQ ID NO: 99. In some embodiments, no nucleotides are inserted when compared to SEQ ID NO: 99. In some embodiments, all modifications made to SEQ ID NO: 99 are nucleotide substitutions.
  • a synthetic liver specific promoter that is at least 50%, 60%, 70%, 80%, 90% or 95% identical to SEQ ID NO: 99 comprises a source regulatory nucleic acid sequence which is active in liver, and the second type of cell or tissue is muscle; or a source regulatory nucleic acid sequence which is active in liver, and the second type of cell or tissue is CNS; or a source regulatory nucleic acid sequence which is active in muscle, and the second type of cell or tissue is liver; or a source regulatory nucleic acid sequence which is active in muscle, and the second type of cell or tissue is CNS.
  • a liver-specific promoter which is a functional variant of a given promoter element preferably retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising the unmodified promoter element).
  • Suitable assays for assessing liver-specific promoter activity are disclosed in Examples 12 and 13 of International Application WO2021102107 which is incorporated herein in its entirity by reference.
  • liver specific promoters include, but are not limited to, transthyretin promoter (TTR), LSP promoter (LSP), a synthetic liver specific promoter.
  • the promoter is a liver specific promoter (LSP), and can be selected from any liver specific promoters including, but not limited to, a transthyretin promoter (TTR), a Liver specific promoter (LSP), for example, as disclosed in 5,863,541 (TTR promoter), or LSP promoter (PNAS; 96: 3906-3910, 1999. See e.g. p. 3906, Materials and Methods, rAAV construction), a synthetic liver promoter, the references which are incorporated herein in their entireties by reference.
  • Other liver promoters can be used, for example, synthetic liver promoters.
  • the TTR promoter is a truncated TTR promoter, e.g., comprising SEQ ID NO: 431, or SEQ ID NO: 12 as disclosed in International WO 2020102645, which is incorporated herein in its entirity by reference, or a variant having at least sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
  • the LSP is a TBG promoter, e.g., comprising SEQ ID NO: 435, or a variant having at least sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
  • liver specific promoters include, but are not limited to promoters for the LDL receptor, Factor VIII, Factor IX, phenylalanine hydroxylase (PAH), ornithine transcarbamylase (OTC), and a 1 -antitrypsin (hAAT), and HCB promoter.
  • Other liver specific promoters include the AFP (alpha fetal protein) gene promoter and the albumin gene promoter, as disclosed in EP Patent Publication 0 415 731, the a-1 antitrypsin gene promoter, as disclosed in Rettenger, Proc. Natl. Acad. Sci.
  • the fibrinogen gene promoter the APO-A1 (Apolipoprotein Al) gene promoter, and the promoter genes for liver transference enzymes such as, for example, SGOT, SGPT and g-glutamyle transferase.
  • the liver specific promoter is a recombinant liver specific promoter, e.g., as disclosed in US20170326256A1, which is incorporated herein in its entirety by reference.
  • a liver specific promoter is the hepatitis B X-gene promoter and the hepatitis B core protein promoter.
  • liver specific promoters can be used with their respective enhancers.
  • the enhancer element can be linked at either the 5' or the 3' end of the nucleic acid encoding the GAA polypeptide.
  • the hepatitis B X gene promoter and its enhancer can be obtained from the viral genome as a 332 base pair EcoRV-NcoI DNA fragment employing the methods described in Twu, J Virol. 61 (1987) 3448-3453.
  • the hepatitis B core protein promoter can be obtained from the viral genome as a 584 base pair BamHI-Bglll DNA fragment employing the methods described in Gerlach, Virol 189 (1992) 59-66. It may be necessary to remove the negative regulatory sequence in the BamHI-Bglll fragment prior to inserting it.
  • the liver-specific promoter used to express the GAA polypeptide is selected in combination with, or in conjunction with the selection of the signal sequence.
  • the signal sequence should be selected that is sufficient to secrete the expressed GAA out of the cell, in order to avoid GAA accumation in the cell and any associated cell toxicity, and/or to avoid the generation of anti-GAA antibodies.
  • the LSP is selected in conjunction with the signal sequence, so that the strength of the liver specific promoter (LSP) that is operatively linked to the nucleic acid encoding the GAA polypeptide can be counter-balanced with the ability of the cell to secrete the expressed GAA protein.
  • LSP liver specific promoter
  • the specific signal sequence must be sufficiently effective to allow for the expressed GAA can be secreted from the cell so that GAA does not accumulate and create cell toxicity and/or induce an immune response.
  • the cell secretory pathway, and the selected signal sequence must be able to match the level of GAA expressed by the AAV, where the level of GAA expression is dependent on both the AAV transduction effiency (determined by AAV dose and capsid) and the strength of the liver specific promoter.
  • the liver-specific promoters as set out above are operably linked to one or more additional regulatory sequences.
  • An additional regulatory sequence can, for example, enhance expression compared to the liver-specific promoter which is not operably linked the additional regulatory sequence.
  • the additional regulatory sequence does not substantively reduce the specificity of the liver-specific promoter.
  • the liver-specific promoter can be operably linked to a sequence encoding a UTR (e.g., a 5’ and/or 3’ UTR), an intron, an UTR (e.g., 5’ or 3’)+intron, or such.
  • the liver-specific promoter is operably linked to sequence encoding a UTR, e.g., a 5’ UTR.
  • a 5' UTR can contain various elements that can regulate gene expression.
  • the 5’ UTR in a natural gene begins at the transcription start site and ends one nucleotide before the start codon of the coding region.
  • 5' UTRs as referred to herein may be an entire naturally occurring 5’ UTR or it may be a portion of a naturally occurring 5’ UTR.
  • the 5 ’UTR can also be partially or entirely synthetic.
  • 5' UTRs have a median length of approximately 150 nt, but in some cases they can be considerably longer. Regulatory sequences that can be found in 5' UTRs are disclosed in International Application WO2021102107 which is incorporated herein in its entirity by reference.
  • a 5-UTR sequence is located 3’ of a liver specific promoter as disclosed herein, and 5’ of the heterologous nucleic acid sequence (e.g., encoding a signal peptide and GAA polypeptide).
  • an exemplary 5-UTR sequence comprises, for example, a 24bp sequence of SEQ ID NO: 41, or a functional variant have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of SEQ ID NO: 41.
  • an exemplary 5-UTR sequence comprising SEQ ID NO: 41 is the sequence of SEQ ID NO: 40, or a functional variant have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of SEQ ID NO: 40.
  • the 5-UTR sequence comprises SEQ ID NO: 41 or SEQ ID NO: 40, or nucleic acid sequence that is at least 50%, preferably 60%, 70%, 80%, 90% or 95% identical to the source regulatory nucleic acid sequence.
  • a 5-UTR sequence comprises SEQ ID NO: 41 or SEQ ID NO: 40 or nucleic acid sequence that is at least 80%, or at least 90% or 95% identical to nucleotides of SEQ ID NO: 41 or SEQ ID NO: 40.
  • a 5-UTR that is at least 50%, 60%, 70%, 80%, 90% or 95% identical to SEQ ID NO: 41 or SEQ ID NO: 40 comprises a nucleic acid sequence where 2% or 1% or fewer of the nucleotides of SEQ ID NO: 41 or SEQ ID NO: 40 are altered.
  • a 5-UTR sequence useful in the methods and compositions as disclosed herein is the same length, or not substantially altered, or 1, 2, 3, 4, 5, or 6 nucleotides longer or 1, 2, 3, 4, 5, or 6 shorter than the length of SEQ ID NO: 41 or SEQ ID NO: 40.
  • a liver-specific promoter as set out above is operably linked to a sequence encoding a 5’ UTR derived from the CMV major immediate gene (CMV-IE gene).
  • CMV-IE gene CMV major immediate gene
  • the 5’ UTR from the CMV-IE gene suitably comprises the CMV-IE gene exon 1 and the CMV-IE gene exon 1, or portions thereof.
  • the promoter element may be modified in view of the linkage to the 5 ‘UTR, for example sequences downstream of the transcription start site (TSS) in the promoter element can be removed (e.g. replaced with the 5’ UTR).
  • the CMV-IE 5 ’UTR is described in Simari, et al, Molecular Medicine 4: 700-706, 1998 “Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene”, which is incorporated herein by reference. Variants of the CMV-IE 5’ UTR sequences discussed in Simari, et al. are also set out in W02002/031137, incorporated by reference, and the regulatory sequences disclosed therein can also be used. Other UTRs that can be used in combination with a promoter are known in the art, e.g. in Leppek, K., Das, R. & Bama, M. “Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them”. Nat Rev Mol Cell Biol 19, 158-174 (2016), incorporated by reference.
  • the sequence encoding the 5’ UTR comprises SEQ ID NO: 145 as disclosed herein, or a functional variant thereof.
  • functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • SEQ ID NO: 145 as disclosed herein encodes a CMV-IE 5’ UTR.
  • the sequence encoding the 5’ UTR comprises SEQ ID NO: 446 as disclosed herein, or a functional variant thereof.
  • functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the 5’ UTR comprises a nucleic acid motif that functions as the protein translation initiation site, e.g. sequences that define a Kozak sequence in the mRNA produced.
  • the sequence encoding the 5’ UTR comprises the sequence motif GCCACC at or near its 3’ end.
  • Other Kozak sequences or other protein translation initiation sites can be used, as is known in the art (e.g. Marilyn Kozak, “Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes” Cell, Vol. 44, 283-292, January 31, 1986; Marilyn Kozak “At Least Six Nucleotides Preceding the AUG Initiator Codon Enhance Translation in Mammalian Cells” J. Mol. Rid.
  • the protein translation initiation site (e.g. Kozak sequence) is preferably positioned immediately adjacent to the start codon.
  • a sequence encoding a 5’ UTR comprises SEQ ID NO: 438 as disclosed herein, or a functional variant thereof.
  • functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • This 5’ UTR comprises six nucleotides of GCCACC, which define a Kozak sequence at the 3’ end of the CMV-IE 5’ UTR.
  • the rAAV expressing GAA for use in the methods to treat Pompe as disclosed herien comprises an intron sequence located 3’ of the promoter sequence and 5’ of the heterologous nucleic acid (i.e., 5’ of the nucleic acid encoding the signal peptide and GAA polypeptide).
  • Intron sequences serve to increase one or more of: mRNA stability, mRNA transport out of nucleus and/or expression and/or regulation of the expressed GAA polypeptide.
  • a rAAV genotype does not comprise an intron sequence.
  • a UTR sequence described herein can be used as a 3 ’UTR.
  • a synthetic liver-specific promoter according to the present invention can be operably linked to a sequence encoding a UTR (e.g. a 5’ and/or 3’ UTR), and/or an intron, or suchlike.
  • a synthetic liver specific promoter as set herein is operably linked to a sequence encoding a 5’ UTR and an intron.
  • the 5’ UTR and intron is derived from the CMV major immediate gene (CMV-IE gene).
  • the CMV-IE 5’UTR and intron is described in Simari, et al., Molecular Medicine 4: 700-706, 1998 “Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene”, which is incorporated herein by reference. Variants of the CMV-IE 5’ UTR and intron sequences discussed in Simari, et al. are also set out in W02002/031137, incorporated by reference, and the regulatory sequences disclosed therein can also be used.
  • the 5’ UTR or the 5’ UTR and intron suitably comprises a nucleic acid motif that functions as the protein translation initiation site, e.g.
  • sequences that define a Kozak sequence in the mRNA produced are sequences that define a Kozak sequence in the mRNA produced.
  • the sequence encoding the 5’ UTR comprises the sequence motif GCCACC at or near its 3’ end.
  • Other Kozak sequences or other protein translation initiation sites can be used, as is known in the art (e.g. Marilyn Kozak, “Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes” Cell, Vol. 44, 283-292, January 31, 1986; Marilyn Kozak “At Least Six Nucleotides Preceding the AUG Initiator Codon Enhance Translation in Mammalian Cells” J. Mol. Rid.
  • the protein translation initiation site (e.g. Kozak sequence) is preferably positioned immediately adjacent to the start codon.
  • any one of the promoters described herein, or variants thereof is linked to a sequence encoding a 5’ UTR and/or a 5’UTR and an intron to provide a composite promoter.
  • such composite promoter may be referred to simply as “composite promoters”, or in some cases simply “promoters” for brevity.
  • the intron sequence is a MVM intron sequence, for example, but not limited to intron sequence of SEQ ID NO: 442, or nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
  • the intron sequence is a HBB2 intron sequence, for example, but not limited to and intron sequence of SEQ ID NO: 443 or SEQ ID NO: 444 or nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
  • a recombinant AAV vector comprises a heterologous nucleic acid sequence that further comprises an intron sequence located 5’ of the sequence encoding the secretory signal peptide, and 3’ of the promoter.
  • the intron sequence comprises a MVM sequence or a HBB2 sequence
  • the MVM sequence comprises the nucleic acid sequence of SEQ ID NO: 442, or a nucleic acid sequence at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 44
  • the HBB2 sequence comprises the nucleic acid sequence of SEQ ID NO: 443 or SEQ ID NO: 444, or a nucleic acid sequence at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 443 or SEQ ID NO: 444.
  • the intron sequence is a ubiquitin C (UBC) intron sequence, e.g., intron 1 from the UBC gene, or a portion thereof, e.g., as disclosed in Bianchi et al, 2009, Gene, 448 (1); 88-101, where the intron 1 sequence of the UBC gene is 812bp and starts at chromosomal location 124,914,586, and ends at 124,913,775.
  • UBC ubiquitin C
  • the intron sequence is a UBC intron, for example, but not limited to intron sequence of SEQ ID NO: 445, or nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to SEQ ID NO: 445.
  • the rAAV genotype comprises an intron sequence selected in the group consisting of a human beta globin b2 (or HBB2) intron, a FIX intron, a chicken beta-globin intron, a CMVIE intron, a UBC intron, a HBB intron sequence, a MVM sequeocne and a SV40 intron.
  • the intron is intron 1 from human RNA pol II.
  • the intron is optionally a modified intron such as a modified HBB2 intron (see, e.g., SEQ ID NO: 17 in of WO2018046774A1): a modified FIX intron (see., e.g., SEQ ID NO: 19 in WO2018046774A1), or a modified chicken beta-globin intron (e.g., see SEQ ID NO: 21 in WO2018046774A1), or modified HBB2 or FIX introns disclosed in WO2015/162302, which are incorporated herein in their entirety by reference.
  • a modified HBB2 intron see, e.g., SEQ ID NO: 17 in of WO2018046774A1
  • a modified FIX intron see.g., e.g., SEQ ID NO: 19 in WO2018046774A1
  • a modified chicken beta-globin intron e.g., see SEQ ID NO: 21 in WO2018046774A1
  • an rAAV vector genome includes at least one poly-A tail that is located 3’ and downstream from the heterologous nucleic acid gene encoding the GAA polypeptide.
  • Any polyA sequence can be used, including but not limited to hGH poly A, BGH poly A, SV40 poly A, synpA polyA and the like.
  • the polyA is a synthetic polyA sequence.
  • the rAAV vector genome comprises two poly-A tails, e.g., a hGH poly A sequence and another polyA sequence, where a spacer nucleic acid sequence is located between the two poly A sequences.
  • the polyA signal is 3’ of the heterologous nucleic acid sequence encoding the GAA polypeptide.
  • the rAAV genome comprises 3’ of the nucleic acid encoding the GAA polypeptide, a first polyA sequence and a reverse RNA polymerase II terminator sequence (rev RNA PolII terminator sequence), and the 3’ ITR.
  • first polyA is hGH poly A, BGH poly A, SV40 poly A or, any functional fragment thereof in 5’ to 3’ orientation.
  • reverse RNA polymerase II terminator sequence is hGH poly A, BGH poly A, SV40 poly A or, any functional fragment thereof in 3’ to 5’ orientation.
  • the rAAV genome comprises 3’ of the nucleic acid encoding the GAA polypeptide, a first polyA sequence, a spacer nucleic acid sequence (e.g., of between 100-400bp, or about 100-250bp, or about 250-400bp), a second poly A sequence, a spacer nucleic acid sequence, and the 3’ ITR.
  • the first and/or second poly A sequence is a hGH poly A sequence, and in some embodiments, the first and second poly A sequences are a synthetic poly A sequence. In some embodiments, the first poly A sequence is a hGH poly A sequence and the second poly A sequence is a synthetic sequence, or vice versa - that is, in alternative embodiments, the first poly A sequence is a synthetic poly A sequence and the second poly A sequence is a hGH polyA sequence.
  • the poly A sequence is selected from any of: SEQ ID NO: 42, SEQ ID NO: 43 or SEQ ID NO: 44, where SEQ ID NO: 44 comprises the signal AATAAA, or a poly A nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to any of SEQ ID NOS: 42, 43 or 44.
  • the poly A sequence is selected from any of: SEQ ID NO: 46 or SEQ ID NO: 47, or a poly A nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to any of SEQ ID NOS: 46 or 47.
  • the poly A sequence is, for example, SEQ ID NO: 15 as disclosed in International WO2021102107 (hGH poly A sequence), or a poly A nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to SEQ ID NO: 15 as disclosed in International Application WO2021102107.
  • the hGHpoly sequence encompassed for use is described in Anderson et al. J. Biol. Chem 264(14); 8222-8229, 1989 (See, e.g., p. 8223, 2nd column, first paragraph) which is incorporated herein in its entirety by reference.
  • the recombinant AAV disclosed herein comprises in its genome a transcriptional terminator signal sequence or a transcriptional pause signal sequence in the reverse orientation between polyA and 3’ITR. In one embodiment, the recombinant AAV disclosed herein comprises in its genome a transcriptional terminator signal sequence or a transcriptional pause signal sequence that is in the 3 ’-5’ orientation between polyA and 3’ITR. Any transcription termination signal can be used including, e.g., inverted natural polyA sequences from any species or synthetic polyA signals or fragments thereof, or other nucleic acid structure terminators known in the art.
  • Exemplary polyA signals and/or transcription terminators include, but are not limited to the polyA signals of BGH, SV40, HGH, Betaglobin, RNA polymerase II transcriptional pause signal from alpha 2 globin gene, transcription termination signal for pol III, or fragments thereof, and in any combination thereof.
  • a transcriptional terminator signal sequence is a reverse RNA polymerase II terminator sequence which is, in a 5’ to 3’ orientation SEQ ID NO: 45, or a rev RNA PolII terminator sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to any of SEQ ID NOS: 45, where SEQ ID NO: 45 orientated in a 5’ to 3’ direction is located between the 3’ of the poly A sequence and 5’ of the right ITR sequence (or 3’ ITR).
  • a transcription terminator signal or reverse RNA Polymerase II terminator sequence as described here is also interchangeably be called a “reverse poly A,” which refers to a polyA signal sequence placed in a 3 ’-5’ orientation downstream of the nucleic acid encoding GAA and upstream of 3’ITR. Any natural or synthetic poly A in 3 ’-5’ orientation can be used as reverse poly A.
  • the reverse poly A is the poly A (pA) as described in International publication no. WO2019143950 and US application publication no. US20200340013, which are incorporated herein by reference in its entirety.
  • reverse poly A the double stranded RNA termination element
  • reverse RNA Polymerase II terminator sequence are used interchangeably herein.
  • the reverse poly A or termination element does not allow transcription from 3’ITR, and hence double stranded RNA is not transcribed from 3’ITR.
  • the reverse poly A or double stranded RNA termination element can be heterologous, e.g., from a different gene, for example, other than the gene of interest, or homologous to, e.g., the same gene as the gene of interest.
  • the poly A signal comprises the double stranded RNA transcription element or reverse poly A.
  • the poly A signal of several aspects of the invention described herein comprises a full length poly A signal in 5’ to 3’ orientation and another poly A signal in 3’ to 5’ orientation.
  • the 5’ end of double stranded RNA termination element or reverse poly A sequence, and the 3’ end of poly A signal are immediately next to each other, or at least 1 nucleotide apart, or at least 2 nucleotides apart, or at least 3 nucleotides apart, or at least 4 nucleotides apart, or at least 5 nucleotides apart, or or at least 6 nucleotides apart, or at least 7 nucleotides apart, or at least 8 nucleotides apart, or at least 9 nucleotides apart, or at least 10 nucleotides apart, or more apart.
  • the poly A signal does not comprise double stranded RNA transcription element or reverse poly A.
  • the poly A signal comprises AATAAA (SEQ ID NO: 467) or AAUAAA (SEQ ID NO: 468).
  • the poly A signal comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 repeats or more of AATAAA (SEQ ID NO: 467) or AAUAAA (SEQ ID NO: 468).
  • the poly A signal comprises transcription termination signal for Pol III as described in "Delineation of the Exact Transcription Termination Signal for Type 3 Polymerase III. Mol Ther Nucleic Acids.
  • the one or more transcription termination signals for Pol III is in 3’ to 5’ orientation.
  • the poly A signal comprises TTTT.
  • poly A signal comprises AAAAAAA (SEQ ID NO: 469). The poly A sequences as described in “Definition of an efficient synthetic poly(A) site” Genes Dev. 1989 Jul;3(7): 1019-25. doi: 10.1101/gad.3.7.1019., which is incorporated by reference in its entirety. All the above poly A sequences and or terminator sequences described herein can be used as inverted sequence e.g., in 3’ to 5’ orientation.
  • the poly A sequence comprises poly A sequence and a terminator sequence, e.g., the poly A sequence comprises hGH Poly A sequence and a Pol III terminator sequence.
  • the poly A sequence and Pol III terminator sequences are interchangeably referred to as “poly A.”
  • the poly A sequence further comprises a Reverse RNA Polymerase II terminator sequence, or RNA Polymerase II transcriptional pause signal sequence, or reverse poly A.
  • Reverse RNA Polymerase II terminator sequence, or RNA Polymerase II transcriptional pause signal sequence, or reverse Poly A is the 3’ sequence of the human hemoglobin alpha gene.
  • a poly-A tail can be engineered to stabilize the RNA transcript that is transcribed from an rAAV vector genome, including a transcript for a heterologous gene, which in one embodiment is a GAA, and in alternative embodiments, the poly-A tail can be engineered to include elements that are destabilizing.
  • the polyA is a bi-directional polyA sequence.
  • Bi-directional polyA sequences are commonly isolated from virual DNA, for example, the SV40 polyA is a bi-directional polyA.
  • a recombinant AAV vector comprises at least one polyA sequence located 3’ of the nucleic acid encoding the GAA gene and 5’ of the 3’ ITR sequence.
  • the poly A is a full length poly A (fl-polyA) sequence.
  • the polyA is a truncated polyA sequence as disclosed in International WO2021102107, which is incorporated herein in its entirity.
  • a poly-A tail can be engineered to become a destabilizing element by altering the length of the poly-A tail.
  • the poly-A tail can be lengthened or shortened.
  • a 3’ untranslated regions located between the heterologous gene encoding the GAA polypeptide and the poly-A tail.
  • a 3’ untranslated region (3 ’UTR) comprises GAA 3’ UTR (SEQ ID NO: 50) or a 3’ UTR (SEQ ID NO: 49) as disclosed herein.
  • a promoter region, or 3’ UTR or polyA region can comprise a destabilizing element, is a target sequence for a microRNA (miRNA) that has the ability to silence (repress translation and promote degradation) the RNA transcripts when the miRNA binds to a miRNA target sequence.
  • miRNA microRNA
  • addition or deletion of seed regions within the 3-UTR or a poly-A tail can increase or decrease expression of a protein, such as the GAA polypeptide.
  • the miRNA target region is a synthetic miRNA target region which is targeted by an artificial miRNA (amiRNA) according to methods known in the art.
  • seed regions can also be engineered into the 3’ untranslated regions (3’UTRs) located between the heterologous gene and the poly-A tail.
  • the destabilizing agent can be an siRNA.
  • the coding region of the siRNA can be included in an rAAV vector genome and is generally located downstream, 3’ of the poly-A tail.
  • the rAAV genome may also comprise a Stuffer DNA nucleic sequence.
  • An exemplary stuffer DNA sequence is SEQ ID NO: 71 as disclosed in International Application WO2021102107, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
  • the stuffer sequence is located 3’ of the poly A tail, for example, and is located 5’ of the ‘3 ITR sequence.
  • the stuffer DNA sequence comprises a synthetic polyadenylation signal in the reverse orientation.
  • a stuffer nucleic acid sequence (also referred to as a “spacer” nucleic acid fragment) can be located between the poly A sequence and the 3’ ITR (i.e., a stuffer nucleic acid sequence is located 3’ of the polyA sequence and 5’ of the 3’ ITR).
  • a stuffer nucleic acid sequence can be about 30bp, 50pb, 75bp, lOObp, 150bp, 200bp, 250bp, 300bp or longer than 300bp.
  • a stuffer nucleic acid fragment is between 20-50bp, 50-100bp, 100-200bp, 200-300bp, 300-500bp, or any integer between 20-500bp.
  • Exemplary stuffer (or spacer) nucleic acid sequence can be selected from any of: SEQ ID NO: 16, SEQ ID NO: 71 or SEQ ID NO: 78 as disclosed in International Application
  • WO2021102107 or a nucleic acid sequence at least about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, identical to SEQ ID NO: 16 or SEQ ID NO: 71 or SEQ ID NO: 78 as disclosed in International Application WO2021102107.
  • a recombinant AAV vector comprises a heterologous nucleic acid sequence that can further comprises at collagen stability (CS) sequence located 3’ of the nucleic acid encoding the GAA polypeptide and 5’ of the 3’ ITR sequence.
  • the rAAV genome disclosed herein comprises a heterologous nucleic acid sequence that can optionally comprise a Collagen stability sequence (CS or CSS), which is positioned 3’ of the nucleic acid encoding the GAA polypeptide and 5’ of the nucleic acid encoding a polyA signal.
  • the CS sequence can be replaced by a 3’ UTR sequence as disclosed herein.
  • Exemplary collagen stability sequences include CCCAGCCCACTTTTCCCCAA or a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.
  • An exemplary collagen stability sequence can have an amino acid sequence of PSPLFP or an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.
  • CS sequences are disclosed in Holick and Liebhaber, Proc. Nat. Acad. Sci. 94: 2410-2414, 1997 (See, e.g. Figure 3, p. 5205), which is incorporated herein its entirety by reference.
  • the rAAV vector or genome as disclosed herein for use in the methods to treat Pompe disease can comprise AAV ITRs that have desirable characteristics and can be designed to modulate the activities of, and cellular responses to vectors that incorporate the ITRs.
  • the AAV ITRs are synthetic AAV ITRs that has desirable characteristics and can be designed to manipulate the activities of and cellular responses to vectors comprising one or two synthetic ITRs, including, as set forth in U.S. Patent No. 9,447433, which is incorporated herein by reference.
  • an ITR exhibits modified transcription activity relative to a naturally occurring ITR, e.g., ITR2 from AAV2. It is known that the ITR2 sequence inherently has promoter activity. It also inherently has termination activity, similar to a poly(A) sequence. The minimal functional ITR of the present invention exhibits transcription activity as shown in the examples, although at a diminished level relative to ITR2. Thus, in some embodiments, the ITR is functional for transcription. In other embodiments, the ITR is defective for transcription. In certain embodiments, the ITR can act as a transcription insulator, e.g., preventing transcription of a transgenic cassette present in the vector when the vector is integrated into a host chromosome.
  • One aspect of the invention relates to an rAAV vector genome comprising at least one synthetic AAV ITR, wherein the nucleotide sequence of one or more transcription factor binding sites in the ITR is deleted and/or substituted, relative to the sequence of a naturally occurring AAV ITR such as ITR2.
  • it is the minimal functional ITR in which one or more transcription factor binding sites are deleted and/or substituted.
  • at least 1 transcription factor binding site is deleted and/or substituted, e.g., at least 5 or more or 10 or more transcription factor binding sites, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 transcription factor binding sites.
  • a rAAV vector including an rAAV vector genome as described herein comprises a polynucleotide comprising at least one synthetic AAV ITR, wherein one or more CpG islands (a cytosine base followed immediately by a guanine base (a CpG) in which the cytosines in such arrangement tend to be methylated) that typically occur at, or near the transcription start site in an ITR are deleted and/or substituted.
  • deletion or reduction in the number of CpG islands can reduce the immunogenicity of the rAAV vector. This results from a reduction or complete inhibition in TLR-9 binding to the rAAV vector DNA sequence, which occurs at CpG islands.
  • methylation of CpG motifs results in transcriptional silencing. Removal of CpG motifs in the ITR is expected to result in decreased TLR-9 recognition and/or decreased methylation and therefore decreased transgene silencing. In some embodiments, it is the minimal functional ITR in which one or more CpG islands are deleted and/or substituted. In an embodiment, AAV ITR2 is known to contain 16 CpG islands of which one or more, or all 16 can be deleted.
  • At least 1 CpG motif is deleted and/or substituted, e.g., at least 4 or more or 8 or more CpG motifs, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 CpG motifs.
  • the synthetic ITR comprises, consists essentially of, or consists of one of the nucleotide sequences listed in Table 4.
  • the synthetic ITR comprises, consist essentially of, or consist of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to any one of the nucleotide sequences listed in Table 4.
  • the ITR is a sequence is disclosed in FIG.
  • the ITR sequence comprises, or consists of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to one of the ITR sequences in FIG. 1 as disclosed in Samulski et al, 1993.
  • the ITR comprises, or consists of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to the ITR sequence of pSM 609 right disclosed in the middle panel of FIG. 1 (that lacks the 9bp) disclosed in Samulski et al, 1983.
  • the ITR comprises a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to the ITR sequence of any of SEQ ID NOs: 79-84 and 450-451.
  • the ITR sequence e.g., Right ITR (or 3’ ITR) is SEQ ID NO: 80 or SEQ ID NO: 82 or a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to SEQ ID NO: 80 or SEQ ID NO: 82.
  • the ITR sequence e.g., left ITR (or 5’ ITR) is SEQ ID NO: 79 or SEQ ID NO: 81 or a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to SEQ ID NO: 79 or SEQ ID NO: 81.
  • the rAAV vector (also referred to as a rAAV virion) as disclosed herein comprises a capsid protein, and a rAAV genome in the capsid protein.
  • a rAAV capsid of the rAAV virion used to treat Pompe Disease is any of those listed in Table 3 herein, or in Table 1 as disclosed in International Applications W02020/102645, and W02020/102667, each of which are incorporated herein in their entirety.
  • a rAAV capsid of the rAAV virion used to treat Pompe Disease is an AAV8 capsid.
  • a rAAV vector is an rAAV8 vector.
  • Table 3 Table 3: AAV Serotypes and exemplary Published corresponding capsid sequence
  • AAV4 See SEQ ID NO: 17 US20140348794)
  • AAV4 (See SEQ ID NO:5 in US20140348794)
  • AAV4 See SEQ ID NO: 3 in US20140348794)
  • AAV4 See SEQ ID NO: 14 in
  • AAVhu.42 (AAV127.5) (See SEQ ID NO:8 in ⁇ AAVhu.43 (See SEQ ID NO: 160 in
  • AAVhu.43 See SEQ ID NO: 236 in AAVhu.43 (AAV128.1) (See SEQ ID NO: 80
  • AAVhu.44R2 See SEQ ID NO: in AAVhu.44R3 (See SEQ ID NO: in
  • S AAVhu.45 See SEQ ID NO: 76 in S AAVhu.45 (See SEQ ID NO: 127 in
  • AAVhu.46 See SEQ ID NO: 82 in AAVhu.46 (See SEQ ID NO: 159 in
  • AAVhu.46 See SEQ ID NO: 224 in ⁇ AAVhu.47 (See SEQ ID NO: 77 in
  • AAVhu.48 See SEQ ID NO: 157 in
  • AAV CLv-D8 See SEQ ID NO: 29 in ?
  • AAV CLv-D8 See SEQ ID NO: 103 in
  • AAV CLv-Kl See SEQ ID NO: 68 in AAV CLv-K3 (See SEQ ID NO: 19 in
  • AAV CSp-8.2 See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in AAV CSp-8.2 (See SEQ ID NO: 39 in
  • AAV CSp-8.7 See SEQ ID NO: 43 in AAV CSp-8.7 (See SEQ ID NO: 93 i
  • the AAV vector (also referred to as a rAAV virion) as disclosed herein comprises a capsid protein from any of those disclosed in WO2019/241324, which is specifically incorporated herein in its entirety by reference.
  • the rAAV vector comprises a liver specific capsid, e.g., a liver specific capsid selected from XL32 and XL32.1, as disclosed in WO2019/241324, which is incorporated herein in its entirety by reference.
  • the rAAV vector is a AAVXL32 or AAVXL32.1 as disclosed in WO2019/241324, which is incorporated herein in its entirety by reference.
  • Exemplary chimeric or variant capsid proteins that can be used as the AAV capsid in the rAAV vector described herein can be selected from Table 2 from U.S. provisional application 62,937,556, filed on November 19, 2019, which is specifically incorporated herein in its reference, or can be used with any combination with wild type capsid proteins and/or other chimeric or variant capsid proteins now known or later identified and each is incorporated herein.
  • the rAAV vector encompassed for use is a chimeric vector, e.g., as disclosed in 9,012,224 and US 7,892,809, which are incorporated herein in their entirety by reference.
  • the rAAV vector is a haploid rAAV vector, as disclosed in US application US2018/0371496 and PCT/US 18/22725, or polyploid rAAV vector, e.g., as disclosed in PCT/US2018/044632 filed on 7/31/2018 and in US application 16/151,110, each of which are incorporated herein in their entirety by reference.
  • the rAAV vector is a rAAV3 vector, as disclosed in 9,012,224 and WO 2017/106236 which are incorporated herein in their entirety by reference.
  • the rAAV is a AAVXL32 or AAVXL32.1 AAV vector as disclosed in WO2019/241324, which is incorporated herein in its entirety by reference.
  • the rAAV vector comprises a capsid disclosed in WO2019241324A1, or International Patent application PCT/US2019/036676, which are incorporated herein in their entirety by reference.
  • the AAV vector is a AAV8 vector or a rational haploid comprising an AAV8 capsid protein.
  • the recombinant AAV vector is a chimeric AAV vector, haploid AAV vector, a hybrid AAV vector or polyploid AAV vector.
  • the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or a AAV vector from any AAV serotypes, for example, from any AAV serotype disclosed in Table 1 as disclosed in International Applications W02020/ 102645, and W02020/ 102667, each of which are incorporated herein in their entirety.
  • an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is an AAV3b capsid.
  • AAV3b capsids encompassed for use are described in 2017/106236, and 9,012,224 and 7,892,809, and International application PCT/US19/61653, filed Nov 15, 2019, and International Applications W02020/102645, and W02020/102667, each of which are incorporated herein in their entirety.
  • AAV3b capsids of the AAV vector for use according to the methods as disclosed herein are disclosed in International Patent Applications WO 2020/102645 and WO2021102107, which are incorporated herien in its entirity by reference herein.
  • the AAV3b capsid comprises SEQ ID NO: 44 as disclosed in International Patent Applications WO 2020/102645 and WO2021102107.
  • the AAV capsid used in the treatment of Pompe Disease can be a modified AAV capsid that is derived in whole or in part from the AAV capsid set forth in SEQ ID NO: 44.
  • the amino acids from an AAV3b capsid as set forth in SEQ ID NO: 44 can be, or are substituted with amino acids from another capsid of a different AAV serotype, wherein the substituted and/or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.
  • an AAV capsid used in the treatment of Pompe Disease is an AAV3b265D capsid.
  • an AAV3b265D capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid G265 of the AAV3b capsid with D265.
  • an AAV3b265D capsid comprises SEQ ID NO: 46.
  • the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 46 as set forth in International Patent Applications WO 2020/102645 and WO2021102107.
  • amino acids from AAV3b265D as set forth in SEQ ID NO. 46 can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and/or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.
  • an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is an AAV3b265D549A capsid.
  • an AAV3b265D549A capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid G265 of the AAV3b capsid with D265 and replacement of amino acid T549 of the AAV3b capsid with A549.
  • an AAV3b265D549A capsid comprises SEQ ID NO: 50 as disclosed herein International Patent Applications WO 2020/102645 and WO2021102107.
  • the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 50.
  • the amino acids from AAV3b265D549A as set forth in SEQ ID NO: 50 can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and/or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.
  • the amino acids from AAV3bSASTG can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and/or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.
  • an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is an AAV3b549A capsid.
  • an AAV3b549A capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid T549 of the AAV3b capsid with A549.
  • an AAV3b549A capsid comprises SEQ ID NO: 52 as disclosed herein International Patent Applications WO 2020/102645 and WO2021102107.
  • the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 52.
  • amino acids from AAV3b549A as set forth in SEQ ID NO: 52 can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and/or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.
  • an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is an AAV3bQ263Y capsid.
  • an AAV3bQ263Y capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid Q263 of the AAV3b capsid with Y263.
  • an AAV3b549A capsid comprises SEQ ID NO: 54 as disclosed herein International Patent Applications WO 2020/102645 and WO2021102107.
  • the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 54.
  • amino acids from AAV3bQ263Y as set forth in SEQ ID NO: 54 can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and/or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.
  • an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is AAV3bSASTG serotype or comprises a AAV3bSASTG capsid.
  • an AAV3bSASTG capsid comprises a modification in the amino acid sequence to comprise a SASTG mutation, in particular, the AAV3b capsid was modified to resemble AAV2 Q263A/T265 subvariant by introducing these modifications at similar positions in the AAV3b capsid (as disclosed in Messina EL, et al., Adeno-associated viral vectors based on serotype 3b use components of the fibroblast growth factor receptor signaling complex for efficient transduction. Hum. Gene Ther.
  • an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is AAV3bSASTG serotype or comprises a AAV3bSASTG capsid comprising a AAV3b Q263A/T265 capsid.
  • the amino acids from AAV3bSASTG can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and/or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.
  • the central nervous system using AAV9 or a rhesus capsid or a rational haploid using at least one of a AAV9 or Rhesus viral protein.
  • AAV9 or Rhesus capsid or a rational haploid using at least one of a AAV9 or Rhesus viral protein.
  • myo AAV see, e.g., WO2019/2071323 and W02022/020616, which are incorporated herein in their entirity by reference.
  • an rAAV vector genome useful in the invention are recombinant nucleic acid constructs that include (1) a heterologous sequence to be expressed (in one embodiment, a polynucleotide encoding a GAA polypeptide) and (2) viral sequence elements that facilitate integration and expression of the heterologous genes.
  • the viral sequence elements may include those sequences of an AAV vector genome that are required in cis for replication and packaging (e.g., functional ITRs) of the DNA into an AAV capsid.
  • the heterologous gene encodes GAA, which is useful for correcting a GAA-deficiency in a patient suffering from Pompe Disease.
  • an rAAV vector genome may also contain marker or reporter genes.
  • an rAAV vector genome can have one or more of the AAV3b wild-type (WT) cis genes replaced or deleted in whole or in part, but retain functional flanking ITR sequences.
  • WT wild-type
  • an optimized rAAV vector genome is created from any of the elements disclosed herein and in any combination, including nucleic acid sequences encoding a promoter, an ITR, a poly-A tail, elements capable of increasing or decreasing expression of a heterologous gene, and in one embodiment, a nucleic acid sequence that is codon optimized for expression of GAA protein in vivo (i.e., wildtype GAA or codon optimized GAA) and optionally, one or more element to reduce immunogenicity.
  • Such an optimized rAAV vector genome can be used with any AAV capsid that has tropism for the tissue and cells in which the rAAV vector genome is to be transduced and expressed.
  • rAAV genome lacks the AAV P5 promoter or, a fragment thereof, which is normally located upstream of the liver-specific promoter as disclosed herein. Normally, the P5 promoter controls expression of the AAV rep/cap proteins during AAV replication.
  • this P5 promoter fragment is present in the rAAV vector as disclosed herein which contains predicted transcription factor binding sites, e.g., cyclic AMP-responsive element-binding protein 3 (CREB3), which can be activated by endoplasmic reticulum (ER)/Golgi stress (Sampieri 2019), activating transcription factor 2 (ATF2), which is also involved in stress response (Watson 2017), Nuclear Receptor Subfamily 1 Group I Member 2 (NR1I2) (also known as Pregnane X receptor [PXR]) is known to be enriched in liver, and is activated by pregnane steroids, rifampin and other molecules including dexamethasone (NR1I2 HGNC) (Xing 2020).
  • CREB3 cyclic AMP-responsive element-binding protein 3
  • ER endoplasmic reticulum
  • ATF2 activating transcription factor 2
  • NR1I2 Nuclear Receptor Subfamily 1 Group I Member 2
  • NR1I2 HGNC
  • the rAAV vector also comprises a RNA polymerase II termination sequence located between the polyA signal and the 3’ ITR.
  • An exemplary terminal sequence is SEQ ID NO: 45, or SEQ ID NO:465, the later of which introduces two termination codons and one restriction site (e.g., Xhol) replaces TAG, and is located immediately downstream of the last coding amino acids of hGAA, and immediately located upstream ofthe 3’ UTR.
  • the recombinant AAV expressing GAA protein as disclosed herein can be used in methods to treat Pompe disease.
  • Pompe disease is a rare genetic disorder caused by a deficiency in the enzyme acid alpha-glucosidase (GAA), which is needed to break down glycogen, a stored form of sugar used for energy.
  • GAA acid alpha-glucosidase
  • Pompe disease is also known as glycogen storage disease type II, GSD II, type II glycogen storage disease, glycogenosis type II, acid maltase deficiency, alpha- 1,4-glucosidase deficiency, cardiomegalia glycogenic diffusa, and cardiac form of generalized glycogenosis.
  • the build-up of glycogen causes progressive muscle weakness (myopathy) throughout the body and affects various body tissues, particularly in the heart, skeletal muscles, liver, respiratory and nervous system.
  • Glycogen storage disease type II also referred to as Pompe disease
  • GAA lysosomal enzyme acid a-glucosidase
  • IOPD infantile-onset Pompe disease
  • LOPD late-onset myopathy
  • the defect in GAA can vary from complete to partial deficiency of GAA, which correlates with clinical severity.
  • LOPD presents with proximal leg weakness and in some cases respiratory insufficiency without significant cardiac involvement and may progress to fatal respiratory failure.
  • Late onset (or juvenile/adult, LOPD) Pompe disease is the result of a partial deficiency of GAA.
  • the onset can be as early as the first decade of childhood or as late as the sixth decade of adulthood and is therefore characterized as slowly progressive.
  • the primary symptom is proximal muscle weakness progressing to respiratory weakness and death from respiratory failure after a course lasting several years.
  • the heart is usually not involved.
  • the presenting clinical manifestations of Pompe disease can vary widely depending on the age of disease onset and residual GAA activity. Residual GAA activity correlates with both the amount and tissue distribution of glycogen accumulation as well as the severity of the disease.
  • Infantile-onset Pompe disease (less than 1% of normal GAA activity) is the most severe form and is characterized by hypotonia, generalized muscle weakness, and hypertrophic cardiomyopathy, and massive glycogen accumulation in cardiac and other muscle tissues. Death usually occurs within one year of birth due to cardiorespiratory failure.
  • Juvenile-onset (1-10% of normal GAA activity) and adult-onset (10-40% of normal GAA activity) Pompe disease are more clinically heterogeneous, with greater variation in age of onset, clinical presentation, and disease progression.
  • Juvenile- and adult- onset Pompe disease are generally characterized by lack of severe cardiac involvement, later age of onset, and slower disease progression, but eventual respiratory or limb muscle involvement results in significant morbidity and mortality. While life expectancy can vary, death generally occurs due to respiratory failure.
  • a GAA enzyme suitable for treating Pompe disease includes a wild-type human GAA, or a fragment or sequence variant thereof which retains the ability to cleave al-4 linkages in linear oligosaccharides.
  • the GAA protein encoded by a GAA nucleic acid sequence e.g., SEQ ID NO: 1-18 as disclosed herein, or a N-terminal truncation thereof as disclosed herein in Table 1.
  • the GAA protein is encoded by a codon optimized GAA nucleic acid sequence, for example, for any one or more of: (1) enhanced expression in vivo, (2) to reduce CpG islands or (3) reduce the innate immune response.
  • the GAA protein is encoded by a codon optimized GAA nucleic sequence, for example, any nucleic acid sequence selected from any of: SEQ ID NO: 1-18, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NOS: 1-18, which encode a GAA polypeptide, where amino acid at position 199 is R (199R); amino acid at position 233 is H (233H), and amino acid at position 780 is I (7801), as compared to the wild type GAA protein.
  • a codon optimized GAA nucleic sequence for example, any nucleic acid sequence selected from any of: SEQ ID NO: 1-18, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NOS: 1-18, which encode a GAA polypeptide, where amino acid at position 199 is R (199R); amino
  • a rAAV vector as described herein transduces the liver of a subject and secretes the hGAA polypeptide into the blood, which perfuses patient tissues where the hGAA polypeptide, is taken up by cells and transported to the lysosome, where the GAA enzyme acts to eliminate material that has accumulated in the lysosomes due to the enzyme deficiency.
  • the therapeutic enzyme must be delivered to lysosomes in the appropriate cells in tissues where the storage defect is manifest.
  • the AAV vector upon administration, selectively expresses and secretes GAA from transduced hepatocytes.
  • the primary mechanism of action of a AAV vector expressing hGAA polypeptide as disclosed herein is to secrete continuous low levels of endogenous GAA from the liver into the systemic circulation in order to provide therapeutic exposure levels of GAA to tissue (e.g., the muscle, but not exclusively the muscle), resulting in glycogen removal and restoration of cellular architecture and function.
  • administration of a AAV vector expressing GAA is administration to a muscle, and can be by any suitable method including intravenous administration, intra-arterial administration, and/or intra-peritoneal administration.
  • exemplary modes of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., via an aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, in utero (or in ovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal, diaphragm and/or cardiac muscle], intradermal, intrapleural, intracerebral, and intraarticular), topical (e.g., to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intralymphatic, and the like, as well as direct tissue or organ injection (e.g., to liver,
  • administration of a AAV vector expressing GAA as disclosed herein is to skeletal muscle according to the present invention, and includes but is not limited to administration to skeletal muscle in the limbs (e.g., upper arm, lower arm, upper leg, and/or lower leg), back, neck, head (e.g., tongue), thorax, abdomen, pelvis/perineum, and/or digits.
  • limbs e.g., upper arm, lower arm, upper leg, and/or lower leg
  • head e.g., tongue
  • thorax e.g., abdomen, pelvis/perineum, and/or digits.
  • Suitable skeletal muscles that can be injected are disclosed in International Application WO2021102107, which is incorporated herein its entirety by reference.
  • the rAAV vectors and/or rAAV genome are administered to the skeletal muscle, liver, diaphragm, costal, and/or cardiac muscle cells of a subject.
  • a conventional syringe and needle can be used to inject a rAAV virion suspension into an animal.
  • Parenteral administration of a the rAAV vectors and/or rAAV genome, by injection can be performed, for example, by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, for example, in ampoules or in multi-dose containers, with an added preservative.
  • compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain agents for a pharmaceutical formulation, such as suspending, stabilizing and/or dispersing agents.
  • agents for a pharmaceutical formulation such as suspending, stabilizing and/or dispersing agents.
  • the rAAV vectors and/or rAAV genome as disclosed herein can be in powder form (e.g., lyophilized) for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use.
  • more than one administration may be employed to achieve the desired level of GAA expression over a period of various intervals, e.g., hourly, daily, weekly, monthly, yearly, etc.
  • Dosing can be single dosage or cumulative (serial dosing), and can be readily determined by one skilled in the art.
  • treatment of Pompe Disease comprises a one-time administration of an effective dose of a pharmaceutical composition comprising a AAV vector encoding a GAA polypeptide.
  • treatment of a subject with Pompe disease may comprise multiple administrations of a pharmaceutical composition comprising a AAV vector encoding a GAA polypeptide when the subject is not administered long-term ERT, where the multiple administrations can be carried out over a range of time periods, such as, e.g., once yearly, or every 6- months, or about every 2-years, or about every 3-years, or about every 4 years, or about every 5-years or longer than 5-year intervals.
  • the timing of administration can vary from individual to individual, depending upon such factors as the severity of an individual's symptoms.
  • an effective dose of a AAV vector encoding a GAA polypeptide as disclosed herein can be administered to an individual once every year, or once every two years, or every six months for an indefinite period of time, or until the individual no longer requires therapy.
  • a person of ordinary skill in the art will recognize that the condition of the individual can be monitored throughout the course of treatment and that the effective amount of a AAV vector encoding a GAA polypeptide as disclosed herein that is administered can be adjusted accordingly.
  • Injectables comprising a AAV vector encoding a GAA polypeptide as disclosed herein can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.
  • a AAV vector encoding a GAA polypeptide as disclosed herein in a local rather than systemic manner, for example, in a depot or sustained-release formulation.
  • the virus vector and/or virus capsid can be delivered adhered to a surgically implantable matrix (e.g., as described in U.S. Patent Publication No. US-2004-0013645-A1).
  • a AAV vector encoding a GAA polypeptide as disclosed herein can be administered to the lungs of a subject by any suitable means, optionally by administering an aerosol suspension of respirable particles comprised of the virus vectors and/or virus capsids, which the subject inhales.
  • the respirable particles can be liquid or solid. Aerosols of liquid particles comprising the virus vectors and/or virus capsids may be produced by any suitable means, such as with a pressure-driven aerosol nebulizer or an ultrasonic nebulizer, as is known to those of skill in the art. See, e.g., U.S. Patent No. 4,501,729. Aerosols of solid particles comprising the virus vectors and/or capsids may likewise be produced with any solid particulate medicament aerosol generator, by techniques known in the pharmaceutical art.
  • a AAV vector encoding a GAA polypeptide as disclosed herein can be formulated in a solvent, emulsion or other diluent in an amount sufficient to dissolve an rAAV vector disclosed herein.
  • the rAAV vectors and/or rAAV genome encoding GAA polypeptide as disclosed herein can herein may be formulated in a solvent, emulsion or a diluent in an amount of, e.g., less than about 90% (v/v), less than about 80% (v/v), less than about 70% (v/v), less than about 65% (v/v), less than about 60% (v/v), less than about 55% (v/v), less than about 50% (v/v), less than about 45% (v/v), less than about 40% (v/v), less than about 35% (v/v), less than about 30% (v/v), less than about 25% (v/v), less than about 20% (v/v), less than about 15% (v/v), less than about 10% (v/v), less than about 5% (v/v), or less than about 1% (v/v).
  • a solvent, emulsion or a diluent in an amount of, e.g., less than
  • the rAAV vectors and/or rAAV genome encoding a GAA polypeptide as disclosed herein can disclosed herein may comprise a solvent, emulsion or other diluent in an amount in a range of, e.g., about 1% (v/v) to 90% (v/v), about 1% (v/v) to 70% (v/v), about 1% (v/v) to 60% (v/v), about 1% (v/v) to 50% (v/v), about 1% (v/v) to 40% (v/v), about 1% (v/v) to 30% (v/v), about 1% (v/v) to 20% (v/v), about 1% (v/v) to 10% (v/v), about 2% (v/v) to 50% (v/v), about 2% (v/v) to 40% (v/v), about 2% (v/v) to 30% (v/v), about 2% (v/v) to 20% (v/v), about 2% (v/v) to
  • a AAV vector encoding a GAA polypeptide can be an AAV of any serotype, including but not limited to encapsulated by any AAV8 capsid, or any AAV3b capsid selected from: AAV3b capsid (SEQ ID NO: 452); AAV3b265D capsid (SEQ ID NO: 454), AAV3b ST (S663V+T492V) capsid (SEQ ID NO: 456), AAV3b265D549A capsid (SEQ ID NO: 458); AAV3b549A capsid (SEQ ID NO: 460); AAV3bQ263Y capsid (SEQ ID NO: 462) or AAV3bSASTG capsid (i.e., a AAV3b capsid comprising Q263A/T265 mutations).
  • AAV3b capsid SEQ ID NO: 452
  • AAV3b ST S663V+T492V capsid
  • Carriers and excipients that might be used include saline (especially sterilized, pyrogen-free saline) saline buffers (for example, citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, proteins (for example, serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol. USP grade carriers and excipients are particularly useful for delivery of virions to human subjects.
  • a AAV vector encoding a GAA polypeptide as disclosed herein can also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by IM injection.
  • a rAAV vector and/or rAAV genome as disclosed herein may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives.
  • the method is directed to treating Pompe Disease that results from a deficiency of GAA in a subject, wherein a AAV vector encoding a GAA polypeptide as disclosed herein is administered to a patient suffering from Pompe Disease, and following administration, GAA is secreted from cells in the liver and there is uptake of the secreted GAA by cells in skeletal muscle tissue, cardiac muscle tissue, diaphragm muscle tissue or a combination thereof, wherein uptake of the secreted GAA results in a reduction in lysosomal glycogen stores in the tissue(s), including but not limited to muscle.
  • a AAV vector encoding a GAA polypeptide as disclosed herein is encapsulated in a capsid, e.g., encapsulated by any AAV3b capsid selected from: AAV3b capsid (SEQ ID NO: 452); AAV3b265D capsid (SEQ ID NO: 454), AAV3b ST (S663V+T492V) capsid (SEQ ID NO: 456), AAV3b265D549A capsid (SEQ ID NO: 458); AAV3b549A capsid (SEQ ID NO: 460); AAV3bQ263Y capsid (SEQ ID NO: 462) or AAV3bSASTG capsid (i.e., a AAV3b capsid comprising Q263A/T265 mutations).
  • AAV3b capsid SEQ ID NO: 452
  • AAV3b ST S663V+T492V capsid
  • At least about 1.6xl0 12 to about 4.0xl0 12 vg/kg will be administered per dose in a pharmaceutically acceptable carrier.
  • dosages of the virus vector and/or capsid to be administered to a subject depend upon the mode of administration, the severity and type of Pompe disease (i.e., LOPD or IOPD) to be treated and/or prevented, the individual subject's condition, age and gender, and the particular virus vector or capsid, the nucleic acid encoding GAA polypeptide to be delivered, and the like, and can be determined in a routine manner.
  • Exemplary doses for achieving therapeutic effects are titers of at least about between 1.0E9vg/kg and 5.0E13 vg/kg, e.g., 1.0E9vg/kg and 5.0E12 vg/kg; 5.0E9vg/kg and 5.0E12 vg/kg; 5.0E9vg/kg and 1.0E12 vg/kg; 5.0E9vg/kg and 5.0E11 vg/kg; 5.0E9vg/kg and 5.0E10 vg/kg; and 1.0E9vg/kg and I.OEIO vg/kg.1.5 x 10 11 vg/kg, or at least about 1.5xl0 12 vg/kg, or at least about 4.0 xlO 12 vg/kg.
  • the dose for achieving therapeutic effects as disclosed herein may also be determined by the strength of the liver specific promoter (LSP) operatively linked to the nucleic acid encoding the GAA polypeptide, as well as specific signal sequence, and ability of the cell to cleave the signal sequence when secreted from the cell.
  • LSP liver specific promoter
  • the dose of the AAV encoding the GAA polypeptide as disclosed herein can be lower than about 1.6xl0 12 when the liver specific promoter is stronger than the LPS (SEQ ID NO: 97) used in a AAV8-LSPhGAA vector, however, the dose of AAV should be titrated and determined based on the level of GAA expressed in the cell, as determined by transduction efficiency of the AAV capsid and the LSP, and the ability of the cell to secrete the expressed GAA polypeptide in order to avoid GAA accumulation in the transfected cell and any associated cell toxicity.
  • a method of treating Pompe Disease by administering a nucleic acid encoding a GAA to a cell, comprising contacting the cell with a rAAV vector and/or rAAV genome as disclosed herein, under conditions for the nucleic acid to be introduced into the cell and expressed to produce GAA.
  • the cell is a cell in vivo. In some embodiments, the cell is a mammalian cell in vivo.
  • a AAV vector encoding a GAA polypeptide as disclosed herein is useful in methods to increase phrenic nerve activity in a mammal having Pompe disease and/or insufficient GAA levels.
  • a AAV vector encoding a GAA polypeptide as disclosed herein e.g., a rAAV vector and/or rAAV genome encapsulated in a capsid, e.g., encapsulated by AAV8 or any AAV3b capsid selected from: AAV3b capsid (SEQ ID NO: 452); AAV3b265D capsid (SEQ ID NO: 454), AAV3b ST (S663V+T492V) capsid (SEQ ID NO: 456), AAV3b265D549A capsid (SEQ ID NO: 458); AAV3b549A capsid (SEQ ID NO: 460);
  • AAV3bQ263Y capsid (SEQ ID NO: 462) or AAV3bSASTG capsid, can be administered to the central nervous system (e.g., neurons).
  • retrograde transport a AAV vector encoding a GAA polypeptide as disclosed herein from the diaphragm (or other muscle) to the phrenic nerve or other motor neurons can result in biochemical and physiological correction of Pompe disease.
  • a rAAV capsid of the rAAV virion used to treat Pompe Disease is any of those listed in Table 1 as disclosed in International Applications W02020/102645, and
  • W02020/ 102667 each of which are incorporated herein in their entirety, and includes any of AAV8 or AAV3, or AAV3b (including but not limited to AAV3b serotypes AAV3b265D,
  • AAV3b265D549A, AAV3b549A, AAV3bQ263Y, AAV3bSASTG i.e., a AAV3b capsid comprising Q263A/T265 mutations) serotypes
  • AAV3bSASTG i.e., a AAV3b capsid comprising Q263A/T265 mutations) serotypes
  • a patient suffering from Pompe Disease by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or
  • an AAV GAA of any serotype is capable of reducing any one or more of the systems of (i) the feeling of weakness in a patient’s lower extremities, including, the legs, trunk and/or arms, ii) a shortness of breath, a hard time exercising, lung infections, a big curve in the spine, trouble breathing while sleeping, an enlarged liver, an enlarged tongue and/or a stiff joint, (iii) in a patient suffering from Pompe Disease by, e.g., about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, about 50% to about 80%
  • At least one symptom associated with Pompe Disease, or at least one adverse side effect associated with Pompe Disease are reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, and the severity of at least one symptom associated with Pompe Disease, or at least one adverse side effect is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.
  • At least one symptom associated with Pompe Disease, or at least one adverse side effect associated with Pompe Disease is reduced by about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70%.
  • rhGAA recombinant human GAA
  • ERT recombinant human GAA
  • ERT recombinant human GAA
  • the inventors have demonstrated that a subject with Pompe disease can take breaks from the normal ERT regimen for extended period of time (e.g., extended periods of ERT cessation) without a clinical set back if the subject is administered a specific dose of AAV vector expressing a GAA polypeptide as disclosed herein.
  • withdrawal of the administration of long-term ERT begins at about the time of administration of the AAV vector to the subject (e.g., the day before, the day of, or the day after), or in some embodiments, withdrawal of the administration of long-term ERT can occur at about 26 weeks, or anywhere within about 24 to about 26 weeks after administration of the AAV vector.
  • a subject administered a AAV vector expressing GAA as disclosed herein can, after an initial period of withdrawal of the administration of long-term ERT for an extended period of time, be administered complementary ERT, where the complementary ERT is administered after about 6-months, or about 1 year, or longer than a year of cessation of the long-term ERT.
  • the technology disclosed herein relates to a method whereby a subject with Pompe disease who is administered a AAV vector expressing GAA as disclosed herein, can have breaks or “holidays” from the normal long-term ERT administration.
  • a subject administered an AAV vector expressing GAA as disclosed herein can have extended periods of time with the absence of administration of long-term ERT administration.
  • the methods as disclosed herein enable flexibility in normal ERT regimens, in that extended breaks or withdrawal of administration of long-term ERT does not result in a clinical decline - that is, a subject remains clinically stable despite not having ongoing long-term ERT.
  • the methods as disclosed herein encompass re-administration of ERT (herein referred to as “complementary ERT”) after an extended period of time of cessation of ERT administration, and enable flexibility in normal ERT regimen, as the continued production of GAA expressed by the AAV permits ERT flexibility.
  • the complementary ERT is pulse administration of ERT, as disclosed herein.
  • the complementary ERT is at less frequent intervals, or at a lower dose, or at irregular doses, or at irregular intervals as compared to the prior administration of long-term ERT.
  • the methods as disclosed herein provide significant advantages to subjects with Pompe disease, including but not limited to reducing or eliminating the rigorous and arduous weekly, or every-other week infusions of long-term rhGAA ERT treatment, which are significantly time- consuming and geographically limiting, and hinders a patient with Pompe disease from travelling for prolonged periods from areas where their ERT infusions are administered. Additionally, as disclosed herein, the absence of ERT administration also reduces any side effects due to anti-rhGAA antibodies against the ERT, and also circumvents the need for administration of immune suppressants normally co-administered with the ERT. As such, the methods to treat Pompe disease as disclosed here leads to greater flexibility in Pompe treatment and an improvement in quality of life and lifestyle of subjects with Pompe disease.
  • the technology relates to a method of treating Pompe disease in a subject, comprising administering to the subject a pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome, a heterologous nucleic acid sequence encoding an alpha-glucosidase (GAA) polypeptide in expressible form wherein the heterologous nucleic acid is operatively linked to a liver-specific promoter, in the absence of administration of long-term GAA enzyme replacement therapy (ERT) for an extended period of time (e.g., ERT administration can be withdrawn or stopped at about 24, or at about 26 weeks, or earlier than 24- or 26 weeks, after administration of the recombinant AAV).
  • AAV recombinant adeno-associated virus
  • the dosage of the recombinant AAV comprising nucleic acid encoding GAA polypeptide ranges from 1.0E1 Ivg/kg and 5.0E13 vg/kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 160 to ⁇ 2,260 nmol/mL/hr, 165 to ⁇ 2,260nmol/ml/hr, 175 to ⁇ 2,260, 180 to ⁇ 2,260, 185 to ⁇ 2,260, 189 to ⁇ 2,260 of at least within two weeks of administration.
  • the dosage of the AAV expressing a GAA polypeptide ranges from 11.0E11 vg/kg and 5.0E13 vg/kg, and in some embodiments, is no more than 4.0E 12 vg/kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 189 to ⁇ 2,260 nmol/mL/hr of at least within two weeks of administration.
  • the dosage of the AAV expressing GAA is no more than 4.0E 12 vg/kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 189 to ⁇ 2,260 nmol/mL/hr of at least within two weeks of administration.
  • the dosage of AAV expressing GAA is no more than 5.0E” vg/kg. In some embodiments, the dosages range from LOE 9 vg/kg to 5.0E” vg/kg.
  • the dosage of AAV expressing GAA is no more than 5.0E13 vg/kg. In some embodiments, the dosages range from 1.0E9vg/kg or 5.0E13 vg/kg.
  • the technology described herein relates to the discovery that a single infusion of a rAAV vector expressing human acid alpha-glucosidase (GAA) can be a stand-alone replacement for repeated infusions of enzyme replacement therapy (ERT) with recombinant human GAA protein (rhGAA).
  • GAA human acid alpha-glucosidase
  • ERT enzyme replacement therapy
  • rhGAA recombinant human GAA protein
  • the inventors demonstrate that a one-time administration of AAV expressing GAA leads to long-term transduction of a normal GAA gene into hepatocytes and continuous constitutive expression of GAA in the systemic circulation.
  • administration of a composition comprising AAV expressing hGAA can replace the biweekly exogenous administration of ERT that subjects with Pompe disease normally receive. That is, the inventors have demonstrated herein that subjects with Pompe that are administered a AAV expressing hGAA as disclosed herein can have long term cessation of ERT.
  • a method of treating Pompe in a subject in need thereof by administering the subject a composition comprising a AAV vector expressing the a-glucosidase (GAA) protein, where the subject is not being concurrently administered a GAA enzyme replacement therapy.
  • the technology relates to a method of administering a AAV expressing GAA where the subject can be withdrawn from a GAA enzyme replacement therapy (ERT) for an extended period of time, e.g., at least 3 months, at least 4 months, at least 5 months, at least 1 year, at least 114 years and points in between 6 months or longer.
  • ERT GAA enzyme replacement therapy
  • the subject is withdrawn from ERT on the day of, or shortly before administration of a AAV expressing GAA, and is clinically stable with respect to at least one or more, as disclosed herein.
  • the subject is withdrawn from ERT at any time between 1-2 days before or after administration, and about 6-months after administration of a AAV expressing GAA, and is clinically stable with respect to at least one or more Pompe symptoms for at least 6 months, as disclosed herein.
  • the inventors have also discovered that Pompe patients administered a AAV expressing GAA according to the methods and dose ranges as disclosed herein, there is minimal immune response to the GAA protein expressed by the AAV.
  • immune modulation or administration of immune suppressants there is minimal, or no need for immune modulation or administration of immune suppressants at the time of, or before, or after the administration of the AAV to the subject, and therefore normal immune suppressants protocols which are typically administered when a subject is administered a viral vector, or undergoing gene therapy are not required.
  • the method to treat Pompe comprises, or consists essentially of, or consists of, administering an AAV vector expressing GAA as disclosed herein, in the absence of administration of ERT for Pompe, and also in the absence of immune modulation.
  • the subject has late onset Pompe Disease (LOPD) or infantile-onset Pompe disease.
  • LOPD late onset Pompe Disease
  • the AAV that comprise a nucleotide sequence containing inverted terminal repeats (ITRs), a promoter, a heterologous gene, a poly-A tail and potentially other regulator elements for use to treat a Pompe disease, e.g., late onset Pompe disease (LOPD), wherein the heterologous gene is GAA, and wherein the vector, e.g., rAAV can be administered to a patient in a therapeutically effective dose that is delivered to the appropriate tissue and/ or organ for expression of the heterologous GAA gene and treatment of the disease, e.g., Pompe disease.
  • ITRs inverted terminal repeats
  • LOPD late onset Pompe disease
  • the vector e.g., rAAV can be administered to a patient in a therapeutically effective dose that is delivered to the appropriate tissue and/ or organ for expression of the heterologous GAA gene and treatment of the disease, e.g., Pompe disease.
  • a subject administered a AAV vector expressing GAA as disclosed herein can, after an initial period of withdrawal of the administration of long-term ERT for an extended period of time, be administered complementary ERT, where the complementary ERT is administered after about 6-months, or about 1 year, or longer than a year of cessation of the long-term ERT.
  • the technology disclosed herein relates to a method whereby a subject with Pompe disease who is administered a AAV vector expressing GAA as disclosed herein, can have breaks or “holidays” from the normal long-term ERT administration.
  • a subject administered an AAV vector expressing GAA as disclosed herein can have extended periods of time with the absence of administration of long-term ERT administration.
  • the methods as disclosed herein enable flexibility in normal ERT regimens, in that extended breaks or withdrawal of administration of long-term ERT does not result in a clinical decline - that is, a subject remains clinically stable despite not having ongoing long-term ERT.
  • the methods as disclosed herein encompass re-administration of ERT (herein referred to as “complementary ERT”) after an extended period of time of cessation of ERT administration, and enable flexibility in normal ERT regimen, as the continued production of GAA expressed by the AAV permits ERT flexibility.
  • the complementary ERT is pulse administration of ERT, as disclosed herein. In some embodiments, the complementary ERT is at less frequent intervals, or at a lower dose, or at irregular doses, or at irregular intervals as compared to the prior administration of long-term ERT.
  • the methods as disclosed herein provide significant advantages to subjects with Pompe disease, including but not limited to reducing or eliminating the rigorous and arduous weekly, or every-other week infusions of long-term rhGAA ERT treatment, which are significantly time- consuming and geographically limiting, and hinders a patient with Pompe disease from travelling for prolonged periods from areas where their ERT infusions are administered. Additionally, as disclosed herein, the absence of ERT administration also reduces any side effects due to anti-rhGAA antibodies against the ERT, and also circumvents the need for administration of immune suppressants normally co-administered with the ERT. As such, the methods to treat Pompe disease as disclosed here leads to greater flexibility in Pompe treatment and an improvement in quality of life and lifestyle of subjects with Pompe disease.
  • the technology relates to a method of treating Pompe disease in a subject, comprising administering to the subject a pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome, a heterologous nucleic acid sequence encoding an alpha-glucosidase (GAA) polypeptide in expressible form wherein the heterologous nucleic acid is operatively linked to a liver-specific promoter, in the absence of administration of long-term GAA enzyme replacement therapy (ERT) for an extended period of time (e.g., ERT administration can be withdrawn or stopped at about 24, or at about 26 weeks, or earlier than 24- or 26 weeks, after administration of the recombinant AAV).
  • AAV recombinant adeno-associated virus
  • the dosage of the recombinant AAV comprising nucleic acid encoding GAA polypeptide ranges from 1.0E9 vg/kg to 5.0E13 vg/kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 160 to ⁇ 2,260 nmol/mL/hr, 165 to ⁇ 2,260nmol/ml/hr, 175 to ⁇ 2,260, 180 to ⁇ 2,260, 185 to ⁇ 2,260, 189 to ⁇ 2,260 of at least within two weeks of administration.
  • the dosage of the AAV expressing GAA is in the range of 1.0E9vg/kg and 5.0E13 vg/kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 189 to ⁇ 2,260 nmol/mL/hr of at least within two weeks of administration.
  • the dosage of the AAV expressing GAA is in the range of 1.0E9vg/kg and 5.0E13 vg/kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 189 to ⁇ 2,260 nmol/mL/hr of at least within two weeks of administration.
  • the technology described herein relates to the discovery that a single infusion of a rAAV vector expressing human acid alpha-glucosidase (GAA) can be a stand-alone replacement for repeated infusions of enzyme replacement therapy (ERT) with recombinant human GAA protein (rhGAA).
  • the inventors demonstrate that a one-time administration of AAV expressing GAA leads to long-term transduction of a normal GAA gene into hepatocytes and continuous constitutive expression of GAA in the systemic circulation. Accordingly, the inventors demonstrate herein that administration of a composition comprising AAV expressing hGAA can replace the biweekly exogenous administration of ERT that subjects with Pompe disease normally receive. That is, the inventors have demonstrated herein that subjects with Pompe that are administered a AAV expressing hGAA as disclosed herein can have long term cessation of ERT.
  • a method of treating Pompe in a subject in need thereof by administering the subject a composition comprising a AAV vector expressing the a-glucosidase (GAA) protein, where the subject is not being concurrently administered a GAA enzyme replacement therapy.
  • the technology relates to a method of administering a AAV expressing GAA where the subject can be withdrawn from a GAA enzyme replacement therapy (ERT) for an extended period of time, e.g., at least 3 months, at least 4 months, at least 5 months, at least 1 year, at least 11 years and points in between 6 months or longer.
  • ERT GAA enzyme replacement therapy
  • the subject is withdrawn from ERT on the day of, or shortly before administration of a AAV expressing GAA, and is clinically stable with respect to at least one or more, as disclosed herein.
  • the subject is withdrawn from ERT at any time between 1-2 days before or after administration, and about 6-months after administration of a AAV expressing GAA, and is clinically stable with respect to at least one or more Pompe symptoms for at least 6 months, as disclosed herein.
  • the inventors have also discovered that Pompe patients administered a AAV expressing GAA according to the methods and dose ranges as disclosed herein, there is minimal immune response to the GAA protein expressed by the AAV.
  • immune modulation or administration of immune suppressants there is minimal, or no need for immune modulation or administration of immune suppressants at the time of, or before, or after the administration of the AAV to the subject, and therefore normal immune suppressants protocols which are typically administered when a subject is administered a viral vector, or undergoing gene therapy are not required.
  • the method to treat Pompe comprises, or consists essentially of, or consists of, administering an AAV vector expressing GAA as disclosed herein, in the absence of administration of ERT for Pompe, and also in the absence of immune modulation.
  • the subject has late onset Pompe Disease (LOPD) or infantile-onset Pompe disease.
  • LOPD late onset Pompe Disease
  • the disclosure herein relates, in general, to a method to treat a subject with Pompe Disease, comprising administering to the subject with Pompe disease a pharmaceutical composition comprising, or consisting essentially of, a recombinant adenovirus associated (AAV) vector comprising in its genome, a heterologous nucleic acid sequence encoding a polypeptide comprising an AAV vector comprising in its genome, a heterologous nucleic acid sequence encoding a polypeptide comprising an AAV vector comprising in its genome, a heterologous nucleic acid sequence encoding a polypeptide comprising an AAV vector comprising in its genome, a heterolog
  • Ill alpha-glucosidase (GAA) polypeptide wherein the heterologous nucleic acid is operatively linked to a liver-specific promoter, and wherein the subject is not administered a GAA enzyme replacement therapy (ERT) for an extended period of time, or can have extended breaks from ERT.
  • GAA GAA enzyme replacement therapy
  • ERT is continued, but at least one of: dosage or frequency is reduced.
  • a steady state of GAA expression by the rAAV as disclosed herein is a serum level of GAA at a pharmacological activity range from 189 to ⁇ 2,260 nmol/mL/hr.
  • the method to treat Pompe disease with rAAV expressing GAA as disclosed herein comprises administration of a therapeutically effective amount of a rAAV to result in a serum level of expressed hGAA within a pharmacological activity range of between 189 to 410 nmol/mL/hr, or 410 to ⁇ 2,260 nmol/mL/hr.
  • the method to treat Pompe disease with rAAV expressing GAA as disclosed herein comprises administration of a rAAV to result in a serum level of expressed hGAA within a range of 189 to ⁇ 2,260 nmol/mL/hr, and where the subject achieves clinical stability of one or more symptoms of Pompe disease.
  • Clinical stability includes a steady state in any one or more of the parameters: the 6MWT (6-minute walk test), FVC (Forced vital capacity).
  • clinical stability refers to a stable level in either motor function (as determined by the 6MWT) and/or pulmonary function (as determined by the FVC) in two consecutive assessments no less than 3- months apart.
  • a clinical stable level of motor function as determined by the 6MWT is ⁇ 12% decline, or less than a 43-meter decrease from baseline in two consecutive assessments no less than 3-months apart. Stated differently, a clinical stable level of motor function as determined by the 6MWT position is within a 0-12% decline from a baseline level in two consecutive assessments no less than 3-months apart.
  • a clinical stable level of pulmonary function as determined by the FVC % predicted in an upright position is ⁇ 15% decrease from baseline in two consecutive assessments no less than 3-months apart. Stated differently, a clinical stable level of pulmonary function as determined by the % FVC predicted in an upright position is between 1-14% from a baseline in two consecutive assessments no less than 3-months apart.
  • the baseline level of the 6MWT or FVC is the level measured at or before administration of the rAAV expressing GAA. In some embodiments, the baseline level of the 6MWT or FVC is the level measured at or before administration of the rAAV expressing GAA when the subject is concurrently administered GAA ERT. In some embodiments, the baseline level of the 6MWT or FVC is the level measured at or before administration of the rAAV expressing GAA when the subject is withdrawn from GAA ERT. In some embodiments, the baseline level of the 6MWT or, FVC is the level before withdrawing GAA ERT, e.g, at about 24 to about 26 weeks.
  • clinical stability is maintained between before ERT withdrawl and after ERT withdrawl of Pompe patients where the patients have received single administration of AAV comprising nucleic acid encoding GAA administrated at the the time of ERT administration, before ERT administration, or, after ERT administration.
  • Clinical stability is maintained indicate that 6MWT and or, FVC are within the ranges from baseline as described herein.
  • the method to treat Pompe disease with rAAV expressing GAA as disclosed herein comprises administration of an amount of rAAV to result in a reduction of glycogen levels in one or more tissues to within a normal range, where the normal range is the glycogen levels in the comparative tissue of a subject without Pompe disease.
  • the methods disclosed herein relate to human subjects can be administered a rAAV expressing GAA as disclosed herein at a dose in the range of 1.0E11 vg/kg and 5.0E13 vg/kg.
  • ERT withdrawal can occur at the time of the administration of the rAAV expressing GAA, or occurring at about 24 or 26 weeks after recombinant AAV administration.
  • the dose of the a rAAV vector or rAAV genome to be administered to the subject according to the method to treat Pompe Disease as disclosed herein depends upon the mode of administration, the promoter used, the signal peptide used, the severity of the Pompe disease or other condition to be treated and/or prevented, the individual subject's condition, the particular virus vector or capsid, the liver-specific promoter being used and the nucleic acid to be delivered, including but not limited to, nucleic acid encoding the signal peptide attached to the 5’ of the nucleic acid encoding expressible GAA polypeptide, and the like, and can be determined in a routine manner.
  • the therapeutically effective amount of the rAAV vector expressing GAA is an amount that results in a serum GAA concentration at steady state similar to the GAA pharmacological activity achieved by long tern GAA ERT (e.g within 5%, 10%, 20% of such levels).
  • a target GAA serum concentration at steady state ranging from about 160 to ⁇ 2,260 nmol/mL/hr, from about 189 to ⁇ 2,260 nmol/mL/hr, or rangin from 410 to ⁇ 2,260 nmol/mL/hr.
  • the dose of the rAAV vector expressing GAA is a therapeutically effective amount to achieve a target GAA serum concentration at steady state that confers pharmacological activity ranges from 189 to ⁇ 2,260 nmol/mL/hr. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase the tissue GAA levels in the subject to >0.30 pmol 4MU/min/gram of tissue, where the normal range of tissue GAA content in a subject without Pompe disease is 0.36 ⁇ /0.13 pmol 4MU/min/gram of tissue.
  • the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase the tissue GAA levels in the subject to between 0.25 to 0.4 pmol 4MU/min/gram of tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to result in a normal tissue GAA content of about 0.36 pmol 4MU/min/gram of tissue, e.g..
  • the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase the tissue GAA levels in the subject to between 0.1-0.5 pmol 4MU/min/gram of tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to result in a normal tissue GAA content of about greater than 0.36 pmol 4MU/min/gram of tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA content or levels in the subject within the range 0.2-0.4 pmol 4MU/min/gram of tissue.
  • the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA content in the subject to within 40%, or within 30%, or within 20%, or within 10%, or within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% of the normal muscle tissue GAA content of 0.36 ⁇ 0.13 (pmol 4MU/min/gram of tissue), where the GAA content of normal muscle tissue is a reference level of GAA in a subject without Pompe Disease.
  • the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA content in the subject greater than 0.1 mol 4MU/min/gram of tissue, where the normal range GAA content in subjects with Pompe disease is 0.05 + 0.04 (pmol 4MU/min/gram of tissue).
  • the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA content in the subject more than 2-fold, or 3-fold, or 4-fold, or 5-fold, or 6-fold, or 7-fold, or 8-fold, or 9-fold, or 10-fold, or more than 10-fold of the level of GAA tissue content in the subject with Pompe.
  • the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA content in the subject to about 50%, or, about 40%, or about 30%, or about 20%, or about 10%, or about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2% or about 1% of the level of GAA tissue content in the subject with Pompe.
  • the GAA activity in muscle is at least 1.5 fold, at least 2 fold, at least 3 fold, at least 5 fold, at least 8 fold, or at least 10 fold than the level prior to AAV administration.
  • the GAA activity in muscle is at least 1.5 fold, at least 2 fold, at least 3 fold, at least 5 fold, at least 8 fold, or at least 10 fold than the level after the long term ERT was withdrawn for at least about 24 weeks.
  • the dose of the rAAV vector expressing GAA is a therapeutically effective amount to reduce the tissue glycogen levels in the subject within the range 0.25 % wet tissue weight to about 1.5 % wet tissue weight. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to reduce the muscle tissue glycogen levels in the subject to within 40%, or within 30%, or within 20%, or within 10%, or within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% of the normal muscle tissue glycogen content of 0.99% ⁇ 0.74 (% wet tissue weight), which is the normal muscle tissue glycogen content (measured as % wet tissue weight), of a subject that does not have Pompe disease.
  • the dose of the rAAV vector expressing GAA is a therapeutically effective amount of GAA to exhibit an improvement in the therapeutic index of 3- to 5-fold.
  • the dose of the rAAV vector expressing GAA is a therapeutically effective amount to result in the subject having clinically stable levels of hGAA at 10-weeks, or at least 20 weeks, or 30 weeks post AAV administration.
  • the term “effective amount” is synonymous with “therapeutically effective amount”, “effective dose”, or “therapeutically effective dose.”
  • the effectiveness of a therapeutic compound disclosed herein to treat Pompe Disease can be determined, without limitation, by observing an improvement in an individual based upon one or more clinical symptoms, and/or physiological indicators associated with Pompe Disease.
  • an improvement in the symptoms associated with Pompe Disease can be indicated by a reduced need for a concurrent therapy.
  • exemplary doses for achieving therapeutic effects of a rAAV vector expressing hGAA as disclosed herein is within the range of 1.0E 9 vg/kg to 5.0E” vg/kg.
  • the dose administerered to a subject is at least about 1.0E 9 vg/kg, at least about 1.0E 10 vg/kg, at least about 1.0E11 vg/kg, at least about 1.0E12vg/kg, about 1.1E12 vg/kg, about 1.2E12 vg/kg, about 1.3E12 vg/kg, about 1.4E12 vg/kg, about 1.5E12 vg/kg, about 1.6E12 vg/kg, about 1.7E12 vg/kg, about 1.8E12 vg/kg, about 1.9E12 vg/kg, about 2.0E12 vg/kg, about 3.0E12 vg/kg, about 4.0E12 vg/
  • the rAAV administration is accompanied with immunomodulators, e.g, prednisone, methotrexate or, a combination thereof.
  • the rAAV of the invention is packaged within AAV XL 32 or AAV XL 32.1 capsid.
  • exemplary doses for achieving therapeutic effects according to the methods as disclosed herein are titers of at between 1.2E12 and 4.0E12 vg/kg, for example, least about 1.0E12 vg/kg, about 1.1E12 vg/kg, about 1.2E12 vg/kg, about 1.3E12 vg/kg, about 1.4E12 vg/kg, about 1.5E12 vg/kg, about 1.6E12 vg/kg, about 1.7E12 vg/kg, about 1.8E12 vg/kg, about 1.9E12 vg/kg, about 2.0E12 vg/kg, about 2.1E12 vg/kg, about 2.2E12 vg/kg, about 2.3E12 vg/kg, about 2.4E12 vg/kg, about 2.5E12 vg/kg, about 2.6E12 vg/kg, about 2.7E12 vg/kg, about 2.8E12 vg/kg,
  • exemplary doses for achieving therapeutic effects according to the methods as disclosed herein are titers of at between 1.0E11 vg/kg and 5.0E13 vg/kg, for example, l.OEl lvg/kg, LlEl lvg/kg, 1.2El lvg/kg, 1.3El lvg/kg, 1.4El lvg/kg, 1.5El lvg/kg, 1.6El lvg/kg, 1.7E11 vg/kg, 1.8E11 vg/kg, 1.9E11 vg/kg, about 1.0E12vg/kg, about 1.1E12 vg/kg, about 1.2E12 vg/kg, about 1.3E12 vg/kg, about 1.4E12 vg/kg, about 1.5E12 vg/kg, about 1.6E12 vg/kg, about 1.7E12 vg/kg, about 1.8E12 vg/kg, 1.9E11 vg/
  • a rAAV vector expressing hGAA as disclosed herein useful for the methods to treat Pompe Diseases exemplary doses for achieving therapeutic effects are titers of at least about 1.0E12 to 4.0E12 vg/kg, or about 1.2E12 to 3.0E12 vg/kg, or about 1.2E12 to 2.5E12 vg/kg, or about 2.5E12 to 4.0E12 vg/kg.
  • the dosage may be modified by a person of ordinary skill in the art, e.g., the dose administered can be lower than LOEB vg/kg, or lower than about 5.0E11 vg/kg where a stronger promoter than the LSP of SEQ ID NO: 97 is operatively linked to the nucleic acid encoding GAA.
  • the dosage may be modified by a person of ordinary skill in the art, e.g., the dose of the rAAV vector administered can be higher than about 1.6E12 vg/kg, or higher than about 5.0E12 vg/kg when a weaker liver-specific promoter than the LSP of SEQ ID NO: 97 used in the AAV8-LSPhGAA vector is operatively linked to the nucleic acid encoding GAA.
  • Exemplary doses for achieving therapeutic effects are titers of at least about LOE 5 , LOE 6 , LOE 7 , LOE 8 , LOE 9 , LOE 10 , LOE 11 , LOE 12 vg/kg, optionally about LOE 10 to about LOE 12 transducing units (vg/kg), and optionally does not exceed about 4.0E 12 vg/kg or optionally is about 3.0E 12 transducing units (vg/kg).
  • no percentage of the administered dose of rAAV vector expressing hGAA as disclosed herein is retained in the liver following administration, e.g., at least 1, 2, 3, 4 weeks or more following administration.
  • less than 1.0E 9 vg/kg to 5.0E 11 vg/kg of the administered rAAV vector expressing hGAA as disclosed herein is retained in the liver following administration, e.g., at least 1, 2, 3, 4 weeks or more following administration.
  • administration of rAAV vector or rAAV genome according to the methods as disclosed herein to treat a subject with Pompe disease can result in production of a GAA protein with a circulatory half-life of 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, one month, two months, three months, four months or more.
  • the methods for treatment of Pompe as disclosed herein relate to a single dose of a rAAV expressing hGAA is used to treat a subject in a single administration.
  • the dose of rAAV to be administered can be given to the subject in multiple administrations, e.g., a dose of rAAV can be divided into sub-doses and administered in multiple administrations.
  • the methods for treatment of Pompe as disclosed herein can comprise multiple administrations of a single dose of a rAAV expressing hGAA, that is, the subject can be treated with a booster administration (i.e., a second, third, fourth, etc.) of a rAAV expressing hGAA after a defined period of time after the initial or first administration.
  • a booster administration i.e., a second, third, fourth, etc.
  • the dose of a booster administration can be the same dose (amount) of rAAV-hGAA administered in the first administration, or can be a higher dose, or a lower dose, depending on the factors above, including, but not limited to, a therapeutically effective dose to achieve any one or more of (i) serum GAA levels indicating steady state of GAA expression, (ii) reduced glycogen levels and/or, maintained glycogen levels within normal range in the muscle, and (iii) one or more Pompe symptoms, including muscle function and/or pulmonary function within clinically stable levels.
  • a therapeutically effective dose to achieve any one or more of (i) serum GAA levels indicating steady state of GAA expression, (ii) reduced glycogen levels and/or, maintained glycogen levels within normal range in the muscle, and (iii) one or more Pompe symptoms, including muscle function and/or pulmonary function within clinically stable levels.
  • a steady state of GAA expression by the rAAV as disclosed herein is a serum level of GAA at a pharmacological activity range from 165 to ⁇ 2260 nmol/ml/hr or, from 189 to ⁇ 2,260 nmol/mL/hr.
  • Stability of one or more symptoms of Pompe disease can be determined by the clinical stability parameters as disclosed herein, and includes a steady state in the 6MWT (6-minute walk test) and/or FVC (Forced vital capacity) in two consecutive assessments no less than 3-months apart as disclosed herein.
  • a clinical stable level of motor function as determined by the 6MWT is ⁇ 12% decline, or less than a 43-meter decrease from baseline in two consecutive assessments no less than 3-months apart.
  • a clinical stable level of pulmonary function as determined by the FVC % predicted in an upright position is ⁇ 15% decrease from baseline in two consecutive assessments no less than 3-months apart.
  • the time period of between administration of a first dose, and a subsequent dose (i.e., a booster dose) of a rAAV vector according to the methods for treatment of Pompe as disclosed herein is selected from any of the following: about 4 months, about 6 months, about 7 months, about 8 months, about 9 months, about 12 months, about 18 months, about 24 months, or about 3 years, about 4 years, about 5 years, or more than 5 years
  • administration of a rAAV vector or rAAV genome as disclosed herein for the treatment of Pompe Disease results in an increase in weight by, e.g., at least 0.5 pounds, at least 1 pound, at least 1.5 pounds, at least 2 pounds, at least 2.5 pounds, at least 3 pounds, at least 3.5 pounds, at least 4 pounds, at least 4.5 pounds, at least 5 pounds, at least 5.5 pounds, at least 6 pounds, at least 6.5 pounds, at least 7 pounds, at least 7.5 pounds, at least 8 pounds, at least 8.5 pounds, at least 9 pounds, at least 9.5 pounds, at least 10 pounds, at least 10.5 pounds, at least 11 pounds, at least 11.5 pounds, at least 12 pounds, at least 12.5 pounds, at least 13 pounds, at least 13.5 pounds, at least 14 pounds, at least 14.5 pounds, at least 15 pounds, at least 20 pounds, at least 25 pounds, at least 30 pounds, at least 50 pounds.
  • an AAV GAA of any serotype, as disclosed herein for the treatment of Pompe Disease results in an increase in weight by, e.g., from 0.5 pounds to 50 pounds, from 0.5 pounds to 30 pounds, from 0.5 pounds to 25 pounds, from 0.5 pounds to 20 pounds, from 0.5 pounds to 15 pounds, from 0.5 pounds to ten pounds, from 0.5 pounds to 7.5 pounds, from 0.5 pounds to 5 pounds, from 1 pound to 15 pounds, from 1 pound to 10 pounds, from 1 pound to 7.5 pounds, form 1 pound to 5 pounds, from 2 pounds to ten pounds, from 2 pounds to 7.5 pounds.
  • Pompe disease Treatment of Pompe disease is normally by administration of long-term enzyme replacement therapy (ERT) with recombinant human acid a-glucosidase (rhGAA) and has previously reported to prolong survival of both LOPD and IOPD patients through improvement in pulmonary and muscle function.
  • ERT enzyme replacement therapy
  • rhGAA recombinant human acid a-glucosidase
  • Schoser et al report that after a period of stabilization, both these parameters continue to decline over time (see Schoser et al., 2017 Neurol, 264: 621-30).
  • ERT with recombinant GAA protein has numerous disadvantages, including but not limited to, short-half life of the administerted recombinant GAA in the blood, lack of efficient skeletal muscle updake, potential for high titer antibody response and even some patients failing to respond to ERT, and rigorous administration of a recombinant GAA infusion every 2 weeks, that can take between 5-8 hours.
  • the benefits of ERT may not be long-lasting, and many patients die or remain weak despite treatment compliance (Tamopolsky et al. 2016 Can J Neurol Sci, 43: 472-85).
  • HSAT sustained anti-GAA antibody titers
  • CRIM cross-reactive immunologic material
  • CRIM-negative Pompe disease subjects produced HSAT and demonstrated markedly reduced efficacy from ERT with rhGAA (Amalfitano et al. 2001).
  • the two subjects who were CRIM-negative produced higher titers of anti-GAA antibodies than the third subject who was CRIM-positive. This corresponded with a markedly reduced efficacy of ERT in the CRIM-negative subjects.
  • the relevance of antibody formation to efficacy of therapy in Pompe disease has been emphasized by the poor response of CRIM-negative subjects to ERT, which correlated with the onset of HSAT (Kishnani et al. 2010).
  • While no LOPD subjects are CRIM negative, some mount high antibody responses to rhGAA capable of interfering with optimal efficacy of ERT (Patel et al. 2012; de Vries et al. 2017;
  • the rAAV vectors expressing a GAA polypeptide as disclosed herein can be used in methods to treat subjects with Pompe disease, and comprises administering a AAV expressing hGAA as disclosed herein that enables the subject to have an extended period of cessation of the administration of long-term ERT.
  • rAAV vectors expressing a GAA polypeptide as disclosed herein can be administered to a subject with Pompe disease that enables them to have the ability to reduce, or eliminate the clinical need for long-term hGAA ERT administration for an extended period of time.
  • another aspect of the technology disclosed herein relates to a method to treat Pompe Disease by administrating to the subject with Pompe disease a composition comprising a rAAV vector expressing a GAA polypeptide as disclosed herein, where in some embodiments, the methods enable subjects with Pompe disease to withdraw from, or stop long-term administration of recombinant human GAA (rhGAA) ERT, which is normally administered on a weekly or every-other week regimen.
  • the methods disclosed herein enable a subject with Pompe disease to take breaks from the normal ERT regimen for extended period of time (e.g., extended periods of ERT cessation) if the subject is administered a specific dose of AAV vector expressing a GAA polypeptide as disclosed herein.
  • withdrawal of the administration of long-term ERT begins at about the time of administration of the AAV vector to the subject (e.g., the day before, the day of, or the day after), or in some embodiments, withdrawal of the administration of long-term ERT can occur at about 24 weeks, or anywhere within about 24 weeks to about 26 weeks after administration of the AAV vector.
  • long-term ERT refer to the standard-of-care (SOC) treatment for a subject with Pompe disease, including IOPD and LOPD, and is normally a regimen of intravenous administration of recombinant human alglucisudease alfa protein (rhGAA) to the subject on a regular and frequent basis, e.g., every week or every 2 weeks, without any breaks in the regimen, and where the administered rhGAA protein provides an exogenous source of GAA.
  • SOC standard-of-care
  • MYOZYME® (alglucosidase alfa) which was first US approved product (2006) for the treatment of Pompe disease
  • LUMIZYME® (alglucosidase alfa) which was approved in 2010 are exemplary current standard- of-care (SOC) treatments for infantile-onset and late-onset Pompe patients.
  • SOC standard- of-care
  • the normal long-term ERT administration regimen is intravenously administration of Alglucosidase alfa every 2 weeks as an infusion at a dose of 20 mg/Kg (LUMIZYME Prescribing Information 2014).
  • the methods as disclosed herein by administering a AAV expressing hGAA as disclosed herein enable the withdrawal or cessation of administration of long-term ERT for an extended period of time.
  • the extended period of time is at least about 3-months, or at least about 6-months, or at least about 1 year, or longer than 1 year.
  • extended period refers to a time period that is longer than 1 month, and in some embodiments is a time period longer than if up to 5 administrations of ERT are missed.
  • the methods to treat a subject with Pompe Disease with a AAV expressing hGAA as disclosed herein comprises administering to the subject a pharmaceutical composition comprising a AAV expressing GAA and where the subject is not administered long-term GAA enzyme replacement therapy (ERT) for an extended period of time.
  • ERT enzyme replacement therapy
  • the cessation or withdrawal of administration of long-term ERT occurs anywhere between 1-2 days of administration and at least 24 weeks after the administration of the AAV-GAA vector. That is, in some embodiments, the subject being treated can stop the administration of ERT on the day of, or the day before or after administration of AAV-GAA.
  • the subject being treated according to the methods as disclosed herein can stop ERT after about 1 week, or about 2 weeks, or about 3 weeks, or about 1 month, or about 2 months, or about 3 months, or about 4 months, or about 5 months, or about 6 months after the administration of the AAV-GAA.
  • the exact timeframe for stopping ERT, or for ERT cessation, by each subject according to the methods as disclosed herein can be determined by an ordinary skilled practitioner, but without wishing to be limited by theory, encompassed herein is a method to treat a subject with Pompe disease by administering a AAV expressing hGAA as disclosed herein, where ERT is stopped at time point that the serum GAA levels achieved from expression by the AAV-hGAA is near or about a serum level of within a pharmacological activity range of at least 165 nmol/ml/hr or, of at least 189 nmol/ml/hr, for example, between 189 to ⁇ 2,260 nmol/mL/hr.
  • encompassed herein is a method where ERT is stopped at time point that the serum GAA levels achieved from expression by the AAV-hGAA is within 50%, or within 60%, or within 70% or within 80% of a serum level of within a pharmacological activity range of between 189 nmol/mL/hr.
  • encompassed herein is a method to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein, where ERT is stopped at time point that the serum GAA levels achieved from expression by the AAV-hGAA is within 50%, or within 60%, or within 70% or within 80% of a serum level of within a pharmacological activity range of between 165 to about 2000 nmol/mL/hr.
  • encompassed herein is a method to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein, where ERT is stopped at time point that the serum GAA levels achieved from a normal ERT regimen are replaced with a GAA serum level achieved from expression by the AAV-hGAA.
  • ERT is stopped at time point that the serum GAA levels achieved from a normal ERT regimen are replaced with a GAA serum level achieved from expression by the AAV-hGAA.
  • ERT withdrawal or cessation occurs when the administered AAV-hGAA results in the expressed GAA to achieve a serum GAA level for clinical stability of one or more symptoms of Pompe disease in the subject, for example, a clinical stable level of motor function as determined by the 6MWT is ⁇ 12% decline, or less than a 43-meter decrease from baseline in two consecutive assessments no less than 3-months apart, or a clinical stable level of pulmonary function as determined by the FVC % in an upright position is ⁇ 15% decrease from baseline in two consecutive assessments no less than 3-months apart, therefore making superfluous the recombinant hGAA from the last ERT administration.
  • a clinical stable level of motor function as determined by the 6MWT is ⁇ 12% decline, or less than a 43-meter decrease from baseline in two consecutive assessments no less than 3-months apart
  • a clinical stable level of pulmonary function as determined by the FVC % in an upright position is ⁇ 15% decrease from baseline in two consecutive assessments no less than 3-months apart, therefore making superfluous the recomb
  • the method to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein enables long term cessation of ERT for a period of about 1 year, or about 15 months, or about 18 months, or about 24 months, or about 30 months or more than 30 months while maintaining clinical stable with one or more symptoms of Pompe disease, as measured by 6MWT and/or % FVC, as disclosed herein.
  • the rAAV vectors encoding a GAA polypeptide as disclosed herein and the methods as disclosed herein provide significant advantages to subjects with Pompe disease, including but not limited to reducing or eliminating the rigorous and arduous weekly, or every-other week infusions of long-term rhGAA ERT treatment, which are significantly time-consuming and geographically limiting, and hinders a patient with Pompe disease from travelling for prolonged periods from areas where their ERT infusions are administered. Additionally, as disclosed herein, the absence of ERT administration also reduces any side effects due to anti-rhGAA antibodies against the ERT, and also circumvents the need for administration of immune suppressants normally co- administered with the ERT. As such, the methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein leads to greater flexibility in Pompe treatment and an improvement in quality of life and lifestyle of subjects with Pompe disease.
  • the method to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein enables a subject to have breaks or “holidays” from the normal regimen of administration long-term ERT. That is, according to the methods as disclosed herein, a subject who is administered an AAV vector expressing GAA as disclosed herein can take extended periods of time in the absence of administration of long-term ERT.
  • a subject administered a AAV vector expressing GAA as disclosed herein can, after an initial period of withdrawal of the administration of long-term ERT for an extended period of time, be administered complementary ERT, where the complementary ERT is administered after about 6-months, or about 1 year, or longer than a year of cessation of the long-term ERT.
  • the methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein enable flexibility in normal long-term ERT administration regimens, allowing both extended breaks or absence of administration of long-term ERT which does not result in a clinical decline - that is, a subject remains clinically stable despite not having ongoing long-term ERT administration for an extended period of time.
  • the methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein encompass re-administration of ERT (herein referred to as “complementary ERT”) after an extended period of time of cessation of ERT administration, and enable flexibility in normal ERT regimen, as the continued production of GAA expressed by the AAV permits include ERT flexibility.
  • the complementary ERT is pulse administration of ERT, as disclosed herein.
  • the complementary ERT is at less frequent intervals, or at a lower dose, or at irregular doses, or at irregular intervals as compared to the prior administration of long-term ERT.
  • the methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein encompass recommencement of ERT (herein referred to as “complementary ERT”) after an extended period of at least 6 months to about 1 year of absence of long-term ERT administration.
  • complementary ERT can be for a short-period of time, and can be followed by a second extended period of ERT administration cessation.
  • complementary ERT can be for a period of anywhere between 3 months to about 2 years, for example, about 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, lOmonths, 11 months, or for about 1 year.
  • the methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein encompasses administering a rAAV expressing GAA according to as subject with Pompe, wherein administration of long-term ERT continues after administration of the recombinant AAV.
  • the ERT is at a lower dose and/or frequency than before the administration of the recombinant AAV vector.
  • long-term ERT can be administered every 3 weeks, once a month, bimonthly, once every 3 months, every 4 months, every 5 months, every 6 months for at least 24 weeks after administration of the AAV-GAA. Dosage of the long-term ERT can be reduced in one embodiment.
  • a pulse administration regimen of long-term ERT after administration of the AAV vector can be used so that an irregular dosing schedule and/or amount can be used.
  • administration of long-term ERT can be withdrawn at 24 weeks, or earlier as disclosed herein.
  • the methods disclosed herein enable flexibility of administration of both long-term ERT or complementary ERT, such that if a subject plans to miss, or inadvertently or accidently misses one or more ERT administrations of a long-term ERT or complementary ERT regimen, the subject will maintain clinical stability.
  • ERT is missed, a much larger amount of ERT is needed to return to the same clinical level.
  • the complementary ERT is at less frequent administration intervals, or at a lower dose, or at irregular doses, or at irregular administration intervals as compared to the prior administration of long-term ERT.
  • the dose of rhGAA administered in a complementary ERT is less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 2%, or less than 1% of the normal dose of the rhGAA administered in a long-term ERT regimen.
  • the complementary ERT is administered as pulse administration.
  • the rAAV vector compositions as disclosed herein can take breaks or interruptions from the regular dosing regimen of the long-term ERT administration or complementary ERT, where the long-term ERT or complementary ERT are administered by pulse administration.
  • the administration of the long-term ERT or complementary ERT can be administered by pulsed administration.
  • a subject administered the compositions can have pulsed administration of the long-term ERT or complementary ERT.
  • pulsed administration of the complementary ERT is suitable provided the subject has been administered the AAV vector composition as disclosed herein at a sufficient dose for continuous expression of GAA to maintain clinical stability and/or maintain a serum GAA level at or above 189 n mol/hr* (e.g., during the entire duration of the ERT break or “ERT holiday” where the regularly scheduled ERT is not administered).
  • the methods disclosed herein allows a subject to undergo pulsed administration of complementary ERT for the lifetime of the subject.
  • the regimen of administration of the complementary ERT can have intermittent breaks, where the administration of ERT is halted (e.g., the duration of the break or “ERT holiday” where the regimen of administration of ERT is halted).
  • the methods encompass administration of complementary ERT by pulsed administration, where the pulsed administration of complementary ERT occurs least once a month, at least every other month, or at least every 6 months, or at least every year, or every other year.
  • pulsed administration can substantially reduce the amount of ERT administered to the patient per dose or per total treatment regimen with an increased effectiveness, and allows for increased flexibility in a ERT administration regimen.
  • administration of complementary ERT is a pulsed administration.
  • a pulsed administration comprises administering complementary ERT for about 8 weeks, followed by not administering complementary ERT for about 4 weeks.
  • the pulsed administration comprises administering complementary ERT for about 6 weeks (i.e., 6 weekly infusions, or 3 infusions every 2 weeks), followed by not administering a complementary ERT for about 2 weeks.
  • the pulsed administration comprises administering complementary ERT for about 4 weeks, followed by not administering complementary ERT for about 2 weeks. In some embodiments, the pulsed administration comprises administering complementary ERT for about 2 weeks, followed by not administering complementary ERT for about 2 weeks.
  • the technology relates to methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein, where the administration of a composition comprising a AAV-GAA vector is administered to the subject without ongoing immune suppression. That is, in some embodiments, immune suppression is not administered to the subject long term.
  • an immune suppressant or immune modulator is administered to the subject intermittently, or for a transient period, e.g., as an immune prophylaxis to the subject to prevent or reduce any immune response to the administered AAV vector, therefore allowing, if necessary, a subsequent or booster administration of the AAV vector expressing GAA according to the methods as disclosed herein.
  • an immune modulator is administered for an initial period at, or around the time the AAV vector expressing GAA as disclosed herein is administered to the subject.
  • an immune modulator is administered starting at about 24hrs before AAV vector expressing GAA is administered to the subject.
  • an immune modulator is administered starting at about 24hrs before AAV administration and is administered for at least 1 day, or at least 2 days, or at least 3 days or at least 4 days, or at least 5 days, or at least 6 days, or for about 1 week, or for longer than 1 week after administration of the AAV vector expressing GAA.
  • an immune modulator is administered starting at, or about 24hrs before AAV administration and is administered for no more than 1 day, or 2 days, 3 days, or 4 days, or 5 days, or 6 days, or for 1 week, or for 2 weeks, or for 3 weeks or for 1 month after administration of the AAV vector expressing GAA.
  • an immune modulator is administered to the subject at tapering lower doses, e.g., at a first dose for a first period of time, at a second lower dose for a second period of time, and third dose that is lower than the second dose - for a third period of time, and so forth until no immune response to the AAV or GAA is produced.
  • the first dose of an immune modulator is started at, or about 24hrs before AAV administration and is administered for at least 1 day, or at least 2 days, or at least 3 days or at least 4 days, or at least 5 days, or at least 6 days, or for about 1 week, or about 2 weeks, or about 3 weeks, or about 4 weeks, after which the immune modulator is reduced to a third dose (which is lower than the second dose) for a third period of time (e.g., for at least 1 day, or at least 2 days, or at least 3 days or at least 4 days, or at least 5 days, or at least 6 days, or for about 1 week).
  • a third dose which is lower than the second dose
  • a third period of time e.g., for at least 1 day, or at least 2 days, or at least 3 days or at least 4 days, or at least 5 days, or at least 6 days, or for about 1 week.
  • the methods to treat Pompe Disease as disclosed herein comprise administering prednisone as an immune suppressant, i.e., immune prophylaxis, at a first dose of 60 milligrams (given orally) starting 24 hours prior to AAV vector administration.
  • prednisone is continued at 60 mg/day po through the completion of week four after vector administration, after which, at the beginning of week 5 the prednisone dose is tapered to a second dose level of 55 mg/day po and maintained for 7 days.
  • the dose is tapered to a third dose level of 50 mg/day po and maintained for 7 days etc., so that the dose of the immune suppressant (i.e., prednisone) is tapered on a weekly basis by 5 mg/day, after an initial immune suppressant dose for 4 weeks.
  • the immune suppressant i.e., prednisone
  • prednisone is exemplified herein as an immune suppressant for immune prophylaxis according to the methods as disclosed herein.
  • prednisone can be readily substituted with a different immune modulator and administration regimen known by a person of ordinary skill in the art.
  • normal immune prophylaxis for preventing immune reactivity to the expressed GAA is stopped, or withdrawn on day 1, or shortly before or after administration of the rAAV expressing GAA according to the methods as disclosed herein.
  • the methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein to the subject without ongoing immune suppression is not administered to the subject long term, and is only administered for a short and pre-defined period, including an initial period (with an initial dose) and a tapering period (with incremental tapering doses) after the administration of the AAV vector expressing GAA to the subject. Accordingly, in some embodiments, the immune suppression is administered for between 4 weeks to up to about 15 weeks after the administration of the AAV vector expressing GAA to the subject, and can be administered in an initial and tapering doses as disclosed herein.
  • the methods and compositions using the AAV vectors and AAV genomes as described herein, for treating Pompe further comprises administering an immune modulator for an initial period followed by a tapering period.
  • the immune modulator can be administered at the time of rAAV vector administration, before rAAV vector administration or, after the rAAV vector administration.
  • a subject being administered a rAAV vector or rAAV genome as disclosed herein is also administered an immunosuppressive agent.
  • an immunosuppressive agent such as a proteasome inhibitor.
  • a proteasome inhibitor known in the art, for instance as disclosed in U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15/796,137, both of which are incorporated herein by reference, is bortezomib.
  • an immunosuppressive agent can be an antibody, including polyclonal, monoclonal, scfv or other antibody derived molecule that is capable of suppressing the immune response, for instance, through the elimination or suppression of antibody producing cells.
  • the immunosuppressive element can be a short hairpin RNA (shRNA).
  • shRNA short hairpin RNA
  • the coding region of the shRNA is included in the rAAV cassette and is generally located downstream, 3’ of the poly-A tail.
  • the shRNA can be targeted to reduce or eliminate expression of immunostimulatory agents, such as cytokines, growth factors (including transforming growth factors 1 and 02, TNF and others that are publicly known).
  • the immune modulator is an immunoglobulin degrading enzyme such as IdeS, IdeZ, IdeS/Z, Endo S, or, their functional variant.
  • immunoglobulin degrading enzymes such as IdeS, IdeZ, IdeS/Z, Endo S, or, their functional variant.
  • the immune modulator or immunosuppressive agent is a proteasome inhibitor.
  • the proteasome inhibitor is Bortezomib.
  • the immune modulator comprises bortezomib and anti CD20 antibody, Rituximab.
  • the immune modulator comprises bortezomib, Rituximab, methotrexate, and intravenous gamma globulin.
  • Non-limiting examples of such references disclosing proteasome inhibitors and their combination with Rituximab, methotrexate and intravenous gamma globulin, as described in US 10,028,993, US 9,592,247, and, US 8,809,282, each of which are incorporated in their entirety by reference.
  • One such proteasome inhibitor known in the art for instance as disclosed in U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15/796,137, both of which are incorporated herein by reference, is bortezomib.
  • an immunosuppressive agent can be an antibody, including polyclonal, monoclonal, scfv or other antibody derived molecule that is capable of suppressing the immune response, for instance, through the elimination or suppression of antibody producing cells.
  • the immunosuppressive element can be a short hairpin RNA (shRNA).
  • shRNA short hairpin RNA
  • the coding region of the shRNA is included in the rAAV cassette and is generally located downstream, 3’ of the poly-A tail.
  • the shRNA can be targeted to reduce or eliminate expression of immunostimulatory agents, such as cytokines, growth factors (including transforming growth factors 1 and 02, TNF and others that are publicly known).
  • the immune modulator is an inhibitor of the NF-kB pathway.
  • the immune modulator is Rapamycin or, a functional variant.
  • Non- limiting examples of references disclosing rapamycin and its use described in US 10,071,114, US 20160067228, US 20160074531, US 20160074532, US 20190076458, US 10,046,064, are incorporated in their entirety.
  • the immune modulator is synthetic nanocarriers comprising an immunosuppressant.
  • the immune modulator is synthetic nanocarriers comprising rapamycin (ImmTORTM nanoparticles) (Kishimoto, et al., 2016, Nat Nanotechnol, 11(10): 890-899; Maldonado, et al., 2015, PNAS, 112(2): E156-165), as disclosed in US20200038463, US Patent 9,006,254 each of which is incorporated herein in its entirety.
  • the immune modulator is an engineered cell, e.g., an immune cell that has been modified using SQZ technology as disclosed in WO2017192786, which is incorporated herein in its entirety by reference.
  • the immune modulator is selected from the group consisting of poly- ICLC, 1018 ISS, aluminum salts, Amplivax, AS15, BCG, CP-870,893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, Juvhnmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PEPTEL, vector system, PLGA microparticles, resiquimod, SRL172, Virosomes and other Virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys, and Aquila's QS
  • the immune modulator is a small molecule that inhibit the innate immune response in cells, such as chloroquine (a TLR signaling inhibitor) and 2-aminopurine (a PKR inhibitor), can also be administered in combination with the composition comprising at least one rAAV as disclosed herein.
  • chloroquine a TLR signaling inhibitor
  • 2-aminopurine a PKR inhibitor
  • TLR-signaling inhibitors include BX795, chloroquine, CLI-095, OxPAPC, polymyxin B, and rapamycin (all available for purchase from INVIVOGENTM).
  • inhibitors of pattern recognition receptors which are involved in innate immunity signaling
  • PRR pattern recognition receptors
  • 2-aminopurine, BX795, chloroquine, and H-89 can also be used in the compositions and methods comprising at least one rAAV vector as disclosed herein for in vivo protein expression as disclosed herein.
  • a rAAV vector can also encode a negative regulators of innate immunity such as NLRX1. Accordingly, in some embodiments, a rAAV vector can also optionally encode one or more, or any combination of NLRX1, NS1, NS3/4A, or A46R. Additionally, in some embodiments, a composition comprising at least one rAAV vector as disclosed herein can also comprise a synthetic, modified-RNA encoding inhibitors of the innate immune system to avoid the innate immune response generated by the tissue or the subject.
  • an immune modulator for use in the administration methods as disclosed herein is an immunosuppressive agent.
  • immunosuppressive drug or agent is intended to include pharmaceutical agents which inhibit or interfere with normal immune function.
  • immunosuppressive agents suitable with the methods disclosed herein include agents that inhibit T-cell/B- cell costimulation pathways, such as agents that interfere with the coupling of T-cells and B-cells via the CTLA4 and B7 pathways, as disclosed in U.S. Patent Pub. No 2002/0182211.
  • an immunosuppressive agent is cyclosporine A.
  • Other examples include myophenylate mofetil, rapamicin, and anti- thymocyte globulin.
  • the immunosuppressive drug is administered in a composition comprising at least one rAAV vector as disclosed herein, or can be administered in a separate composition but simultaneously with, or before or after administration of a composition comprising at least one rAAV vector according to the methods of administration as disclosed herein.
  • An immunosuppressive drug is administered in a formulation which is compatible with the route of administration and is administered to a subject at a dosage sufficient to achieve the desired therapeutic effect.
  • the immunosuppressive drug is administered transiently for a sufficient time to induce tolerance to the rAAV vector as disclosed herein.
  • an immunosuppressive agent such as a proteasome inhibitor.
  • a proteasome inhibitor known in the art, for instance as disclosed in U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15/796,137, both of which are incorporated herein by reference, is bortezomib.
  • an immunosuppressive agent can be an antibody, including polyclonal, monoclonal, scfv or other antibody derived molecule that is capable of suppressing the immune response, for instance, through the elimination or suppression of antibody producing cells.
  • the immunosuppressive element can be a short hairpin RNA (shRNA).
  • shRNA short hairpin RNA
  • the coding region of the shRNA is included in the rAAV cassette and is generally located downstream, 3’ of the poly-A tail.
  • the shRNA can be targeted to reduce or eliminate expression of immunostimulatory agents, such as cytokines, growth factors (including transforming growth factors 1 and 02, TNF and others that are publicly known).
  • immune modulating agents facilitates the ability to for one to use multiple dosing (e.g., multiple administration) over numerous months and/or years. This permits using multiple agents as discussed below, e.g., a rAAV vector encoding multiple genes, or multiple administrations to the subject.
  • the recombinant AAV comprising a nucleic acid encoding human GAA is produced by the triple transfection method that uses close ended linear duplexed DNA molecules that lack bacterial backbone sequences, for example, as described in PCT/US2021/013689, published as WO/2021/146591, which is incorporated herein by reference in its entirety.
  • the rAAV of the invention is manufactured using plasmid DNA as starting material.
  • the rAAV of the invention is manufactured using close ended linear duplexed DNA as starting material.
  • Non- limiting examples of close ended linear duplex nucleic acids include doggy bone DNA (dbDNA) or dumbbell-shaped DNA.
  • the close ended linear duplex nucleic acids may be generated within cells or using in vitro cell free system.
  • Cell free in vitro synthesis of dumbbell-shaped DNA and doggy bone DNA are described in U.S. Patent No. 6,451,563; Efficient production of superior dumbbell-shaped DNA minimal vectors for small hairpin RNA expression- Nucleic Acids Res. 2015 Oct 15; 43(18): el20; High-Purity Preparation of a Large DNA Dumbbell- Antisense & nucleic acid drug development 11: 149-153 (2001);US 9,109,250; U.S. Patent No.
  • DNA from cell free in vitro synthesis is devoid of any prokaryotic DNA modifications (e.g., is substantially free of bacterial DNA).
  • One example of an in vitro process for producing a closed linear DNA comprises (a) contacting a DNA template flanked on either side by a protelomerase target sequence with at least one DNA polymerase in the presence of one or more primers under conditions promoting amplification of said template; and (b) contacting amplified DNA produced in (a) with at least one protelomerase under conditions promoting formation of a closed linear expression cassette DNA.
  • the closed linear DNA may be a closed DNA expression cassette DNA product that may comprise, consist or consist essentially of a eukaryotic promoter operably linked to a coding sequence of interest and optionally, a eukaryotic transcription termination sequence.
  • the closed linear expression cassette DNA product may additionally lack one or more bacterial or vector sequences, typically selected from the group consisting of: (i) bacterial origins of replication; (ii) bacterial selection markers (typically antibiotic resistance genes) and (iii) unmethylated CpG motifs.
  • compositions [00432]
  • the rAAV vectors as disclosed herein for use in the methods of administration as disclosed herein can be formulated in a pharmaceutical composition with a pharmaceutically acceptable excipient, i.e., one or more pharmaceutically acceptable carrier substances and/or additives, e.g., buffers, carriers, excipients, stabilizers, etc.
  • a pharmaceutically acceptable excipient i.e., one or more pharmaceutically acceptable carrier substances and/or additives, e.g., buffers, carriers, excipients, stabilizers, etc.
  • the pharmaceutical composition may be provided in the form of a kit.
  • Pharmaceutical compositions comprising the rAAV vectors as disclosed herein for use in the methods of administration as disclosed herein and uses thereof are known in the art.
  • a further aspect of the invention provides a pharmaceutical composition comprising a rAAV vector as disclosed herein for use in the methods of administration as disclosed herein.
  • Relative amounts of the active ingredient e.g., a rAAV vectors aa disclosed herein
  • a pharmaceutically acceptable excipient e.g., any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered.
  • the composition may comprise between 0.1 percent and 99 percent (w/w) of the active ingredient.
  • the composition may comprise between 0.1 percent and 100 percent, e.g., between.5 and 50 percent, between 1-30 percent, between 5- 80 percent, at least 80 percent (w/w) active ingredient.
  • compositions can be formulated using one or more excipients or diluents to (1) increase stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed release of the payload; (4) alter the biodistribution (e.g., target the viral particle to specific tissues or cell types); (5) increase the translation of encoded protein; (6) alter the release profile of encoded protein and/or (7) allow for regulatable expression of the payload of the invention.
  • a pharmaceutically acceptable excipient may be at least 95 percent, at least 96 percent, at least 97 percent, at least 98 percent, at least 99 percent, or 100 percent pure.
  • an excipient is approved for use for humans and for veterinary use.
  • an excipient may be approved by United States Food and Drug Administration. In some embodiments, an excipient may be of pharmaceutical grade. In some embodiments, an excipient may meet the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and/or the International Pharmacopoeia. Excipients, as used herein, include, but are not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired.
  • excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21 st Edition, A. R. Gennaro, Lippincott, Williams and Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety).
  • the use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.
  • the rAAV vectors as disclosed herein can be formulated in a composition.
  • the rAAV vectors as disclosed herein can be formulated in a pharmaceutical composition with a pharmaceutically acceptable excipient, i.e., one or more pharmaceutically acceptable carrier substances and/or additives, e.g., buffers, carriers, excipients, stabilisers, etc.
  • a pharmaceutically acceptable excipient i.e., one or more pharmaceutically acceptable carrier substances and/or additives, e.g., buffers, carriers, excipients, stabilisers, etc.
  • the composition e.g., the pharmaceutical composition may be provided in the form of a kit. It is noted the terms “composition” and “formulation” are used interchangeably here.
  • composition comprising the recombinant AAV vector particles described herein.
  • the composition comprises the recombinant AAV vector particles described herein at a concentration from about le 9 vg/ml to about le 15 vg/ml.
  • the composition comprises the recombinant AAV vector particles described herein at a concentration from about le 10 vg/ml to about le 14 vg/ml.
  • the composition comprises the recombinant AAV vector particles described herein at a concentration from about le 12 vg/ml to about le 14 vg/ml.
  • the composition comprises the recombinant AAV vector particles described herein at a concentration from about le 12 vg/ml to about le 15 vg/ml.
  • the composition comprises the recombinant AAV vector particles described herein at a concentration from about 3e 9 vg/ml to about 3e 13 vg/ml, from about 2.5e 10 vg/ml to about le 14 vg/ml, from about 3e 10 vg/ml to about le 13 vg/ml, or from le n vg/ml to about 5e 12 vg/ml.
  • the composition comprises the recombinant AAV vector particles described herein at a concentration of about le n vg/ml, or about 1.5e 12 vg/ml, or about 2e n vg/ml, or about 2.5e 12 vg/ml, or about 3e 12 vg/ml, or about 3.5e 12 vg/ml, or about 4e 12 vg/ml, or about 4.5e 12 vg/ml, or about 5e 12 vg/ml, or about 5.5e 12 vg/ml, or about 6e 12 vg/ml, or about 6.5e 12 vg/ml, or about 7e 12 vg/ml, or about 7.5e 12 vg/ml, or about 8e 12 vg/ml, or about 8.5e 12 vg/ml, or about 9e 12 vg/ml, or about 9.5e 13 vg/ml, or
  • the pharmaceutical composition comprises the population of purified recombinant adeno- associated virus (rAAV) described herein.
  • the pharmaceutical composition comprising the rAAV comprises a buffer of pH about 6.5 to about 8.0.
  • the pH is about 6.5 to about 7.5.
  • the pH is from about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4 or about 7.5.
  • the pH is less than about 7.5.
  • the pH is less than about 7.4, less than about 7.3, less than about 7.2, less than about 7.1, less than about 7.0, less than about 6.9, less than about 6.8, less than about 6.7, or less than about 6.6.
  • the pharmaceutical composition comprises one or, more excipients, comprising one or, more multivalent ions and/or, salts thereof.
  • the multivalent ions can be selected or, optionally selected from the group consisting of citrate, sulfate, magnesium and phosphate.
  • the pharmaceutical composition comprises one or, more excipients, comprising one or, more ions selected or, optionally selected from the group consisting of, sodium, potassium, chroride, ammonium, carbonate, nitrate, chlorate, chlorite, and calcium.
  • the pharmaceutical composition comprising the rAAV further comprises a non-ionic surfactant.
  • the non-ionic surfactant is selected from the group consisting of polyoxyethylene fatty alcohol ethers, polyoxyethylene alkyl phenyl ethers, polyoxyethylene-polyoxypropylene block copolymers, alkylglucosides, alkyl phenol ethoxylates, preferably polysorbates, polyoxyethylene alkyl phenyl ethers, and any combinations thereof.
  • non-ionic surfactant is selected from the group consisting of TWEEN 60 nonionic detergent, PPG-PEG-PPG Pluronic 10R5, Polyoxyethylene (18) tridecyl ether, Polyoxyethylene (12) tridecyl ether, MERPOL SH surfactant, MERPOL OJ surfactant, MERPOL HCS surfactant, Poloxamer Pl 88, Poloxamer P407, Poloxamer P338 IGEPAL CO-720, IGEPAL CO-630, IGEPAL CA-720, Brij S20, BrijSlO, Brij 010, Brij CIO, BRIJ 020, ECOSURF EH-9 , ECOSURF EH-14, TERGITOL 15-S-7, PF-68, ECOSURF SA-15, TERGITOL15-S-9, TERGITOL 15-S-12, TERGITOL L-64, TERGITOLNP-7, TERGITOL NP-8,
  • the composition comprises a buffer.
  • buffers include, but are not limited to, PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, a-ketoglutaric acid, carbonate (bicarbonate-carbonic acid buffer), and protein buffers.
  • the buffer is PBS.
  • the buffer comprises Tris.
  • buffer is Tris.HCl.
  • the buffer is histidine buffer.
  • the buffer has a salt concentration of from about 50 mM to about 750 mM.
  • the buffer has a salt concentration from about 75 mM to about 700 mM, from about 100 mM to about 650 mM, from about 120 mM to about 600 mM, or from about 140 mM to about 550 mM.
  • the buffer has a salt concentration from about 150mM to about 400mM.
  • the buffer has a salt concentration of about 150 mM, about 175 mM, about 200 mM, about 225 mM, about 250 mM, about 275 mM, about 300 mM, about 325 mM, about 350 mM, about 375 mM, about 400 mM, about 425 mM, about 450 mM, or about 475 mM.
  • the buffer has a salt concentration of about 150 mM, about 200 mM or about 365 mM.
  • the ionic strength of the composition is at least about 100 mM.
  • the ionic strength of the composition is from about 125 mM to about 750 mM, or from about 150 mM to about 500 mM, or from about 175 mM to about 700 mM, from about 200mM to about 600 mM, or from about 225 mM to about 550 mM, or from about 250 mM to about 500 mM, or from about 275 mM to about 450 mM, or from about 300 mM to about 400 mM.
  • the ionic strength of the composition is at least about 125 mM, at least about 150 mM, at least about 175 mM, at least about 200 mM, at least about 225 mM, at least about 250 mM, at least about 275 mM, at least about 300 mM, at least about 325 mM, at least about 350 mM, at least about 375 mM, at least about 400 mM, at least about 425 mM, at least about 450 mM, at least about 475 mM or at least about 500 mM.
  • the ionic strength of the composition is less than lOOmM, for example about 95mM, about 90mM, about 85mM, about 80mM, about 75mM, about 70mM, about 65mM, about 60mM, about 55mM, about 50mM, or, even less.
  • the osmolarity of the composition is maintained at near isotonic levels.
  • the osmolarity of the composition can be from about 100 mOsm to about 600 mOsm, such as from about 125 mOsm to about 500 mOsm, or, from about 130 mOsm to about 350 mOsm, or, from about 140 mOsm to about 400 mOsm, or, from about 140 mOsm to about 350 mOsm, or from about 200 mOsm to about 400 mOsm, or from about 500 mOsm to about 600 mOsm, or from about 200 mOsm to about 600 mOsm, or from about 300 mOsm to about 600 mOsm, or from about 200 mOsm to about 500 mOsm, or from about 300 mOsm to about 400 mOsm, or from about 150 mOsm to about 350
  • the composition has a pH of about 6.5 to about 8.0.
  • the composition has a pH of about 6.5 to about 7.5.
  • the composition has a pH of from about 7 to about 8.
  • the composition has a pH of from about 7.3 to about 7.9.
  • the composition has a pH of from about 7.4 to about 7.8 or from about 7.4 to about 7.7.
  • the composition has a pH of from about 7.3 to about 7.6, e.g., from about 7.3 to about 7.55.
  • the composition has a pH less than about 7.5.
  • the composition has a pH about 7.4 or lower, about 7.3 or lower, about 7.2 or lower, about 7.1 or lower, about 7.0 or lower, about 6.9 or lower, about 6.8 or lower, about 6.7 or lower, about 6.6 or lower, or about 6.5 or lower.
  • the composition can comprise one or more ions and/or salts thereof.
  • exemplary ions include, but are not limited to sodium, potassium, chloride, magnesium ammonium, carbonate, nitrate, chlorate, chlorite, and calcium.
  • the ions can be provided as a salt, such as a halide (F, Cl, Br, I) salt of sodium, potassium, magnesium, and/or calcium, non-limiting examples of which include NaCl, KC1, MgCl 2 , CaCl 2 , and combinations thereof.
  • Additional exemplary salts that can be used include, but are not limited to, carboxylic acid salts, such as acetates, propionates, pyrrol idonecarboxylates (or pidolates) or sorbates; poly hydroxylated carboxylic acid salts, such as gluconates, heptagluconates, ketogluconates, lactate gluconates, ascorbates or pantothenates; mono- or polycarboxyl hydroxy acid salts, such as citrates or lactates; amino acid salts, such as aspartates or glutamates; and fulvate salts.
  • the salts are individually included at a concentration of from about 500 ⁇ M to about 500 mM.
  • the composition comprises one or more multivalent ions and/or salts thereof.
  • multivalent ions include, but are not limited to, calcium, citrate, sulfate, magnesium, and phosphate.
  • Multivalent ions and/or salts thereof can be individually included in the composition at a concentration of from about 500 M to about 500 mM, for example, at a concentration of about 500 ⁇ M , about 750 ⁇ M , about 1 mM, about 1.3 mM, about 1.5 mM, about 1.7 mM, about 2.3 mM, about 2.5 mM, about 2.7 mM, about 3.3 mM, about 3.5 mM, about 3.7 mM, about 4.3 mM, about 4.5 mM, about 4.7 mM, about 5 mM, about 10 mM, about 25 mM, about 50 mM, about 75 mM, about 80mM, about 85mM, about 90mM, about 95mM, about 100 mM
  • the composition comprises NaCl.
  • NaCl can be at a concentration from about 100 mM to about 500 mM, or from about 125 mM to about 450 mM, or from about 100 mM to about 200 mM, or from about 150 mM to about 200 mM.
  • the composition can comprise NaCl at a concentration from about 150 mM to about 425 mM, from about 175 mM to about 400 mM, or from about 175 mM to about 375 mM, or from about 200 mM to about 375 mM.
  • the composition comprises KC1.
  • KC1 can be at a concentration from about 1 mM to about 10 mM.
  • the composition can comprise KC1 at a concentration from about 1.5 mM to about 7.5 mM.
  • the composition comprises CaCl 2 .
  • CaCl 2 can be at a concentration from about 0.1 mM to about 2 mM.
  • the composition can comprise CaCl 2 at a concentration from about 0.5 mM to about 1.5 mM.
  • the composition comprises CaCl 2 at a concentration from about 0.75 mM to about 1.25 mM.
  • the composition comprises MgCl 2 .
  • MgCl 2 can be at a concentration from about 0.1 mM to about 1.5 mM.
  • the composition can comprise MgCl 2 at a concentration from about 0.25 mM to about 1 mM or from about 0.25 mM to about 0.75 mM.
  • the composition comprises MgSO 4 .
  • MgSO 4 can be at a concentration from about 5 mM to about 150 mM.
  • the composition can comprise MgSO 4 at a concentration from about 10 mM to about 120 mM, or from about 10 mM to about 50 mM, or from about 15 mM to about 45 mM, or about 75 mM to about 125 mM, or from about 80 mM to about 100 mM, or from about 85 mM to about 95 mM, or from about 15 mM to about 100 mM.
  • the composition comprises phosphate, e.g., mono basic or dibasic phosphate or a salt thereof.
  • the phosphate e.g., mono basic or dibasic phosphate or a salt thereof can be at a concentration from about 5 mM to about 30 mM.
  • the composition can comprise phosphate, e.g., mono basic or dibasic phosphate or a salt thereof at a concentration from about 7.5 mM to about 25 mM.
  • the composition comprises phosphate, e.g., mono basic or dibasic phosphate or a salt thereof at a concentration from about 10 mM to about 20 mM.
  • the composition comprises a mono basic phosphate or a salt thereof at a concentration from about 0.25 mM to about 3 mM.
  • the composition comprises a mono basic phosphate or a salt thereof at a concentration from about 0.5 mM to about 2.75 mM, or from about 0.75 mM to about 2.5 mM or from about 1 mM to about 2.25 mM.
  • the mono basic phosphate or salt thereof is potassium phosphate monobasic.
  • the composition comprises a dibasic phosphate or a salt thereof at a concentration from about 5 mM to about 15 mM.
  • the composition comprises a dibasic phosphate or a salt thereof at a concentration from about 7.5 mM to about 12.5 mM or from about 8 mM to about 10 mM.
  • the dibasic phosphate or a salt thereof is sodium phosphate dibasic.
  • the composition is substantially free of dibasic phosphate, e.g., sodium phosphate dibasic.
  • the composition comprises Tris (e.g., Tris.HCl) or a salt thereof at a concentration from about 1 mM to about 50 mM.
  • the composition comprises Tris (e.g., Tris.HCl) or a salt thereof at a concentration of from about 5 mM to about 40 mM, or from about 7.5 mM to about 35 mM, or from about 10 mM to about 30 mM or from about 15 mM to about 25 mM.
  • the composition comprises histidine or a salt thereof at a concentration from about 1 mM to about 50 mM.
  • the composition comprises histidine or a salt thereof at a concentration of from about 5 mM to about 40 mM, or from about 7.5 mM to about 35 mM, or from about 10 mM to about 30 mM or from about 15 mM to about 25 mM.
  • the composition can also comprise a bulking agent.
  • exemplary bulking agents include, but are not limited to sugars, polyols and (PVP K24).
  • Exemplary polyols include, but are not limited to, polyhydroxy hydrocarbons, monosaccharides, disaccharides, and trisaccharides.
  • Some exemplary polyols include but are not limited to, sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose and dextran.
  • polyol is sorbitol, sucrose or mannitol.
  • the bulking agent is sorbitol.
  • the bulking agent is sucrose. In some embodiments, the bulking agent is mannitol. In some embodiments, the bulking agent is trehalose, e.g., trehalose dehydrate. In some embodiments, the bulking agent is a dextran, e.g., Dextran T40 and/or Dextran T10. [00457] When present, the bulking agent can be present at a concentration of from about 0.5 % (w/v) to about 10% (w/v).
  • the composition can comprise a bulking agent, e.g., a polyol or providone (PVP K24) at a concentration from about from about 1 % (w/v) to about 7.5% (w/v), e.g., from about l%(w/v) to about 4% (w/v) or from about 4%(w/v) to about 6% (w/v).
  • a bulking agent e.g., a polyol or providone (PVP K24) at a concentration from about from about 1 % (w/v) to about 7.5% (w/v), e.g., from about l%(w/v) to about 4% (w/v) or from about 4%(w/v) to about 6% (w/v).
  • PVP K24 polyol or providone
  • the composition comprises glycerol, sorbitol, sucrose, or mannitol at a concentration from about 1% (w/v) to about 10% (w/v). In some embodiments, the composition comprises glycerol, sorbitol, sucrose, or mannitol at a concentration from about l%(w/v) to about 10%(w/v). In some embodiments, the composition comprises sorbitol at concentration from about 3%(w/v) to about 6% (w/v).
  • the composition comprises sorbitol at concentration of about 1% (w/v), about 2% (w/v), about 3% (w/v), about 4% (w/v), about 5% (w/v), about 6% (w/v), about 7% (w/v), about 8% (w/v), about 9% (w/v), or about 10% (w/v).
  • the composition comprises sucrose at concentration from about 3%(w/v) to about 6% (w/v).
  • the composition comprises sucrose at concentration of about 1% (w/v), about 2% (w/v), about 3% (w/v), about 4% (w/v), about 5% (w/v), about 6% (w/v), about 7% (w/v), about 8% (w/v), about 9% (w/v), or about 10% (w/v).
  • the composition comprises mannitol at concentration from about 3%(w/v) to about 6% (w/v).
  • the composition comprises mannitol at concentration of about 1% (w/v), about 2% (w/v), about 3% (w/v), about 4% (w/v), about 5% (w/v), about 6% (w/v), about 7% (w/v), about 8% (w/v), about 9% (w/v), or about 10% (w/v).
  • the composition can also comprise a non-ionic surfactant.
  • the non-ionic surfactant can be selected from the group consisting of polyoxyethylene fatty alcohol ethers, polyoxyethylene alkyl phenyl ethers, polyoxyethylene-polyoxypropylene block copolymers, alkylglucosides, alkyl phenol ethoxylates, preferably polysorbates, polyoxyethylene alkyl phenyl ethers, and any combinations thereof.
  • Non-limiting examples of suitable non-ionic surfactants include polyoxyethylene (12) isooctylphenyl ether (e.g., IGEPAL® CA-270 polyoxyethylene (12) isooctylphenyl ether), polyoxyethylenesorbitan monooleate (e.g., TWEEN® 80 polyoxyethylenesorbitan monooleate), polyethylene glycol octadecyl ether (e.g., Brij® S20 polyethylene glycol octadecyl ether), seed oil surfactant (e.g., EcosurfTM SA-15 seed oil surfactant), poloxamer 188 (a copolymer of polyoxyethylene and polyoxypropylene), nonylphenol ethoxylate (e.g., TergitolTM NP-10 nonylphenol ethoxylate), and combinaitons thereof.
  • polyoxyethylene (12) isooctylphenyl ether e.g., IGEPAL® CA-270
  • the non-ionic surfactant is selected from the group consisting of TWEEN 60 nonionic detergent, PPG-PEG-PPG Pluronic 10R5, Pluronic F-68 (PF 68), Polyoxyethylene (18) tridecyl ether, Polyoxyethylene (12) tridecyl ether, MERPOL SH surfactant, MERPOL OJ surfactant, MERPOL HCS surfactant, Poloxamer Pl 88, Poloxamer P407, Poloxamer P 338, IGEPAL CO-720, IGEPAL CO-630, IGEPAL CA-720, Brij S20, BrijSlO, Brij 010, Brij CIO, BRIJ 020, ECOSURF EH-9 , ECOSURF EH-14, TERGITOL 15-S-7, ECOSURF SA-15, TERGITOL15-S-9, TERGITOL 15-S-12, TERGITOL L-64, TERGITOLNP-7, TER
  • the non-ionic surfactant is Poloxamer P 188, Poloxamer P407, Pluronic F-68, Ecosurf SA-15, Brij S20, Tergitol NP-10, IGEPAL CA 720 or Tween 80.
  • the composition is substantially free of a non-ionic surfactant.
  • the non-ionic surfactant is not a polysorbate, e.g., Tween 80 (also referred to as polysorbate 80 or PS80).
  • the non-ionic surfactant can be present at a concentration from about 0.0001% (w/v) to about 0.01% (w/v).
  • the composition can comprise a non-ionic surfactant at a concentration from about 0.0005% (w/v) to about 0.0015% (w/v).
  • the composition can comprise a non-ionic surfactant at a concentration of about 0.0001% (w/v), about 0.0002% (w/v), about 0.0003% (w/v), about 0.0004% (w/v), about 0.0005% (w/v), about 0.0006% (w/v), about 0.0007% (w/v), about 0.0008% (w/v), about 0.0009% (w/v), about 0.001% (w/v), about 0.002% (w/v), about 0.003% (w/v), about 0.004% (w/v), about 0.005% (w/v), about 0.006% (w/v), about 0.007% (w/v), about 0.008% (w/v), about 0.009% (w/v), or about 0.01%. (w/v).
  • the composition comprises a non-ionic surfactant at a concentration of about 0.0005% (w/v) or about 0.001% (w/v).
  • the composition comprises, in addition to the rAAV, a buffer (e.g., PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, a- ketoglutaric acid, carbonate buffer), a bulking agent (e.g., a polyol such as sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose and dextran) and a non-ionic surfactant (e.g., Poloxamer P 188, Poloxamer P407, Pluronic F-68, Ecosurf SA-15, Brij S20, Tergitol NP-10, IGEPAL CA 720 or Tween 80).
  • a buffer e.g., PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succ
  • the composition comprises, in addition to the rAAV, a buffer (e.g., PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, a- ketoglutaric acid, carbonate buffer), a bulking agent (e.g., a polyol such as sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose and dextran), a non-ionic surfactant (e.g., Poloxamer P 188, Poloxamer P407, Pluronic F-68, Ecosurf SA- 15, Brij S20, Tergitol NP-10, IGEPAL CA 720 or Tween 80), and a multivalent ion (e.g., a multivalent ion selected from the group consisting of calcium, cit
  • a buffer e.g
  • the composition comprises, in addition to the rAAV, a buffer (e.g., PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, a- ketoglutaric acid, carbonate buffer), a bulking agent (e.g., a polyol such as sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose and dextran), and a multivalent ion (e.g., a multivalent ion selected from the group consisting of calcium, citrate, sulfate, and magnesium).
  • a buffer e.g., PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, a- ketoglutaric acid, carbonate buffer
  • a bulking agent
  • any one of the specific buffers or group of buffers listed in the description of the compositions can be used with any one of the specific bulking agents or group of bulking agents listed in the description of the compositions and with any of the specific non-ionic surfactants or group of surfactants listed in the description of the compositions and with any of the specific multivalent ions and multivalent ion group listed in the description of the compositions.
  • any one of the specific bulking agents or group of bulking agents listed in the description of the compositions can be used with any one of the specific buffers or group of buffers listed in the description of the compositions and with any of the specific non-ionic surfactants or group of surfactants listed in the description of the compositions and with any of the specific multivalent ions and multivalent ion group listed in the description of the compositions.
  • any of the specific non-ionic surfactants or group of surfactants listed in the description of the compositions can be used with any one of the specific buffers or group of buffers listed in the description of the compositions and with any one of the specific bulking agents or group of bulking agents listed in the description of the compositions and with any of the specific multivalent ions and multivalent ion group listed in the description of the compositions.
  • any of the specific multivalent ions and multivalent ion group listed in the description of the compositions can be used with any one of the specific buffers or group of buffers listed in the description of the compositions and with any one of the specific bulking agents or group of bulking agents listed in the description of the compositions and with any of the specific non-ionic surfactants or group of surfactants listed in the description of the compositions.
  • all individual specific combinations of buffers, buffer group, bulking agents, bulking agent groups, non-ionic surfactants, non-ionic surfactant groups, multivalent ions and multivalent ion groups listed in the description of the compositions are specifically contemplated and claimed.
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 10 mM Phosphate pH 7.4, about 200 mM NaCl, about 5 mM KC1, about 1% (w/v) mannitol, and about 0.0005% (w/v) IGEPAL CA 720.
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 20 mM Phosphate pH 7.4, about 300 m NaCl, about 3 mM KC1, about 3 % (w/v) mannitol, and about 0.001% (w/v) Brij S20.
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 20 mM Phosphate pH 7.4, about 300 mM NaCl, about 3 mM KC1, about 3 % (w/v) sorbitol, and about 0.001% (w/v) Ecosurf SA-15.
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 10 mM Phosphate pH 7.4, about 350 mM NaCl, about 2.7 mM KC1, about 5 % (w/v) sorbitol, and about 0.001% (w/v) poloxamer 188.
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about lOmM Phosphate pH 6.95-7.2, about 137mM NaCl, about 2.7mM KC1, about 0.9mM CaCl 2 , about 0.5mM MgCl 2 , and about 0.001% (w/v) Pluronic F-68.
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about lOmM Phosphate pH 7.3, about 180 mM NaCl, about 2.7 mM KC1, about 5 % (w/v) sorbitol, and about 0.001% (w/v) Poloxamer 188.
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 15 mM Phosphate pH 7.4, about 375 m NaCl, about 3.5 mM KC1, about 5 % (w/v) sorbitol, and about 0.0005% (w/v) Tergitol NP-10.
  • the c composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 15 mM Phosphate pH 7.4, about 375 mM NaCl, about 3.5 mM KC1, about 3 % (w/v) glycerol, and about 0.0005% (w/v) Tween 80.
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about lOmM Phosphate pH 7.6, about 137 mM NaCl, about 2.7 mM KC1, about 5% (w/v) sorbitol, and about 0.01% Pluronic F-68.
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about lOmM Phosphate pH 7.4, about 137 mM NaCl, about 2.7 mM KC1, about 5% (w/v) sorbitol, about 0.01% Pluronic F-68, and about 20 mM MgSC .
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about lOmM Phosphate pH 7.6, about 137 mM NaCl, about 2.7 mM KC1, about 5% (w/v) mannitol, and about 0.01% Pluronic F-68.
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about lOmM Phosphate pH 7.3, about 137 mM NaCl, about 2.7 mM KC1, about 5% (w/v) mannitol, about 0.01% Pluronic F-68, and about 20 mM MgSC .
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about lOmM Phosphate pH 7.4, about 137 mM NaCl, about 2.7 mM KC1, about 5% (w/v) sorbitol, and about 20 mM MgSC .
  • the composition e.g., the pharmaceutical composition comprises, in addition to the rAAV, about lOmM Phosphate pH 7.4, about 137 mM NaCl, about 2.7 mM KC1, about 5% (w/v) mannitol, and about 20 mM MgSC .
  • the composition e.g., the pharmaceutical composition comprises recombinant AAV vector (rAAV), in 10 mM Phosphate pH 7.4, 200 mM NaCl, 5 mM KC1, 1% (w/v) mannitol, 0.0005% (w/v) IGEPAL CA 720 to a fill volume of 5ml.
  • the fill volume is 1ml, 2ml, 3ml, 4 ml, 5ml, 6 ml, 7 ml, 8 ml, 9 ml, or, 10 ml.
  • the composition e.g., the pharmaceutical composition comprises recombinant AAV vector (rAAV), in 20 mM Phosphate pH 7.4, 300 mM NaCl, 3 mM KC1, 3 % (w/v) mannitol, 0.001% (w/v) Brij S20 to a fill volume of 5ml.
  • the fill volume is 1ml, 2ml, 3ml, 4 ml, 5ml, 6 ml, 7 ml, 8 ml, 9 ml, or, 10 ml.
  • the composition e.g., the pharmaceutical composition comprises recombinant AAV vector (rAAV), in 20 mM Phosphate pH 7.4, 300 mM NaCl, 3 mM KC1, 3 % (w/v) sorbitol, 0.001% (w/v) Ecosurf SA- 15 to a fill volume of 5ml.
  • the fill volume is 1ml, 2ml, 3ml, 4 ml, 5ml, 6 ml, 7 ml, 8 ml, 9 ml, or, 10 ml.
  • the composition e.g., the pharmaceutical composition comprises recombinant AAV vector (rAAV), in 10 mM Phosphate pH 7.4, 350 mM NaCl, 2.7 mM KC1, 5 % (w/v) sorbitol, 0.001% (w/v) poloxamer 188 to a fill volume of 5ml.
  • the fill volume is 1ml, 2ml, 3ml, 4 ml, 5ml, 6 ml, 7 ml, 8 ml, 9 ml, or, 10 ml.
  • the composition e.g., the pharmaceutical composition comprises recombinant AAV vector (rAAV), in 15 mM Phosphate pH 7.4, 375 mM NaCl, 3.5 mM KC1, 5 % (w/v) sorbitol, 0.0005% (w/v) Tergitol NP-10 to a fill volume of 5ml.
  • the fill volume is 1ml, 2ml, 3ml, 4 ml, 5ml, 6 ml, 7 ml, 8 ml, 9 ml, or, 10 ml.
  • the composition e.g., the pharmaceutical composition comprises recombinant AAV vector (rAAV), in 15 mM Phosphate pH 7.4, 375 mM NaCl, 3.5 mM KC1, 3 % (w/v) glycerol, 0.0005% (w/v) Tween 80 to a fill volume of 5ml.
  • the fill volume is 1ml, 2ml, 3ml, 4 ml, 5ml, 6 ml, 7 ml, 8 ml, 9 ml, or, 10 ml.
  • compositions/compositions comprising rAAV are described in PCT/US2022/0137279, the content of which is incorporated herein by reference in its entirety.
  • the rAAV vectors as disclosed herein for use in the methods of administration as disclosed herein may be used in combination with one or more other therapeutic, prophylactic, research or diagnostic agents.
  • Compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures.
  • the delivery of one treatment e.g., gene therapy vectors
  • the delivery of one treatment is still occurring when the delivery of the second (e.g., one or more therapeutic) begins, so that there is overlap in terms of administration.
  • the delivery of one treatment ends before the delivery of the other treatment begins.
  • the treatment is more effective because of combined administration.
  • the second treatment is more effective, e.g., an equivalent effect is seen with less of the second treatment, or the second treatment reduces symptoms to a greater extent, than would be seen if the second treatment were administered in the absence of the first treatment, or the analogous situation is seen with the first treatment.
  • delivery is such that the reduction in a symptom, or other parameter related to the disorder is greater than what would be observed with one treatment delivered in the absence of the other.
  • the effect of the two treatments can be partially additive, wholly additive, or greater than additive.
  • the delivery can be such that an effect of the first treatment delivered is still detectable when the second is delivered.
  • the composition described herein and the at least one additional therapy can be administered simultaneously, in the same or in separate compositions, or sequentially.
  • the gene therapy vectors described herein can be administered first, and the one or more therapeutic can be administered second, or the order of administration can be reversed.
  • the gene therapy vectors and the one or more therapeutic can be administered during periods of active disorder, or during a period of remission or less active disease.
  • the gene therapy vectors can be administered before another treatment, concurrently with the treatment, post-treatment, or during remission of the disorder.
  • the rAAV vectors as disclosed herein for use in the methods of administration as disclosed herein and the one or more therapeutic can be administered in an amount or dose that is higher, lower or the same as the amount or dosage of each used individually, e.g., as a monotherapy.
  • the administered amount or dosage of a rAAV vector as disclosed herein for use in the methods of administration as disclosed herein and the one or more therapeutic (e.g., second or third agent), or all is lower (e.g., at least 20%, at least 30%, at least 40%, or at least 50%) than the amount or dosage of each used individually.
  • the amount or dosage of the rAAV vector as disclosed herein for use in the methods of administration as disclosed herein and the one or more therapeutic (e.g., second or third agent), or all, that results in a desired effect is lower (e.g., at least 20%, at least 30%, at least 40%, or at least 50% lower) than the amount or dosage of each individually required to achieve the same therapeutic effect.
  • the methods of administration of a rAAV vector as disclosed herein can deliver a rAW vector disclosed herein alone, or in combination with an additional agent, for example, an immune modulator as disclosed herein.
  • the AAV vectors expressing GAA as disclosed herein are not administered concurrently with, or in combination with ERT.
  • the AAV vectors expressing GAA as disclosed herein are administered in combination with ERT for a maximum period of 24 weeks or shorter than 24 weeks after administration of the AAV expressing ERT.
  • the AAV vectors expressing GAA as disclosed herein are administered in combination with an immune modulator for an initial period and, optionally a tapering period after administration of the AAV expressing ERT.
  • the term "about,” as used herein when referring to a measurable value such as an amount of the length of a polynucleotide or polypeptide sequence, dose, time, temperature, and the like, is meant to encompass variations of ⁇ 20%, ⁇ 10%, ⁇ 5%, ⁇ 1%, ⁇ 0.5%, or event 0.1% of the specified amount.
  • the transitional phrase "consisting essentially of means that the scope of a claim is to be interpreted to encompass the specified materials or steps recited in the claim, "and those that do not materially affect the basic and novel characteristic(s)" of the claimed invention. See, In re Herz, 537 F.2d 549, 551-52, 190 USPQ 461,463 (CCPA 1976) (emphasis in the original); see also MPEP ⁇ 2111.03.
  • the term “consisting essentially of when used in a claim of this invention is not intended to be interpreted to be equivalent to "comprising.” Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination.
  • amino acid can be selected from any subset of these amino acid(s) for example A, G, I or L; A, G, I or V; A or G; only L; etc. as if each such subcombination is expressly set forth herein.
  • amino acid can be disclaimed (e.g., by negative proviso).
  • the amino acid is not A, G or I; is not A; is not G or V; etc. as if each such possible disclaimer is expressly set forth herein.
  • parvovirus encompasses the family Parvoviridae, including autonomously replicating parvoviruses and dependoviruses.
  • the autonomous parvoviruses include members of the genera Parvovirus, Erythrovirus, Densovirus, Iteravirus, and Contravirus.
  • Exemplary autonomous parvoviruses include, but are not limited to, minute virus of mouse, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, goose parvovirus, Hl parvovirus, Muscovy duck parvovirus, B19 vims, and any other autonomous parvovirus now known or later discovered.
  • Other autonomous parvoviruses are known to those skilled in the art. See, e.g., BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
  • AAV adeno-associated vims
  • AAV type 1 AAV type 2
  • AAV type 3 including types 3A and 3B
  • AAV type 4 AAV type 5
  • AAV type 6 AAV type 7
  • AAV type 8 AAV type 9
  • AAV type 10 AAV type 11, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV now known or later discovered. See, e.g., BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
  • a number of relatively new AAV serotypes and clades have been identified (see, e.g., Gao et al., (2004) J. Virology 78:6381-6388; Moris et al., (2004) Virology 33-:375- 383); and also Table 1 as disclosed in U.S. Provisional Application 62,937,556, filed on November 19, 2019 and Table 1 in International Applications W02020/ 102645, and W02020/102667, each of which is incorporated herein in their entirety.
  • tropism refers to preferential entry of the virus into certain cells or tissues, optionally followed by expression (e.g., transcription and, optionally, translation) of a sequence(s) carried by the viral genome in the cell, e.g., for a recombinant virus, expression of a heterologous nucleic acid(s) of interest.
  • systemic tropism and “systemic transduction” (and equivalent terms) indicate that the virus capsid or virus vector of the invention exhibits tropism for and/or transduces tissues throughout the body (e.g., brain, lung, skeletal muscle, heart, liver, kidney and/or pancreas).
  • selective tropism or “specific tropism” means delivery of virus vectors to and/or specific transduction of certain target cells and/or certain tissues.
  • efficient transduction or “efficient tropism,” or similar terms, can be determined by reference to a suitable control (e.g., at least about 50%, 60%, 70%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400%, 500% or more of the transduction or tropism, respectively, of the control).
  • the virus vector efficiently transduces or has efficient tropism for liver cells and muscle cells. Suitable controls will depend on a variety of factors including the desired tropism and/or transduction profile.
  • a virus “does not efficiently transduce” or “does not have efficient tropism” for a target tissue, or similar terms by reference to a suitable control.
  • the virus vector does not efficiently transduce (i.e., has does not have efficient tropism) for kidney, gonads and/or germ cells.
  • transduction e.g., undesirable transduction
  • tissue(s) e.g., kidney
  • transduction e.g., undesirable transduction
  • tissue(s) e.g., kidney
  • the level of transduction of the desired target tissue(s) e.g., liver, skeletal muscle, diaphragm muscle, cardiac muscle and/or cells of the central nervous system.
  • polypeptide encompasses both peptides and proteins, unless indicated otherwise.
  • a "polynucleotide” is a sequence of nucleotide bases, and may be RNA, DNA or DNA-RNA hybrid sequences (including both naturally occurring and non-naturally occurring nucleotides), but in representative embodiments are either single or double stranded DNA sequences.
  • heterologous nucleotide sequence and “heterologous nucleic acid molecule” are used interchangeably herein and refer to a nucleic acid sequence that is not naturally occurring in the virus.
  • the heterologous nucleic acid molecule or heterologous nucleotide sequence comprises an open reading frame that encodes a polypeptide and/or nontranslated RNA of interest (e.g., for delivery to a cell and/or subject).
  • a “chimeric nucleic acid” comprises two or more nucleic acid sequences covalently linked together to encode a fusion polypeptide.
  • the nucleic acids may be DNA, RNA, or a hybrid thereof.
  • fusion polypeptide comprises two or more polypeptides covalently linked together, typically by peptide bonding.
  • an "isolated" polynucleotide e.g., an "isolated DNA” or an “isolated RNA" means a polynucleotide at least partially separated from at least some of the other components of the naturally occurring organism or virus, for example; the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polynucleotide.
  • an "isolated" nucleotide is enriched by at least about 10-fold, lOO'-fold, 1000-fold, 10,000-fold or more as compared with the starting material.
  • an "isolated" polypeptide means a polypeptide that is at least partially separated from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polypeptide.
  • an "isolated" polypeptide is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more as compared with the starting material.
  • an "isolated cell” refers to a cell that is separated from other components with which it is normally associated in its natural state.
  • an isolated cell can be a cell in culture medium and/or a cell in a pharmaceutically acceptable carrier of this invention.
  • an isolated cell can be delivered to and/or introduced into a subject.
  • an isolated cell can be a cell that is removed from a subject and manipulated as described herein ex vivo and then returned to the subject.
  • a population of virions can be generated by any of the methods described herein.
  • the population is at least 101 virions.
  • the population is at least 102 virions, at least 103, virions, at least 104 virions, at least 105 virions, at least 106 virions, at least 107 virions, at least 108 virions, at least 109 virions, at least 1010 virions, at least 1011 virions, at least 1012 virions, at least 1013 virions, at least 1014 virions, at least 1015 virions, at least 1016 virions, or at least 1017 virions.
  • a population of virions can be heterogeneous or can be homogeneous (e.g., substantially homogeneous or completely homogeneous).
  • a substantially homogeneous population is at least 90% of identical virions (e.g., the desired virion), and can be at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% of identical virions.
  • a population of virions that is completely homogeneous contains only identical virions.
  • virus vector or virus particle or population of virus particles it is meant that the virus vector or virus particle or population of virus particles is at least partially separated from at least some of the other components in the starting material.
  • an "isolated” or “purified” virus vector or virus particle or population of virus particles is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more as compared with the starting material.
  • efficient transduction or “efficient tropism,” or similar terms, can be determined by reference to a suitable control (e.g., at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400%, 500% or more of the transduction or tropism, respectively, of the control).
  • the virus vector efficiently transduces or has efficient tropism for neuronal cells and cardiomyocytes. Suitable controls will depend on a variety of factors including the desired tropism and/or transduction profile.
  • a "therapeutic polypeptide” is a polypeptide that can alleviate, reduce, prevent, delay and/or stabilize symptoms that result from an absence or defect in a protein in a cell or subject and/or is a polypeptide that otherwise confers a benefit to a subject, e.g., enzyme replacement to reduce or eliminate symptoms of a disease, or improvement in transplant survivability or induction of an immune response.
  • heterologous nucleotide sequence and “heterologous nucleic acid molecule” are used interchangeably herein and refer to a nucleic acid sequence that is not naturally occurring in the virus.
  • the heterologous nucleic acid molecule or heterologous nucleotide sequence comprises an open reading frame that encodes a polypeptide and/or nontranslated RNA of interest (e.g., for delivery to a cell and/or subject), for example the GAA polypeptide.
  • virus vector refers to a virus (e.g., AAV) particle that functions as a nucleic acid delivery vehicle, and which comprises the vector genome (e.g., viral DNA [vDNA]) packaged within a virion.
  • vector may be used to refer to the vector genome/vDNA alone.
  • rAAV vector genome or "rAAV genome” is an AAV genome (i.e., vDNA) that comprises one or more heterologous nucleic acid sequences. rAAV vectors generally require only the inverted terminal repeat(s) (TR(s)) in cis to generate virus. All other viral sequences are dispensable and may be supplied in trans (Muzyczka, (1992) Curr. Topics Microbial. Immunol. 158:97).
  • the rAAV vector genome will only retain the one or more TR sequence so as to maximize the size of the transgene that can be efficiently packaged by the vector.
  • the structural and non- structural protein coding sequences may be provided in trans (e.g., from a vector, such as a plasmid, or by stably integrating the sequences into a packaging cell).
  • the rAAV vector genome comprises at least one ITR sequence (e.g., AAV TR sequence), optionally two ITRs (e.g., two AAV TRs), which typically will be at the 5' and 3' ends of the vector genome and flank the heterologous nucleic acid, but need not be contiguous thereto.
  • the TRs can be the same or different from each other.
  • terminal repeat or "TR” includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (i.e., an ITR that mediates the desired functions such as replication, virus packaging, integration and/or provirus rescue, and the like).
  • the TR can be an AAV TR or a non-AAV TR.
  • a non-AAV TR sequence such as those of other parvoviruses (e.g., canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19) or any other suitable virus sequence (e.g., the SV40 hairpin that serves as the origin of SV40 replication) can be used as a TR, which can further be modified by truncation, substitution, deletion, insertion and/or addition.
  • the TR can be partially or completely synthetic, such as the "double-D sequence" as described in United States Patent No. 5,478,745 to Samulski et al.
  • An "AAV terminal repeat” or “AAV TR,” including an “AAV inverted terminal repeat” or “AAV ITR” may be from any AAV, including but not limited to serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 or any other AAV now known or later discovered.
  • An AAV terminal repeat need not have the native terminal repeat sequence (e.g., a native AAV TR or AAV ITR sequence may be altered by insertion, deletion, truncation and/or missense mutations), as long as the terminal repeat mediates the desired functions, e.g., replication, virus packaging, integration, and/or provirus rescue, and the like.
  • AAV proteins VP1, VP2 and VP3 are capsid proteins that interact together to form an AAV capsid of an icosahedral symmetry.
  • VP 1.5 is an AAV capsid protein described in US Publication No. 2014/0037585.
  • the virus vectors of the invention can further be "targeted" virus vectors (e.g., having a directed tropism) and/or a "hybrid” parvovirus (i.e., in which the viral TRs and viral capsid are from different parvoviruses) as described in international patent publication WO 00/28004 and Chao et al., (2000) Molecular Therapy 2:619.
  • targeted virus vectors e.g., having a directed tropism
  • a “hybrid” parvovirus i.e., in which the viral TRs and viral capsid are from different parvoviruses
  • the virus vectors of the invention can further be duplexed parvovirus particles as described in international patent publication WO 01/92551 (the disclosure of which is incorporated herein by reference in its entirety).
  • double stranded (duplex) genomes can be packaged into the virus capsids of the invention.
  • viral capsid or genomic elements can contain other modifications, including insertions, deletions and/or substitutions.
  • a "chimeric' capsid protein as used herein means an AAV capsid protein (e.g., any one or more of VP1, VP2 or VP3) that has been modified by substitutions in one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid residues in the amino acid sequence of the capsid protein relative to wild type, as well as insertions and/or deletions of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid residues in the amino acid sequence relative to wild type.
  • complete or partial domains, functional regions, epitopes, etc., from one AAV serotype can replace the corresponding wild type domain, functional region, epitope, etc.
  • haploid AAV shall mean that AAV as described in International Application W02018/170310, or US Application US2018/037149, which are incorporated herein in their entirety by reference.
  • a population of virions is a haploid AAV population where a virion particle can be constructed wherein at least one viral protein from the group consisting of AAV capsid proteins, VP1, VP2 and VP3, is different from at least one of the other viral proteins, required to form the virion particle capable of encapsulating an AAV genome.
  • VP1, VP2, and/or VP3 that protein is the same type (e.g., all AAV2 VP1).
  • at least one of the viral proteins is a chimeric viral protein and at least one of the other two viral proteins is not a chimeric.
  • VP1 and VP2 are chimeric and only VP3 is non- chimeric.
  • VP1/VP2 the viral particle composed of VP1/VP2 from the chimeric AAV2/8 (the N-terminus of AAV2 and the C-terminus of AAV8) paired with only VP3 from AAV2; or only the chimeric VP1/VP228m-2P3 (the N-terminal from AAV8 and the C-terminal from AAV2 without mutation of VP3 start codon) paired with only VP3 from AAV2.
  • only VP3 is chimeric and VP1 and VP2 are non-chimeric.
  • at least one of the viral proteins is from a completely different serotype.
  • no chimeric is present.
  • hybrid AAV vector or parvovirus refers to a rAAV vector where the viral TRs or ITRs and viral capsid are from different parvoviruses.
  • Hybrid vectors are described in international patent publication WO 00/28004 and Chao et al., (2000) Molecular Therapy 2:619.
  • a hybrid AAV vector typically comprises the adenovirus 5' and 3' cis ITR sequences sufficient for adenovirus replication and packaging (i.e., the adenovirus terminal repeats and PAC sequence).
  • polyploid AAV refers to a AAV vector which is composed of capsids from two or more AAV serotypes, e.g., and can take advantages from individual serotypes for higher transduction but not in certain embodiments eliminate the tropism from the parents.
  • GAA GAA polypeptide
  • precursor e.g., ⁇ 110 kDa
  • modified e.g., truncated or mutated by insertions, deletion(s) and/or substitution(s)
  • GAA proteins or fragments thereof that retain biological function (i.e., have at least one biological activity of the native GAA protein, e.g., can hydrolyze glycogen, as defined above) and GAA variants (e.g., GAA II as described by Kunita et al., (1997) Biochemica et Biophysica Acta 1362:269; GAA polymorphisms and SNPs are described by Hirschhom, R.
  • GAA GAA coding and noncoding sequences.
  • GAA GAA coding and noncoding sequences.
  • GAA GAA coding and noncoding sequences.
  • targeting peptide is also referred to as a “targeting sequence” as used herein is intended to refer to a peptide that targets a particular subcellular compartment, for example, a mammalian lysosome.
  • a targeting peptide encompassed for use herein is a lysosome targeting peptide that is mannose-6-phosphate-independent.
  • An exemplary targeting sequence is an IGF2 targeting peptide as disclosed herein.
  • signal sequence is used interchangeably herein with the term “secretory signal sequence” or “leader sequence” or “signal peptide” or variations thereof, and intended to refer to amino acid sequences that function to enhance (as defined above) secretion of an operably linked polypeptide, (e.g., a GAA peptide) from the cell as compared with the level of secretion seen with the native polypeptide.
  • an operably linked polypeptide e.g., a GAA peptide
  • impaired secretion it is meant that the relative proportion of GAA polypeptide synthesized by the cell that is secreted from the cell is increased; it is not necessary that the absolute amount of secreted protein is also increased.
  • essentially all (i.e., at least 95%, 97%, 98%, 99% or more) of the GAA-polypeptide is secreted. It is not necessary, however, that essentially all or even most of the GAA polypeptide is secreted, as long as the level of secretion is enhanced as compared with the native GAA polypeptide.
  • leader sequences include, but are not limited to the innate GAA signal sequence (also referred to as endogenous GAA signal sequence), AAT sequence, IL2(l-3), IL2 leader sequence (IL2 wt), a modified IL2 leader sequence (IL2 mut), fibronectin (FN1, also referred to as FBN), or IgG leader sequence or functional variants thereof, as disclosed herein.
  • innate GAA signal sequence also referred to as endogenous GAA signal sequence
  • AAT sequence IL2(l-3)
  • IL2 leader sequence IL2 wt
  • IL2 mut a modified IL2 leader sequence
  • FN1 fibronectin
  • IgG leader sequence or functional variants thereof as disclosed herein.
  • amino acid encompasses any naturally occurring amino acid, modified forms thereof, and synthetic amino acids.
  • Naturally occurring, levorotatory (L-) amino acids are disclosed in Table 2 of US Publication 2018/0371496, which is incorporated herein in its entirety.
  • the amino acid can be a modified amino acid residue (nonlimiting examples are shown in Table 4 of US Publication of US Publication 2018/0371496) and/or can be an amino acid that is modified by post-translation modification (e.g., acetylation, amidation, formylation, hydroxylation, methylation, phosphorylation or sulfatation).
  • non-naturally occurring amino acid can be an “unnatural” amino acid as described by Wang et al., Annu Rev Biophys Biomol Struct. 35:225-49 (2006). These unnatural amino acids can advantageously be used to chemically link molecules of interest to the AAV capsid protein.
  • amino acid can be selected from any subset of these amino acid(s) for example A, G, I or L; A, G, I or V; A or G; only L; etc. as if each such subcombination is expressly set forth herein.
  • amino acid can be disclaimed (e.g., by negative proviso).
  • the amino acid is not A, G or I; is not A; is not G or V; etc. as if each such possible disclaimer is expressly set forth herein.
  • promoter refers to a region of DNA that generally is located upstream of a nucleic acid sequence to be transcribed that is needed for transcription to occur, i.e. which initiates transcription. Promoters permit the proper activation or repression of transcription of a coding sequence under their control.
  • a promoter typically contains specific sequences that are recognized and bound by plurality of TFs. TFs bind to the promoter sequences and result in the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of the gene. A great many promoters are known in the art.
  • synthetic promoter as used herein relates to a promoter that does not occur in nature. Parts of the synthetic promoter may be naturally occurring (e.g. the minimal promoter), but the synthetic promoter as a complete entity is not naturally occurring.
  • minimal promoter refers to a short DNA segment which is inactive or largely inactive by itself, but can mediate transcription when combined with other transcription regulatory elements.
  • Minimum promoter sequence can be derived from various different sources, including prokaryotic and eukaryotic genes. Examples of minimal promoters are discussed above, and include the dopamine beta-hydroxylase gene minimum promoter, cytomegalovirus (CMV) immediate early gene minimum promoter (CMV-MP), and the herpes thymidine kinase minimal promoter (MinTK).
  • a minimal promoter typically comprises the transcription start site (TSS) and elements directly upstream, a binding site for RNA polymerase II, and general transcription factor binding sites (often a TATA box).
  • proximal promoter relates to the minimal promoter plus the proximal sequence upstream of the gene that tends to contain primary regulatory elements. It often extends approximately 250 base pairs upstream of the TSS, and includes specific TFBS.
  • the proximal promoter can be a naturally occurring liver-specific proximal promoter. However, the proximal promoter can be synthetic.
  • a “functional variant” of a promoter or other nucleic acid sequence in the context of the present invention is a variant of a reference sequence that retains the ability to function in the same way as the reference sequence, e.g. as a liver-specific promoter.
  • Alternative terms for such functional variants include “biological equivalents” or “equivalents”.
  • liver-specific or “liver-specific expression” when in reference to a promoter refers to the ability of promoter to enhance or drive expression of a gene in the liver (or in liver- derived cells) in a preferential or predominant manner as compared to other tissues (e.g. spleen, muscle, heart, lung, and brain). Expression of the gene can be in the form of mRNA or protein. In some embodiments, liver-specific expression is such that there is negligible expression in other (i.e. non-liver) tissues or cells, i.e. expression is highly liver-specific. In some embodiments, while a liver- specific promoter drives expression preferentially in the liver, it can also drive expression of the gene in another tissue of interest at a lower level, e.g., muscle.
  • any variant of the liver-specific promoter recited above remains functional (i.e. it is a functional variant as defined above).
  • any given promoter to be assessed can be operably linked to a minimal promoter (e.g. positioned upstream of CMV-MP) and the ability of the promoter to drive liver-specific expression of a gene (typically a reporter gene) is measured.
  • a minimal promoter e.g. positioned upstream of CMV-MP
  • the ability of the promoter to drive liver-specific expression of a gene typically a reporter gene
  • the ability of a promoter to drive liver- specific expression can be readily assessed by the skilled person (e.g. as described in the examples below).
  • Expression levels of a gene driven by a variant of a reference promoter can be compared to the expression levels driven by the reference sequence.
  • liver-specific expression levels driven by a variant promoter are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% of the expression levels driven by the reference promoter, it can be said that the variant remains functional.
  • Suitable nucleic acid constructs and reporter assays to assess liver-specific expression enhancement can easily be constructed, and the examples set out below give suitable methodologies.
  • Liver-specificity can be identified wherein the expression of a gene (e.g. a therapeutic or reporter gene) occurs preferentially or predominantly in liver-derived cells.
  • a gene e.g. a therapeutic or reporter gene
  • Preferential or predominant expression can be defined, for example, where the level of expression is significantly greater in liver-derived cells than in other types of cells (i.e. non-liver-derived cells).
  • expression in liver-derived cells is suitably at least 5-fold higher than non-liver cells, preferably at least 10-fold higher than non-liver cells, and it may be 50-fold higher or more in some cases.
  • liver-specific expression can suitably be demonstrated via a comparison of expression levels in a hepatic cell line (e.g.
  • liver-derived cell line such as Huh7 and/or HepG2 cells
  • liver primary cells compared with expression levels in a kidney-derived cell line (e.g. HEK-293), a cervical tissue-derived cell line (e.g. HeLa) and/or a lung-derived cell line (e.g. A549).
  • a kidney-derived cell line e.g. HEK-293
  • a cervical tissue-derived cell line e.g. HeLa
  • a lung-derived cell line e.g. A549
  • the synthetic liver-specific promoters of the present invention are preferably suitable for promoting expression in the liver of a subject, e.g., driving liver-specific expression of a transgene, preferably a therapeutic transgene.
  • Preferred synthetic liver-specific promoters of the present invention are suitable for promoting liver-specific transgene expression and have an activity in liver cells which is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TBG promoter (see, e.g., SEQ ID NO: 435 as disclosed in International Application WO2021102107).
  • the synthetic liver-specific promoters of the present invention are preferably suitable for promoting liver-specific expression at a level at least 1.5-fold greater than a CMV-IE promoter (see, e.g., SEQ ID NO: 433 as disclosed in International Application WO2021102107) in liver-derived cells, preferably at least 2-fold greater than a CMV promoter in liver-derived cells (e.g. HEK-293, HeLa, and/or A549 cells).
  • identity refers to the sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, such as between two DNA molecules. Sequence alignments and determination of sequence identity can be done, e.g., using the Basic Local Alignment Search Tool (BLAST) originally described by Altschul et al. 1990 (J Mol Biol 215: 403- 10), such as the "Blast 2 sequences” algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174: 247-250).
  • BLAST Basic Local Alignment Search Tool
  • synthetic means a nucleic acid molecule that does not occur in nature. Synthetic nucleic acid expression constructs of the present invention are produced artificially, typically by recombinant technologies. Such synthetic nucleic acids may contain naturally occurring sequences (e.g. promoter, enhancer, intron, and other such regulatory sequences), but these are present in a non-naturally occurring context. For example, a synthetic gene (or portion of a gene) typically contains one or more nucleic acid sequences that are not contiguous in nature (chimeric sequences), and/or may encompass substitutions, insertions, and deletions and combinations thereof.
  • naturally occurring sequences e.g. promoter, enhancer, intron, and other such regulatory sequences
  • a “spacer sequence” or “spacer” as used herein is a nucleic acid sequence that separates two functional nucleic acid sequences. It can have essentially any sequence, provided it does not prevent the functional nucleic acid sequence (e.g. cis-regulatory element) from functioning as desired (e.g. this could happen if it includes a silencer sequence, prevents binding of the desired transcription factor, or suchlike). Typically, it is non-functional, as in it is present only to space adjacent functional nucleic acid sequences from one another.
  • treat By the terms “treat,” “treating” or “treatment of (and grammatical variations thereof) it is meant that the severity of the subject's condition is reduced, at least partially improved or stabilized and/or that some alleviation, mitigation, decrease or stabilization in at least one clinical symptom is achieved and/or there is a delay in the progression of the disease or disorder.
  • prevent refers to prevention and/or delay of the onset of a disease, disorder and/or a clinical symptom(s) in a subject and/or a reduction in the severity of the onset of the disease, disorder and/or clinical symptom(s) relative to what would occur in the absence of the methods of the invention.
  • the prevention can be complete, e.g., the total absence of the disease, disorder and/or clinical symptom(s).
  • the prevention can also be partial, such that the occurrence of the disease, disorder and/or clinical symptom(s) in the subject and/or the severity of onset is substantially less than what would occur in the absence of the present invention.
  • a “treatment effective” amount as used herein is an amount that is sufficient to provide some improvement or benefit to the subject.
  • a “treatment effective” amount is an amount that will provide some alleviation, mitigation, decrease or stabilization in at least one clinical symptom in the subject.
  • the therapeutic effects need not be complete or curative, as long as some benefit is provided to the subject.
  • a "prevention effective" amount as used herein is an amount that is sufficient to prevent and/or delay the onset of a disease, disorder and/or clinical symptoms in a subject and/or to reduce and/or delay the severity of the onset of a disease, disorder and/or clinical symptoms in a subject relative to what would occur in the absence of the methods of the invention.
  • prevention effective amount need not be complete, as long as some preventative benefit is provided to the subject.
  • a “therapeutically effective amount” and like phrases mean a dose or plasma concentration in a subject that provides the desired specific pharmacological effect, e.g. to express a therapeutic gene in the liver, and secretion into the plasma. It is emphasized that a therapeutically effective amount may not always be effective in treating the conditions described herein, even though such dosage is deemed to be a therapeutically effective amount by those of skill in the art. The therapeutically effective amount may vary based on the route of administration and dosage form, the age and weight of the subject, and/or the disease or condition being treated.
  • the terms “individual,” “subject,” and “patient” are used interchangeably, and refer to any individual subject with a disease or condition in need of treatment.
  • the subject may be a primate, preferably a human, or another mammal, such as a dog, cat, horse, pig, goat, or bovine, and the like.
  • Additional patents incorporated for reference herein that are related to, disclose or describe an AAV or an aspect of an AAV, including the DNA vector that includes the gene of interest to be expressed are: U.S. Patent Nos. 6,491,907; 7,229,823; 7,790,154; 7,201898; 7,071,172; 7,892,809; 7,867,484; 8,889,641; 9,169,494; 9,169,492; 9,441,206; 9,409,953; and, 9,447,433; 9,592,247; and, 9,737,618.
  • a recombinant adenovirus associated (rAAV) vector comprising in its genome: a. 5’ and 3’ AAV inverted terminal repeats (ITR) sequences, and b. located between the 5’ and 3’ ITRs, a heterologous nucleic acid sequence encoding all or a portion of an endogenous GAA signal peptide, a heterologous signal peptide and an alpha-glucosidase (GAA) polypeptide, wherein the GAA polypeptide comprises amino acid residues 28-952 of SEQ ID NO: 1, 57-952 of SEQ ID NO: 1, or comprises a N-terminal GAA polypeptide fragment comprising amino acids 28, 28-29, 28-30, 28-31, 28-32, or 28-33 of SEQ ID NO: 1 and a deletion of any number of amino acids from the next about 5 amino acids to about 40 amino acids after the N terminal GAA polypeptide fragment of SEQ ID NO: 1, and wherein the heterologous signal peptide can be inserted immediately after
  • AAV vector of any of the preceding paragraphs which comprises the nucleic acid sequence of SEQ ID NO: 23, or a functional variant thereof.
  • heterologous nucleic acid sequence encodes a GAA protein comprising a signal peptide fused to the GAA polypeptide, wherein the signal peptide is an endogenous GAA signal peptide, or a heterologous signal peptide, or a combination thereof.
  • AAV vector of any of the preceding paragraphs further comprising at least one of a UTR, or a reverse RNA polll terminator sequence.
  • AAV vector of any of the preceding paragraphs wherein the AAV genome comprises, in the 5’ to 3’ direction: a. a 5’ ITR, b. a liver-specific promoter sequence, c. an 5’ UTR sequence, d. a nucleic acid encoding a portion or all of the endogenous GAA signal peptide, e. a nucleic acid encoding a heterologous signal peptide or the N-terminal GAA polypeptide fragment, f. a nucleic acid encoding an alpha-glucosidase (GAA) polypeptide, wherein the GAA polypeptide is functionally active, g. a poly A sequence, and h. a reverse RNA pol II terminator sequence.
  • GAA alpha-glucosidase
  • nucleic acid encoding the signal peptide encodes a signal sequence is selected from any of: an endogenous GAA signal peptide, a fibronectin signal peptide (FN1), a IL-2 wt signal peptide, modified IL-2 signal peptide, IL2(l-3) signal peptide, IgG signal peptide, a AAT signal peptide, a A2M signal peptide, or a PZP signal peptide, or an active fragment thereof having signal peptide activity.
  • nucleic acid sequence encodes a GAA polypeptide having the amino acid sequence of SEQ ID NO: 1, or a polypeptide having at least 80% sequence identity to SEQ ID NO: 1 where amino acid residue 199 is a R (199R), amino acid residue 223 is a H (223H) and amino acid residue 780 is a I (7801).
  • nucleic acid sequence encoding the GAA polypeptide is SEQ ID NO: 3, or a nucleic acid sequence having at least 80%, or at least 85%, or at least 90% sequence identity to SEQ ID NO: 3 that encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO: 1 where amino acid residue 199 is a R (199R), amino acid residue 223 is a H (223H) and amino acid residue 780 is a I (7801).
  • the recombinant AAV vector of any of the preceding paragraphs wherein the intron sequence is selected from the group consisting of: MVM sequence, a HBB2 sequence, an CMVIE intron sequence, or a UBC intron sequence or a SV40 sequence.
  • heterologous nucleic acid sequence further comprises a 3’ UTR sequence, wherein the 3’ UTR sequence is located 3’ of the nucleic acid encoding the GAA polypeptide and 5’ of the 3’ ITR sequence, or is located between the nucleic acid encoding the GAA polypeptide and the poly A sequence, or RNA pol II terminator sequence.9.
  • the ITR comprises an insertion, deletion or substitution. 1.
  • the recombinant AAV vector of any of the preceding paragraphs, wherein a. the nucleic acid encoding the signal peptide is selected from any of the group consisting of:
  • AAT signal peptide e.g., SEQ ID NO: 67
  • an active fragment thereof having secretory signal activity e.g., a nucleic acid encoding an amino acid sequence that has at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 67
  • a fibronectin signal peptide FN1
  • an active fragment thereof having secretory signal activity e.g., a nucleic acid encoding an amino acid sequence that has at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 73-75
  • an endogenous GAA signal peptide SEQ ID NO: 51
  • an active fragment thereof having secretory signal activity e.g., a nucleic acid encoding an amino acid sequence that has at least about 75%, or 80%
  • the nucleic acid encoding the GAA polypeptide is selected from any of the group consisting of: SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NOS: 1-18.
  • nucleic acid encoding the GAA polypeptide is selected from SEQ ID NO: 3, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 3 which encodes a GAA polypeptide at least 85% sequence identity to SEQ ID NO: 1 where amino acid residue 199 is a R (199R), amino acid residue 223 is a H (223H) and amino acid residue 780 is a I (7801).
  • nucleic acid encoding the GAA polypeptide encodes a GAA polypeptide beginning at any of amino acid residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793, or 796 of SEQ ID NO: 1 or a sequence 80% identical to SEQ ID NO: 1 where amino acid residue 199 is a R (199R), amino acid residue 223 is a H (223H) and amino acid residue 780 is a I (7801).
  • the GAA polypeptide has an endogenous GAA signal peptide attached, or a heterologous signal peptide attached to the N-terminal of the GAA polypeptide, wherein the endogenous signal peptide has the amino acid sequence of SEQ ID NO: 59 or a sequence at least 80% sequence identity to SEQ ID NO: 59, and the heterologous signal peptide is selected from the group consisting of: SEQ ID NO: 60 (201 IgG signal peptide), or an IL2 wild type signal peptide (SEQ ID NO: 61), modified IL2 signal peptide (SEQ ID NO: 62), A2M signal peptide (SEQ ID NO: 63), or PZP signal peptide (SEQ ID NO: 64), or artificial signal peptide (SEQ ID NO: 65), or cathpetsin L signal peptide (SEQ ID NO: 66) or signal peptides at least 90% sequence
  • liver specific promoter is selected from any of: SEQ ID NOS: 86, 88, 91-96, 146-150 or 439-441, or a liver specific promoter having at least 80% sequence identity to SEQ ID NOs: 86, 88, 91-96, 146-150 or 439-441.
  • the liver specific promoter is selected from any of: SEQ ID NOS: 98 or 99, or a liver specific promoter having at least 80% sequence identity to SEQ ID NOs: 98 or 99.
  • the recombinant AAV vector of any of the preceding paragraphs, wherein the nucleic acid comprises SEQ ID NO: 25, or a functional fragment thereof.
  • the recombinant AAV vector of any of the preceding paragraphs wherein the recombinant AAV vector is a chimeric AAV vector, haploid AAV vector, a hybrid AAV vector or polyploid AAV vector.
  • the recombinant AAV vector of any of the preceding paragraphs wherein the recombinant AAV vector is selected from the group consisting of: a AAVXL32 vector, a AAVXL32.1 vector, a AAV8 vector, or a haploid AAV8 vector comprising at least one AAV8 capsid protein.
  • the recombinant AAV vector of any of the preceding paragraphs, wherein the serotype is AAV3b.
  • the recombinant AAV vector of any of the preceding paragraphs, wherein the AAV3b serotype comprises one or mutations in a capsid protein selected from any of: 265D, 549A, Q263Y.
  • poly A sequence is selected from SEQ ID NO: 42, 43 or 44, or a nucleic acid sequence at least 80% sequence identity to SEQ ID NOS: 42-44.
  • a pharmaceutical composition comprising the recombinant AAV vector of any one of the previous paragraphs in a pharmaceutically acceptable carrier.
  • a method to treat a subject with Pompe Disease, or a glycogen storage disease type II (GSD II, Acid Maltase Deficiency) or having a deficiency in alpha-glucosidase (GAA) polypeptide comprising administering any of the recombinant AAV vector, or the rAAV genome or the nucleic acid sequence of any one of the previous paragraphs to the subject.
  • the recombinant AAV vector comprises the nucleic acid sequence of SEQ ID NO: 3, or a functional fragment thereof.
  • the recombinant AAV vector comprises the nucleic acid sequence of SEQ ID NO: 23, or a functional variant thereof.
  • GAA polypeptide is secreted from the subject’s liver and there is uptake of the secreted GAA by skeletal muscle tissue, cardiac muscle tissue, diaphragm muscle tissue or a combination thereof, wherein uptake of the secreted GAA results in a reduction in lysosomal glycogen stores in the tissue(s).
  • the administering to the subject is selected from any of: intramuscular, sub-cutaneous, intraspinal, intracistemal, intrathecal, intravenous administration.
  • the recombinant AAV vector is a chimeric AAV vector, haploid AAV vector, a hybrid AAV vector or polyploid AAV vector.
  • the method of any of the preceding paragraphs, where the recombinant AAV vector is a AAVXL32 vector or a AAVXL32.1 vector or a AAV8 vector, or a haploid AAV8 vector comprising at least one AAV8 capsid protein.
  • the recombinant AAV vector is a AAV8 vector. 51. The method of any of the preceding paragraphs, where the recombinant AAV vector is administered at a dosage range of between l.OEllvg/kg and 5.0E13 vg/kg.
  • a nucleic acid construct comprising SEQ ID NO: 3, or a nucleic acid sequence at least 80% sequence identity to SEQ ID NOS: 3.
  • nucleic acid of paragraph 50 wherein the expression of the nucleic acid sequence of SEQ ID NO: 3 or a nucleic acid having 80% sequence identity thereto encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO: 1 and wherein there is R at position 199, a H at position 223 and I at position 780.
  • a nucleic acid construct comprising SEQ ID NO: 23, or a nucleic acid sequence at least 80% sequence identity to SEQ ID NO: 23.
  • nucleic acid construct of paragraph 52 comprising SEQ ID NO: 3 or SEQ ID NO: 25, or a nucleic acid sequence at least 80% sequence identity to SEQ ID NOS: 3 or 25.
  • nucleic acid of any of the preceding paragraphs wherein the expression of the nucleic acid sequence of SEQ ID NO: 3 or a nucleic acid having 80% sequence identity thereto encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO: 1 and wherein there is R at position 199, a H at position 223 and I at position 780.
  • a recombinant AAV comprising the nucleic acid construct of any of the preceding paragraphs.
  • the rAAV genomes were packed into capsids to generate rAAV vectors using a rAAV producing cell line. Solely for proof of principal of rAAV vector construction, the capsids used were AAV3b capsids.
  • rAAV in the rAAV producing cell line triple transfection technique was used to make rAAV in a suspension rAAV producer cell line, which can be scaled up for making clinical grade vector.
  • different plasmids can be used, e.g., 1) pXX680 - ad helper and 2) pXR3 the Rep and Cap 3) and the Transgene plasmid (ITR — transgene-ITR).
  • rAAV genomes generated in Example 1 are used to generate rAW vectors using a rAAV producing cell line, according to the methods as described in US patent 9,441,206, which is incorporated herein in its entirety by reference.
  • rAAV vectors or rAAV virions are produced using a method comprising: (a) providing a rAAV producing cell line an AAV expression system; (b) culturing the cells under conditions in which AAV particles are produced; and (c) optionally isolating the AAV particles.
  • Ratios of triple transfection of the plasmid and transfection cocktail volumes can be optimized, with varying plasmid ratios of XX680, AAV rep/cap helper and TR plasmid to determine the optimal plasmid ratio for rAAV vector production.
  • the cells are cultured in suspension under conditions in which AAV particles are produced.
  • the cells are cultured in animal component-free conditions.
  • the animal component-free medium can be any animal component-free medium (e.g., serum-free medium) compatible with the rAAV producer cell line. Examples include, without limitation, SFM4Transfx-293 (Hyclone), Ex-Cell 293 (JRH Biosciences), LC-SFM (Invitrogen), and Pro293-S (Lonza).
  • Conditions sufficient for the replication and packaging of the AAV particles can be, e.g., the presence of AAV sequences sufficient for replication of an rAAV genome described herein and encapsidation into AAV capsids (e.g., AAV rep sequences and AAV cap sequences) and helper sequences from adenovirus and/or herpesvirus.
  • Bacterial DNA sequences from the plasmid backbone can be packaged into AAV capsids during manufacturing of the recombinant AAV vectors leading to activations of the innate immune system through its interaction with TLR9 (Akira, 2006; Chadeuf, 2005; Wright, 2014).
  • Various technologies can be used to eliminate plasmid backbone sequences in recombinant AAV preparations, for example minicircles which have limited scalability (Schnodt, 2016).
  • Another method to avoid bacterial DNA sequence in the plasmid backbone is to use closed ended linear duplex DNA, which includes a range of DNA replication technology, including but not limited to doggy bone DNA (dbDNATM) for specifically manufacturing of recombinant AAV vectors.
  • dbDNATM doggy bone DNA
  • dbDNATM closed ended linear duplex DNA
  • dbDNATM eliminates the bacterial backbone and has been used to produce vaccines and lentivirus (Walters et al, 2014; Scott et al, 2015; Karda et al, 2019) and was shown to be unable to trigger TLR9 responses by DNA vaccine developers.
  • generation of rAAV vectors for use in the methods and compositions as disclosed herein can be performed using closed ended linear duplex DNA, including but not limited to Doggybone technology (dbDNATM), as disclosed in US Application 2018/0037943 and Karbowniczek et al., Bioinsights, 2017, which is incorporated herein in its entirety by reference.
  • a plasmid for AAV production using a closed ended linear duplex DNA technology can comprise the ITRs, promoter and gene of interest, e.g., GAA as disclosed herein, is flanked by a 56bp palindromic protelomerase recognition sequence.
  • the plasmid is denatured, and in the presence of a Phi29 DNA polymerase, and appropriate primers, Phi29 initiates rolling circle amplification (RCA), creating a double stranded cancatameric repeats of the original construct.
  • RCA rolling circle amplification
  • protelomerase is added, binding of the palindromic protelomerase recognition sequences occurs and cleavage-joining reaction occurs to result in a monomeric double stranded (ds) linear covalently closed DNA construct.
  • Addition of common restriction enzymes remove the undesired DNA plasmid backbone sequence and digestion with exonuclease activity, resulting in dbDNA which can be size fractionated to isolate the dbDNA sequence encoding the ITRs, promoter and gene of interest.
  • An exemplary plasmid for generation of rAAV vectors using closed ended linear duplex DNA such as dbDNATM technology comprises in the following 5’ to 3’ direction: 5 ’-protelomerase RS, 5’ITR, LSP promoter, GAA (e.g., wild-type or codon optimized), 3’UTR, hGH poly(A), 3’ ITR, 3’- protelomerase RS (sense strand), where the sense strand is linked to the complementary antisense strand for a stranded (ds) linear covalently closed DNA construct.
  • closed ended linear duplex DNA e.g., doggy bone DNA (dbDNATM)
  • dbDNATM doggy bone DNA
  • TLR9 Toll-like receptor 9
  • SEQ ID NO: 37 An exemplary dbDNA plasmid for use in the manufacturing of a rAAV vector for use in the methods and compositions as disclosed herein is SEQ ID NO: 37.
  • the 4780bp fragment of 347-5126bp of SEQ ID NO: 37 (i.e., the ITR-to-ITR sequence of SEQ ID NO: 37) can be replaced by any ITR-to-ITR sequence as disclosed herein, e.g., a ITR-to-ITR sequence selected from any of: SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 31-35 as disclosed herein.
  • Use of closed ended linear duplex DNA technology for manufacturing further reduce the risk for liver enzyme elevations observed at a dose of 1.6E13 vg/kg in patients with Pompe disease.
  • Study Objective The primary objective of this study presented herein in this example is to evaluate a series of gene therapy vector variants for tissue biodistribution and expression of human acid glucosidase alpha (GAA) in a mouse model of Pompe Disease.
  • GAA human acid glucosidase alpha
  • the following vectors ACTUS 101 (lot AB20200915), M3 dbp (lot AB20200914) and M3 db (lot AB20201117) were included in this study.
  • ACTUS-101 (AAV2/8-LSPhGAA) (SEQ ID NO:451) is an infectious non- replicating recombinant adeno-associated viral vector (AAV) serotype 8, pseudotyped with AAV2 inverted terminal repeats (ITR), expressing human GAA under the control of a liver specific promoter (LSP).
  • AAV adeno-associated viral vector
  • ITR inverted terminal repeats
  • LSP liver specific promoter
  • the GAA has an amino acid composition that is the same as in the FDA approved Enzyme Replacement Therapy Myozyme/Lumizyme for the treatment of Pompe Disease.
  • An additional change includes the use of synthetic doggy bone DNA (dbDNATM) as a starting material for the manufacturing of the gene therapy vector, eliminating the bacterial backbone and thus minimizing the ability of the product to trigger Toll-like receptor 9 (TLR9) responses.
  • dbDNATM doggy bone DNA
  • the M3 vector (SEQ ID NO: 37) in this study uses the same AAV8 capsid as in ACTUS-101 and is made using the doggy bone precursor plasmid (dbp) for lot AB20200914 and doggy bone DNA (db) for lot AB20201117.
  • Cloning and vector quantification All vectors were made using methods as described in Example 1. The constructs were packaged in the AAV8 viral capsid and titered by digital droplet PCR (ddPCR) method using primers directed at vector ITRs.
  • ddPCR digital droplet PCR
  • Tissue preservation Fresh tissue and sera specimens were immediately frozen and stored at -80°C until use for molecular biology analyses.
  • Tissues were homogenized in T-PER buffer (ThermoFisher 78510) with Halt Protease Inhibitor Cocktail (Thermo 78430) in TissueLyser and protein was quantified by BCA assay.
  • Membranes were imaged on iBright imager (FL15000) using the Ponceau S setting and destained using 0.1M NaOH for 30 sec followed by rinsing the membrane with water for 2-3 minutes. Blocking was done in Superblock (TBS) blocking solution (ThermoFisher 37536) for 1 hour at room temperature. Acid-a-glucosidase (GAA) protein detection was obtained after incubation overnight at 4°C with a rabbit anti-GAA antibody (AbCam 137068) diluted 1:8000 in PBS 0.05% tween 20, followed by a goat anti-rabbit HRP conjugated antibody (Abeam ab205718) diluted 1:10000.
  • TBS Superblock
  • the HRP enzyme activity was detected by Clarity Enhanced Chemiluminescence (ECL) Western Blotting Substrate (BioRad 1705061).
  • ECL Clarity Enhanced Chemiluminescence
  • BioRad 1705061 Clarity Enhanced Chemiluminescence
  • the images were acquired by iBright imaging system, densitometry was performed on iBright software v. 4.0.1 and results were expressed as relative calculation (ratio) of the intensity of GAA antibody detected band per total protein by Ponceau S staining.
  • rhGAA was run as a standard curve for absolute quantification.
  • GAA activity measurement in tissues GAA activity was measured on frozen tissues following homogenization and sonication of tissue samples in distilled water. Depending upon the tissue size, 10-50 mg tissue was weighed and homogenized, the homogenates were sonicated at 4 degree C 3 times for 15 seconds, then centrifuged for 3 min at 15000 RPM. For serum GAA, 10 ul was analyzed, with or without 80 ⁇ M acarbose. The reaction was set up with lOul of supernatant and 20 ul of substrate - 4MUa-D-glucoside, in a 96 wells plate (VWR62402-970).
  • the reaction mixture was incubated at 37 degrees C for one hour and was stopped by adding 130ul of Sodium Carbonate buffer pH 10.5.
  • a standard curve (0- 1000 pmol/ ul of 4MU) was used to measure released fluorescent 4MU from individual reaction mixture, using TECAN GENios microplate reader at 465 nm (Emission) and 360 nm (excitation).
  • the protein concentrations of the clarified supernatants were quantified via the Bradford assay (Bio-Rad Laboratories, Cat No. 500-0006).
  • GAA activity was measured in the tissue homogenates by conversion of the artificial substrate 4-methylumbelliferyl (4- MU) a-D-glucoside to the fluorescent product umbelliferone at acidic pH 4.3 as described [1]. To calculate the GAA activity, released 4MU concentration was divided by the sample protein concentration and activity was reported as nmol/hour/mg protein. QA and QC samples were run on the same plate for experimental assay controls.
  • GAA activity measurement in serum Fresh blood samples obtained from submandibular bleed were centrifuged and serum collected. 10 ul of serum was treated 2ul of 800 aca ⁇ rMbose. The reaction was set up with l0ul of supernatant and 20 ul of substrate - 4MUa-D-glucoside, in a 96 wells plate (VWR62402-970). The reaction mixture was incubated at 37 degrees C for one hour and was stopped by adding 130ul of Sodium Carbonate buffer pH10.5. A standard curve of rhGAA (R&D Systems, Cat. No 8329-GH) Standards, 2,000 ng/mL to 25 ng/mL was used.
  • Glycogen content of tissues was measured indirectly as the glucose released after total digestion by amyloglucosidase of the tissue homogenates using the Aspergillus niger assay system and the glucose reagent (Infinity Glucose; TRI 5421, Thermo Scientific, VA, USA) in a standardized reaction using the Aspergillus niger assay system.
  • the same tissue homogenates used above were used to measure total glycogen content in each tissue.
  • the reaction was set up with 20ul of supernatant and 55ul distilled water. Samples were boiled for 3 min and immediately cooled on ice for 10 min.
  • M3 construct was similarly unable to increase GAA levels and activity in target tissues, such as the heart, diaphragm, quadriceps muscle and liver, following administration as compared to Actus 101 (see, e.g., FIGs 3A-4D).
  • the data presented herein in this Example indicates that the M3 construct fails to perform better than Actus 101 with regards to increasing GAA protein levels and activity that can be sustained over a long period of time (e.g., more than 4 weeks) and that was capable of inducing glycogen clearance in the cell.
  • pP110 exhibited a superior ability to promote glycogen clearance from the heart as compared to Actus 101 and pP113 — a marked reduction of glyocen levels are observed in the heart following administration of pP110. A greater reduction of glycogen was observed when the pP110 was administered at a dose of 3E11 as compared to an administration of 3E10, confirming that this effect is dosage dependent.
  • Study Objective The primary objective of this study presented herein in this example is to evaluate a series of gene therapy vector variants for tissue biodistribution and expression of human acid glucosidase alpha (GAA) in a mouse model of Pompe Disease.
  • GAA human acid glucosidase alpha
  • ACTUS-101 (AAV2/8-LSPhGAA) is an infectious non-replicating recombinant adeno-associated viral vector (AAV) serotype 8, pseudotyped with AAV2 inverted terminal repeats (ITR), expressing human GAA under the control of a liver specific promoter (LSP).
  • AAV adeno-associated viral vector
  • ITR inverted terminal repeats
  • LSP liver specific promoter
  • the GAA has an amino acid composition that is the same as in the FDA approved Enzyme Replacement Therapy Myozyme/Lumizyme for the treatment of Pompe Disease
  • M4 Modification 4 vector to ACTUS-101.
  • the specific elements that were removed include all Cytosine-phosphate-Guanine (CpG) dinucleotides found within the protein coding sequence, and a remnant fragment of the AAV P5 promoter located upstream of the LSP promoter.
  • M4 also includes an RNA polymerase II termination sequence between the poly(A) signal and the 3 ’ITR to prevent the potential formation of the double stranded RNA.
  • An additional change includes the use of synthetic doggy bone DNA (dbDNATM) as a starting material for the manufacturing of the gene therapy vector, eliminating the bacterial backbone and thus minimizing the ability of the product to trigger Toll-like receptor 9 (TLR9) responses.
  • dbDNATM doggy bone DNA
  • the M4 vector in this study uses the same AAV8 capsid as in ACTUS-101 and is made using the doggy bone precursor plasmid (dbp).
  • Tissue preservation Fresh tissue and sera specimens were immediately frozen and stored at -80°C until use for molecular biology analyses.
  • Tissues were homogenized in T-PER buffer (ThermoFisher 78510) with Halt Protease Inhibitor Cocktail (Thermo 78430) in TissueLyser and protein was quantified by BCA assay.
  • Membranes were imaged on iBright imager (FL15000) using the Ponceau S setting and destained using 0.1M NaOH for 30 sec followed by rinsing the membrane with water for 2-3 minutes. Blocking was done in Superblock (TBS) blocking solution (ThermoFisher 37536) for 1 hour at room temperature. Acid-a-glucosidase (GAA) protein detection was obtained after incubation overnight at 4°C with a rabbit anti-GAA antibody (AbCam 137068) diluted 1:8000 in PBS 0.05% tween 20, followed by a goat anti-rabbit HRP conjugated antibody (Abeam ab205718) diluted 1:10000.
  • TBS Superblock
  • Acid-a-glucosidase (GAA) protein detection was obtained after incubation overnight at 4°C with a rabbit anti-GAA antibody (AbCam 137068) diluted 1:8000 in PBS 0.05% tween 20, followed by a goat anti-rabbit HRP conjugated antibody (
  • the HRP enzyme activity was detected by Clarity Enhanced Chemiluminescence (ECL) Western Blotting Substrate (BioRad 1705061).
  • ECL Clarity Enhanced Chemiluminescence
  • BioRad 1705061 Clarity Enhanced Chemiluminescence
  • the images were acquired by iBright imaging system, densitometry was performed on iBright software v. 4.0.1 and results were expressed as relative calculation (ratio) of the intensity of GAA antibody detected band per total protein by Ponceau S staining.
  • rhGAA was run as a standard curve for absolute quantification.
  • the images were acquired by the image analyzer iBright imaging system, densitometry was performed on iBright software v. 4.0.1 and results were given by relative calculation (ratio) of the intensity of GAA antibody detected band per total protein by Ponceau S staining.
  • GAA activity measurement in tissues GAA activity was measured on frozen tissues following homogenization and sonication of tissue samples in distilled water. Depending upon the tissue size, 10-50 mg tissue was weighed and homogenized, the homogenates were sonicated at 4 degree C 3 times for 15 seconds, then centrifuged for 3 min at 15000 RPM. For serum GAA, 10 ul was analyzed, with or without 80 ⁇ M acarbose. The reaction was set up with lOul of supernatant and 20 ul of substrate - 4MUa-D-glucoside, in a 96 wells plate (VWR62402-970).
  • the reaction mixture was incubated at 37 degrees C for one hour and was stopped by adding 130ul of Sodium Carbonate buffer pH 10.5.
  • a standard curve (0- 1000 pmol/ ul of 4MU) was used to measure released fluorescent 4MU from individual reaction mixture, using TECAN GENios microplate reader at 465 nm (Emission) and 360 nm (excitation).
  • the protein concentrations of the clarified supernatants were quantified via the Bradford assay (Bio-Rad Laboratories, Cat No. 500-0006).
  • GAA activity was measured in the tissue homogenates by conversion of the artificial substrate 4-methylumbelliferyl (4- MU) a-D-glucoside to the fluorescent product umbelliferone at acidic pH 4.3 as described [1]. To calculate the GAA activity, released 4MU concentration was divided by the sample protein concentration and activity was reported as nmol/hour/mg protein. QA and QC samples were run on the same plate for experimental assay controls.
  • GAA activity measurement in serum Fresh blood samples obtained from submandibular bleed were centrifuged and serum collected. 10 ul of serum was treated 2ul of 800 aca ⁇ rMbose. The reaction was set up with lOul of supernatant and 20 ul of substrate - 4MUa-D-glucoside, in a 96 wells plate (VWR62402-970). The reaction mixture was incubated at 37 degrees C for one hour and was stopped by adding 130ul of Sodium Carbonate buffer pH10.5. A standard curve of rhGAA (R&D Systems, Cat. No 8329-GH) Standards, 2,000 ng/mL to 25 ng/mL was used.
  • GAA activity measurement in serum- alternative method GAA, 10 ul was analyzed, with or without 80 ⁇ M acarbose. The reaction was set up with lOul of supernatant and 20 ul of substrate - 4MUa-D-glucoside, in a 96 wells plate (VWR62402-970). The reaction mixture was incubated at 37 degrees C for one hour and was stopped by adding 130ul of Sodium Carbonate buffer pH10.5. A standard curve (0- 1000 pmol/ ul of 4MU) was used to measure released fluorescent 4MU from individual reaction mixture, using TECAN GENios microplate reader at 465 nm (Emission) and 360 nm (excitation).
  • the protein concentrations of the clarified supernatants were quantified via the Bradford assay (Bio-Rad Laboratories, Cat No. 500-0006).
  • GAA activity was measured in the tissue homogenates by conversion of the artificial substrate 4-methylumbelliferyl (4-MU) a-D- glucoside to the fluorescent product umbelliferone at acidic pH 4.3 as described [1].
  • 4MU concentration was divided by the sample protein concentration and activity was reported as nmol/hour/mg protein.
  • a QA and QC samples were run on the same plate for experimental assay controls.
  • Glycogen content of tissues was measured indirectly as the glucose released after total digestion by amyloglucosidase of the tissue homogenates using the Aspergillus niger assay system and the glucose reagent (Infinity Glucose; TRI 5421, Thermo Scientific, VA, USA) in a standardized reaction using the Aspergillus niger assay system.
  • the same tissue homogenates used above were used to measure total glycogen content in each tissue.
  • the reaction was set up with 20ul of supernatant and 55ul distilled water. Samples were boiled for 3 min and immediately cooled on ice for 10 min.
  • M4 constructs having different codon-optimized GAA sequences have been developed and tested for their ability to induce superior levels of GAA protein and activity, as well as their ability to promote glycogen clearance in the cell.
  • M4 constructs i.e., Seql2 (SEQ ID NO: 30), Seq99 (SEQ ID NO: 29), Seq3 (SEQ ID NO:28), and SeqlOO (SEQ ID NO: 27), which comprise codon optimized nucleic acid sequences: SEQ ID NO:7 (Seql2), SEQ ID NO: 13, (Seq99), SEQ ID NO: 3 (SeqlOO) and SEQ ID NO: 4 (Seq3), respectively, which encode a GAA polypeptide of SEQ ID NO: 1, were selected for further study, as being identified as being best in class, and data provided herein this example shows the comparison of these constructs.
  • GAA protein levels and activity, as well as glycogen clearance from the cell was assessed. As shown in Fig. 25, GAA protein levels were markedly higher than Actus or other M4 constructs 21 days post administration in the liver, heart and diaphragm. Increased GAA activity levels were similarly observed in the liver, heart and diaphragm in SeqlOO-administered mice as compared to Actus or other M4 constructs 21 days post administration (see, e.g., FIG 26A).
  • SeqlOO comprising codon optimized nucleic acid sequence of SEQ ID NO: 3
  • target tissues e.g., liver, heart, and diaphragm
  • the M4 variants p065 and p072 showed a greater reduction in glyocogen present in the heart as compared to M4 following administration. This result was found to be dosage dependent; a greater reduction in glyocogen in the heart was observed at a dose of 3E11 as compared to 3E10 for both p065 and p072.
  • Example 5 Constructs encoding a GAA-signal peptide, a heterologous signal peptide, and a GAA polypeptide
  • SEQ ID NO: 463 and 464 are exemplary plasmids (pPl 12 and pP113, respectively) where pPl 12 , (see, e.g., Fig.
  • plasmid 29 is a plasmid comprising in the 5’ to 3’ direction: [ITR]-LSP-[l-27aa GAA-SP]-[2011p]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA]-ITR2, and pP113 (see, e.g., Fig. 29) is a plasmid comprising in a 5’ to 3’ direction: [ITR]-LSP-[l-24aa GAA-SP]-met-[2011p]-[ GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA]-ITR2.
  • nucleic acid encoding the N- terminal truncated GAA polypeptide in pPl 12 and pP113 can be readily substituted for any nucleic acid sequence encoding a GAA polypeptide, including codon optimized nucleic acid sequences: SEQ ID NO:7 (Seql2), SEQ ID NO: 13, (Seq99), SEQ ID NO: 3 (SeqlOO) and SEQ ID NO: 4 (Seq3), as well as 5’ deletions thereof, such that the nucleic acid sequences encode for a N-terminal truncated GAA polypeptide beginning at amino acid residues selected from any of: 28, 35, 40, 50, 57, 57, 68, 69, 70, 72, 74, 89, 779, 790, 791, 792, 793 or 796.
  • the 2011p (having an amino acid sequence of: MEFGLSWVFLVALLKGVQCE (SEQ ID NO: 60) encoded by nucleic acid sequence SEQ ID NO: 54) is an exemplary heterologous signal peptide included in plasmids pPl 12 and pP113, and can be readily substituted for other heterologous leader peptide disclosed herein, e.g., any of: wtIL2 Ip: MYRMQLLSCIALSLALVTNS (SEQ ID NO: 61) encoded by nucleic acid sequence SEQ ID NO: 55, or mutIL2 Ip: MYRMQLLLL/ALSLALVTNS (SEQ ID NO: 62) encoded by nucleic acid sequence SEQ ID NO: 56, A2M signal peptide MGKNKLLHPSLVLLLLVLLPTDA (SEQ ID NO: 63) encoded by nucleic acid sequence SEQ ID NO: 57, PZP signal peptide MRKDRLLHLCLVLL
  • rAAV vectors were generated using the ProlO cell production system, e.g., as described in US patent 9,441,206, the contents of which are incorporated herein by reference in its entirety.
  • the constructs were packaged in the AAV8 viral capsid and tittered by digital droplet PCR (ddPCR) method using primers directed at vector ITRs. All assays and analysis were performed as described herein in Example 3.
  • ddPCR digital droplet PCR
  • pPl 12 and pP113 were used to generate infectious non- replicating recombinant adeno-associated viral vector (AAV) serotype 8, pseudotyped with AAV2 inverted terminal repeats (ITR), expressing human GAA under the control of a liver specific promoter (LSP), where there is a GAA-signal peptide (or 1-24 amino acid portion of the GAA-signal peptide and a heterologous 20 lip signal peptide to promote expression of the GAA polypeptide, and where the GAA polypeptide is a N-terminal truncated protein beginning at amino acid 57 of SEQ ID NO: 1.
  • AAV adeno-associated viral vector
  • ITR AAV2 inverted terminal repeats
  • LSP liver specific promoter
  • mice Male GAA knock-out mice were injected with the generated AAV via a tail vein injection; 5 male mice were included in each group (i.e., control (saline), pPl 12, pP113). AAV was administered at a dose of IxlO 6 in a total volume of 150ul. Weekly bleeds were performed on the mice for 4 weeks. Each mouse was then sacrificed at 4 weeks, and serum and target tissue was removed for anaylsis. [00617] Expression of GAA in serum was assessed 4 weeks post administration of rAAV generated from pPl 12 and pP113 plasmids. After 4 weeks, the animals were sacrificed and tissue was harvested.
  • rAAV encoding GAA polypeptide comprising both a N-terminal endogenous GAA signal peptide or a fragment thereof, and a heterologous 20 lip signal peptide promoted GAA expression in the serum ( Figures 30 and 31), and increased GAA activity in the serum and target tissues (e.g., heart) ( Figures 32 and 33).
  • a reduction of glycogen levels in the heart as compared a rAAV encoding a GAA polypeptide comprising only a N-terminal heterologous signal peptide was also observed (Figure 34).
  • a reduction in GAA retention in the liver was noted 4 weeks following administration of the rAAV ( Figures 35A and 35B).
  • Example 6 Constructs encoding a GAA-signal peptide, a heterologous signal peptide, and a GAA polypeptide
  • pPl 12 and pP113 are used to generate infectious non-replicating recombinant adeno- associated viral vector (AAV) serotype 8, pseudotyped with AAV2 inverted terminal repeats (ITR), expressing human GAA under the control of a liver specific promoter (LSP), where there is a GAA- signal peptide (or 1-24 amino acid portion of the GAA-signal peptide and a heterologous 20 lip signal peptide to promote expression of the GAA polypeptide, and where the GAA polypeptide is a N- terminal truncated protein beginning at amino acid 57 of SEQ ID NO: 1, as described in Example 5.
  • AAV infectious non-replicating recombinant adeno- associated viral vector
  • ITR AAV2 inverted terminal repeats
  • LSP liver specific promoter
  • mice Male GAA knock-out mice are injected with the generated AAV via a tail vein injection; 5 male mice are included in each group (i.e., control (saline), pP112, pP113), as described in Example 5.
  • AAV is administered at a dose of IxlO 6 in a total volume of 150ul. Weekly bleeds are performed on the mice for 12 weeks. Each mouse is then sacrificed at 12 weeks, and serum and target tissue is removed for anaylsis.
  • GAA expression in serum is assessed 12-weeks after administration of rAAV generated from pPl 12 and pP113 plasmids. After 12 weeks, the animals are sacrificed and tissue harvested, and GAA expression in sera over time by western blotting and semi-quantitative densitometry is assessed, as well as GAA uptake by target organs (heart, diaphragm) by western blotting and semi-quantitative densitometry.
  • GAA enzymatic activity in sera over time is assessed by 4MU assay; and GAA enzymatic activity in liver is assessed by 4MU assay; GAA uptake by select tissues (heart, diaphragm) is assessed by 4MU assays; glycogen content in select tissues (heart, diaphragm) is also assessed, as described in Example 3.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2023/015531 2022-03-18 2023-03-17 Therapeutic adeno-associated virus using codon optimized nucleic acid encoding alpha-glucosidase (gaa) for treating pompe disease, with signal peptide modifications Ceased WO2023177885A2 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
EP23771464.7A EP4493704A2 (en) 2022-03-18 2023-03-17 Therapeutic adeno-associated virus using codon optimized nucleic acid encoding alpha-glucosidase (gaa) for treating pompe disease, with signal peptide modifications
CA3254578A CA3254578A1 (en) 2022-03-18 2023-03-17 Adeno-associated virus therapy involving an alpha-glucosidase (GAA) codon-optimized nucleic acid to treat Pompe disease, with signal peptide modifications
AU2023235203A AU2023235203A1 (en) 2022-03-18 2023-03-17 Therapeutic adeno-associated virus using codon optimized nucleic acid encoding alpha-glucosidase (gaa) for treating pompe disease, with signal peptide modifications
KR1020247032558A KR20250005569A (ko) 2022-03-18 2023-03-17 신호 펩타이드 변형을 갖는, 폼페병을 치료하기 위한 코돈 최적화된 알파-글루코시다제(gaa) 암호화 핵산을 사용하는 치료적 아데노-연관 바이러스
US18/848,389 US20250213726A1 (en) 2022-03-18 2023-03-17 Therapeutic adeno-associated virus using codon optimized nucleic acid encoding alpha-glucosidase (gaa) for treating pompe disease, with signal peptide modifications
IL315711A IL315711A (en) 2022-03-18 2023-03-17 Therapeutic adeno-associated virus using codon optimized nucleic acid encoding alpha-glucosidase (gaa) for treating pompe disease, with signal peptide modifications
JP2024555349A JP2025510017A (ja) 2022-03-18 2023-03-17 シグナルペプチド改変を有する、ポンペ病を処置するためのアルファ-グルコシダーゼ(gaa)をコードするコドン最適化核酸を使用する治療用アデノ随伴ウイルス
CN202380041220.6A CN119213137A (zh) 2022-03-18 2023-03-17 具有信号肽修饰的、使用编码α-葡萄糖苷酶(GAA)的经密码子优化的核酸治疗庞贝氏病的治疗性腺相关病毒
MX2024011396A MX2024011396A (es) 2022-03-18 2024-09-17 Virus asociados a adeno terapéuticos usando ácido nucléico optimizado en su codón que codifica alfa-glucosidasa (gaa) para tratar la enfermedad de pompe con modificaciones de péptido de señal

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US202263321336P 2022-03-18 2022-03-18
US63/321,336 2022-03-18
US202263348862P 2022-06-03 2022-06-03
US63/348,862 2022-06-03
US202363444804P 2023-02-10 2023-02-10
US63/444,804 2023-02-10

Publications (2)

Publication Number Publication Date
WO2023177885A2 true WO2023177885A2 (en) 2023-09-21
WO2023177885A3 WO2023177885A3 (en) 2023-10-26

Family

ID=88024211

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/015531 Ceased WO2023177885A2 (en) 2022-03-18 2023-03-17 Therapeutic adeno-associated virus using codon optimized nucleic acid encoding alpha-glucosidase (gaa) for treating pompe disease, with signal peptide modifications

Country Status (11)

Country Link
US (1) US20250213726A1 (https=)
EP (1) EP4493704A2 (https=)
JP (1) JP2025510017A (https=)
KR (1) KR20250005569A (https=)
CN (1) CN119213137A (https=)
AU (1) AU2023235203A1 (https=)
CA (1) CA3254578A1 (https=)
IL (1) IL315711A (https=)
MX (1) MX2024011396A (https=)
TW (1) TW202403048A (https=)
WO (1) WO2023177885A2 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4482516A4 (en) * 2022-02-25 2026-03-25 Askbio Inc Adeno-associated virus therapy for the treatment of Pompe disease with long-term cessation of GAA enzymatic replacement therapy

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE521701T1 (de) * 2003-01-22 2011-09-15 Univ Duke Verbesserte konstrukte zur expression lysosomaler polypeptide
EP3293259A1 (en) * 2016-09-12 2018-03-14 Genethon Acid-alpha glucosidase variants and uses thereof
WO2020102667A2 (en) * 2018-11-16 2020-05-22 Asklepios Biopharmaceutical, Inc. Vectors comprising a nucleic acid encoding lysosomal enzymes fused to a lysosomal targeting sequence
CA3159018A1 (en) * 2019-11-19 2021-05-27 Michael W. O'CALLAGHAN Therapeutic adeno-associated virus comprising liver-specific promoters for treating pompe disease and lysosomal disorders

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4482516A4 (en) * 2022-02-25 2026-03-25 Askbio Inc Adeno-associated virus therapy for the treatment of Pompe disease with long-term cessation of GAA enzymatic replacement therapy

Also Published As

Publication number Publication date
US20250213726A1 (en) 2025-07-03
IL315711A (en) 2024-11-01
MX2024011396A (es) 2024-11-08
JP2025510017A (ja) 2025-04-14
CA3254578A1 (en) 2023-09-21
TW202403048A (zh) 2024-01-16
AU2023235203A1 (en) 2024-10-31
KR20250005569A (ko) 2025-01-09
EP4493704A2 (en) 2025-01-22
CN119213137A (zh) 2024-12-27
WO2023177885A3 (en) 2023-10-26

Similar Documents

Publication Publication Date Title
AU2019375975B2 (en) Artificial expression constructs for selectively modulating gene expression in excitatory cortical neurons
AU774643B2 (en) Compositions and methods for use in recombinational cloning of nucleic acids
KR20210149060A (ko) Tn7-유사 트랜스포존을 사용한 rna-유도된 dna 통합
KR102863181B1 (ko) 윌슨병을 치료하기 위한 유전자 치료
AU2021204620A1 (en) Central nervous system targeting polynucleotides
AU2016232146B2 (en) Optimized liver-specific expression systems for FVIII and FIX
AU2019257708B2 (en) Expression of human FOXP3 in gene edited T cells
AU2016343979A1 (en) Delivery of central nervous system targeting polynucleotides
KR20210151916A (ko) 뒤시엔느 근육 이영양증의 치료를 위한 aav 벡터-매개된 큰 돌연변이 핫스팟의 결실
KR20200064129A (ko) 트랜스제닉 선택 방법 및 조성물
KR20220130093A (ko) 오토펄린 듀얼 벡터 시스템을 사용한 감각신경성 난청을 치료하기 위한 조성물 및 방법
KR102628872B1 (ko) 세포의 증식을 제어하기 위해 세포 분열 좌위를 사용하기 위한 도구 및 방법
BRPI0806354A2 (pt) plantas oleaginosas transgências, sementes, óleos, produtos alimentìcios ou análogos a alimento, produtos alimentìcios medicinais ou análogos alimentìcios medicinais, produtos farmacêuticos, bebidas fórmulas para bebês, suplementos nutricionais, rações para animais domésticos, alimentos para aquacultura, rações animais, produtos de sementes inteiras, produtos de óleos misturados, produtos, subprodutos e subprodutos parcialmente processados
KR20210151785A (ko) 비바이러스성 dna 벡터 및 fviii 치료제 발현을 위한 이의 용도
CN111733174B (zh) 一种分离的核酸分子及其用途
KR20240004253A (ko) 오토펄린 듀얼 벡터 시스템을 사용한 감각신경성 난청을 치료하기 위한 방법
KR20200116084A (ko) 발효 공정
CN113260704B (zh) CYP4V2和RdCVF在制备药物中的用途
AU2023412590A1 (en) Fusion and use thereof
US20250213726A1 (en) Therapeutic adeno-associated virus using codon optimized nucleic acid encoding alpha-glucosidase (gaa) for treating pompe disease, with signal peptide modifications
AU2023328197A1 (en) Crispr-cas13 system and use thereof
AU2018326582B2 (en) Retinal promoter and uses thereof
RU2812852C2 (ru) Невирусные днк-векторы и варианты их применения для экспрессии терапевтического средства на основе фактора viii (fviii)
NL2027815B1 (en) Genomic integration
TW202603176A (zh) 以密碼子最佳化核酸編碼lamp2b的治療性腺相關病毒

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23771464

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: MX/A/2024/011396

Country of ref document: MX

Ref document number: 315711

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 18848389

Country of ref document: US

Ref document number: 2024555349

Country of ref document: JP

Ref document number: 12024552214

Country of ref document: PH

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112024019188

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 815585

Country of ref document: NZ

Ref document number: AU2023235203

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2023771464

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2023771464

Country of ref document: EP

Effective date: 20241018

WWE Wipo information: entry into national phase

Ref document number: 11202406504R

Country of ref document: SG

ENP Entry into the national phase

Ref document number: 2023235203

Country of ref document: AU

Date of ref document: 20230317

Kind code of ref document: A

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23771464

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 202380041220.6

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 112024019188

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20240918

WWP Wipo information: published in national office

Ref document number: 202380041220.6

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 18848389

Country of ref document: US