WO2023177188A1 - Cosmetic composition having anti-inflammatory and barrier effects, comprising fresh centella asiatica extract obtained through diffusion-based sugar extraction, and use thereof - Google Patents

Abstract

Provided are: a method for preparing a Centella asiatica extract by using diffusion-based sugar extraction; a Centella asiatica extract prepared by the method; and use of the Centella asiatica extract for anti-inflammation, skin moisturization or skin barrier strengthening. The method is eco-friendly and has high active substance extraction efficiency. The Centella asiatica extract extracted by the method has excellent skin functionality, and thus can be applied as a cosmetic composition, a pharmaceutical composition, a health functional food composition, and the like.

Description

Cosmetic composition with anti-inflammatory and barrier effects containing fresh Centella asiatica extract extracted by sugar diffusion extraction method and use thereof

This application claims priority to Republic of Korea Patent Application No. 10-2022-0031496, filed on March 14, 2022, and the entire specification is a reference to this application.

It relates to a cosmetic composition containing centella asiatica extract extracted by sugar diffusion extraction method and its anti-inflammatory, skin moisturizing and skin barrier strengthening uses.

Centella Asiatica contains ingredients useful for the skin, and is widely used in the cosmetics field in the form of centella asiatica oil and centella asiatica extract. In order to develop Centella asiatica extract as a cosmetic raw material, research using various extraction solvents or extraction methods is in progress.

Methods widely used to extract natural products include hot water extraction, which uses hot water to elute the active ingredients contained in natural products; solvent extraction, which uses solvents such as alcohol to dissolve and separate active ingredients from solid or liquid samples; There is a supercritical extraction method that extracts using critical fluid. For example, KR Patent Publication No. 10-2021-0000522 discloses a method of producing Centella asiatica extract by mixing pulverized Centella asiatica with methanol solvent and then subjecting it to ultrasonic extraction. However, the above existing methods have low yields, the bioactive ingredients are destroyed or denatured when high-temperature heat is applied to natural products, or the organic solvent remaining after extraction does not provide a level of safety suitable for use in human cosmetics. There are various problems such as not being able to meet the requirements.

In addition, since the extraction yield and content of biologically active ingredients of natural extracts vary greatly depending on the plant that is the raw material, even if the extraction method has been confirmed to be effective for a specific plant, it will have the same or similar level of effect for other plants. In most cases, it cannot be displayed.

Therefore, there is an emerging need for an eco-friendly method that does not use organic solvents while having a high content of active ingredients when producing Centella asiatica extract.

Accordingly, the present inventors have developed a method for producing Centella asiatica extract that can increase the extraction efficiency of active substances without using chemical processes or organic solvents, and the excellent anti-inflammatory, skin moisturizing and skin barrier properties of Centella asiatica extract using this extraction method have been developed. The present invention was completed by confirming the use of reinforcement.

One aspect provides a method for producing a Centella asiatica extract using a sugar diffusion extraction method.

Another aspect provides a Centella asiatica extract prepared by the above method.

Another aspect provides the use of the Centella asiatica extract.

Another aspect provides a composition comprising the Centella asiatica extract.

Another aspect provides a method of preventing, ameliorating, or treating a condition in a subject comprising treating or administering an effective amount of the composition described above to the subject in need thereof.

One aspect provides a method for producing a Centella asiatica extract using a sugar diffusion extraction method.

The “sugar diffusion extraction method” refers to a diffusion-based extraction method using sugar. The term “diffusion” refers to the phenomenon in which particles constituting a material move from a side of high density or concentration to a side of low density due to a difference in density or concentration. The term “osmotic pressure” refers to the pressure created when water moves from a lower concentration area to a higher concentration area through osmosis. When natural products (e.g. plants) and high concentration of sugar are mixed, the natural products are eluted together to the outside due to osmotic pressure. Therefore, in this specification, the “sugar diffusion extraction method” is interchangeable with “diffusion-based extraction method using sugar,” “osmotic pressure extraction method using sugar,” or “osmotic pressure-based extraction method using sugar.” can be used

The sugar diffusion extraction method is an environmentally friendly extraction method that does not use chemical processes or organic solvents. In addition, the sugar diffusion extraction method can increase the extraction efficiency of active substances compared to the existing hot water extraction method and ultrasonic extraction method.

The method includes the step of mixing Centella asiatica and sugar to spread and extract Centella asiatica.

The centella asiatica is not limited to a specific part, and for example, whole plants, leaves, stems, roots, etc. can be used. The Centella asiatica is not limited to a specific form, but it is preferable to use fresh Centella asiatica or its finely cut products. Dried Centella asiatica has a low moisture content, so it may not be suitable for applying the above method.

The “sugar” refers to a substance with a sweet taste and can be classified into monosaccharides, disaccharides made of two monosaccharides, and oligosaccharides made of about 3 to 10 monosaccharides. The sugar suitable for applying the diffusion extraction method can be used.

In one embodiment, the sugar may be an oligosaccharide. The oligosaccharides exist in the form of glycans, linked to amino acid side chains of fats or proteins, and are generally found in two forms: N-linked oligosaccharides or O-linked oligosaccharides.

In one embodiment, the sugar is fructo-oligosaccharide (FOS), isomalto-oligosaccharide (IMO), malto-oligosaccharide (IMO), galacto-oligosaccharide It may be Galacto-oligosaccharide (GOS), Alpha-Glucan Oligosaccharide, Inulin, Dextran, Levan, or a combination thereof, but is not limited thereto.

In one embodiment, the sugar may be fructooligosaccharide. The fructo-oligosaccharide is an oligosaccharide in which 1 to 3 fructose is bonded to sucrose, and is typically 1-ketose, 1-ketose, and 1-fructosilnis. There is 1-fructosylnistose. Fructooligosaccharide is a sugar that is not digested by the digestive enzymes of animals and is not used by caries bacteria. When ingested, it proliferates bifidobacteria, an intestinal bacterium, in the lower intestine and exhibits various physiological effects, including intestinal function. Therefore, fructooligosaccharides are also used as functional ingredients in prebiotic foods.

The concentration of the sugar may be high. The 'high concentration' refers to a concentration high enough to apply the sugar diffusion extraction method. Therefore, the concentration may be higher than the intracellular concentration of centella asiatica. Specifically, the concentration is 10% (w/w) or more, specifically 10 to 90% (w/w), 10 to 80% (w/w), 10 to 70% (w/w), 10 to 60% % (w/w), 10 to 50% (w/w), 20 to 90% (w/w), 20 to 80% (w/w), 20 to 70% (w/w), 20 to 60 % (w/w), 20 to 50% (w/w), 30 to 90% (w/w), 30 to 80% (w/w), 30 to 70% (w/w), 30 to 60 % (w/w), or 30 to 50% (w/w), but is not limited thereto.

The osmotic pressure during the diffusion extraction is 0.0129 kgf/cm ² to 1.166 kgf/cm ² , 0.02 kgf/cm ² to 1.0 kgf/cm ² , 0.1 kgf/cm ² to 1.0 kgf/cm ² according to Van't Hoff's formula, for example. For example, it could be 0.5 kgf/ ^cm2 .

The 'mixing' of Centella asiatica and sugar is not limited to a specific method, but may be, for example, a simple mixing.

The term “diffusion extraction” may be used interchangeably with “osmotic extraction”. By the diffusion extraction, substances inside Centella asiatica, for example, water-soluble substances, oil-soluble substances, or a combination thereof, may be eluted to the outside.

The term “extract” includes all substances obtained by extracting components of natural products, and also includes substances that can be obtained by extracting components of natural products and then processing or processing them in other ways. For example, the processing or treatment may include dilution, concentration, drying, purification, fractionation, filtration, fermentation, enzyme treatment, etc. The processing or processing can be performed by conventional methods. Therefore, the extract may include an extract, a diluted or concentrated solution of the extract, a dried product obtained by drying the extract, or a crude or purified product thereof, or a fraction thereof.

The method may further include filtering the diffusion-extracted Centella asiatica extract. Therefore, the Centella asiatica extract may be a filtrate of Centella asiatica extract.

The extraction may be performed under extraction conditions for diffusing and extracting the components of Centella asiatica. The extraction conditions refer to extraction time, extraction temperature, etc. The extraction time is 30 minutes to 24 hours, 30 minutes to 20 hours, 30 minutes to 10 hours, 30 minutes to 5 hours, 30 minutes to 3 hours, 30 minutes to 2 hours, 1 hour to 24 hours, 1 hour to 20 hours. time, 1 hour to 10 hours, 1 hour to 5 hours, 1 hour to 3 hours, 1 hour to 2 hours, 2 hours to 24 hours, 2 hours to 20 hours, 2 hours to 10 hours, 2 hours to 5 hours, Alternatively, it may be 2 to 3 hours, but can be appropriately selected depending on other conditions such as sugar concentration and extraction temperature. If the extraction time is less than 30 minutes, the active ingredient may not be sufficiently extracted.

The extraction temperature may be 10 to 100°C, 10 to 80°C, 10 to 60°C, 10 to 40°C, 20 to 100°C, 20 to 80°C, 20 to 60°C, 20 to 40°C, or room temperature. It can be appropriately selected depending on other conditions such as sugar concentration and extraction time.

Another aspect provides a Centella asiatica extract prepared by a method for producing a Centella asiatica extract using a sugar diffusion extraction method according to one aspect.

Centella asiatica extract prepared by the above method can be harmless to the human body using an environmentally friendly method. Therefore, the Centella asiatica extract can be safe to use as a raw material for cosmetics, drugs, and food.

In addition, the Centella asiatica extract prepared by the above method may have superior anti-inflammatory, skin moisturizing, and skin barrier strengthening effects compared to the Centella asiatica extract prepared by the existing extraction method.

In one embodiment, compared to Centella asiatica hot water extract (Comparative Example 1), a simple mixture of Centella asiatica hot water extract and sugar (Comparative Example 2), and sugar alone (Comparative Example 3), the raw Centella asiatica extract extracted by the sugar diffusion extraction method (implemented Example 1) has excellent anti-inflammatory effects by significantly inhibiting the expression of IL-1α, and has excellent skin moisturizing and skin barrier strengthening effects by significantly increasing the expression of hyaluronic acid synthase (HAS3) and filaggrin (FLG) genes. Confirmed (Experimental Examples 1 and 2).

Another aspect provides use of a Centella asiatica extract according to one aspect. In detail, a composition comprising a centella asiatica extract according to one aspect is provided.

Uses of the extract may include improving skin condition, preventing or treating skin diseases.

The skin condition improvement may be one or more of anti-inflammatory, skin moisturizing, and skin barrier strengthening.

Accordingly, the composition is an anti-inflammatory composition; Alternatively, it may be a composition for moisturizing the skin or strengthening the skin barrier.

The extract inhibits or reduces the expression of inflammatory cytokines (eg, IL-1α); It may increase the expression of genes related to skin moisturization and skin barrier (e.g. HAS3, filaggrin).

The term “anti-inflammatory” can be used interchangeably with “improvement of inflammation” and “inhibition of inflammation,” and can refer to any action that alleviates the immune response and suppresses NO production.

The term “skin disease” may be a skin inflammatory disease, or a disease caused by impaired skin barrier function.

The damage to the skin barrier function may mean any change that appears in the skin due to decreased or damaged skin barrier function. For example, it may include dryness, dermatitis, atopic dermatitis, allergic dermatitis, acne, etc.

The skin inflammatory disease may be any one selected from the group consisting of skin wounds, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, erythema, urticaria, psoriasis, drug rash, and acne.

The term “prevention” includes suppressing the occurrence of a disease.

The term “treatment” includes inhibiting, alleviating, or eliminating the development of a disease.

The term “skin moisturizing” can refer to any action that maintains skin moisture or prevents moisture loss.

The term “skin barrier strengthening” can refer to any action that improves the function of the skin barrier, which is located on the outermost layer of the skin and prevents moisture and nutrition loss.

In one embodiment, the extract can reduce or inhibit the expression of IL-1α. Therefore, the composition may exhibit anti-inflammatory effects, such as improving skin inflammation and preventing or treating skin inflammatory diseases, by reducing or inhibiting the expression of IL-1α.

In one embodiment, the extract may increase the expression of one or more of Hyaluronan synthase 3 (HAS3) and Filaggrin. Therefore, the composition may exhibit skin moisturizing and skin barrier strengthening effects by increasing the expression of one or more of HAS3 and filaggrin.

The composition is 0.001% to 80% by weight, for example, 0.01% to 60% by weight, 0.01% to 50% by weight, 0.01% to 40% by weight, 0.01% to 30% by weight, based on the total weight of the composition. %, 0.01% to 20% by weight, 0.01% to 10% by weight, 0.01% to 5% by weight, 0.05% to 60% by weight, 0.05% to 50% by weight, 0.05% to 40% by weight, 0.05% to 30% by weight, 0.05% to 20% by weight, 0.05% to 10% by weight, 0.05% to 5% by weight, 0.1% to 60% by weight, 0.1% to 50% by weight, 0.1% by weight % to 40% by weight, 0.1% to 30% by weight, 0.1% to 20% by weight, 0.1% to 10% by weight, 0.1% to 5% by weight, 1% to 50% by weight, 1% to 1% by weight. 40% by weight, 1% to 30% by weight, 1% to 20% by weight, 1% to 10% by weight, 10% to 50% by weight, 10% to 40% by weight, 10% to 30% by weight %, or 10% to 20% by weight of extract.

The composition may include the extract as an active ingredient.

The term "included as an active ingredient" means that the extract of the present specification is added to an extent that can produce the effects mentioned above, and various ingredients are added as sub-ingredients for drug delivery and stabilization, etc. to formulate various forms ( It means being formulated.

The composition may be in a liquid state or a dry state. In one embodiment, the composition may be in dry powder form.

The drying method for preparing the composition in a dry state may be a method generally used in the art and is not particularly limited. Non-limiting examples of the drying method include air drying method, natural drying method, spray drying method, freeze drying method, etc. These methods can be used alone or at least two methods can be used together.

The composition may include an effective amount of additives sufficient to reduce deterioration of the extract. The additive may be, for example, a binder, but is not limited thereto.

The composition may further include a cosmetically, pharmaceutically, or foodologically acceptable carrier. The composition can be formulated with a carrier and provided as cosmetics, drugs, food additives, etc.

The composition may be a cosmetic composition.

In addition to the active ingredients disclosed in this specification, the cosmetic composition may further include ingredients commonly used in cosmetic compositions, functional additives, etc., such as antioxidants, stabilizers, solubilizers, surfactants, dispersants, preservatives, and vitamins. , conventional auxiliaries such as pigments, fragrances, etc., and carriers.

The cosmetic composition is not particularly limited to a specific formulation, and the formulation may be appropriately selected depending on the purpose. The cosmetic composition may have, for example, a solubilized formulation, an emulsified formulation, or a dispersed formulation. The cosmetic composition may have, for example, an softening lotion, a nourishing lotion, a massage cream, a nourishing cream, an essence, a pack, a gel, an ampoule, or a skin-adhesive cosmetic formulation.

The composition may be a composition for external skin application.

In this specification, the external skin agent may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal delivery patch, drug-containing bandage, lotion, or a combination thereof. The skin external preparations include ingredients commonly used in external skin preparations such as cosmetics and medicines, such as aqueous ingredients, oil-based ingredients, powder ingredients, alcohols, moisturizers, thickeners, ultraviolet absorbers, whitening agents, preservatives, antioxidants, surfactants, and fragrances. , colorants, various skin nutrients, or a combination thereof may be appropriately mixed according to need. The skin external preparations include metal sequestrants such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid; Drugs such as caffeine, tannin, bellapamil, licorice extract, glablidin, hot water extract of calin fruit, various herbal medicines, tocopherol acetate, glythylitic acid, tranexamic acid and its derivatives or salts; Vitamin C, magnesium ascorbyl phosphate, ascorbate glucoside, arbutin, kojic acid; Sugars such as glucose, fructose, and trehalose can also be appropriately mixed.

The composition may be a pharmaceutical composition.

The pharmaceutical composition may additionally include a pharmaceutically acceptable diluent or carrier. The diluent may be lactose, corn starch, soybean oil, microcrystalline cellulose, mannitol, or a combination thereof. The carrier may be an excipient, disintegrant, binder, lubricant, or a combination thereof. The excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof. The disintegrant may be calcium carboxymethylcellulose, sodium starch glycolate, calcium monohydrogen phosphate anhydride, or a combination thereof. The binder may be polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose, or a combination thereof. The lubricant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.

The pharmaceutical composition may be formulated as an oral or parenteral dosage form. Oral dosage forms may be granules, powders, solutions, tablets, capsules, dry syrup, etc. Parenteral dosage forms may be injections, ointments, etc.

The composition may be a food composition. In this case, it can be formulated in the form of a typical health functional food known in the art. Therefore, the food composition may be a health functional food composition.

The food composition may be used alone or in combination with other foods or food ingredients, and may be used appropriately according to conventional methods. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention, health, or therapeutic treatment). There are no particular restrictions on the types of health functional foods. Among the types of health functional foods, beverage compositions may contain various flavoring agents or natural carbohydrates as additional ingredients like ordinary beverages. The natural carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; and polysaccharides such as dextrins and cyclodextrins; Sugar alcohols such as xylitol, sorbitol, and erythritol. As a sweetener, natural sweeteners such as thaumatin and stevia extract or synthetic sweeteners such as saccharin and aspartame can be used. The health food composition also contains nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, and carbonated beverages. It may contain the carbonating agent used, or a combination thereof. The health functional food composition may also contain pulp for the production of natural fruit juice, fruit juice beverage, vegetable beverage, or a combination thereof.

Another aspect provides a method of preventing, ameliorating, or treating a condition in a subject comprising treating or administering an effective amount of the composition described above to the subject in need thereof.

The subject's condition may be a skin-related condition, or a condition related to skin inflammation.

The terms “administering,” “introducing,” and “implanting” are used interchangeably, and are used interchangeably, and are used interchangeably, to introduce an agent into an individual by a method or route that results in at least partial localization of the composition according to one embodiment to the desired site. It may refer to the arrangement of the composition according to the specific example.

Administration can be done by methods known in the art. Administration may be administered directly to the subject by any means, such as, for example, intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal or subcutaneous administration. You can. The administration may be administered systemically or locally.

The subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat. The subject may be an individual in need of skin improvement, for example, an individual in need of skin inflammation improvement, skin moisturization, or skin barrier strengthening effects.

The administration of the composition according to one embodiment is 0.1 mg to 1,000 mg, for example, 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1 mg per day. 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg , 5 mg to 50 mg , 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or 10 mg to 25 mg. However, the dosage may be prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, gender, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity, and those skilled in the art will Taking these factors into consideration, the dosage can be adjusted appropriately. The frequency of administration can be once a day or two or more times within the range of clinically acceptable side effects, and can be administered at one or two or more locations, daily or at intervals of 2 to 5 days. The number of days of administration can be from 1 to 30 days per treatment. If necessary, the same treatment can be repeated after an appropriate period. For animals other than humans, the dosage per kg is the same as for humans, or the above dosage is converted into, for example, the volume ratio (e.g., average value) of the organs (heart, etc.) between the target animal and human. One dose can be administered.

Redundant content is omitted in consideration of the complexity of the present specification, and terms not otherwise defined in the present specification have meanings commonly used in the technical field to which the present invention pertains.

The method of producing Centella asiatica extract using the sugar diffusion extraction method according to one aspect is an environmentally friendly method as it does not use chemical processes or organic solvents, and the extraction efficiency of active substances is high.

Centella asiatica extract according to one aspect has excellent anti-inflammatory effects, skin moisturizing and skin barrier strengthening effects, so it can be applied in various ways such as cosmetic compositions, pharmaceutical compositions, health functional food compositions, etc.

Figure 1 shows Example 1 (diffused extract of Centella asiatica), Comparative Example 1 (centella asiatica hot-water extract), Comparative Example 2 (simple mixture of Centella asiatica hot-water extract and fructooligosaccharide), and Comparative Example 3 (fructooligosaccharide alone). ) is the result of measuring the expression level of IL-1α gene, an inflammatory factor, after treating inflammation-induced fibroblasts.

Figure 2 shows Example 1 (diffused extract of Centella asiatica), Comparative Example 1 (centella asiatica hot-water extract), Comparative Example 2 (simple mixture of Centella asiatica hot-water extract and fructooligosaccharide), and Comparative Example 3 (fructooligosaccharide alone). ) is the result of measuring the expression level of HAS3, a hyaluronic acid synthesis gene, after treating fibroblasts.

Figure 3 shows Example 1 (diffusion extract of Centella asiatica), Comparative Example 1 (centella asiatica hot-water extract), Comparative Example 2 (simple mixture of Centella asiatica hot-water extract and fructooligosaccharide), and Comparative Example 3 (fructooligosaccharide alone) ) is the result of measuring the expression level of filaggrin (FLG), a skin barrier-related gene, after treating fibroblasts.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1. Preparation of sugar diffusion extract of Centella asiatica

Fructo-oligosaccharide, an oligosaccharide, was treated at high concentration in raw Byeongbap. The concentration of fructooligosaccharide can be appropriately selected from 10 to 90% (w/w), but in this example, the concentration of fructooligosaccharide was 40% (w/w). The cell tissue of Centella asiatica was compressed by a physical diffusion pressure (osmotic pressure) of 0.5 kgf/㎠, and substances within the plant cells were eluted. This was filtered to obtain a sugar diffusion extract of fresh Centella asiatica.

Comparative Example 1. Preparation of Centella asiatica hot water extract

A hot water extract of Centella asiatica was prepared according to a conventional method.

Comparative Example 2. Preparation of a simple mixture of Centella asiatica hot water extract and sugar

A mixed solution was prepared by simply mixing the Centella asiatica hot water extract and fructooligosaccharide obtained in Comparative Example 1 at a weight ratio of 6:4. The final concentration of fructooligosaccharide in the mixed solution of Comparative Example 2 was 40% (w/w).

Comparative Example 3. Preparation of sugar-only solution

A sugar-only solution was prepared by dissolving fructooligosaccharide in water. The final concentration of fructooligosaccharide in the sugar-only solution of Comparative Example 3 was 40% (w/w).

Experimental Example 1. Evaluation of anti-inflammatory efficacy

In order to evaluate the anti-inflammatory efficacy of the fresh Centella asiatica diffusible extract of Example 1, the expression level of the inflammatory factor IL-1α was confirmed.

Specifically, human epidermal cells (HaCaT) were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% fetal bovine serum (FBS) and 1% penicillin, and cultured under conditions of 37°C, 5% CO ₂ and 95% humidity. This was carried out in an incubator for 24 hours. Afterwards, the medium was removed, DPBS was added, washed once, and the medium was changed to FBS-free medium. Example 1 and Comparative Examples 1, 2, and 3 were treated with 100 ppm each and further cultured for 4 hours. As a negative control group, 10 ug/ml of Poly I:C + 10 ng/ml IL-4 was used, and as a positive control group, a group to which 1 μM dexamethasone was added was used. Afterwards, cells from each medium were obtained, washed with cooled PBS, and RNA was isolated using an RNAprep kit (Monarch® Total RNAprep Kit, NEB, USA). After quantifying RNA at 260 nm with a nanodrop, cDNA was synthesized in an amplifier using 2 μg of RNA each (C1000 Thermal Cycler, Bio-Rad, USA). Using the synthesized cDNA as a template, Cyber Green (SYBR Green supermix, Applied Biosystems, USA) was added to the target gene, IL-1α, together with the primers and cDNA shown in Table 1 below, and PCR was performed using a real-time PCR machine (Step One). Real-time polymerase chain reaction was performed by Plus, Applied Biosystems, USA). The real-time PCR reaction was performed by activating the polymerase at 94°C for 5 minutes, followed by 40 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. The expression level of the IL-1α gene was finally analyzed through correction for the β-actin gene, and the results are shown in Figure 1.

sequence number	gene	direction	primer sequence
One	IL-1α	forward	5'- TGGCTCATTTTCCCTCAAAAGTTG -3'
2		reverse	5'-AGAAATCGTGAAATCCGAAGTCAAG-3'
3	β-actin	forward	5'-GGCCATCTCTTGCTCGAAGT-3'
4		reverse	5'-GAGACCTTCAACACCCCAGC-3'

As shown in Figure 1, after inducing inflammation, the expression of the inflammatory factor IL-1α significantly increases, but the Centella asiatica hot water extract of Comparative Example 1, the simple mixture of Centella asiatica hot water extract and sugar in Comparative Example 2, and the sugar alone in Comparative Example 3 In comparison, it can be seen that the degree of inhibition of the expression level of the inflammatory factor IL-1α was significantly increased in the perfusion extract of Centella asiatica of Example 1. Therefore, it was confirmed that the fresh Centella asiatica extract extracted using the sugar diffusion extraction method had an excellent anti-inflammatory effect.

Experimental Example 2. Evaluation of skin moisturizing and skin barrier strengthening efficacy

In order to evaluate the skin moisturizing and skin barrier strengthening efficacy of the fresh Centella asiatica diffusible extract of Example 1, HAS3 (Hyaluronan synthase 3), which is involved in hyaluronic acid synthesis, and Filaggrin (FLG) genes, which are involved in the skin barrier, were tested. The level of expression was confirmed.

Specifically, human epidermal cells (HaCaT) were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% fetal bovine serum (FBS) and 1% penicillin, and cultured under conditions of 37°C, 5% CO ₂ and 95% humidity. This was carried out in an incubator for 24 hours. Afterwards, the medium was removed, DPBS was added, washed once, and the medium was changed to FBS-free medium. Example 1 and Comparative Examples 1, 2, and 3 were treated with 100 ppm each and further cultured for 24 hours. A group added with pure distilled water was used as a negative control group, and a group added with 1 μM retinoic acid was used as a positive control group. Afterwards, cells from each medium were obtained, washed with cooled PBS, and RNA was isolated using an RNAprep kit (Monarch® Total RNAprep Kit, NEB, USA). After quantifying RNA at 260 nm with a nanodrop, cDNA was synthesized in an amplifier using 2 μg of RNA each (C1000 Thermal Cycler, Bio-Rad, USA). Using the synthesized cDNA as a template, Cyber Green (SYBR Green supermix, Applied Biosystems, USA) was added to the target genes HAS3 and FLG along with the primers and cDNA shown in Table 2 below, and used in a real-time PCR machine (Step One). Real-time polymerase chain reaction was performed by Plus, Applied Biosystems, USA). The real-time PCR reaction was performed by activating the polymerase at 94°C for 5 minutes, followed by 40 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. The expression levels of HAS3 and FLG genes were finally analyzed through correction for the β-actin gene, and the results are shown in Figures 2 and 3, respectively.

sequence number	gene	direction		primer sequence
5	HAS3	forward	5'-CTTAAGGGTTGCTTGCTTGC-3'
6		reverse	5'-GTTCGTGGGAGATGAAGGAA-3'
7	FLG	forward	5'-AGGGCACTCAGGGGGGCTCACA-3'
8		reverse	5'-CCGGCTTGGCCGTAATGTGT-3'
3	β-actin	forward	5'-GGCCATCTCTTGCTCGAAGT-3'
4		reverse	5'-GAGACCTTCAACACCCCAGC-3'

As shown in Figure 2, compared to the Centella asiatica hot water extract of Comparative Example 1, the simple mixture of Centella asiatica hot water extract and sugar in Comparative Example 2, and the sugar alone in Comparative Example 3, the Centella asiatica sugar diffusion extract of Example 1 is effective in hyaluronic acid synthesis. It was confirmed that the expression level of the involved HAS3 gene was significantly increased. As shown in Figure 3, compared to the Centella asiatica hot water extract of Comparative Example 1, the simple mixture of Centella asiatica hot water extract and sugar in Comparative Example 2, and the sugar alone in Comparative Example 3, the diffuse extract of Centella asiatica in Example 1 is involved in the skin barrier. It was confirmed that the expression level of the FLG gene was significantly increased.

Therefore, it was found that the fresh Centella asiatica extract extracted using the sugar diffusion extraction method had an excellent effect on moisturizing the skin and strengthening the skin barrier by increasing the expression of HAS3 and FLG genes.

In summary, compared to Centella asiatica hot water extract (Comparative Example 1), a simple mixture of Centella asiatica hot water extract and sugar (Comparative Example 2), and sugar alone (Comparative Example 3), the fresh Centella asiatica extract extracted by the sugar diffusion extraction method (Example 1) ) has excellent anti-inflammatory effects by significantly inhibiting the expression of IL-1α, and has excellent skin moisturizing and skin barrier strengthening effects by significantly increasing the expression of HAS3 and FLG genes. Therefore, fresh Centella asiatica extract extracted by diffusion extraction using sugar can be used for anti-inflammatory, skin moisturizing, and skin barrier strengthening purposes.

Claims (10)

1. A method of producing a Centella asiatica extract comprising the step of mixing Centella asiatica and sugar to spread and extract Centella asiatica.
2. The method according to claim 1, wherein the sugar is an oligosaccharide.
3. The method of claim 1, wherein the sugar is fructooligosaccharide, isomaltooligosaccharide, maltooligosaccharide, galactooligosaccharide, alpha-glucan oligosaccharide, inulin, dextran, levan, or a combination thereof. method.
4. The method according to claim 1, wherein the concentration of the sugar is 10 to 70% (w/w).
5. Centella asiatica extract prepared by the method of claim 1.
6. An anti-inflammatory composition comprising the Centella asiatica extract of claim 5.
7. A cosmetic composition comprising the Centella asiatica extract of claim 5.
8. The cosmetic composition according to claim 7, which is for moisturizing skin or strengthening the skin barrier.
9. The cosmetic composition according to claim 7, which increases the expression of at least one of Hyaluronan synthase 3 (HAS3) and Filaggrin.
10. A food composition comprising the Centella asiatica extract of claim 5.

Images