KR102495397B1 - Cosmetic composition having anti-inflammatory and barriet effect comprising fresh Centella asiatica extracts extracted by diffusion-based extraction method using sugar and use thereof - Google Patents

Abstract

The present invention relates to a method for preparing a Centella asiatica extract using a sugar diffusion extraction method, to a Centella asiatica extract prepared by the method, and to anti-inflammatory, skin moisturizing or skin barrier strengthening uses of the Centella asiatica extract. The method of the present invention is an environmentally friendly method and has high extraction efficiency of effective substances. The Centella asiatica extract extracted by the method has excellent skin functionality, and thus can be utilized as a cosmetic composition, a pharmaceutical composition, a health functional food composition, and the like.

Description

Cosmetic composition having anti-inflammatory and barrier effect comprising fresh Centella asiatica extracts extracted by diffusion-based extraction method using sugar and use thereof }

It relates to a cosmetic composition comprising a centella asiatica extract extracted by a sugar diffusion extraction method and its anti-inflammatory, skin moisturizing and skin barrier strengthening uses.

Centella Asiatica contains ingredients useful for the skin, and is widely used in the cosmetic field in the form of centella asiatica oil and centella asiatica extract. In order to develop centella asiatica extract as a cosmetic raw material, research using various extraction solvents or extraction methods is being conducted.

Methods widely used to extract natural products include a hot water extraction method in which active ingredients contained in natural products are eluted using hot water, a solvent extraction method in which active ingredients are dissolved and separated from a solid or liquid sample using a solvent such as alcohol, and a second method. There is a supercritical extraction method that extracts using a critical fluid. For example, KR Patent Publication No. 10-2021-0000522 discloses a method for preparing a centella asiatica extract by mixing centella pulverized material and a methanol solvent and then ultrasonically extracting the centella asiatica extract. However, the above existing methods have low yields, or destruction or denaturation of physiologically active ingredients by applying high-temperature heat to natural products, or safety to a degree suitable for use in cosmetics for human body due to organic solvents remaining after extraction. There are various problems such as not being satisfied.

In addition, since the extraction yield and the content of physiologically active ingredients of natural extracts vary greatly depending on the plant that is the raw material, even if the extraction method has been confirmed effective for a specific plant, the same or similar level of effect is obtained for other plants. In most cases, it does not represent

Therefore, the need for an environmentally friendly method that does not use organic solvents while having a high content of active ingredients in the preparation of centella asiatica extract is emerging.

Accordingly, the present inventors have developed a method for manufacturing centella asiatica extract that can increase the extraction efficiency of active substances without using chemical processes or organic solvents, and the centella asiatica extract using this extraction method has excellent anti-inflammatory, skin moisturizing and skin barrier properties. The present invention was completed by confirming the use of reinforcement.

One aspect provides a method for preparing a centella asiatica extract using a sugar diffusion extraction method.

Another aspect provides the Centella asiatica extract prepared by the above method.

Another aspect provides the use of the Centella asiatica extract.

Another aspect provides a composition comprising the Centella asiatica extract.

Another aspect provides a method for preventing, ameliorating, or treating a condition in a subject comprising treating or administering to a subject in need thereof an effective amount of a composition described above.

One aspect provides a method for preparing a centella asiatica extract using a sugar diffusion extraction method.

The "sugar diffusion extraction method" refers to a diffusion-based extraction method using sugar. The term "diffusion" refers to a phenomenon in which particles constituting a material move from a higher density or concentration to a lower density due to a difference in density or concentration. The term "osmotic pressure" refers to the pressure generated when water moves from a lower concentration to a higher concentration through osmosis. When a natural product (e.g., plant) is mixed with a high concentration of sugar, the natural substances are eluted out together by osmotic pressure. Therefore, in the present specification, the "sugar diffusion extraction method" is interchangeably with "diffusion-based extraction method using sugar", "osmotic pressure extraction method using sugar", or "osmotic pressure-based extraction method using sugar". can be used

The sugar diffusion extraction method is an environmentally friendly extraction method that does not use chemical processes or organic solvents. In addition, the sugar diffusion extraction method can increase the extraction efficiency of effective substances compared to conventional hot water extraction methods and ultrasonic extraction methods.

The method includes diffusion extraction of centella asiatica by mixing centella asiatica and sugar.

The centella asiatica is not limited to a specific site, and for example, an outpost, leaf, stem, root, etc. may be used. The Centella asiatica is not limited to a specific form, but it is preferable to use Centella asiatica or its minced product. Dry centella asiatica may not be suitable for applying the above method because of its low moisture content.

The "sugar" refers to a substance having a sweet taste, and may be classified into monosaccharides, disaccharides composed of two monosaccharides, and oligosaccharides composed of about 3 to 10 monosaccharides. As the sugar, a kind suitable for applying the diffusion extraction method may be used.

In one embodiment, the sugar may be an oligosaccharide. The oligosaccharide exists in the form of glycan and is linked to amino acid side chains of fats or proteins, and is generally found in two forms: N-linked oligosaccharides and O-linked oligosaccharides.

In one embodiment, the sugar is fructo-oligosaccharide (FOS), isomalto-oligosaccharide (IMO), malto-oligosaccharide (IMO), galacto-oligosaccharide It may be Galacto-oligosaccharide (GOS), Alpha-Glucan Oligosaccharide, Inulin, Dextran, Levan, or a combination thereof, but is not limited thereto.

In one embodiment, the sugar may be a fructooligosaccharide. The fructooligosaccharide is an oligosaccharide in which 1 to 3 fructose are bound to sucrose, and are typically 1-ketose, nistose, 1-fructosylnis There is 1-fructosylnistose. Fructooligosaccharide is a sugar that is not digested by animal digestive tract enzymes and is not used by caries bacteria. When ingested, it proliferates bifidobacteria, an enteric bacterium, in the lower small intestine and exhibits various physiological effects including intestinal function. Therefore, fructooligosaccharide is also used as a functional material for prebiotic foods.

The concentration of the sugar may be high. The 'high concentration' means a concentration high enough to apply the sugar diffusion extraction method. Therefore, the concentration may be higher than the intracellular concentration of the green centipede. Specifically, the concentration is 10% (w / w) or more, specifically 10 to 90% (w / w), 10 to 80% (w / w), 10 to 70% (w / w), 10 to 60% % (w/w), 10 to 50% (w/w), 20 to 90% (w/w), 20 to 80% (w/w), 20 to 70% (w/w), 20 to 60 % (w/w), 20 to 50% (w/w), 30 to 90% (w/w), 30 to 80% (w/w), 30 to 70% (w/w), 30 to 60 % (w/w), or 30 to 50% (w/w), but may be, but is not limited thereto.

During the diffusion extraction, the osmotic pressure is 0.0129 kgf/cm ² to 1.166 kgf/cm ² , 0.02 kgf/cm ² to 1.0 kgf/cm ² , 0.1 kgf/cm ² to 1.0 kgf/cm ² according to Van't Hoff's formula, for example For example, it may be 0.5 kgf/cm ² .

The 'mixing' of the centella asiatica and sugar is not limited to a specific method, but may be, for example, simple mixing.

The term “diffusion extraction” may be used interchangeably with “osmotic extraction”. By the diffusion extraction, a substance inside the Centella Asiatica, for example, a water-soluble substance, an oil-soluble substance, or a combination thereof may be eluted to the outside.

The term "extract" includes all substances obtained by extracting components of natural substances, and also includes substances that can be obtained by extracting components of natural substances and then processing or treating them by other methods. For example, the processing or treatment may include dilution, concentration, drying, purification, fractionation, filtration, fermentation, enzymatic treatment, and the like. The processing or treatment can be carried out by conventional methods. Therefore, the extract may include an extract, a dilution or concentrate of the extract, a dried product obtained by drying the extract, or a crude or purified product thereof, or a fraction obtained by fractionating the same.

The method may further include filtering the diffusion-extracted centella asiatica extract. Therefore, the Centella asiatica extract may be a filtrate of the centella asiatica extract.

The extraction may be performed under extraction conditions for diffusion extraction of components of centella asiatica. The extraction conditions refer to extraction time, extraction temperature, and the like. The extraction time is 30 minutes to 24 hours, 30 minutes to 20 hours, 30 minutes to 10 hours, 30 minutes to 5 hours, 30 minutes to 3 hours, 30 minutes to 2 hours, 1 hour to 24 hours, 1 hour to 20 hours time, 1 hour to 10 hours, 1 hour to 5 hours, 1 hour to 3 hours, 1 hour to 2 hours, 2 hours to 24 hours, 2 hours to 20 hours, 2 hours to 10 hours, 2 hours to 5 hours, Alternatively, it may be 2 to 3 hours, but it may be appropriately selected according to other conditions such as sugar concentration and extraction temperature. If the extraction time is less than 30 minutes, the active ingredient may not be sufficiently extracted.

The extraction temperature may be 10 to 100 ° C, 10 to 80 ° C, 10 to 60 ° C, 10 to 40 ° C, 20 to 100 ° C, 20 to 80 ° C, 20 to 60 ° C, 20 to 40 ° C, or room temperature, It can be appropriately selected according to other conditions such as sugar concentration and extraction time.

Another aspect provides a centella asiatica extract prepared by a method for preparing a centella asiatica extract using a sugar diffusion extraction method according to one aspect.

Centella asiatica extract prepared by the method may be harmless to the human body using an environmentally friendly method. Therefore, the Centella Asiatica extract may be safe to use as a cosmetic, pharmaceutical, or food raw material.

In addition, the Centella asiatica extract prepared by the above method may have excellent anti-inflammatory, skin moisturizing and skin barrier strengthening effects compared to the Centella asiatica extract prepared by the conventional extraction method.

In one embodiment, compared to the centella asiatica hot water extract (Comparative Example 1), a simple mixture of Centella asiatica hot water extract and sugar (Comparative Example 2), and sugar alone (Comparative Example 3), the Centella asiatica extract extracted by the sugar diffusion extraction method (Example Example 1) significantly inhibits the expression of IL-1α and has excellent anti-inflammatory effect, and remarkably increases the expression of hyaluronic acid synthase (HAS3) and filaggrin (FLG) genes to show excellent skin moisturizing and skin barrier strengthening effects. It was confirmed (Experimental Examples 1 and 2).

Another aspect provides the use of the centella asiatica extract according to one aspect. Specifically, it provides a composition containing the centella asiatica extract according to one aspect.

Uses of the extract may include improving skin conditions, preventing or treating skin diseases.

The skin condition improvement may be one or more of anti-inflammatory, skin moisturizing, and skin barrier strengthening.

Accordingly, the composition is an anti-inflammatory composition; Alternatively, it may be a composition for moisturizing the skin or strengthening the skin barrier.

The extract inhibits or reduces the expression of inflammatory cytokines (eg, IL-1α); It may be to increase the expression of skin moisturizing and skin barrier related genes (eg HAS3, filaggrin).

The term "anti-inflammatory" may be used interchangeably with "improvement of inflammation" and "inhibition of inflammation", and may refer to any action that suppresses NO production by alleviating the immune response.

The term “skin disease” may be a skin inflammatory disease or a disease caused by impaired skin barrier function.

The skin barrier function impairment may refer to any change that occurs in the skin due to a decrease or damage of the skin barrier function. Examples include dryness, dermatitis, atopic dermatitis, allergic dermatitis, acne, and the like.

The skin inflammatory disease may be any one selected from the group consisting of skin wound, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, erythema, urticaria, psoriasis, drug rash, and acne.

The term "prevention" includes inhibiting the development of a disease.

The term "treatment" includes inhibition of the development of, alleviation of, or elimination of a disease.

The term “moisturizing the skin” can refer to any action that maintains skin moisture or prevents moisture loss.

The term "strengthening the skin barrier" may refer to any action that enhances the function of the skin barrier, which is located at the outermost layer of the skin and prevents loss of moisture and nutrients.

In one embodiment, the extract can reduce or inhibit the expression of IL-1α. Accordingly, the composition may exhibit anti-inflammatory effects such as improving skin inflammation and preventing or treating inflammatory skin diseases by reducing or inhibiting the expression of IL-1α.

In one embodiment, the extract may increase the expression of any one or more of hyaluronan synthase 3 (HAS3) and filaggrin. Therefore, the composition may exhibit skin moisturizing and skin barrier strengthening effects through an increase in the expression of any one or more of HAS3 and filaggrin.

The composition is 0.001% to 80% by weight, for example, 0.01% to 60% by weight, 0.01% to 50% by weight, 0.01% to 40% by weight, 0.01% to 30% by weight, based on the total weight of the composition. %, 0.01% to 20%, 0.01% to 10%, 0.01% to 5%, 0.05% to 60%, 0.05% to 50%, 0.05% to 40%, 0.05% to 30% by weight, 0.05% to 20% by weight, 0.05% to 10% by weight, 0.05% to 5% by weight, 0.1% to 60% by weight, 0.1% to 50% by weight, 0.1% by weight % to 40% by weight, 0.1% to 30% by weight, 0.1% to 20% by weight, 0.1% to 10% by weight, 0.1% to 5% by weight, 1% to 50% by weight, 1% to 1% by weight 40 wt%, 1 wt% to 30 wt%, 1 wt% to 20 wt%, 1 wt% to 10 wt%, 10 wt% to 50 wt%, 10 wt% to 40 wt%, 10 wt% to 30 wt% %, or from 10% to 20% by weight of the extract.

The composition may include the extract as an active ingredient.

The term "included as an active ingredient" means that the extract of the present specification is added to the extent that the above-mentioned effects can be exhibited, and various ingredients are added as subcomponents for drug delivery and stabilization, etc. to be formulated in various forms ( It means that it includes being formulated.

The composition may be in a liquid or dry state. In one embodiment, the composition may be in the form of a dry powder.

A drying method for preparing the composition in a dry state may use a method commonly used in the art, and is not particularly limited. Non-limiting examples of the drying method include an air drying method, a natural drying method, a spray drying method, a freeze drying method, and the like. These methods may be used alone or at least two methods may be used together.

The composition may contain an effective amount of an additive sufficient to reduce deterioration of the extract. The additive may be, for example, a binder, but is not limited thereto.

The composition may further include a cosmetically, pharmaceutically or food-acceptable carrier. The composition may be formulated with a carrier and provided as cosmetics, drugs, food additives, and the like.

The composition may be a cosmetic composition.

The cosmetic composition may further include ingredients commonly used in cosmetic compositions, functional additives, etc. in addition to the active ingredients disclosed herein, such as antioxidants, stabilizers, solubilizers, surfactants, dispersants, preservatives, and vitamins. , conventional adjuvants such as pigments, flavors, and the like, and carriers.

The cosmetic composition is not particularly limited to a specific formulation, and the formulation may be appropriately selected according to the purpose. The cosmetic composition may have, for example, a solubilizing formulation, an emulsifying formulation, or a dispersion formulation. The cosmetic composition may have, for example, a softening lotion, a nutrient lotion, a massage cream, a nutrient cream, an essence, a pack, a gel, an ampoule, or a skin-adhesive cosmetic formulation.

The composition may be a composition for external application for skin.

In the present specification, the external skin preparation may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal delivery patch, drug-containing bandage, lotion, or a combination thereof. The external skin preparation is a component usually used in external preparations for skin such as cosmetics or pharmaceuticals, for example, water-based components, oil-based components, powder components, alcohols, moisturizers, thickeners, ultraviolet absorbers, whitening agents, preservatives, antioxidants, surfactants, and fragrances. , colorants, various skin nutrients, or combinations thereof and may be suitably blended as needed. The skin external preparation, metal sequestering agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, gluconic acid; drugs such as caffeine, tannin, bellapamil, licorice extract, glabridin, hot water extract of calin fruit, various herbal medicines, tocopherol acetate, glycylitnic acid, tranexamic acid and its derivatives or salts; Vitamin C, magnesium ascorbyl phosphate, ascorbic acid glucoside, arbutin, kojic acid; Sugars, such as glucose, fructose, and trehalose, etc. can also be mix|blended suitably.

The composition may be a pharmaceutical composition.

The pharmaceutical composition may additionally include a pharmaceutically acceptable diluent or carrier. The diluent may be lactose, corn starch, soybean oil, microcrystalline cellulose, mannitol, or a combination thereof. The carrier may be an excipient, a disintegrant, a binder, a lubricant, or a combination thereof. The excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof. The disintegrant may be calcium carboxymethylcellulose, sodium starch glycolate, calcium monohydrogen phosphate, or a combination thereof. The binder may be polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose, or a combination thereof. The lubricant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.

The pharmaceutical composition may be formulated for oral or parenteral administration. Oral dosage forms may be granules, powders, liquids, tablets, capsules, dry syrups, and the like. Parenteral dosage forms may be injections, ointments, and the like.

The composition may be a food composition. In this case, it may be formulated in the form of a conventional health functional food known in the art. Therefore, the food composition may be a health functional food composition.

The food composition may use the extract alone, or may be used in combination with other foods or food ingredients, and may be appropriately used according to conventional methods. The mixing amount of the active ingredient can be suitably determined depending on the purpose of use (prevention, health or therapeutic treatment). There is no particular limitation on the type of health functional food. Among the types of health functional foods, beverage compositions may contain various flavoring agents or natural carbohydrates as additional components, like conventional beverages. The natural carbohydrates include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; and polysaccharides such as dextrins and cyclodextrins; It is a sugar alcohol, such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used. The health food composition may also contain nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, and carbonated beverages. carbonation agent used, or a combination thereof. The health functional food composition may also contain natural fruit juice, fruit juice beverages, fruit flesh for preparing vegetable beverages, or a combination thereof.

Another aspect provides a method for preventing, ameliorating, or treating a condition in a subject comprising treating or administering to a subject in need thereof an effective amount of a composition described above.

The condition of the subject may be a condition related to skin or a condition related to skin inflammation.

The terms "administering", "introducing", and "implanting" are used interchangeably and are used interchangeably, according to one embodiment to the action of a composition into a subject by a method or route that results in at least partial localization to a desired site. It may refer to the arrangement of the composition according to the specific embodiment.

Administration may be administered by a method known in the art. Administration may be administered directly to a subject by any means, for example, by routes such as intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal or subcutaneous administration. can The administration may be administered systemically or locally.

The subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat. The subject may be a subject in need of skin improvement, for example, a subject in need of skin inflammation improvement, skin moisturizing, or skin barrier strengthening effect.

The administration is 0.1 mg to 1,000 mg per day of the composition according to one embodiment, for example, 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg , 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or 10 mg to 25 mg may be administered. However, the dosage may be prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and reaction sensitivity, and those skilled in the art can Dosage can be appropriately adjusted in consideration of these factors. The number of administrations can be once a day or two or more times within the range of clinically acceptable side effects, and administration can be performed at one or two or more sites, daily or at intervals of 2 to 5 days. The number of administration days may be administered from 1 day to 30 days per treatment. If necessary, the same treatment can be repeated after a titration period. For non-human animals, the same dosage per kg as for humans is used, or the above dosage is converted by the volume ratio (eg, average value) of the organ (heart, etc.) between the target animal and the human. A single dose can be administered.

Redundant content is omitted in consideration of the complexity of the present specification, and terms not defined otherwise in the present specification have meanings commonly used in the technical field to which the present invention belongs.

The method for preparing the centella asiatica extract using the sugar diffusion extraction method according to one aspect is an environmentally friendly method without using a chemical process or an organic solvent, and has high extraction efficiency of effective substances.

Centella asiatica extract according to one aspect has an excellent anti-inflammatory effect, skin moisturizing and skin barrier strengthening effects, so it can be applied in various ways such as cosmetic compositions, pharmaceutical compositions, and health functional food compositions.

1 shows Example 1 (diffusion extract per Centella asiatica), Comparative Example 1 (hot water extract Centella asiatica), Comparative Example 2 (simple mixture of hot water extract Centella asiatica and fructooligosaccharide), Comparative Example 3 (fructooligosaccharide alone) ) to inflammation-induced fibroblasts, and then the expression level of IL-1α gene, an inflammatory factor, was measured.
2 shows Example 1 (diffusion extract per Centella asiatica), Comparative Example 1 (hot water extract of Centella asiatica), Comparative Example 2 (simple mixture of hot water extract of Centella asiatica and fructooligosaccharide), Comparative Example 3 (fructooligosaccharide alone) ) to fibroblasts, and the expression level of HAS3, a gene for synthesizing hyaluronic acid, was measured.
3 shows Example 1 (diffusion extract per Centella asiatica), Comparative Example 1 (hot water extract of Centella asiatica), Comparative Example 2 (simple mixture of hot water extract of Centella asiatica and fructooligosaccharide), Comparative Example 3 (fructooligosaccharide alone) ) was treated with fibroblasts, and the expression level of filaggrin (FLG), a skin barrier-related gene, was measured.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are intended to illustrate the present invention by way of example, and the scope of the present invention is not limited to these examples.

Example 1. Preparation of sugar diffusion extract of centella asiatica

Fructooligosaccharide, an oligosaccharide, was treated with centella asiatica at high concentration. The concentration of fructooligosaccharide can be appropriately selected from 10 to 90% (w/w), but in this example, the concentration of fructooligosaccharide was 40% (w/w). Centella asiatica cell tissue was compressed by a physical diffusion pressure (osmotic pressure) of 0.5 kgf/cm 2 , and substances in the plant cells were eluted out. This was filtered to obtain a sugar diffusion extract of Centella asiatica.

Comparative Example 1. Preparation of centella asiatica hot water extract

A hot water extract of centella asiatica was prepared according to a conventional method.

Comparative Example 2. Preparation of simple mixture of centella asiatica hot water extract and sugar

A mixed solution was prepared by simply mixing the centella asiatica hot-water extract and fructooligosaccharide obtained in Comparative Example 1 in a weight ratio of 6:4. The final concentration of fructooligosaccharide in the mixed solution of Comparative Example 2 was 40% (w/w).

Comparative Example 3. Preparation of sugar-only solution

A sugar-only solution was prepared by dissolving fructooligosaccharides in water. The final concentration of fructooligosaccharide in the sugar solution of Comparative Example 3 was 40% (w/w).

Experimental Example 1. Evaluation of anti-inflammatory efficacy

In order to evaluate the anti-inflammatory efficacy of the centella asiatica extract of Example 1, the expression level of the inflammatory factor IL-1α was confirmed.

Specifically, human epidermal cells (HaCaT) were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% fetal bovine serum (FBS) and 1% penicillin, and the culture was performed under conditions of 37°C, 5% CO ₂ and 95% humidity. It was performed for 24 hours in an incubator. Thereafter, the medium was removed, DPBS was added, washed once, changed to a medium without FBS, and Example 1 and Comparative Examples 1, 2, and 3 were treated with 100 ppm, respectively, and further cultured for 4 hours. As a negative control group, Poly I:C 10 ug/ml + IL-4 10 ng/ml added group and 1 μM dexamethasone added group were used as a positive control group. Thereafter, cells in each medium were obtained, washed with cold PBS, and RNA was isolated using an RNAprep kit (Monarch® Total RNAprep Kit, NEB, USA). After RNA was quantified at 260 nm with a nanodrop, cDNA was synthesized using an amplifier using 2 μg of each RNA (C1000 Thermal Cycler, Bio-Rad, USA). Using the synthesized cDNA as a template, cybergreen (SYBR Green supermix, Applied Biosystems, USA) was added together with the primers and cDNA in Table 1 for the target gene, IL-1α, using a real-time PCR machine (Step One Plus, Applied Biosystems, USA) real-time polymerase chain reaction was performed. The real-time PCR reaction was performed by repeating 40 cycles of polymerase activation at 94°C for 5 minutes, followed by 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. The expression level of the IL-1α gene was finally analyzed through correction for the β-actin gene, and the results are shown in FIG. 1 .

sequence number gene direction primer sequence One IL-1α forward 5'- TGGCTCATTTTCCCTCAAAAGTTG -3' 2 reverse 5'- AGAAATCGTGAAATCCGAAGTCAAG -3' 3 β-actin forward 5'-GGCCATCTCTTGCTCGAAGT-3' 4 reverse 5’-GAGACCTTCAACACCCCAGC-3’

As shown in FIG. 1, after induction of inflammation, the expression of the inflammatory factor IL-1α significantly increased. In comparison, it can be confirmed that the diffusion extract of Centella asiatica of Example 1 significantly increased the degree of inhibition of the expression level of the inflammatory factor IL-1α. Therefore, it was confirmed that the Centella asiatica extract extracted by the saccharide diffusion extraction method had excellent anti-inflammatory effects. could

Experimental Example 2. Skin moisturizing and skin barrier strengthening efficacy evaluation

In order to evaluate the skin moisturizing and skin barrier strengthening effects of the centella asiatica extract of Example 1, the HAS3 (Hyaluronan synthase 3) involved in hyaluronic acid synthesis and the filaggrin (FLG) gene involved in skin barrier The expression level was confirmed.

Specifically, human epidermal cells (HaCaT) were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% fetal bovine serum (FBS) and 1% penicillin, and the culture was performed under conditions of 37°C, 5% CO ₂ and 95% humidity. It was performed for 24 hours in an incubator. Thereafter, the medium was removed, DPBS was added, washed once, changed to a medium without FBS, and Example 1 and Comparative Examples 1, 2, and 3 were treated with 100 ppm, respectively, and further cultured for 24 hours. As a negative control group, a group containing pure distilled water and a group containing 1 μM retinoic acid were used as a positive control group. Thereafter, cells in each medium were obtained, washed with cold PBS, and RNA was isolated using an RNAprep kit (Monarch® Total RNAprep Kit, NEB, USA). After RNA was quantified at 260 nm with a nanodrop, cDNA was synthesized using an amplifier using 2 μg of each RNA (C1000 Thermal Cycler, Bio-Rad, USA). Using the synthesized cDNA as a template, cybergreen (SYBR Green supermix, Applied Biosystems, USA) was added together with the primers and cDNA in Table 2 for the target genes, HAS3 and FLG, using a real-time PCR machine (Step One Plus, Applied Biosystems, USA) real-time polymerase chain reaction was performed. The real-time PCR reaction was performed by repeating 40 cycles of polymerase activation at 94°C for 5 minutes, followed by 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. The expression levels of the HAS3 and FLG genes were finally analyzed through correction for the β-actin gene, and the results are shown in FIGS. 2 and 3, respectively.

sequence number gene direction primer sequence 5 HAS3 forward 5'-CTTAAGGGTTGCTTGCTTGC-3' 6 reverse 5'-GTTCGTGGGAGATGAAGGAA-3' 7 FLG forward 5’-AGTGCACTCAGGGGGGCTCACA-3’ 8 reverse 5'-CCGGCTTGGCCGTAATGTGT-3' 3 β-actin forward 5'-GGCCATCTCTTGCTCGAAGT-3' 4 reverse 5’-GAGACCTTCAACACCCCAGC-3’

As shown in FIG. 2, compared to the hot water extract of Centella asiatica of Comparative Example 1, the simple mixture of the hot water extract of Centella asiatica of Comparative Example 2 and sugar alone, and the sugar alone of Comparative Example 3, the diffusion extract of Centella asiatica of Example 1 was effective in synthesizing hyaluronic acid. As shown in FIG. 3, the centella asiatica hot-water extract of Comparative Example 1, the simple mixture of the centella asiatica extract and sugar of Comparative Example 2, and the sugar alone of Comparative Example 3 were compared with those of Comparative Example 3. Thus, it was confirmed that the diffusion extract per Centella asiatica of Example 1 markedly increased the expression level of the FLG gene involved in the skin barrier.

Therefore, it was found that the Centella Asiatica extract extracted by the saccharide diffusion extraction method had an excellent effect on skin moisturizing and strengthening the skin barrier by increasing the expression of HAS3 and FLG genes.

In summary, compared to the centella asiatica hot water extract (Comparative Example 1), a simple mixture of Centella asiatica hot water extract and sugar (Comparative Example 2), and sugar alone (Comparative Example 3), the centella asiatica extract extracted by the sugar diffusion extraction method (Example 1 ) has excellent anti-inflammatory effect by significantly inhibiting the expression of IL-1α, and excellent skin moisturizing and skin barrier strengthening effects by significantly increasing the expression of HAS3 and FLG genes. Therefore, centipede extract extracted by a diffusion extraction method using sugar can be used for anti-inflammatory, skin moisturizing, and skin barrier strengthening purposes.

SEQUENCE LISTING <110> Cosmax, INC. GOWOONSESANG COSMETICS CO., LTD <120> Cosmetic composition comprising Centella asiatica extracts extracted by diffusion-based extraction method using sugar and use it <130> PN143264KR <160> 8 <170> PatentIn version 3.2 <210> 1 <211> 24 <212> DNA <213> artificial <220> <223> IL-1α forward primer <400> 1 tggctcattt tccctcaaaa gttg 24 <210> 2 <211> 25 <212> DNA <213> artificial <220> <223> IL-1α reverse primer <400> 2 agaaatcgtg aaatccgaag tcaag 25 <210> 3 <211> 20 <212> DNA <213> artificial <220> <223> β-actin forward primer <400> 3 ggccatctct tgctcgaagt 20 <210> 4 <211> 20 <212> DNA <213> artificial <220> <223> β-actin reverse primer <400> 4 gagaccttca acaccccagc 20 <210> 5 <211> 20 <212> DNA <213> artificial <220> <223> HAS3 forward primer <400> 5 cttaagggtt gcttgcttgc 20 <210> 6 <211> 20 <212> DNA <213> artificial <220> <223> HAS3 reverse primer <400> 6 gttcgtggga gatgaaggaa 20 <210> 7 <211> 21 <212> DNA <213> artificial <220> <223> FLG forward primer <400> 7 agtgcactca gggggctcac a 21 <210> 8 <211> 20 <212> DNA <213> artificial <220> <223> FLG reverse primer <400> 8 ccggcttggc cgtaatgtgt 20

Claims (10)

A method for producing a centella asiatica extract comprising the step of diffusion-extracting centella asiatica by mixing centella asiatica and sugar,
The concentration of the sugar is 20 to 60% (w / w),
The osmotic pressure during the diffusion extraction is 0.1 kgf / cm ² To 1.0 kgf / cm ² The method. The method of claim 1, wherein the sugar is an oligosaccharide. The method according to claim 1, wherein the sugar is fructooligosaccharide, isomaltooligosaccharide, maltooligosaccharide, galactooligosaccharide, alpha-glucan oligosaccharide, inulin, dextran, levan or a combination thereof method. Centella asiatica extract prepared by the method of claim 1. An anti-inflammatory composition comprising the Centella asiatica extract of claim 4. A cosmetic composition comprising the centella asiatica extract of claim 4. The cosmetic composition according to claim 6, which is for moisturizing the skin or strengthening the skin barrier. The cosmetic composition according to claim 6, which increases the expression of any one or more of hyaluronan synthase 3 (HAS3) and filaggrin. A food composition comprising the centella asiatica extract of claim 4. The food composition according to claim 9, which is for moisturizing the skin or strengthening the skin barrier.

Images