WO2023172004A1 - 수복 상아질 재생 활성을 갖는 펩타이드 및 이의 용도 - Google Patents
수복 상아질 재생 활성을 갖는 펩타이드 및 이의 용도 Download PDFInfo
- Publication number
- WO2023172004A1 WO2023172004A1 PCT/KR2023/003027 KR2023003027W WO2023172004A1 WO 2023172004 A1 WO2023172004 A1 WO 2023172004A1 KR 2023003027 W KR2023003027 W KR 2023003027W WO 2023172004 A1 WO2023172004 A1 WO 2023172004A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- peptide
- pulp
- dentin
- amino acid
- acid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K6/00—Preparations for dentistry
- A61K6/50—Preparations specially adapted for dental root treatment
- A61K6/54—Filling; Sealing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/10—Peptides having 12 to 20 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K6/00—Preparations for dentistry
- A61K6/60—Preparations for dentistry comprising organic or organo-metallic additives
- A61K6/69—Medicaments
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0654—Osteocytes, Osteoblasts, Odontocytes; Bones, Teeth
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/998—Proteins not provided for elsewhere
Definitions
- the present invention relates to the use of a functional peptide derived from vitronectin for dentin regeneration, prevention or treatment of pulp disease, pulp restoration material, and root canal filling material.
- a tooth is an organ that has enamel on the outermost layer, hard tissue called dentin on the inner layer, odontoblasts that produce dentin inside the dentin, and pulp cells in the center.
- the pulp is a soft connective tissue that fills the pulp cavity inside the tooth, is rich in nerves and blood vessels, and extends to the surface layer of dentin.
- the pulp-dentin complex is a structure with a very dynamic function and is a tissue that plays a very important role in protecting teeth by immunologically defending against harmful stimuli and responding to trauma or infection with healing and regeneration. Dentin is divided into primary dentin, secondary dentin, and tertiary dentin according to the order of development.
- Tertiary dentin is dentin formed additionally on the pulp side in response to harmful stimuli such as dental caries, hair growth, wear, and dental preservation procedures. This dentin is formed only in areas where existing dentin has received harmful stimulation.
- tertiary dentin There are two types of tertiary dentin: reactive dentin and reparative dentin.
- Reactive dentin is dentin formed by existing odontoblasts when harmful stimuli are weak, and restorative dentin is when harmful stimuli are severe, the existing odontoblasts that created primary dentin and secondary dentin die and odontoblast-like cells form. This is dentin created by newly differentiated dentin. Pulp disease caused by dentin damage, pulp damage, and resulting bacterial infection can extend to periapical disease and periodontal disease.
- Teeth are formed by the induction of developmental processes in the fetal period and are functional units constructed by several cell types, similar to organs or organs. Therefore, teeth are not developed by a stem cell system in which various cell types are generated from stem cells such as hematopoietic stem cells or mesenchymal stem cells in adults.
- stem cells such as hematopoietic stem cells or mesenchymal stem cells in adults.
- teeth have the characteristic of not being regenerated spontaneously in adults, they are tissues that are continuously exposed to and used in daily life, such as human food intake and speech, and are subject to dental caries, periodontal disease, and external shocks. It is an organ that can be easily lost. Accordingly, due to the characteristics of tissues that do not regenerate spontaneously, these days, they are often supplemented with methods such as dentures or implants.
- interest in the development of dental tissue regeneration technology is increasing to maintain health and lead a high-quality life.
- Gutta Percha an existing root canal filling material used in the treatment of dental caries, has the advantages of good plasticity and operability, low cytotoxicity, radio-opacity, and can be easily removed by heat and solvents. , There is a risk of micro-leakage because it does not adhere to dentin. In addition, when heated, it contracts as it cools, causing micro-leakage. It only has the ability to physically occlude the root canal, but does not have the ability to induce dentin, making it very difficult to use it in wide root canals or unfinished tooth roots, and it is difficult to form restorative dentin. If total necrosis occurs, failure of dental caries treatment is inevitable. In addition, if it is overcharged, it is difficult to remove and may actually cause periapical disease, so improvements have been required.
- Korean Patent No. 10-1943978 proposes a peptide with regeneration-promoting activity for hard tissue and pulp tissue
- Japanese Patent No. 5519121 proposes a synthetic peptide containing the RGD sequence of dentin phosphoporine with hard tissue-inducing activity.
- active substances such as peptides for pulp tissue regeneration, but the development of biocompatible active substances for dentin regeneration has not yet achieved satisfactory results.
- bioactive peptides derived from vitronectin promoted the differentiation of pulp cells into odontoblasts in a dental pulp exposure animal model, promoting cell behavior and calcification of dentin.
- the present invention was completed by experimentally proving that it has the activity of
- One object of the present invention is to provide a composition for dentin regeneration containing a physiologically active peptide derived from vitronectin as an active ingredient.
- Another object of the present invention is to provide a pharmaceutical composition for preventing or treating dental pulp disease containing the peptide as an active ingredient.
- Another object of the present invention is to provide a composition for root canal fillings containing the above peptide as an active ingredient.
- Another object of the present invention is to provide a composition for dental implants containing the peptide as an active ingredient.
- One aspect of the present invention is a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the polynucleotide.
- a composition for dentin regeneration comprising a recombinant vector containing a as an active ingredient.
- Another aspect of the present invention is a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the polynucleotide.
- a composition for preventing or treating dental pulp disease comprising a recombinant vector containing as an active ingredient.
- Another aspect of the present invention is a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the polynucleotide.
- a composition for root canal fillings containing a recombinant vector containing as an active ingredient.
- Another aspect of the present invention is a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the polynucleotide.
- a composition for dental implant restoration containing a recombinant vector containing as an active ingredient.
- composition for dentin regeneration Composition for dentin regeneration
- One aspect of the present invention is a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the polynucleotide.
- a composition for dentin regeneration comprising a recombinant vector containing a as an active ingredient.
- peptide refers to a polymer compound in which two or more amino acids are linked by a peptide bond.
- the peptide used for dentin regeneration in the present invention is a bioactive peptide derived from vitronectin, and has a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO. 1 (RVYFFKGKQYWE) in the amino acid sequence of SEQ ID NO. 2. It is a peptide composed of.
- the peptide of the present invention is a peptide containing the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE), and may consist of 12 to 173 consecutive amino acid sequences within the amino acid sequence of SEQ ID NO: 2.
- the peptide of the present invention contains 12 to 173 consecutive amino acids, 12 to 80 consecutive amino acids, or 12 to 40 consecutive amino acids, or 12 to 12 consecutive amino acids, including the amino acid sequence of SEQ ID NO: 1 within the amino acid sequence of SEQ ID NO: 2. It may be a peptide consisting of 30 amino acids, 12 to 25 amino acids, 12 to 20 amino acids, 12 to 14 consecutive amino acids, or 12 to 13 consecutive amino acids, and may be a peptide that exhibits dentin regeneration activity.
- the peptide of the present invention is included in the scope of the peptide of the present invention as long as it exhibits dentin regeneration activity even if other amino acids are added, amino acids are deleted, or other peptides are fused to the amino acid sequence constituting the peptide of the present invention.
- the peptide consisting of the amino acid sequence of SEQ ID NO: 2 is an active peptide derived from vitronectin, and is a peptide from which the biologically active peptide motif consisting of the amino acid sequence of SEQ ID NO: 1 of the present invention is derived.
- the amino acid sequence of SEQ ID NO. 1 of the present invention (RVYFFKGKQYWE) It has the same activity as a peptide consisting of or a peptide containing this amino acid sequence.
- the peptide used for dentin regeneration in the present invention is a bioactive peptide derived from vitronectin and contains the amino acid sequence “RVYFFKGKQYWE” of SEQ ID NO: 1.
- the peptide may include a variant peptide having a different sequence due to deletion, insertion, substitution, or a combination of amino acid residues, or a protein fragment having the same function, to the extent that it does not affect the activity of the peptide. It may be in the form.
- amino acid modifications at the protein and peptide level that include the amino acid sequence of SEQ ID NO: 1 and do not overall change its activity are known in the art, and in some cases, include phosphorylation and sulfation. , acrylation, glycosylation, methylation, farnesylation, etc. Accordingly, the peptide includes not only the amino acid sequence of SEQ ID NO: 1, but also a peptide or a variant thereof having an amino acid sequence substantially identical thereto.
- the peptide having the substantially identical amino acid sequence is 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more with the amino acid sequence of SEQ ID NO: 1.
- It may be a peptide containing an amino acid sequence having more than 98%, more than 99%, or more than 99.5% homology, but is not limited thereto, and is a sequence having more than 90% amino acid sequence homology to the amino acid sequence of SEQ ID NO: 1. Any peptide that contains and has the same activity is included in the scope of the present invention.
- the peptide of the present invention includes the amino acid sequence of SEQ ID NO: 1 and may be composed of 20 or less amino acids that exhibit dentin regeneration activity. Specifically, the peptide may be composed of 20 or less, 18 or less, 15 or less, or 12 amino acids.
- the peptide may be a peptide having the amino acid sequence of SEQ ID NO: 1.
- the peptide having the amino acid sequence of SEQ ID NO: 1 is also referred to as “VnP-16 peptide”.
- the peptide of the present invention can be obtained by various methods well known in the art. As an example, it can be manufactured using polynucleotide recombination and protein expression systems, in vitro synthesis through chemical synthesis such as peptide synthesis, and cell-free protein synthesis, but is limited by the manufacturing method. no.
- the peptides of the present invention are used to obtain better chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., broad spectrum of biological activity), and reduced antigenicity.
- a protecting group may be bound to the N-terminus or C-terminus of.
- the protecting group may be an acetyl group, fluorenyl methoxy carbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group, or polyethylene glycol (PEG), but can be used to modify the peptide, especially to improve the stability of the peptide. If there is an ingredient, it can be included without limitation.
- the 'stability' refers not only to in vivo stability, which protects the peptide of the present invention from attack by protein-cleaving enzymes in vivo, but also to storage stability (e.g., storage stability at room temperature).
- the peptide of the present invention has the activity of promoting dentin regeneration by odontoblasts or dental pulp cells, it can be used for dentin regeneration or for promoting dentin regeneration.
- dentin in the present invention is a white, hard tissue that makes up most of the tooth, and is a calcified tissue of extramesenchymal origin and containing collagen. Dentin is made by odontoblasts originating from ectomesenchymal cells of the dental papilla. The crown area is covered with enamel and the root area is covered with cementum, so it is not exposed on the surface of the tooth. However, when the enamel wears away with aging, dentin is exposed at the tip of the crown or occlusal surface. Dentin is different from normal bone, the main body of cells that make dentin exist in the pulp, and only the protrusions extend into the dentin. Because odontoblasts that form dentin exist in the pulp, the pulp and dentin are considered a single functional unit, the dentin-pulp complex.
- the term “dental pulp” refers to a portion made up of soft connective tissue and odontoblasts that fill the pulp chamber inside the tooth, and is richly distributed with nerves and blood vessels. It is responsible for forming dentin.
- dentin may be reparative dentin or reactive dentin.
- the peptides of the invention promote the regeneration or formation of dentin, specifically restorative dentin or reactive dentin.
- Restorative dentin and reactive dentin are a type of tertiary dentin.
- Tertiary dentin is dentin formed additionally on the pulp side in response to harmful stimuli such as dental caries, hair loss, wear, and dental preservation procedures.
- the restorative dentin is formed only in areas where existing dentin has received harmful stimulation, and is formed by odontoblast-like cells newly differentiated from pulp cells after the existing odontoblasts that created primary dentin and secondary dentin die. It is dentin that has been formed.
- the reactive dentin is dentin formed by existing postmitotic odontoblasts that survive the noxious stimulus when the noxious stimulus is weak.
- the dentin may be dentin with exposed pulp. Specifically, the dentin may be damaged in the tooth and the pulp inside the tooth is exposed to the outside.
- the peptide of the present invention promotes the formation of uniform and thick hard tissue in a rat dental pulp exposure animal model.
- the composition for dentin regeneration of the present invention can be used for pulp-capping.
- the term "odontoblast" is present on the surface of the dental papilla in contact with the inner enamel cells of dentin.
- odontoblasts create predentin, and dentin is created by depositing calcareous on this.
- odontoblasts may include not only mitotic odontoblasts but also odontoblast-like cells.
- the odontoblast-like cells are cells induced to differentiate into odontoblasts from stem cells, progenitor cells, dental pulp cells, etc., and refer to cells having characteristics similar to odontoblasts.
- the peptide of the present invention has the activity of promoting the behavior of dental pulp cells.
- the activity that promotes the behavior of dental pulp cells may be an activity that promotes attachment, spreading, or migration of dental pulp cells.
- the peptide of the present invention exerts dentin regeneration promoting activity through the activity of promoting attachment, spreading, or migration of dental pulp cells.
- attachment in the present invention refers to the attachment of cells, and includes not only attachment of cells to each other but also attachment of cells to a substrate. When the adhesion ability of cells is improved, cells easily attach to the relevant area.
- the term “spreading” in the present invention refers to the process of spreading the cytoplasm thinly on the surface of the substrate after an animal cell adheres to the substrate, or the state in which the cell has completed cell attachment to the substrate.
- Normal cells are substrate dependent and cannot proliferate unless they adhere to the substrate and extend.
- Cell spreading occurs when integrin, a cell adhesion receptor on the cell surface, recognizes and adheres to cell adhesion proteins on the substrate, and as the adhesion signal is transmitted into the cell, the cytoskeleton is oriented and the cytoplasm spreads thinly on the substrate surface.
- Cell spreading is distinct from cell adhesion and is related to cell proliferation and migration.
- the term “migration” in the present invention refers to the movement of cells in response to external signals. If cell movement is improved, it can help suppress cell damage, and when there is a harmful stimulus or wound, the wound recovery ability can be excellent.
- the peptide of the present invention strongly promoted attachment, spreading, and migration of human dental pulp cells.
- the peptide of the present invention has the activity of promoting differentiation of dental pulp cells into odontoblasts or odontoblast-like cells or the activity of promoting calcification.
- the activity that promotes the differentiation of pulp cells into odontoblasts or odontoblast-like cells may be an activity that increases mRNA expression or protein expression of odontogenic differentiation marker genes.
- the differentiation marker gene may be one or more selected from the group consisting of ALP, DMP-1, and DSPP.
- the calcification is also called mineralization or mineralization, and means that calcium and phosphorus, the main components of the dentin or enamel of the tooth, are deposited as apatite to form teeth.
- the calcification process plays an important role in odontoblast differentiation mechanisms in tooth development and stem cell-based tooth regeneration.
- Calcification of teeth is mainly caused by deposition of tertiary dentin.
- Tertiary dentin has very irregular dentinal tubules and is generally not continuous with secondary dentin. This feature serves to protect harmful substances from the outside from being transmitted to the pulp tissue through the dentinal tubules.
- the calcification can be measured by Alizarin S red (ARS) staining and quantitative analysis thereof, alkaline phosphatase (ALP) staining, activity, and RT-PCR (real time-PCR).
- ARS Alizarin S red
- ALP alkaline phosphatase
- RT-PCR real time-PCR
- the peptide of the present invention has a significantly increased degree of ALP or ARS staining compared to the negative control group, as demonstrated by the experimental results of specific examples of the present specification, so that the VnP-16 peptide is stained in dental pulp cells to odontoblasts or odontoblasts. -It was confirmed that it induces differentiation into similar cells and has the activity of promoting calcification ( Figures 2a to 2d).
- the peptide of the present invention can promote the expression of one or more odontogenic differentiation marker genes selected from the group of ALP, DMP-1, and DSPP in dental pulp cells, as demonstrated by the experimental results of specific examples herein.
- composition of the present invention may further include ingredients that generally have a dentin regeneration effect in addition to the above-mentioned peptides as active ingredients.
- composition of the present invention may include not only the peptide, but also a polynucleotide encoding the peptide, or a recombinant vector containing the polynucleotide as an active ingredient.
- polynucleotide is a polymer of nucleotides in which nucleotide monomers are connected in a long chain by covalent bonds, and is a DNA nucleic acid molecule or RNA nucleic acid molecule of a certain length or more, encoding (encoding) the peptide of the present invention. ) refers to a polynucleotide.
- nucleic acid bases may be mutated by substitution, deletion, insertion, or a combination thereof, and these are also included within the scope of the present invention.
- the recombinant vector of the present invention refers to an expression construct that is used to stably express the peptide of the present invention by introducing it into a cell.
- known expression vectors such as plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, etc. It includes a vector, and such a recombinant vector can be easily produced by a person skilled in the art according to any known method using DNA recombination technology.
- Another aspect of the present invention is a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the poly
- a dentin regeneration method comprising the step of contacting a recombinant vector containing nucleotides to dental pulp or dental pulp cells.
- Another aspect of the present invention includes the step of contacting a peptide containing the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE), a polynucleotide encoding the peptide, or a recombinant vector containing the polynucleotide to the dental pulp or dental pulp cells.
- a dentin regeneration method Provides a dentin regeneration method.
- composition for dentin regeneration of the present invention may also be provided in the form of a pharmaceutical composition described later.
- Another aspect of the present invention is a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the poly
- a pharmaceutical composition for preventing or treating dental pulp disease comprising a recombinant vector containing nucleotides as an active ingredient.
- the peptide may be a peptide containing the amino acid sequence of SEQ ID NO: 1.
- the peptide of the present invention uses the content described in the composition for dentin regeneration and is not described in duplicate. As described above, the peptide of the present invention has the activity of promoting dentin regeneration in pulp cells, so it can be used for the prevention or treatment of pulp disease.
- the pulp disease refers to a lesion that occurs in the pulp tissue, which is a soft connective tissue that fills the pulp cavity inside the tooth and is rich in nerves and blood vessels.
- pulp tissue which is a soft connective tissue that fills the pulp cavity inside the tooth and is rich in nerves and blood vessels.
- pulp hyperemia When the pulp is exposed due to damage to the dentin and physical, chemical, or bacterial stimulation is applied to the pulp, the blood vessels in the pulp expand at first and hyperemia can be seen (pulp hyperemia). If this stimulation continues, the pulp becomes inflamed (pulpitis). ).
- pulpitis There are differences in the degree of inflammation depending on the intensity of stimulation and the presence or absence of bacterial infection. Due to the anatomical characteristics of the pulp piled up by hard dentin, if inflammation occurs, circulatory failure is likely to occur, and if left as is, the pulp is likely to die.
- Pulp diseases to be treated in the present invention may include, for example, dentin hypersensitivity, pulp congestion, pulpitis, pulp degeneration, pulp necrosis, or pulp gangrene, but are not limited thereto.
- prevention in the present invention refers to any action that inhibits or delays the occurrence of dental pulp disease by administering a pharmaceutical composition for preventing or treating dental pulp disease containing the peptide of the present invention.
- treatment of the present invention means that a pharmaceutical composition containing the peptide of the present invention as an active ingredient is administered to an individual in need of treatment for pulp disease to promote regeneration of dentin or pulp tissue, thereby performing treatment of pulp disease. It means all actions performed.
- the pharmaceutical composition of the present invention contains (i) a therapeutically effective amount of the peptide of the present invention described above, a polynucleotide encoding the peptide, or a recombinant vector containing the polynucleotide; and (ii) pharmaceutically acceptable salts.
- terapéuticaally effective amount refers to an amount sufficient for the composition of the present invention to achieve treatment or prevention efficacy of dental pulp disease.
- the pharmaceutically acceptable carriers are commonly used in formulations and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Includes, but is not limited to, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.
- the pharmaceutical composition of the present invention may further include, but is not limited to, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
- lubricants wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
- suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington: The Science and Practice of Pharmacy, (21st ed., 2006, Williams & Wilkins).
- the pharmaceutical composition of the present invention can be administered by any route suitable for treating pulp disease, for example, it can be administered orally or parenterally, and in the case of parenteral administration, it is applied directly to the area where the pulp disease occurs or It can be administered locally, and it can also be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, and transdermal administration.
- the suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. Usually, a skilled physician can easily determine and prescribe an effective dosage for the desired treatment or prevention.
- the daily dosage of the pharmaceutical composition of the present invention is 0.00001-10,000 mg/kg, but is not limited thereto, and may vary depending on the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, It may be administered in varying dosages depending on factors such as excretion rate and responsiveness.
- the pharmaceutical composition of the present invention is prepared in unit dosage form by formulating it using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by those skilled in the art. Alternatively, it can be manufactured by placing it in a multi-capacity container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet, or capsule, and may additionally contain a dispersant or stabilizer.
- the method of treating pulp disease using the pharmaceutical composition of the present invention may be direct pulp-capping, but is not limited thereto, and includes various treatment methods for the pulp, such as apexification, pulp capping. Barrier technique, indirect pulp capping, pulpotomy, pulpectomy, induction of hard tissue formation around the root apex, guided bony regeneration (GBR) ) and root perforation repair.
- GLR guided bony regeneration
- the composition of the present invention is applied to the exposed nerve area to aid healing and prevent secondary infection when used in direct pulp demography, which effectively prevents pulp disease. It can be treated.
- the pharmaceutical composition of the present invention may further include a drug that can regulate the regeneration and inflammatory response of pulp tissue or dentin.
- drugs include inhibitors of histone deacetylases, antioxidants, anti-inflammatory agents whose main action is to inhibit phospholipases and cyclooxygenase, Wnt signaling modulators, and antibiotics. can do.
- drugs that can be added include trichostatin A, butyrate, valproic acid, apicidin; N-acetyl cysteine; Aspirin, Tylenol, acetaminophen, ibuprofen, Diclofenac, indomethacin, Ketoprofen, Voltaren, feldene, Mobic ); Penicillin, cephalosporin, kanamycin, gentamicin, sisomicin, erythromycin, vancomycin, teicoplanin, quinolone ), isoxazole derivatives, and lithium chloride.
- a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the above
- a method for treating or preventing dental pulp disease comprising administering a therapeutically effective amount of a recombinant vector containing a polynucleotide to a subject in need of treatment for dental pulp disease.
- the subject may include humans or non-human mammals.
- composition for root canal filling and pulp restoration material Composition for root canal filling and pulp restoration material
- Another aspect of the present invention is a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the poly
- a composition for root canal fillings containing a recombinant vector containing nucleotides as an active ingredient.
- Another aspect of the present invention is a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the poly
- a composition for dental implant restoration containing a recombinant vector containing nucleotides as an active ingredient.
- the peptide may be a peptide containing the amino acid sequence of SEQ ID NO: 1.
- the term “root canal capping” refers to permanently sealing the root canal after cleaning it, giving it shape, and treating it with chemicals in the treatment of dental caries. Root canal filling materials used for root canal filling are divided into gutta-percha, which fills the core of the root canal, and root canal sealer, which is responsible for sealing. Root canal filling is a material that removes damaged or infected pulp tissue during the treatment of dental caries and places it on top of the cut pulp tissue to directly fill the empty space to seal the coronal pulp tissue rich in nerves and cells.
- the root canal filling sealer is used to seal the root canal after filling empty spaces during the treatment of dental caries. It serves to prevent microorganisms from entering the pulp or periapical tissue or to trap and block microorganisms remaining in the root canal. do. It also plays a role in preventing pain by closing the microscopic tooth root canals present within the root canal.
- a desirable root canal filling material should have biocompatibility, good sealing properties, and the activity of promoting the regeneration of damaged pulp tissue.
- the peptide of the present invention has the activity of promoting the regeneration of dentin, especially tertiary dentin, by promoting the behavior of dental pulp cells and the differentiation of odontoblasts, so it can be used as an active ingredient in root canal fillings or pulp restoration materials. there is.
- the peptide of the present invention uses the content described in the composition for dentin regeneration and does not provide redundant explanation.
- composition for root canal filling material of the present invention may further include a material used as a dental root canal filling material.
- composition for root canal filling materials includes, for example, zinc-oxide eugenol based sealer, resin-based sealer, calcium hydroxide-based sealer, glass ionomer based sealer, formaldehyde-containing sealer, etc. It may include gutta-percha, chloroperchar, silicone-based sealer, MTA (mineral trioxide aggregate)-based sealer, calcium-silicate-phosphate-based bioceramic sealer, or calcium phosphate sealer.
- the zinc oxide eugenol-based sealer may include zinc oxide and eugenol, or may include zinc oxide, resin, and eugenol.
- the resin-based sealer may include an epoxy resin-based sealer or a methacrylate resin-based sealer.
- the calcium hydroxide-based sealer may include zinc oxide eugenol and calcium hydroxide, or may include resin and calcium hydroxide.
- composition for root canal fillings includes, for example, MTA (mineral trioxide aggregate), gutta-percha, calcium oxide, zinc oxide, resin, epoxy resin, methacrylate resin, eugenol, aluminum oxide, aluminum silicate, silicon dioxide, silicon, salicylic acid.
- MTA mineral trioxide aggregate
- gutta-percha calcium oxide, zinc oxide, resin, epoxy resin, methacrylate resin, eugenol, aluminum oxide, aluminum silicate, silicon dioxide, silicon, salicylic acid.
- Salt fatty acid, glass ionomer, calcium carbonate, calcium silicate, tricalcium silicate, calcium hydroxide, tricalcium phosphate, quaternary calcium phosphate, octacalcium phosphate, hydroxyapatite, collagen, demineralized freeze-dried bone, indium foil (indium foil) foil), calcium sulfate, dentin or white dentin fragments, bone fragments, titanium, chitosan, Teflon, and tantalum.
- composition for root canal filling may further include at least one contrast medium selected from barium oxide, barium sulfate, zirconium oxide, tantalum oxide, yttrium oxide, and calcium tungstate.
- the contrast agent may provide radiopacity to enable observation of the root canal filling composition in radiographs.
- the composition for root canal fillings of the present invention may further include various additives.
- Another aspect of the present invention is a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the poly
- a root canal capping method including the step of placing a recombinant vector containing nucleotides into the root canal.
- Another aspect of the present invention is a root canal filling method comprising placing a peptide containing the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE), a polynucleotide encoding the peptide, or a recombinant vector containing the polynucleotide into the root canal.
- the present invention provides a composition for pulp-capping agent.
- pulp restoration material refers to a material applied to the upper part of the cut pulp tissue after removing the exposed pulp tissue to maintain the vitality of the pulp-exposed tooth in the partial pulp amputation method, which is a conservative treatment of teeth.
- composition for pulp restoration material may further include the same materials as those added to the composition for root canal filling material described above, and the material further included in the composition for pulp restoration material is the content of the added material described in the composition for root canal filling material. is used and is not explained redundantly to avoid excessive complexity of the specification.
- Another aspect of the present invention is a peptide consisting of a contiguous 12 to 173 amino acid sequence including the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE) within the amino acid sequence of SEQ ID NO: 2, a polynucleotide encoding the peptide, or the poly
- a pulp-capping method comprising placing a recombinant vector containing nucleotides in a pulp is provided.
- Another aspect of the present invention is a method for denuding teeth, comprising the step of placing a peptide containing the amino acid sequence of SEQ ID NO: 1 (RVYFFKGKQYWE), a polynucleotide encoding the peptide, or a recombinant vector containing the polynucleotide into the dental pulp.
- vitronectin-derived functional peptide of the present invention Using the vitronectin-derived functional peptide of the present invention, cell adhesion, cell spreading, and cell migration of pulp cells can be increased, and differentiation of pulp cells into odontoblasts can be promoted.
- the peptide of the present invention has the activity of promoting dentin regeneration, so it can be usefully used as an active ingredient in dental materials related to dentin regeneration, such as root canal fillers and pulp restoration materials, and can also be used as a treatment for pulp diseases. can be used
- Figure 1a shows hDPC human pulp cells attached to a peptide-treated plate in serum-free medium for 1 hour (top panel) and the spread of human pulp cells after 3 hours (bottom panel).
- Figure 1b quantifies the degree of cell attachment and proliferation of human dental pulp cells with respect to the immobilized peptide.
- Figure 1c shows scratch wound movement after applying scratch stimulation to 80% confluent human pulp cells to induce horizontal movement.
- Figure 1d shows the results of measuring the cell migration area 0, 24, and 48 hours after applying scratch stimulation to human pulp cells.
- Figure 1e shows the results showing the viability of human dental pulp cells treated with VnP-16 peptide after 24 and 48 hours.
- Figures 2a to 2e show experimental results showing the activity of VnP-16 peptide in promoting differentiation and calcification of human pulp cells into odontoblast-like cells.
- Figure 2a shows the results of alkaline phosphatase (ALP) staining after treating human dental pulp cells with VnP-16 peptide to induce odontogenic differentiation for 7 days.
- ALP alkaline phosphatase
- Figure 2b shows the results of Alizarin Red S (ARS) staining after treating human dental pulp cells with VnP-16 peptide to induce odontogenic differentiation for 21 days.
- ARS Alizarin Red S
- Figure 2c quantifies the results of alkaline phosphatase (ALP) staining of human odontogenic cells in which odontogenic differentiation was induced.
- ALP alkaline phosphatase
- Figure 2d quantifies the results of Alizarin Red S (ARS) staining of human odontogenic cells in which odontogenic differentiation was induced.
- ARS Alizarin Red S
- Figure 2e shows the results of quantitative real-time polymerase chain reaction (qRT-PCR) performed on ALP, DMP1, and DSPP genes by harvesting cells on days 3, 7, and 14 after inducing odontogenic differentiation.
- qRT-PCR quantitative real-time polymerase chain reaction
- Figure 3a shows the results of quantitative histological analysis of the inflammatory response in the exposed pulp area of a rat 2 weeks after surgery.
- Figure 3b shows the results of histological quantitative analysis of the degree of restorative dentin formation in the exposed pulp area 2 weeks after pulp exposure surgery in rats.
- Figure 3c shows a cross-section of the exposed pulp area after H&E staining 2 weeks after surgery to expose the pulp of a rat.
- a mild inflammatory reaction was confirmed in all groups, except for the MTA group and the VnP-16 group. It was confirmed that no hard tissue was formed.
- Figure 4a shows the results of histological quantitative analysis of the inflammatory response in the exposed pulp area of a rat 4 weeks after pulp exposure surgery.
- Figure 4b shows the results of histological quantitative analysis of the degree of restorative dentin formation in the exposed pulp area 4 weeks after pulp exposure surgery in rats.
- Figure 4c shows a cross-section of the exposed pulp area after H&E staining 4 weeks after pulp exposure surgery in rats.
- Hard tissue was formed in all groups, but especially in the VnP-16 group, the positive control MTA group, or the rhBMP-2 group. Restorative dentin was formed thicker and more uniformly.
- Figure 5 shows the results of immunohistochemical staining using an anti-DSP antibody 2 weeks after surgery to expose the pulp of a rat.
- DSP was detected scattered along the cells in all groups except the resin-only group.
- the MTA group and VnP-16 group showed high intensity inside the calcified tissue.
- Figure 6 shows the results of immunohistochemical staining using an anti-DSP antibody 4 weeks after surgery to expose the pulp of a rat. At week 4, there was no staining in the resin-only group. As hard tissue was formed, the degree of staining decreased in the center of the exposed pulp, and rather, cells surrounding the hard tissue were observed to be stained in most groups.
- All peptides of the present invention were synthesized using a C-terminal amide and Fmoc (9-fluorenylmethoxycarbonyl)-based solid phase method in a Pioneer peptide synthesizer (Applied Biosystems). The peptides were purified and characterized by Peptron (Daejeon, Korea). The purity of all peptides used in the present invention was more than 97%.
- VnP-16 peptide of the present invention (RVYFFKGKQYWE: SEQ ID NO: 1) was used as an experimental group, human plasma vitronectin purchased from Millipore (Bedford, MA, USA) was used as a positive control, and scrambled peptide (SP) was used as a positive control.
- SP scrambled peptide
- FVWRQFYKYEKG SEQ ID NO: 3 was used as a negative control.
- hDPC human dental pulp cells
- DMEM medium Gibco BRL, Carlsbad, CA, USA
- penicillin/streptomycin 10,000 U/ml penicillin, 10,000 ⁇ g ml streptomycin; Gibco, Paisley, Scotland.
- hDPCs were cultured in DMEM supplemented with 10% FBS, 1% penicillin/streptomycin, 10mM glycerol-2-phosphate ( ⁇ -glycerophosphate), 200 ⁇ M ascorbic acid, and 0.1 ⁇ M dexamethasone to induce odontogenic differentiation. Culture was performed using medium.
- VnP-16 The viability of hDPC was examined in the presence of VnP-16 using the Cytox Cell Viability Assay Kit (DoGenBio, Seoul, Korea).
- a 96-well culture plate was treated with VnP-16 at concentrations of 50, 100, and 200 ⁇ g/ml, then 1.5 x 10 4 cells were plated in each well and cultured at 37°C for 24 or 48 hours.
- Water-soluble tetrazolium salt reagent (10 ⁇ l) was added to each well and incubated at 37°C for 2 hours. Finally, absorbance was measured at 450 nm using a microplate reader (Epoch2, Bio-Tek, VT, USA).
- a 48-well culture plate was coated with human plasma vitronectin (0.26 ⁇ g/cm 2 ) for 24 hours at 4°C.
- SP and VnP-16 (10.5 ⁇ g/cm 2 ) were also dried at room temperature for 24 hours and coated on the plate.
- Cell adhesion assays were determined from dose-response curves, and the lowest concentration showing maximum adhesion was used.
- the peptide-coated plate was blocked with PBS containing 1% heat-inactivated bovine serum albumin (BSA) for 1 hour at 37°C, and then washed again with PBS.
- hDPC cells 5 Attached cells were fixed with 10% formalin for 15 minutes and stained with 0.5% crystal violet for 1 hour.
- the plate was gently washed three times with double distilled water. Afterwards, the contents of each well were dissolved in 2% sodium dodecyl sulfate for 5 minutes, and the absorbance was measured at 570 nm using a microplate reader.
- hDPC cells (3 x 10 4 cells/250 ⁇ L) were cultured on each plate coated with peptides in the same manner as above for 3 hours at 37°C. Attached cells were fixed with 10% formalin and stained with 0.5% crystal violet for 1 hour. Then, the plate was gently washed three times with PBS, and the degree of cell spreading was assessed by measuring the surface area of the cells using Image Pro Plus software (version 4.5; Media Cybernetics, Silver Spring, MD, USA).
- hDPCs were plated in a 24-well plate and cultured in complete medium until 80% confluence. Afterwards, after subculturing in serum-free medium for 24 hours, scratch stimulation was applied with a 200 ⁇ l pipette tip. After washing the medium with PBS to remove cell debris, the cell cultures were treated with vehicle (10% DMSO), vitronectin (1.25 ⁇ g/ml), SP (50 ⁇ g/ml), or VnP-16 (50 ⁇ g/ml). . Photographs were taken using a microscope (Nikon, Tokyo, Japan) at 0, 24, and 48 hours after treatment.
- Scratch closure rate (%) [A(0) - A(t)/A(0)] ⁇ 100.
- the initial scratch area was set to “A(0)” and the area after incubation time (t) was set to “A(t)”.
- Scratch wound migration analysis was performed in triplicate.
- ALP staining was performed on day 7 after odontogenic induction using a tartrate-resistant acid phosphatase (TRAP)/ALP double staining kit (Takara, Shiga, Japan) according to the manufacturer's protocol.
- ARS staining was performed 3 weeks after odontogenic induction.
- cells were fixed with ice-cold 95% ethanol for 30 minutes at -20°C and then stained with 40 mM Alizarin red S solution (pH 4.2) for 1 hour. Stained cells were washed five times with double distilled water and then washed with PBS for 15 minutes. The plates were photographed using a microscope (Nikon, Tokyo, Japan) to visualize the mineral deposits.
- Quantitative real-time polymerase chain reaction qRT -PCR
- RNA from human dental pulp cells was performed using the RNeasy® MiniKit (QIAGEN, Valencia, CA, USA) according to the manufacturer's instructions.
- cDNA was prepared using SuperScript® IV reverse transcriptase (Invitrogen, CA, USA), and PCR amplification was performed for specific marker genes.
- cDNA was amplified using SYBR® Premix Ex TaqTM (Takara) and each primer shown in [Table 1] below at a concentration of 200 nM.
- Cycle threshold (CT) values were determined by automated threshold analysis using Sequenced Detection Software (version 1.3; Applied Biosystems) and further analyzed using Microsoft Excel. The relative expression level of each target mRNA was analyzed using the comparative cycle threshold method according to the manufacturer's (Applied Biosystems) protocol.
- GAPDH glyceraldehyde-3-phosphate dehydrogenase
- ALP alkaline phosphatase
- DMP-1 dentin matrix protein-1
- DSPP dentin sialophosphoprotein
- OC osteocalcin
- RUNX2 runt-related transcription factor 2
- mice were anesthetized by intraperitoneal injection of 31.25 mg/kg tiletamine/zolazepam and 8.75 mg/kg xylazine. After confirming general anesthesia, the oral cavity was opened using a custom-made wire to expose the mandibular first molar. After cleaning and disinfecting with a cotton soaked in 3% H 2 O 2 and 10% povidone-iodine, carefully clean the center of the occlusal surface using a #1/4 round bur (0.5 mm in diameter) mounted on a high-speed handpiece. Perforated. MTA (ProRoot MTA, Dentsply Sirona, York, PA, USA) was mixed according to the manufacturer's instructions and applied to the exposed pulp.
- MTA ProRoot MTA, Dentsply Sirona, York, PA, USA
- Vehicle (10 ⁇ L DMSO and 5 ⁇ L DDW) (vehicle (Veh) group), rhBMP-2 (2 ⁇ g per scaffold, 15 ⁇ L volume; Pepro-Tech, Rocky Hill, NJ, USA) on absorbable collagen sponges (BiolandKorea, Cheonan, Korea).
- rhBMP-2 group or synthetic peptides SP or VnP-16 (2 mg per scaffold, 15 ⁇ L volume) (SP and VnP-16 groups), respectively, were absorbed and then applied to the exposed pulp.
- the perforated area was covered with resin cement after applying MTA or collagen sponge. In the resin group, resin cement was applied directly to the perforation site.
- the sharp cusp tips of the maxillary molars and mandibular first molars were polished using a soccer ball-shaped diamond bur.
- Rats were histologically analyzed 2 and 4 weeks after pulp exposure surgery. The entire mandible was fixed in 4% paraformaldehyde for 24 h at 4°C. For histological staining, specimens were decalcified with 12% EDTA for 4 weeks and embedded in paraffin. The paraffin-embedded samples were sliced to a thickness of 5 ⁇ m, the slices were treated with anti-DSP (MABT37; Millipore, Billerica, MA, USA) according to the manufacturer's protocol, and the samples were washed with hematoxylin and eosin (H&E) solution. Counterstained and observed under a microscope. Each sample was evaluated according to the criteria presented in Table 2 below and scored for inflammatory response and hard tissue formation. In this experiment, the restorative dentin formed at the bottom of the exposed pulp area was evaluated, which is distinct from the regenerated dentin at the bottom of the existing dentin.
- H&E hematoxylin and eosin
- VnP-16 promotes attachment, spreading, and wound migration of hDPC in vitro.
- VnP-16 can induce hDPC behavior.
- human plasma vitronectin strongly promoted cell attachment and spreading.
- VnP-16 induced cell attachment and spreading at a higher level than the BSA control and SP control, which was confirmed to be similar to that of vitronectin ( Figures 1a and 1b).
- the scratch analysis results confirmed that vitronectin and VnP-16 strongly promoted wound migration of hDPC ( Figures 1c and 1d).
- VnP-16 was confirmed to be cytocompatible with no cytotoxicity toward hDPC ( Figure 1e).
- VnP-16 promotes differentiation and calcification of hDPCs into odontoblast-like cells
- VnP-16 promotes restorative dentin formation in vivo
- VnP-16 The in vivo potential of VnP-16 to induce restorative dentin formation was investigated and the inflammatory pulp response was evaluated in a rat pulp exposure model ( Figs. 3 and 4 ).
- cells arranged along the pulp had a structure with a nucleus oriented toward the pulp, and were aligned at the boundary between the formed hard tissue bridge and the pulp, making them similar to odontoblasts. .
- the MTA, rhBMP-2, SP, and VnP-16 groups showed similar levels of restorative dentin formation at week 4, but the quality of restorative dentin differed between groups ( Figure 4c). All specimens in the SP group contained hard tissue-formed but non-tubular, large cell-containing structures. It was observed that the VnP-16 group formed thicker and more uniform restorative dentin compared to the positive control groups, the MTA group and the rhBMP-2 group.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Epidemiology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Oral & Maxillofacial Surgery (AREA)
- Gastroenterology & Hepatology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Rheumatology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
본 발명은 상아질 재생 활성을 갖는 펩타이드 및 이의 용도에 관한 것이다. 본 발명의 펩타이드는 치수세포의 부착, 퍼짐 및 이동을 포함하는 치수세포의 행동을 촉진하고, 치수세포의 상아질모세포(ondontoblast)로의 분화를 촉진한다. 본 발명의 펩타이드는 치아의 회복 및 상아질 재생과 관련된 치과용 재료, 예를 들어 근관충전재 또는 치수복조재의 활성성분으로 사용될 수 있으며, 치수질환의 치료 및 예방 용도로도 활용될 수 있다.
Description
[관련출원과의 상호인용]
본 출원은 2022년 03월 11일에 출원된 한국특허출원 제10-2022-0031002호에 기초한 우선권의 이익을 주장하며, 해당 한국특허출원 문헌에 개시된 모든 내용은 본 명세서의 일부로서 포함된다.
[기술분야]
본 발명은 비트로넥틴(vitronectin) 유래 기능성 펩타이드의 상아질 재생, 치수질환의 예방 또는 치료, 치수복조재 및 근관충전재 용도에 관한 것이다.
치아는 최외층에 법랑질, 그 내층에는 상아질이라는 경조직을 가지고 있으며, 상아질 안쪽에 상아질을 생산하는 상아질모세포, 더 중심부에는 치수세포를 가진 기관이다. 치수는 치아의 내부에 있는 치수강을 채우고 있는 부드러운 결합조직으로 신경과 혈관이 풍부하게 분포되어 있으며 상아질의 표층에까지 이르는 곳을 말한다. 치수-상아질 복합체는 매우 역동적인 기능을 하는 구조물로 유해한 자극에 대하여 면역학적으로 방어하고 외상이나 감염에 대하여는 치유와 재생으로 반응하는 등 치아를 보호하는데 매우 중요한 역할을 하는 조직이다. 상아질은 발생 순서에 따라 일차 상아질(primary dentin), 이차 상아질(secondary dentin), 삼차 상아질(tertiary dentin)로 구분한다. 삼차 상아질은 치아에 치아우식, 교모, 마모, 치과보존시술 같은 유해자극이 가해지는 경우 이에 대한 반응으로 치수 쪽에서 추가로 형성된 상아질이다. 이 상아질은 기존의 상아질이 유해자극을 받은 부위에서만 형성된다. 삼차 상아질에는 반응 상아질(reactionary dentin)과 수복 상아질(reparative dentin)의 2종류가 있다. 반응 상아질은 유해자극이 약한 경우에 기존의 상아질모세포에 의해 형성되는 상아질이며, 수복 상아질은 유해자극이 심하여 일차 상아질 및 이차 상아질을 만들었던 기존의 상아질모세포가 죽고 상아질모세포유사세포(odontoblast-like cell)가 새로 분화되어 만든 상아질이다. 상아질이 손상되어 치수가 및 이로 인한 세균 감염으로 발생한 치수질환은 치근단 질환과 치주질환까지 확대될 수 있다.
치아는 태아기의 발생 과정의 유도에 의해 형성되며, 여러 개의 세포종에 의해 구축된 기능 단위로서, 기관이나 장기와 같다. 따라서, 치아는 성체 내의 조혈 줄기세포나 간엽계 줄기세포와 같은 줄기세포에서 각종 세포종으로 발생되는 줄기세포 시스템에 의해 발생하지는 않는다. 이와 같이, 치아는 성체에서는 자발적으로 재생되지 않는 특성을 가지는데 비하여, 인간의 음식 섭취나 언어 생활 등 일상생활에서 지속적으로 외부에 노출되고 사용되는 조직으로, 치아우식증이나 치주병 또는 외부적 충격 등에 의해 쉽게 소실될 수 있는 기관이다. 이에, 자발적으로 재생되지 않는 조직의 특징에 따라 최근에는 의치나 임플란트와 같은 방법으로 보충하는 경우가 많다. 그러나, 치아의 유무는 외관이나 음식물의 미각에 크게 영향을 주는바, 건강 유지나 질 높은 생활을 위해 치아 조직의 재생 기술의 개발에 대한 관심이 높아지고 있다.
치아우식치료에 사용되는 기존의 근관 충전재인 가타 퍼챠(Gutta Percha)는 가소성(plasticity) 및 조작성이 좋고, 세포 독성이 낮으며, 방사선 불투과성이고, 열과 용해제에 의해 쉽게 제거할 수 있는 장점이 있으나, 상아질과 접착하지 않아 미세 누출의 위험성이 있다. 또한 가열된 경우 식으면서 수축하게 되어 미세 누출이 발생하고, 물리적으로 근관을 폐쇄하는 능력만 있을 뿐 상아질(dentin) 유도 능력이 없어 넓은 근관 또는 미완성 치근에서의 사용이 매우 어렵고, 수복 상아질이 형성되기 전 괴사가 발생하면 치아우식증 치료의 실패가 불가피하다. 또한 과충전된 경우 제거가 어려우며 오히려 치근단 질환의 원인이 될 수 있어 이에 대한 개선이 요구되어 왔다.
대한민국 등록특허 제10-1943978호에는 경조직 및 치수조직의 재생촉진 활성을 갖는 펩타이드가 제안되어 있고, 일본 등록특허 제5519121호에는 경조직 유도 활성이 있는 상아질 포스포포린의 RGD 배열을 포함한 합성 펩타이드가 제안되어 있는 등 펩타이드와 같은 활성물질을 치수 조직 재생용도로 개발하기 위한 노력이 계속되고 있으나, 생체적합성을 가진 상아질 재생 용도의 활성물질의 개발은 아직까지 만족할 만한 성과를 거두고 있지 못하였다.
이러한 배경하에 본 발명자들은 상아질 재생용 물질을 개발하기 위해 연구 노력한 결과, 비트로넥틴(vitronectin) 유래 생리 활성 펩타이드가 치수 노출 동물 모델에서 치수세포의 상아질모세포로 분화, 세포의 행동 및 상아질의 석회화를 촉진하는 활성이 있음을 실험적으로 증명하여 본 발명을 완성하였다.
[선행기술문헌]
[특허문헌]
대한민국 등록특허 제10-1943978호
일본 등록특허 제5519121호
본 발명의 일 목적은, 비트로넥틴(vitronectin) 유래 생리 활성 펩타이드를 유효성분으로 포함하는 상아질 재생용 조성물을 제공하는 것에 있다.
또한, 본 발명의 다른 목적은 상기 펩타이드를 유효성분으로 포함하는 치수질환의 예방 또는 치료용 약학적 조성물을 제공하는 것에 있다.
또한, 본 발명의 또 다른 목적은 상기 펩타이드를 유효성분으로 포함하는, 근관충전재용 조성물을 제공하는 것에 있다.
또한, 본 발명의 또 다른 목적은 상기 펩타이드를 유효성분으로 포함하는, 치수복조재용 조성물을 제공하는 것에 있다.
본 발명의 일 측면은 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 상아질 재생용 조성물을 제공한다.
본 발명의 다른 측면은 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 치수질환의 예방 또는 치료용 조성물을 제공한다.
본 발명의 다른 측면은 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 근관충전재용 조성물을 제공한다.
본 발명의 다른 측면은 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 치수복조재용 조성물을 제공한다.
이하에서 본 발명을 상세히 설명한다.
상아질 재생용 조성물
본 발명의 일 측면은 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 상아질 재생용 조성물을 제공한다.
본 발명에서 용어 “펩타이드”는 2개 이상의 아미노산이 펩타이드 결합으로 연결된 중합체 화합물을 의미한다.
본 발명에서 상아질 재생 용도로 사용되는 펩타이드는 비트로넥틴(vitronectin) 유래 생리활성 펩타이드로서, 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드이다.
다르게 표현하면, 본 발명의 펩타이드는 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 펩타이드로서, 서열번호 2의 아미노산 서열내의 연속되는 12 내지 173개의 아미노산 서열로 이루어질 수 있다.
본 발명의 펩타이드는 서열번호 2의 아미노산 서열 내의 서열번호 1의 아미노산 서열을 포함하는 연속하는 12개 내지 173개, 연속하는 12개 내지 80개, 또는 연속하는 12개 내지 40개, 또는 12개 내지 30개, 12개 내지 25개, 12개 내지 20개, 연속하는 12개 내지 14개, 또는 연속하는 12개 내지 13개의 아미노산으로 이루어진 펩타이드로서, 상아질 재생 활성을 나타내는 펩타이드일 수 있다.
본 발명의 펩타이드는 본 발명의 펩타이드를 이루는 아미노산 서열에서 다른 아미노산이 추가되거나, 아미노산이 결실되거나, 다른 펩타이드가 융합되더라도 상아질 재생 활성을 나타내는 한, 본 발명의 펩타이드 범위에 포함된다.
상기 서열번호 2의 아미노산 서열로 이루어지는 펩타이드는 비트로넥틴 유래의 활성 펩타이드로서, 본 발명의 서열번호 1의 아미노산 서열로 이루어지는 생물학적 활성 펩타이드 모티프(motif)가 유래된 펩타이드이다.
상기 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드는 상기 생물학적 활성 펩타이드 모티프를 포함하므로, 본 발명의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)로 이루어지는 펩타이드 또는 이 아미노산 서열을 포함하는 펩타이드가 갖는 활성을 동등하게 보유한다.
본 발명에서 상아질 재생 용도로 사용되는 펩타이드는 비트로넥틴 (vitronectin) 유래 생리활성 펩타이드로서, 서열번호 1의 아미노산 서열 "RVYFFKGKQYWE" 을 포함하는 펩타이드이다.
상기 펩타이드는 상기 펩타이드의 활성에 영향을 미치지 않는 범위 내에서, 아미노산 잔기의 결실, 삽입, 치환 또는 이들의 조합에 의해 상이한 서열을 가지는 변이체 펩타이드를 포함할 수 있으며, 또는 동일한 기능을 가지는 단백질 단편의 형태일 수 있다.
상기 서열번호 1의 아미노산 서열을 포함하면서 이의 활성을 전체적으로 변경시키지 않는, 단백질 및 펩타이드 수준에서의 아미노산 변형은 본 발명의 기술분야에 공지되어 있으며, 경우에 따라서는 인산화 (phosphorylation), 황화(sulfation), 아크릴화(acrylation), 당화(glycosylation), 메틸화(methylation), 파네실화(farnesylation) 등으로 변형될 수 있다. 따라서, 상기 펩타이드는 서열번호 1의 아미노산 서열뿐만 아니라 이와 실질적으로 동일한 아미노산 서열을 갖는 펩타이드 또는 이의 변이체를 포함한다. 상기 실질적으로 동일한 아미노산 서열을 갖는 펩타이드는, 상기 서열번호 1의 아미노산 서열과 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 상동성을 가지는 아미노산 서열을 포함하는 펩타이드일 수 있으나 이에 한정되지 않으며, 상기 서열번호 1의 아미노산 서열과 90% 이상의 아미노산 서열의 상동성을 가지는 서열을 포함하면서 동일한 활성을 가지는 펩타이드라면 본 발명의 범위에 포함된다.
본 발명의 펩타이드는 서열번호 1의 아미노산 서열을 포함하면서, 상아질 재생 활성을 나타내는 20개 이하의 아미노산으로 이루어지는 것일 수 있다. 구체적으로, 상기 펩타이드는 20개 이하, 18개 이하, 15개 이하 또는 12개의 아미노산으로 이루어지는 것일 수 있다.
일 구현예에서, 상기 펩타이드는 서열번호 1의 아미노산 서열을 갖는 펩타이드일 수 있다. 본 명세서에서 상기 서열번호 1의 아미노산 서열을 갖는 펩타이드는“VnP-16 펩타이드”로도 지칭되면서 설명된다.
본 발명의 상기 펩타이드는 당해 분야에서 널리 공지된 다양한 방법으로 획득할 수 있다. 일례로서, 폴리뉴클레오타이드 재조합과 단백질 발현 시스템을 이용하여 제조하거나 펩타이드 합성과 같은 화학적 합성을 통하여 시험관 내에서 합성하는 방법, 및 무세포 단백질 합성법 등으로 제조될 수 있으나, 이의 제조방법에 의해 한정되는 것은 아니다.
또한, 본 발명의 펩타이드는 보다 나은 화학적 안정성, 강화된 약리 특성(반감기, 흡수성, 역가, 효능 등), 변경된 특이성(예를 들어, 광범위한 생물학적 활성 스펙트럼), 감소된 항원성을 획득하기 위하여, 펩타이드의 N-말단 또는 C-말단에 보호기가 결합되어 있을 수 있다. 예컨대, 상기 보호기는 아세틸기, 플루오레닐 메톡시 카르보닐기, 포르밀기, 팔미토일기, 미리스틸기, 스테아릴기 또는 폴리에틸렌글리콜(PEG)일 수 있으나, 펩타이드의 개질, 특히 펩타이드의 안정성 증진시킬 수 있는 성분이라면, 제한없이 포함할 수 있다. 상기 '안정성'은 생체 내 단백질 절단 효소의 공격으로부터 본 발명의 펩타이드를 보호하는 인 비보에서의 안정성뿐만 아니라, 저장안정성(예컨대, 상온 저장 안정성)도 의미한다.
본 발명의 펩타이드는 상아질모세포 또는 치수세포에 의한 상아질 재생을 촉진하는 활성을 가지므로, 상아질 재생 용도 또는 상아질 재생 촉진 용도로 사용될 수 있다.
본 발명의 용어 "상아질(dentin)"은 치아의 대부분을 구성하고 있는 흰색의 단단한 조직으로, 외중간엽 기원으로 교원질을 함유하고 있는 석회화 조직이다. 상아질은 치유두(dental papilla)의 외배엽성중간엽세포(ectomesenchymal cell)에서 기원하는 상아질모세포(odontoblast)에 의해 만들어진다. 치관부에서는 법랑질, 치근부에서는 백악질로 덮여있어 치아의 표면으로는 드러나지 않으나, 노화에 따라 법랑질이 마멸되면 치관의 선단부나 교합면에 상아질이 노출된다. 상아질은 보통의 뼈와 다르게, 상아질을 만들고 있는 세포의 본체는 치수 속에 존재하고 그 돌기만 상아질 속으로 뻗어나와 있다. 상아질을 형성하는 상아질모세포가 치수에 존재하기 때문에 치수와 상아질이 하나의 기능적 단위인 상아질-치수복합체(dentin-pulp complex)로 간주된다.
본 발명에서 용어 “치수(dental pulp)”는 치아의 내부에 있는 치수강(pulp chamber)을 채우고 있는 부드러운 결합조직과 상아질모세포(odontoblast)로 이루어져 있는 부분이고, 신경과 혈관이 풍부하게 분포해 있으며, 상아질(dentin)을 형성하는 기능을 담당한다.
본 발명에서 상아질은 수복 상아질(reparative dentin) 또는 반응 상아질(reactionary dentin)일 수 있다. 본 발명의 펩타이드는 상아질, 구체적으로 수복 상아질 또는 반응 상아질의 재생 또는 형성을 촉진한다. 수복 상아질과 반응 상아질은 삼차상아질의 일종으로, 삼차상아질은 치아에 치아우식증, 교모, 마모, 치과보존시술 같은 유해자극이 가해지는 경우 이에 대한 반응으로 치수 쪽에서 추가로 형성된 상아질이다. 상기 수복 상아질은 기존의 상아질이 유해자극을 받은 부위에서만 형성되며, 일차상아질 및 이차상아질을 만들었던 기존의 상아질모세포가 죽고 치수세포로부터 새로 분화된 상아질모세포-유사세포(odontoblast-like cell)에 의해 형성되는 형성한 상아질이다. 상기 반응 상아질은 유해자극이 약한 경우에, 유해자극에서 살아남은 기존의 유사분열된 상아질모세포(postmitotic odontoblasts)에 의해 형성되는 상아질이다.본 발명에서 상아질은 치수가 노출된 상아질일 수 있다. 구체적으로, 상기 상아질은 치아가 손상되어 치아 내의 치수가 외부로 노출된 것일 수 있다. 본 명세서의 실시예에서, 본 발명의 펩타이드는 쥐(rat)의 치수노출 동물 모델에서 균일하고 두꺼운 경조직 형성을 촉진함을 확인하였다. 본 발명의 상아질 재생용 조성물은 치수복조(pulp-capping)에 사용될 수 있다. 본 발명에서 용어 "상아질모세포(odontoblast)"는 상아질의 내에나멜세포에 접해있는 치유두의 표면에 존재하며, 상아질모세포가 전상아질을 만들고, 이에 석회질이 침착되어 상아질이 만들어진다. 본 발명에서 상아질모세포는 유사분열된 상아질모세포뿐 아니라 상아질모세포-유사세포(odontoblast-like cell)를 포함할 수 있다. 상기 상아질모세포-유사세포란 원래 줄기세포나, 전구세포, 치수세포 등에서 상아질모세포로 분화하도록 유도한 세포로 상아질모세포와 유사한 형질을 가지는 세포를 의미한다.
본 발명의 펩타이드는 치수세포(dental pulp cell)의 행동을 촉진하는 활성을 갖는다. 구체적으로 상기 치수세포의 행동을 촉진하는 활성은 치수세포의 부착, 퍼짐 또는 이동을 촉진하는 활성일 수 있다.
본 발명의 펩타이드는 치수세포의 부착, 퍼짐 또는 이동을 촉진하는 활성을 통해 상아질 재생 촉진 활성을 발휘한다.
본 발명의 용어 "부착(attachment)"은 세포의 부착을 의미하며, 세포끼리의 부착뿐 아니라 세포가 기질에 부착하는 현상을 포함한다. 세포의 부착능이 향상되면, 해당 부위에 세포가 용이하게 부착된다.
본 발명의 용어 “퍼짐(spreading)”은 동물세포가 기질에 접착한 후, 세포질을 기질면에 얇게 펴서 넓히는 과정 또는 세포가 기질에의 세포 부착을 완료한 상태를 의미한다. 정상적인 세포는 기반의존성이 있어, 기질에 접착하여 신전하지 않으면 증식할 수 없다. 세포 퍼짐은 세포표면 상의 세포부착수용체인 인테그린이 기질 상의 세포부착성단백질 등을 인식하여 접착함으로써 일어나고, 접착 신호가 세포내로 전달됨으로써 세포골격이 배향하여 세포질이 기질면에 얇게 넓혀진다. 세포 퍼짐은 세포 부착과는 구별되는 것으로서, 세포의 증식과 이동과 관련된 것이다.
본 발명의 용어 “이동(migration)”은 세포가 외부의 신호에 반응하여 이동하는 것을 의미한다. 세포 이동이 향상되는 경우 세포 손상 억제에 도움이 될 수 있고, 유해자극이나 상처가 있을 때 상처 회복 능력이 우수할 수 있다.
본 발명의 일 실시예에서 증명되는 바와 같이, 본 발명의 펩타이드는 인간치수세포의 부착, 퍼짐 및 이동을 강력하게 촉진하였다.
본 발명의 펩타이드는 치수세포가 상아질모세포(odontoblast) 또는 상아질모세포-유사세포(odontoblast-like cell)로의 분화되는 것을 촉진하는 활성 또는 석회화를 촉진하는 활성을 갖는다.
상기 치수세포가 상아질모세포(odontoblast) 또는 상아질모세포-유사세포(odontoblast-like cell)로 분화되는 것을 촉진하는 활성은 치성(odontogenic) 분화 마커 유전자의 mRNA 발현이나 단백질 발현을 증가시키는 활성일 수 있다. 상기 분화 마커 유전자는 ALP, DMP-1 및 DSPP으로 이루어지는 군에서 선택되는 하나 이상일 수 있다.
상기 석회화(mineralization)는 광화 또는 무기화라고도 하며, 치아의 상아질 또는 법랑질에서 주요성분인 칼슘과 인이 인회석으로 침착되어 치아를 형성하는 것을 의미한다. 석회화 과정은 치아 발달과 줄기세포에 기초한 치아 재생에 있어, 상아질모세포 분화 메커니즘에 중요한 역할을 한다. 치아의 석회화는 주로 삼차 상아질(tertiary dentin)이 침착되어 나타나는 현상으로, 삼차 상아질은 상아세관이 매우 불규칙적이어서 일반적으로 이차 상아질과 연속되지 않는 특징이 있다. 이러한 특징은 외부로부터 유해한 물질이 상아세관을 통해 치수조직으로 전달되지 않도록 보호하는 작용을 한다. 상기 석회화는 Alizarin S red(ARS) 염색 및 이의 정량분석, 알카린인산분해효소(ALP: alkaline phosphatase) 염색, 활성 및 RT-PCR (real time-PCR)로 측정될 수 있다. 그러나, 이에 제한되지 않고 더 다양한 방법으로 석회화를 측정할 수 있다. 따라서 석회화를 촉진하는 활성은 치아에서 칼슘 또는 인의 침착을 증가시켜 치아 내지 상아질의 재생을 촉진하는 활성일 수 있다.
일 구현예에서, 본 발명의 펩타이드는 본 명세서 구체적인 실시예의 실험결과로 증명되는 바와 같이, 음성대조군에 비해 ALP 또는 ARS 염색되는 정도가 확연히 증가하여 VnP-16 펩타이드가 치수세포에서 상아질모세포 또는 상아질모세포-유사세포로의 분화를 유도하고, 석회화를 촉진하는 활성이 있음을 확인하였다(도 2a 내지 도 2d).
일 구현예에서, 본 발명의 펩타이드는 본 명세서 구체적인 실시예의 실험결과로 증명되는 바와 같이 치수세포에서 ALP, DMP-1 및 DSPP 군에서 선택되는 하나 이상의 치성 분화 마커 유전자의 발현을 촉진할 수 있다.
본 발명의 조성물은 유효성분으로서 상술한 펩타이드 외에 일반적으로 상아질 재생 효과를 갖는 성분을 더 포함할 수 있다.
본 발명의 조성물은 상기 펩타이드 뿐만 아니라, 상기 펩타이드를 암호화하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함할 수 있다.
본 발명에서 용어 폴리뉴클레오티드는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 사슬모양으로 길게 이어진 뉴클레오티드의 중합체(polymer)이며, 일정한 길이 이상의 DNA 핵산 분자 또는 RNA 핵산 분자로서, 본 발명의 펩타이드를 암호화(코딩)하는 폴리뉴클레오티드를 의미한다.
본 발명의 폴리뉴클레오티드는 상기 펩타이드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 코딩영역으로부터 발현되는 펩타이드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있고, 코딩영역을 제외한 부분에서도 유전자의 발현에 영향을 미치지 않는 범위 내에서 다양한 변형 또는 수식이 이루어질 수 있다.
본 발명의 폴리뉴클레오티드는 이와 동등한 활성을 갖는 펩타이드를 코딩하는 한, 하나 이상의 핵산 염기가 치환, 결실, 삽입 또는 이들의 조합에 의해 변이될 수 있으며, 이들 또한 본 발명의 범위에 포함된다.
본 발명의 재조합 벡터는 세포 내에 도입하여 본 발명의 펩타이드를 안정적으로 발현시키기 위한 수단의 발현 컨스트럭트를 의미하며, 예를 들어 플라스미드 벡터, 코즈미드 벡터, 박테리오파아지 벡터, 바이러스 벡터 등 공지의 발현벡터를 포함하며, 이러한 재조합 벡터는 DNA 재조합 기술을 이용한 임의의 공지된 방법에 따라 당업자가 용이하게 제조할 수 있다.
본 발명의 다른 측면은, 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 치수 또는 치수세포에 접촉시키는 단계를 포함하는 상아질 재생 방법을 제공한다. 본 발명의 다른 측면은, 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 치수 또는 치수세포에 접촉시키는 단계를 포함하는 상아질 재생 방법을 제공한다.
한편, 본 발명의 상아질 재생용 조성물은 후술하는 약학적 조성물의 형태로도 제공될 수 있다.
치수질환 예방 또는 치료용 약학적 조성물
본 발명의 다른 측면은, 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 치수질환의 예방 또는 치료용 약학적 조성물을 제공한다.
상기 약학적 조성물에서, 상기 펩타이드는 서열번호 1의 아미노산 서열을 포함하는 펩타이드일 수 있다.
본 발명의 펩타이드는 상아질 재생용 조성물에서 설명된 내용을 원용하며, 중복하여 설명되지 않는다. 본 발명의 펩타이드는 상술한 바와 같이, 치수세포에서 상아질의 재생을 촉진하는 활성이 있으므로, 치수질환의 예방 또는 치료 용도로 사용될 수 있다.
상기 치수질환은 치아의 내부에 있는 치수강을 채우고 있는 부드러운 결합조직으로 신경과 혈관이 풍부하게 분포되어 있는 치수 조직에 생기는 병변을 일컫는 것이다. 상아질의 손상으로 치수가 노출되어, 치수에 물리적 화학적 또는 세균성의 자극이 가해지면 처음에는 치수의 혈관이 확장되어 충혈을 볼 수 있고(치수충혈), 이 자극이 계속되면 치수에 염증이 생긴다(치수염). 자극의 세기, 세균감염의 유무에 따라서 염증에 정도의 차이가 있는데, 단단한 상아질에 의해서 쌓여 있는 치수의 해부학적 특징 때문에 염증이 일어나면 순환장애가 일어나기 쉽고, 그대로 내버려두면 치수가 괴사하기 쉽다. 치수질환의 원인은 매우 다양하나, 대부분의 경우는 충치에 의한 세균감염과 치아의 천공, 파절, 균열, 치주낭을 통해서 치수 내부로의 감염에 의해 발생한다. 또한 외상, 마모, 치아 균열, 치료 시 치과용 기구에서 나오는 열과 마찰 등도 유발할 수 있다. 치수질환이 악화되어 치아의 뿌리와 치은까지 염증이 확산하면, 치근단 질환과 치주질환으로 확대될 수 있다. 본 발명에서 치료대상인 치수질환은 예컨대 상아질 지각과민증, 치수충혈, 치수염, 치수변성, 치수의 괴사 또는 치수의 괴저를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 용어 "예방"이란, 본 발명의 펩타이드를 포함하는 치수질환 예방 또는 치료용 약학 조성물의 투여로 치수질환의 발생을 저해 또는 지연시키는 모든 행위를 의미한다.
본 발명의 용어 "치료"란, 본 발명의 펩타이드를 유효성분으로 포함하는 약학 조성물을 치수질환의 치료가 요구되는 개체에 투여하여 상아질 또는 치수조직의 재생을 촉진함으로써, 치수질환의 치료가 수행되도록 하는 모든 행위를 의미한다.
본 발명의 약학적 조성물은 (i) 상술한 본 발명의 펩타이드, 상기 펩타이드를 암호화하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터의 치료학적 유효량(therapeutically effective amount); 및 (ii) 약학적으로 허용되는 담쳬를 포함한다.
상기 용어 “치료학적 유효량”은 본 발명의 조성물이 치수질환의 치료 또는 예방 효능을 달성하는 데 충분한 양을 의미한다.
상기 약학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있으나, 이에 한정되는 것은 아니다. 적합한 약학적으로 허용되는 담체 및 제제는 Remington: The Science and Practice of Pharmacy, (21th ed., 2006, Williams & Wilkins)에 상세히 기재되어 있다.
본 발명의 약학적 조성물은 치수질환을 치료하기 위한 적합한 모든 경로로 투여될 수 있으며, 예를 들어, 경구 또는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 치수질환이 발생한 부위에 직접 도포하거나 국소투여로 행할 수 있으며, 이외에도 정맥내 주입, 피하 주입, 근육내 주입, 복강내 주입, 경피 투여 등으로 투여할 수 있다.
본 발명의 약학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다.
본 발명의 약학적 조성물의 1일 투여량은 0.00001-10,000 ㎎/㎏이나, 이에 한정되지 않고, 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양한 투여량으로 투여될 수 있다.
본 발명의 약학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이 때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 약학적 조성물을 이용한 치수질환의 치료 방법은 직접 치수복조법(direct pulp-capping)일 수 있으나, 이에 한정되지 않고, 치수에 대한 다양한 치료방법, 예를 들어 치근단형성술(apexification), 치수보호술식(barrier technique), 간접 치수복조법(indirect pulp capping), 치수절단술(pulpotomy), 치근단절제술(pulpectomy), 치근단 주변의 경조직형성(hard tissue formation)유도, 골유도 재생술(guided bony regeneration, GBR) 및 치근천공 수복(perforation repair) 등에 이용될 수 있다. 구체적으로, 상아질이 손상되어 치수의 치아 신경이 노출됐을 때 본 발명의 조성물을 노출된 신경부위에 도포하여 치유를 돕고 이차적인 감염을 막아주는 치료법인 직접 치수복조법에 이용할 때, 효과적으로 치수질환을 치료할 수 있다.
본 발명의 약제학적 조성물은 치수조직 또는 상아질의 재생 및 염증 반응을 조절할 수 있는 약물을 더 포함할 수 있다. 예를 들어, 약물은 히스톤 디아세틸라아제(histone deacetylases) 저해제, 항산화제, 포스포리파아제(phospholipases) 및 사이클로옥시게나아제(cyclooxygenase) 저해를 주요 작용으로 하는 소염제, Wnt 신호전달조절제 및 항생제를 포함할 수 있다. 구체적으로, 추가 가능한 약물은 트리코스타틴 A (trichostatin A), 부틸레이트(butyrate), 발프로익산(valproic acid), 아피시딘 (apicidin); N-아세틸 시스테인(N-acetyl cysteine); 아스피린(Aspirin), 타이레놀(Tylenol, acetaminophen), 이부프로펜(ibuprofen), 디클로페낙 (Diclofenac), 인도메타신(indomethacin), 케토프로펜(Ketoprofen), 볼타렌(Voltaren), 펠덴(feldene), 모빅(Mobic); 페니실린(penicillin), 세팔로스포린(cephalosporin), 카나마이신(kanamycin), 겐타마이신(gentamicin), 시소마이신(sisomicin), 에리트로마이신(erythromycin), 반코마이신(vancomycin), 타이코플라닌(teicoplanin), 퀴놀론(quinoline), 이소옥사졸(isoxazole) 유도체 및 리튬클로라이드(lithium chloride)로 이루어진 군에서 선택 된 하나 이상의 약물일 수 있다.
본 발명의 다른 측면에 따르면, 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터의 치료학적 유효량을 치수질환 치료가 필요한 대상체에 투여하는 단계를 포함하는 치수질환의 치료 또는 예방하는 방법을 제공한다. 상기 대상체는 인간 또는 인간을 제외한 포유 동물을 포함할 수 있다.
근관충전재용 및 치수복조재용 조성물
본 발명의 다른 측면은, 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 근관 충전재용 조성물을 제공한다.
본 발명의 다른 측면은, 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 치수복조재용 조성물을 제공한다.
상기 조성물에서, 상기 펩타이드는 서열번호 1의 아미노산 서열을 포함하는 펩타이드일 수 있다. 본 발명에서 용어 “근관 충전(root canal capping)”은 치아의 우식치료에서 근관의 세척 후 형태 부여, 약제 처리 후 근관을 영구적으로 밀폐하는 것을 의미한다. 상기 근관 충전에 사용되는 근관 충전재는 근관 중심(core)을 채우는 거터퍼챠(gutta-percha)와 전색을 담당하는 근관 충전 실러(root canal sealer)로 구분된다. 근관충전재는 치아의 치아우식증 치료과정에서 손상되거나 감염된 치수조직을 제거하고 절단된 치수조직의 상방에 넣어 신경과 세포가 풍부한 치관부 치수조직을 밀폐하기 위해 빈 공간을 직접 메우는 재료이다. 또한 상기 근관 충전 실러는 치아의 치아우식증 치료과정에서 빈 공간을 메운 뒤 근관을 밀폐하기 위해 사용되는 것으로, 치수나 치근단 조직에 미생물이 침입할 수 없게 하거나 근관 내에 잔존한 미생물을 가두어 차단하는 역할을 한다. 또한 근관 내에 존재하는 미세 치아 근관을 폐쇄하여 동통을 방지하는 역할을 한다. 바람직한 근관충전재는 생체 적합성, 우수한 밀봉 특성, 손상된 치수 조직의 재생을 촉진하는 활성이 있어야 한다.
본 발명의 펩타이드는 상술한 바와 같이 치수세포의 행동 및 상아질모세포의 분화를 촉진하여 상아질, 특히 삼차 상아질의 재생을 촉진하는 활성을 가지므로, 근관충전재 또는 치수복조재에 포함되어 활성성분으로 사용될 수 있다.
본 발명의 펩타이드는 상아질 재생용 조성물에서 설명된 내용을 원용하며, 중복하여 설명하지 않는다.
본 발명의 근관충전재용 조성물은 치과용 근관충전재로 사용되는 재료를 더 포함할 수 있다.
상기 근관충전재용 조성물은 예를 들어, 산화아연유지놀계 실러(zinc-oxide eugenol based sealer), 레진계 실러, 수산화칼슘계 실러, 글라스아이오노머계 실러(glass ionomer based sealer), 포름알데하이드 함유 실러, 거타퍼차(gutta-percha), 클로르퍼챠(chloroperchar), 실리콘계 실러, MTA(mineral trioxide aggreate)계 실러, 칼슘-실리케이트-포스페이트계 바이오세라믹 실러, 또는 칼슘포스페이트 실러를 포함할 수 있다.
상기 산화아연유지놀계 실러는 산화아연, 및 유지놀(eugenol)을 포함하거나, 산화아연, 레진, 및 유지놀을 포함할 수 있다. 상기 레진계 실러는 에폭시 레진계 실러, 또는 메타크릴레이트 레진계 실러를 포함할 수 있다. 상기 수산화칼슘계 실러는 산화아연 유지놀 및 수산화칼슘을 포함하거나, 레진 및 수산화칼슘을 포함할 수 있다.
상기 근관충전재용 조성물은 예컨대, MTA(mineral trioxide aggregate), 거타퍼차, 산화 칼슘, 산화 아연, 레진, 에폭시 레진, 메타크릴레이트 레진, 유지놀, 산화 알루미늄, 규산 알루미늄, 이산화 규소, 실리콘, 살리실산염, 지방산, 글라스아이노머, 탄산칼슘, 규산 칼슘, 규산 삼칼슘, 수산화 칼슘, 인산 제3칼슘, 인산 제4칼슘, 인산 제8칼슘, 수산화인회석, 콜라겐, 탈회냉동건조골, 인듐박 (indium foil), 황산칼슘, 상아질 또는 백아질삭편, 골삭편, 티타늄, 키토산, 테프론 (Teflon) 및 탄탈 중 적어도 하나를 더 포함할 수 있다.
또한, 상기 근관충전재용 조성물은 산화바륨, 황산바륨, 산화지르코늄, 산화탄탈륨, 산화이트륨 및 텅스텐산 칼슘 중 선택된 적어도 하나의 조영제를 더 포함할 수 있다. 이때, 조영제는, 방사선 불투과성을 부여하여 방사선 사진에서 상기 근관 충전재용 조성물의 관찰이 가능하도록 할 수 있다. 그러나, 전술한 것에 제한되지 않고 본 발명의 근관충전재용 조성물은 보다 다양한 첨가물을 더 포함할 수 있다.
본 발명의 다른 측면은, 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 근관에 위치시키는 단계를 포함하는 근관충전(root canal capping) 방법을 제공한다.
본 발명의 다른 측면은, 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 근관에 위치시키는 단계를 포함하는 근관충전 방법을 제공한다.
본 발명은 치수복조재(pulp-capping agent)용 조성물을 제공한다.
본 발명에서 치수복조재는 치아의 보존적 치료인 부분치수절단법에서 치수노출치아의 생활력을 유지하기 위해 노출된 치수조직을 제거하고 절단된 치수조직의 상방에 적용하는 재료를 의미한다.
상기 치수복조재용 조성물은 상술한 근관충전재용 조성물에 첨가되는 재료와동일한 재료를 더 포함할 수 있으며, 상기 치수복조재용 조성물에서 더 포함되는 재료는 근관충전재용 조성물에서 설명된 첨가되는 재료에 관한 내용을 원용하며 명세서의 과도한 복잡성을 피하기 위해 중복하여 설명하지 않는다.
본 발명의 다른 측면은, 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 치수에 위치시키는 단계를 포함하는 치수복조(pulp-capping) 방법을 제공한다.
본 발명의 다른 측면은, 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 치수에 위치시키는 단계를 포함하는 치수복조 방법을 제공한다.
본 발명의 비트로넥틴 유래 기능성 펩타이드를 이용하여 치수세포의 세포부착, 세포퍼짐, 세포이동을 증가시키고, 치수세포에서 상아질모세포로의 분화를 촉진할 수 있다. 이와 같이, 본 발명의 펩타이드는 상아질 재생을 촉진하는 활성을 가지므로, 상아질의 재생과 관련된 치과용 재료, 예를 들어 근관충전재, 치수복조재의 활성성분으로 유용하게 사용될 수 있고, 치수질환 치료제로도 사용될 수 있다.
다만, 본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않은 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다.
도 1a는 무혈청 배지에서 펩타이드 처리된 플레이트에 1시간동안 부착시킨 hDPC 인간치수세포(상단 패널)와 3시간 후 인간치수세포의 퍼짐(하단 패널)을 보여주는 것이다.
도 1b는 고정된 펩타이드에 대해 인간치수세포의 세포 부착 및 확산 정도를 정량화한 것이다.
도 1c는 수평 이동을 유도하기 위해 80% 컨플루언스(confluence)된 인간치수세포에 스크래치 자극을 가한 뒤, 스크래치 상처 이동을 보여주는 것이다.
도 1d는 스 인간치수세포에 스크래치 자극을 가하고 0, 24 및 48시간 후, 세포의 이동 영역을 측정한 결과이다.
도 1e는 인간치수세포에 VnP-16 펩타이드를 처리하여 24 및 48시간이 지난 후 세포의 생존능을 보여주는 결과이다.
도 2a 내지 도 2e는 VnP-16 펩타이드가 인간치수세포의 상아질모세포-유사 세포로 분화 및 석회화를 촉진시키는 활성을 보여주는 실험결과를 나타낸 것이다.
도 2a는 인간치수세포에 VnP-16 펩타이드를 처리하여 7일 동안 치성 분화를 유도한 후 알칼리인산분해효소(ALP) 염색을 수행한 결과를 나타낸 것이다.
도 2b는 인간치수세포에 VnP-16 펩타이드를 처리하여 21일 동안 치성 분화를 유도한 후 Alizarin Red S(ARS) 염색을 수행한 결과를 나타낸 것이다.
도 2c는 치성 분화가 유도된 인간치성세포의 알칼리포스파타제(ALP) 염색 결과를 정량화한 것이다.
도 2d는 치성 분화가 유도된 인간치성세포의 Alizarin Red S(ARS) 염색 결과를 정량화 한 것이다.
도 2e는 치성 분화를 유도한 후 3, 7, 14일차에 세포를 수확하여 ALP, DMP1 및 DSPP 유전자에 대하여 정량적 실시간 중합효소 연쇄반응(qRT-PCR)을 수행한 결과를 나타낸 것이다.
도 3a는 쥐의 치수 노출 수술 2주 후, 노출된 치수부위에서 염증반응을 조직학적으로 정량 분석한 결과이다.
도 3b는 쥐의 치수 노출 수술 2주 후, 노출된 치수부위에서 수복 상아질 형성 정도를 조직학적으로 정량 분석한 결과이다.
도 3c는 쥐의 치수 노출 수술 2주 후, 노출된 치수 부위를 H&E 염색한 후의 단면을 나타낸 것으로, 모든 그룹에서 경미한 정도의 염증 반응을 확인할 수 있었으며, MTA 그룹과 VnP-16 그룹을 제외한 모든 그룹에서 경조직이 형성되지 않음을 확인할 수 있었다.
도 4a는 쥐의 치수 노출 수술 4주 후, 노출된 치수 부위에서 염증반응을 조직학적으로 정량 분석한 결과이다.
도 4b는 쥐의 치수 노출 수술 4주 후, 노출된 치수부위에서 수복 상아질 형성 정도를 조직학적으로 정량 분석한 결과이다.
도 4c는 쥐의 치수 노출 수술 4주 후, 노출된 치수 부위를 H&E 염색한 후의 단면을 나타낸 것으로, 모든 그룹에서 경조직이 형성되었으나 특히 VnP-16 그룹에서 양성 대조군인 MTA 그룹이나 rhBMP-2 그룹에 비해 더 두껍고 균일하게 수복 상아질이 형성되었다.
도 5는 쥐의 치수 노출 수술 2주 후, 항-DSP 항체를 이용하여 면역조직화학염색한 결과를 나타내 것으로, 레진 단독 그룹을 제외한 모든 그룹에서 DSP가 세포를 따라 흩어져 검출되었다. MTA 그룹과 VnP-16 그룹은 석회화된 조직 내부에서 높은 강도를 나타내었다
도 6은 쥐의 치수 노출 수술 4주 후, 항-DSP 항체를 이용하여 면역조직화학염색한 결과를 나타내 것이다. 4주차에 레진 단독 그룹은 염색이 되지 않았다. 경조직이 형성됨에 따라, 노출된 치수의 중심에서 염색 정도가 감소하였으며 오히려 대부분의 그룹에서 경조직을 둘러싼 세포가 염색된 것이 관찰되었다.
이하, 본 출원을 실시예에 의하여 상세히 설명한다. 단, 하기 실시예는 본 출원을 구체적으로 예시하는 것이며, 본 출원의 내용이 하기 실시예에 의해 한정되지 아니한다.
[실시예 1]
펩타이드(peptide) 및 시약의 준비
본 발명의 모든 펩타이드(peptide)는 Pioneer 펩타이드 합성기(Applied Biosystems)에서 C-말단에 아마이드(amide)와 Fmoc(9-fluorenylmethoxycarbonyl)-기반 고체상 방법을 이용하여 합성하였다. 펩트론(Peptron)사(대전, 한국)에서 펩타이드를 정제하고, 특징을 분석하였다. 본 발명에 사용된 모든 펩타이드의 순도는 97% 이상이었다. 실험에서는 본 발명의 VnP-16 펩타이드(RVYFFKGKQYWE: 서열번호 1)를 실험군으로 사용하였고, Millipore(Bedford, MA, USA)에서 구입한 인간 혈장 비트로넥틴을 양성 대조군으로, 망가진 펩타이드(scrambled peptide; SP)(FVWRQFYKYEKG: 서열번호 3)를 음성 대조군으로 사용하였다.
[실시예 2]
세포 배양
hDPC(human dental pulp cell, 인간치수세포)는 서울대학교 치과병원(IRB No. CRI19007)의 IRB(Institutional Review Board)의 환자 동의 및 승인을 받아 환자의 제3대구치에서 수집하였다. hDPC는 10% 소태아혈청(FBS) 및 1% 페니실린/스트렙토마이신(10,000U/ml 페니실린, 10,000㎍ ml 스트렙토마이신; Gibco, Paisley, Scotland)이 첨가된 DMEM 배지(Gibco BRL, Carlsbad, CA, USA)에서 3회 계대 배양하였다. 이후, hDPC는 치성(odontogenic) 분화를 유도하기 위해 10% FBS, 1% 페니실린/스트렙토마이신, 10mM 글리세롤-2-인산(β-glycerophosphate), 200μM 아스코르브산, 0.1μM 덱사메타손(dexamethasone)이 첨가된 DMEM 배지를 사용하여 배양하였다.
[실시예 3]
세포 생존능 분석
hDPC의 생존능을 Cytox Cell Viability Assay Kit (DoGenBio , Seoul, Korea) 를 사용하여 VnP-16 존재하에서 조사하였다. 96웰 배양 플레이트에 VnP-16을 50, 100 및 200㎍/ml의 농도로 처리한 다음, 각 웰에 1.5 x 104세포를 플레이팅하고 37°C에서 24시간 또는 48시간동안 배양하였다. 수용성 테트라졸륨염 시약(10 ㎕)을 각 웰에 첨가하고, 37℃에서 2시간 동안 배양하였다. 마지막으로 마이크로플레이트 리더(Epoch2, Bio- Tek, VT, USA)를 사용하여 450 nm에서 흡광도를 측정하였다.
[실시예 4]
hDPC 세포 부착 및 퍼짐 분석
먼저, 세포 부착 분석을 위해 48-웰 배양 플레이트를 4℃에서 24시간 동안 인간 혈장 비트로넥틴 (0.26㎍ /cm2)으로 코팅하였다. SP 및 VnP-16(10.5μg/cm2)도 실온에서 24시간 동안 건조하여 플레이트에 코팅하였다. 세포 부착 분석은 용량-반응 곡선으로부터 결정하였고, 최대 부착을 나타내는 최저 농도를 사용하였다. 펩타이드로 코팅된 플레이트를 37℃에서 1시간 동안 1% 열불활성화 소혈청 알부민(BSA)이 첨가된 PBS로 차단한 후, 다시 PBS로 세척하였다. hDPC 세포(5 x 104cell/250μL)를 각 플레이트에 첨가하고 37°C에서 1시간 동안 배양한 후, 플레이트를 PBS로 2회 세척하여 부착되지 않은 세포를 제거하였다. 부착된 세포를 10% 포르말린으로 15분 동안 고정하고 0.5% 크리스탈 바이올렛으로 1시간 동안 염색하였다. 이후 플레이트를 2차 증류수로 부드럽게 3회 세척하였고. 이후 각 well의 내용물을 2% 도데실 황산 나트륨(sodium dodecyl sulfate)에 5분간 용해시킨 후 마이크로프레이트 리더를 이용하여 570 nm에서 흡광도를 측정하였다.
또한, 세포 퍼짐 분석을 위해, 상기와 같은 방법으로 펩타이드가 코팅된 각 플레이트에 hDPC 세포(3 x 104cell/250μL)를 37°C에서 3시간 동안 배양하였다. 부착된 세포를 10% 포르말린으로 고정하고 0.5% 크리스탈 바이올렛으로 1시간 동안 염색하였다. 그런 다음, 플레이트를 PBS로 부드럽게 3회 세척한 후 Image Pro Plus 소프트웨어(버전 4.5; Media Cybernetics, Silver Spring, MD, USA)를 사용하여 세포의 표면적을 측정하여 세포 퍼짐 정도를 평가하였다.
[실시예 5]
스크래치 상처 이동 분석
hDPC의 이동 능력 및 상처 회복능력을 평가하기 위해 스크래치 분석을 수행하였다. 24웰 플레이트에서 hDPC를 플레이팅하여 완전 배지에서 80% 컨플루언스(confluence)시기까지 배양하였다. 그 후, 무혈청배지에서 24시간 계대배양한 후에 200μl 피펫 팁으로 스크래치 자극을 가하였다. PBS로 배지를 세척하여 세포 파편을 제거한 후, 세포 배양물에 비히클(10% DMSO), 비트로넥틴(1.25μg/ml), SP(50μg/ml) 또는 VnP-16(50μg/ml)를 처리하였다. 처리 후 0, 24 및 48시간이 지났을 때 현미경(Nikon, Tokyo, Japan)을 사용하여 사진을 찍었다. Image Pro Plus 소프트웨어(버전 4.5; Media Cybernetics, MD, USA)를 사용하여 데이터를 분석하여 0시간부터 48시간까지 시점까지의 스크래치 폐쇄율을 비교하였다. 스크래치 폐쇄율(%) = [A(0) - A(t)/A(0)] × 100의 식으로 계산하였다. 여기서 초기 스크래치 면적은 "A(0)"이고 배양 시간(t) 후의 면적은 "A(t)"으로 하였다. 스크래치 상처 이동 분석은 3번 수행하였다.
[실시예 6]
알칼리인산분해효소(Alkaline phosphatase, ALP) 및 Alizarin red S(ARS) 염색
ALP 염색은 Tartrate-resistant acid phosphatase(TRAP)/ALP 이중 염색 키트(Takara, Shiga, Japan)를 사용하여 제조사의 프로토콜에 따라 치성(odontogenic) 유도 후 7일차에 수행하였다. ARS 염색은 치성 유도 후 3주차에 수행하였다. ARS 염색을 위해 세포를 -20°C에서 30분 동안 ice-cold 95% 에탄올로 고정한 후, 40 mM Alizarin red S 용액(pH 4.2)으로 1시간 동안 염색하였다. 염색된 세포를 2차 증류수로 5회 세척한 후 PBS로 15분 동안 세척하였다. 광상을 시각화하기 위해 현미경(Nikon, Tokyo, Japan)을 사용하여 플레이트를 촬영하였다.
[실시예 7]
정량적 실시간 중합효소 연쇄 반응(qRT -PCR)
인간 치수세포(hDPCs)의 전체(total) RNA의 분리는, RNeasy® MiniKit (QIAGEN, Valencia, CA, USA)를 사용하여 제조사의 지시서에 따라 수행하였다. cDNA는 SuperScript® IV 역전사 효소(Invitrogen, CA, USA)를 사용하여 준비하고, 특정 마커 유전들에 대한 PCR 증폭을 수행하였다. cDNA를 SYBR® Premix Ex TaqTM (Takara)를 사용하고, 아래 [표 1]의 각각의 프라이머를 200 nM의 농도로 사용하여 증폭하였다. CT(cycle threshold) 값을 Sequenced Detection Software (version 1.3; Applied Biosystems)을 사용하는 자동화 역치 분석에 의해 결정하고, Microsoft Excel를 사용하여 추가 분석하였다. 각 표적 mRNA의 상대 발현 수준은 comparative cycle threshold 방법을 사용하여 제조사(Applied Biosystems)의 프로토콜에 따라 분석하였다.
| 서열번호 | 유전자 | 프라이머 | 염기서열(5'->3') |
| 4 | GAPDH | Forward | GTATCCGTTGTGGATCTGAC |
| 5 | Reverse | TGTTGAAGTCACAGGAGACA | |
| 6 | ALP | Forward | ACTGGTACTCGGACAATGAG |
| 7 | Reverse | AGACATAGTGGGAGTGCTTG | |
| 8 | DMP-1 | Forward | CACACAGTCCAGTGAAGACA |
| 9 | Reverse | ACCCGATATTCCTCACTCTC | |
| 10 | DSPP | Forward | CAGAGGTCAGGGTTCAGTTA |
| 11 | Reverse | GAGATTCTGGTTGTCCTGTG | |
| 12 | OC | Forward | CTCTCTCTGCTCACTCTGCT |
| 13 | Reverse | CGGAGTCTATTCACCACCT | |
| 14 | RUNX2 | Forward | TACTTCGTCAGCGTCCTATC |
| 15 | Reverse | CCAGACAGACTCATCCATTC |
[표 1에서, GAPDH: glyceraldehyde-3-phosphate dehydrogenase; ALP: alkaline phosphatase; DMP-1: dentin matrix protein-1; DSPP: dentin sialophosphoprotein; OC: osteocalcin; RUNX2: runt-related transcription factor 2]
[실시예 8]
쥐(Rat) 치아 치수 노출
7주령 수컷 Sprague-Dawley 쥐(rat)는 서울대학교 동물관리위원회(No. SNU-180109-2)의 승인을 받고 OrientBio에서 구입하였다. 쥐를 표준 동물 사육 조건(음식과 물에 자유롭게 접근할 수 있는 12시간 명암 주기)에서 1주일 동안 순응시킨 후 치수 복조(pulp-capping) 시술을 위해 무작위로, 자가 접착성 레진 시멘트(Resin) 그룹, ProRoot MTA(MTA) 그룹, 비히클(Veh) 그룹, rhBMP-2 그룹, SP 그룹, 및 VnP-16 그룹의 6개 그룹으로 나누었다. 레진(Resin) 그룹과 비히클(Veh) 그룹은 음성 대조군으로, MTA 그룹과 rhBMP-2 그룹은 양성 대조군으로 사용하였다. 모든 실험군에서 레진 시멘트(Rely X U-200, 3M ESPE, MN, USA)를 최종 수복물로 사용하였다.
구체적으로, 쥐에 31.25 mg/kg tiletamine/zolazepam 및 8.75 mg/kg 자일라진(xylazine)을 복강내 주사하여 마취시켰다. 전신마취를 확인한 후 맞춤형 와이어로 구강을 개방하여 하악 제1대구치를 노출시켰다. 3% H2O2와 10% 포비돈요오드를 적신 면으로 세척 및 소독한 후에, 고속 핸드피스에 장착된 #1/4 원형 버(bur)(직경 0.5mm)를 사용하여 교합면 중앙을 조심스럽게 천공하였다. MTA(ProRoot MTA, Dentsply Sirona, York, PA, USA)는 제조업체의 지침에 따라 혼합하여 노출된 치수에 도포하였다. 흡수성 콜라겐 스폰지(BiolandKorea, 천안, 한국)에 비히클(DMSO 10μL 및 DDW 5μL)(비히클(Veh) 그룹), rhBMP-2(스캐폴드당 2μg, 15μL 부피; Pepro-Tech, Rocky Hill, NJ, USA)(rhBMP-2 그룹), 또는 합성 펩타이드인 SP 또는 VnP-16 (스캐폴드당 2mg, 15μL 부피)(SP 및 VnP-16 그룹)를 각각 흡수시킨 다음 노출된 치수에 도포하였다. 천공된 부위는 MTA 또는 콜라겐 스폰지를 도포한 후 레진 시멘트로 덮었다. 레진 그룹에는 레진 시멘트를 천공 부위에 직접 도포하였다. 저작에 의한 치아 파절을 방지하기 위해 상악 대구치와 하악 제1대구치의 날카로운 교두 끝을 축구공 모양의 다이아몬드 버(bur)를 사용하여 연마하였다.
[실시예 9]
조직학적 분석
치수 노출 수술 후 2주와 4주 후에 쥐를 조직학적으로 분석하였다. 전체 하악골을 4°C에서 24시간 동안 4% 파라포름알데히드에 고정하였다. 조직학적 염색을 위해 표본을 12% EDTA로 4주간 석회질을 제거하고 파라핀에 포매(embedding)하였다. 파라핀 포매된 샘플을 5 μm 두께로 박편한 다음, 제조사 프로토콜에 따라 이 박편에 항-DSP(MABT37; Millipore, Billerica, MA, USA)을 처리한 뒤 샘플을 헤마톡실린 및 에오신(H&E) 용액으로 대조염색하고 현미경으로 관찰하였다. 하기 [표 2]에 제시된 기준에 따라 각 샘플을 평가하고 염증 반응 및 경조직 형성에 대해 점수를 매겼다. 본 실험에서는 기존 상아질 하부의 재생된 상아질과는 구분되는, 치수가 노출된 부위의 하부에 형성된 수복 상아질을 평가하였다.
| 점수 | 염증세포 침투 | 경조직 형성 |
| 1 | 없음(none): 염증성 세포가 없거나 매우 적음 | 다량(heavy): 연속적인 상아질 다리가 노출된 치수부위를 완전히 수복함. |
| 2 | 경증(mild): 상아질 다리 또는 치수 노출 부위 옆에만 염증성 세포/근관 치수 조직의 1/3까지 도달 | 보통(moderate): 불연속적인 상아질 다리가 형성되어 노출된 치수부위의 절반 이상이 수복됨. 그러나 완전히 수복되지는 않음. |
| 3 | 중등증(moderate): 관부치수 조직에서 근관 치수 조직의 최대 3분의 2까지 염증성 세포가 관찰됨 | 약간(slight): 노출된 치수 부위에서 50% 미만의 분산된 상아질 다리 형성. |
| 4 | 중증(severe): 모든 관부치수/근관 치수 조직의 3분의 2 이상이 침투하거나 괴사함 | 없음(none): 경조직 형성 없음. |
[실시예 10]
통계 분석
본 발명의 실시예에서 실험한 모든 데이터는 평균±S.D.로 나타내었고, 결과의 통계학적 분석은 STATISTICA 6.0 소프트웨어 패키지(StatSoft)를 이용하여 수행하였다. 분산 테스트의 분석을 이용하여 결과를 비교하였다. 중요한 차이점이 발견되었을 때, Scheffe's 조정을 이용하여 쌍으로 비교를 수행하였다. Two-tailed Student's t-테스트를 이용하여 통계학적 유의성을 계산하였다. 0.05 미만의 P 값의 차이는 통계적으로 유의한 것으로 간주하였다.
[실시예 11]
시험관 내에서 hDPC의 부착, 퍼짐 및 상처 이동을 촉진하는 VnP-16.
VnP-16이 hDPC 행동을 유도할 수 있는지 여부를 조사하기 위해, 상술한 실시예에 따라, hDPC 세포 부착, 세포 퍼짐 및 스크래치 상처 이동 분석을 수행하였다. 그 결과, 인간 혈장 비트로넥틴은 세포 부착 및 퍼짐을 강력하게 촉진하였다. 또한, VnP-16은 BSA 대조군 및 SP 대조군보다 더 높은 수준으로 세포 부착 및 퍼짐을 유도했으며, 이는 비트로넥틴과 유사한 수준으로 확인되었다(도 1a 및 도 1b). 또한, 스크래치 분석 결과 비트로넥틴과 VnP-16이 hDPC의 상처 이동을 강력하게 촉진한다는 것을 확인하였다(도 1c 및 도 1d). 또한, VnP-16은 hDPC에 대한 세포독성이 없어 세포적합성이 있는 것으로 확인되었다(도 1e). 이러한 실험결과는 VnP-16이 hDPC의 세포 부착 및 퍼짐을 촉진하는 데 중요한 역할을 하는 활성을 갖는 펩타이드임을 입증한다.
[실시예 12]
hDPC의 상아질모세포-유사 세포로의 분화 및 석회화를 촉진하는 VnP-16
VnP-16이 상아질모세포 분화에 미치는 영향을 평가하기 위해 hDPC를 조골세포 분화 배지(Cell Applications, San Diego, CA, USA)에서 7일(ALP) 또는 21일(ARS) 동안 배양하였다. VnP-16은 비트로넥틴과 유사한 수준으로 ALP 염색 및 ARS 염색이 증가하여 치성(odontogenic) 분화 및 석회화가 진행됨을 확인할 수 있었다(도 2a 내지 도 2d). 또한, qRT -PCR 결과, VnP-16이 ALP, DMP-1 및 DSPP를 포함한 치성 마커를 상향 조절하는 것으로 확인되었다(도 2e). 이러한 실험결과는 VnP-16 펩타이드가 비트로넥틴과 유사한 정도로 hDPC의 분화 및 석회화를 촉진한다는 것을 의미한다.
[실시예 13]
생체 내 수복 상아질 형성을 촉진하는 VnP-16
쥐의 치수 노출 모델에서 수복 상아질 형성을 유도하는 VnP-16의 생체 내 잠재력을 조사하고 염증성 치수 반응을 평가하였다(도 3 및 도 4).
치수 노출 수술 후 2주차에는 레진 단독 그룹을 제외하고는 심한 치수 염증성 반응을 보이는 표본은 없었다. rhBMP-2 그룹은 50%(표본 6개 중 3개 표본)에서 중등증(moderate)의 염증 반응이 나타났고, 수지 단독 그룹(표본 3개), 비히클 그룹(표본 6개) 및 MTA 그룹(표본 4개) 들은 1개 표본에서 중등증의 염증 반응이 나타났다(도 3a). 레진 단독 그룹, 비히클 그룹, rhBMP-2 그룹, SP 그룹에서는 치수 노출 부위에서 새로 형성된 석회화된 조직이 거의 검출되지 않은 반면(도 3b), MTA 그룹에서는 표본 4개 중 3개, VnP-16 그룹은 표본 6개 중 1개에서 치수 노출 부위를 완전히 덮는 수복 상아질이 형성되었다(도 3c, 하단 패널). MTA 그룹과 VnP-16 그룹에서 치수를 따라 배열된 세포는 치수 쪽으로 치우쳐진 핵을 가지는 구조를 가지고, 형성된 경조직 다리와 치수 사이의 경계에 정렬되어 있어 상아질모세포(odontoblast)와 유사함을 알 수 있었다.
치수 노출 수술 후 4주차에, 레진 단독 그룹의 75%(4개 중 3개)는 중등증(moderate)에서 중증(severe)의 염증 반응을 보였고, 나머지 그룹은 67%에서 100%까지 염증 반응이 경증(mild)하거나 전혀 나타나지 않았다(도 4a). 모든 그룹에서 약간(slight) 또는 다량(heavy)의 수복상아질 형성 경향을 보였으나, 레진 단독 그룹의 1개, 비히클 그룹의 1개 표본에서는 상아질 형성이 관찰되지 않았다. rhBMP-2 그룹과 VnP-16 그룹의 표본 모두 보통(moderate) 및 다량(heavy) 정도의 수복 상아질 형성을 보여주었다(도 4B). 또한, MTA, rhBMP-2, SP 및 VnP-16 그룹은 4주차에 비슷한 수복 상아질 형성 수준을 보였지만, 수복 상아질의 품질은 그룹마다 차이가 있었다(도 4c). SP 그룹의 모든 표본은 경조직이 형성되었지만 관이 없고(non-tubular), 큰 세포-포함 구조를 포함하였다. VnP-16 그룹은 양성대조군인 MTA 그룹과 rhBMP-2 그룹에 비해 더 두껍고 균일한 수복 상아질이 형성된 것이 관찰되었다.
또한, 도 5 및 도 6에 나타난 바와 같이, DSP에 대한 면역조직화학 염색은 상기 H&E 염색 결과와 일치하는 결과를 확인할 수 있었는데, 모든 그룹에서 상아질과 새로 형성된 경조직 주변에서 중요한 염색 패턴을 보였다. 이러한 실험결과들은 VnP-16 펩타이드가 염증 반응 없이 수복 상아질 형성을 촉진하는 활성이 비트로넥틴보다 우수하고, MTA 및 rhBMP2에 필적하는 정도임을 의미한다.
Claims (16)
- 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 상아질 재생용 조성물.
- 서열번호 1의 아미노산 서열을 포함하는 펩타이드, 상기 펩타이드를 암호화하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 상아질 재생용 조성물.
- 청구항 1에 있어서, 상기 상아질은 수복 상아질 또는 반응 상아질인 것인 상아질 재생용 조성물.
- 청구항 1에 있어서, 상기 상아질은 치수가 노출된 것인 상아질 재생용 조성물.
- 청구항 1에 있어서, 상기 펩타이드는 치수세포의 상아질모세포(odontoblast) 또는 상아질모세포-유사 세포(odontoblast-like cell)로의 분화를 촉진하는 것인, 상아질 재생용 조성물.
- 청구항 1에 있어서, 상기 펩타이드는 치수세포의 행동을 촉진하는 것인, 상아질 재생용 조성물.
- 청구항 6에 있어서, 상기 치수세포의 행동은 치수세포의 부착, 퍼짐 또는 이동인 것인, 상아질 재생용 조성물.
- 청구항 1에 있어서, 상기 펩타이드는 치수세포 또는 상아질의 석회화를 촉진하는 것인 상아질 재생용 조성물.
- 청구항 1에 있어서, 상기 펩타이드는 ALP, DMP-1 및 DSPP로 이루어지는 군에서 선택되는 하나 이상의 유전자의 발현을 증가시키는 것인, 상아질 재생용 조성물.
- 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 치수질환의 예방 또는 치료용 약학적 조성물.
- 청구항 10에 있어서, 상기 펩타이드는 서열번호 1의 아미노산 서열을 포함하는 펩타이드인 치수질환의 예방 또는 치료용 약학적 조성물.
- 청구항 10에 있어서, 상기 치수질환은 상아질 지각과민증, 치수충혈, 치수염, 치수변성, 치수의 괴사 또는 치수의 괴저인 것인, 치수질환의 예방 또는 치료용 약학적 조성물.
- 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 근관충전재용 조성물.
- 청구항 13에 있어서, 상기 펩타이드는 서열번호 1의 아미노산 서열을 포함하는 펩타이드인 것인, 근관충전재용 조성물.
- 서열번호 2의 아미노산 서열내의 서열번호 1의 아미노산 서열(RVYFFKGKQYWE)을 포함하는 연속하는 12개 내지 173개의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는 치수복조재용 조성물.
- 청구항 15에 있어서, 상기 펩타이드는 서열번호 1의 아미노산 서열을 포함하는 펩타이드인 것인, 치수복조재용 조성물.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18/557,532 US20240207141A1 (en) | 2022-03-11 | 2023-03-06 | Peptide having reparative dentin-regenerating activity and use thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020220031002A KR102779289B1 (ko) | 2022-03-11 | 2022-03-11 | 수복상아질 재생 활성을 갖는 펩타이드 및 이의 용도 |
| KR10-2022-0031002 | 2022-03-11 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023172004A1 true WO2023172004A1 (ko) | 2023-09-14 |
Family
ID=87935380
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2023/003027 Ceased WO2023172004A1 (ko) | 2022-03-11 | 2023-03-06 | 수복 상아질 재생 활성을 갖는 펩타이드 및 이의 용도 |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20240207141A1 (ko) |
| KR (1) | KR102779289B1 (ko) |
| WO (1) | WO2023172004A1 (ko) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170203009A1 (en) * | 2014-07-14 | 2017-07-20 | Temple University-Of The Commonwealth System Of Higher Education | Biomimetic Scaffold for Regenerative Dentistry |
| US20190091373A1 (en) * | 2016-03-09 | 2019-03-28 | President And Fellows And Harvard College | Methods and compositions for dental tissue repair and/or regeneration |
| US20210077359A1 (en) * | 2017-05-10 | 2021-03-18 | Marquette University | Medical and Dental Integrated Multiphasic Biomaterials for Single or Multi-Tissue Reconstruction/Regeneration |
| US20210196802A1 (en) * | 2019-03-20 | 2021-07-01 | Takashi Saito | Pharmaceutical composition including laminin fragments to treat or prevent the disease, disorder or symptom of tooth dentin and/or dental pulp |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS5519121U (ko) | 1978-07-19 | 1980-02-06 | ||
| KR101896762B1 (ko) * | 2015-06-18 | 2018-09-11 | 서울대학교산학협력단 | 골 형성 촉진 또는 골 흡수 억제용 펩타이드 및 이의 용도 |
| KR101943978B1 (ko) | 2017-12-28 | 2019-01-30 | 주식회사 하이센스바이오 | 신규한 펩타이드 |
-
2022
- 2022-03-11 KR KR1020220031002A patent/KR102779289B1/ko active Active
-
2023
- 2023-03-06 US US18/557,532 patent/US20240207141A1/en active Pending
- 2023-03-06 WO PCT/KR2023/003027 patent/WO2023172004A1/ko not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170203009A1 (en) * | 2014-07-14 | 2017-07-20 | Temple University-Of The Commonwealth System Of Higher Education | Biomimetic Scaffold for Regenerative Dentistry |
| US20190091373A1 (en) * | 2016-03-09 | 2019-03-28 | President And Fellows And Harvard College | Methods and compositions for dental tissue repair and/or regeneration |
| US20210077359A1 (en) * | 2017-05-10 | 2021-03-18 | Marquette University | Medical and Dental Integrated Multiphasic Biomaterials for Single or Multi-Tissue Reconstruction/Regeneration |
| US20210196802A1 (en) * | 2019-03-20 | 2021-07-01 | Takashi Saito | Pharmaceutical composition including laminin fragments to treat or prevent the disease, disorder or symptom of tooth dentin and/or dental pulp |
Non-Patent Citations (2)
| Title |
|---|
| PARK C., SONG M., KIM S.Y., MIN B.M.: "Vitronectin-Derived Peptide Promotes Reparative Dentin Formation", JOURNAL OF DENTAL RESEARCH, INTERNATIONAL ASSOCIATION FOR DENTAL RESEARCH, US, vol. 101, no. 12, 1 November 2022 (2022-11-01), US , pages 1481 - 1489, XP093089714, ISSN: 0022-0345, DOI: 10.1177/00220345221101506 * |
| PARK CHO-YEON: "Effects of vitronectin-derived bioactive peptide on reparative dentinogenesis in rats ", PH.D. THESIS, GRADUATE SCHOOL OF DENTISTRY, SEOUL NATIONAL UNIVERSITYCHO-YEON, 1 February 2021 (2021-02-01), XP093089713, Retrieved from the Internet <URL:https://s-space.snu.ac.kr/handle/10371/176184> [retrieved on 20231009] * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20230133704A (ko) | 2023-09-19 |
| US20240207141A1 (en) | 2024-06-27 |
| KR102779289B1 (ko) | 2025-03-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Morotomi et al. | Current and future options for dental pulp therapy | |
| Brännström | The cause of postrestorative sensitivity and its prevention | |
| de Souza Costa et al. | Short-term evaluation of the pulpo-dentin complex response to a resin-modified glass-ionomer cement and a bonding agent applied in deep cavities | |
| Callis et al. | Tissue response to retrograde root fillings in the ferret canine: a comparison of a glass ionomer cement and gutta-percha with sealer | |
| PL204797B1 (pl) | Zastosowanie preparatów aktywnej substancji szkliwa | |
| JPH05505170A (ja) | 成長因子による口内粘膜炎の治療および予防 | |
| Medina et al. | Histopathologic study on pulp response to single-bottle and self-etching adhesive systems | |
| WO2019216568A1 (ko) | 상아질 지각과민증 완화를 위한 치약 조성물 | |
| SK12362000A3 (sk) | Prostriedky na báze proteínov matrice na hojenie rán | |
| Rungvechvuttivittaya et al. | Responses of macrophage-associated antigen-expressing cells in the dental pulp of rat molars to experimental tooth replantation | |
| WO1996025944A1 (en) | Remedies for arthrosis deformans and inflammatory joint diseases | |
| ES2334977T3 (es) | Composiciones de proteinas de la matriz para la regeneracion de dentina. | |
| JPH11501029A (ja) | モルフォゲン誘導性ぞうげ質再生 | |
| WO2019132353A1 (ko) | Cpne4 단백질을 포함하는 상아질-치수질환 또는 치주질환 예방 또는 치료용 약학적 조성물 | |
| WO2019143070A1 (ko) | Cpne7의 치주인대 재생 용도 | |
| US10016492B2 (en) | Methods for extracting a tooth | |
| WO2016137267A2 (ko) | 법랑모세포 배양액을 포함하는 치주질환 치료용 약학 조성물 | |
| KR102779289B1 (ko) | 수복상아질 재생 활성을 갖는 펩타이드 및 이의 용도 | |
| HÖRSTED et al. | Monkey pulp reactions to restorative materials | |
| REDDY et al. | Comparative evaluation of formocresol, propolis and growth factor as pulpotomy medicaments in deciduous teeth-an invivo study. | |
| JPH0912473A (ja) | ムチン産生促進剤 | |
| Aiuto et al. | The application of nanomaterials for the rescue of a single compromised tooth with a multidisciplinary approach: case report and scoping review | |
| Weiner et al. | Identification of axons in the peri-implant region by immunohistochemistry. | |
| CN113784726B (zh) | 非细胞根管填料以及非细胞牙体组织再生促进试剂盒 | |
| Pilloni et al. | Molecular Analysis of Peri-implant Soft Tissue Response to Different Abutment Materials in Humans: A Pilot Study. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23767105 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 18557532 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 23767105 Country of ref document: EP Kind code of ref document: A1 |