WO2023146230A1 - 단백질 발현을 위한 mrna와 이를 위한 주형 - Google Patents

단백질 발현을 위한 mrna와 이를 위한 주형 Download PDF

Info

Publication number
WO2023146230A1
WO2023146230A1 PCT/KR2023/001035 KR2023001035W WO2023146230A1 WO 2023146230 A1 WO2023146230 A1 WO 2023146230A1 KR 2023001035 W KR2023001035 W KR 2023001035W WO 2023146230 A1 WO2023146230 A1 WO 2023146230A1
Authority
WO
WIPO (PCT)
Prior art keywords
utr
region
nucleotide sequence
mrna
seq
Prior art date
Application number
PCT/KR2023/001035
Other languages
English (en)
French (fr)
Inventor
정운희
김정인
서기원
Original Assignee
에스케이바이오사이언스 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 에스케이바이오사이언스 주식회사 filed Critical 에스케이바이오사이언스 주식회사
Publication of WO2023146230A1 publication Critical patent/WO2023146230A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • the present invention relates to mRNA for protein expression and a template therefor.
  • mRNA has recently been attracting attention as an active pharmaceutical ingredient (API) of pharmaceuticals.
  • API active pharmaceutical ingredient
  • the present invention relates to mRNA for protein expression and a template therefor.
  • An object of the present invention is to provide an mRNA transcription vector comprising a promoter region recognized by RNA polymerase and a gene construct operably linked to the promoter region.
  • Another object of the present invention is to provide a method for preparing an mRNA molecule, comprising the step of performing transcription using the mRNA transcription vector as a template.
  • Another object of the present invention is to provide the prepared mRNA molecule.
  • Another object of the present invention is to provide a pharmaceutical composition comprising the prepared mRNA molecule as an active ingredient.
  • Another object of the present invention is to provide a use of the mRNA transcription vector for preparing mRNA and a pharmaceutical composition.
  • the target protein can be expressed in large quantities and obtained.
  • Figure 1 shows the mRNA transcription vector prepared in Example 1.
  • One aspect of the present invention is an mRNA transcription vector.
  • the mRNA transcription vector includes a promoter region recognized by RNA polymerase, and a gene construct operably linked to the promoter region.
  • the gene construct As one embodiment, the gene construct
  • ORF open reading frame
  • the 3'-UTR region consists of SEQ ID NO: 1 or a nucleotide sequence having 90% or more sequence identity therewith, or the 5'-UTR region is SEQ ID NO: 47 or 90% or more sequence identity therewith It is characterized in that it consists of a nucleotide sequence having.
  • the 3'-UTR region included in the mRNA expression vector according to any one of the preceding embodiments consists of SEQ ID NO: 1 or a nucleotide sequence having 90% or more sequence identity therewith, and the 5'-UTR is SEQ ID NO: 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 19, 20, 21, 22, 23, 42 or a nucleotide sequence having at least 90% sequence identity thereto.
  • the 5'-UTR region included in the mRNA expression vector according to any one of the preceding embodiments consists of SEQ ID NO: 47 or a nucleotide sequence having 90% or more sequence identity therewith, and the 3'-UTR region is SEQ ID NO: 50 or 51 , 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 or a nucleotide sequence having at least 90% sequence identity therewith.
  • the gene construct included in the mRNA expression vector includes (1) a 5'-untranslated region (5'-UTR) region, (2) the 5'-UTR an open reading frame (ORF) region comprising a nucleotide sequence encoding a protein of interest, operably linked to the region, and (3) a 3'-untranslated region operably linked to the open reading frame region; (3'-Untranslated region: 3'-UTR) region, wherein the 3'-UTR region consists of SEQ ID NO: 1 or a nucleotide sequence having at least 90% sequence identity therewith, or the 5'-UTR region is It consists of SEQ ID NO: 47 or a nucleotide sequence having 90% or more sequence identity therewith, but when the 3'-UTR region consists of SEQ ID NO: 1 or a nucleotide sequence having 90% or more sequence identity therewith, the 5'-UTR region is sequence No.
  • the 3'-UTR region is SEQ ID NO: 50, 51, 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 or a nucleotide sequence having at least 90% sequence identity therewith.
  • the open reading frame region included in the mRNA expression vector according to any one of the preceding embodiments is characterized in that it includes a nucleotide sequence encoding an antigen.
  • the open reading frame region included in the mRNA expression vector according to any one of the preceding embodiments is characterized in that it includes a nucleotide sequence encoding an antigen derived from a pathogen.
  • the pathogen is a virus, bacterium, prion, fungus, protozoon, viroid, and parasite ( parasite).
  • the gene construct included in the mRNA expression vector according to any one of the preceding embodiments further comprises a nucleotide sequence transcribed as a 5' Cap operably linked to the 5'-UTR. do.
  • the gene construct included in the mRNA expression vector according to any one of the preceding embodiments is characterized in that it further comprises a nucleotide sequence transcribed into a poly A tail operably linked to the 3'-UTR region.
  • the poly A tail included in the mRNA expression vector according to any one of the preceding embodiments is characterized in that it includes 20 to 200 adenines.
  • the mRNA expression vector according to any one of the preceding embodiments is characterized in that it is a plasmid.
  • the mRNA expression vector according to any one of the preceding embodiments is characterized in that it is linearized.
  • Another aspect of the present invention is a method for producing an mRNA molecule.
  • the method is characterized in that it comprises the step of performing transcription (transcription) using the mRNA transcription vector of the above-described aspect as a template.
  • the method for producing the mRNA is characterized in that it includes the step of performing in vitro transcription using the mRNA transcription vector of the above-described embodiment as a template.
  • Another aspect of the present invention is an mRNA molecule prepared by the method for producing an mRNA molecule of the above-described aspect.
  • Another aspect of the present invention is a pharmaceutical composition
  • a pharmaceutical composition comprising the mRNA molecule prepared in the above aspect as an active ingredient.
  • the pharmaceutical composition is a pharmaceutical composition for preventing or treating diseases.
  • the pharmaceutical composition is characterized in that it contains a pharmaceutically acceptable excipient.
  • the pharmaceutical composition is an immunogenic composition.
  • the mRNA molecule contained in the pharmaceutical composition according to any one of the preceding embodiments is characterized in that it forms a complex with at least one lipid component.
  • the mRNA molecules of the pharmaceutical composition according to any one of the preceding embodiments form complexes with at least one lipid component to form lipidoids, liposomes, lipid nanoparticles and/or lipoplexes. characterized by the formation of
  • composition according to any one of the preceding embodiments is characterized in that it is administered intramuscularly or subcutaneously.
  • Another aspect of the present invention is a method for preparing a pharmaceutical composition containing mRNA as an active ingredient.
  • the method is characterized in that it comprises the step of obtaining mRNA by performing transcription using the above-described mRNA transcription vector as a template.
  • Another aspect of the present invention is the use of an mRNA transcription vector for mRNA production.
  • Another aspect of the present invention is a composition for preparing a pharmaceutical composition comprising an mRNA transcription vector.
  • Another aspect of the present invention is the use of an mRNA transcription vector for preparing a pharmaceutical composition.
  • Another aspect of the present invention is (1) a 5'-untranslated region (5'-Untranslated region: 5'-UTR) region, (2) operably linked to the 5'-UTR region, encoding a target protein (3) an open reading frame (ORF) region comprising a nucleotide sequence comprising a nucleotide sequence comprising, and (3) a 3'-untranslated region (3'-UTR) operably linked to the open reading frame region. ) region, which is a genetic construct.
  • the gene construct comprises a 3'-UTR region consisting of SEQ ID NO: 1 or a nucleotide sequence having 90% or more sequence identity therewith; And a nucleotide sequence selected from SEQ ID NO: 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 19, 20, 21, 22, 23, 42 or a nucleotide sequence having at least 90% sequence identity therewith. It is characterized in that it comprises a 5'-UTR region consisting of.
  • the gene construct comprises a 5'-UTR region consisting of SEQ ID NO: 47 or a nucleotide sequence having 90% or more sequence identity therewith; And a 3'-UTR region consisting of a nucleotide sequence selected from SEQ ID NOs: 50, 51, 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 or a nucleotide sequence having 90% or more sequence identity therewith It is characterized by including.
  • nucleotide sequence of the present invention is also referred to as a "base sequence” and is a polymer of nucleotides in which nucleotide monomers are connected in a long chain shape by covalent bonds, and is also referred to as a "polynucleotide", which is a DNA or RNA strand of a certain length or more. can be referred to
  • Polynucleotides of the present invention may include modified nucleotides.
  • modified nucleotide means any non-conventional nucleoside, nucleotide or its corresponding phosphorylated form.
  • a modified nucleotide may have one or more backbone or base modifications. Examples of modified nucleotides include dI, dU, 8-oxo-dG, dX and THF, and may include other natural or non-natural nucleotides known in the art.
  • uridine present in mRNA may be present as thymidine in each DNA encoding the mRNA. It can also be appreciated that although the polynucleotide sequences presented herein reference a “T” in a representative DNA sequence, the "T” is replaced with a "U” when the sequence represents RNA.
  • non-natural means a polynucleotide, polypeptide, carbohydrate, lipid or composition that does not exist in nature.
  • Such polynucleotides, polypeptides, carbohydrates, lipids or compositions may differ in one or more aspects from natural polynucleotides, polypeptides, carbohydrates, lipids or compositions.
  • polymers eg, polynucleotides, polypeptides, or carbohydrates
  • polymers may differ in the type and arrangement of their constituent building blocks (eg, nucleotide sequence, amino acid sequence, or sugar molecule). Polymers may differ from natural polymers in terms of the molecule(s) linking them.
  • operably linked means a configuration in which regulatory sequences are placed in appropriate positions so that the regulatory sequences control transcription of coding sequences, and for the purpose of the present invention, nucleotide sequences are functionally linked so that mRNA transcription can occur. means that it is connected to
  • mRNA transcription vector refers to a vector containing the template strand of mRNA transcription.
  • the vector of the present invention may include a promoter capable of initiating transcription, an operator sequence for regulating the promoter, a sequence encoding a target mRNA, and a sequence regulating termination of transcription and translation.
  • the vector of the present invention may include a restriction enzyme binding site for easy cloning.
  • the promoter included in the vector of the present invention may be any promoter for any DNA-dependent RNA polymerase.
  • a promoter sequence having high binding affinity to RNA polymerase may be selected and used, but is not necessarily limited thereto.
  • Such vectors can be obtained by cloning a polynucleotide, such as cDNA, and introducing it into an appropriate expression cassette or vector for transcription.
  • a DNA template can be obtained by reverse transcription of mRNA or gene synthesis.
  • the vector of the present invention includes a promoter region recognized by RNA polymerase, and a gene construct operably linked to the promoter region,
  • ORF open reading frame
  • 5'UTR refers to an untranslated region present upstream of the initiation codon.
  • the 5'UTR may be involved in regulating translation of RNA and/or stabilizing mRNA.
  • the 5'UTR sequence of the present invention can be modified or optimized to improve mRNA stability and/or translation accuracy. For example, avoiding gene sequences similar to the beginning of an ORF in the 5' UTR can effectively prevent false starts of frames during mRNA translation.
  • some specific sequences can be added to the 5' UTR to improve mRNA stability and translation accuracy. For example, it can be configured to start the translation process more accurately by inserting a Kozak sequence.
  • 3'UTR refers to an untranslated region present downstream of an mRNA coding region.
  • the 3'UTR sequence of the present invention can be modified or optimized to improve mRNA stability and/or translation accuracy.
  • mRNA stability can be increased and half-life can be increased by using an appropriate sequence for the 3' UTR.
  • the mRNA transcription vector of the present invention is characterized by including a specific 5'-UTR and 3'-UTR combination.
  • the mRNA transcription vector of the present invention comprises a 3'-UTR sequence comprising SEQ ID NO: 1 or a nucleotide sequence having 90% or more sequence identity therewith; And SEQ ID NO: 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 19, 20, 21, 22, 23, 42 or at least 90% or more of the sequence selected from any one of the above sequences. and a 5'-UTR sequence comprising a nucleotide sequence selected from the group consisting of identical nucleotide sequences.
  • the mRNA transcription vector of the present invention comprises a 5'-UTR sequence comprising SEQ ID NO: 47 or a nucleotide sequence having at least 90% sequence identity therewith; And a group consisting of SEQ ID NO: 50, 51, 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 or a nucleotide sequence having at least 90% sequence identity with any one sequence selected from the above sequences. It includes a 3'-UTR sequence comprising a nucleotide sequence selected from.
  • the UTR sequence may include, consist essentially of, or consist of a nucleotide sequence represented by a specific SEQ ID NO.
  • the 5'-UTR and 3'-UTR sequences consist of a nucleotide sequence set forth in a specific SEQ ID NO or a nucleotide sequence having at least 90% sequence identity therewith.
  • the mRNA transcription vector of the present invention comprises a 3'-UTR sequence consisting of SEQ ID NO: 1 or a nucleotide sequence having 90% or more sequence identity therewith; And SEQ ID NO: 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 19, 20, 21, 22, 23, 42 or at least 90% or more of the sequence selected from any one of the above sequences. and a 5'-UTR sequence consisting of a nucleotide sequence selected from the group consisting of identical nucleotide sequences.
  • the mRNA transcription vector of the present invention comprises a 5'-UTR sequence consisting of SEQ ID NO: 47 or a nucleotide sequence having at least 90% sequence identity therewith; And a group consisting of SEQ ID NO: 50, 51, 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 or a nucleotide sequence having at least 90% sequence identity with any one sequence selected from the above sequences. It includes a 3'-UTR sequence consisting of a nucleotide sequence selected from.
  • nucleotide sequences in which some sequences are deleted, modified, substituted, or added to the extent that they have homology or identity with the nucleotide sequence of a specific sequence number and exhibit the same activity as the nucleotide sequence consisting of the sequence number are also included in the scope of the present invention.
  • homology refers to the degree of similarity between corresponding sequences in two given amino acid or base sequences and can be expressed as a percentage.
  • homology and identity are often used interchangeably.
  • Calculation of sequence identity can be performed, for example, by aligning the two sequences for optimal comparison purposes (e.g., gaps are present in one or both of a first nucleic acid sequence and a second nucleic acid sequence for optimal alignment). may be introduced, and non-identical sequences may be disregarded for comparison purposes).
  • the length of sequences to be aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% of the length of the reference sequence. % or 100%. Nucleotides are then compared at corresponding nucleotide positions.
  • tools for alignment include those of the BLAST suite (Stephen F.
  • FGSAA Fast Optimal Global Sequence Alignment Algorithm
  • the percent identity between two nucleic acid sequences can be measured using the PAM120 weighted residue table, a gap length penalty of 12 and a gap penalty of 4, according to Meyers and Miller's, incorporated into the ALIGN program (version 2.0). It can be determined using an algorithm (CABIOS, 1989, 4:11-17). The percent identity between two nucleic acid sequences can alternatively be determined using the GAP program in the GCG software package using the NWSgapdna.CMP matrix.
  • ORF open reading frame
  • ORFs refers to a segment or region of an mRNA molecule encoding a protein or polypeptide of interest. ORFs contain successive stretches of DNA beginning with an initiation codon and ending with a stop codon, and are translated by ribosomes.
  • the protein or polypeptide of interest may be an antigen.
  • antigen refers to a substance capable of being recognized by the immune system and triggering an antigen-specific immune response.
  • the antigen may be recognized by the adaptive immune system and trigger an immune response through the formation of antibodies and/or antigen-specific T cells as part of the adaptive immune response.
  • the antigen may include a peptide or protein that can be presented to T cells by MHC.
  • the antigen may be a fragment of a peptide/protein containing at least one epitope (antigen determinant), or a variant or derivative thereof.
  • the antigen may be a translation product of the aforementioned mRNA.
  • the antigen may be derived from a pathogen.
  • the pathogen is selected from the group consisting of virus, bacterium, prion, fungus, protozoon, viroid, and parasite. can However, it is not limited thereto.
  • the antigen may be a peptide or protein antigen derived from a pathogen associated with an infectious disease.
  • the antigen of the present invention may be a tumor associated antigen.
  • cancer-associated antigens include tissue differentiation antigens, tumor germline antigens (e.g. NY-ESO-1 or MAGE-3), and normal proteins overexpressed by tumor cells (e.g. EGFR, Muc-1, Her2/neu). , oncoviral proteins (eg EBV, HPV), tumor-specific mutant antigens (eg Mum-1, ⁇ -Catenin or CDK4).
  • These antigens may be individualized cancer antigens or tissue specific. However, it is not limited to the above example.
  • the target protein may be a protein involved in preventing or treating a disease.
  • the protein may be selected from a chimeric antigen receptor (CAR) capable of recognizing a target antigen, an immunostimulatory cytokine polypeptide, and telomerase reverse transcriptase.
  • CAR chimeric antigen receptor
  • the protein may be related to the prevention or treatment of metabolic diseases including obesity.
  • target proteins include, but are not limited to, FGF21 (Fibroblast growth factor 21) and leptin.
  • the mRNA transcription vector of the present invention may further include a nucleotide sequence transcribed with 5'Cap.
  • 5' Cap means a modified entity that caps the ends of mRNA.
  • a 5' cap can generally be formed by modification, eg, a guanine derivative.
  • the 5' cap may be linked to the 5' end through a 5' -> 5' triphosphate bond.
  • the 5' cap may be methylated.
  • capping may be performed together with transcription by adding a cap analogue during in vitro transcription. This is also called co-transcriptional capping.
  • the cap is incorporated into the RNA molecule concurrently with transcription during the in vitro transcription process.
  • capping may be performed through an enzymatic reaction after in vitro transcription. Enzymes such as triphosphatase and guanyl transferase may be involved in this enzymatic reaction.
  • the mRNA may include a 5'Cap using a method known in the art without being limited thereto.
  • the mRNA transcription vector of the present invention may include a poly A tail.
  • poly A tail refers to a contiguous or discontinuous sequence of adenylic acid residues typically located at the 3' end of an RNA molecule.
  • Such poly A tails may consist of at least 20, at least 25, at least 40, at least 60, at least 80, or at least 100, or about 200 or more adenyl (A) nucleotides; Typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% based on the number of nucleotides in the poly-A tail.
  • the tail may include a modification that delays the degradation of the mRNA, for example, the poly A tail may include 20 to 200 adenines.
  • the vector of the present invention may include a selection marker to determine whether or not the transformation occurs.
  • Markers conferring selectable phenotypes such as drug resistance, auxotrophy, and resistance to cytotoxic agents can be used, and only cells expressing the selectable marker survive or exhibit other phenotypes in the environment treated with the selective agent. Therefore, transformed cells can be selected.
  • a selection marker to determine whether or not the transformation occurs.
  • Markers conferring selectable phenotypes such as drug resistance, auxotrophy, and resistance to cytotoxic agents can be used, and only cells expressing the selectable marker survive or exhibit other phenotypes in the environment treated with the selective agent. Therefore, transformed cells can be selected.
  • “In vitro transcription” of the present invention relates to the process by which RNA is synthesized in a cell-free system (in vitro).
  • the vector of the present invention is used as a template for mRNA production.
  • vectors can be linearized prior to in vitro transcription.
  • Linearized vectors can be obtained by treating the vectors with appropriate restriction enzymes.
  • the vector of the present invention may be a plasmid.
  • vectors known in the art may be used.
  • the term "pharmaceutical composition” is a composition that can be used for preventing or treating a disease.
  • the term “immunogenicity” refers to the property of inducing an immune response when introduced into the body. Disease can be prevented by administering the immunogenic composition of the present invention to a subject. Therefore, the "pharmaceutical composition for preventing disease" of the present invention may be an "immunogenic composition” or "vaccine composition".
  • the pharmaceutical composition may include a pharmaceutically acceptable carrier, excipient, binder, carrier, preservative, buffer, It may further include an isotonic agent, an emulsifying agent, or a wetting agent.
  • RNA included in the pharmaceutical composition of the present invention may increase stability; increase in cell transfection; allowing sustained or delayed release (eg, from a depot formulation); alteration of biodistribution (eg, targeting to specific tissues or cell types); increase in translation of the encoded protein in vivo; and/or to alter the release profile of the encoded protein (antigen) in vivo.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable excipient.
  • the pharmaceutical composition may be formulated. Such formulations may be solid or liquid, or combinations thereof.
  • the mRNA included in the pharmaceutical composition of the present invention may be naked, included in a vector, or complexed with a delivery system.
  • the pharmaceutical composition of the present invention may include lipidoids, liposomes, lipoplexes, lipid nanoparticles, compound polymers, peptides/proteins, cells, nanoparticle mimics, or nanotubes as a delivery agent for delivering mRNA.
  • the mRNA and delivery agent may form a complex.
  • polyamidoamine PAA
  • poly(beta-amino-ester) PBAE
  • polyethyleneimine PEI
  • poly(l-lysine) PLL
  • spermine chitosan and/or polyurethane
  • nanoparticles include ferritin, platelet membrane-coated nanoparticles (PNP), and the like.
  • An example of a peptide/protein is protamine.
  • lipid nanoparticles for delivering mRNA may include phospholipids, structural lipids, PEG lipids, ionizable lipids, and/or quaternary amine compounds.
  • the pharmaceutical composition of the present invention may include mRNA molecules complexed with at least one lipid component.
  • the mRNA molecule may form a complex with at least one lipid component and liposomes, lipid nanoparticles, and/or lipoplexes.
  • the pharmaceutical composition of the present invention may be administered to a subject, and mRNA may be translated in vivo to produce an antigenic polypeptide (antigen).
  • antigenic polypeptide antigen
  • the pharmaceutical composition of the present invention can be administered by infusion or injection, similar to the administration of vaccines known in the art.
  • transdermal, oral, parenteral routes such as intradermal, subcutaneous, intravenous, intramuscular, intranodal and/or intraperitoneal injection, or intranasal (nasal) route of administration (eg tracheal inhalation).
  • the composition may be administered intranasally, vaginally, rectally, orally, or transdermally.
  • the vaccine composition may be administered by a “needle-free” delivery system.
  • the pharmaceutical composition of the present invention can be used to raise antibodies in mammals.
  • the pharmaceutical composition of the present invention may be provided in a single dose or multidose dose.
  • “Multi-dose” or “multi-dose” refers to a unit of preparation comprising more than one (eg, two or more) inoculated doses that can be administered to one subject or to more than one subject.
  • An immunogenic composition of the present invention may include an immunologically effective amount of a polynucleotide.
  • immunologically effective amount is an amount effective to elicit an antibody response to an antigen when administered to a subject.
  • the immunologically effective amount depends on the health and physical condition of the individual being treated, the age of the individual, the ability of the individual's immune system to synthesize antibodies, the level of protection required, the formulation of the composition, the treating physician's assessment of the medical situation, and other relevant factors. may vary depending on
  • the immunogenic composition provided in the present invention may include an adjuvant.
  • adjuvant refers to a substance used to increase the immunogenicity of the immunogenic composition of the present invention.
  • the adjuvant is often provided to enhance the immune response.
  • composition for preparing the pharmaceutical composition of the present invention may include components necessary for synthesizing RNA. Specifically, components for in vitro transcription (IVT) may be included.
  • IVTT in vitro transcription
  • the composition may include RNA polymerase.
  • the composition may include ATP, GTP, UTP, CTP or analogs thereof.
  • the composition may include a buffer solution.
  • mRNA transcription may be performed in vitro. In vitro transcription is as described above.
  • Example 1 mRNA transcription vector and production of mRNA transcript transcribed therefrom
  • mRNA transcription vectors composed of various 5'/3'-untranslated region (UTR) sequence combinations and mRNA transcripts transcribed therefrom were prepared.
  • UTR 5'/3'-untranslated region
  • d2EGFP was used as an example of the target protein.
  • the promoter region sequence, 5' UTR region sequence, ORF region sequence, 3' UTR region sequence, and poly A-tail region sequence can be operated sequentially.
  • An mRNA transcription vector was prepared using the linked structure as a basic skeleton.
  • pcDNA3.1 plasmid is used to insert the T7 promoter sequence (TAATACGACTCACTATA) 5'UTR region sequence, Kozak sequence (GCCACC), d2EGFP gene, 3'UTR region sequence, poly A sequence and Esp3I recognition site, A plasmid was constructed.
  • 3'UTR ( ⁇ -globin UTR used in Moderna vaccine) fixed sequence
  • No. origin classification gene 3'UTR sequence order number Moderna - ⁇ -globin GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTTGAATAAAGTCTGAGTGGGCGGCA
  • 5'UTR ( ⁇ -globin UTR used in Pfizer/BioNTech vaccine) fixed sequence No. origin classification gene 5'UTR sequence order number Pfizer/BioNTech - ⁇ -globin AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC 47
  • a total of 91 (specifically, Moderna Ref; A-1 to A-11; B-1 to B-10; C-1 to C-9; D-1 to D-7; E-1 to E -7; Pfizer/BioNTech Ref; F-1 to F-10; G-1 to G-10; H-1 to H-8; I-1 to I-8; J-1 to J-9) mRNA A transcription vector was constructed.
  • E. coli transformed with the prepared mRNA transcription vector plasmid was cultured, the plasmid was isolated using the CompactPrep Plasmid Midi Kit (Qiagen), and the plasmid was linearized using Esp3I restriction enzyme. After recovering the linearized plasmid using the MinElute Reaction Cleanup Kit (Qiagen), it was used in an in vitro transcription (IVT) reaction for mRNA production. To this end, after mixing the linearized plasmid DNA template according to the conditions shown in Table 14 below, the mixture was reacted at 37 °C for 2 hours.
  • IVTT in vitro transcription
  • Linearized plasmid DNA template (1ug total) 1ug/40ul Nuclease-free H 2 O Use as much as the amount to meet the total amount of 40 ul ATP 2 ul (concentration: 5 mM) CTP 2 ul (concentration: 5 mM) UTP 2 ul (concentration: 5 mM) GTP 2 ul (concentration: 5 mM) CleanCap AG (Catalog No: N-7413) 1.5 ul (concentration: 4 mM) T7 RNA Polymerase mix 2ul 10X reaction buffer 2ul (0.5X) total amount 40ul
  • RNA was precipitated by centrifugation after mixing 25ul of LiCl per 50ul of RNA and reacting at -20 ° C for 30 minutes. The RNA precipitate was washed with 70% ethanol, and the remaining ethanol was removed, followed by elution with Nuclease-free H 2 O. By treating for 5 minutes at 65 ° C. so that no precipitate remains, mRNA transcripts suitable for transfection were prepared.
  • Example 1 A total of 91 mRNA transcripts prepared in Example 1 were independently transfected into primary skeletal muscle cells (ATCC, PCS-950-010) using LipofectamineTM MessengerMAX (Thermo Fisher). Specifically, the primary skeletal muscle cells were seeded in a 24 well plate at 2 x 10 4 cells/well, and then cultured for 5 hours or more in an environment of 37° C. and 5% CO 2 to attach them. For transfection, 0.75ul of LipofectamineTM MessengerMAX was mixed with 25ul of OptiMEM (Gibco) per mRNA sample to make a MessengerMax mixture incubated at room temperature for 10 minutes, and an mRNA mixture containing 50ng of RNA transcript was prepared in 25ul of OptiMEM.
  • OptiMEM OptiMEM
  • the d2EGFP protein expression level was evaluated using Cytation 7 (BioTek). Specifically, after measuring the expression level with the GFP channel (469, 525), the fluorescence of an area included in a circle with a radius of 3200 um from the center of the well was analyzed. The minimum value of the amount of light emission was set to 5000 or more, and the size of the cells to be analyzed was set to 30um to 200um. Then, the total amount of light emission was measured by multiplying the analyzed mean fluorescent value by the cell count. A total of 4 to 6 evaluations were performed for each mRNA transcript, and the result values were expressed as average values.
  • the GFP protein expression levels when only the 5'UTR was changed with the 3'UTR fixed are shown in Tables 15 and 16 below.
  • A-3 to A-7 (SEQ ID NOs: 5 to 9), A-9 to A-11 (SEQ ID NOs: 11 to 13); B-1 (SEQ ID NO: 14), B-3 (SEQ ID NO: 16), B-6 to B-10 (SEQ ID NOs: 19 to 23); and for E-3 (SEQ ID NO: 42),
  • F-2 to F-3 (SEQ ID NOs: 50 to 51), F-5 to F-7 (SEQ ID NOs: 53 to 55); G-2 (SEQ ID NO: 60), G-6 to G-9 (SEQ ID NO: 64 to 67); H-7 (SEQ ID NO: 75); and for J-7 (SEQ ID NO: 91),
  • Pfizer/BioNTech Ref It can be seen that relatively very good protein expression efficiency is achieved compared to the comparison and other same/different tissue-derived UTR combinations. In particular, from the Fold values in parentheses, Pfizer/BioNTech Ref. The degree of superiority of the comparative protein expression efficiency can be confirmed in detail.
  • A-3 to A-7 (SEQ ID NOs: 5 to 9), A-9 to A-11 among the groups in which only the 5'UTR was changed while the 3'UTR ( ⁇ -globin UTR used in the Moderna vaccine) was fixed.
  • B-1 SEQ ID NO: 14
  • B-3 SEQ ID NO: 16
  • B-6 to B-10 SEQ ID NOs: 19 to 23
  • E-3 SEQ ID NO: 42

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 출원은 단백질 발현을 위한 mRNA와 이를 위한 주형에 관한 것으로서, 일 실시예에 따른 유전자 컨스트럭트를 포함하는 mRNA 전사 벡터, 상기 mRNA 전사 벡터를 이용하여 전사를 수행하는 단계를 포함하는 mRNA 분자를 제조하는 방법, 상기 방법에 의해 제조된 mRNA 분자, 및 상기 mRNA 분자를 유효 성분으로 포함하는 약학 조성물을 제공한다.

Description

단백질 발현을 위한 MRNA와 이를 위한 주형
본 발명은 단백질 발현을 위한 mRNA와 이를 위한 주형에 관한 것이다.
mRNA는 최근 의약품의 주약 성분 (API, Active Pharmaceutical Ingredient)으로 주목받고 있다. 이러한 mRNA를 이용한 백신의 장점은 크게 3가지가 있다. 첫째, 생산적 측면에서 과정이 비교적 간단하여 단기간에 제조 가능하여 팬데믹과 같은 긴급 상황에서 또는 변이에 대해 신속하고 유연한 대응이 가능하다. 둘째, 기능적 측면에서 세포 내 전달이 효과적으로 이뤄진다면 체액성면역(Systemic immunity)과 세포성면역(Cellular immunity)을 모두 유도 가능하여 타 종류의 백신에 비하여 보다 효과적으로 질병 예방을 기대할 수 있다. 셋째, 안전성 측면에서 부작용이 적으며, DNA와 달리 RNA는 핵으로 들어가서 인체 유전자의 변형을 일으키지 않는 큰 장점이 있다. 이에 따라 mRNA를 대량 생산하기 위한 적절한 발현 시스템의 개발이 요구된다.
본 발명은 단백질 발현을 위한 mRNA와 이를 위한 주형에 관한 것이다.
본 발명의 목적은 RNA 중합효소 (RNA polymerase)에 의해 인식되는 프로모터 영역 및 상기 프로모터 영역과 작동 가능하게 연결된, 유전자 컨스트럭트를 포함하는 mRNA 전사 벡터를 제공하는 것이다.
본 발명의 다른 목적은 상기 mRNA 전사 벡터를 주형으로 전사 (transcription)를 수행하는 단계를 포함하는, mRNA 분자를 제조하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 제조된 mRNA 분자를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 제조된 mRNA 분자를 유효성분으로 포함하는 약학 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 mRNA 전사 벡터의 mRNA 제조 용도 및 약학 조성물의 제조 용도를 제공하는 것이다.
본 발명의 특정 UTR 조합을 포함하는 mRNA 전사 벡터에 의해 타겟 단백질의 발현량을 증가시킬 수 있으므로 목적하는 단백질을 대량 발현하여 수득할 수 있다.
도 1은 실시예 1에서 제조한 mRNA 전사 벡터를 도시한 것이다.
본 발명의 하나의 양태는 mRNA 전사 벡터이다.
상기 mRNA 전사 벡터는 RNA 중합효소 (RNA polymerase)에 의해 인식되는 프로모터 영역, 및 상기 프로모터 영역과 작동 가능하게 연결된 유전자 컨스트럭트를 포함한다.
하나의 구체예로서, 상기 유전자 컨스트럭트는
(1) 5’-비번역 부위 (5’-Untranslated region: 5’-UTR) 영역,
(2) 상기 5’-UTR 영역에 작동 가능하게 연결된, 목적 단백질을 코딩하는 뉴클레오티드 서열을 포함하는 오픈 리딩 프레임 (Open reading frame: ORF) 영역, 및
(3) 상기 오픈 리딩 프레임 영역에 작동 가능하게 연결된, 3’-비번역 부위 (3’-Untranslated region: 3’-UTR) 영역을 포함하는 것을 특징으로 한다.
다른 하나의 구체예로서, 상기 3'-UTR 영역은 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지거나, 또는 상기 5'-UTR 영역은 서열번호 47 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 mRNA 발현 벡터에 포함되는 상기 3'-UTR 영역은 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지고, 5'-UTR은 서열번호 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 19, 20, 21, 22, 23, 42 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로부터 선택되는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 mRNA 발현 벡터에 포함되는 상기 5'-UTR 영역은 서열번호 47 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지고, 3'-UTR 영역은 서열번호 50, 51, 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로부터 선택되는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 mRNA 발현 벡터에 포함되는 상기 유전자 컨스트럭트는 (1) 5'-비번역 부위 (5'-Untranslated region: 5'-UTR) 영역, (2) 상기 5'-UTR 영역에 작동 가능하게 연결된, 목적 단백질을 코딩하는 뉴클레오티드 서열을 포함하는 오픈 리딩 프레임 (Open reading frame: ORF) 영역, 및 (3) 상기 오픈 리딩 프레임 영역에 작동 가능하게 연결된, 3'-비번역 부위 (3'-Untranslated region: 3'-UTR) 영역을 포함하고, 상기 3'-UTR 영역은 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지거나, 또는 상기 5'-UTR 영역은 서열번호 47 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지되, 상기 3'-UTR 영역이 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어질 경우, 5'-UTR 영역은 서열번호 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 19, 20, 21, 22, 23, 42 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로부터 선택되고, 상기 5'-UTR 영역이 서열번호 47 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어질 경우, 3'-UTR 영역은 서열번호 50, 51, 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로부터 선택되는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 mRNA 발현 벡터에 포함되는 상기 오픈 리딩 프레임 영역은 항원을 코딩하는 뉴클레오티드 서열을 포함하는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 mRNA 발현 벡터에 포함되는 상기 오픈 리딩 프레임 영역은 병원체로부터 유래되는 항원을 코딩하는 뉴클레오티드 서열을 포함하는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 mRNA 발현 벡터에서 상기 병원체는 바이러스(virus), 박테리아(bacterium), 프리온(prion), 균류(fungus), 원생동물(protozoon), 바이로이드(viroid), 및 기생동물(parasite)로 이루어진 군으로부터 선택되는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 mRNA 발현 벡터에 포함되는 상기 유전자 컨스트럭트는 상기 5'-UTR에 작동 가능하게 연결된 5' 캡 (5' Cap)으로 전사되는 뉴클레오티드 서열을 추가로 포함하는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 mRNA 발현 벡터에 포함되는 상기 유전자 컨스트럭트는 상기 3'-UTR 영역에 작동 가능하게 연결된, 폴리 A 테일로 전사되는 뉴클레오티드 서열을 추가로 포함하는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 mRNA 발현 벡터에 포함되는 상기 폴리 A 테일은 20 내지 200개의 아데닌을 포함하는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 mRNA 발현 벡터는 플라스미드인 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 mRNA 발현 벡터는 선형화된(linearized) 것을 특징으로 한다.
본 발명의 다른 하나의 양태는 mRNA 분자의 제조 방법이다.
하나의 구체예로서 상기 방법은 전술한 양태의 mRNA 전사 벡터를 주형으로 하여 전사(transcription)를 수행하는 단계를 포함하는 것을 특징으로 한다.
다른 하나의 구체예로서 상기 mRNA의 제조 방법은 전술한 양태의 mRNA 전사 벡터를 주형으로 하여 시험관내 전사(in vitro transcription)를 수행하는 단계를 포함하는 것을 특징으로 한다.
본 발명의 다른 하나의 양태는 전술한 양태의 mRNA 분자 제조 방법에 의해 제조된 mRNA 분자이다.
본 발명의 다른 하나의 양태는 전술한 양태의 제조된 mRNA 분자를 유효 성분으로 포함하는 약학 조성물이다.
하나의 구체예로서 상기 약학 조성물은 질환의 예방 또는 치료용 약학 조성물이다.
다른 하나의 구체예로서 상기 약학 조성물은 약학적으로 허용가능한 부형제를 포함하는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 구체예에서 상기 약학 조성물은 면역원성 조성물이다.
앞선 구체예 중 어느 하나에 따른 약학 조성물에 포함되는 mRNA 분자는 적어도 하나 이상의 지질 성분과 복합체를 형성하는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 약학 조성물의 mRNA 분자는 적어도 하나 이상의 지질 성분과 복합체를 형성하여, 리피도이드, 리포솜(liposomes), 지질 나노입자(lipid nanoparticles) 및/또는 리포플렉스(lipoplexes) 를 형성하는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 약학 조성물은 근육 또는 피하 투여되는 것을 특징으로 한다.
본 발명의 다른 하나의 양태는 mRNA를 유효성분으로 포함하는 약학 조성물의 제조방법이다.
하나의 구체예로서 상기 방법은 전술한 양태의 mRNA 전사 벡터를 주형으로 전사(transcription)를 수행하여 mRNA를 수득하는 단계를 포함하는 것을 특징으로 한다.
본 발명의 다른 하나의 양태는 mRNA 전사 벡터의 mRNA 제조 용도이다.
본 발명의 다른 하나의 양태는 mRNA 전사 벡터를 포함하는 약학 조성물 제조용 조성물이다.
본 발명의 다른 하나의 양태는 mRNA 전사 벡터의 약학 조성물 제조 용도이다.
본 발명의 다른 하나의 양태는 (1) 5’-비번역 부위 (5’-Untranslated region: 5’-UTR) 영역, (2) 상기 5’-UTR 영역에 작동 가능하게 연결된, 목적 단백질을 코딩하는 뉴클레오티드 서열을 포함하는 오픈 리딩 프레임 (Open reading frame: ORF) 영역, 및 (3) 상기 오픈 리딩 프레임 영역에 작동 가능하게 연결된, 3’-비번역 부위 (3’-Untranslated region: 3’-UTR) 영역을 포함하는, 유전자 컨스트럭트이다.
하나의 구체예로서 상기 유전자 컨스트럭트는 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지는 3'-UTR 영역; 및 서열번호 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 19, 20, 21, 22, 23, 42 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열 중 선택되는 뉴클레오티드 서열로 이루어지는 5'-UTR 영역을 포함하는 것을 특징으로 한다.
다른 하나의 구체예로서 상기 유전자 컨스트럭트는 서열번호 47 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지는 5'-UTR 영역; 및 서열번호 50, 51, 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로부터 선택되는 뉴클레오티드 서열로 이루어지는 3'-UTR 영역을 포함하는 것을 특징으로 한다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 발명에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 발명에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 발명에 기재된 본 발명의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 발명에 포함되는 것으로 의도된다.
또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명의 "뉴클레오티드 서열"은 "염기서열"로도 지칭되며 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥인 "폴리뉴클레오티드"로도 지칭 될 수 있다.
본 발명의 폴리뉴클레오티드는 변형된 뉴클레오티드를 포함할 수 있다. 본 발명에서 "변형된 뉴클레오티드"는 임의의 비-전형적인 뉴클레오시드, 뉴클레오티드 또는 이의 대응되는 인산화된 형태를 의미한다. 변형된 뉴클레오티드는 하나 이상의 백본 또는 염기 변형을 가질 수 있다. 변형된 뉴클레오티드에 대한 예로는 dI, dU, 8-옥소-dG, dX 및 THF를 포함하며, 그밖에 당업계에 공지된 천연 또는 비-천연 뉴클레오티드를 포함할 수 있다.
본 발명의 일부 구현예에서 mRNA 내에 존재하는 우리딘은 mRNA를 암호화하는 각각의 DNA 내에서는 티미딘으로서 존재할 수 있다. 또한 본 발명에 제시된 폴리뉴클레오타이드 서열이 대표적 DNA 서열에서 "T"를 인용하지만, 서열이 RNA를 나타내는 경우 "T"는 "U"로 치환된다는 것을 인식할 수 있다.
본 발명에서 용어 "비-천연"은 자연에 존재하지 않는 폴리뉴클레오티드, 폴리펩타이드, 탄수화물, 지질 또는 조성물을 의미한다. 이러한 폴리뉴클레오티드, 폴리펩타이드, 탄수화물, 지질 또는 조성물은 천연 폴리뉴클레오티드, 폴리펩타이드, 탄수화물, 지질 또는 조성물과 한가지 이상의 측면에서 상이할 수 있다. 예를 들어, 폴리머 (예, 폴리뉴클레오티드, 폴리펩타이드 또는 탄수화물)는 구성성분 빌딩 블록의 종류 및 배열 (예, 뉴클레오티드 서열, 아미노산 서열 또는 당 분자) 측면에서 다를 수 있다. 폴리머는 이를 연결하는 분자(들) 측면에서 천연 폴리머와 다를 수 있다.
본 발명에서 용어 "작동 가능하게 연결된" 이란 조절 서열이 코딩 서열의 전사를 제어하도록 조절 서열이 적절한 위치에 배치되는 구성을 의미하며, 본 발명의 목적상, mRNA 전사가 일어날 수 있도록 뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 발명에서 "mRNA 전사 벡터" 는 mRNA 전사의 주형 가닥을 포함하는 벡터를 지칭한다.
일 예로, 본 발명의 벡터는 전사를 개시할 수 있는 프로모터, 이를 조절하기 위한 오퍼레이터 서열, 목적하는 mRNA를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 일 예로, 본 발명의 벡터는 클로닝에 용이한 제한효소 결합부위를 포함할 수 있다.
일 예로, 본 발명의 벡터에 포함되는 프로모터는 임의의 DNA 의존성 RNA 중합효소를 위한 임의의 프로모터일 수 있다. 상기 프로모터는 RNA 중합효소에 대해 높은 결합 친화도를 갖는 프로모터 서열을 선택하여 사용할 수 있으나 반드시 이에 제한되는 것은 아니다.
상기 벡터는 폴리뉴클레오티드, 예컨대 cDNA를 클로닝하고 전사를 위한 적절한 발현 카세트 혹은 벡터에 도입함으로써 수득할 수 있다. mRNA의 역전사 또는 유전자 합성에 의해 DNA 주형이 수득될 수 있다.
본 발명의 벡터는, RNA 중합효소 (RNA polymerase)에 의해 인식되는 프로모터 영역, 및 상기 프로모터 영역과 작동 가능하게 연결된 유전자 컨스트럭트를 포함하고,
(1) 5'-비번역 부위 (5'-Untranslated region: 5'-UTR) 영역,
(2) 상기 5'-UTR 영역에 작동 가능하게 연결된, 목적 단백질을 코딩하는 뉴클레오티드 서열을 포함하는 오픈 리딩 프레임 (Open reading frame: ORF) 영역, 및
(3) 상기 오픈 리딩 프레임 영역에 작동 가능하게 연결된, 3'-비번역 부위 (3'-Untranslated region: 3'-UTR) 영역을 포함한다.
본 발명에서 "5'UTR"은 개시 코돈의 상류(upstream)에 존재하는 비번역 영역을 지칭한다. 상기 5'UTR은 RNA의 번역을 조절하거나/하고 mRNA를 안정화하는데 관여할 수 있다.
본 발명의 5'UTR 서열은 mRNA의 안정성 및/또는 번역의 정확성을 향상시키도록 변형 또는 최적화 될 수 있다. 예를 들어 5' UTR에 ORF의 시작부분과 유사한 유전자 서열을 피하면 mRNA 번역 시에 frame의 잘못된 시작을 효과적으로 방지할 수 있다. 또한, mRNA의 안정성과 번역의 정확성을 향상시키기 위해 일부 특정 서열을 5' UTR에 추가할 수 있다. 예를 들어 Kozak 시퀀스를 삽입하여 번역 프로세스를 보다 정확하게 시작하도록 구성할 수 있다.
본 발명에서 "3'UTR"은 mRNA의 코딩 영역의 하류(downstream)에 존재하는 비번역 영역을 지칭한다.
본 발명의 3'UTR 서열은 mRNA의 안정성 및/또는 번역의 정확성을 향상시키도록 변형 또는 최적화 될 수 있다. 일 예로, 3' UTR에 적절한 서열을 사용하여 mRNA 안정성을 높일 수 있고, 반감기를 늘릴 수 있다
본 발명의 mRNA 전사 벡터는 특정 5'-UTR과 3'-UTR 조합을 포함하는 것을 특징으로 한다.
일 구현예에서, 본 발명의 mRNA 전사 벡터는 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열을 포함하는 3'-UTR 서열; 및 서열번호 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 19, 20, 21, 22, 23, 42 또는 상기 서열 중 선택되는 어느 하나의 서열과 적어도 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 구성된 군에서 선택되는 뉴클레오티드 서열을 포함하는 5'-UTR 서열을 포함한다.
일 구현예에서, 본 발명의 mRNA 전사 벡터는 서열번호 47 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열을 포함하는 5'-UTR 서열; 및 서열번호 50, 51, 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 또는 상기 서열 중 선택되는 어느 하나의 서열과 적어도 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 구성된 군에서 선택되는 뉴클레오티드 서열을 포함하는 3'-UTR 서열을 포함한다.
상기 UTR 서열은 특정 서열번호로 기재된 뉴클레오티드 서열을 포함하거나, 상기 뉴클레오티드 서열로 실질적으로 이루어지거나(consisting essentially of), 또는 이루어지는(consist of) 것일 수 있다. 본 발명의 일부 구현예에서, 5'-UTR 및 3'-UTR 서열은 특정 서열번호로 기재된 뉴클레오티드 서열 또는 그와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어진다.
일 구현예에서, 본 발명의 mRNA 전사 벡터는 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지는 3'-UTR 서열; 및 서열번호 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 19, 20, 21, 22, 23, 42 또는 상기 서열 중 선택되는 어느 하나의 서열과 적어도 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 구성된 군에서 선택되는 뉴클레오티드 서열로 이루어지는 5'-UTR 서열을 포함한다.
일 구현예에서, 본 발명의 mRNA 전사 벡터는 서열번호 47 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지는 5'-UTR 서열; 및 서열번호 50, 51, 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 또는 상기 서열 중 선택되는 어느 하나의 서열과 적어도 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 구성된 군에서 선택되는 뉴클레오티드 서열로 이루어지는 3'-UTR 서열을 포함한다.
또한 특정 서열번호의 뉴클레오티드 서열과 상기 상동성, 동일성을 가지며 상기 서열번호로 이루어지는 뉴클레오티드 서열과 동일한 활성을 나타내는 범위에서 일부 서열이 결실, 변형, 치환 또는 부가된 뉴클레오티드 서열 역시 본 발명의 범위에 포함된다.
용어 "상동성" 또는 "동일성"은 두 개의 주어진 아미노산 또는 염기 서열에서 상호 상응하는 서열간의 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
서열 동일성의 계산은 예를 들어 최적의 비교 목적을 위해 두 서열을 정렬함으로써 수행될 수 있다(예를 들어, 갭은 최적의 정렬을 위해 제1 핵산 서열과 제2 핵산 서열 중 하나 또는 둘 다에 도입될 수 있고, 비-동일 서열은 비교 목적을 위해 무시될 수 있다). 소정의 실시형태에서, 비교 목적을 위해 정렬되는 서열의 길이는 기준 서열 길이의 적어도 30%, 적어도 40%, 적어도 50%, 적어도 60%, 적어도 70%, 적어도 80%, 적어도 90%, 적어도 95% 또는 100%이다. 이어서, 대응하는 뉴클레오티드 위치에서 뉴클레오티드가 비교된다. 정렬을 위한 이러한 도구는 BLAST 스위트의 도구를 포함한다(Stephen F. Altschul, et al (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402). 다른 대중적인 국소 정렬 기법은 스미스-워터만(Smith-Waterman) 알고리즘에 기반한다(Smith, T.F. & Waterman, M.S. (1981) "Identification of common molecular subsequences." J. Mol. Biol. 147:195-197). 동적 프로그래밍에 기반한 일반적인 전반적 정렬 기법은 니들만-뷘시(Needleman-Wunsch) 알고리즘이다(Needleman, S.B. & Wunsch, C.D. (1970) "A general method applicable to the search for similarities in the amino acid sequences of two proteins." J. Mol. Biol. 48:443-453.). 더 최근에 알려진 바에 의하면 니들만-뷘시 알고리즘을 포함하는 최적의 전반적 정렬 방법 이외의 뉴클레오티드 및 단백질 서열의 전반적 정렬을 생성하는 빠른 최적의 전반적 서열 정렬 알고리즘(Fast Optimal Global Sequence Alignment Algorithm: FOGSAA)이 개발되었다.
서열의 비교 및 두 서열 사이의 동일성 백분율의 결정은 수학적 알고리즘을 이용하여 달성될 수 있다. 예를 들어, 두 핵산 서열 사이의 동일성 백분율은 문헌[Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; 및 Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991]에 기재된 것과 같은 방법을 이용하여 결정될 수 있다. 예를 들어, 두 핵산 서열 사이의 동일성 백분율은 PAM120 가중치 잔기 표, 12의 갭 길이 페널티 및 4의 갭 페널티를 이용하여 ALIGN 프로그램(버전 2.0)에 편입된, 마이어스(Meyers) 및 밀러(Miller)의 알고리즘(CABIOS, 1989, 4:11-17)을 이용하여 결정될 수 있다. 두 핵산 서열 사이의 동일성 백분율은, 대안으로, NWSgapdna.CMP 매트릭스를 이용하는 GCG 소프트웨어 패키지에서 GAP 프로그램을 이용하여 결정될 수 있다. 서열 사이의 동일성 백분율을 결정하기 위해 흔히 사용되는 방법은 [Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988)]에 개시된 것을 포함하지만, 이들로 제한되지 않는다. 두 서열 사이의 상동성을 결정하기 위한 예시적 컴퓨터 소프트웨어는 GCG 프로그램 패키지, 문헌[Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)], BLASTP, BLASTN 및 FASTA Altschul, 문헌[S. F. et al., J. Molec. Biol., 215, 403 (1990)]을 포함하지만, 이들로 제한되지 않는다.
본 발명에서 "오픈 리딩 프레임(Open reading frame)" 은 "ORF"로서 약칭되기도 하며, 목적하는 단백질 또는 폴리펩타이드를 코딩하는 mRNA 분자의 세그먼트 또는 영역을 지칭한다. ORF는 개시 코돈으로 시작하고 정지 코돈으로 종결되는 DNA의 연속적 신장을 포함하며, 리보솜에 의해 번역된다.
일 구현예로, 상기 목적하는 단백질 또는 폴리펩타이드는 항원일 수 있다.
본 발명에서 "항원"은 면역계에 의해 인지될 수 있고, 항원 특이적 면역 반응을 촉발시킬 수 있는 물질을 지칭한다. 예를 들어, 상기 항원은 적응 면역계에 의해 인지될 수 있고, 적응 면역 반응의 일부로 항체 및/또는 항원 특이적 T 세포의 형성을 통해 면역 반응을 촉발시킨다. 일 예로, 상기 항원은 MHC에 의해 T 세포에 제시될 수 있는 펩타이드 또는 단백질을 포함할 수 있다. 일 예로, 상기 항원은 적어도 하나의 에피토프(항원 결정기)를 포함하는 펩타이드/단백질의 단편, 그의 변이체 또는 유도체일 수 있다.
본 발명의 목적상, 상기 항원은 전술한 mRNA의 번역 산물일 수 있다.
일 예로 상기 항원은 병원체로부터 유래되는 것일 수 있다.
일 예로, 상기 병원체는 바이러스(virus), 박테리아(bacterium), 프리온(prion), 균류(fungus), 원생동물(protozoon), 바이로이드(viroid), 및 기생동물(parasite)로 이루어진 군으로부터 선택되는 것일 수 있다. 그러나 이에 제한되는 것은 아니다.
일 예로, 상기 항원은 감염성 질병과 관련된 병원체로부터 유래되는 펩타이드 또는 단백질 항원일 수 있다.
다른 일 예로 본 발명의 항원은 암 관련 항원(tumor associated antigen)일 수 있다. 암 관련 항원의 예시로, 조직 분화 항원, 종양 생식계열 항원 (예: NY-ESO-1 또는 MAGE-3), 종양 세포에 의해 과발현된 정상 단백질(예: EGFR, Muc-1, Her2/neu), 온코바이러스 단백질 (예: EBV, HPV), 종양-특이적 돌연변이 항원(예: Mum-1, β-Catenin 또는 CDK4)을 들 수 있다. 이러한 항원은 개체(personalized cancer antigen) 또는 조직 특이적인 것일 수 있다. 그러나 전술한 예시에 제한되는 것은 아니다.
다른 구현예로, 상기 목적 단백질은 질환의 예방 또는 치료에 관여하는 단백질일 수 있다. 일 예로, 상기 단백질은 타겟으로 하는 항원을 인식할 수 있는 키메라 항원 수용체(CAR), 면역자극성 사이토카인 폴리펩티드, 텔로머라제 역전사효소(telomerase reverse transcriptase) 중 선택되는 것일 수 있다. 다른 일 예로, 상기 단백질은 비만을 포함하는 대사성 질환의 예방 또는 치료와 관련된 것일 수 있다. 이러한 목적 단백질의 예시로는 FGF21(Fibroblast growth factor 21), 렙틴(leptin) 을 들 수 있으나 이에 제한되지는 않는다.
일 구현예에서 본 발명의 mRNA 전사 벡터는 5'Cap으로 전사되는 뉴클레오티드 서열을 더 포함할 수 있다.
본 발명에서 "5' Cap"은 mRNA의 말단을 덮는(caps) 변형 독립체를 의미한다. 5' 캡은 일반적으로 변형, 예를 들어 구아닌 유도체에 의해 형성될 수 있다. 일 예로, 5'캡은 5'->5'트리포스페이트(triphosphate) 결합을 통해 5' 말단에 연결 될 수 있다. 일 예로, 5'캡은 메틸화 될 수 있다.
일 예로, 인비트로 전사 시에 캡 유사체(Cap analogue)를 추가하여 전사와 함께 캡핑이 수행될 수 있다. 이를 동시-전사 캡핑 (co-transcriptional capping)이라고도 한다. 동시-전사 방법의 경우, 시험관내 전사 과정 중에 전사와 동시에 RNA 분자에 캡이 통합된다. 다른 예로, 인비트로 전사 후 효소반응을 통해 캡핑을 수행할 수 있다. 이러한 효소 반응에는 트리포스파타제(triphosphatase), 구아닐 트랜스퍼라제와 같은 효소가 관여할 수 있다. 그러나 이에 제한되지 않고 당업계에 공지된 방법을 사용하여 mRNA가 5'Cap을 포함하도록 할 수 있다.
일 구현예에서 본 발명의 mRNA 전사 벡터는 폴리 A 테일을 포함할 수 있다.
본 발명에서 “폴리 A 테일(poly A tail)"은 전형적으로 RNA 분자의 3'말단에 위치하는 아데닐산 잔기들의 연속 또는 불연속 서열을 지칭한다. 폴리 A 테일은 본 발명의 mRNA 3'UTR의 뒤에 이어질 수 있다. 이러한 폴리 A 테일은 20개 이상, 25개 이상, 40개 이상, 60개 이상, 80개 이상, 또는 100개 이상, 또는 약 200개 또는 그 이상의 아데닐(A) 뉴클레오티드로 구성되거나 이를 포함할 수 있다. 폴리-A 꼬리의 뉴클레오티드의 개수를 기준으로 전형적으로 적어도 75%, 적어도 80%, 적어도 85%, 적어도 90%, 적어도 95%, 적어도 96%, 적어도 97%, 적어도 98%, 또는 적어도 99%는 A 뉴클레오티드이지만, 나머지 뉴클레오티드는 A 뉴클레오티드 이외의 뉴클레오티드, 예컨대, U 뉴클레오티드(우리딜산), G 뉴클레오티드(구아닐산), 또는 C 뉴클레오티드(시티딜산)일 수 있다. 일 예로, 폴리 A 테일은 mRNA의 분해를 지연시키도록 하는 변형을 포함할 수 있다. 일 예로, 상기 폴리 A 테일은 20 내지 200개의 아데닌을 포함할 수 있다.
일 예로, 본 발명의 벡터는 형질 전환 여부를 확인하기 위한 선별 마커(selection marker)를 포함할 수 있다. 약물 내성, 영양 요구성, 세포 독성제에 대한 내성과 같은 선택 가능 표현형을 부여하는 마커들이 사용될 수 있으며, 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다. 그러나 전술한 예시에 한정되는 것은 아니다.
본 발명의 "시험관내 전사"는 RNA가 무세포 시스템(시험관 내)에서 합성되는 과정에 관한 것이다. 본 발명의 방법에서 본 발명의 벡터가 mRNA 생성을 위한 주형으로 사용된다.
일 예로, 시험관내 전사를 수행하기 전 벡터를 선형화할 수 있다. 선형화된 벡터는 적절한 제한 효소로 벡터를 처리함으로써 수득할 수 있다.
일 예로, 본 발명의 벡터는 플라스미드 일 수 있다. 그러나 이에 특별히 제한되는 것은 아니며, 당업계에 알려진 벡터를 사용할 수 있다.
본 발명에서 용어 "약학 조성물"은 질환의 예방 또는 치료를 위해 사용될 수 있는 조성물이다.
본 발명에서 용어 "면역원성"은 체내에 유입되었을 때 면역반응을 유발하는 성질을 지칭한다. 본 발명의 면역원성 조성물을 개체에 투여하여 질환을 예방할 수 있다. 따라서, 본 발명의"질환을 예방하기 위한 약학 조성물"은 "면역원성 조성물" 또는 "백신 조성물"일 수 있다.상기 약학 조성물은 약학적으로 허용가능한 운반체, 부형제, 결합제, 담체, 보존제, 완충제, 등장화제, 에멀전화제 또는 습윤제를 추가로 포함하는 것일 수 있다.
본 발명의 약학 조성물에 포함되는 RNA는 안정성 증가; 세포 형질감염의 증가; (예를 들어, 데포 제형으로부터) 지속 또는 지연 방출의 허용; 생체 분포의 변경(예를 들어, 특정 조직 또는 세포 유형에 대한 표적); 생체내 암호화된 단백질 번역의 증가; 및/또는 생체내 암호화된 단백질(항원)의 방출 프로파일 변경을 위해, 하나 이상의 부형제를 사용하여 제형화될 수 있다. 이에 따라, 본 발명의 약학 조성물은 약학적으로 허용 가능한 부형제를 포함할 수 있다.
상기 약학 조성물은 제제화된 것일 수 있다. 이러한 제제는 고형 또는 액상, 또는 그의 조합일 수 있다.
일 예로, 본 발명의 약학 조성물에 포함된 mRNA는 노출된(naked) 형태이거나, 벡터에 포함된 형태이거나, 전달제(delivery system)와 복합체를 형성한 형태일 수 있다.
일 예로, 본 발명의 약학 조성물은 mRNA를 전달하기 위한 전달제로 리피도이드, 리포솜, 리포플렉스, 지질 나노입자, 화합물 폴리머, 펩타이드/단백질, 세포, 나노입자 모방체 또는 나노튜브를 포함할 수 있다. 상기 mRNA와 전달제는 복합체를 형성할 수 있다.
폴리머의 일 예로, 폴리아미도아민(PAA), 폴리베타아미노에스테르 (poly(beta-amino-ester): PBAE) 및 폴리에틸렌이민(poly(ethylenimine): PEI), 폴리리신(poly(l-lysine) : PLL), 스퍼민, 키토산 및/또는 폴리우레탄을 mRNA의 전달체로 사용할 수 있다. 나노입자의 일 예로, 페리틴(ferritin), PNP (platelet membrane-coated nanoparticles) 등을 들 수 있다. 펩타이드/단백질의 일 예로, 프로타민을 들 수 있다.
일 예로, mRNA를 전달하기 위한 지질 나노입자는 인지질, 구조 지질, PEG 지질, 이온화 가능한 지질, 및/또는 4차 아민 화합물을 포함할 수 있다.
일 예로, 본 발명의 약학 조성물은 적어도 하나 이상의 지질 성분과 복합체를 형성한 mRNA 분자를 포함할 수 있다. 그 예로 상기 mRNA 분자는 적어도 하나 이상의 지질 성분과 리포솜(liposomes), 지질 나노입자(lipid nanoparticles) 및/또는 리포플렉스(lipoplexes) 복합체를 형성할 수 있다.
일 예로, 본 발명의 약학 조성물은 대상체에게 투여되어, mRNA가 생체내에서 번역되어 항원성 폴리펩타이드(항원)를 생산할 수 있다.
일 예로, 본 발명의 약학 조성물은 당업계에 공지된 백신의 투여와 유사하게 주입 또는 주사 에 의해 투여될 수 있다. 예를 들어 경피, 경구, 비경구 경로, 예를 들어 피내(Intradermal), 피하 (Subcutaneous), 정맥 내 (Intravenous), 근육 내 (Intramuscular), 결절 내 (Intranodal) 및/또는 복막 내 주사, 또는 비강(nasal) 내 (예를 들어 기관 흡입)투여 경로를 포함한다. 또한, 조성물은 비내, 질, 직장, 경구, 또는 경피로 투여될 수 있다. 다른 예로, 백신 조성물은 "바늘-없는" 전달 시스템에 의해 투여될 수 있다.
일 예로, 본 발명의 약학 조성물은 포유류에서 항체를 발생시키는 데 사용될 수 있다.
본 발명의 약학 조성물은 1회 투여 용량 또는 다회 투여(multidose) 용량으로 제공될 수 있다. "다회투여량" 또는 "다중투여량"은 하나의 대상체 또는 하나 초과의 대상체에게 투여될 수 있는 1회 초과 (예를 들어, 2회 이상) 하여 접종 가능한 용량을 포함하는 제제 단위를 지칭한다.
본 발명의 면역원성 조성물은 면역학적 유효량의 폴리뉴클레오티드를 포함할 수 있다. 용어 "면역학적 유효량"은 개체에게 투여된 경우, 항원에 대한 항체 반응을 유발하는 데 효과적인 양이다. 면역학적 유효량은 치료될 개체의 건강 및 신체 조건, 이들 개체의 연령, 개체의 면역계가 항체를 합성하는 역량, 필요한 보호 수준, 조성물의 제형, 의료 상황에 대한 치료 의사의 평가, 및 다른 관계된 인자에 따라 다양할 수 있다.
본 발명에서 제공하는 면역원성 조성물은 어쥬번트(adjuvant)를 포함할 수 있다. 본 발명에서 "어쥬번트" 란 본 발명의 면역원성 조성물의 면역원성을 증가시키는데 사용되는 물질을 말한다. 상기 어쥬번트는 종종 면역 반응을 증진시키기 위하여 제공된다.
본 발명의 약학 조성물을 제조하기 위한 조성물에는 RNA를 합성하기 위해 필요한 구성요소가 포함될 수 있다. 구체적으로는 인비트로(in vitro)의 전사(IVT)를 위한 구성요소가 포함될 수 있다.
일 예로, 상기 조성물은 RNA 폴리머라제를 포함할 수 있다. 일 예로, 상기 조성물은 ATP, GTP, UTP, CTP 또는 이의 유사체(analogue)를 포함할 수 있다. 일 예로, 상기 조성물은 완충액을 포함할 수 있다.
본 발명의 약학 조성물의 제조방법에 있어서, mRNA 전사가 인비트로(in vitro)에서 수행될 수 있다. 인비트로 전사에 대해서는 전술한 바와 같다.
이하 본 발명을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.
실시예 1. mRNA 전사벡터와 이로부터 전사되는 mRNA transcript 제작
본 실시예에서는 다양한 5'/3'-비 번역 부위(Untranslated region; UTR) 서열 조합으로 구성된 mRNA 전사벡터와 이로부터 전사되는 mRNA 전사체(transcript)를 제작하였다. 본 실시예에서 목적 단백질의 발현 수준을 용이하게 확인하고자, 목적 단백질의 일 예로 d2EGFP를 사용하였다.
1-1. mRNA 전사벡터 제작
도 1에 도시한 바와 같이, 5' 말단으로부터 3' 말단 방향으로, 프로모터 영역 서열, 5' UTR 영역 서열, ORF 영역 서열, 3' UTR 영역 서열, 및 폴리 A-테일 영역 서열이 순차적으로 작동 가능하게 연결된 구조를 기본 골격으로 하여, mRNA 전사 벡터를 제조하였다.
보다 구체적으로, pcDNA3.1 플라스미드를 사용하여 T7 프로모터 서열 뒤로 (TAATACGACTCACTATA) 5'UTR 영역 서열, Kozak 서열 (GCCACC), d2EGFP 유전자, 3'UTR 영역 서열, poly A 서열 및 Esp3I 인식 부위를 삽입하여, 플라스미드를 제작하였다.
이때, UTR 서열만 다양하게 변화시키며 여러 mRNA 전사벡터를 제조하였으며,
3'UTR(Moderna 백신에 사용된 α-globin UTR)을 고정한 상태로 5'UTR만 변경한 서열정보는 표 1; 및 표 2 내지 표 4 에,
5'UTR(Pfizer/BioNTech 백신에 사용된 α-globin UTR)을 고정한 상태로 3'UTR만 변경한 서열정보는 표 5; 및 표 6 내지 표 12에,
모든 실시예에서 변동없이 그대로 유지한 서열정보는 표 13에 나타내었다.
3'UTR(Moderna 백신에 사용된 α-globin UTR)을 고정한 상태로 5'UTR만 변경한 실시예 서열정보:
3'UTR(Moderna 백신에 사용된 α-globin UTR) 고정서열
No. 유래
분류 		유전자 3'UTR 서열 서열
번호
Moderna - α-globin GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA 1
Figure PCTKR2023001035-appb-img-000001
Figure PCTKR2023001035-appb-img-000002
Figure PCTKR2023001035-appb-img-000003
5'UTR(Pfizer/BioNTech 백신에 사용된 α-globin UTR)을 고정한 상태로 3'UTR만 변경한 실시예 서열정보:
5'UTR(Pfizer/BioNTech 백신에 사용된 α-globin UTR) 고정서열
No. 유래
분류 		유전자 5'UTR 서열 서열
번호
Pfizer/BioNTech - α-globin AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC 47
Figure PCTKR2023001035-appb-img-000004
Figure PCTKR2023001035-appb-img-000005
Figure PCTKR2023001035-appb-img-000006
Figure PCTKR2023001035-appb-img-000007
Figure PCTKR2023001035-appb-img-000008
Figure PCTKR2023001035-appb-img-000009
Figure PCTKR2023001035-appb-img-000010
모든 실시예에서 변동없이 그대로 유지한 서열정보:
Figure PCTKR2023001035-appb-img-000011
종합하여, 총 91개(구체적으로, Moderna Ref; A-1 내지 A-11; B-1 내지 B-10; C-1 내지 C-9; D-1 내지 D-7; E-1 내지 E-7; Pfizer/BioNTech Ref; F-1 내지 F-10; G-1 내지 G-10; H-1 내지 H-8; I-1 내지 I-8; J-1 내지 J-9)의 mRNA 전사벡터를 제작하였다.
1-2. mRNA 전사벡터로부터 mRNA transcript 제작
상기 제작한 mRNA 전사벡터 플라스미드로 형질전환된 대장균을 배양하고, CompactPrep Plasmid Midi Kit (Qiagen)을 이용하여 플라스미드를 분리한 뒤, Esp3I 제한효소를 이용하여 상기 플라스미드를 선형화시켰다. 상기 선형화된 플라스미드를 MinElute Reaction Cleanup Kit (Qiagen)을 이용하여 회수한 후, 이를 mRNA 제조를 위한 시험관 내 전사 (in vitro transcription; IVT) 반응에 사용하였다. 이를 위하여, 아래 표 14에 기재된 조건에 따라 선형화된 플라스미드 DNA 주형 등을 혼합한 후 37 ℃에서 2 시간 동안 반응시켰다.
물질명 사용량
선형화된 플라스미드 DNA 주형 (총 1ug) 1ug/40ul
Nuclease-free H2O 총량 40 ul을 맞추기 위한 양만큼 사용
ATP 2 ul (농도: 5 mM)
CTP 2 ul (농도: 5 mM)
UTP 2 ul (농도: 5 mM)
GTP 2 ul (농도: 5 mM)
CleanCap AG (Catalog No: N-7413) 1.5 ul (농도: 4 mM)
T7 RNA Polymerase mix 2 ul
10X Reaction buffer 2 ul (0.5X)
총량 40 ul
이후, 상기의 반응을 종료시킨 후, 각 샘플 당 DNase1을 2 unit 첨가하고 37 ℃에서 15 분 동안 반응시켜, 남아있는 선형화된 플라스미드 DNA 주형을 제거하였다.
이후, 50ul의 RNA당 25ul의 LiCl를 섞어 -20℃에서 30분 반응 후 원심분리로 RNA를 침전하였다. RNA 침전물을 70% 에탄올로 세척한 뒤 남아있는 에탄올을 제거한 후 Nuclease-free H2O로 용출하였다. 남아있는 침전물이 없도록 65℃에서 5분 처리를 하여, 형질감염에 적합한 mRNA 전사체(transcript)를 제작하였다.
실시예 2. UTR 서열 조합에 따른 단백질 발현수준 평가
본 실시예에서는 다양한 5'/3'-비 번역 부위(Untranslated region; UTR) 서열 조합에 따른 단백질 발현수준 차이를 평가하였다.
Lipofectamine™ MessengerMAX (Thermo Fisher)를 이용하여, 상기 실시예 1에서 제작한 총 91개 mRNA 전사체(transcript)를 Primary Skeletal Muscle cell (ATCC, PCS-950-010)에 독립적으로 형질감염 시켰다. 구체적으로, Primary Skeletal Muscle cell을 24 well plate에 2 x 104cell/well로 seeding 후 37℃, 5% CO2의 환경에서 5시간 이상 배양하여 부착시켰다. 형질감염을 위해 한 개의 mRNA 샘플 당 25ul의 OptiMEM (Gibco)에 0.75ul의 Lipofectamine™ MessengerMAX을 섞어 상온에서 10분 배양한 MessengerMax mixture를 만들고, OptiMEM 25ul에 RNA 전사체 50ng이 들어간 mRNA mixture를 만들었다. Messenger Max mixture 25ul과 mRNA mixture 25ul을 혼합하여 5분간 상온에 배양한 뒤 혼합한 용액 50ul을 Primary Skeletal Muscle cell에 처리하였다. 이를 수행한 시점으로부터 24시간 및 48시간 경과 후, Cytation 7(BioTek)을 통해 d2EGFP 단백질 발현수준을 평가하였다. 구체적으로, GFP 채널 (469, 525)로 발현수준을 측정한 뒤, well의 정중앙으로부터 반지름이 3200um인 원 안에 포함되는 면적의 fluorescent을 분석하였다. 발광량의 최소값은 5000 이상, 분석할 세포의 크기는 30um~200um으로 설정하였다. 이후 분석된 mean fluorescent 값과 cell count를 곱하여 총 발광량을 측정하였다. 각 mRNA 전사체마다 평가는 총 4~6회 수행하였으며, 결과값은 평균값으로 나타내었다.
2-1. 3'UTR(Moderna 백신에 사용된 α-globin UTR)을 고정한 상태로 5'UTR만 변경한 경우 GFP 단백질 발현수준 평가
3'UTR을 고정한 상태로, 5'UTR만 변경한 경우 GFP 단백질 발현수준을 하기 표 15 및 표 16에 나타내었다.
Figure PCTKR2023001035-appb-img-000012
Figure PCTKR2023001035-appb-img-000013
상기 표 15 및 표 16에 나타낸 바와 같이, 3'UTR(Moderna 백신에 사용된 α-globin UTR)을 고정한 상태로 5'UTR만 변경한 군 중,
A-3 내지 A-7(서열번호 5 내지 9), A-9 내지 A-11(서열번호 11 내지 13); B-1(서열번호 14), B-3(서열번호 16), B-6 내지 B-10(서열번호 19 내지 23); 및 E-3(서열번호 42)의 경우,
Moderna Ref. 대비, 그리고 다른 동일/상이한 조직유래 UTR 조합 대비 상대적으로 매우 우수한 단백질 발현효율이 달성됨을 알 수 있다. 특히, 괄호 안 Fold 값으로부터, Moderna Ref. 대비 단백질 발현효율의 우수한 정도를 구체적으로 확인할 수 있다.
2-2. 5'UTR(Pfizer/BioNTech 백신에 사용된 α-globin UTR)을 고정한 상태로 3'UTR만 변경한 경우 GFP 단백질 발현수준 평가
5'UTR을 고정한 상태로, 3'UTR만 변경한 경우 GFP 단백질 발현수준을 하기 표 17 및 표 18에 나타내었다.
Figure PCTKR2023001035-appb-img-000014
Figure PCTKR2023001035-appb-img-000015
상기 표 17 및 표 18에 나타낸 바와 같이, 5'UTR(Pfizer/BioNTech 백신에 사용된 α-globin UTR)을 고정한 상태로 3'UTR만 변경한 군 중,
F-2 내지 F-3(서열번호 50 내지 51), F-5 내지 F-7(서열번호 53 내지 55); G-2(서열번호 60), G-6 내지 G-9(서열번호 64 내지 67); H-7(서열번호 75); 및 J-7(서열번호 91)의 경우,
Pfizer/BioNTech Ref. 대비, 그리고 다른 동일/상이한 조직유래 UTR 조합 대비 상대적으로 매우 우수한 단백질 발현효율이 달성됨을 알 수 있다. 특히, 괄호 안 Fold 값으로부터, Pfizer/BioNTech Ref. 대비 단백질 발현효율의 우수한 정도를 구체적으로 확인할 수 있다.
2-3. 소결
상기 2-1. 결과로부터 3'UTR(Moderna 백신에 사용된 α-globin UTR)을 고정한 상태로 5'UTR만 변경한 군 중 A-3 내지 A-7(서열번호 5 내지 9), A-9 내지 A-11(서열번호 11 내지 13); B-1(서열번호 14), B-3(서열번호 16), B-6 내지 B-10(서열번호 19 내지 23); 및 E-3(서열번호 42); 및
상기 2-2. 결과로부터 5'UTR(Pfizer/BioNTech 백신에 사용된 α-globin UTR)을 고정한 상태로 3'UTR만 변경한 군 중 F-2 내지 F-3(서열번호 50 내지 51), F-5 내지 F-7(서열번호 53 내지 55); G-2(서열번호 60), G-6 내지 G-9(서열번호 64 내지 67); H-7(서열번호 75); 및 J-7(서열번호 91)에서 현저히 우수한 단백질 발현수준이 달성됨을 알 수 있다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (14)

  1. RNA 중합효소 (RNA polymerase)에 의해 인식되는 프로모터 영역 및 상기 프로모터 영역과 작동 가능하게 연결된, 유전자 컨스트럭트를 포함하는 mRNA 전사 벡터로서, 상기 유전자 컨스트럭트는,
    (1) 5'-비번역 부위 (5'-Untranslated region: 5'-UTR) 영역,
    (2) 상기 5'-UTR 영역에 작동 가능하게 연결된, 목적 단백질을 코딩하는 뉴클레오티드 서열을 포함하는 오픈 리딩 프레임 (Open reading frame: ORF) 영역, 및
    (3) 상기 오픈 리딩 프레임 영역에 작동 가능하게 연결된, 3'-비번역 부위 (3'-Untranslated region: 3'-UTR) 영역을 포함하고,
    상기 3'-UTR 영역은 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지거나, 또는 상기 5'-UTR 영역은 서열번호 47 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지되,
    상기 3'-UTR 영역이 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어질 경우, 5'-UTR 영역은 서열번호 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 19, 20, 21, 22, 23, 42 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로부터 선택되고,
    상기 5'-UTR 영역이 서열번호 47 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어질 경우, 3'-UTR 영역은 서열번호 50, 51, 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로부터 선택되는, mRNA 전사 벡터.
  2. 제1항에 있어서, 상기 오픈 리딩 프레임 영역은 병원체로부터 유래되는 항원을 코딩하는 뉴클레오티드 서열을 포함하는 것인, mRNA 전사 벡터.
  3. 제2항에 있어서, 상기 병원체는 바이러스(virus), 박테리아(bacterium), 프리온(prion), 균류(fungus), 원생동물(protozoon), 바이로이드(viroid), 및 기생동물(parasite)로 이루어진 군으로부터 선택되는 것인, mRNA 전사 벡터.
  4. 제1항에 있어서, 상기 유전자 컨스트럭트는 상기 5'-UTR에 작동 가능하게 연결된, 5' 캡 (5' Cap)으로 전사되는 뉴클레오티드 서열을 추가로 포함하는 것인, mRNA 전사 벡터.
  5. 제1항에 있어서, 상기 유전자 컨스트럭트는 상기 3'-UTR 영역에 작동 가능하게 연결된, 폴리 A 테일로 전사되는 뉴클레오티드 서열을 추가로 포함하는 것인, mRNA 전사 벡터.
  6. 제5항에 있어서, 상기 폴리 A 테일은 20 내지 200개의 아데닌을 포함하는, mRNA 전사 벡터.
  7. 제1항에 있어서, 상기 mRNA 전사 벡터는 플라스미드인 것인, mRNA 전사 벡터.
  8. 제1항에 있어서, 상기 mRNA 전사 벡터는 선형화된 것인, mRNA 전사 벡터.
  9. 제1항 내지 제8항 중 어느 한 항의 mRNA 전사 벡터를 주형으로 하여 전사(transcription)를 수행하는 단계를 포함하는, mRNA 분자를 제조하는 방법.
  10. 제9항의 방법에 의해 제조된 mRNA 분자.
  11. 제10항의 mRNA 분자를 유효 성분으로 포함하는, 약학 조성물.
  12. 제11항에 있어서, 상기 mRNA 분자는 적어도 하나 이상의 지질 성분과 복합체를 형성하여, 리포솜(liposomes), 지질 나노입자(lipid nanoparticles) 및 리포플렉스(lipoplexes) 중 선택되는 어느 하나를 형성하는 것인, 약학 조성물.
  13. 제11항에 있어서, 상기 약학 조성물은 근육 또는 피하 투여되는 것인, 약학 조성물.
  14. (1) 5'-비번역 부위 (5'-Untranslated region: 5'-UTR) 영역,
    (2) 상기 5'-UTR 영역에 작동 가능하게 연결된, 목적 단백질을 코딩하는 뉴클레오티드 서열을 포함하는 오픈 리딩 프레임 (Open reading frame: ORF) 영역, 및
    (3) 상기 오픈 리딩 프레임 영역에 작동 가능하게 연결된, 3'-비번역 부위 (3'-Untranslated region: 3'-UTR) 영역을 포함하는 유전자 컨스트럭트로,
    상기 3'-UTR 영역은 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지거나, 또는 상기 5'-UTR 영역은 서열번호 47 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어지되,
    상기 3'-UTR 영역이 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어질 경우, 5'-UTR 영역은 서열번호 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 19, 20, 21, 22, 23, 42 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로부터 선택되고,
    상기 5'-UTR 영역이 서열번호 47 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 이루어질 경우, 3'-UTR 영역은 서열번호 50, 51, 53, 54, 55, 60, 64, 65, 66, 67, 75, 91 또는 이와 90% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로부터 선택되는,
    유전자 컨스트럭트.
PCT/KR2023/001035 2022-01-27 2023-01-20 단백질 발현을 위한 mrna와 이를 위한 주형 WO2023146230A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220012551 2022-01-27
KR10-2022-0012551 2022-01-27

Publications (1)

Publication Number Publication Date
WO2023146230A1 true WO2023146230A1 (ko) 2023-08-03

Family

ID=87471915

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/001035 WO2023146230A1 (ko) 2022-01-27 2023-01-20 단백질 발현을 위한 mrna와 이를 위한 주형

Country Status (2)

Country Link
KR (1) KR20230116700A (ko)
WO (1) WO2023146230A1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210076181A (ko) * 2013-11-12 2021-06-23 브리제 유니버시타이트 브루셀 Rna 전사 벡터 및 이의 용도

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2021216443A1 (en) 2020-02-07 2022-09-08 RNAimmune, Inc. Composition and method of mRNA vaccines against novel coronavirus infection

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210076181A (ko) * 2013-11-12 2021-06-23 브리제 유니버시타이트 브루셀 Rna 전사 벡터 및 이의 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ANDREW G. DIAMOS, SUN H. ROSENTHAL, HUGH S. MASON: "5' and 3' Untranslated Regions Strongly Enhance Performance of Geminiviral Replicons in Nicotiana benthamiana Leaves", FRONTIERS IN PLANT SCIENCE, vol. 7, 2016, XP055635819, DOI: 10.3389/fpls.2016.00200 *
DATABASE Nucleotide 18 November 2020 (2020-11-18), ANONYMOUS : "KR 1020200035073-A/17: TREATMENT OF LOCAL SKIN HYPOTROPHY CONDITIONS ", XP093081834, retrieved from NCBI Database accession no. LY979524.1 *
KIRTIKA H. ASRANI, JEREMIAH D. FARELLI, MARY R. STAHLEY, REBECCA L. MILLER, CHRISTOPHER J. CHENG, ROMESH R. SUBRAMANIAN & JEFFREY : "Optimization of mRNA untranslated regions for improved expression of therapeutic mRNA.", RNA BIOLOGY, vol. 15, no. 6, 26 March 2018 (2018-03-26), pages 756 - 762, XP002793471, ISSN: 1555-8584, DOI: 10.1080/15476286.2018.1450054 *
W VAN DER VELDEN, VOORMA HARRY O, THOMAS ADRI A M: "Vector Design for Optimal Protein Expression", BIOTECHNIQUES, vol. 31, 1 September 2001 (2001-09-01), pages 572 - 582, XP055668162, DOI: 10.2144/01313rr02 *

Also Published As

Publication number Publication date
KR20230116700A (ko) 2023-08-04

Similar Documents

Publication Publication Date Title
WO2019209079A1 (en) Nucleic acid molecules inserted expression regulation sequences, expression vector comprising nucleic acid moleclues and pharmaceutical use thereof
CA2232234A1 (en) Methods for production of recombinant plasmids
RU98118319A (ru) Гены рецептора трансферрина moraxella
ATE256730T1 (de) Rekombinante mykobakterielle expressions-träger sowie deren verwendung
SE8603145L (sv) Forfarande for framstellning av interferon-beta
WO2019117671A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
RU2005136354A (ru) Противотуберкулезная вакцина с улучшенной эффективностью
JP2010535488A (ja) インターフェロン融合タンパク質
US11951120B2 (en) Modification of gene transcription and translation efficiency by 5′UTR sequence variation
CN118086388A (zh) 致耐受性dna疫苗
TW202245809A (zh) 用於治療b型肝炎病毒感染之組合療法
WO2023146230A1 (ko) 단백질 발현을 위한 mrna와 이를 위한 주형
US4780530A (en) Novel interferon alphas
CN113788890B (zh) 一种人白细胞介素2-聚乙二醇偶联物及其应用
WO2021221470A1 (ko) 인터페론-베타 변이체와 항체가 융합된 재조합 단백질 및 이를 포함하는 약학 조성물
JP2653061B2 (ja) 新規ポリペプチドおよびその製造法
US20200339650A1 (en) Tolerogenic DNA Vaccine
WO2021194186A1 (ko) Vgll1 펩타이드를 포함하는 암 치료용 조성물
WO2022131398A1 (ko) 유전자 발현 및 억제가 동시에 가능한 핵산 구조체
WO2022250498A1 (ko) 세포내에서 장시간동안 존재할 수 있는 외부 도입 mRNA를 선별하는 방법
WO2024014770A1 (ko) mRNA 백신 및 치료제의 제조를 위한 변형된 RNA
WO2009145573A9 (ko) 아미노 말단의 메티오닌이 제거된 재조합 사람 변이 인터페론-베타 단백질을 생산하는 재조합 대장균 및 이의 제조방법
WO2023234661A1 (ko) 신규한 변형 폴리아데닌 서열 및 이의 용도
WO2021108500A1 (en) T cell receptors targeting mutations in rna splicing factors
WO2023128639A1 (ko) 목적 단백질의 발현 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23747272

Country of ref document: EP

Kind code of ref document: A1