WO2023142096A1 - Composition et méthode de prévention et/ou de traitement d'infections par clostridioides difficile provoquées par des souches de clade 2 - Google Patents

Composition et méthode de prévention et/ou de traitement d'infections par clostridioides difficile provoquées par des souches de clade 2 Download PDF

Info

Publication number
WO2023142096A1
WO2023142096A1 PCT/CN2022/075137 CN2022075137W WO2023142096A1 WO 2023142096 A1 WO2023142096 A1 WO 2023142096A1 CN 2022075137 W CN2022075137 W CN 2022075137W WO 2023142096 A1 WO2023142096 A1 WO 2023142096A1
Authority
WO
WIPO (PCT)
Prior art keywords
tcdb4
tfpi
isolated polypeptide
tcdb2
seq
Prior art date
Application number
PCT/CN2022/075137
Other languages
English (en)
Inventor
Liang TAO
Yanyan LI
Jianhua Luo
Original Assignee
Westlake University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Westlake University filed Critical Westlake University
Priority to PCT/CN2022/075137 priority Critical patent/WO2023142096A1/fr
Publication of WO2023142096A1 publication Critical patent/WO2023142096A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/33—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Clostridium (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto

Definitions

  • the present disclosure generally relates to isolated polypeptides that specifically bind to TcdB2 and/or TcdB4, especially TcdB4, from clade 2 Clostridioides difficile (C. difficile, previously known as Clostridium difficile) strains, pharmaceutical compositions comprising the isolated polypeptides, and use of the isolated polypeptides and the pharmaceutical compositions in prevention and/or treatment of Clostridioides difficile infections (CDI) caused by Clade 2 strains.
  • CDI Clostridioides difficile infections
  • the present disclosure further relates to nucleic acid molecules encoding isolated polypeptides, vectors or expression cassettes and/or cells comprising said nucleic acid molecules, and methods for producing the isolated polypeptides. Furthermore, the present disclosure relates to a method for preventing and/or treating Clostridioides difficile infections caused by Clade 2 strains.
  • Clostridioides difficile C. difficile, previously known as Clostridium difficile infection (CDI) is a leading cause of nosocomial and community-acquired diarrhea and gastroenteritis-associated death in developed countries, accounting for around a half-million cases and 15,000 deaths annually in the United States (Guh et al., 2020; Lessa et al., 2015) .
  • CDI Clostridium difficile infection
  • the global burden of CDI is exacerbated due to the emergence and widespread of hypervirulent strains (Guh et al., 2020; He et al., 2013; Hunt and Ballard, 2013) .
  • the emergence of hypervirulent clade 2 Clostridioides difficile is associated with severe symptoms and accounts for more than 20%of global infections.
  • Clostridioides difficile produces three known exotoxins: toxin A (TcdA) , toxin B (TcdB) , and Clostridioides difficile transferase (CDT) .
  • Clostridioides difficile exploits these toxins to disrupt the intestinal epithelial barrier, cause tissue damage and gain nutrients, provoke or suppress inflammation, and contribute to colonization (Aktories et al., 2017; Cowardin et al., 2016; Fletcher et al., 2021; Pruss and Sonnenburg, 2021; VanInsberghe et al., 2020; Xu et al., 2014) .
  • TcdB plays a key role in causing gastrointestinal diseases, since all pathogenic Clostridioides difficile contain functional tcdB genes and lacking TcdB, but not TcdA or CDT, could drastically attenuate the virulence of clinical strains in animal models (Carter et al., 2015; Kuehne et al., 2010; Kuehne et al., 2014; Lyras et al., 2009) .
  • TcdB is a member of the large clostridial toxin (LCT) family, which enters target cells via receptor-mediated endocytosis and glucosylates small GTPase proteins, leading to cytoskeletal dysfunction and eventual cell death (Aktories et al., 2017; Chandrasekaran and Lacy, 2017; Voth and Ballard, 2005) .
  • LCT large clostridial toxin
  • Recent genomic and functional studies reported that TcdB can be classified into at least eight natural variants/subtypes, with type-1 to 4 as major variants associated with human diseases (Mansfield et al., 2020; Shen et al., 2020) .
  • TcdB1 and TcdB3 exploit Wnt receptor Frizzled proteins (FZDs) to disrupt the epithelial barrier and chondroitin sulfate proteoglycan 4 (CSPG4) to impair the intestinal subepithelial myofibroblasts layer afterward (Chen et al., 2018; Chen et al., 2021; Pan et al., 2021; Tao et al., 2016; Yuan et al., 2015) .
  • FZDs Wnt receptor Frizzled proteins
  • CSPG4 chondroitin sulfate proteoglycan 4
  • Clostridioides difficile strains from multi-locus sequence typing (MLST) clade 2 also known as the hypervirulent clade (Stabler et al., 2006) , exclusively express two TcdB variants (TcdB2 and TcdB4) that do not recognize FZDs (Chung et al., 2018; Henkel et al., 2020; Lopez-Urena et al., 2019; Pan et al., 2021; Simeon et al., 2019) . How these TcdB variants target the intestinal epithelium to initiate the damage remains unknown.
  • MLST multi-locus sequence typing
  • Clostridioides difficile infection mainly focuses on the following directions: antibiotic therapies, fecal microbiota transplantation, toxin-neutralizing antibody/immunoprotein, vaccine development, small molecule inhibitors, and the like. These methods are used to deal with Clostridioides difficile infection in different situations, and each of the methods has obvious advantages and disadvantages in use.
  • Antibiotic therapy is a traditional method, and its effectiveness and recurrence of CDI are main problems associated with this therapy.
  • the antibiotic therapy is not suitable for prevention of CDI.
  • Fecal microbiota transplantation is a novel method for treatment and intervention.
  • Clostridioides difficile mainly expresses two exotoxins, TcdA and TcdB, in which TcdB is a decisive pathogenic factor.
  • TcdA and TcdB are exotoxins that are a decisive pathogenic factor.
  • TcdB is a decisive pathogenic factor.
  • the use of toxin-neutralizing immune molecules is an effective method for prevention and treatment.
  • Toxin-neutralizing antibody/immunoprotein is mainly aimed at the remission and prevention of acute infectious diseases, and the related technical route has developed rapidly.
  • ZINPLAVA TM Clostridioides difficile infection
  • TcdB is a dominant virulence factor of Clostridioides difficile
  • clade 2 strains exclusively express two TcdB variants (TcdB2 and TcdB4) that use unknown receptors distinct from the classic TcdB. Therefore, there are needs for identifying the receptors of the TcdB variants from clade 2 strains and developing new medicaments and/or therapies for prevention and treatment CDI caused by clade 2 strains.
  • the present disclosure has an objective to identify receptors for the TcdB variants (TcdB2 and TcdB4) expressed by clade 2 Clostridioides difficile strains.
  • the present disclosure has another objective to find inhibitors of the TcdB variants (TcdB2 and TcdB4) expressed by clade 2 Clostridioides difficile strains, and further find an effective therapy for preventing and/or treating CDI caused by clade 2 strains.
  • the inventors performed CRISPR/Cas9 screens for TcdB4 and identified tissue factor pathway inhibitor (TFPI) as its receptor.
  • TFPI tissue factor pathway inhibitor
  • cryo-EM the inventors determined a complex structure of the full-length TcdB4 with TFPI, defining a common receptor-binding region for TcdB. Residue variations within this region divide major TcdB variants into two classes: one recognizes Frizzled (FZDs) , and the other recognizes TFPI.
  • FZDs Frizzled
  • TFPI is highly expressed in the intestinal glands and recombinant TFPI protects the colonic epithelium from TcdB4/2.
  • the present disclosure provides an isolated polypeptide specifically binding TcdB2 and/or TcdB4, wherein the isolated polypeptide comprises an amino acid sequence of SEQ ID NO: 1 or 2.
  • the isolated polypeptide comprises an amino acid sequence of any one of SEQ ID Nos: 3 to 5.
  • the isolated polypeptide comprises R135, R140, I138, I133, M162, L159 of TFPI (numbering according to SEQ ID NO: 22 or 23, containing a signal peptide) .
  • the isolated polypeptide is soluble. In some embodiments, the isolated polypeptide is TFPI and derivates thereof. In some embodiments, the TFPI is a human TFPI or a mouse Tfpi, or derivates thereof.
  • the human TFPI includes two variants, TFPI ⁇ (SEQ ID NO: 3) and TFPI ⁇ (SEQ ID NO: 4) , without the signal peptide, and the mouse Tfpi is Tfpi ⁇ (SEQ ID NO: 5) .
  • R135, R140, I138, I133, M162, L159 in TFPI are identified as critical residues for specific binding to TcdB4.
  • the isolated polypeptide specifically binds TcdB4, especially receptor-binding domain (DRBD) of TcdB4, TcdB4 842-1834 fragment (SEQ ID NO: 15) or TcdB4 1285-1834 fragment (SEQ ID NO: 16) .
  • DRBD receptor-binding domain
  • TcdB4 842-1834 fragment SEQ ID NO: 15
  • TcdB4 1285-1834 fragment SEQ ID NO: 16
  • E1433, D1467, D1468, E1469, S1598, L1599, L1434, K1435, M1438, V1492, L1494, I1496, L1489, P1506, Y1510 of TcdB4 (SEQ ID NO: 9) are critical residues for receptor recognition.
  • the receptor-binding domain (DRBD) of TcdB4 is represented by SEQ ID NO: 14 (i.e., positions 841-1834 of SEQ ID NO: 9) .
  • the isolated polypeptide specifically binds TcdB2, especially receptor-binding domain (DRBD) of TcdB2, TcdB2 841-1833 fragment (SEQ ID NO: 29) or TcdB2 1284-1833 fragment (SEQ ID NO: 30) .
  • DRBD receptor-binding domain
  • TcdB2 841-1833 fragment SEQ ID NO: 29
  • TcdB2 1284-1833 fragment SEQ ID NO: 30
  • E1432, D1466, D1467, S1597, L1598, L1433, K1434, M1437, V1491, L1493, and L1488 of TcdB2 (SEQ ID NO: 7) are critical residues for receptor recognition.
  • the receptor-binding domain (DRBD) of TcdB2 is represented by SEQ ID NO: 28 (i.e., positions 840-1833 of SEQ ID NO: 7) .
  • the present disclosure provides an isolated polypeptide comprising an amino acid sequence that has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5%identity to any one of SEQ ID NOs: 1-5, wherein the isolated polypeptide maintains specific binding to TcdB2 and/or TcdB4, similar to any one of SEQ ID NOs: 1-5.
  • the present disclosure provides an isolated polypeptide comprising an amino acid sequence that has less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3 or less than 2 mutated amino acid residues in any one of SEQ ID NOs: 1-5, wherein the isolated polypeptide maintains specific binding to TcdB2 and/or TcdB4, similar to any one of SEQ ID NOs: 1-5.
  • the mutated amino acid residues are resulted from substitution, insertion, or deletion of amino acid residues in any one of SEQ ID NOs: 1-5, preferably, the substitution is conserved substitution.
  • the polypeptide is cross-linked, cyclized, conjugated, acylated, carboxylated, lipidated, acetylated, thioglycolic acid amidated, alkylated, methylated, polyglycylated, glycosylated, polysialylated, phosphorylated, adenylylated, PEGylated, or any combination thereof.
  • the polypeptide comprises a modification at the C-terminus or at the N-terminus.
  • the polypeptide further contains a fusion domain.
  • the fusion domain is selected from the group consisting of polyhistidine, Glu-Glu, glutathione S transferase (GST) , thioredoxin, protein A, protein G, an immunoglobulin heavy chain constant region (Fc) , maltose binding protein (MBP) , or human serum albumin.
  • the polypeptide further contains an Fc portion of human IgG1.
  • the isolated polypeptide consists of an amino acid sequence of any one of SEQ ID NOs: 1-5.
  • the present disclosure provides a fusion protein comprising:
  • an isolated polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 1-5, or an amino acid sequence that has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5%identity to any one of SEQ ID NOs: 1-5; and
  • the fusion domain is selected from the group consisting of polyhistidine, Glu-Glu, glutathione S transferase (GST) , thioredoxin, protein A, protein G, an immunoglobulin heavy chain constant region (Fc) , maltose binding protein (MBP) , or human serum albumin.
  • the fusion domain is an Fc portion of an immunoglobulin, more preferably, the fusion domain is an Fc portion of a human IgG1.
  • the fusion protein comprises or consists of SEQ ID NO: 26 or SEQ ID NO: 27.
  • the present disclosure provides a conjugate comprising the isolated polypeptide disclosed herein.
  • the isolated polypeptide disclosed herein is conjugated to a moiety having desired activity.
  • the moiety prolongs the serum half-life of the isolated polypeptide.
  • the moiety prolongs the shelf-life of the isolated polypeptide.
  • the moiety is a labeling molecule, an imaging agent, a toxin, a radionuclide or an agent capable of preventing or treating CDI or other bacterial infection.
  • the moiety is a Fc fragment of human IgG, IgA, IgM, IgD, or IgE, preferably a Fc fragment of human IgG.
  • the isolated polypeptide disclosed herein is covalently conjugated to any one of the above moieties.
  • the present disclosure provides a chimeric molecule comprising a first portion and a second portion, wherein the first portion comprises an isolated polypeptide disclosed herein, and wherein the second portion is a molecule that is different from the isolated polypeptide disclosed herein.
  • the first portion is a monomer or multimer of the isolated polypeptide disclosed herein. In some embodiments, the first portion is the isolated polypeptide disclosed herein. In some embodiments, the first portion is a dimer, trimer, tetramer, or pentamer of the isolated polypeptide disclosed herein.
  • the second portion may be a moiety capable of improving the serum half-life of the isolated polypeptide. In some embodiments, the second portion may be a moiety improving the shelf-life of the isolated polypeptide.
  • the second portion may be an anti-bacterial agent.
  • the anti-bacterial agent is an antibiotic, for example, but not limited to Vancomycin, Metronidazole and the like.
  • the second portion may be an anti-TcdB immune molecule, for example, a binder or antibody that binds TcdB, or a nanobody against TcdB.
  • the second portion may be an ankyrin repeat.
  • the second portion is CSPG4 polypeptide. In some embodiments, the second portion is a fragment of CSPG4, preferably CSPG4 410-550 (CSPG4 R1 , SEQ ID NO: 20) .
  • first portion and the second portion are linked directly or indirectly via a linker.
  • the present disclosure provides an isolated nucleic acid molecule comprising a polynucleotide encoding the isolated polypeptide disclosed herein.
  • the present disclosure provides a vector or an expression cassette comprising a polynucleotide encoding the isolated polypeptide disclosed herein.
  • the present disclosure provides a recombinant host cell comprising a polynucleotide encoding the isolated polypeptide disclosed herein or comprising a vector or an expression cassette comprising a polynucleotide encoding the isolated polypeptide disclosed herein.
  • the recombinant host cell is used to produce the isolated polypeptide disclosed herein.
  • the recombinant host cell is selected from, but not limited to, a prokaryotic cell or a eucaryotic cell, preferably a bacterial cell, yeast cell, insect cell, or mammalian cell, for example, E. coli cell, 293F cell, or CHO cell, and the like.
  • the present disclosure provides a pharmaceutical composition
  • a pharmaceutical composition comprising the isolated polypeptide, the fusion protein, the conjugate or the chimeric molecule disclosed herein, and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition further comprises an anti-bacterial agent such as an antibiotic, or an anti-TcdB immune molecule, for example, a monoclonal antibody or nanobody against TcdB.
  • an anti-bacterial agent such as an antibiotic, or an anti-TcdB immune molecule, for example, a monoclonal antibody or nanobody against TcdB.
  • the pharmaceutical composition is used in the prevention and/or treatment of diseases caused by TcdB2 and/TcdB4, for example, Clostridioides difficile infections caused by Clade 2 Clostridioides difficile strains.
  • the pharmaceutical composition is provided as a pharmaceutical kit.
  • the kit comprises a container comprising the polypeptide or the pharmaceutical composition disclosed herein.
  • the present disclosure provides a use of the isolated polypeptide, the fusion protein, the conjugate or the chimeric molecule disclosed herein in the manufacture of a pharmaceutical composition for preventing and/or treating diseases caused by TcdB2 and/TcdB4, for example, Clostridioides difficile infections caused by Clade 2 strains in a subject in need thereof.
  • the present disclosure provides a method for preventing and/or treating diseases caused by TcdB2 and/TcdB4, for example, Clostridioides difficile infections caused by Clade 2 strains in a subject in need thereof, wherein the method comprises administering to the subject a therapeutically effective amount of the isolated polypeptide, the fusion protein, the conjugate, the chimeric molecule, or the pharmaceutical composition disclosed herein.
  • the subject is a mammal, for example, a human or a non-human primate.
  • the present disclosure provides an immune molecule such as an antibody against the isolated polypeptide disclosed herein.
  • the immune molecule e.g., an antibody
  • the immune molecule is capable of specifically binding TFPI on cell surface, thereby blocking the binding between TFPI and TcdB2, or between TFPI and TcdB4.
  • the isolated polypeptide disclosed herein is used as a target to screen immune molecules which compete with TcdB2 or TcdB4 for binding to TFPI on cell surface, or block the binding between TFPI and TcdB2, or between TFPI and TcdB4.
  • the immune molecules are anti-TFPI antibodies.
  • the isolated polypeptide disclosed herein is used as a neutralizing protein to prevent, block or inhibit the binding between TcdB2 and/or TcdB4 and TFPI on cell surface.
  • the immune molecules are used to prevent and/or treat diseases caused by TcdB2 and/TcdB4, for example, Clostridioides difficile infections caused by Clade 2 strains in a subject in need thereof.
  • the isolated polypeptide disclosed herein is used as a target antigen to screen antibodies which compete with TcdB2 or TcdB4 for binding to TFPI on cell surface, or block the binding between TFPI and TcdB2, or between TFPI and TcdB4.
  • the antibodies are used to prevent and/or treat diseases caused by TcdB2 and/TcdB4, for example, Clostridioides difficile infections caused by Clade 2 strains in a subject in need thereof.
  • the present disclosure provides a method for screening molecules which specifically bind to TcdB4, wherein the method comprises: contacting candidate molecules with TcdB4, testing the binding affinity between the candidate molecules and TcdB4, and selecting the molecules with desired binding affinity.
  • the candidate molecules are contacted with DRBD fragment (SEQ ID NO: 14) of TcdB4.
  • the candidate molecules are contacted with TcdB4 842-1834 fragment (SEQ ID NO: 15) or TcdB4 1285-1834 fragment (SEQ ID NO: 16) .
  • the present disclosure provides a method for screening molecules which specifically bind to TcdB2, wherein the method comprises: contacting candidate molecules with TcdB2, testing the binding affinity between the candidate molecules and TcdB4, and selecting the molecules with desired binding affinity.
  • the candidate molecules are contacted with DRBD fragment (SEQ ID NO: 28) of TcdB2.
  • the candidate molecules are contacted with TcdB2 841-1833 fragment (SEQ ID NO: 29) or TcdB2 1284-1833 fragment (SEQ ID NO: 30) .
  • the present disclosure provides molecules specifically binding DRBD fragment of TcdB4.
  • the molecules specifically binding DRBD fragment of TcdB4 are monoclonal antibodies, humanized antibodies or chimeric antibodies. In some embodiments, the molecules specifically bind TcdB4 842-1834 fragment (SEQ ID NO: 15) or TcdB4 1285-1834 fragment (SEQ ID NO: 16) .
  • the present disclosure provides molecules specifically binding DRBD fragment of TcdB2.
  • the molecules specifically binding DRBD fragment of TcdB2 are monoclonal antibodies, humanized antibodies or chimeric antibodies. In some embodiments, the molecules specifically bind TcdB2 841-1833 fragment (SEQ ID NO: 29) or TcdB2 1284-1833 fragment (SEQ ID NO: 30) .
  • the molecules specifically binding TcdB4 or TcdB2 are used in the prevention and treatment of Clostridioides difficile infections caused by Clade 2 Clostridioides difficile strains.
  • the present disclosure provides neutralizing molecules targeting one or more site selected from E1433, D1467, D1468, E1469, S1598, L1599, L1434, K1435, M1438, V1492, L1494, I1496, L1489, P1506, or Y1510 of TcdB4 (SEQ ID NO: 9) .
  • the neutralizing molecules targeting any combination of E1433, D1467, D1468, E1469, S1598, L1599, L1434, K1435, M1438, V1492, L1494, I1496, L1489, P1506, or Y1510 of TcdB4 (SEQ ID NO: 9) .
  • the present disclosure provides neutralizing molecules targeting one or more site selected from E1432, D1466, D1467, S1597, L1598, L1433, K1434, M1437, V1491, L1493, or L1488 of TcdB2 (SEQ ID NO: 7) .
  • the neutralizing molecules targeting any combination of E1432, D1466, D1467, S1597, L1598, L1433, K1434, M1437, V1491, L1493, or L1488 of TcdB2 (SEQ ID NO: 7) .
  • the neutralizing molecules are antibodies, for example, but not limited to, monoclonal antibodies or humanized antibodies. In some embodiments, the neutralizing molecules are used in the prevention and treatment of Clostridioides difficile infections caused by Clade 2 Clostridioides difficile strains.
  • the neutralizing molecules are formulated into a pharmaceutical composition.
  • the pharmaceutical composition comprises therapeutically effective amount of the neutralizing molecules, and a pharmaceutically acceptable carrier.
  • the present disclosure relates to a method for preventing and/or treating diseases caused by TcdB2 and/TcdB4, especially Clostridioides difficile infections (CDI) caused by clade 2 strains, in a subject in need thereof, wherein the method comprises administering to the subject a therapeutically effective amount of the neutralizing molecules.
  • diseases caused by TcdB2 and/TcdB4 especially Clostridioides difficile infections (CDI) caused by clade 2 strains
  • the present disclosure relates to use of the neutralizing molecules in the manufacture of a pharmaceutical composition for preventing and/or treating diseases caused by TcdB2 and/TcdB4, especially Clostridioides difficile infections (CDI) caused by clade 2 strains, in a subject.
  • CDI Clostridioides difficile infections
  • TFPI is a cellular receptor for TcdB4.
  • HeLa KO cells for the indicated genes were generated using the CRISPR-Cas9 technique.
  • TcdB4 interacts with the Kunitz-2 domain of TFPI.
  • TFPI K1+K2 protects the HeLa CSPG4 -/- cells from TcdB4 but not TcdB1 as measured by the cell rounding assay.
  • TcdB4-TFPI complex Cryo-EM structure of the TcdB4-TFPI complex.
  • GTD glucosyltransferase domain
  • CPD cysteine protease domain
  • DRBD transmembrane delivery and receptor-binding domain
  • CROPs combined repetitive oligopeptides domain of TcdB4 are shown in wheat, pink, light blue, green, respectively.
  • the TFPI is bound at the periphery of TcdB4 through direct interactions between the Kunitz-2 domain (cyan) of TFPI and the DRBD of TcdB4.
  • TFPI K2 is anchored on a hydrophobic surface of TcdB4 DRBD through two epitopes: loop1 (residues 131-138) and loop2 (residues 155-162) .
  • TcdB contains two classes of RBIs recognizing either FZDs or TFPI.
  • TcdB4 1285-1834 Point mutations on TcdB4 1285-1834 were examined in pull-down assays, using TFPI K2 -Fc as bait. Bound TcdB4 1285-1834 mutants were co-precipitated with TFPI K2 -Fc using the Protein A resin and detected by immunoblot analysis.
  • TFPI is a physiologically relevant receptor for TcdB4.
  • Kidney tissues from the WT and Tfpi ⁇ -/- mice were harvested after i.p. injection of 1 ⁇ g/kg TcdB4 and assessed by H&E staining. Normal (green arrows) and damaged (red arrows) glomerulus were denoted. Scale bar represents 50 ⁇ m.
  • TcdB4 is potent to both HeLa WT and CSPG4 -/- /FZD1/2/7 -/- cells.
  • the HeLa CSPG4 -/- cells were pretreated with or without PI-PLC for 30 minutes. Cells were then exposed to 0.28 nM TcdB4 and incubated at 37 °C. Representative images of cell rounding at 2.5-and 3.5-hours post-exposure to TcdB4 were shown. Scale bar represents 50 ⁇ m.
  • TcdB4 specifically binds to TFPI.
  • TFPI K1+K2 -Fc protects the HeLa CSPG4 -/- cells from TcdB4 but not TcdB1 as measured by the cell rounding assay.
  • TcdB2 binds to TFPI K2 .
  • Figure 17 is related to Figure 5.
  • Tfpi is a colonic cryptic receptor for TcdB4.
  • Tfpi is a physiologically relevant receptor for TcdB4 in systematic infection.
  • FIG. 21 The kidney is vulnerable to systematic TcdB4 exposure.
  • TcdB is a dominant virulence factor of Clostridioides difficile while clade 2 strains exclusively express two TcdB variants (TcdB2 and TcdB4) that use unknown receptors distinct from the classic TcdB.
  • TcdB2 and TcdB4 two TcdB variants that use unknown receptors distinct from the classic TcdB.
  • TFPI tissue factor pathway inhibitor
  • TcdB variants divide major TcdB variants into two classes: one recognizes Frizzled (FZDs) , and the other recognizes TFPI.
  • FZDs Frizzled
  • TFPI is highly expressed in the intestinal glands and recombinant TFPI protects the colonic epithelium from TcdB4/2.
  • CSPG4 Chondroitin sulfate proteoglycan 4 (CSPG4, also known as neuron-glial antigen 2 (NG2) in rodents) has been identified as a functional receptor for TcdB in HeLa cells and in a colorectal cell line HT-29. However, CSPG4 is not expressed in colonic epithelial cells.
  • NG2 neuron-glial antigen 2
  • Poliovirus receptor-like 3 (PVRL3) was recently suggested as a cellular factor contributing to necrotic cell death process (cytotoxicity) after exposure to high concentrations of TcdB in HeLa cells and in a colorectal cell line Caco-2, but whether PVRL3 is a relevant TcdB receptor in the colonic epithelium remains unknown and its role in directly mediating TcdB entry into cells has not been established.
  • Described in the Examples and Figures of the present disclosure are the identification and validation of TcdB receptors in colonic epithelia cells using a CRISPR/Cas9 mediated knockout screening system.
  • the CRISPR/Cas9 system and its use is known in the art, e.g., US Patent Publication US20140357530.
  • TFPI and K2 domain thereof are identified and validated as novel and pathologically relevant TcdB receptors in the present disclosure, especially, colonic cryptic receptors of TcdB2 and/or TcdB4, especially TcdB4, from clade 2 Clostridioides difficile strains.
  • TcdB Binding of TcdB to TFPI or K2 domain thereof on cell surface mediates the entry of the TcdB toxin into the cells.
  • TcdB catalyzes the glycosylation of small GTPases inside epithelial cells, causing cell rounding and death.
  • illustrated herein is a novel mechanism independent of the intracellular mechanism of TcdB pathogenesis, relating to the inhibition of the binding between TFPI or K2 domain thereof and TcdB, for example, TcdB2 and/or TcdB4, especially TcdB4, from clade 2 Clostridioides difficile strains.
  • TcdB4 that interacts with TFPI or K2 domain thereof is identified to be an amino acid sequence at positions 842 to 1834 (SEQ ID NO: 15) , particularly at positions 1285 to 1834 (SEQ ID NO: 16) of the TcdB4 protein (SEQ ID NO: 9, full length TcdB4 protein) .
  • E1433, D1467, D1468, E1469, S1598, L1599, L1434, K1435, M1438, V1492, L1494, I1496, L1489, P1506, Y1510 of TcdB4 are critical residues for receptor recognition.
  • TcdB2 that interacts with TFPI or K2 domain thereof is identified to be an amino acid sequence at positions 841 to 1833 (SEQ ID NO: 29) , particularly at positions 1284 to 1833 (SEQ ID NO: 30) of the TcdB2 protein (SEQ ID NO: 7, full length TcdB2 protein) .
  • E1432, D1466, D1467, S1597, L1598, L1433, K1434, M1437, V1491, L1493, or L1488 of TcdB2 are critical residues for receptor recognition.
  • R135, R140, I138, I133, M162, L159 in TFPI are critical residues for specific binding to TcdB4 (SEQ ID NO: 22 or 23, containing a signal peptide) .
  • Human TFPI has two variants: TFPI ⁇ (SEQ ID NO: 3) and TFPI ⁇ (SEQ ID NO: 4) , without the signal peptide, and mouse Tfpi ⁇ is represented by SEQ ID NO: 5.
  • K2 domain of human TFPI is represented by SEQ ID NO: 1
  • K2 domain of mouse Tfpi is represented by SEQ ID NO: 2.
  • the K2 domain is the functional fragment of TFPI for specifically binding TcdB2 and/or TcdB4.
  • the present disclosure provides an isolated polypeptide specifically binding TcdB2 and/or TcdB4.
  • isolated polypeptide refers to a polypeptide that is isolated from, or is otherwise substantially free of (e.g., at least 80%, 90%, 95%, 97%, 99%, or 99.5%free of) , other protein (s) and/or other polypeptide (s) .
  • the isolated polypeptide is 100%free of other protein (s) and/or other polypeptide (s) .
  • binding refers to a non-random binding reaction between two molecules, such as between TcdB4 and TFPI.
  • the isolated polypeptides of the present disclosure prevent, block or inhibit the binding of TcdB2 and/or TcdB4 to TFPI or K2 domain thereof on cell surface.
  • the terms “prevent” , “block” and “inhibit” are used interchangeably in the present disclosure.
  • the effect of the prevention, blocking and inhibition of the isolated polypeptides of the present disclosure is measured as compared with the binding between TcdB2 and/or TcdB4 and TFPI or K2 domain thereof on cell surface in absence of said isolated polypeptides.
  • the isolated polypeptides of the present disclosure can be used as a TcdB (e.g., TcdB2 and/or TcdB4) neutralizing protein with high efficacy per se, thereby preventing or treating diseases caused by TcdB (e.g., TcdB2 and/or TcdB4) , especially Clostridioides difficile infections caused by clade 2 strains.
  • TcdB e.g., TcdB2 and/or TcdB4
  • Clostridioides difficile infections caused by clade 2 strains especially Clostridioides difficile infections caused by clade 2 strains.
  • the isolated polypeptide comprises an amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5. In some embodiments, the isolated polypeptide comprises R135, R140, I138, I133, M162, L159 of TFPI, numbering according to SEQ ID NO: 22 or 23.
  • the isolated polypeptide comprises an amino acid sequence that has at least 85%identity to any one of SEQ ID NOs: 1-5.
  • the isolated polypeptide comprises an amino acid sequence that has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5%identity to any one of SEQ ID NOs: 1-5.
  • Gapped BLAST can be utilized as described in Altschul et al, Nucleic Acids Res. 25 (17) : 3389-3402, 1997.
  • the default parameters of the respective programs e.g., XBLAST and NBLAST.
  • polypeptides described herein can be conjugated or otherwise covalently attached to other molecules (e.g., using a chemical linker) .
  • One such form of attachment is through a non-amide linkage (e.g., a disulfide bond) .
  • the polypeptide is covalently attached (e.g., via a linker molecule) to an antibody or a domain thereof suitable for enhancing the half-life of the molecule (e.g., one or more constant domains in an Fc domain) .
  • the polypeptide is linked to an Fc domain disclosed herein (e.g., IgG, IgA, IgM, IgD, or IgE) .
  • the isolated polypeptide of the present disclosure further comprises a fusion domain.
  • a fusion domain also provided herein are functional variants or modified forms of the polypeptide fragments having one or more fusion domains.
  • fusion domains include, without limitation, polyhistidine, Glu-Glu, glutathione S transferase (GST) , thioredoxin, protein A, protein G, an immunoglobulin heavy chain constant region (Fc) , maltose binding protein (MBP) , or human serum albumin.
  • GST glutathione S transferase
  • Fc immunoglobulin heavy chain constant region
  • MBP maltose binding protein
  • human serum albumin or human serum albumin.
  • a fusion domain may be selected for purpose of conferring a desired property. For example, some fusion domains are particularly useful for isolation of the fusion proteins by affinity chromatography.
  • relevant matrices for affinity chromatography such as glutathione-, amylase-, and nickel-or cobalt-conjugated resins are used. Many of such matrices are available in "kit” form, such as the Pharmacia GST purification system and the QIAexpress TM system (Qiagen) useful with (HIS6) fusion partners.
  • the isolated polypeptide fragment is fused with a domain that stabilizes the isolated polypeptide fragment in vivo (a "stabilizer" domain) .
  • Stabilizing means an increase in the half-life of the polypeptide in vivo, regardless of whether this is caused by decreased destruction, decreased clearance by the kidney, or other pharmacokinetic effect. Fusions with the Fc portion of an immunoglobulin are known to confer desirable pharmacokinetic properties on a wide range of proteins. Likewise, fusions to human serum albumin can confer desirable properties. Other types of fusion domains that may be selected include multimerizing (e.g., dimerizing, tetramerizing) domains and functional domains.
  • the isolated polypeptides of the present disclosure further comprises an Fc portion of human IgG1.
  • fusion proteins comprising an Fc portion of an immunoglobulin are also contemplated herein.
  • the fusion protein comprises or consists of SEQ ID NO: 26 or SEQ ID NO: 27.
  • the Fc domain may have one or more mutations at residues such as Asp-265, lysine 322, and Asn-434.
  • the mutant Fc domain having one or more of these mutations e.g., Asp-265 mutation
  • the mutant Fc domain having one or more of these mutations has increased ability of binding to the MHC class I-related Fc-receptor (FcRN) relative to a wildtype Fc domain.
  • fusion proteins may be arranged in any manner that is consistent with the desired functionality.
  • an immunoglobulin Fc region is understood to mean the carboxyl-terminal portion of an immunoglobulin chain constant region, preferably an immunoglobulin heavy chain constant region, or a portion thereof.
  • an immunoglobulin Fc region may comprise 1) a CH1 domain, a CH2 domain, and a CH3 domain, 2) a CH1 domain and a CH2 domain, 3) a CH1 domain and a CH3 domain, 4) a CH2 domain and a CH3 domain, or 5) a combination of two or more domains and an immunoglobulin hinge region.
  • the immunoglobulin Fc region comprises at least an immunoglobulin hinge region a CH2 domain and a CH3 domain, and preferably lacks the CH1 domain.
  • the class of immunoglobulin from which the heavy chain constant region is derived is IgG (Ig ⁇ ) ( ⁇ subclasses 1, 2, 3, or 4) .
  • Other classes of immunoglobulin, IgA (Ig ⁇ ) , IgD (Ig ⁇ ) , IgE (Ig ⁇ ) and IgM (Ig ⁇ ) may be used.
  • the choice of appropriate immunoglobulin heavy chain constant region is discussed in detail in U.S. Pat. Nos. 5,541,087, and 5,726,044.
  • the choice of particular immunoglobulin heavy chain constant region sequences from certain immunoglobulin classes and subclasses to achieve a particular result is considered to be within the level of skill in the art.
  • the portion of the DNA construct encoding the immunoglobulin Fc region preferably comprises at least a portion of a hinge domain, and preferably at least a portion of a CH3 domain of Fc ⁇ or the homologous domains in any of IgA, IgD, IgE, or IgM.
  • substitution or deletion of amino acids within the immunoglobulin heavy chain constant regions may be useful in the practice of the methods and compositions disclosed herein.
  • One example would be to introduce amino acid substitutions in the upper CH2 region to create an Fc variant with reduced affinity for Fc receptors (Cole et al. (1997) J. Immunol. 159: 3613) .
  • the isolated polypeptides of the present disclosure may comprise modifications. Polypeptides comprising modifications have additional features other than the reference polypeptide.
  • a "modification" or “derivative” of a peptide produces a modified or derivatized polypeptide, which is a form of a given peptide that is chemically modified relative to the reference peptide, the modification including, but not limited to, oligomerization or polymerization, modifications of amino acid residues or peptide backbone, cross-linking, cyclization, conjugation, glycosylation, acetylation, phosphorylation, acylation, carboxylation, lipidation, thioglycolic acid amidation, alkylation, methylation, polyglycylation, glycosylation, polysialylation, adenylylation, PEGylation, fusion to additional heterologous amino acid sequences, or other modifications that substantially alter the stability, solubility, or other properties of the peptide while substantially retaining the activity of the polypeptides described herein.
  • the isolated polypeptides comprising such modifications are cross-linked, cyclized, conjugated, acylated, carboxylated, lipidated, acetylated, thioglycolic acid amidated, alkylated, methylated, polyglycylated, glycosylated, polysialylated, phosphorylated, adenylylated, PEGylated, or any combination thereof.
  • the modified polypeptide fragments of the present disclosure may contain non-amino acid elements, such as polyethylene glycols, lipids, poly-or mono-saccharide, and phosphates.
  • the isolated polypeptides of the present disclosure may comprise the modifications disclosed herein at the C-terminus (e.g., C-terminal amidation) , or N-terminus (e.g., N-terminal acetylation) .
  • Terminal modifications are useful, and are well known, to reduce susceptibility to proteinase digestion, and therefore serve to prolong half-life of the polypeptides in solutions, particularly biological fluids where proteases may be present.
  • the polypeptides or fusion proteins described herein are further modified within the sequence, such as, modification by terminal-NH2 acylation, e.g., acetylation, or thioglycolic acid amidation, by terminal-carboxyl amidation, e.g., with ammonia, methylamine, and the like terminal modifications.
  • Amino terminus modifications include methylation (e.g., -NHCH3 or -N (CH3) 2) , acetylation (e.g., with acetic acid or a halogenated derivative thereof such as a-chloroacetic acid, a-bromoacetic acid, or a-iodoacetic acid) , adding a benzyloxycarbonyl (Cbz) group, or blocking the amino terminus with any blocking group containing a carboxylate functionality defined by RCOO-or sulfonyl functionality defined by R-SO2-, where R is selected from the group consisting of alkyl, aryl, heteroaryl, alkyl aryl, and the like, and similar groups.
  • methylation e.g., -NHCH3 or -N (CH3) 2
  • acetylation e.g., with acetic acid or a halogenated derivative thereof such as a-chloroacetic acid, a-bro
  • the N-terminus is acetylated with acetic acid or acetic anhydride.
  • Carboxy terminus modifications include replacing the free acid with a carboxamide group or forming a cyclic lactam at the carboxy terminus to introduce structural constraints.
  • Methods of circular peptide synthesis are known in the art, for example, in U.S. Patent Application No. 20090035814; Muralidharan and Muir, 2006, Nat Methods, 3: 429-38; and Lockless and Muir, 2009, Proc Natl Acad Sci USA.
  • C-terminal functional groups of the peptides described herein include amide, amide lower alkyl, amide di (lower alkyl) , lower alkoxy, hydroxy, and carboxy, and the lower ester derivatives thereof, and the pharmaceutically acceptable salts thereof.
  • the polypeptides or the fusion proteins described herein are phosphorylated.
  • the linker used in the fusion protein, conjugate or chimeric molecule of the disclosure is a chemical linker such as linkages by disulfide bonds between cysteine amino acid residues or by chemical bridges formed by amine crosslinkers, for example, glutaraldehyde, bis (imido ester) , bis (succinimidyl esters) , diisocyanates and diacid chlorides.
  • amine crosslinkers for example, glutaraldehyde, bis (imido ester) , bis (succinimidyl esters) , diisocyanates and diacid chlorides.
  • the isolated polypeptides described herein, as monomers are dimerized or multimerized by covalent attachment to at least one linker moiety.
  • the methods for preparing dimer or multimer with a polypeptide are well known in the art.
  • polypeptides, fusion proteins, and polypeptide multimers as described herein may be attached to one or more polymer moieties.
  • these polymers are covalently attached to the polypeptides of the disclosure.
  • the polymer is pharmaceutically acceptable.
  • One skilled in the art will be able to select the desired polymer based on such considerations as whether the polymer-peptide conjugate will be used therapeutically, and if so, the desired dosage, circulation time, resistance to proteolysis, and other considerations.
  • Suitable polymers include, for example, polyethylene glycol (PEG) , polyvinyl pyrrolidone, polyvinyl alcohol, polyamino acids, divinylether maleic anhydride, N- (2-Hydroxypropyl) -methacrylamide, dextran, dextran derivatives including dextran sulfate, polypropylene glycol, polyoxyethylated polyol, heparin, heparin fragments, polysaccharides, cellulose and cellulose derivatives, including methylcellulose and carboxymethyl cellulose, starch and starch derivatives, polyalkylene glycol and derivatives thereof, copolymers of polyalkylene glycols and derivatives thereof, polyvinyl ethyl ethers, and ⁇ , ⁇ -Poly [ (2-hydroxyethyl) -DL-aspartamide, and the like, or mixtures thereof.
  • PEG polyethylene glycol
  • polyvinyl pyrrolidone polyviny
  • Such a polymer may or may not have its own biological activity.
  • the polymers can be covalently or non-covalently conjugated to the polypeptide. Methods of conjugation for increasing serum half-life are known in the art, for example, in U.S. Pat. Nos.: 5,180,816, 6,423,685, 6,884,780, and 7,022,673.
  • the polymer prolongs the serum half-life of the isolated polypeptide when attached to the isolated polypeptide. In some embodiments, the polymer prolongs the shelf-life of the isolated polypeptide when attached to the isolated polypeptide.
  • serum half-life refers to the period of time required for the concentration or amount of the polypeptides in the body to be reduced by one-half. A polypeptide's serum half-life depends on how quickly it is eliminated from the serum. The longer the serum half-life is, the more stable the polypeptide is in the body.
  • shelf-life refers to the period of time, from the date of manufacture, that a product is expected to remain within its approved product specification while stored under defined conditions. It is desirable for a therapeutic agent, e.g., the isolated polypeptide of the present disclosure, to have a longer shelf-life.
  • the isolated polypeptides of the present disclosure may comprise conservative amino acid substitutions.
  • conservative amino acid substitution refers to an amino acid substitution that changes an amino acid to a different amino acid with similar biochemical properties (e.g., charge, hydrophobicity and size) .
  • Conservative substitutions of amino acids include, for example, substitutions made amongst amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.
  • Conservative amino acid substitutions do not alter the relative charge or size characteristics of the protein in which the amino acid substitutions are made.
  • Conservative amino acid substitutions typically do not change the overall structure of the peptide and/or the type of amino acid side chains available for forming van der Waals bonds with a binding partner.
  • Amino acid substitution can be achieved during chemical synthesis of the peptide by adding the desired substitute amino acid at the appropriate sequence in the synthesis process. Alternatively, molecular biology methods can be used. Non-conservative substitutions are also encompassed to the extent that they substantially retain the activities of those polypeptides described herein. The amino acid substituted polypeptide will substantially retain the activity of the non-substituted polypeptide.
  • substantially retain means one or more activity of the variant is at least 50%compared to the activity of the original polypeptide in a similar assay, under similar conditions; preferably the activity is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, at least 100%, at least 2-fold, at least 5-fold, at least 10-fold, at least 100-fold or higher activity compared to the original polypeptide.
  • chimeric molecules comprising a first portion and a second portion, wherein the first portion comprises an isolated polypeptide disclosed herein, and wherein the second portion is a molecule that is different from the isolated polypeptide disclosed herein.
  • the second portion of the chimeric molecule comprises a therapeutic agent.
  • the therapeutic agent may be an anti-bacterial agent.
  • the therapeutic agent may be an antibiotic, for example, but not limited to Vancomycin, Metronidazole and the like.
  • Classes of anti-bacterial agents that may be used in accordance with the present disclosure include, without limitation, aminoglycosides, ansamycins, carbacephems, carbapenems, cephalosporins, glycopeptides, lincosamides, lipopeptides, macrolides, monobactams, nitrofurans, oxazolidinones, penicillins, quinolones, sulfonamides, and tetracyclines. It is to be understood that any known anti-bacterial agent in the art that can be attached to a polypeptide may be used herein.
  • the second portion of the chimeric molecule may be an anti-TcdB immune molecule, for example, a binder or antibody that binds TcdB, or a nanobody against TcdB.
  • the second portion may be an ankyrin repeat.
  • the second portion is CSPG4 polypeptide. In some embodiments, the second portion is a fragment of CSPG4, preferably CSPG4 410-550 (CSPG4 R1 , SEQ ID NO: 20) .
  • Nucleic acid molecules, vectors or expression cassettes, or recombinant host cells are provided.
  • an isolated nucleic acid molecule comprising a polynucleotide encoding the isolated polypeptide disclosed herein, a vector or an expression cassette comprising a polynucleotide encoding the isolated polypeptide disclosed herein, or a recombinant host cell comprising a polynucleotide encoding the isolated polypeptide disclosed herein or comprising a vector or an expression cassette comprising a polynucleotide encoding the isolated polypeptide disclosed herein.
  • some regulating elements may be comprised, for example, a promoter, an enhancer, a selectable marker, or a purification tag, and the like.
  • Another aspect of the present disclosure provides a method for producing the isolated polypeptide disclosed herein, wherein the method comprising obtaining a cell described herein and expressing nucleic acid described herein in said cell. In some embodiments, the method further comprises isolating and purifying a polypeptide described herein.
  • Another aspect of the present disclosure provides neutralizing molecules targeting one or more site selected from E1433, D1467, D1468, E1469, S1598, L1599, L1434, K1435, M1438, V1492, L1494, I1496, L1489, P1506, or Y1510 of TcdB4 (SEQ ID NO: 9) .
  • the neutralizing molecules targeting any combination of E1433, D1467, D1468, E1469, S1598, L1599, L1434, K1435, M1438, V1492, L1494, I1496, L1489, P1506, or Y1510 of TcdB4 (SEQ ID NO: 9) .
  • Another aspect of the present disclosure provides neutralizing molecules targeting one or more site selected from E1432, D1466, D1467, S1597, L1598, L1433, K1434, M1437, V1491, L1493, or L1488 of TcdB2 (SEQ ID NO: 7) .
  • the neutralizing molecules targeting any combination of E1432, D1466, D1467, S1597, L1598, L1433, K1434, M1437, V1491, L1493, or L1488 of TcdB2 (SEQ ID NO: 7) .
  • the neutralizing molecules are antibodies, for example, but not limited to, monoclonal antibodies or humanized antibodies. In some embodiments, the neutralizing molecules are used in the prevention and treatment of Clostridioides difficile infections caused by clade 2 Clostridioides difficile strains.
  • the neutralizing molecules are formulated into a pharmaceutical composition.
  • the pharmaceutical composition comprises therapeutically effective amount of the neutralizing molecules, and a pharmaceutically acceptable carrier.
  • the present disclosure relates to a method for preventing and/or treating diseases caused by TcdB2 and/TcdB4, especially Clostridioides difficile infections (CDI) caused by clade 2 strains, in a subject in need thereof, wherein the method comprises administering to the subject a therapeutically effective amount of the neutralizing molecules.
  • diseases caused by TcdB2 and/TcdB4 especially Clostridioides difficile infections (CDI) caused by clade 2 strains
  • the present disclosure relates to use of the neutralizing molecules in the manufacture of a pharmaceutical composition for preventing and/or treating diseases caused by TcdB2 and/TcdB4, especially Clostridioides difficile infections (CDI) caused by clade 2 strains, in a subject.
  • CDI Clostridioides difficile infections
  • compositions comprising the isolated polypeptide, the fusion protein, the conjugate, the chimeric molecule, or the neutralizing molecules targeting specific site (s) of TcdB2 and/TcdB4 disclosed herein, and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition can further comprise additional agents (e.g., for specific delivery, increasing half-life, or other therapeutic agents) .
  • additional agents e.g., for specific delivery, increasing half-life, or other therapeutic agents
  • the pharmaceutical composition of the present disclosure may further comprise other therapeutic agents suitable for the specific disease such composition is designed to treat.
  • pharmaceutically-acceptable carrier means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid) , or solvent encapsulating material, involved in carrying or transporting the polypeptide from one site (e.g., the delivery site) of the body, to another site (e.g., organ, tissue or portion of the body) .
  • manufacturing aid e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid
  • solvent encapsulating material involved in carrying or transporting the polypeptide from one site (e.g., the delivery site) of the body, to another site (e.g., organ, tissue or portion of the body) .
  • a pharmaceutically acceptable carrier is "acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the tissue of the subject (e.g., physiologically compatible, sterile, physiologic pH, etc. ) .
  • tissue of the subject e.g., physiologically compatible, sterile, physiologic pH, etc.
  • Some examples of materials which can serve as pharmaceutically acceptable carriers are well known in the art, and those skilled in the art can may appropriate options according to the requirements.
  • Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in the formulation.
  • an isolated polypeptide of the present disclosure in a composition is administered by injection, by means of a catheter, by means of a suppository, or by means of an implant, the implant being of a porous, non-porous, or gelatinous material, including a membrane, or a fiber.
  • materials to which the polypeptide of the disclosure does not absorb are used.
  • the isolated polypeptides of the present disclosure are delivered in a controlled release system.
  • the pharmaceutical composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous or subcutaneous administration to a subject, e.g., a human being.
  • compositions for administration by injection are solutions in sterile isotonic aqueous buffer.
  • the pharmaceutical can also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • the pharmaceutical is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.
  • a pharmaceutical composition for systemic administration may be a liquid, e.g., sterile saline, lactated Ringer's or Hank's solution.
  • the pharmaceutical composition can be in solid forms and re-dissolved or suspended immediately prior to use. Lyophilized forms are also contemplated.
  • the pharmaceutical composition can be contained within a lipid particle or vesicle, such as a liposome or microcrystal, which is also suitable for parenteral administration.
  • compositions of the present disclosure may be administered or packaged as a unit dose, for example.
  • unit dose when used in reference to a pharmaceutical composition of the present disclosure refers to physically discrete units suitable as unitary dosage for the subject, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent (e.g., carrier, or vehicle) .
  • the isolated polypeptides described herein may be conjugated to a therapeutic moiety, e.g., an antibiotic.
  • a therapeutic moiety e.g., an antibiotic.
  • Techniques for conjugating such therapeutic moieties to polypeptides, including e.g., Fc domains, are well known; see, e.g., Amon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy” , in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds. ) , 1985, pp. 243-56, Alan R. Liss, Inc. ) ; Hellstrom et al., "Antibodies For Drug Delivery” , in Controlled Drug Delivery (2nd Ed. ) , Robinson et al.
  • the pharmaceutical composition can be provided as a pharmaceutical kit.
  • the kit comprises a container comprising the polypeptide or the pharmaceutical composition disclosed herein.
  • the isolated polypeptides, chimeric molecules, and the pharmaceutical compositions comprising such isolated polypeptides of the present disclosure may be used to prevent and/or treat a variety of diseases caused by TcdB2 and/TcdB4.
  • the disease is Clostridioides difficile infection (CDI) , e.g., CDI caused by clade 2 Clostridioides difficile strains.
  • CDI Clostridioides difficile infection
  • kits for preventing and/or treating Clostridioides difficile infection comprising administering to a subject in need thereof, a therapeutically effective amount of the isolated polypeptides or the pharmaceutical composition comprising such isolated polypeptides disclosed herein, or the neutralizing molecules targeting specific site (s) of TcdB2 and/TcdB4 disclosed herein.
  • the isolated polypeptides of or the pharmaceutical composition comprising such isolated polypeptides is effective in blocking TcdB2 and/TcdB4 binding to TFPI on cell surface.
  • clade 2 Clostridioides difficile strains refer to a class of Clostridioides difficile strains classified into clade 2 according to multi-locus sequence typing (MLST) (Griffiths, D. et al. Multilocus sequence typing of Clostridium difficile. J. Clin. Microbiol. 48, 770–778 (2010) ) .
  • MLST multi-locus sequence typing
  • Clostridioides difficile MLST classification can be found on the Internet-accessible database (http: //pubmlst. org) .
  • TcdB2 and TcdB4 Clostridioides difficile exclusively expressing two TcdB variants, TcdB2 and TcdB4.
  • TcdB2 and TcdB4 do not recognize Wnt receptor Frizzled proteins (FZDs) (Chung et al., 2018; Henkel et al., 2020; Lopez-Urena et al., 2019; Pan et al., 2021; Simeon et al., 2019) , but recognize TFPI, as demonstrated in the present disclosure.
  • Frizzled proteins FZDs
  • “Clade 2 Clostridioides difficile strains” contain several epidemically and clinically important strains belonging to ST01 (RT027) , ST67, ST41, ST48, etc. (Knight, D.R., Imwattana, K., Kullin, B., Guerrero-Araya, E., Paredes-Sabja, D., Didelot, X., Dingle, K.E., Eyre, D.W., Rodriguez, C., and Riley, T.V. (2021) .
  • the pharmaceutically composition used for preventing and/or treating CDI of the present disclosure further comprises additional therapeutic agents or polypeptides, for example, CSPG4 polypeptide, or a fragment thereof, preferably CSPG4 410-550 (CSPG4 R1 , SEQ ID NO: 20) .
  • the pharmaceutically composition used for preventing and/or treating CDI of the present disclosure further comprises agents that facilitate blocking TcdB2 and/or TcdB4 binding to TFPI on cell surface.
  • agents may be, for example, an antibody against TcdB2 and/or TcdB4.
  • a therapeutically effective amount refers to the amount of each therapeutic agent of the present disclosure (e.g., the isolated polypeptide fragment, the additional isolated polypeptide fragment, and the agent that blocks TcdB2 and/or TcdB4 binding to TFPI on cell surface) required to confer therapeutic effect on the subject, either alone or in combination with one or more other therapeutic agents. Effective amounts vary, as recognized by those skilled in the art, depending on the particular condition being treated, the severity of the condition, the individual subject parameters including age, physical condition, size, gender and weight, the duration of the treatment, the nature of concurrent therapy (if any) , the specific route of administration and like factors within the knowledge and expertise of the health practitioner.
  • a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a subject may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.
  • Empirical considerations such as the half-life, generally will contribute to the determination of the dosage.
  • therapeutic agents that are compatible with the human immune system, such as polypeptides comprising regions from humanized antibodies or fully human antibodies, may be used to prolong half-life of the polypeptide and to prevent the polypeptide being attacked by the host's immune system.
  • Frequency of administration may be determined and adjusted over the course of therapy, and is generally, but not necessarily, based on treatment and/or suppression and/or amelioration and/or delay of a disease.
  • sustained continuous release formulations of a polypeptide may be appropriate.
  • formulations and devices for achieving sustained release are known in the art.
  • the dosage is daily, every other day, every three days, every four days, every five days, or every six days.
  • dosing frequency is once every week, every 2 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, or every 10 weeks; or once every month, every 2 months, or every 3 months, or longer. The progress of this therapy is easily monitored by conventional techniques and assays.
  • the dosing regimen (including the polypeptide used) can vary over time.
  • the appropriate dosage of a therapeutic agent as described herein will depend on the specific agent (or compositions thereof) employed, the formulation and route of administration, the type and severity of the disease, whether the polypeptide is administered for preventive or therapeutic purposes, previous therapy, the subject's clinical history and response to the antagonist, and the discretion of the attending physician.
  • the clinician will administer a polypeptide until a dosage is reached that achieves the desired result.
  • Administration of one or more polypeptides can be continuous or intermittent, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners.
  • the administration of a polypeptide may be essentially continuous over a preselected period of time or may be in a series of spaced dose, e.g., either before, during, or after developing a disease.
  • the term “preventing” or “prevention” in connection with a disease, refers to the prevention of occurrence or onset of a disease, or occurrence or onset of one or more symptoms of a disease.
  • the term “treating” or “treatment” refers to the application or administration of a polypeptide or composition comprising the polypeptide to a subject in need thereof.
  • a subject in need thereof refers to an individual who has a disease, a symptom of the disease, or a predisposition toward the disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, the symptom of the disease, or the predisposition toward the disease.
  • the subject has CDI, for example, CDI caused by clade 2 strains.
  • the subject is a mammal.
  • the subject is a non-human primate.
  • the subject is human.
  • Alleviating a disease includes delaying the development or progression of the disease, or reducing disease severity. Alleviating the disease does not necessarily require curative results. As used therein, "delaying" the development of a disease means to defer, hinder, slow, retard, stabilize, and/or postpone progression of the disease. This delay can be of varying lengths of time, depending on the history of the disease and/or individuals being treated.
  • a method that "delays" or alleviates the development of a disease, or delays the onset of the disease is a method that reduces probability of developing one or more symptoms of the disease in a given time frame and/or reduces extent of the symptoms in a given time frame, when compared to the control in which the method is not used. Such comparisons are typically based on clinical studies, using a number of subjects sufficient to give a statistically significant result.
  • “Development” or “progression” of a disease means initial manifestations and/or ensuing progression of the disease. Development of the disease can be detectable and assessed using standard clinical techniques as well known in the art. However, development also refers to progression that may be undetectable. For purpose of this disclosure, development or progression refers to the biological course of the symptoms. “Development” includes occurrence, recurrence, and onset. As used herein "onset” or “occurrence” of a disease includes initial onset and/or recurrence.
  • compositions can also be administered via other conventional routes, e.g., administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir.
  • parenteral as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques.
  • injectable depot routes of administration such as using 1-, 3-, or 6-month depot injectable or biodegradable materials and methods.
  • TcdB2 full-length sequence from Clostridioides difficile strain R20291, SEQ ID NO: 7; underlined part is SEQ ID NO: 29, positions 841-1833 of SEQ ID NO: 7; bolded part is SEQ ID NO: 30, positions 1284-1833 of SEQ ID NO: 7; the receptor-binding domain (DRBD) of TcdB2 corresponds to positions 840-1833 of SEQ ID NO: 7)
  • TcdB4 full-length sequence from Clostridioides difficile strain 8864, SEQ ID NO: 9; underlined part is SEQ ID NO: 15, positions 842-1834 of SEQ ID NO: 9; bolded part is SEQ ID NO: 16, positions 1285-1834 of SEQ ID NO: 9; the receptor-binding domain (DRBD) of TcdB4 corresponds to positions 841-1834 of SEQ ID NO: 9)
  • TFPI K2 -CSPG4 R1 (SEQ ID NO: 21, the linker is capitalized)cfleedpgicrgyitryfynnqtkqcerfkyggclgnmnnfetleecknicGGGGSGGGGSGGGGSelpepcvpepglppvfanftqlltisplvvaeggtawlewrhvqptldlmeaelrksqvlfsvtrgarhgeleldipgaqarkmftlldvvnrkarfihdgsedtsdqlvlevsvtarvpmpsclrrgqtyllpiqvnpvnd
  • TFPI K2 -Fc (SEQ ID NO: 26, Fc portion is shown in lower letters, and TFPI K2 is underlined)
  • Tfpi K2 -Fc (SEQ ID NO: 27, Fc portion is shown in lower letters, and Tfpi K2 is underlined)
  • All cell lines were commercially available. All cell lines were cultured in DMEM medium plus 10%fetal bovine serum (FBS) and 1%penicillin-streptomycin in a humidified atmosphere of 95%air and 5%CO 2 at 37 °C. HeLa and 293T cells were tested negative for mycoplasma contamination and authenticated via STR profiling (Shanghai Biowing Biotechnology Co. LTD, Shanghai, China) .
  • FBS fetal bovine serum
  • 1%penicillin-streptomycin in a humidified atmosphere of 95%air and 5%CO 2 at 37 °C.
  • HeLa and 293T cells were tested negative for mycoplasma contamination and authenticated via STR profiling (Shanghai Biowing Biotechnology Co. LTD, Shanghai, China) .
  • mice Male and female, 6-8 weeks were purchased from Shanghai Jihui Laboratory Animal Care Co., Ltd. (Shanghai, China) .
  • the Tfpi ⁇ KO mice were generated in the Laboratory Animal Resources Center of Westlake University. Mice were housed with food and water without limitation and monitored under the care of full-time staff.
  • TcdB5 reference sequence: TcdB ES130 , SEQ ID NO: 10
  • TcdB6 reference sequence: TcdB CD160 , SEQ ID NO: 11
  • DNA fragments encoding TcdB4 1-841 , TcdB4 842-1834 , TcdB4 1801-2367 , TcdB4 1285-1834 , and TcdB2 1285-1834 were PCR amplified and cloned into a pET28a vector with a HA-His tag introduced to their C-terminus.
  • Genes encoding human TFPI ⁇ (SEQ ID NO: 3) , TFPI ⁇ (SEQ ID NO: 4) , TFPI K1 -GPI, TFPI K2 -GPI, TFPI2 K1 -GPI, TFPI2 K2 -GPI, AMBP K3 -GPI, and mouse Tfpi ⁇ (SEQ ID NO: 5) were codon-optimized, synthesized by Genscript (Nanjing, China) , and cloned into a PLVX-IRES-Cherry vector.
  • DNA fragments encoding TFPI K1+K2 , TFPI K1 , TFPI K2 , Tfpi K1 , Tfpi K2 , CSPG4 R1 , and TFPI K2 -CSPG4 R1 were PCR amplified and cloned into a pCAG or PHLsec vector with a FLAG, Fc-FLAG, Fc-His, or GFP-His tag fused to their C-terminus.
  • TcdB4 1-841 , TcdB4 842-1834 , TcdB4 1801-2367 , TcdB4 1285- 1834 , and TcdB2 1285-1834 were expressed in E. coli BL21 (DE3) and purified as His-tagged proteins.
  • TFPI ⁇ -GFP Recombinant TFPI ⁇ -GFP, TFPI K1+K2 -GFP, TFPI K1+K2 , TFPI K1+K2 -Fc, TFPI K1 -Fc, TFPI K2 -Fc, Tfpi K1 -Fc, Tfpi K2 -Fc, CSPG4 R1 , and TFPI K2 -CSPG4 R1 were expressed in 293F cells and purified as His or FLAG-tagged proteins.
  • the cytopathic effect (cell-rounding) of TcdB was analyzed using the gold-standard cell-rounding assay. In brief, cells were exposed to toxins for the indicated time (or 12 hours, if not noted) . The phase-contrast images were captured by an Olympus IX73 microscopy system ( ⁇ 10-20 objectives) . The numbers of round-shaped and normal-shaped cells were manually counted. The percentage of round-shaped cells was analyzed using GraphPad Prism and Origin software.
  • HeLa CRISPR/Cas9 genome-wide KO library was generated as previously described (Tao et al., 2019; Tao et al., 2016) .
  • the GeCKO v2 library is composed of two sub-libraries (A and B) and contains six gRNAs targeting each gene.
  • 293T cells were used to package the lentiviruses. 48 hours post-transfection, the supernatant of the 293T culture was collected.
  • the HeLa-Cas9 cells were then transduced with the lentiviral library at a multiplicity of infection (MOI) of 0.3 and selected with 2.5 ug/mL puromycin for 4 days.
  • MOI multiplicity of infection
  • each CRISPR sub-library at least 6.7 ⁇ 10 7 cells were plated onto 15-cm cell culture dishes to ensure sufficient gRNA coverage.
  • the cell library was then added with TcdB4 of indicated concentrations and cultured for 18 hours.
  • the plates were then washed with phosphate buffer saline (PBS) to remove loosely attached cells.
  • PBS phosphate buffer saline
  • the remaining cells were cultured with the toxin-free medium and allowed to grow to ⁇ 70%confluence and subjected to the next round of screen.
  • Three rounds of screens were performed with increasing concentrations of TcdB4 (0.045, 0.15, and 0.45 pM, respectively) .
  • Cells from the final round of the screen were collected, and their genomic DNA was extracted using the Blood and Cell Culture DNA mini kit (Qiagen) .
  • DNA fragments containing the gRNA sequences were amplified by PCR using primers lentiGP1_F (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG) and lentiGP-3_R (ATGAATACTGCCATTTGTCTCAAGATCTAGTTACGC) .
  • NGS Next-Generation Sequencing
  • TFPI 5′-CCTGACTCCGCAATCAACCA-3′
  • PIGM 5′-GTATACGGACATCGACTACC-3′
  • PIGP 5′-CTACAGTACTTTACCTCGTG-3′
  • PIGX 5′-CGATGATAGCGGCAGTGCAC-3′
  • the HeLa CSPG4 -/- /TFPI -/- cells were generated from the HeLa CSPG4 -/- cells via CRISPR/Cas9 mediated KO using the above gRNA targeting TFPI.
  • Lentiviruses were produced by the co-transfection of LentiGuide-puro plasmid containing each gRNA, pSPAX2, and pMD2. G into 293T cells.
  • HeLa-Cas9 cells were transduced with lentiviruses expressing target gRNAs. Mixed populations of infected cells were selected with puromycin (2.5 ⁇ g/ml) . For all KO cells, monoclonal cells were then isolated and validated by sequencing.
  • the protein amounts in cell lysate were determined by BCA assay (Beyotime, P0012S) .
  • the cell lysates were added with SDS sample buffer, heated for 10 minutes, separated on an SDS-PAGE gel, and transferred onto a nitrocellulose membrane (GE Healthcare, 10600002) .
  • the membranes were blocked with 0.5%bovine serum albumin (BSA) and 0.1%Tween-20 in tris-buffered saline at room temperature (RT) for 30 minutes.
  • BSA bovine serum albumin
  • RT room temperature
  • the membranes were then incubated with the primary antibodies overnight (4°C) , washed, and incubated with secondary antibodies for 30 minutes. Signals were detected using the enhanced chemiluminescence substrate (Thermo Fisher Scientific, 1863096) with a Fuji LAS3000 imaging system.
  • Toxins were pre-incubated with TFPI K1+K2 -Fc, TFPI K1 -Fc, or TFPI K2 -Fc for 10 minutes at room temperature with indicated toxin/protein ratios. The mixtures were added to the culture medium. Cells were then incubated at 37 °C and the percentage of cell rounding was examined.
  • Pull-down assays were performed using Protein A agarose beads (Thermo Fisher Scientific) . Briefly, Fc-tagged TFPI domains were mixed with full-length TcdB1/TcdB4 or TcdB4 fragments of indicated concentrations in 1 ml of PBS. The mixtures were incubated at 4°C for 30 minutes and co-precipitated by Protein A agarose beads. Beads were washed, pelleted, boiled in SDS sample buffer, and subjected to SDS-PAGE or immunoblot analysis.
  • the binding affinities between recombinant TcdB4 and human/mouse TFPI domains were measured by BLI assay using the Octet RED96 system (ForteBio) . All proteins were diluted in PBS.
  • Fc-tagged human/mouse TFPI domains (10 ⁇ g/mL) were immobilized onto Dip and Read Anti-human IgG-Fc biosensors (ForteBio) and balanced with PBS. The biosensors were then exposed to full-length TcdB4, TcdB4 1285-1834 , or TcdB2 1285-1834 , followed by washing (dissociation) with PBS. Binding affinities (K d ) were calculated using the Data Analysis software (ForteBio) .
  • TFPI K2 -Fc (10 ⁇ g /mL) was immobilized onto Dip and Read Anti-human IgG-Fc biosensors and balanced with HNBSACa buffer (50mM HEPES, 100mM NaCl, 5mM CaCl2, 0.1%BSA, pH 7.3) .
  • HNBSACa buffer 50mM HEPES, 100mM NaCl, 5mM CaCl2, 0.1%BSA, pH 7.3
  • the loaded biosensors were first exposed to 100 nM FXa, balanced again with HNBSACa buffer, and then exposed to 300 nM TcdB4 1285-1834 .
  • the loaded biosensors were first exposed to 300 nM TcdB4 1285-1834 , balanced with HNBSACa, buffer and then exposed to 100 nM FXa. All biosensors were then washed with HNBSACa buffer.
  • Cryo-EM specimens were imaged on a 300-kV Titan Krios electron microscope (Thermo Fisher Scientific) using a normal magnification of 81,000 ⁇ . Movies were recorded using a Gatan K3 detector (Thermo Fisher Scientific) equipped with a GIF Quantum energy filter (slit width 20 eV) at the counted mode, with a pixel size of Each stack of 32 frames was exposed for 2.56 seconds, with a dose rate of ⁇ 23 counts/second/physical-pixel ( ⁇ 19.5 ) for each frame. AutoEMation II (Lei and Frank, 2005) was used for the fully automated data collection with high efficiency ( ⁇ 3000 stacks/24 hours) .
  • a total of 2,317,113 particles were auto-picked using Gautomatch (developed by Kai Zhang, https: //www. mrc-lmb. cam. ac. uk/kzhang/Gautomatch/) and were subjected to two-dimensional (2D) classification, resulting in 1,244,165 good particles.
  • the inventors performed two parallel runs of single-reference 3D classification using 4x binned particles (pixel size: ) (Round 1) . After Round 1, good particles were selected and merged, and the duplicated particles were removed.
  • the remaining 953, 332 particles were applied to another two parallel runs of single-reference 3D classification (Round 2) , but with 2x binned particles (pixel size: ) .
  • the remaining 536,277 particles were re-centered and re-extracted (pixel size: ) for auto-refinement, generating a reconstruction of the TcdB4-TFPI complex at an average resolution of
  • an additional round (Round 3) of 3D classification was performed.
  • the remaining particles were classified with a soft mask on the core region of the complex.
  • the good class containing 227,825 particles yielded a reconstruction at an average resolution of These particles were further locally classified and refined using a soft mask on the interface between TFPI and TcdB4, generating an additional reconstruction for the interface at
  • the angular distributions of the particles used for the final reconstruction are reasonable, and the refinement of the atomic coordinates did not suffer from severe over-fitting.
  • the resulting EM density maps display clear features for amino acid side chains in the core region and the TcdB4-TFPI interface. Reported resolution limits were calculated based on the FSC 0.143 criterion with a high-resolution noise substitution method (Chen et al., 2013) . Prior to visualization, all EM maps were corrected for modulation transfer function (MTF) of the detector and then sharpened by applying a negative B-factor that was estimated using an automated procedure (Rosenthal and Henderson, 2003) . Local resolution variations were estimated using ResMap (Swint-Kruse and Brown, 2005) .
  • MTF modulation transfer function
  • the crystal structure of Clostridioides difficile toxin B (PDB code: 6OQ5) was used as a template to generate a homology model for TcdB4 using CHAINSAW (Stein, 2008) .
  • the homology model was fit into the cryo-EM map for the TcdB4-TFPI complex using UCSF Chimera (Pettersen et al., 2004) .
  • Manual adjustment of the model was performed in COOT (Emsley and Cowtan, 2004) , followed by iterative rounds of real-space refinement in PHENIX and manual adjustment in COOT.
  • the crystal structure of the K2 domain of TFPI was fit into the cryo-EM map and manually adjusted in COOT. See Table 2 for statistics of 3D reconstructions and model refinement.
  • TcdB or TcdB fragments were generated with oligonucleotides containing the mutations of interest using QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, 200523) or Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S) .
  • the spCas9 protein and sgRNAs were microinjected into the fertilized eggs of C57BL/6 mice, sequences of sgRNAs are shown in Table 3. Fertilized eggs were transplanted to obtain positive F0 mice which were confirmed by PCR and sequencing. A stable F1 generation mouse model was obtained by mating positive F0 generation mice with C57BL/6 mice. Genotyping of mice was performed using the mouse tissue direct PCR Kit (10185ES50, Yeasen) . PCR products were analyzed by agarose gel electrophoresis. Primers used for genotyping are summarized in Table 3.
  • mice All procedures were conducted following the guidelines approved by the Institutional Animal Care and Use Committee at Westlake University (IACUC Protocol #19-010-TL) . 6-8 weeks old female mice were anesthetized by intraperitoneal injection of 1%pentobarbital sodium. A midline laparotomy was performed to locate the ascending colon and seal a ⁇ 2 cm loop with silk ligatures.
  • Colon specimens were fixed in formalin for 12 h before being dehydrated by using an alcohol gradient, cleared with xylene then embedded in paraffin. Paraffin blocks were cut into 5 ⁇ m thick sections. The sections were stained with hematoxylin and eosin or detected with an antibody against TFPI (ab180619, Abcam) via immunohistochemical analysis. The H&E staining sections were scored blinded by two pathologists based on edema, inflammatory cell infiltration, epithelial disruption, and cryptic damage on a scale of 0 to 3 (mild to severe) . The average scores were plotted on the charts.
  • phase-contrast images of cells were taken (Olympus IX73, 10-20 ⁇ objectives) .
  • a zone of 300 ⁇ 300 ⁇ m was selected randomly, which contains 50 ⁇ 150 cells.
  • Round-shaped and normal-shaped cells were counted manually, and the percentage of round-shaped cells was calculated.
  • Data were represented as mean ⁇ SD from six independent replicates and analyzed using Student’s t-test in the software OriginPro or GraphPad Prism. ns, not significant; *, p ⁇ 0.05; **, p ⁇ 0.01; ***, p ⁇ 0.001.
  • H&E staining sections were scored blinded and plotted on the charts. Data were represented as mean ⁇ SEM and analyzed by One-way ANOVA using Fisher LSD test for multiple comparisons in the software OriginPro or GraphPad Prism. ns, not significant; *, p ⁇ 0.05; **, p ⁇ 0.01; ***, p ⁇ 0.001; ****, p ⁇ 0.0001.
  • Genome-wide CRISPR-Cas9 screen identifies host factors for TcdB4
  • the inventors set out to perform the gold-standard cytopathic cell-rounding assays on HeLa-Cas9 cells (parental HeLa cell line, referred to as the wildtype thereafter) and CSPG4 -/- /FZD1/2/7 -/- cells to monitor the activities of reference TcdB from each of eight known subtypes.
  • TcdB4 reference sequence from strain 8864
  • the inventors observed that TcdB4 (reference sequence from strain 8864) is a toxin variant highly potent to both HeLa WT and CSPG4 -/- /FZD1/2/7 -/- cells ( Figure 8) .
  • the inventors then tested several human cell lines from various tissue origins for their sensitivity towards TcdB4.
  • TcdB4 Some cell lines, including U2OS and MCF-7, are much less sensitive to TcdB4 than others, such as HeLa, A549, and HT-29 ( Figure 1A) . These findings indicate that an uncharacterized and cell type-specific receptor could efficiently mediate the cellular entry of TcdB4.
  • the inventors conducted a genome-wide CRISPR-Cas9 screen in HeLa cells.
  • cells were transduced with a genome-wide gRNA library (GeCKO v2) targeting 19,052 human genes (Sanjana et al., 2014) using lentiviruses and subjected to three rounds of selection with increasing concentration of TcdB4 ( Figure 1B) .
  • the gRNAs sequences from the surviving cell population were decoded by next-generation sequencing (NGS) .
  • NGS next-generation sequencing
  • the inventors assessed the identified genes based on fold-enrichment of gRNA reads, NGS reads per gene, and the number of unique gRNAs ( Figure 1C and 1D) .
  • UGP2 and CSPG4 are two expected top hits.
  • UGP2 is a cytosolic enzyme that produces UDP-glucose (Flores-Diaz et al., 1997) , a co-factor required for most LCTs to glucosylate small GTPases (Chaves-Olarte et al., 1996; Jank and Aktories, 2008) .
  • CSPG4 is a characterized receptor for TcdB1 and TcdB2 (Chen et al., 2021; Tao et al., 2016; Yuan et al., 2015) .
  • a previous study also showed that CSPG4 KO cells were mildly resistant to TcdB4 (Pan et al., 2021) .
  • TFPI stood out from the screen with five different gRNAs targeted. TFPI regulates the tissue factor-dependent pathway of blood coagulation and mainly exists on the cell membrane and in the extracellular space (Broze and Girard, 2012; Wood et al., 2014) .
  • GPI-anchoring is a posttranslational modification and allows the modified proteins to be attached to the cell membrane via the glycolipid structure.
  • RNF41 is a cytosolic E3 ubiquitin-protein ligase (Qiu and Goldberg, 2002) and ZNF619 is a predicted nuclear protein with the nucleic acid binding property.
  • the inventors generated TFPI -/- , PIGX -/- , PIGM -/- , and PIGP -/- HeLa cell lines using the CRISPR-Cas9 approach. For each candidate gene, two single-KO clones were established, and targeted disruptions of the open reading frames were confirmed by DNA sequencing. These cell lines, together with the FZD1/2/7 -/- and CSPG4 -/- cells, were tested by the cytopathic cell rounding experiment (toxin concentration that induces 50%of cells to turn to round is defined as CR 50 ) using TcdB4 ( Figure 2A) .
  • HeLa FZD1/2/7 -/- cells remained as sensitive as the WT cells to TcdB4, while CSPG4 -/- cells showed mildly increased resistance (based on CR 50 thereafter) .
  • HeLa PIGX -/- , PIGM -/- , and PIGP -/- cells showed modestly reduced sensitivities ( ⁇ 7 to 20-fold) compared with the WT cells to TcdB4 ( Figure 2B) .
  • PI-PLC phosphatidylinositol-specific phospholipase C
  • HeLa TFPI -/- cells were highly resistant to TcdB4, with reduced sensitivity of ⁇ 260-fold compared with the WT cells (Figure 2B) .
  • the increased resistance in TFPI -/- cells was further confirmed by immunoblot for RAC1 glucosylation ( Figure 2D) .
  • the inventors monitored the surface binding of TcdB4 in the HeLa WT, FZD1/2/7 -/- , CSPG4 -/- , and TFPI -/- cells using the immunoblot assay.
  • TcdB4 is equally bound to the cell surface of WT and FZD1/2/7 -/- cells.
  • Membrane attached TFPI isoforms act as receptors for TcdB4
  • TFPI has multiple spliced isoforms since its pre-mRNA undergoes alternative splicing events (Broze and Girard, 2012; Maroney et al., 2010) .
  • TFPI has two major isoforms, TFPI ⁇ and TFPI ⁇ , which are also produced by all mammals (Wood et al., 2014) .
  • TFPI ⁇ contains three tandem Kunitz-type protease inhibitory (Kunitz-1, Kunitz-2, and Kunitz-3, or K1, K2, and K3) domains followed by a basic carboxyterminal (C-terminal) region.
  • TFPI ⁇ lacks the K3 and basic C-terminal domains of TFPI ⁇ .
  • TFPI ⁇ is a GPI-anchored protein, which is in line with the screen result that multiple GPI anchor biosynthesis genes were targeted. Because TcdB4 also binds CSPG4 (yet inefficiently) for cellular entry and CSPG4 is highly expressed in the HeLa cells (Gupta et al., 2017; Tao et al., 2016) , HeLa CSPG4 -/- cells are utilized to minimize the affection of CSPG4 when studying the roles of TFPI in HeLa cells.
  • HeLa CSPG4 -/- /TFPI -/- cells were more resistant to TcdB4 than CSPG4 -/- cells, while the susceptibility of CSPG4 -/- /TFPI -/- cells could be restored by transient transfection of TFPI ⁇ ( Figure 2G and 2H) .
  • TFPI ⁇ is a secreted isoform that localizes both on the cell surface or in blood plasma (Novotny et al., 1989; Piro and Broze, 2005; Wood et al., 2014) .
  • the cell membrane localization of TFPI ⁇ is mainly compassed by binding of its K3 domain to protein S and basic C-terminal region to cell-surface glycosaminoglycans (Donahue et al., 2006; Ndonwi et al., 2012; Ndonwi et al., 2010; Piro and Broze, 2004; Sandset et al., 1988) .
  • TcdB4 interacts with the Kunitz-1 and Kunitz-2 domains of TFPI (TFPI K1+K2 ) .
  • the inventors expressed and purified recombinant TFPI K1+K2 fused with human Fc fragment ( Figure 3A) and performed the competition assay on the HeLa CSPG4 -/- cells.
  • TFPI K1+K2 effectively protected the cells from TcdB4 but failed to alleviate the intoxication of TcdB1 ( Figure 3B and Figure 11A) , supporting the idea that TFPI K1+K2 specifically binds TcdB4.
  • TcdB4 but not TcdB1 was bound to the recombinant TFPI K1+K2 -Fc and co-precipitated by Protein A beads ( Figure 11B) .
  • Kunitz domains are small, disulfide-rich, and ⁇ / ⁇ fold structural domains that function as protease inhibitors (Ascenzi et al., 2003) . Kunitz domains can be found in many proteins including TFPI, TFPI2, Alpha-1-Microglobulin/Bikunin Precursor (AMBP) , and Amyloid Precursor Protein (APP) .
  • ABP Alpha-1-Microglobulin/Bikunin Precursor
  • APP Amyloid Precursor Protein
  • TcdB4 binds to TFPI K1 or TFPI K2 and the binding selectivity
  • the inventors expressed GPI-anchored TFPI K1 , TFPI K2 , TFPI2 K1 , or AMBP K3 in the HeLa CSPG4 -/- /TFPI -/- cells and then tested their sensitivities to TcdB4.
  • the inventors showed that transient transfection of only GPI-anchored TFPI K2 could restore the susceptibility of CSPG4 -/- /TFPI -/- cells ( Figure 3D) , suggesting TcdB4 specifically recognizes the Kunitz-2 domain of TFPI.
  • TFPI K2 -Fc, but not TFPI K1 -Fc protected the HeLa CSPG4 -/- cells in the competition experiment ( Figure 11C) .
  • the inventors further quantified the binding kinetics between TFPI K1+K2 -Fc and TcdB4 using the bio-layer interferometry (BLI) assay, which revealed a high affinity with a dissociation constant (K d ) of ⁇ 13 nM ( Figure 12A) .
  • BLI assay also showed that TcdB4 bound to TFPI K2 -Fc with a K d of ⁇ 6 nM, but not to TFPI K1 -Fc or human Fc fragment ( Figure 3E and 12B) .
  • TcdB4 bound to Fc-tagged mouse Tfpi K2 with a K d of ⁇ 4 nM ( Figure 12C) .
  • TcdB ( ⁇ 270 kDa) is one of the largest bacterial toxins composed of four functional domains, including a glucosyltransferase domain (GTD) , a cysteine protease domain (CPD) , a transmembrane delivery and receptor-binding domain (DRBD) , and a C-terminal combined repetitive oligopeptides (CROPs) domain (Figure 4A) .
  • GTD glucosyltransferase domain
  • CPD cysteine protease domain
  • DRBD transmembrane delivery and receptor-binding domain
  • CROPs C-terminal combined repetitive oligopeptides
  • TcdB4 The overall architecture of TcdB4 is similar to the previously determined structure of TcdB (Chen et al., 2019; Simeon et al., 2019) .
  • the CPD and GTD form an integrated region while the CROPs domain module curve around the core region by forming like a big hook (Figure 4B) .
  • the Kunitz-2 domain of TFPI is bound to the convex edge of the DRBD largely through two flexible loops in TFPI: loop-1 (residues 131-138) and loop-2 (residues 155-162) (Figure 4B and 4C) .
  • Each loop engages TcdB4 via an extensive network composed of hydrogen bonds and hydrophobic interactions (Figure 4D) .
  • TcdB4-TFPI The resolved structure of TcdB4-TFPI, together with the previously reported structure of TcdB1-FZD2 (Chen et al., 2018) , revealed an evolutionarily functional region in TcdB for receptor recognition.
  • the inventors performed a phylogenetic analysis of the receptor-binding interface (RBI) of TcdB (residues 1431-1606, Figure 5A) .
  • the phylogenetic tree is clustered into two major branches (denoted as Class I and II) .
  • Class I RBIs derive from TcdB1, TcdB3, and TcdB5, which prefer to bind FZDs.
  • Class II RBIs were composed of sequences from TcdB2, TcdB4, TcdB6, and TcdB7 (Figure 5A) , mainly existing in clade 2 Clostridioides difficile ( Figure 5B) .
  • a small number of RBIs from TcdB2 and TcdB4 were found either in Class I or as outliers, possibly due to the historically frequent recombination events among TcdB variants (Knight et al., 2021; Mansfield et al., 2020; Shen et al., 2020) .
  • Albeit FZD2 and TFPI are very different in structure, they both engage the same hydrophobic interface located on the convex edge of TcdB RBI ( Figure 5C) .
  • residues including but not limited to L1434, M1438, L1494, and Y1510 (positions in TcdB4; residues in TcdB1 shift to the left by one position in the alignment) , are shared by Class I and Class II RBIs and contribute to both FZD and TFPI interactions.
  • the interaction is bridged by a palmitoleic acid (PAM) with its tail protruding into a hydrophobic pocket in TcdB1.
  • PAM palmitoleic acid
  • TcdB4-TFPI complex the side chain of TFPI R135 is deeply embedded in the same pocket but forms multiple hydrogen bonds with adjacent residues including E1433, D1467, and E1469 from TcdB4 ( Figure 5D) .
  • F1597 in TcdB1 is a critical residue stabilizing the middle part of PAM and interacts with the nearby F130 in FZD2 (Chen et al., 2018; Peng et al., 2019) , while a Phe to Ser substitution mimicking TcdB2 and TcdB4 abolishes FZD binding (Henkel et al., 2020) .
  • TcdB4 forms a close hydrogen bond with the nearby R140 in TFPI ( Figure 5E) .
  • an F1598S substitution for TcdB may impair FZD-binding but contribute to TFPI-binding.
  • Phe is conserved in all Class I RBIs while Ser is conserved in all Class II RBIs at this position.
  • TcdB2 The potential TFPI-binding interface in TcdB2 resembles TcdB4 ( Figure 5F) , providing a structural clue that TcdB2 may also recognize TFPI.
  • the HeLa CSPG4 -/- /TFPI -/- cells are more resistant to TcdB2 than its parental CSPG4 -/- cells ( Figure 5G) , while its susceptibility to TcdB2 could be restored by ectopic expressing a GPI-anchored Tfpi K2 ( Figure 5H) .
  • Tfpi K2 -Fc effectively protected the HeLa CSPG4 -/- cells from TcdB2 intoxication (Figure 5I and Figure 17A) .
  • the inventors also performed BLI analysis to detect the TcdB2-TFPI interaction (reference sequence from R20291, an ST01/RT027 strain) and observed that TcdB2 bound to Fc-tagged mouse Tfpi K2 and human TFPI K2 with respective K d of ⁇ 0.2 and 0.4 ⁇ M ( Figure 17B-17D) .
  • TFPI is a physiologically relevant receptor for TcdB4
  • TFPI is primarily produced by endothelial cells, megakaryocytes, monocytes, and smooth muscle cells (Maroney and Mast, 2015; Wood et al., 2014) .
  • TFPI is highly expressed in endothelial cells and glandular cells (Uhlen et al., 2015) .
  • the inventors also confirmed that Tfpi is highly expressed at the base of the glands in mouse intestines, including ileum, jejunum, cecum, and colon, via immunohistochemistry (IHC) analysis ( Figure 6A and Figure 19A) .
  • mice injected with saline or TcdB4 premixed with TFPI K2 -Fc showed normal activities.
  • the inventors found the largely collapsed architectures of the colonic crypts as well as the partly disrupted cryptic epithelium in the TcdB4 group, indicating that colonic crypts are vulnerable targets for TcdB4.
  • mice with partial Tfpi retained appear to exhibit no overt developmental defect (Girard et al., 2018) . Therefore, the inventors generated the Tfpi ⁇ isoform KO mice (more precisely, ⁇ + ⁇ isoforms KO) using the CRISPR-Cas9 approach ( Figure 20A) .
  • intraperitoneal i.p.
  • Tfpi ⁇ -/- mice have reduced Tfpi levels compared to the WT mice, particularly in the kidney, presumably kidney mainly expresses the Tfpi ⁇ isoform ( Figure 21A) .
  • kidney damage including glomerulus and retrobulbar capillaries dilate, structural damage of red blood cells, deposition of hemoglobin in the intravascular, and renal interstitial congestion and bleeding. Livers, lungs, spleens, and hearts in all injected mice seem to be normal.
  • Tfpi ⁇ -/- mice with TcdB4 injected showed normal kidneys ( Figure 6F and Figure 21B) . These data indicate that TcdB4 entering the circulation system, which is common in severe infections, may strongly damage the kidney and cause death.
  • TcdB2 is the other major subtype expressed by clade 2 Clostridioides difficile.
  • TcdB2 is the other major subtype expressed by clade 2 Clostridioides difficile.
  • the inventors further performed colon-loop ligation assays using TcdB2 and TFPI K2 -Fc.
  • TcdB2 caused severe intestinal injuries, including edema, epithelial disruption, and inflammatory cell infiltration, which was in line with the previous studies (Chen et al., 2021; Pan et al., 2021) .
  • TcdB2 For mice co-injected with TcdB2 and TFPI K2 -Fc, all above pathological features, particularly submucosal edema, were alleviated ( Figure 7A-7C) . However, this protection still seemed to be suboptimal for TcdB2. Since TcdB2 additionally utilizes CSPG4 as its high-affinity receptor, the residual tissue damage may be due to the CSPG4-mediated toxin entry.
  • TcdB2 (2 ⁇ g) , TcdB2 premixed with CSPG4 R1 (50 ⁇ g) , or TcdB2 premixed with TFPI K2 -CSPG4 R1 (50 ⁇ g) were injected into the lumens of ligated mouse colon segments, the colon tissues were then dissected out for histopathological analysis 6 hours post-injection.
  • CSPG4 R1 partly reduced TcdB2-induced damage to the colon, including inflammatory cell infiltration and submucosal edema, which is in line with the previous report.
  • TFPI K2 -CSPG4 R1 provided further enhanced protection to colon tissues albeit an indeed lower toxin-inhibitor molar ratio was adopted, particularly in reducing mucosal edema, epithelial disruption, and cryptic damage (Figure 7D-7F) .
  • Figure 7D-7F a possible therapeutic avenue of simultaneous inhibiting both TFPI-and CSPG4-binding abilities, which provides optimal protection from the clade 2 Clostridioides difficile TcdB.
  • Clostridioides difficile clade 2 Clinical strains belonging to Clostridioides difficile clade 2 are frequently isolated in North America, Europe, and Australia, accounting for over 20%of global CDI (Badilla-Lobo and Rodriguez, 2021; He et al., 2013; Knight et al., 2021) .
  • the clade 2 lineages have been generally concerned not only because they are epidemically associated with severe symptoms, but also because they exclusively produce variant forms of TcdB which exhibit varied biological activities including receptor recognition (Lanis et al., 2010; Pan et al., 2021; Quesada-Gomez et al., 2016; Stabler et al., 2008) .
  • TcdB variants fail to bind FZDs but retain varied CSPG4-recognizing abilities (Pan et al., 2021) .
  • CSPG4 is absent in the intestinal epithelium, as validated in multiple studies (Mileto et al., 2020; Tao et al., 2016; Terada et al., 2006) .
  • the inventors showed that TFPI is a functional receptor for TcdB from clade 2 Clostridioides difficile. More importantly, TFPI is highly expressed in human and mouse intestinal glandular epithelia (Uhlen et al., 2015) .
  • Our discovery of TFPI as a physiologically relevant receptor for TcdB4 and TcdB2 fills the gap of how TcdB from clade 2 Clostridioides difficile targets the colonic epithelium to initiate the tissue damage.
  • TcdB4-TFPI revealed an interacting pattern that is similar to TcdB1-FZD2 as well as TcsL-SEMA6A (Chen et al., 2018; Lee et al., 2020) .
  • the structure of the toxin part is similar to the previously reported full-length TcdB structure (Chen et al., 2019; Simeon et al., 2019) , indicating that TFPI-binding does not require or trigger conformational changes of the toxin.
  • TcdB2 which is expressed by several notorious Clostridioides difficile genotypes including ST01/RT027, could recognize TFPI as well.
  • the inventors showed that the reference sequence of TcdB2 bound mouse Tfpi and human TFPI with the K d of ⁇ 0.2 and ⁇ 0.4 ⁇ M.
  • the attenuation of the affinity (K d for TcdB4-TFPI is ⁇ 13 nM) is mainly due to a residue change of I1496S in TcdB2, while substitutions at other positions may also be involved.
  • I1496 is found in certain TcdB2 sequences, those TcdB2 may exhibit strong binding to TFPI.
  • TcdB variants can exploit two types of cellular receptors, TFPI and FZDs, to target the host intestinal barrier largely expands our perception of CDI pathogenesis. TcdB variants are sequentially divergent; the primary sequence identity between TcdB1 and TcdB4 is only 85.6%.
  • TcdB1 and TcdB4 adopt different sorts of proteins as intestinal epithelial receptors, together with the fact that these variants show distinguishable enzymatic activity (Genth et al., 2014; Quesada-Gomez et al., 2016; von Eichel-Streiber et al., 1995) , functionally supported the notion that the TcdB subfamily is likely a cluster of toxins originated from multiple ancestral lineages (Knight et al., 2021; Mansfield et al., 2020; Shen et al., 2020) .
  • TFPI TFPI in multiple cell types in the intestine, including glandular cells, endothelial cells, enterocytes, megakaryocytes, and monocytes.
  • Colonic glands also known as colonic crypts, are critical for the self-renew of the intestinal epithelium, producing mucus, and secreting anti-microbial molecules (Clevers, 2013) .
  • Severe gut damage induced by Clostridioides difficile often results in erosion of crypts and loss of glandular cells (Carter et al., 2015; Smits et al., 2016) .
  • TcdB2 damaged the crypt base of mouse colon in an FZDs-independent manner (Mileto et al., 2020) , which could be elucidated by our findings that colonic crypts express high levels of TFPI and thus are vulnerable targets of both TcdB2 and TcdB4. Strikingly, over 60%of the Tfpi ⁇ -/- mice survived in the TcdB4 challenge assay while all the WT mice died rapidly within 12 hours.
  • Tfpi ⁇ -/- mice have only partial Tfpi depleted but already showed high resistance to TcdB4, strongly supporting the idea that TFPI is a physiologically relevant receptor for the clade 2 Clostridioides difficile TcdB in the systematic exposure to the toxin, which is common in severe infections.
  • the previous toxin challenge assay showed equal lethality of TcdB1 to the WT and CSPG4 KO mice (Yuan et al., 2015) , implying CSPG4 may not be critical for systematic exposure to TcdB.
  • the inventors further determined that the kidney is a vulnerable target under such conditions, as acute kidney damage along with rapid death was observed in the WT mice, but not Tfpi ⁇ -/- mice. In line with our result, it was also reported that Clostridioides difficile infection accompanies acute kidney injury clinically (Charilaou et al., 2018) .
  • TFPI dampens the initiation of blood coagulation by inhibiting TF-factor VIIa (TF-FVIIa) complex, FXa, and prothrombinase (Maroney and Mast, 2015; Mast, 2016; Wood et al., 2013) .
  • TF-FVIIa TF-factor VIIa
  • prothrombinase TF-factor VIIa
  • the K2 domain of TFPI binds to TcdB and its trypsin-like substrates (Brandstetter et al., 1996; Burgering et al., 1997) (i.e. FXa) through the same loops.
  • Anti-TFPI therapy has recently been proposed as a novel strategy to treat coagulation disorders such as hemophilia (Chowdary, 2020; Sidonio and Zimowski, 2019) .
  • TcdB4 RBI might be a potential candidate to develop therapeutics for blood diseases. Besides, the inventors postulate that the affected coagulation might bring additional advantages for Clostridioides difficile during the infection, whereas the exact relevance and contribution to the disease progression remains to be investigated.
  • Soluble TFPI and derivates are potential agents to neutralize the toxin and alleviate the intoxication caused by clade 2 Clostridioides difficile TcdB.
  • the inventors exploited TFPI K2 as a potent decoy that effectively reduced tissue damage induced by TcdB4 and TcdB2 in vivo.
  • the inventors demonstrated that simultaneous inhibiting both TFPI-and CSPG4-binding provided the best protection from TcdB2, while protection via inhibiting TFPI-or CSPG4-binding alone was suboptimal.
  • a similar strategy of simultaneous abolishing FZD-and CSPG4-binding offered ideal protection for TcdB1 (Simeon et al., 2019) .
  • the inventors suggest that simultaneous blocking two receptor-binding sites would be an optimal strategy for neutralizing TcdB and thus developing next-generation therapeutics for the prevention and treatment of CDI.
  • TFPI Anti-tissue factor pathway inhibitor
  • Clostridioides difficile exploits toxin-mediated inflammation to alter the host nutritional landscape and exclude competitors from the gut microbiota. Nat Commun 12, 462. 10.1038/s41467-020-20746-4
  • Haemorrhagic toxin and lethal toxin from Clostridium sordellii strain vpi9048 molecular characterization and comparative analysis of substrate specificity of the large clostridial glucosylating toxins. Cell Microbiol 16, 1706-1721. 10.1111/cmi. 12321.
  • TFPIbeta is the GPI-anchored TFPI isoform on human endothelial cells and placental microsomes. Blood 119, 1256-1262. 10.1182/blood-2011-10-388512
  • Toxin B is essential for virulence of Clostridium difficile. Nature 458, 1176-1179. 10.1038/nature07822
  • Clostridioides difficile infection damages colonic stem cells via TcdB, impairing epithelial repair and recovery from disease. Proc. Natl. Acad. Sci. U.S.A. 117, 8064-8073. 10.1073/pnas. 1915255117
  • Nrdp1/FLRF is a ubiquitin ligase promoting ubiquitination and degradation of the epidermal growth factor receptor family member, ErbB3 (vol 99, pg 14843, 2002) . Proc. Natl. Acad. Sci. U. S. A. 99, 17220-17220. 10.1073/pnas. 013671499.
  • CHAINSAW a program for mutating pdb files used as templates in molecular replacement. J. Appl. Crystallogr. 41, 641-643. 10.1107/s0021889808006985.
  • Frizzled proteins are colonic epithelial receptors for C. difficile toxin B. Nature 538, 350-355. 10.1038/nature19799
  • Tissue factor pathway inhibitor-alpha inhibits prothrombinase during the initiation of blood coagulation. Proc. Natl. Acad. Sci. U. S. A. 110, 17838-17843. 10.1073/pnas. 1310444110

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Oncology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Dermatology (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Communicable Diseases (AREA)

Abstract

La présente demande concerne des polypeptides isolés qui se lient de manière spécifique à Tcdb2 et/ou à Tcdb4, en particulier à Tcdb4, à partir de souches de clade 2 C difficile, les compositions pharmaceutiques comprenant les polypeptides isolés, et l'utilisation des polypeptides isolés et des compositions pharmaceutiques dans la prévention et le traitement d'infections par clostrdioides difficile provoquées par des souches de clade 2. Lesdits polypeptides isolés comprennent une séquence d'acides aminés de l'une quelconque des SEQ ID NO : 1 à 5. La présente demande concerne en outre des molécules d'acide nucléique codant pour des polypeptides isolés, des vecteurs ou des cassettes d'expression et/ou des cellules comprenant lesdites molécules d'acide nucléique, et des procédés de production des polypeptides isolés. En outre, la présente demande concerne une méthode de prévention et/ou de traitement d'infections par clostridioides difficile provoquées par des souches de clade 2.
PCT/CN2022/075137 2022-01-30 2022-01-30 Composition et méthode de prévention et/ou de traitement d'infections par clostridioides difficile provoquées par des souches de clade 2 WO2023142096A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/CN2022/075137 WO2023142096A1 (fr) 2022-01-30 2022-01-30 Composition et méthode de prévention et/ou de traitement d'infections par clostridioides difficile provoquées par des souches de clade 2

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2022/075137 WO2023142096A1 (fr) 2022-01-30 2022-01-30 Composition et méthode de prévention et/ou de traitement d'infections par clostridioides difficile provoquées par des souches de clade 2

Publications (1)

Publication Number Publication Date
WO2023142096A1 true WO2023142096A1 (fr) 2023-08-03

Family

ID=87470257

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/075137 WO2023142096A1 (fr) 2022-01-30 2022-01-30 Composition et méthode de prévention et/ou de traitement d'infections par clostridioides difficile provoquées par des souches de clade 2

Country Status (1)

Country Link
WO (1) WO2023142096A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030139340A1 (en) * 2001-10-15 2003-07-24 Abla Creasey Treatment of sepsis by low dose administration of tissue factor pathway inhibitor (TFPI)
US20090176701A1 (en) * 2005-07-22 2009-07-09 Sabine Schirm Anti-microbial agents that interact with the complement system
US20090276160A1 (en) * 2004-12-10 2009-11-05 Eigenbrot Jr Charles E Crystal structure of hepatocyte growth factor activator complexed with kunitz domain inhibitor
US20110091477A1 (en) * 2009-10-19 2011-04-21 Genentech, Inc. Modulators of hepatocyte growth factor activator
US20180030151A1 (en) * 2015-02-25 2018-02-01 Mogam Institute For Biomedical Research Novel antibody binding to tfpi and composition comprising the same

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030139340A1 (en) * 2001-10-15 2003-07-24 Abla Creasey Treatment of sepsis by low dose administration of tissue factor pathway inhibitor (TFPI)
US20090276160A1 (en) * 2004-12-10 2009-11-05 Eigenbrot Jr Charles E Crystal structure of hepatocyte growth factor activator complexed with kunitz domain inhibitor
US20090176701A1 (en) * 2005-07-22 2009-07-09 Sabine Schirm Anti-microbial agents that interact with the complement system
US20110091477A1 (en) * 2009-10-19 2011-04-21 Genentech, Inc. Modulators of hepatocyte growth factor activator
US20180030151A1 (en) * 2015-02-25 2018-02-01 Mogam Institute For Biomedical Research Novel antibody binding to tfpi and composition comprising the same

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein 10 June 2019 (2019-06-10), ANONYMOUS : "tissue factor pathway inhibitor isoform X3 [Mus caroli]", XP093082230, retrieved from NCBI Database accession no. XP_029330367.1 *
DATABASE Protein 12 December 2021 (2021-12-12), ANONYMOUS : "tissue factor pathway inhibitor isoform a precursor [Homo sapiens]", XP093082232, retrieved from NCBI Database accession no. NP_001316168 *
DATABASE Protein 21 September 2020 (2020-09-21), ANONYMOUS : "tissue factor pathway inhibitor isoform X2 [Mus musculus] ", XP093082234, retrieved from NCBI Database accession no. XP_006499212 *

Similar Documents

Publication Publication Date Title
Luo et al. TFPI is a colonic crypt receptor for TcdB from hypervirulent clade 2 C. difficile
Malik et al. Conformational control of the bacterial Clp protease by natural product antibiotics
JP6770043B2 (ja) 補体活性の変調
JP6915034B2 (ja) 補体活性の変調剤
US20110190221A1 (en) Modulation and repletion/enhancement of the complement system for treatment of trauma
BR112017023707B1 (pt) Composição, uso de uma composição, vetor recombinante, microrganismo transgênico, e polipeptídeo recombinante
TWI694087B (zh) 多黏桿菌素衍生物及其用途
CN112512556A (zh) 用于抑制wnt信号传导的组合物和方法
US9926345B2 (en) Compositions and methods for treating or preventing Clostridium infection
WO2023142096A1 (fr) Composition et méthode de prévention et/ou de traitement d'infections par clostridioides difficile provoquées par des souches de clade 2
WO2018115877A2 (fr) Compositions et méthodes de traitement
ES2960783T3 (es) Una combinación que comprende el uso de un compuesto oligopeptídico y anticuerpo anti-PD-1 o PD-L1 para su uso en el tratamiento de enfermedades neoplásicas
Papatheodorou et al. An Updated View on the Cellular Uptake and Mode-of-Action of Clostridioides difficile Toxins
CN106795506B (zh) 去免疫化溶葡萄球菌酶和使用方法
TW200936155A (en) Anti-bacterial compositions
US10913786B2 (en) Compositions and methods for inhibiting Wnt signaling
CN110621688A (zh) 用于治疗细菌感染的手段和方法
KR20180080127A (ko) 항-b형 간염 바이러스 x 단백질 폴리펩티드 약제
EP3265112A1 (fr) Promotion de la transformation de nf-kappab1 p105 en p50 par l'ubiquitine ligase kpc1, déclenchant un fort effet antitumoral
AU2019240693A1 (en) Kv1.3 potassium channel antagonists
Jiang Structural Analysis of Clostridium Difficile Tcbd Uptake Mechanism
WO2023143559A1 (fr) Polypeptides de liaison à tfpi et leurs utilisations
US20230203107A1 (en) Peptide for treating sepsis derived from rv3364c protein of mycobacterium tuberculosis
Orrell Biochemical and Genomic Insights into the Translocation of Large Clostridial Toxins across Host Cell Membranes
Finnell Anthrax, Matrix Biology, and Angiogenesis: Capillary Morphogenesis Gene 2 Mediates Activity and Uptake of Type IV Collagen-Derived Anti-Angiogenic Peptides

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22922925

Country of ref document: EP

Kind code of ref document: A1