WO2023140722A1 - 7-디하이드로콜레스테롤이 고농도로 함유된 토마토 및 이의 제조 방법 - Google Patents
7-디하이드로콜레스테롤이 고농도로 함유된 토마토 및 이의 제조 방법 Download PDFInfo
- Publication number
- WO2023140722A1 WO2023140722A1 PCT/KR2023/001125 KR2023001125W WO2023140722A1 WO 2023140722 A1 WO2023140722 A1 WO 2023140722A1 KR 2023001125 W KR2023001125 W KR 2023001125W WO 2023140722 A1 WO2023140722 A1 WO 2023140722A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- dwf5
- seq
- tomato
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1007—Methyltransferases (general) (2.1.1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01101—Acylglycerone-phosphate reductase (1.1.1.101)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y201/00—Transferases transferring one-carbon groups (2.1)
- C12Y201/01—Methyltransferases (2.1.1)
- C12Y201/01041—Sterol 24-C-methyltransferasee (2.1.1.41)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
Definitions
- the present invention relates to a tomato containing a high concentration of 7-dihydrocholesterol, a precursor of vitamin D3, and a method for preparing the same.
- Vitamin D is an essential nutrient for life, and insufficient vitamin D causes not only rickets, osteomalacia, and osteoporosis, but also malignant tumors such as breast cancer, colon cancer, and prostate cancer, cardiovascular diseases including hypertension, diabetes, multiple sclerosis, psoriasis, rheumatoid arthritis, and tuberculosis. It has been reported to increase. Vitamin D is a vitamin that can be ingested through food, but can also be synthesized in the body through adequate sunlight. Therefore, if you are not exposed to sunlight enough, you should take foods rich in vitamin D or vitamin D nutritional supplements.
- vitamin D In the case of insufficient exposure to sunlight, vitamin D must be consumed through food, but there is a problem in that there are not many foods with a high vitamin D content. Even if foods are known to be rich in vitamin D, the amount of vitamin D contained per 100 g is 0.29 ⁇ g / about 7 sheets (100 g) of sliced cheese, 2.9 ⁇ g / 100 g of tuna, 1.36 ⁇ g / 2 eggs (100 g), and 4.4 ⁇ g / about 1 cup (100 g) of raisins.
- Korean Publication No. 10-2017-0138657 discloses that when the DWF5 (delta 5, 7-sterol deta 7 reductase, DWARF5), CPD (constitutive photomorphogenic DWAF, DWF3), and SMT1 (sterol methyltransferase 1) genes are deleted, lettuce enriched with 7-dehydrocampesterol, a precursor of vitamin D, can be prepared. It is disclosed that it can. However, no studies have been conducted on the production of tomatoes enriched with 7-dehydrocholesterol as a precursor of vitamin D3.
- the present inventors conducted experiments by deleting the DWF5-1, CPD, and SMT1 genes through CRISPR technology. As a result, it was confirmed that tomatoes containing a high concentration of 7-dihydrocholesterol were produced when the DWF5-1 gene was deleted.
- the present invention was completed. Specifically, the present invention is to identify DWF5-1, CPD and SMT1 deletion sites optimized for developing tomatoes containing high concentrations of 7-dihydrocholesterol, a precursor for vitamin D3 production, and to develop tomatoes enriched with vitamin D3 precursors containing them.
- one aspect of the present invention provides a transformed tomato containing a high concentration of 7-dehydrocholesterol of Formula 1 below.
- Another aspect of the present invention provides a vector comprising one or more sgRNA (single guide RNA) complementary to the nucleotide sequence of the DWF5-1 gene and a nucleotide sequence encoding a clustered regularly interspaced palindromic repeats (CRISPR) related protein.
- sgRNA single guide RNA
- CRISPR clustered regularly interspaced palindromic repeats
- Another aspect of the present invention provides a method for producing a transformed tomato containing a high concentration of 7-dihydrocholesterol, comprising the step of introducing the vector into tomato using Agrobacterium.
- the transformed tomato prepared according to the present invention was homozygous and contained the mutation of the DWF5-1 gene, a large amount of 7-dehydrocholesterol was accumulated in the fruit and root of the tomato.
- the homozygotes (T2) were able to produce seeds and thus preserve the desired tomato traits. Therefore, the transgenic tomato of the present invention has high commercial utility.
- FIG. 1 is a diagram showing the location of DWF5-1 targeted by DWF5-1 sgRNA.
- Figure 2 is a diagram showing the location of CPD targeted by CPD sgRNA.
- 3 is a diagram showing the location of SMT1 targeted by SMT1 sgRNA.
- FIG. 4 is a view showing the results of confirming the gene editing efficiency of DWF5-1 sgRNA using RGEN.
- 5 is a view showing the results of confirming the CPD gene editing efficiency of CPD sgRNA using RGEN.
- FIG. 6 is a diagram showing the results of confirming the SMT1 gene editing efficiency of SMT1 sgRNA using RGEN.
- FIG. 7 is a schematic diagram of a Cas9-sgRNA vector loaded with DWF5-1 sgRNA.
- FIG. 8 is a schematic view of a Cas9-sgRNA vector loaded with DWF5-1 sgRNA and CPD sgRNA.
- FIG. 9 is a diagram showing a schematic diagram of a Cas9-sgRNA vector loaded with DWF5-1 sgRNA, CPD sgRNA, and SMT1 sgRNA.
- FIG. 10 is a flowchart showing a process for producing transgenic tomatoes using Agrobacterium.
- 13 is an observation view of tomato plants in which DWF5-1 and CPD genes have been edited.
- 15 is a view showing the result of confirming whether DWF5-1, CPD or SMT1 gene was edited through a T7E1 assay.
- 16 is a view showing the results of confirming the DWF5-1 gene deletion through Sanger sequencing.
- 17 is a view showing the result of confirming the DWF5-1 gene phenotype in T1 generation transgenic tomato plants in which the DWF5-1 gene was deleted through next generation sequencing.
- 18a is a diagram showing gene editing efficiency, harvested seed quantity (top), and gene sequence (bottom) of T1 generation homozygous transgenic tomato plants in which the DWF5-1 gene was deleted.
- 18b is a view showing the gene sequences of T1 generation homozygous transgenic tomato plants in which the DWF5-1 gene was deleted.
- FIG. 19 is a flow chart showing a sample preparation process for measuring 7-dihydrocholesterol contained in T2 generation transgenic tomato plants of homozygous (T1) DWF5-1 gene deletion.
- FIG. 20 is a view showing measurement conditions for measuring 7-dihydrocholesterol contained in T2 generation transgenic tomato plants of homozygous (T1) DWF5-1 gene deletion by LC/MS.
- FIG. 21 is a diagram showing the results of LC/MS measurement of 7-dihydrocholesterol contained in wild-type (WT) tomato plants, commercially available 7-dihydrocholesterol as a standard reagent, and T2-generation transgenic tomato plants of homozygotes (T1) in which the DWF5-1 gene was deleted.
- WT wild-type
- T1 T2-generation transgenic tomato plants of homozygotes
- FIG. 22 is a graph showing the results of LC/MS measurement of 7-dihydrocholesterol contained in fruits of T2 generation transgenic tomato plants of homozygotes (T1) in which the DWF5-1 gene was deleted.
- FIG. 23 is a view showing the results of confirming the expression of hygromycin and phosphinothricin (PPT) resistance genes by RT-PCR in T2 generation transgenic tomato plants of homozygotes (T1) in which the DWF5-1 gene was deleted.
- PPT phosphinothricin
- FIG. 24 is a diagram showing the results of comparative analysis of the nucleotide sequence of the exon 6 domain of DWF5-1 in T2 generation transgenic tomato plants (D100_3-14-29 and D100_7-1-15) in which antibiotic resistance genes are not expressed, with wild type (WT) tomato plants.
- 25 is a diagram showing the results of comparative analysis of the amino acid sequence of the exon 6 domain of DWF5-1 in T2 generation transgenic tomato plants (D100_3-14-29 and D100_7-1-15) in which antibiotic resistance genes are not expressed, with wild type (WT) tomato plants.
- 26 is a diagram showing the phenotype of a homozygous (T2) transgenic tomato plant (T2) in which the DWF5-1 gene was deleted.
- FIG. 27 is a graph showing the result of confirming the expression level of DWF5-1 or DWF5-2 gene in roots, stems, leaves and fruits of tomato plants through q-PCR. ****p ⁇ 0.0001
- One aspect of the present invention provides a transformed tomato containing a high concentration of 7-dehydrocholesterol of Formula 1 below.
- the term "tomato” refers to a plant or fruit (fruit) of the Solanum lycopersicum family, whose scientific name is Solanum lycopersicum. It is an annual plant native to Latin America, 1 to 3 m tall with yellow flowers. The fruit is red in color due to lycopene and is used for edible purposes.
- the tomato may be a plant body, plant organs (eg, roots, stems, leaves, petals (flowers), seeds, fruits (fruits), etc.), plant tissues (epidermis, sieve, soft tissue, xylem, vascular tissue), etc. Specifically, it may be a fruit and/or a root. At this time, the tomato plant body may include a cell culture body including root cultured roots and the like.
- the term "7-dehydrocholesterol" is a provitamin D3 that is converted to vitamin D3.
- the transformed tomato may contain 0.01 mg to 1.5 mg of 7-dihydrocholesterol per 100 g in weight.
- the transformed tomato is 0.01 mg, 0.10 mg, 0.20 mg, 0.30 mg, 0.40 mg, 0.50 mg, 0.60 mg, 0.70 mg, 0.80 mg, 0.90 mg, 1.00 mg, 1.10 mg, 1.20 mg, 1.30 mg, 1.40 mg or 1 per 100 g of weight. .50 mg of 7-dihydrocholesterol.
- the transformed tomato may be genetically engineered to reduce the expression or activity of the lycopersicum DWF5-1 (DWF5-1) gene or DWF5-1 protein compared to the wild type.
- the genetic manipulation may be induced by modification in the nucleic acid sequence.
- the term "DWF5" refers to 7-dehydrocholesterol reductase.
- This enzyme is also called delta 5,7-sterol delta 7 reductase.
- the enzyme has an activity of reducing 5-dehydroepisterol, an intermediate metabolite of the phytosterol metabolic pathway, and converting it to 24-methylenecholesterol.
- DWF5-1 and DWF5-2 may include amino acid sequences of SEQ ID NO: 2 and SEQ ID NO: 4, respectively. It has been reported that the DWF5-1 gene will function in the phytosterol metabolic pathway and the DWF5-2 gene in the cholesterol production pathway by reducing 7-dehydrocholesterol reductase to cholesterol.
- mutant plants lacking only the DWF5-1 gene produced high amounts of provitamin D3 in both immature and mature tomato fruits and root tissues, and were similar in growth and seed production to wild-type tomatoes (FIG. 18, FIG. 26 and Table 13). Therefore, in the present invention, a tomato in which provitamin D3 is produced in high concentration in mature fruits was developed through a deletion of only the DWF5-1 gene, and it was confirmed that a single deletion of the DWF5-1 gene is an industrially useful technology capable of growing and producing fruits similar to wild type.
- the DWF5 may be DWF5-1.
- the DWF5 may be DWF5-1 including the amino acid of SEQ ID NO: 2.
- the DWF5-1 gene may be genomic DNA, cDNA or RNA containing a nucleotide sequence encoding DWF5-1. More specifically, in the present invention, the DWF5-1 gene may be genomic DNA.
- DWF5, DWF5-1 and SlDWF5-1 may be used interchangeably.
- genomic DNA refers to chromosomal DNA, and refers to a form in which genetic information is encoded in eukaryotic cells.
- Eukaryotic genomic DNA (hereinafter referred to as DNA) contains exons and introns. The exon is a portion including a nucleic acid sequence encoding a protein, and an intron is a portion not involved in protein synthesis.
- DNA is transcribed into RNA, and at this time, exons excluding introns are linked together. Introns contain information that helps transcription, such as promoters that induce protein transcription, and are used to make pre-mRNA in the transcription process, but are truncated rather than used to make mature mRNA.
- the DWF5-1 gene may include 12 exons and 11 introns.
- the DWF5-1 may include exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, and exon 12.
- intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10 and intron 11 may be included.
- exon 1 to exon 12 of the DWF5-1 gene may include or consist of the nucleic acid sequences of SEQ ID NO: 40 to SEQ ID NO: 51, respectively.
- Intron 1 to Intron 11 of the DWF5-1 gene may include or consist of the nucleic acid sequences of SEQ ID NO: 52 to SEQ ID NO: 62, respectively.
- the DWF5-1 gene may include or consist of the nucleic acid sequence of SEQ ID NO: 63.
- the DWF5-1 gene may include a flanking region that regulates transcription of DWF5-1.
- flanking region is a DNA sequence that extends on both sides of a specific gene and is not transcribed into RNA.
- the DNA region adjacent to the 5' end of the gene is called the 5' flanking region, and the DNA region adjacent to the 3' end is called the 3' flanking region.
- the flanking region includes a regulatory sequence, and regulates gene transcription by binding to a protein involved in transcription through the sequence.
- proteins such as transcription factors and RNA polymerase, including enhancers, silencers, and promoters, bind to the 5' flanking region to regulate transcription.
- the 5' flanking region of the DWF5-1 gene may include the nucleic acid sequence of SEQ ID NO: 64.
- the 3' flanking region of the DWF5-1 gene may include the nucleic acid sequence of SEQ ID NO: 65.
- the DWF5-1 gene may be cDNA. In one embodiment, it may include or consist of the nucleic acid sequence of SEQ ID NO: 1.
- genetic engineering or “genetically engineered” may refer to an act of introducing one or more genetic modifications to a cell or a cell made thereby.
- the term "decreased expression or activity of a gene or protein” means that the expression or activity of a gene or protein is low compared to a wild type of the same species to which a target gene or protein is comparable.
- “inactivation” means that a protein that is not expressed compared to a wild-type target gene or protein or that has no activity even if expressed is produced.
- the reduction or inactivation of the expression or activity of the DWF5-1 gene or protein means that all or part of the biological function or role normally performed by the wild-type DWF5-1 gene is lost.
- the protein expressed by the DWF5-1 gene may be prematurely terminated or lose its normal function as a protein.
- the gene editing may be to knock-out the DWF5-1 gene by generating a stop codon at the target site or generating a codon encoding an amino acid different from that of the wild type.
- it may be to introduce a mutation into a non-coding DNA sequence that does not produce a protein, but is not limited thereto.
- the genetically engineered transformed tomato may be reduced by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, or about 100% compared to the DWF5-1 gene or protein of wild-type tomato.
- Expression or activity of the DWF5-1 gene or DWF5-1 protein can be determined using any method known in the art.
- the genetic manipulation may be induced by alteration in a nucleic acid sequence. Specifically, genetic manipulation can lead to alterations in nucleic acid sequences through conversion, deletion, or insertion.
- the DWF5-1 gene of the transgenic tomato of the present invention may contain a different gene sequence from the DWF5-1 gene of the wild-type tomato, and the biological function of the gene may be lost.
- nucleotides of the DWF5-1 gene are substituted with nucleotides different from those of the wild-type DWF5-1 gene;
- iv) a combination thereof can be induced through modification in any one nucleic acid sequence selected from the group consisting of.
- deletion of all or part of the DWF5-1 gene e.g., one or more nucleotides of the DWF5-1 gene, e.g., 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3 deletion of one or more nucleotides;
- nucleotides of the DWF5-1 gene e.g., 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3 or 1 nucleotides are wild type DWF5-1 Substitution with a nucleotide different from the gene,
- nucleotides selected from A, T, C and G, for example, 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3 or 1 nucleotide of the DWF5-1 gene insert in any location; and
- iv) a combination of i) to iii); can be induced through modification in any one nucleic acid sequence selected from the group consisting of;
- the part where the nucleic acid sequence of the DWF5-1 gene is modified ('target site') is at least 1, at least 3, at least 5, at least 7, at least 10, at least 12, at least 15, at least 17, at least 20, at least 25, at least 27, at least 30, at least 33, at least 37, at least 40, at least 43, at least 47 Or it may be a region of 50 or more consecutive nucleotide sequences.
- the modification in the nucleic acid sequence of the DWF5-1 gene may be included in the nucleic acid sequence of any one domain selected from the group consisting of exon 6 (SEQ ID NO: 9), exon 7 (SEQ ID NO: 10), exon 9 (SEQ ID NO: 11), exon 10 (SEQ ID NO: 12), exon 11 (SEQ ID NO: 13), and combinations thereof.
- the modification in the nucleic acid sequence of the DWF5-1 gene may be included in the nucleic acid sequence of the exon 6 domain.
- nucleotide sequence of SEQ ID NO: 9 including the nucleic acid sequence of the exon 6 domain of DWF5-1 may be altered in the nucleic acid sequence by substitution, deletion or insertion. More specifically, the nucleotide sequence of SEQ ID NO: 9, which includes the nucleic acid sequence of the exon 6 domain of the DWF5-1 gene, is induced to undergo substitution, deletion, or insertion in the base sequence, thereby lowering the expression or activity of the DWF5-1 gene or DWF5-1 protein, and termination coding can be generated.
- Transformed tomatoes of the present invention may further be genetically engineered to reduce CPD gene or CPD protein expression or activity. Genetic manipulation is the same as described above.
- CPD constitutive photomophogenic DWAF
- CP90A family of cytochrome P450 monooxygenases
- DWF3 cytochrome P450 monooxygenases
- the C6 oxidation pathway converts cathasterone into testerone and converts 6-deoxocathasterone into 6-deoxoteasterone.
- the enzyme serves to reduce 7-dehydrocampesterol to 7-dehydrocampestanol.
- the CPD may include the amino acid sequence of SEQ ID NO: 6.
- the nucleic acid encoding this may include the nucleotide sequence of SEQ ID NO: 5.
- the expression or activity reduction or inactivation of the CPD gene or CPD protein in the present invention may mean that all or part of the biological function or role normally performed by the wild-type CPD gene is lost.
- expression or activity reduction and inactivation of the gene or protein are the same as described above.
- the protein expressed by the CPD gene may be prematurely terminated or may have lost its normal function as a protein.
- the gene editing may be to knock out the CDP gene by generating a stop codon at the target site or generating a codon encoding an amino acid different from the wild type.
- it may be in the form of introducing a mutation into a non-coding DNA sequence that does not produce a protein, but is not limited thereto.
- the genetically engineered transformed tomato may be reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the CPD gene or protein of wild-type tomato.
- Expression or activity of a CPD gene or CDP protein can be determined using any method known in the art.
- the genetic manipulation may be induced by alteration in a nucleic acid sequence. Specifically, genetic manipulation can lead to alterations in nucleic acid sequences through substitutions, deletions or insertions.
- the CPD gene of the transgenic tomato of the present invention may contain a different gene sequence from the CPD gene of the wild-type tomato, and the biological function of the gene may be lost.
- nucleotides of the CPD gene are replaced with nucleotides different from those of the wild-type CPD gene;
- iv) a combination thereof can be induced through modification in any one nucleic acid sequence selected from the group consisting of.
- deletion of all or part of the CPD gene e.g., one or more nucleotides of the CDP gene, e.g., 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3 or 1 Nucleotide deletion;
- nucleotides of the CPD gene e.g., 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3 or 1 nucleotides different from the wild type CPD gene substitution,
- nucleotides selected from A, T, C and G, e.g., 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3 or 1 nucleotide at any position of the CPD gene insert into; and
- iv) a combination of i) to iii); can be induced through modification in any one nucleic acid sequence selected from the group consisting of;
- the part where the nucleic acid sequence of the CDP gene is modified is at least 1, at least 3, at least 5, at least 7, at least 10, at least 12, at least 15, at least 17, at least 20, at least 25, at least 27, at least 30, at least 33, at least 37, at least 40, at least 43, at least 47, or at least 5 It may be zero or more contiguous nucleotide sequence regions.
- the modification in the nucleic acid sequence of the CPD gene may be included in the nucleic acid sequence of any one domain selected from the group consisting of exon 7 (SEQ ID NO: 14), exon 8 (SEQ ID NO: 15), and combinations thereof.
- the modification in the nucleic acid sequence of the CPD gene may be a modification in the nucleic acid sequence of the exon 8 domain.
- the modification in the nucleic acid sequence of the CPD gene may be a substitution, deletion or insertion in the nucleotide sequence of SEQ ID NO: 15 including the nucleic acid sequence of the exon 8 domain. More specifically, by substitution, deletion or insertion of the nucleotide sequence of SEQ ID NO: 15 including the nucleic acid sequence of the exon 8 domain of the CDP gene, CPD activity may be lowered and termination coding may be generated.
- Transformed tomatoes containing the mutations of the DWF5-1 and CPD genes of the present invention may be genetically engineered to further reduce the expression or activity of the SMT1 gene or SMT1 protein. Genetic manipulation is the same as described above.
- SMT1 sterol methyltransferase 1
- SMT1 sterol methyltransferase 1
- the SMT1 serves to convert 5-dehydroepisterol to 7-dehydrocampesterol.
- the SMT1 may include the amino acid sequence of SEQ ID NO: 8.
- the nucleic acid encoding this may include the nucleotide sequence of SEQ ID NO: 7.
- the expression or activity reduction or inactivation of the SMT1 gene or SMT1 protein in the present invention may mean that all or part of the biological function or role normally performed by the wild-type SMT1 gene is lost.
- expression or activity reduction and inactivation of the gene or protein are the same as described above.
- the protein expressed by the SMT1 gene may be prematurely terminated or lose its normal function as a protein.
- the gene editing may be knocking out the SMT1 gene by generating a stop codon at the target site or generating a codon encoding an amino acid different from that of the wild type.
- it may be to introduce a mutation into a non-coding DNA sequence that does not produce a protein, but is not limited thereto.
- the genetically engineered transformed tomato may be reduced by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, or about 100% compared to the SMT1 gene or SMT1 protein of wild-type tomatoes.
- Expression or activity of the SMT1 gene or SMT1 protein can be determined using any method known in the art.
- the genetic manipulation may be induced by alteration in a nucleic acid sequence. Specifically, genetic manipulation can lead to alterations in nucleic acid sequences through substitutions, deletions or insertions.
- the SMT1 gene of the transgenic tomato of the present invention may contain a gene sequence different from that of the wild-type tomato, and the biological function of the gene may be lost.
- nucleotides of the SMT1 gene are replaced with nucleotides different from those of the wild-type SMT1 gene;
- iv) a combination thereof can be induced through modification in any one nucleic acid sequence selected from the group consisting of.
- deletion of all or part of the SMT1 gene e.g., one or more nucleotides of the CDP gene, e.g., 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3 or 1 Nucleotide deletion;
- nucleotides of the SMT1 gene e.g., 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3 or 1 nucleotides different from the wild type SMT1 gene substitution with nucleotides,
- nucleotides selected from A, T, C and G e.g., 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3 or 1 nucleotides of any of the SMT1 genes insert into position; and
- iv) a combination of i) to iii); can be induced through modification in any one nucleic acid sequence selected from the group consisting of;
- the part where the nucleic acid sequence of the SMT1 gene is modified is one or more, 3 or more, 5 or more, 7 or more, 10 or more, 12 or more, 15 or more, 17 or more, 20 or more, 25 or more, 27 or more, 30 or more, 33 or more, 37 or more, 40 or more, 43 or more, 47 or more, or It may be a region of 50 or more contiguous base sequences.
- the modification in the nucleic acid sequence of the SMT1 gene may be included in the nucleic acid sequence of any one domain selected from the group consisting of exon 7 (SEQ ID NO: 16), exon 9 (SEQ ID NO: 17), exon 11 (SEQ ID NO: 18), exon 12 (SEQ ID NO: 19), and combinations thereof.
- mutations in the SMT1 gene may include modifications in the nucleic acid sequences of the exon 7 and exon 9 domains.
- the mutation of the SMT1 gene may be a modification caused by substitution, deletion, or insertion in the nucleotide sequences of SEQ ID NO: 16 and SEQ ID NO: 17 including the nucleic acid sequences of the exon 7 and exon 9 domains. More specifically, substitution, deletion, or insertion in the nucleotide sequences of SEQ ID NO: 16 and SEQ ID NO: 17 including the nucleic acid sequences of the exon 7 and exon 9 domains of the SMT1 gene may be induced to lower the activity of SMT1, and termination coding may be generated.
- the transformed tomato may be homozygous. That is, modifications in the nucleic acid sequence may be included in two genes encoding DWF5-1. In one embodiment, modifications in the nucleic acid sequence may be included in two genes encoding any one domain selected from the group consisting of exon 6, exon 7, exon 9, exon 10, exon 11, and combinations thereof of the DWF5-1 gene. In one embodiment of the present invention, the transformed tomato may have sequences modified differently from the nucleic acid sequence of the wild-type DWF5-1 gene in two genes encoding the exon 6 domain of the DWF5-1 gene.
- the transformed tomato may contain modifications in the nucleic acid sequence of two genes encoding DWF5-1, CPD and SMT1.
- two genes encoding any one domain selected from the group consisting of exon 7, exon 8, and combinations thereof of the CPD gene may have sequences modified differently from the nucleic acid sequence of the wild-type CPD gene.
- modifications in the nucleic acid sequence may be included in two genes encoding any one domain selected from the group consisting of exon 7, exon 9, exon 11, and exon 12 of the SMT1 gene, and combinations thereof. At this time, the modification in the nucleic acid sequence is the same as described above.
- the transformed tomato may contain modifications in the nucleic acid sequence of two genes each encoding the exon 6 domain of DWF5-1, the exon 7 domain of CDP, and the exon 7 and exon 9 domains of SMT1.
- the tomato can form seeds.
- the tomato may not bear fruit and may not form seeds.
- Another aspect of the present invention provides a vector comprising one or more sgRNAs complementary to the nucleotide sequence of the DWF5-1 gene and a nucleotide sequence encoding a CRISPR-related protein.
- DWF5-1 is the same as described above.
- the DWF5-1 gene may be genomic DNA, cDNA or RNA.
- guide RNA refers to a polynucleotide that recognizes a target nucleic acid in a cell through genome editing and cuts, inserts, or connects the target nucleic acid.
- the gRNA may include a sequence complementary to a target sequence in a target nucleic acid.
- the gRNA may be a polynucleotide complementary to a nucleotide sequence of 2 to 24 consecutive nucleotides (hereinafter referred to as 'nt') in the 5' or 3' direction of the PAM in the target nucleic acid.
- the length of the gRNA may be 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt or 24 nt.
- the gRNA may be a single guide RNA (sgRNA).
- the sgRNA may include a CRISPR RNA (crRNA) specific to a target nucleic acid sequence and/or a transactivating crRNA (tracrRNA) that forms a complex with a CRISPR-associated protein.
- the sgRNA may include a portion having a base sequence (targeting sequence) complementary to a target nucleic acid sequence in a target gene (target site) (also referred to as a spacer region, a target DNA recognition sequence, a base pairing region, etc.) and a hairpin structure for CRISPR-related protein binding.
- sgRNA may be used as long as the sgRNA includes a base sequence complementary to the main regions of crRNA and tracrRNA and the target gene.
- the sgRNA may complementarily bind to the nucleic acid sequence of the genomic DNA of DWF5-1.
- the sgRNA may complementarily bind to SEQ ID NO: 63.
- the sgRNA may complementarily bind to a nucleic acid sequence of one or more domains selected from the group consisting of exon 1 to exon 12, intron 1 to intron 11, 5' flank region and 3' flank region of the DWF5-1 gene. More specifically, it may complementarily bind to a nucleic acid sequence of one or more domains selected from the group consisting of SEQ ID NO: 40 to SEQ ID NO: 62, SEQ ID NO: 64, and SEQ ID NO: 65.
- the sgRNA may complementarily bind to the nucleic acid sequence of the DWF5-1 cDNA. Specifically, the sgRNA may complementarily bind to the nucleic acid sequence of SEQ ID NO: 1.
- the sgRNA may complementarily bind to a nucleic acid sequence of any one domain selected from the group consisting of exon 6, exon 7, exon 9, exon 10 and exon 11 of the DWF5-1 gene.
- the sgRNA binding to the nucleic acid sequence of the exon 6 domain of the DWF5-1 gene may include the nucleotide sequence of SEQ ID NO: 20 or SEQ ID NO: 21.
- the sgRNA binding to the nucleic acid sequence of the exon 7 domain may include the nucleotide sequence of SEQ ID NO: 22.
- the sgRNA binding to the nucleic acid sequence of the exon 9 domain may include the nucleotide sequence of SEQ ID NO: 23 or SEQ ID NO: 24.
- the sgRNA binding to the exon 10 domain may include the nucleotide sequence of SEQ ID NO: 25.
- the sgRNA binding to the nucleic acid sequence of the exon 11 domain may include the nucleotide sequence of SEQ ID NO: 26.
- the sgRNA may include or consist of the nucleotide sequences of SEQ ID NO: 20 and SEQ ID NO: 21 complementary to the nucleic acid sequence of the exon 6 domain.
- the vector may further include an sgRNA that complementarily binds to the nucleotide sequence of the CPD gene.
- the sgRNA complementarily binding to the CPD gene may complementarily bind to a nucleotide sequence of the exon 7 or exon 8 domain of the CPD gene.
- the sgRNA binding to the domain of exon 7 of the CPD gene may include the nucleotide sequence of SEQ ID NO: 27.
- the sgRNA binding to the exon 8 domain of the CPD gene may include a nucleotide sequence of SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 or SEQ ID NO: 31.
- the sgRNA may include nucleotide sequences of SEQ ID NO: 28 and SEQ ID NO: 29 complementary to the nucleotide sequences of the exon 8 domain.
- the vector including the sgRNA complementaryly binding to the base sequences of the DWF5 and CPD genes may further include an sgRNA binding complementary to the base sequences of the SMT1 gene.
- the sgRNA complementaryly binding to the base sequence of the SMT1 gene may complementarily bind to a base sequence of one or more domains selected from the group consisting of exon 7, exon 9, exon 11, and exon 12 of the SMT1 gene.
- the sgRNA binding to the domain of exon 7 of the SMT1 gene may include the nucleotide sequence of SEQ ID NO: 32.
- the sgRNA binding to the exon 9 domain of the SMT1 gene may include the nucleotide sequence of SEQ ID NO: 33.
- the sgRNA binding to the domain of exon 11 of the SMT1 gene may include the nucleotide sequence of SEQ ID NO: 34.
- the sgRNA binding to the exon 12 domain of the SMT1 gene may include the nucleotide sequence of SEQ ID NO: 35.
- the sgRNA may include the nucleotide sequences of SEQ ID NO: 32 and SEQ ID NO: 33 complementary to the nucleotide sequences of the exon 7 and exon 9 domains.
- the sgRNA complementary to the nucleotide sequences of the DWF5 and CPD genes is the same as described above.
- CRISPR-associated protein refers to a CRISPR-associated protein that recognizes and cleaves when a nucleic acid such as DNA or RNA has double-stranded or single-stranded (dsDNA/RNA and ssDNA/RNA) enzymes. Specifically, they can recognize double-stranded or single-stranded nucleic acid bound to sgRNA and cleave it.
- the CRISPR-associated protein includes a CRISPR-associated protein and a mutant having its function.
- the CRISPR-associated protein is Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis rougevillei, Streptomyces pristinae Spiralis (Streptomyces pristinae spiralis), Streptomyces viridochromogenes, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus seleniti reducens), Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalene vorans (Polaromonas naphthalenivorans), Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcysti
- the CRISPR-associated proteins are Cas9, Cpf1, c2c1, C2c2, Cas13, c2c3, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a, Cas8al, Cas8a2, Cas8b, Cas8c, Csnl, Csxl2, Cas10, Cas10d, CaslO , CaslOd, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel(CasA), Cse2(CasB), Cse3(CasE), Cse4(CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, C
- the Cas9 protein may form a complex with the guide sgRNA to act as a ribonucleic acid protein (RNP).
- RNP ribonucleic acid protein
- ribonucleoprotein (RNP) is a complex of RNA and protein, and may be a Cas9-sgRNA complex in the present invention.
- a “vector” is capable of being introduced into a host cell and then recombination and integration into the host cell genome.
- the vector is understood to be a nucleic acid vehicle comprising a polynucleotide sequence capable of autonomous replication as an episome.
- Such vectors include linear nucleic acids, plasmids, phagemids, cosmids, RNA vectors, viral vectors, mini-chromosomes and analogues thereof.
- viral vectors include, but are not limited to, retroviruses, adenoviruses, and adeno-associated viruses.
- the vector may include any one of the nucleotide sequences of SEQ ID NO: 36 to SEQ ID NO: 38.
- the vector has about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% sequence homology to any one of SEQ ID NOs: 36 to 38.
- the vector may be partially or completely codon-optimized for expression in a target organism or cell.
- the vector may be operably linked to an appropriate promoter so that the polynucleotide can be expressed in a host cell.
- the promoter of the present invention may include a promoter used for gene introduction into plants.
- SP6 promoter for example, SP6 promoter, T7 promoter, T3 promoter, PM promoter, corn ubiquitin promoter (Ubi), cauliflower mosaic virus (CaMV) 35S promoter, nopaline synthase (nos) promoter, pigwort mosaic virus 35S promoter, sucrose crane bacilliform virus promoter, commelina yellow mottle virus promoter, ribulose-1,5-bis-phosphate carboxylase small subunit (ssRU) BISCO), rice cytosolic triosephosphate isomerase (TPI) promoter, Arabidopsis adenine phosphoribosyltransferase (APRT) promoter and octopine synthase promoter.
- Ubi corn ubiquitin promoter
- CaMV cauliflower mosaic virus
- nos nopaline synthase
- pigwort mosaic virus 35S promoter for example, SP6 promoter, T7 promoter, T3 promoter, PM promoter, corn ubiquitin promoter (U
- the vector can be plasmid DNA, phage DNA, etc., and commercially developed plasmids (PUC18, PBAD, PIDTSAMRT-AMP, etc.) Winis-derived plasmids (PUB110, PTP5, etc.), yeast-derived plasmids (yep13, yep24, ycp50, etc.) Retrovirus, adenovirus, backinia virus, etc., insect virus vector (Baculovirus, etc.) can be available. Since the expression level and modification of the protein of the vector appear differently depending on the host cell, it is preferable to select and use the host cell most suitable for the purpose.
- the vector may include a selectable marker.
- the selectable marker is a nucleic acid sequence having characteristics that can be selected by a conventional chemical method, and includes all genes capable of distinguishing transformed cells from non-transformed cells. For example, there are herbicide resistance genes such as glyphosate, glufosinate ammonium, or phosphinothricin, and antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol, but are not limited thereto.
- the selectable marker may be hygromycin and/or phosphinotricin.
- Another aspect of the present invention provides a method for producing a transformed tomato containing a high concentration of 7-dihydrocholesterol, comprising the step of introducing a vector containing the gene encoding the sgRNA and the gene encoding the CRISPR-associated protein into tomatoes using Agrobacterium.
- the transgenic plant may be produced through a plant transformation method known in the art.
- a person skilled in the art can select and carry out a known transformation method suitable for a particular plant in consideration of the characteristics of the plant selected as the host.
- a transformation method using Agrobacterium can be used as a plant transformation method.
- the "transformation method using Agrobacterium” is a method of transferring an external gene to plant cells using Agrobacteria, a gram-negative soil bacterium that causes tumors in the roots and stems of plants. This is a method using a phenomenon in which T-DNA (transfer DNA) of a tumor-inducing plasmid (Ti plasmid) found in Agrobacteria such as Agrobacterium tumefaciens and Agrobacterium rhizogenes is inserted into the plant genome.
- T-DNA transfer DNA
- Ti plasmid tumor-inducing plasmid
- a homozygous tomato when a modification in the nucleic acid sequence is included in the exon 6 domain of the DWF5-1 gene, a homozygous tomato (T1) can produce seeds (FIG. 18).
- homozygous T2 generation tomatoes having a nucleic acid sequence variation in the exon 6 domain of the DWF5-1 gene were able to grow normally and produce seeds (FIG. 26), and 7-dehydrocholesterol was accumulated in fruits and roots at high concentrations (Table 14, FIGS. 21 and 22).
- the transformed tomatoes contained modifications in the nucleic acid sequence in the domains of exon 6 of the DWF5-1 gene and exon 8 of the CPD gene, the tomatoes failed to grow into intact plants.
- DWF5-1 (hereinafter referred to as 'DWF5', Fig. 1), CPD (Fig. 2) and SMT1 (Fig. 3) genes
- 'DWF5' Fig. 1
- CPD Fig. 2
- SMT1 Fig. 3
- sgRNAs for editing were conducted through the Cas-Designer site (http://www.rgenome.net/cas-dessdaigner/).
- the Cas9 to be used was selected, and the sgRNA was designed by obtaining results such as the required exon position in the gene, the GC content of the sgRNA, and off-target where there is a mismatch.
- Cas9 has a PAM of NGG-3', and tomato (S. lycopersicum) was selected as the plant (FIGS. 1 to 3).
- sgRNA was screened to confirm gene editing efficiency (Table 2 and FIGS. 1 to 3).
- the targeting adequacy of sgRNA was conducted using RGEN (RNA-guided endonuclease) analysis.
- the DNA template was purified using a PCR purification kit from the amplified PCR product above (PCR product), and then RGEN was performed in the combination shown in Table 1 by measuring the amount of the DNA template. After incubation at 37°C for 1 hour, 3 ⁇ L of 6x DNA-Purple dye was put into each, frozen, and then loaded onto a 2.5% Gel. The efficiency of gene editing was analyzed by analyzing the degree of uncut bands in the DNA template.
- SolycDWF5 (SEQ ID NO: 1) SolycDWF5-1 O D5-1 TGGAGCTTTATCCTCGTATCGGG (SEQ ID NO: 20) 6 (SEQ ID NO: 9) SolycDWF5-2 O D5-2 GCAGATTTGGTATGATGTCTTGG (SEQ ID NO: 21) 6 (SEQ ID NO: 9) SolycDWF5-3 O D5-3 TGTAAATACGATATTGATGTTGG (SEQ ID NO: 22) 7 (SEQ ID NO: 10) SolycDWF5-4 ⁇ D5-4 GACCAGCCACTAGTATGTAAAGG (SEQ ID NO: 23) 9 (SEQ ID NO: 11) SolycDWF5-5 O D5-5 TGCATTTTCCATTTGTTCTCCGG (SEQ ID NO: 24) 9
- a Cas9-sgRNA vector containing sgRNAs targeting DWF5, CPD or SMT1 was finally constructed.
- the pNGPJ0014 vector (SEQ ID NO: 39) was constructed based on the pCAMBIA1300 plasmid having kanamycin and hygromycin resistance genes.
- the pNGPJ0014 vector has an antibiotic cassette for selection by kanamycin and hygromycin antibiotics, and a polycistronic tRNA-gRNA cassette synthesized with Cas9.
- the Cas9 was designed to be expressed by the Arabidopsis Ubiquitin 10 (Ubi 10) promoter, and the tRNA-gRNA was designed to be expressed by the Arabidopsis Ubiquitin 6 promoter.
- the Cas9-sgRNA vector was constructed to target 1 to 3 types of genes. In addition, it was designed to load two types of sgRNA per target.
- the Cas-sgRNA vector containing the base sequences of D5-1 sgRNA (SEQ ID NO: 20) and D5-2 sgRNA (SEQ ID NO: 21) targeting the DWF5 gene was named "D100" (SEQ ID NO: 36) (FIG. 7).
- a Cas9-sgRNA vector targeting the CPD and DWF5 genes was named “D120” (SEQ ID NO: 37).
- the CPD sgRNA includes the nucleotide sequences of C2 (SEQ ID NO: 28) and C3 (SEQ ID NO: 29)
- the DWF5 sgRNA includes the nucleotide sequences of D5-1 (SEQ ID NO: 20) and D5-2 (SEQ ID NO: 21) (FIG. 8).
- a Cas9-sgRNA vector targeting the SMT1, CPD and DWF5 genes was named “D121” (SEQ ID NO: 38).
- the SMT1 sgRNA includes the nucleotide sequences of S1 (SEQ ID NO: 32) and S2 (SEQ ID NO: 33)
- the CPD sgRNA includes the nucleotide sequences of C2 (SEQ ID NO: 28) and C3 (SEQ ID NO: 29)
- the DWF5 sgRNA includes the nucleotide sequences of D5-1 (SEQ ID NO: 20) and D5-2 (SEQ ID NO: 21) (FIG. 9).
- TMS(V) medium MS SALT 4.3g/1L Myo-inositol 100 mg/L
- 100X (100X) vitamin concentrate was used at 10 mL/L each. Nicotinic acid 0.5 mg/L Pyridoxine HCl 0.5 mg/L Thiamin HCl 0.1 mg/L Sucrose 30g/L Plant Agar 0.6 ⁇ 0.7%/L
- the pH was corrected to 5.7 using 1 N NaOH, sterilized in an autoclave at 121 ° C for 15 minutes, and about 30 mL was dispensed into 90x15 mm petridish.
- the vitamin concentrate was added when the temperature of the medium was between 55 and 60°C.
- TPC badge Tomato Pre-Culture Medium
- MS SALT 4.3g/1L Myo-inositol 100 mg/L
- 100X (100X) vitamin concentrate was used at 10 mL/L each. Nicotinic acid 0.5 mg/L Pyridoxine HCl 0.5 mg/L Thiamin HCl 0.1 mg/L Sucrose 30g/L Gelrite 0.25%/L BA 1 mg/L NAA 0.1 mg/L
- the pH was corrected to 5.7 using 1 N NaOH, sterilized in an autoclave at 121 ° C for 15 minutes, and about 30 mL was dispensed into 90x15 mm petridish.
- the vitamin concentrate was added when the temperature of the medium was between 55 and 60°C.
- TCC badge Tomato Co-Culture Medium
- MS SALT 4.3g/1L Myo-inositol 100 mg/L
- 100X (100X) vitamin concentrate was used at 10 mL/L each.
- Nicotinic acid 0.5 mg/L Pyridoxine HCl 0.5 mg/L Thiamin HCl 0.1 mg/L Sucrose 30g/L Gelrite 0.25%/L BA 1 mg/L NAA 0.1 mg/L Acetosyringone (AS) 100 mM/L
- pH was corrected to 5.2 using 1 N NaOH, sterilized in an autoclave at 121 ° C for 15 minutes, and about 30 mL was dispensed into 90x15 mm petridish.
- Vitamin concentrate, BA, NA and AS were added when the medium was sterilized and the medium temperature was between 55 and 60°C.
- TSI badge Tomato Shoot Indunction Medium
- 100X (100X) vitamin concentrate was used at 10 mL/L each.
- Nicotinic acid 0.5 mg/L Pyridoxine HCl 0.5 mg/L Thiamin HCl 0.1 mg/L Sucrose 30g/L Gelrite 0.25% IAA 0.2 mg/L Zeatin 2 mg/L PPT 5 mg/L carbenicillin 5 mg/L
- the pH was corrected to 5.7 with 1 N NaOH and 1 N HCl, sterilized in an autoclave at 121 ° C for 15 minutes, and about 30 mL was dispensed into a 90x15 mm petridish.
- Vitamin concentrate, BA, NA and AS were added when the medium was sterilized and the medium temperature was between 55 and 60°C.
- Rooting badge 1/2 MS SALT with vitamins 2.2g/L Sucrose 30g/L Plant Agar 0.6 ⁇ 0.7%/L IAA 0.2 mg/L Carbenicillin 300 mg/L
- the pH was corrected to 5.7 with 1 N NaOH and 1 N HCl, sterilized in an autoclave at 121 ° C for 15 minutes, and dispensed into magenta boxes. IAA was added after sterilization, when the medium temperature was between 55 and 60 °C.
- Product name or manufacturing method BA 1 mg/mL Purchase and use Calsson (BSL01-100mL) 1 mg/mL solution.
- NAA 1 mg/mL Purchase and use Calsson (NSL01-100mL) 1 mg/mL solution.
- Indole acetic acid (IAA) 1 mg/mL Dissolve 50 mL of Duchefa, I0901 reagent in 50 mL of D.W. After filtering, dispense and store in a refrigerator.
- the prepared solution is dispensed by 1 mL and stored in a freezer (not frozen).
- Modified vitamin solution 100x It is prepared as a 100-fold concentrated solution and used when preparing a medium.
- Myo-inositol (MB cell, MB-I4715) 10 g/L; Nicotinic Acid (Showa, 1414-0130) 50 mg/L; Prydoxine HCl (Sigma, P-8666) 50 mg/L; and Thiamine HCl (Duchefa, T0614) 10 mg/L; dissolved in 1 L of DW, sterilized in an autoclave at 121° C. for 15 minutes, and then stored in a refrigerator.
- tomato seeds were disinfected with 70% ethanol for 5 seconds and disinfected with 2% bleach for 20 minutes.
- the sterilized seeds were washed with sterilized water 4 to 5 times, and then placed on sterilized filter paper to remove moisture.
- Sterilized tomato seeds were transferred to seed sowing medium TMS (Table 3) and dark cultured at 25 ° C. for 3 days, followed by light culture.
- Agrobacterium (GV3101 strain, DSMZ, CAT.No.DSM12364) was prepared by adding 100 mM AS (acetosyringone), 50 mg/L rifampicin, and 50 mg/L kanamycin (Km) to 50 mL culture medium (YEP) at 28°C for 1 to 2 days to obtain an OD600 value of 0.8 to 1.2. during cancer culture.
- AS acetosyringone
- Km kanamycin
- the cultured bacteria were centrifuged at 4° C. and 6,000 rpm for 15 minutes to remove the supernatant, and the pellet was resuspended in the same amount of Tomato Co-Culture (TCC) medium (Table 5) and diluted to an OD value of 0.5.
- TTC Tomato Co-Culture
- Callus was differentiated from the cut section between 3 and 4 weeks after tooth injury, and when shoots were induced from the differentiated callus and grew more than 1 cm, they were transferred to a rooting medium (Table 9) to induce roots. At this time, the callus was removed as much as possible and rooting was induced by transplanting the shoot part. When the roots were fully rooted, the objects were washed with tap water to remove the remaining Agrobacteria, and then moved to soil and cultured while adapting to the external environment (humidity change and non-sterile conditions) while maintaining the culture room environment.
- a rooting medium Table 9
- the target region was first amplified through PCR, and then the amplified PCR product was purified using a PCR Purification kit. Using the purified PCR product as a DNA template, heteroduplex formation was performed under the conditions of Table 11 and the combinations shown in Table 10. Then, 1 ⁇ L of T7 endonuclease I (T7E1) was added and reacted at 37° C. for 30 minutes. Finally, 1 ⁇ L of Proteinase K was treated and reacted at 37°C for 5 minutes to inactivate T7E1 enzyme activity. The efficiency of gene editing was evaluated to the extent that the PCR product had a fragment concentration.
- T7E1 T7 endonuclease I
- sgRNA target region was amplified from genomic DNA extracts using Q5 High-Fidelity DNA Polymerase (NewEngland Biolabs) in 20 ⁇ L reactions. Then, the PCR product was cloned into a TA vector using an All in one Cloning Kit (Biofact, South Korea), and 15 to 20 cloned clones were individually sequenced for each sample. As a result, 14 DWF5 gene deletion tomato homozygotes produced by transformation with D100 were identified (FIGS. 15 and 16). In addition, one homozygous tomato transformed with D121 and deficient in DWF5, CPD, and SMT1 genes was identified (FIG. 15 and Table 12). In the case of D121 transgenic plants, plant hormone imbalance caused by gene deletion resulted in a phenomenon in which fruit was not formed.
- T2 generation tomatoes Seeds (T2) obtained in Example 4 were sown and the content of provitamin D3 contained in T2 generation tomatoes was measured by LC/MS. At this time, tomato wild type (WT), #3-14 line (D100-3-14) T2 generation (4 individuals) and #7-1 line (D100-7-1) T2 generation (11 individuals) were used as samples, and 7-dehydrocholesterol (provitamin D3, sigma, Cat30800, Lo t.BCBS6021) was used. In addition, as a control, wild type (WT) tomatoes were used as samples.
- each sample was weighed and 30 mL of ethanol and 1 mL of 10% ethanolic Pyrogallo were added. Then, 3 mL of 90% potassium hydroxide (KOH) was added and reacted for 30 minutes while vortexing every 10 minutes in an 80 ° C water bath. After the reaction was finished, after cooling at room temperature, 30 mL of distilled water and n-hexane were added, respectively, and mixed by shaking for 1 hour. Then, the supernatant was transferred to a separatory funnel, and 30 mL of n-hexane was added to the water layer, followed by vortexing and mixing.
- KOH potassium hydroxide
- Seeds (T2) obtained in Example 4 were disinfected with 70% ethanol for 5 seconds and disinfected with 2% bleach for 20 minutes. The sterilized seeds were washed with sterilized water 4 to 5 times and then placed on sterilized filter paper to remove moisture. The seeds were sown in MS medium (Table 15) and cultured at 25° C. under 16-hour light/8-hour dark cycle conditions. After 2-3 weeks, when roots are formed, they are taken out from the plate, and then roots (hairy roots) are collected and analyzed for 7-DHC content by GC-MS.
- root extract was obtained by mixing 10 mg of root sample with 3 mL of 0.1% ascorbic acid-ethanol and 0.05 mL of 5 ⁇ -cholestane. The extract was mixed with 80% potassium hydroxide to proceed to saponification, and then mixed with hexane to separate lipophilic substances. The separated lipophilic substance was derivatized using pyridine and N -methyl- N -trimethylsilyl trifluoroacetamide, and then GC-MS (gas chromatography-quadrupole mass spectrometry) analysis was performed. For quantitative and qualitative analysis, calibration curves calculated as standard materials were used.
- #3-14-29 and #7-1-15 individuals were checked for DWF5 gene editing.
- the nucleotide sequence of the individual was different from that of wild-type (WT) tomato (FIG. 24), and the amino acid sequence also confirmed that the sequence corresponding to exon 6 was deleted (FIG. 25).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Nutrition Science (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Physiology (AREA)
- Pregnancy & Childbirth (AREA)
- Reproductive Health (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Virology (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2024565892A JP2025503326A (ja) | 2022-01-24 | 2023-01-25 | 高レベルの7-デヒドロコレステロールを含有するトマトおよびその調製方法 |
| CA3249407A CA3249407A1 (en) | 2022-01-24 | 2023-01-25 | TOMATOES CONTAINING A HIGH CONCENTRATION OF DEHYDRO-7 CHOLESTEROL AND PRODUCTION METHOD |
| CN202380030161.2A CN119031835A (zh) | 2022-01-24 | 2023-01-25 | 含高浓度7-脱氢胆固醇的番茄及其生产方法 |
| US18/832,478 US20250154520A1 (en) | 2022-01-24 | 2023-01-25 | Tomatoes containing high levels of 7-dehydrocholesterol and preparation method therefor |
| EP23743565.6A EP4470364A4 (en) | 2022-01-24 | 2023-01-25 | TOMATOES CONTAINING HIGH LEVELS OF 7-DEHYDROCHOLESTEROL AND PROCESS FOR THEIR PREPARATION |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2022-0009633 | 2022-01-24 | ||
| KR1020220009633A KR102542130B1 (ko) | 2022-01-24 | 2022-01-24 | 7-디하이드로콜레스테롤이 고농도로 함유된 토마토 및 이의 제조 방법 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023140722A1 true WO2023140722A1 (ko) | 2023-07-27 |
Family
ID=86762539
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2023/001125 Ceased WO2023140722A1 (ko) | 2022-01-24 | 2023-01-25 | 7-디하이드로콜레스테롤이 고농도로 함유된 토마토 및 이의 제조 방법 |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20250154520A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4470364A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2025503326A (cg-RX-API-DMAC7.html) |
| KR (1) | KR102542130B1 (cg-RX-API-DMAC7.html) |
| CN (1) | CN119031835A (cg-RX-API-DMAC7.html) |
| CA (1) | CA3249407A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2023140722A1 (cg-RX-API-DMAC7.html) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040148655A1 (en) * | 2000-03-27 | 2004-07-29 | The Arizona Board Of Regents On Behalf Of The University Of Arizona, An Arizona Corporation | Dwf5 mutants |
| KR20190066718A (ko) * | 2017-12-06 | 2019-06-14 | (주)지플러스 생명과학 | 고농도의 비타민d를 함유한 토마토 및 그 제조방법 |
| WO2019163601A1 (ja) * | 2018-02-26 | 2019-08-29 | 神戸天然物化学株式会社 | 形質転換植物、およびその利用 |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20170138657A (ko) | 2016-06-08 | 2017-12-18 | (주)지플러스 생명과학 | 고농도의 비타민d를 함유한 상추 및 그 제조방법 |
| KR102264215B1 (ko) * | 2020-12-23 | 2021-06-11 | 전남대학교산학협력단 | 유전자 교정을 이용한 아스코르브산 함량이 증가된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체 |
-
2022
- 2022-01-24 KR KR1020220009633A patent/KR102542130B1/ko active Active
-
2023
- 2023-01-25 EP EP23743565.6A patent/EP4470364A4/en active Pending
- 2023-01-25 WO PCT/KR2023/001125 patent/WO2023140722A1/ko not_active Ceased
- 2023-01-25 JP JP2024565892A patent/JP2025503326A/ja active Pending
- 2023-01-25 CA CA3249407A patent/CA3249407A1/en active Pending
- 2023-01-25 US US18/832,478 patent/US20250154520A1/en active Pending
- 2023-01-25 CN CN202380030161.2A patent/CN119031835A/zh active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040148655A1 (en) * | 2000-03-27 | 2004-07-29 | The Arizona Board Of Regents On Behalf Of The University Of Arizona, An Arizona Corporation | Dwf5 mutants |
| KR20190066718A (ko) * | 2017-12-06 | 2019-06-14 | (주)지플러스 생명과학 | 고농도의 비타민d를 함유한 토마토 및 그 제조방법 |
| WO2019163601A1 (ja) * | 2018-02-26 | 2019-08-29 | 神戸天然物化学株式会社 | 形質転換植物、およびその利用 |
Non-Patent Citations (3)
| Title |
|---|
| DATABASE NUCLEOTIDE ANONYMOUS : "Solanum lycopersicum cDNA, clone: LEFL1035BF01, HTC in leaf", XP093079214, retrieved from NCBI * |
| JAPELT, R. B. ET AL.: "Vitamin D in plants: a review of occurrence, analysis, and biosynthesis", FRONTIERS IN PLANE SCIENCE. 2013, vol. 4, 2013, pages 1 - 20, XP055458454, DOI: 10.3389/fpls.2013.00136 * |
| See also references of EP4470364A4 * |
Also Published As
| Publication number | Publication date |
|---|---|
| US20250154520A1 (en) | 2025-05-15 |
| CN119031835A (zh) | 2024-11-26 |
| EP4470364A1 (en) | 2024-12-04 |
| JP2025503326A (ja) | 2025-01-30 |
| EP4470364A4 (en) | 2025-07-09 |
| CA3249407A1 (en) | 2025-02-21 |
| KR102542130B1 (ko) | 2023-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20120102593A1 (en) | Use of a Histone Deacetylase Gene OsHDT1 in Enhancing Rice Heterosis | |
| US20240188521A1 (en) | Plants with Modified Deoxyhypusine Synthase Genes | |
| WO2019235907A1 (ko) | Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용 | |
| EP3095863A1 (en) | Parthenocarpy regulation gene and use thereof | |
| CN117534743A (zh) | OsJAB1蛋白及其在提高水稻盐胁迫耐性中的应用 | |
| WO2012148121A2 (ko) | 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 atpg7 단백질과 그 유전자 및 이들의 용도 | |
| KR20210011394A (ko) | Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용 | |
| WO2023140722A1 (ko) | 7-디하이드로콜레스테롤이 고농도로 함유된 토마토 및 이의 제조 방법 | |
| Inoue et al. | LATERAL BRANCHING OXIDOREDUCTASE specificity for strigolactone branching inhibition in barley | |
| CN119242627A (zh) | Tga7基因和/或其编码蛋白在调控植物生长和低氮胁迫适应性中的应用 | |
| KR102890138B1 (ko) | GmFT6 유전자 교정에 의해 조기 개화 및 조기 등숙이 유도된 유전체 교정 콩 식물체의 제조방법 및 상기 방법에 의해 제조된 조기 개화 및 조기 등숙이 유도된 유전체 교정 콩 식물체 | |
| WO2014209036A1 (ko) | 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg10 단백질과 그 유전자 및 이들의 용도 | |
| KR102890160B1 (ko) | GmFT4 유전자 교정에 의해 조기 등숙이 유도된 유전체 교정 콩 식물체의 제조방법 및 상기 방법에 의해 제조된 조기 등숙이 유도된 유전체 교정 콩 식물체 | |
| US20250034586A1 (en) | Method for editing banana genes | |
| US20240381898A1 (en) | Edible composition comprising non-toxic solanum plant or plant part | |
| WO2012148122A2 (ko) | 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 atpg8 단백질과 그 유전자 및 이들의 용도 | |
| US12270041B2 (en) | ROP—deficient plants having high water use efficiency | |
| KR100803391B1 (ko) | 전신 발현 프로모터, 이의 증폭용 프라이머, 이를 포함하는발현벡터 및 형질전환 식물체 | |
| CN121653178A (zh) | 大豆NAC转录因子基因GmNAC4在调控大豆籽粒大小和/或抗旱性中的应用 | |
| KR20260001615A (ko) | GmE1 유전자 교정에 의해 조기 개화 및 조기 등숙이 유도된 유전체 교정 콩 식물체의 제조방법 및 상기 방법에 의해 제조된 조기 개화 및 조기 등숙이 유도된 유전체 교정 콩 식물체 | |
| KR20240031315A (ko) | 바나나 과실의 갈변 지연 또는 예방 | |
| WO2025110693A1 (ko) | EPSPs 유전자 염기교정에 의해 제초제 내성 형질을 가지는 옥수수 식물체 및 이의 제조방법 | |
| WO2025095353A1 (ko) | CRISPR/Cas9 시스템을 이용한 만추성 상추 식물체의 제조방법 및 상기 방법에 의해 제조된 만추성 상추 식물체 | |
| CN121992002A (zh) | 大豆GmSMS6蛋白及其编码基因在调控大豆籽粒粒重及粒型中的应用 | |
| CN119591681A (zh) | GmDWF1蛋白在调控植物株高中的应用 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23743565 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 18832478 Country of ref document: US Ref document number: 2024565892 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2023743565 Country of ref document: EP Effective date: 20240826 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202380030161.2 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 18832478 Country of ref document: US |