WO2023140596A1 - Ensemble d'amorces universelles du virus du chikungunya pour l'amplification du génome entier et kit de diagnostic l'utilisant - Google Patents

Ensemble d'amorces universelles du virus du chikungunya pour l'amplification du génome entier et kit de diagnostic l'utilisant Download PDF

Info

Publication number
WO2023140596A1
WO2023140596A1 PCT/KR2023/000830 KR2023000830W WO2023140596A1 WO 2023140596 A1 WO2023140596 A1 WO 2023140596A1 KR 2023000830 W KR2023000830 W KR 2023000830W WO 2023140596 A1 WO2023140596 A1 WO 2023140596A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
chikungunya virus
genome
sequencing
sequence
Prior art date
Application number
PCT/KR2023/000830
Other languages
English (en)
Korean (ko)
Inventor
김세일
박동주
핫산 조하입울
박창우
Original Assignee
한국표준과학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국표준과학연구원 filed Critical 한국표준과학연구원
Publication of WO2023140596A1 publication Critical patent/WO2023140596A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2521/00—Reaction characterised by the enzymatic activity
    • C12Q2521/10—Nucleotidyl transfering
    • C12Q2521/107—RNA dependent DNA polymerase,(i.e. reverse transcriptase)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a technology for amplifying the viral genome from a small amount of sample using a primer set capable of amplifying the entire genome of Chikungunya virus and analyzing the base sequence to obtain full-length genome information.
  • Chikungunya virus is a positive-sense single-stranded RNA virus belonging to the genus Alphavirus and family Togaviridae 1,2 . This virus has a genome approximately 12 kb in length, containing 3 untranslated regions (UTRs), 4 non-structural protein (NSP) coding sequences and 5 structural protein coding sequences 2,3 . It was first recognized as a large-scale fever in Africa in 1952-1953 4,5 . CHIKV was widely spread in Africa by Aedes aegypti, one of the major insect vectors 6,7 . East Central South African (ECSA) and some West African (WA) lineages have been identified. Outbreaks in Southeast Asia were frequently observed with an Asian lineage prior to 2004.
  • UTRs untranslated regions
  • NSP non-structural protein
  • E1-A226V variant a single amino acid mutation at position 226 of the E1 envelope glycoprotein of the ECSA line from an Indian Ocean island in 2004 induced high susceptibility of the second major vector, Aedes albopictus 9 .
  • This variant is a sublineage of ECSA and clustered into the first ECSA genotype-Indian Ocean lineage (IOL) 9,12,13 .
  • IOL ECSA genotype-Indian Ocean lineage
  • Whole genome sequencing has grown in importance in terms of vaccine and treatment development, epidemiology and evolutionary genomics at risk of CHIKV reemergence 22 .
  • Whole genome sequencing is sequencing for complete sequencing. It arises from the application of whole genome random sequencing as a shotgun approach 23 . With random-sized genome sequencing, each genome fragment (called a 'read') has a region that is repetitive in sequence. A read identifies these repeating regions and combines them into one continuous sequence. As a result, the entire genome is sequenced 23,24 . WGS can now be performed on the NGS platform 25 .
  • NGS Next generation sequencing
  • Illumina is one of the platforms presenting the short-read NGS28.
  • the Illumina platform performs pair-end sequencing with bridge amplification of two reversible adapters.
  • a different adapter sequence connects to each end of the single-stranded DNA fragment and attaches it to the surface of the flow cell. The other binds to a complementary oligo on the surface after attaching one adapter.
  • ONT Olford Nanopore Technology
  • RNA sequencing metagenomics, disease transmission monitoring (tracking), and bioinformatics 31-36 .
  • the present invention aims to develop CHIKV universal primers for rapid next-generation sequencing (NGS).
  • NGS next-generation sequencing
  • Strain NCCP43132 strain KNIH/2009/77
  • the primers were designed as far as possible to cover the entire sequence of ECSA (including IOL) and Asian lineages.
  • ECSA including IOL
  • Asian lineages we performed illumine shotgun sequencing using double-stranded cDNA for the whole-genome sequence. Rapid sequencing of amplicons was performed by Oxford Nanopore Technique and sequences were analyzed using CLC Workbench software. To confirm the efficiency of the primers, the same experiment was performed with several strains from other countries and clinical samples from Pakistan.
  • Korean Patent Registration No. 2030245 discloses an oligonucleotide set for detecting chikungunya virus and its use
  • Korean Patent Publication No. 2011-0118176 discloses a probe and primer for detecting chikungunya
  • US Patent Publication No. 2019/0367998 discloses a chikungunya virus detection method.
  • the present invention was derived from the above request, and the present inventors utilized general-purpose primers capable of amplification in Chikungunya virus to quickly and easily perform genome sequencing on the genome amplified through PCR or the like from a small amount of genome. It was confirmed that it was possible to secure the genome sequence and completed the present invention.
  • the present invention provides a method for confirming the whole genome sequence of chikungunya virus in an isolated sample comprising the following steps.
  • the sequence confirmation method includes (a) preparing one or more sets of forward and reverse primers complementary to the full genome of Chikungunya virus;
  • the primer set includes SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; and primer sets of SEQ ID NO: 7 and SEQ ID NO: 8.
  • the present invention is a chikungunya virus diagnostic kit comprising at least one forward and reverse primer set complementary to the full-length chikungunya virus genome,
  • the primer set is SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; and a chikungunya virus diagnostic kit comprising primer sets of SEQ ID NO: 7 and SEQ ID NO: 8.
  • the present invention is a composition for diagnosing an alpha corona virus-induced disease comprising at least one forward and reverse primer set complementary to the full-length chikungunya virus genome,
  • the primer set is SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; And SEQ ID NO: 7 and SEQ ID NO: 8 provides a composition for diagnosing a disease caused by Chikungunya virus.
  • the sample is separated from blood, serum, sputum, urine or biological tissue.
  • the chikungunya virus includes KNIH/2009/77.
  • the chikungunya virus-induced disease is at least one selected from the group consisting of sudden fever, polyarthralgia, and rash.
  • the present invention relates to a method for obtaining the sequence of the whole genome of chikungunya virus and its use.
  • the method, kit, and composition of the present invention use forward and reverse primer sets capable of amplifying the entire genome of Chikungunya virus, and because genome amplification is performed, the presence or absence of Chikungunya virus and the presence or absence of variants can be easily and quickly confirmed in small amounts of virus samples and uncultured clinical samples.
  • the method, kit, and composition of the present invention enable accurate and rapid acquisition of the whole genome sequence of Chikungunya virus, and thus can be effectively applied to the diagnosis of diseases caused by Chikungunya virus.
  • 1 shows the results of phylogenetic analysis according to an embodiment of the present invention.
  • (1A) The phylogenetic tree of Chikungunya virus is divided into three families; West Africa (WA), East Central and South Africa (ECSA), and Asia.
  • (1B) The black square is a small tree enlargement based on the red arrow in (1A) to see the phylogenetic distance between the KNIH/2009/77 strain and other strains.
  • the present invention provides a method for confirming the whole genome sequence of chikungunya virus in an isolated sample comprising the following steps.
  • the sequence confirmation method includes (a) preparing one or more sets of forward and reverse primers complementary to the full genome of Chikungunya virus;
  • the primer set includes SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; and primer sets of SEQ ID NO: 7 and SEQ ID NO: 8.
  • the concentration of the primer is 0.1 to 1.0 pM, 0.1 to 0.8 pM, 0.1 to 0.6 pM, 0.2 to 1.0 pM, 0.2 to 0.8 pM, 0.2 to 0.6 pM, 0.3 to 1.0 pM, 0.3 to 0.8 pM, 0.3 to 0.6 pM, 0.4 to 1. It may be 0 pM or 0.4 to 0.8 pM, for example, 0.4 to 0.6 pM, but is not limited thereto.
  • the step of carrying out the polymerase chain reaction is 30 to 50 cycles, 30 to 46 cycles, 30 to 44 cycles, 33 to 50 cycles, 33 to 46 cycles, 33 to 44 cycles, 36 to 50 cycles, 36 to 46 cycles, 36 to 44 cycles, 38 to 50 cycles or 38 to 46 cycles, for example, 38 to 44 cycles It may be performed under conditions, but is not limited thereto.
  • the sample is separated from blood, serum, sputum, urine or biological tissue.
  • the chikungunya virus includes KNIH/2009/77.
  • any sequencing method known in the art may be used regardless of the type, preferably Sanger method or next generation sequencing (NGS), but is not limited thereto.
  • NGS next generation sequencing
  • chromosomal abnormalities including DNA copy number mutations (CNVs) in which part of the chromosome is missing or duplicated
  • various tests such as karyotyping, fluorescence in situ hybridization, chromosome microarray, and NGS-based screening are being performed (Capalbo A, et al. 2017, Hum Reprod. Vol. 32(3), pp. 492-498).
  • karyotyping has a lower resolution of about 5 Mb, and chromosomal deletions/duplications smaller than that cannot be detected.
  • microdeletion/duplication Small chromosomal deletions and duplications of less than 5 Mb are called microdeletion/duplication, and among diseases caused by a single gene, the ratio of microdeletion/duplication accounts for 15% of all mutations (Vissers LE, et al. 2005, Hum Mol Genet. Vol. 15;14 Spec No. 2:R215-23.).
  • Fluorescence in situ hybridization is a test method to confirm whether a specific nucleotide sequence is present in a chromosome by attaching a fluorescent label to a probe complementary to the nucleotide sequence to be identified. Since it shows a resolution of 100 kb-1 Mb, it is possible to detect microdeletion/duplication, but it has the disadvantage that it can detect only previously known mutations because only the part complementary to the probe sequence can be identified.
  • CGH comparative genomic hybridization
  • the technology for determining the nucleotide sequence of genes constituting living organisms is divided into the first-generation Sanger method and NGS (Next Generation Sequencing), a next-generation sequencing method.
  • the first-generation method called Sanger sequencing developed around 1977, is a method of verifying the base sequence by collecting amplified DNA fragments by applying the chain-termination principle in which di-deoxynucleotidetriphosphates (ddNTPs) stop the synthesis of DNA strands during the polymerase chain reaction (PCR) process.
  • ddNTPs di-deoxynucleotidetriphosphates
  • PCR polymerase chain reaction
  • NGS Next-generation sequencing
  • SNPs single nucleotide polymorphisms
  • INDELs insertions and deletions
  • NGS can detect chromosomal abnormalities caused by chromosomal rearrangements that cannot be detected by probe-based microarrays and new CNVs previously unknown (Talkowski ME, et al. 2011, Am J Hum Genet. Vol. 88(4), pp. 469-81).
  • it has the advantage of showing higher coverage and resolution than microarrays due to the characteristics of sequencing by slicing chromosomes into small fragments, and detecting breakpoints where chromosomal abnormalities begin (Zhao M, et al. 2013, BMC Bioinformatics. Vol. 14, Suppl 11: S1).
  • the present invention is a chikungunya virus diagnostic kit comprising at least one forward and reverse primer set complementary to the chikungunya virus full-length genome,
  • the primer set is SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; and a chikungunya virus diagnostic kit comprising primer sets of SEQ ID NO: 7 and SEQ ID NO: 8.
  • the present invention is a composition for diagnosing an alpha corona virus-induced disease comprising at least one forward and reverse primer set complementary to the full-length chikungunya virus genome,
  • the primer set is SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; And SEQ ID NO: 7 and SEQ ID NO: 8 provides a composition for diagnosing a disease caused by Chikungunya virus.
  • the chikungunya virus-induced disease may be at least one selected from the group consisting of sudden fever, polyarthralgia, and rash.
  • Viral RNA (KNIH/2009/77) of strain NCCP 43132 was provided by the National Institute of Pathogens and Culture of Korea (NCCP). Table 1 provides details of the genomic RNA and clinical samples used in this study. Clinical samples were delivered in cDNA condition from Pakistan. The initial concentration of genomic RNA was quantified using the QuantiFluor RNA System (Promega, USA) and the QuantusTM Fluorometer (Promega, USA) according to the manufacturer's manual.
  • Genomic position are based on the genomic sequence of strain S27-African prototype (NC_004162)
  • Single-stranded cDNA was synthesized from genomic RNA.
  • a 20 ⁇ l reaction mixture consisted of 4 ⁇ l of 5X LunaScript RT supermix (New England Biolabs, USA), 2 ⁇ l of RNA and nuclease-free water. Reacted under the following conditions; 25° C. for 2 min (primer annealing); 55° C. for 10 min (cDNA synthesis); 95° C. for 1 min (heat inactivated).
  • CHIKV The genome sequence of CHIKV was retrieved from the Virus Pathogen Resource (ViPR; www.viprbrc.org) database. A total of 767 genome sequences of CHIKV were aligned using ViPR and conserved regions of CHIKV were determined. Primers were designed with conserved sequences. Primers were designed with criteria similar to previous studies 37 . All oligomers were synthesized by Macrogen (Korea).
  • PCR reactions were performed in a 96-Well Thermal Cycler (Veriti Instruments, INC., USA) using the TaKaRa Ex Taq® kit (Takara, Japan).
  • a 50 ⁇ l reaction contained 1 ⁇ l of each primer (10 ⁇ M), 5 ⁇ l of Ex Taq Buffer (10X), 3 ⁇ l of dNTP (2.5 mM each), 2 ⁇ l of template, 0.25 ⁇ l of TaKaRa Ex Taq Polymerase and sterile distilled water.
  • PCR conditions were as follows; 95° C. for 1 minute (initial denaturation); 30 cycles of 95°C for 15 seconds (denaturation), 60°C for 15 seconds (annealing), and 72°C for 3 minutes (extension); 72° C.
  • qPCR real-time quantitative PCR
  • ddPCR digital droplet PCR
  • Primers and probes used in the assay are listed in Table 2 38-40 .
  • Assay mixes were prepared by mixing each primer and probe in one tube ready for use. Each primer and probe was mixed at 0.5 ⁇ M for qPCR and 0.4 ⁇ M for ddPCR. The next volume of each assay mix is used in a single reaction to make a final concentration of 0.2 ⁇ M in the reaction. 3 ⁇ l of nsp2-1, C, E1 assay and 5 ⁇ l of nsp2-2 assay.
  • Target amplicon Target gene Name 5'-Sequence-3' Site* Source One nsp2-1 CHIKV_nsp2_F1 CATCTGCACYCAAGTGTACCA 2578-2598 Jesse J. Waggoner et al. CHIKV_nsp2_R1 GCGCATTTTGCCTTCGTAATG 2654-2674 CHIKV_nsp2_P1 GCGGTGTACACTGCCTGTGACYGC 2614-2637 2 nsp2-2 CHIKV_nsp2_F2a GAGCATA Y GGTTACGCAGATAG 3855-3876 Barbara W. Johnson et al.
  • CHIKV_nsp2_R2 TACTGGTGATACATGGTGGTTTC + TGCTGGTGACACATGGTGGTTTC 3934-3956 CHIKV_nsp2_P2a ACGAGTAATCTGCGTACTGGGACGTA + ACGAGTCATCTGCGTA Y TGGGACGCA 3886-3911 3 C CHIKV_C_F CAACTTGCCCAGCTGATCTC 7684-7703 CHIKV_C_R TTCTTATTCTTCCGATTCYTGCG 7750-7772 CHIKV_C_P ATAAACTGACAATGCGCGYGGTACC 7712-7736 4 E1 CHIKV_E1_F AAGCTYCGCGTCCTTTACCAAG 10387-10408 Boris Pastorino et al. CHIKV_E1_R CCAAATTGTCCYGGTCTTCCT 10575-10595 CHIKV_E1_P CCAATGTCYTCMGCCTGGACACC
  • Oligonucleotides have one base change form original sequences for wide coverage spectrums against CHIKV. Changed base highlight by extrabold.
  • the reaction mixture for qPCR was prepared using Maxima Probe/ROX qPCR Master Mix 2X (Thermo ScientificTM, USA). 25 ⁇ l of each reaction mixture consisted of 12.5 ⁇ l 2X Master Mix, 2 ⁇ l template, assay mix and nuclease-free water. PCR conditions are as follows. 95° C. for 10 minutes (initial denaturation); 40 cyclers of 95°C 15 sec (denaturation) and 60°C 60 sec (anneal/extension). Fluorescence was recorded over the dynamic range of the FAM at the extension stage on a LightCycler® 96 instrument (Roche, Switzerland) and analyzed with LightCycler® 96 software (version 1.1).
  • the reaction mixture of ddPCR had a volume of 20 ⁇ l and consisted of 10 ⁇ l of ddPCR supermix for probe (BioRad Laboratories, USA), 2 ⁇ l of template, assay mix and nuclease-free water. All valid copy numbers were selected from the dynamic range FAM (470 nM/514 nM) according to the manufacturer's instructions.
  • ddPCR experiments were performed using the QX200 system (BioRad Laboratories, Hercules, CA, USA). Raw data were initially analyzed using QuantaSoft software (BioRad Laboratories, Hercules, CA, USA).
  • Copy numbers of amplicons were calculated from qPCR results using linear regression analysis with ddPCR results as previously described 41 .
  • RNA sequencing There are two methods of RNA sequencing. One is to make double-stranded cDNA (ds cDNA) and the other is to use an RNA library prep kit.
  • ds cDNA was prepared by synthesizing second-strand cDNA from single-strand cDNA. Single-stranded cDNA was synthesized using the LunaScript RT supermix kit (NEB, England) containing both random hexamer and oligo-dt primers. The mixture consisted of 4 ⁇ l LunaScript RT SuperMix (5X), 4 ⁇ l template and up to 20 ⁇ l nuclease-free water volume.
  • Second-strand cDNA synthesis was performed using the MaximaTM H Minus Double-Stranded cDNA Synthesis kit (Thermo Fisher Scientific, USA) according to the manufacturer's protocol. Then, 100 U of RNase I was added to 100 ⁇ l of ds cDNA reaction and incubated at room temperature for 5 minutes to remove residual RNA. Purified ds cDNA with DNA Clean & Concentrator Kits (Zymo Research, USA) was quantified using the QuantiFluor ds DNA System (Promega, USA) and QuantusTM Fluorometer according to the manufacturer's instructions.
  • CLC Genomic Workbench Software version 20.0.4, Qiagen, Denmark was used for trimming and mapping reads. Illumina's two-end reads (forward-reverse) were trimmed with the following parametric conditions to remove low-quality reads. Phred Quality Score of 30; 1 of the maximum number of ambiguities; homopolymers (homopolymers meaning identical bases over 9 out of 20 bases at the termini); 15 and 10 bases were removed from the 5' and 3' terminals, respectively. Delete reads with a length less than 60. Trimmed reads were mapped to FJ445484 (11,790 bp) downloaded from NCBI. The mapping condition is as follows.
  • FAST5 files were transferred in FASTAQ format for analysis. Low quality reads were then trimmed by the MinION GUI software. Trimmed read data were imported into CLC Genomic Workbench Software for analysis. The second trimming was processed to be read under the following conditions. 1 of the maximum number of ambiguities; homopolymer removal; 15 and 10 bases were removed from the 5' and 3' terminals, respectively. Reads less than 60 in length were discarded. Trimmed reads were mapped to a reference sequence taken from the whole genome sequence by shotgun sequencing. The complete sequence of CHIKV was analyzed from the consensus sequence by MEGA software.
  • NCCP 43132 KNIH/2009/77 was first isolated from a travel-related patient and deposited with the National Pathogen Collection (NCCP) 42 . Only the partial coding sequence (CDS) or structural protein CDS region of this strain has been previously studied 42–44 . To provide a basis for further full genome-based studies, we first analyzed whole-genome shotgun sequencing of this strain using double-stranded cDNA. Paired-end read data were generated by Illumina sequencing and entered into the CLC workbench. Read data were trimmed based on quality control reports.
  • (3A) Chart indicate the result of trimming, mapping of shotgun sequencing based on the number of reads.
  • Genomic site are provided based on the reference sequence CHKV strain S27-African prototype (NC_004162). Note show the bases at same site in all whole genome database of CHIKV.
  • Chikungunya virus had three major lineages prior to 2004. West Africa (WA), East Central South Africa (ECSA) and Asia (also known as Asian Cities, AUL). Viruses found in Indian Ocean Islands are a subgroup of ECSA47 and have been classified as Indian Ocean Islands (IOL) subfamily. In 2013–2014, Chikungunya viruses from the Caribbean and South America were classified as an Asian lineage, and a new American subgroup of the ECSA lineage was presented in 2016 48 . Today, three or four strains are used as the main strains of CHIKV; WA, ECSA, Asia and IOL 46 .

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un procédé d'obtention d'une séquence de génome entier pour déterminer si une infection par le virus du chikungunya est présente, et son utilisation. Le procédé, un kit, une composition de la présente invention comprennent un ensemble d'amorces universelles permettant l'amplification d'une séquence génomique du virus chikungunya, et ainsi la présence ou non du virus chikungunya cible dans un échantillon, et une maladie associée peut être vérifiée de manière pratique et rapide. De plus, la mutation ou non du virus du chikungunya peut être déterminée par séquençage du génome entier, et ainsi la présente invention peut également être efficacement utilisée pour l'identification du virus du chikungunya.
PCT/KR2023/000830 2022-01-18 2023-01-18 Ensemble d'amorces universelles du virus du chikungunya pour l'amplification du génome entier et kit de diagnostic l'utilisant WO2023140596A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220007098A KR20230111359A (ko) 2022-01-18 2022-01-18 전장유전체 증폭을 위한 치쿤군야 바이러스 범용 프라이머 세트 및 이를 이용한 진단 키트
KR10-2022-0007098 2022-01-18

Publications (1)

Publication Number Publication Date
WO2023140596A1 true WO2023140596A1 (fr) 2023-07-27

Family

ID=87348979

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/000830 WO2023140596A1 (fr) 2022-01-18 2023-01-18 Ensemble d'amorces universelles du virus du chikungunya pour l'amplification du génome entier et kit de diagnostic l'utilisant

Country Status (2)

Country Link
KR (1) KR20230111359A (fr)
WO (1) WO2023140596A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110118176A (ko) * 2009-02-25 2011-10-28 빅텍 프라이빗 리미티드 치쿤군야의 검출을 위한 프로브 및 프라이머
US20190367998A1 (en) * 2008-04-21 2019-12-05 Gen-Probe Incorporated Method for detecting chikungunya virus
KR102201869B1 (ko) * 2020-01-09 2021-01-12 서울대학교 산학협력단 뎅기 바이러스의 4종류 혈청형 동시 검출용 올리고뉴클레오티드 및 플라스미드와 이를 이용한 뎅기 바이러스 혈청형 분석 방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102030245B1 (ko) 2017-10-12 2019-10-08 고려대학교 산학협력단 치쿤군야 바이러스 검출용 올리고뉴클레오티드 세트 및 이의 용도

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190367998A1 (en) * 2008-04-21 2019-12-05 Gen-Probe Incorporated Method for detecting chikungunya virus
KR20110118176A (ko) * 2009-02-25 2011-10-28 빅텍 프라이빗 리미티드 치쿤군야의 검출을 위한 프로브 및 프라이머
KR102201869B1 (ko) * 2020-01-09 2021-01-12 서울대학교 산학협력단 뎅기 바이러스의 4종류 혈청형 동시 검출용 올리고뉴클레오티드 및 플라스미드와 이를 이용한 뎅기 바이러스 혈청형 분석 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
E. SREEKUMAR ; ANEESH ISSAC ; SAJITH NAIR ; RAMKUMAR HARIHARAN ; M. B. JANKI ; D. S. ARATHY ; R. REGU ; THOMAS MATHEW ; M. ANOOP ;: "Genetic characterization of 2006–2008 isolates of Chikungunya virus from Kerala, South India, by whole genome sequence analysis", VIRUS GENES, KLUWER ACADEMIC PUBLISHERS, BO, vol. 40, no. 1, 23 October 2009 (2009-10-23), Bo , pages 14 - 27, XP019775237, ISSN: 1572-994X *
STAPLEFORD KENNETH A., MORATORIO GONZALO, HENNINGSSON RASMUS, CHEN RUBING, MATHEUS SÉVERINE, ENFISSI ANTOINE, WEISSGLAS-VOLKOV DAP: "Whole-Genome Sequencing Analysis from the Chikungunya Virus Caribbean Outbreak Reveals Novel Evolutionary Genomic Elements", PLOS NEGLECTED TROPICAL DISEASES, vol. 10, no. 1, pages e0004402, XP093080039, DOI: 10.1371/journal.pntd.0004402 *

Also Published As

Publication number Publication date
KR20230111359A (ko) 2023-07-25

Similar Documents

Publication Publication Date Title
WO2016167408A1 (fr) Procédé permettant de prédire le rejet d'une greffe d'organe au moyen d'un séquençage de nouvelle génération
US11834723B2 (en) Methods and compositions for detection of enterovirus D68
CN113774168A (zh) 2019新型冠状病毒及其德尔塔和拉姆达变异株分型核酸检测试剂盒及检测方法
JP2023530205A (ja) チフス菌の検査キット、その製造方法及びその用途
CN112739833A (zh) 利用巢式RPA技术检测SARS-CoV-2的引物对、探针、试剂盒及其应用
WO2017139715A1 (fr) Systèmes et procédés pour la détection de maladies infectieuses
WO2022050700A1 (fr) Ensemble d'amorces universelles de coronavirus-2 du sars humain pour l'amplification du génome entier et kit de diagnostic l'utilisant
WO2023140596A1 (fr) Ensemble d'amorces universelles du virus du chikungunya pour l'amplification du génome entier et kit de diagnostic l'utilisant
CN112011595A (zh) 一种针对SARS-CoV-2病毒的全基因组扩增方法及应用及测序方法及试剂盒
NL2031160B1 (en) Primer Set, Probe and Application for Distinguishing Brucella S2 Vaccine Strain from Wild Strain
WO2019132581A1 (fr) Composition de diagnostic du cancer, tel que du cancer du sein et du cancer de l'ovaire, et son utilisation
WO2021091211A1 (fr) Procédé de détection de génome entier utilisant l'amplification du génome entier d'un virus mers-cov, et kit de diagnostic
WO2022071737A1 (fr) Matériau de référence d'arn de sars-cov-2 et procédé de fourniture d'informations pour le diagnostic d'une infection par sars-cov-2 l'utilisant
WO2022145658A1 (fr) Composition pour diagnostiquer une maladie de tsutsugamushi et kit la comprenant
WO2020171596A1 (fr) Composition pour la détection d'un micro-organisme du genre ganoderma et pour le diagnostic de la pourriture racinaire, et procédé d'utilisation correspondant
WO2022050721A1 (fr) Composition pour amplifier les gènes hla et son utilisation
WO2021141178A1 (fr) Ensemble d'amorces pour analyse simultanée d'une séquence génomique entière de quatre sérotypes du virus de la dengue et procédé de synthèse d'adnc l'utilisant
CN111647683B (zh) 一种新冠状病毒2019-nCoV核酸检测试剂盒及其应用
WO2011142646A9 (fr) Procédé de détection de hpv (papillomavirus humain) et de son génotype
WO2012002598A1 (fr) Amorce et sonde pour le diagnostic de la tuberculose, trousse comprenant celles-ci et méthode de diagnostic de la tuberculose à l'aide de la trousse
CN113549709A (zh) 利用巢式RPA技术检测SARS-CoV-2的引物对、探针、试剂盒及其应用
WO2021215556A1 (fr) Procede de preparation d'un kit de diagnostic de coronavirus, kit de diagnostic de coronavirus ainsi preparé, et procédé de diagnostic de coronavirus l'utilisant
WO2018110940A1 (fr) Procédé permettant de mesurer la complexité d'une banque en vue d'un séquençage de nouvelle génération
WO2023085783A1 (fr) Composition d'amplification de gènes pour la détection et la détermination de la résistance aux médicaments du complexe mycobacterium tuberculosis, et utilisations associées
WO2020171604A1 (fr) Composition pour la détection d'un microorgansime de l'espèce ganoderma et le diagnostic d'une maladie de la pourriture des racines et procédé d'utilisation de cette composition

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23743443

Country of ref document: EP

Kind code of ref document: A1