WO2023043220A1 - Wfdc2의 발현을 조절하는 안티센스 화합물 - Google Patents

Wfdc2의 발현을 조절하는 안티센스 화합물 Download PDF

Info

Publication number
WO2023043220A1
WO2023043220A1 PCT/KR2022/013783 KR2022013783W WO2023043220A1 WO 2023043220 A1 WO2023043220 A1 WO 2023043220A1 KR 2022013783 W KR2022013783 W KR 2022013783W WO 2023043220 A1 WO2023043220 A1 WO 2023043220A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
moe
modified
cancer
antisense compound
Prior art date
Application number
PCT/KR2022/013783
Other languages
English (en)
French (fr)
Inventor
김연준
김지은
Original Assignee
주식회사 큐마인
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 큐마인 filed Critical 주식회사 큐마인
Priority to CN202280062781.XA priority Critical patent/CN117940567A/zh
Priority claimed from KR1020220116229A external-priority patent/KR102613178B1/ko
Publication of WO2023043220A1 publication Critical patent/WO2023043220A1/ko

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/312Phosphonates
    • C12N2310/3125Methylphosphonates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/314Phosphoramidates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA

Definitions

  • the present invention relates to antisense compounds that modulate the expression of WFDC2.
  • WFDC2 is a glycosylated protein first observed in human epididymal tissue, and is reported to be overexpressed in various cancers including ovarian cancer.
  • the WFDC2 gene product is a member of the family of stable 4-disulfide core proteins.
  • the human epididymal-specific cDNA encodes a protein with sequence homology to extracellular protease inhibitors
  • the overexpression of WFDC2 suggests that the protein can be used as a biomarker for cancer, in particular, ovarian cancer.
  • U.S. Patent No. 7,811,778 relates to a method for diagnosing gastrointestinal cancer, and the document discloses that the expression significantly increases during the conversion and differentiation of main cells into SPEM after oxidative atrophy, and some of the upregulated genes are WFDC2. there is.
  • Korean Patent Registration No. 10-2055305 relates to a marker for diagnosis and targeted treatment of gastroesophageal borderline cancer, and the expression level of WFDC2, one of various genes with increased expression level, measures the BCCP (Bayesian Compound Covariate Predictor) score It is disclosed that there is a possibility as a biomarker for diagnosing gastric cancer or esophageal cancer as a gene that does.
  • BCCP Bayesian Compound Covariate Predictor
  • WFDC2 is one of the various genes whose expression increases during cancer, and there are prior literature showing the possibility that it can be used as a biomarker for ovarian cancer, gastric cancer, etc., but through antisense compounds that inhibit or inhibit its expression Studies confirming the therapeutic effect of cancer are rarely conducted.
  • One aspect of the present invention binds complementary to a nucleic acid sequence in the transcript of a gene encoding WFDC2 (WAP Four-Disulfide Core Domain 2), and is a modified oligo composed of 10 to 30 consecutively linked nucleosides. It is to provide antisense compounds comprising nucleotides.
  • WFDC2 WAP Four-Disulfide Core Domain 2
  • Another aspect of the invention is to provide a conjugate wherein the antisense compound is covalently linked to one or more non-nucleotide moieties.
  • Another aspect of the present invention is to provide a pharmaceutical composition for preventing or treating cancer comprising the antisense compound or the conjugate as an active ingredient.
  • One aspect of the present invention binds complementary to a nucleic acid sequence in the transcript of a gene encoding WFDC2 (WAP Four-Disulfide Core Domain 2), and is a modified oligo composed of 10 to 30 consecutively linked nucleosides.
  • Antisense compounds comprising nucleotides are provided.
  • the nucleic acid sequence of the transcript of the gene encoding the WFDC2 may be SEQ ID NO: 1 or SEQ ID NO: 2.
  • the antisense compound may include a modified oligonucleotide composed of 16 to 20 consecutively linked nucleosides.
  • the modified oligonucleotide comprises one or more modified internucleoside linkages, one or more modified nucleosides comprising a modified sugar moiety, and one or more modified nucleobases. It may contain one or more modifications selected from modified nucleosides.
  • the modified nucleoside is 2'-O-methyl (methyl), 2'-O-methoxyethyl (methoxyethyl), 2'-amino (amino), 2'-fluoro (fluoro) , consisting of a sugar moiety substituted with 2'-arabino-fluoro, 2'-O-benzyl and 2'-O-methyl-4-pyridine. It may contain one or more modified sugar moieties selected from the group
  • the modified nucleoside is locked nucleic acid (LNA), constrained ethyl bicyclic nucleic acid (cEt), 2'-O,4'-C-ethylene - It may be one or more modified nucleosides selected from the group consisting of 2'-O,4'-C-ethylene-bridged nucleic acid (ENA) and tricyclo-DNA.
  • LNA locked nucleic acid
  • cEt constrained ethyl bicyclic nucleic acid
  • EDA 2'-O,4'-C-ethylene-bridged nucleic acid
  • tricyclo-DNA tricyclo-DNA
  • the modified nucleoside may be a modified nucleoside comprising a sugar surrogate having a 6-membered ring or an acyclic moiety.
  • the modified nucleoside is pseudouridine, 2'-thiouridine, N6'-methyladenosine, 5'-methylcytidine, 5' -Fluoro-2-deoxyuridine, N-ethylpiperidine 7'-EAA triazole modified adenine, N-ethylpiperidine 6'-triazole modified adenine (N-ethylpiperidine 6'-triazol modified adenine), 6'-phenylpyrrolocytosine (6'-phenylpyrrolocytosine), 2',4'-difluorotoluylribonucleoside (2 It may be a modified nucleoside including one or more modified nucleobase selected from the group consisting of ',4'-difluorotoluylribonuleoside) and 5'-nitroindole.
  • the modified internucleoside linkage is phosphotriester, phosphoramidate, mesyl phosphoramidate, phosphorothioate, phosphoro It may be one or more modified internucleoside linking groups selected from the group consisting of dithioate, methylphosphonate, and methoxypropyl-phosphonate.
  • the modified oligonucleotide comprises a gap segment composed of linked deoxynucleosides, a 5' wing segment composed of linked nucleosides, and a 3' wing segment composed of linked nucleosides,
  • the gap segment is located between the 5' wing segment and the 3' wing segment, and the nucleoside of each wing segment may contain a modified sugar moiety or sugar surrogate.
  • the modified oligonucleotide comprises a gap segment consisting of 8 to 10 linked deoxynucleosides
  • a 5' wing segment consisting of 3 to 5 linked nucleosides
  • each nucleoside of each wing segment is a modified sugar moir may contain tea.
  • the antisense compound has a nucleotide sequence that is at least 70% or more, at least 80% or more, at least 90% or more completely complementary to any sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and the antisense compound has a sequence Base sequence of No.
  • the antisense compound is a modified oligonucleotide that complementarily binds to SEQ ID NO: 1 or SEQ ID NO: 2, and SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 20, SEQ ID NO: 38, sequence SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 65, SEQ ID NO: 83, SEQ ID NO: 86, SEQ ID NO: 89, SEQ ID NO: 109, SEQ ID NO: 113 , SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO:
  • the antisense compound is SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 20, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 65, SEQ ID NO: 83, SEQ ID NO: 86, SEQ ID NO: 89, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 148, SEQ ID NO: 154, SEQ ID NO: 155,
  • Another aspect of the invention is to provide a conjugate wherein the antisense compound is covalently linked to one or more non-nucleotide moieties.
  • the non-nucleotide moiety may include a protein, a fatty acid chain, a sugar residue, a glycoprotein, a polymer, or a combination thereof.
  • Another aspect of the present invention is to provide a pharmaceutical composition for preventing or treating cancer comprising the antisense compound or the conjugate as an active ingredient.
  • the cancer is from the group consisting of gastric cancer, esophageal cancer, bile duct cancer, ovarian cancer, cervical cancer, head and neck cancer, brain tumor, lung cancer, liver cancer, thyroid cancer, prostate cancer, bladder cancer, kidney cancer, gallbladder cancer, colon cancer and pancreatic cancer. may be selected.
  • Antisense compounds that regulate the expression of WFDC2 according to the present invention can exhibit anticancer effects in various carcinomas.
  • Figure 1 is a graph showing the cancer growth inhibitory effect (cancer cell size) for subcutaneous administration of an antisense compound according to one embodiment in the SNU638 cell line Xenograft mouse model.
  • Figure 2 is a graph showing the cancer growth inhibitory effect (cancer cell size) of intravenous administration of an antisense compound according to one embodiment in the SNU638 cell line Xenograft mouse model.
  • Figure 3 is a graph showing the cancer growth inhibitory effect (cancer cell weight) for subcutaneous or intravenous administration of an antisense compound according to one embodiment in the SNU638 cell line Xenograft mouse model.
  • Figure 4 is a photograph showing the cancer growth inhibitory effect of subcutaneous or intravenous administration of an antisense compound according to one embodiment in the SNU638 cell line Xenograft mouse model.
  • Figure 5 is a graph showing the cancer growth inhibitory effect (cancer cell size) of intravenous administration of an antisense compound according to one embodiment in the SF268 cell line Xenograft mouse model.
  • Figure 6 is a photograph showing the cancer growth inhibitory effect of intravenous administration of an antisense compound according to one embodiment in the SF268 cell line Xenograft mouse model.
  • One aspect of the present invention binds complementary to a nucleic acid sequence in the transcript of a gene encoding WFDC2 (WAP Four-Disulfide Core Domain 2), and is a modified oligo composed of 10 to 30 consecutively linked nucleosides.
  • Antisense compounds comprising nucleotides are provided.
  • WFDC2 WAP Four-Disulfide Core Domain 2
  • the WFDC2 gene product is a family member of the WAP 4-disulfide core proteins.
  • WFDC2 is a secreted and glycosylated protein first observed in human epididymal tissue and is known to be overexpressed in some carcinomas including ovarian cancer.
  • the overexpression of WFDC2 in cancer cells suggests that this protein and its various isoforms can be biomarkers for detecting cancer or diagnosing patients with high cancer risk.
  • nucleotide refers to a unit molecule constituting a nucleic acid composed of a combination of a nucleobase, a sugar moiety, and a phosphate group, and the nucleotide is a nucleotide It can be interpreted as a concept that includes all unmodified or modified nucleobases, sugar moieties and / or phosphate groups, such as analogs, modified nucleotides, non-natural nucleotides, non-standard nucleotides, and the like.
  • nucleoside refers to a glycosylamine, which is considered a part of a nucleotide except for a phosphate group, and refers to a monomeric molecule composed of a nucleobase and a sugar moiety, wherein the nucleoside is a nucleotide As in, it can be interpreted as a concept that includes both nucleosides with or without modification of the nucleobase "G / or sugar moiety.
  • oligonucleotide refers to oligomers or polymers of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or analogs thereof, which oligonucleotides are generally Oligonucleotides composed of covalent bonds between nucleobases, sugars and nucleosides (backbones) existing in vivo, as well as nucleotide analogues, modified nucleotides, non-natural nucleotides, modifications composed of non-standard nucleotides that function similarly or substituted oligonucleotides. Such modified or substituted oligonucleotides have properties such as enhanced cellular uptake, enhanced nucleic acid target affinity, and increased stability in the presence of nucleases than oligonucleotides that are not modified or substituted.
  • antisense compound is interpreted to include an oligonucleotide capable of hybridizing with a target nucleic acid sequence by hydrogen bonding.
  • Antisense compounds include oligonucleotides, oligonucleotide analogs, oligonucleotide mimetics, antisense oligonucleotides, siRNA, single-stranded siRNA (ss siRNA), and short hairpin RNA (shRNA) that hybridize to a target nucleic acid sequence and regulate its expression.
  • RNA mimetics include single-stranded and double-stranded oligonucleotides. interpreted as
  • the antisense compound has a nucleic acid sequence comprising the reverse complement of the target portion of the target nucleic acid sequence to be targeted when written in the 5' to 3' direction.
  • the antisense compound may complementarily bind to a nucleic acid sequence in the transcript of a gene encoding WFDC2.
  • the transcript of the gene encoding the WFDC2 is a target nucleic acid of the antisense compound, and may be selected from mRNA and pre-mRNA including introns, exons, and untranslated regions.
  • the nucleotide sequence of the transcript of the gene encoding WFDC2 is SEQ ID NO: 1 or SEQ ID NO: 2, and the nucleotide sequence of SEQ ID NO: 1 is the human WFDC2 genome sequence (GenBank accession number cut from nucleotides 45469753 to 45481532) NC_000020.11's complement, pre-mRNA sequence), and SEQ ID NO: 2 is the human WFDC2 mRNA sequence (RefSeq or GenBank accession number NM_006103.4).
  • the antisense compound is at least 70% or more, at least 80% or more, at least 90% or more of any sequence of SEQ ID NO: 1 or SEQ ID NO: 2, which is a nucleic acid sequence in the transcript of the gene encoding WFDC2, or 10 to 30, preferably 12 to 25, more preferably 10 to 30, preferably 12 to 25, comprising at least 8 or more contiguous sequences that are completely complementary and completely complementary to any sequence of SEQ ID NO: 1 or SEQ ID NO: 2 It may include modified oligonucleotides composed of 14 to 23, most preferably 16 to 20 consecutively linked nucleosides.
  • the antisense compound is at least 70% or more, at least 80% or more, at least 90% or more of any sequence of SEQ ID NO: 1 or SEQ ID NO: 2, which is a nucleic acid sequence in the transcript of the gene encoding WFDC2, or It has a completely complementary base sequence and includes a part of the nucleic acid base sequence of any one of SEQ ID NOs: 7 to 386, and may include a modified oligonucleotide composed of 10 to 30 consecutively linked nucleosides.
  • the antisense compound has a nucleotide sequence that is at least 70% or more, at least 80% or more, at least 90% or more completely complementary to any sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and the antisense compound has a sequence Base sequence of No.
  • the antisense compound has a nucleotide sequence completely complementary to any of the nucleic acid sequences in the transcript of the gene encoding WFDC2, and the antisense compound is a nucleic acid of any one of SEQ ID NOs: 7 to 386 It may include a modified oligonucleotide comprising at least 8 or more contiguous nucleobases completely complementary to any sequence in the nucleotide sequence and composed of 10 to 30 consecutively linked nucleosides.
  • the antisense compound has a nucleotide sequence that is at least 70% or more, at least 80% or more, at least 90% or more completely complementary to any sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and SEQ ID NO: 7, sequence SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 20, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 65, SEQ ID NO: 83 , SEQ ID NO: 86, SEQ ID NO: 89, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 135, sequence SEQ ID NO:
  • the antisense compound may include a modified oligonucleotide consisting of any one of SEQ ID NOs: 7 to 386.
  • the antisense compound is SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 20, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 65, SEQ ID NO: 83, SEQ ID NO: 86, SEQ ID NO: 89, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 148, SEQ ID NO: 154, SEQ ID NO: 155,
  • the length of the antisense compound capable of complementarily binding to a nucleic acid sequence in the transcript of the gene encoding WFDC2 includes a modified oligonucleotide consisting of 10 to 30 consecutively linked nucleosides. can do.
  • the antisense compound consists of a modified oligonucleotide consisting of 12 to 28, 15 to 25, 18 to 24, 19 to 22 or 20 consecutively linked nucleosides in length.
  • the antisense compound has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , It may be a modified oligonucleotide composed of 28, 29, 30 consecutively linked nucleosides in length.
  • the antisense compound may be single-stranded or double-stranded.
  • the double-strand comprises a first modified oligonucleotide having a region complementary to the target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide.
  • the antisense compound selects one or more target sites in the nucleic acid sequence in the transcript of the gene encoding WFDC2, selects an oligonucleotide sufficiently complementary to the target site, and sufficiently specifically hybridizes with the target site, thereby expressing WFDC2
  • the desired effect on control can be obtained.
  • hybridization refers to hydrogen bonds between complementary nucleosides or nucleotide bases, which may be Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bonds. do.
  • adenine and thymine are complementary nucleic acid bases that pair by forming hydrogen bonds.
  • hybridizable or “complementary” or “substantially complementary” means that a nucleic acid (e.g., RNA, DNA) under appropriate in vitro and/or in vivo conditions of temperature and solution ionic strength Pairing of adenine (A) with thymidine (T) that non-covalently binds another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to a complementary nucleic acid) bases of nucleotides capable of forming, "annealing", or “hybridizing” adenine (A) and uracil (U) pairings, and guanine (G) and cytosine (C) pairings. It means to include sequence.
  • a nucleic acid e.g., RNA, DNA
  • T thymidine
  • the hybridization occurs between the antisense compound disclosed herein and the nucleic acid sequence in the transcript of the gene encoding WFDC2.
  • the most common mechanism of hybridization involves hydrogen bonding between complementary nucleic acid bases of nucleic acid molecules.
  • Hybridization can occur under a variety of conditions. Stringent conditions depend on the sequence and are determined by the nature and composition of the nucleic acid molecules to be hybridized. Methods for determining whether a sequence can specifically hybridize with a target nucleic acid are known in the art.
  • the term "complementary" refers to the property of being able to pair precisely between two nucleotides. For example, when the nucleotide sequences of two different nucleic acids or oligonucleotides of oligonucleotides are written in the 5' to 3' direction, when the nucleotide sequences of a certain portion of one nucleic acid or oligonucleotide are aligned in the opposite direction , that non-covalently binds to a portion of the other nucleic acid or oligonucleotide, i.e., adenine (A) and thymidine (T) pairing, adenine (A) and uracil (U) pairing, and guanine ( When G) and cytosine (C) form a pair, the two nucleic acids or oligonucleotides are said to be complementary.
  • oligonucleotide and “complementary” refer to a sufficient degree of complementarity or sophisticated pairing to allow stable specific binding to occur between an oligonucleotide and a DNA or RNA target. It can be interpreted as a term used to indicate. It is known in the art that the sequence of an antisense compound need not be 100% complementary to the sequence of a target nucleic acid to which it specifically hybridizes.
  • the antisense compound is capable of inhibiting the normal function of the target DNA or RNA by specifically hybridizing to the target DNA or RNA, and under conditions in which specific binding is desired, that is, under physiological conditions in the case of in vivo analysis or treatment, In the case of an in vitro assay, it is interpreted that there is a sufficient degree of complementarity to prevent non-specific binding of an antisense compound with a non-target sequence under the conditions in which the assay is performed.
  • an antisense compound can specifically hybridize with a target nucleic acid, non-complementary nucleic acid bases between the antisense compound and the target nucleic acid can be tolerated.
  • an antisense compound can hybridize with one or more nucleic acid moieties such that intervening or adjacent moieties are not involved in hybridization (eg, loop structures, mismatches or hairpin structures).
  • the antisense compound of the present invention or the modified oligonucleotide constituting the antisense compound has at least a nucleic acid sequence in the transcript of the gene encoding WFDC2 (eg, SEQ ID NO: 1 or SEQ ID NO: 2) 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% complementary.
  • the percent complementarity of an antisense compound with a target nucleic acid can be determined by conventional methods known in the art. For example, an antisense compound in which 18 out of 20 nucleic acid bases of the antisense compound are complementary to the target region can hybridize specifically and has 90% complementarity.
  • the remaining non-complementary nucleic acid bases are grouped with or located within complementary nucleic acid bases, and need not be contiguous with each other or with complementary nucleic acid bases. Accordingly, an antisense compound having a length of 18 nucleic acid bases having four non-complementary nucleic acid bases flanking both regions of two regions completely complementary to the target nucleic acid has 77.8% overall complementarity with the target nucleic acid, and thus is not within the scope of the present invention. be interpreted as including The percent complementarity of an antisense compound with a target nucleic acid region can be routinely determined using BLAST and PowerBLAST programs known in the art (Altschul et al., J. MoI.
  • the antisense compound of the present invention or the modified oligonucleotide constituting the antisense compound is 80 in the nucleic acid sequence in the transcript of the gene encoding WFDC2 (eg, SEQ ID NO: 1 or SEQ ID NO: 2) % or more complementary, preferably 90% or more, and most preferably fully complementary (100% complementary).
  • WFDC2 eg, SEQ ID NO: 1 or SEQ ID NO: 2
  • % or more complementary preferably 90% or more, and most preferably fully complementary (100% complementary.
  • “fully complementary” means that each nucleic acid base of an antisense compound can precisely base pair with the corresponding nucleic acid base of a target nucleic acid.
  • the location of the non-complementary nucleic acid base may be located at the 5' end or 3' end of the antisense compound.
  • non-complementary nucleic acid bases or nucleic acid bases may be located inside the antisense compound. Where two or more non-complementary nucleic acid bases are present, they may be contiguous (ie linked) or non-contiguous.
  • the non-complementary nucleic acid base may be located in a wing portion of a gapmer antisense oligonucleotide.
  • the antisense compound of the present invention may include those complementary to a nucleic acid sequence within the transcript of a gene encoding WFDC2.
  • portion refers to a predetermined number of nucleic acid bases contiguous (i.e., bound) within a region or portion of a target nucleic acid. The portion also refers to a certain number of adjacent nucleic acid bases of the antisense compound.
  • the antisense compound may be complementary to at least 8 nucleic acid base portions, complementary to at least 12 nucleic acid base portions, or complementary to at least 15 nucleic acid base portions of the target portion. Antisense that is complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more of the target portion, or a range of nucleic acid bases defined by two of these values. Compounds are also construed to be included in this range.
  • the antisense compound may include a modified oligonucleotide, wherein the modified oligonucleotide includes one or more modified internucleoside linkages and one or more modified sugar moieties. modified nucleosides and one or more modified nucleosides, including modified nucleobases.
  • the modified nucleoside is a sugar modified with a non-bicyclic modified sugar moiety and/or a bicyclic or tricyclic sugar moiety, and/or a sugar surrogate or sugar mimetic, etc. It can be a modified nucleoside containing moiety.
  • substituents selected from may be introduced sugar moieties, but are not limited thereto.
  • An antisense compound according to one embodiment of the present invention may optionally contain one or more modified nucleosides having a substituted or modified sugar moiety. Modification of the sugar moiety imparts nuclease stability, binding affinity or other advantageous biological properties to the antisense compound.
  • the (pento)furanosyl) sugar ring of the natural nucleoside may be selected from the addition of a substituent (particularly at the 2'position); bridging of two alternate ring atoms to form a bicyclic nucleic acid (BNA); and substitution of atoms or groups such as -S-, -N(R)- or -C(R1)(R2) on the ring oxygen at the 4'-position, but is not limited thereto. .
  • the base moiety in the nucleoside comprising the modified sugar moiety may remain to hybridize with the target nucleic acid.
  • the modified nucleoside is F at the 2'position; O-, S-, or N-alkyl; O-, S- or N-alkenyl; O-, S- or N-alkynyl; O-alkyl-O-alkyl; O-alkyl-O-alkyl-N (dialkyl); or O-alkyl-carboxylamides, wherein alkyl, alkenyl and alkynyl are optionally substituted C 1 to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl.
  • modified oligonucleotides include C 1 to C 10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 at the 2' position.
  • OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino or polyalkylamino may include one of the substituents.
  • the modification is 2'-methoxyethoxy (2'-O-CH 2 CH 2 OCH 3 , also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al. al., HeIv. Chim. Acta, 1995, 78, 486-504), i.e., an alkoxyalkoxy group, wherein the modification is 2'-dimethylaminooxyethoxy (i.e., also known as 2'-DMAOE).
  • the 2'-modification can be in the arabino (upper) position or the ribo (lower) position.
  • a preferred 2'-arabino modification is 2'-F, and other positions of the nucleoside (particularly the 3' position of the sugar of the 3' terminal nucleoside or the 5' position of the 5' terminal nucleoside) are similarly modified. It can be.
  • the moiety per bicyclic or tricyclic is, for example, locked nucleic acid (LNA), constrained ethyl bicyclic nucleic acid (cEt), 2'-O,4'- It may be selected from the group consisting of C-ethylene-bridged nucleic acid (2'-O,4'-C-ethylene-bridged nucleic acid (ENA)) and tricyclo-DNA, but is not limited thereto.
  • LNA locked nucleic acid
  • cEt constrained ethyl bicyclic nucleic acid
  • EDA C-ethylene-bridged nucleic acid
  • the modified nucleoside may include a sugar surrogate having a 6-membered ring or an acyclic moiety.
  • the sugar surrogate may be, for example, a morpholino ring, such as phodphorodiamidate morpholino oligomer (PMO), a cyclohexenyl ring, a cyclohexyl ring, and, for example, hexitol, anitol , mannitol, may be selected from the group consisting of tetrahydropyranyl ring such as fluorine hexitol, but is not limited thereto.
  • PMO phodphorodiamidate morpholino oligomer
  • a cyclohexenyl ring such as phodphorodiamidate morpholino oligomer
  • anitol anitol
  • mannitol may be selected from the group consisting of tetrahydropyranyl ring such as fluorine he
  • sugar surrogate may be, for example, an acyclic moiety such as an unlocked nucleic acid (UNA) or a peptide nucleic acid (PNA), but is not limited thereto.
  • UNA unlocked nucleic acid
  • PNA peptide nucleic acid
  • PNA Peptide nucleic acid
  • PNA Peptide nucleic acid
  • PNA is a type of nucleic acid analog in which nucleobases are linked by peptide bonds rather than phosphate bonds. Since it has a nucleobase such as cytosine, it can specifically hybridize with nucleic acids. PNA is not found in nature, is artificially synthesized through chemical methods, and can form double strands through hybridization with nucleic acids of complementary nucleotide sequences. In addition, since PNA is electrically neutral, it is not only chemically stable, but also biologically stable because it is not decomposed by nucleases or proteases.
  • N-aminoethylglycine backbone is the most widely used PNA, as is known in the art, PNA having a modified backbone may also be used (P.E. Nielsen and M. Egholm "An Introduction to PNA” in P.E. Nielsen (Ed. .) "Peptide Nucleic Acids: Protocols and Applications” 2nd Ed. Page 9 (Horizon Bioscience, 2004)).
  • Unlocked nucleic acid is a modified nucleoside that does not have a C2'-C3' bond of ribose, and is not constrained in three-dimensional configuration due to its open chain structure, and can adjust the flexibility of oligonucleotides.
  • UNA Unlocked nucleic acid
  • Tm value can be lowered by about 5 ° C to 10 ° C and the off-target can be reduced.
  • the modified nucleoside is pseudouridine, 2'-thiouridine, N6'-methyladenosine, 5'-methylcytidine, 5' -Fluoro-2-deoxyuridine, N-ethylpiperidine 7'-EAA triazole modified adenine, N-ethylpiperidine 6'-triazole modified adenine (N-ethylpiperidine 6'-triazol modified adenine), 6'-phenylpyrrolocytosine (6'-phenylpyrrolocytosine), 2',4'-difluorotoluylribonucleoside (2 It may be a modified nucleoside including one or more modified nucleobase selected from the group consisting of ',4'-difluorotoluylribonuleoside) and 5'-nitroindole.
  • Unmodified or natural nucleic acid bases refer to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • the modified nucleosides may also include nucleobase modifications or substitutions.
  • Nucleobase modifications or substitutions are structurally distinct forms, but are functionally interchangeable with naturally occurring but synthetically unmodified nucleobases.
  • Naturally occurring nucleobases and modified nucleobases can participate in hydrogen bonding.
  • Such nucleobase modifications impart nuclease stability, binding affinity or other beneficial biological properties to the antisense compounds.
  • Certain nucleobase substitutions such as, for example, 5-methylcytosine substitutions, are known to increase nucleic acid duplex stability by 0.6-1.2°C and can be particularly useful for enhancing the binding affinity of antisense compounds to target nucleic acids.
  • the modified nucleobases are 5'-hydroxymethyl cytosine, xanthine, hypoxanthine, 2'-aminoadenine, 6'-methyl and other alkyl derivatives of adenine and guanine, 2'- adenine and guanine.
  • propyl and other alkyl derivatives 2'-thiouracil, 2'-thiothymine and 2'-thiocytosine, 5'-haluracil and cytosine, 5'-propynyl (-C ⁇ C-CH 3 ) uracil and cytosine, and Other alkynyl derivatives of pyrimidine bases, 6'-azouracil, cytosine and thymine, 5'-uracil (pseudouracil), 4'-thiouracil, 8'-halo, 8'-amino, 8'-thiol, 8 '-thioalkyl, 8'-hydroxy and other 8'-substituted adenine and guanine, 5'-halo (particularly 5'-bromo), 5'-trifluoromethyl and other 5'-substituted uracil and cytosine, 7'-methylguanine and 7'-methyladenine, 2'-F-aden
  • heterocyclic base groups include heterocyclic base groups such as 7'-deaza-adenine, 7'-deazaguanosine, 2'-aminopyridine, and 2'-pyridone in which a purine or pyrimidine base is substituted with another heterocyclic ring. can do.
  • Nucleic acid bases particularly useful for enhancing the binding affinity of the antisense compounds include, for example, 5'-substituted pyrimidines, 6'-azapyrimidines and 2'-aminopropyladenine, 5'-propynyluracil and 5'- but is not limited to N-2, N-6 and O-6 substituted purines, including propynylcytosine.
  • modified nucleobases are disclosed in U.S. Patent No. 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu , B. ed., CRC Press, 1993].
  • the modified internucleoside linkage is phosphotriester, phosphoramidate, mesyl phosphoramidate, phosphorothioate ), phosphorodithioate, methylphosphonate, and methoxypropyl-phosphonate.
  • a nucleoside is a combination of a nucleobase and a sugar moiety.
  • the nucleotide further contains a phosphate group that is covalently bonded to the sugar moiety of the nucleoside.
  • the phosphate group can bind to the 2', 3' or 5' hydroxyl group of the linking sugar.
  • phosphate groups covalently bond with adjacent nucleosides to form a linear polymeric compound.
  • each end of the linear polymeric structure is also joined to form a circular structure, but an open linear structure is generally preferred.
  • phosphate groups usually form the internucleoside backbone of oligonucleotides, and the naturally occurring linkages and backbones of RNA and DNA are 3' to 5' phosphodiester linkages.
  • An antisense compound according to one embodiment may include one or more modified internucleoside linkages in addition to naturally occurring linkages between nucleosides, which include enhancement of cellular uptake, enhancement of target nucleic acid affinity, increase of stability in the presence of nucleases, etc. Because of its properties, it is often selected over antisense compounds that contain naturally occurring internucleoside linkages.
  • oligonucleotide comprising a modified backbone or non-natural internucleoside linkages.
  • oligonucleotides with modified backbones include nucleotides containing phosphorus atoms in their backbones and nucleotides not containing phosphorus atoms in their backbones.
  • modified oligonucleotides that do not contain phosphorus atoms in internucleoside backbones are interpreted as oligonucleotides in the present specification.
  • the modified linkage between nucleosides may include a linkage between nucleosides having phosphoric acid as well as a linkage between nucleosides not containing phosphoric acid.
  • Representative phosphoric acid-containing nucleoside linkages include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, 3'-alkylene phosphonates, 5'-alkyl Methyl and other alkyl phosphonates, phosphinates, including lene phosphonates and chiral phosphonates, 3'-amino phosphorami with their normal 3'-5' linkage, 2'-5' linkage analogs Phosphoamidates, including date and aminoalkylphosphoramidates, mesyl phosphoramidates, thionophosphoamidates, thionoalkylphosphonates, thionoalkylphosphotriesters
  • oligonucleotides with opposite polarity may have a single 3'-3' linkage in the 3'-most internucleotide linkage, i.e., one inverted nucleoside residue (a nucleic acid base is missing, which may be a missing base, instead having a hydroxyl group).
  • Various salts, salt mixtures and free acid forms may also be included.
  • Preferred modified oligonucleotide backbones that do not contain phosphorus include short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short-chain heteroatomic or heterocyclic nucleoside linkages. It may be a backbone formed by bonds between seeds.
  • backbones with morpholine linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbone sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • riboacetyl backbone alkene-containing backbones; sulfamate backbone; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbone; but is not limited to backbones having N, O, S and CH 2 mixed component elements.
  • the antisense compound has a hydroxyl group at the 5' end of 5'-(E)-vinylphosphonate, 5'-methylphosphonate, (S)-5'-C- It may be substituted with one selected from the group consisting of methyl with phosphate and 5'-phosphorothioate.
  • RISC RNA-induced silencing complex
  • ss siRNA single-stranded short interfering RNA
  • ds siRNA double-stranded short interfering RNA
  • the antisense compound has a chimeric form of Lx - Dy - Lz, where L may be a modified nucleoside.
  • D is DNA
  • x and z are arbitrary integers from 1 to 7, which may be identical or different
  • y is an arbitrary integer from 5 to 25.
  • x and z are any integers from 1 to 5
  • y may be any integers from 7 to 24, more preferably
  • x and z are any integers from 3 to 5
  • y may be any integer from 8 to 23.
  • At least the sugar moiety of the L region closest to the D region is modified, and the boundary between the L region and the D region may be defined.
  • each internucleoside linking group in all of the above regions may include one or more phosphodiester or modified internucleoside linking groups (eg, phosphorothioate) described above,
  • Nucleobases within the nucleoside may also include one or more natural nucleobases or modified nucleobases described above.
  • the modified oligonucleotide comprises a gap segment composed of linked deoxynucleosides, a 5' wing segment composed of linked nucleosides, and a 3' wing segment composed of linked nucleosides,
  • the gap segment is located between the 5' wing segment and the 3' wing segment, and the nucleoside of each wing segment may contain a modified sugar moiety or sugar surrogate.
  • Chimeric antisense compounds may typically contain at least one region that has been modified to confer increased nuclease resistance, increased cellular uptake, increased binding affinity for a target nucleic acid, and/or increased inhibitory activity.
  • a chimeric antisense compound may be formed as a hybrid structure of two or more oligonucleotides or modified oligonucleotides. Such compounds are also referred to in the art as hybrids or gapmers, and for the preparation of gapmer structures see U.S. Patent Nos.
  • an internal region with multiple nucleotides supporting RNaseH cleavage is located between the nucleosides of the internal region and an external region with multiple nucleosides that are chemically different.
  • the gap segment (the D region in the antisense compounds herein) supports cleavage of the target nucleic acid
  • the wing segment (the L region in the antisense compounds herein)
  • the gap segment may also include a modified oligonucleotide.
  • the modified oligonucleotide is one selected from one or more modified nucleoside comprising one or more modified internucleoside linkages, one or more modified nucleosides comprising a modified sugar moiety, and one or more modified nucleosides comprising a modified nucleobase.
  • the above modifications may be included, and each modification is as described above.
  • each different region in the gapmer may contain a uniform sugar moiety.
  • each different region is delimited by different sugar moieties, but the sugar moiety in each region can be in the form of a mixer freely selected from non-modified nucleotides and modified nucleotides.
  • this wing segment-gap segment-wing segment motif can be expressed in the form of Lx - Dy - Lz (where x represents the length of the 5 'wing segment, y is represents the length of the gap segment, and z represents the length of the 3' wing segment).
  • An antisense compound according to one embodiment may have a gapmer motif.
  • x, y, z are, for example, 5-10-5, 3-10-3, 1-12-1, 2-10-3, 3-9-4, 3 -8-3, 1-9-2, 2-13-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-16-2, 1-18 -1, 2-10-2, 1-10-1 or 2-8-2.
  • the antisense compound may have a wing segment-gap segment or gap segment-wing segment structure, that is, a “wingmer” motif when x or z is 0.
  • the wingmer structure is, for example, 10-10, 8-10, 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2- including but not limited to 10, 1-10 or 8-2.
  • the characteristics of the 3' wing segment and the 5' wing segment of the antisense compound may be independently selected. Further, in the above embodiment, the number of monomers in the 5' wing segment (x in Lx) and the number of monomers in the 3' wing segment (z in Lz) may be the same or different.
  • the modification (if any) of the 5' wing segment is the same as the modification (if any) of the 3' wing segment, or the modification (if any) may be different, and the monomeric connection of the 5' wing segment and the 3' wing
  • the monomeric linkages of the segments may be the same or different. That is, the entire region does not have to be uniformly modified, and one or more of the modifications may be introduced into one or more nucleotides within the antisense oligonucleotide.
  • One aspect of the present invention provides a conjugate in which the antisense compound is covalently linked to one or more non-nucleotide moieties, and according to one embodiment, the non-nucleotide moiety is a protein, fatty acid chain, sugar residue, glycoprotein, polymer or a combination thereof.
  • conjugation refers to an antisense compound or antisense oligonucleotide covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region). Such conjugation can improve the pharmacology of the antisense oligonucleotide by, for example, affecting its activity, cellular distribution, cellular uptake or stability.
  • the non-nucleotide moiety is capable of modifying or enhancing the pharmacokinetic properties of an antisense oligonucleotide by improving cellular distribution, bioavailability, metabolism, excretion, permeability, and/or cellular uptake of the antisense oligonucleotide.
  • the non-nucleotide moiety may target the antisense oligonucleotide to a specific organ, tissue or cell type, thereby enhancing the effectiveness of the antisense oligonucleotide in that organ, tissue or cell type.
  • the non-nucleotide moiety may reduce the activity of the antisense oligonucleotide in a non-target cell type, tissue or organ, e.g., off-target activity or activity in a non-target cell type, tissue or organ.
  • International Patent Publications WO93/07883 and WO2013/033230 disclose suitable non-nucleotide moieties.
  • the non-nucleotide moiety is an intercalator, reporter molecule, polyamine, polyamide, peptide, carbohydrate, vitamin moiety, polyethylene glycol, thioether, polyether, cholesterol, cholic acid moiety, polyether.
  • the non-nucleotide moiety may include an active drug substance such as aspirin, warfarin, ketoprofen, carprofen, diazepines, antibacterial agents, antibiotics.
  • an active drug substance such as aspirin, warfarin, ketoprofen, carprofen, diazepines, antibacterial agents, antibiotics.
  • the non-nucleotide moiety may further include an antibody.
  • the non-nucleotide moiety may be linked to the 5' end or 3' end of the antisense compound or antisense oligonucleotide.
  • the non-nucleotide moiety may include at least 1 to 3 N-acetylgalactosamine (GalNAc).
  • oligonucleotides can be prepared using formulations that minimize degradation, facilitate delivery and/or absorption, or provide other beneficial properties to the oligonucleotide in the formulation.
  • formulations that minimize degradation, facilitate delivery and/or absorption, or provide other beneficial properties to the oligonucleotide in the formulation.
  • a variety of formulations have been developed that can be delivered to a subject or cellular environment.
  • the antisense oligonucleotide for reducing the expression of WFDC2 is suitably such that, when administered to a subject in the environment encountered by target cells or systemically, a sufficient portion of the oligonucleotide enters the cell and reduces the expression of WFDC2.
  • the antisense oligonucleotide may be formulated in the form of a buffer solution, for example, a phosphate buffered saline solution, liposome, micellar structure or capsid.
  • the naked oligonucleotide or conjugate thereof can be formulated in water or an aqueous solution (eg, pH adjusted water) or basic buffered aqueous solution (eg, PBS).
  • the introduction of oligonucleotides into cells can be facilitated by using formulations of oligonucleotides with cationic lipids.
  • cationic lipids such as lipofection, cationic glycerol derivatives, and polyvalent cationic molecules (eg polylysine) may be used
  • suitable lipids include oligofectamine, lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc.), or FuGene 6 (Roche)), all of which may be used according to the manufacturer's protocol.
  • Such formulations may include lipid nanoparticles.
  • the formulation may include an excipient.
  • Excipients include liposomes, lipids, lipid complexes, microspheres, microparticles, nanospheres, or nanoparticles, or may be otherwise formulated for administration to a cell, tissue, organ, or body of a subject in need thereof ( See, eg, Remington: The Science and Practice of Pharmacy, 22nd edition, Pharmaceutical Press, 2013). Excipients impart improved stability, improved absorption, improved solubility and/or therapeutic enhancement of the active ingredient to the composition.
  • the excipient can be a buffer (eg, sodium citrate, sodium phosphate, Tris base, or sodium hydroxide) or a vehicle (eg, a buffered solution, petrolatum, dimethyl sulfoxide, or mineral oil).
  • a buffer eg, sodium citrate, sodium phosphate, Tris base, or sodium hydroxide
  • a vehicle eg, a buffered solution, petrolatum, dimethyl sulfoxide, or mineral oil.
  • oligonucleotides may be lyophilized to extend their shelf life and then brought into solution prior to use.
  • excipients in compositions comprising the oligonucleotides comprising the antisense compounds according to the present invention may be lyoprotectants (e.g. mannitol, lactose, polyethylene glycol, or polyvinyl pyrrolidone), or disintegration temperature regulators (e.g. For example, dextran, ficoll or gelatin) may be used.
  • compositions suitable for injectable use may include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor EL.TM. (BASF) or phosphate buffered saline (PBS).
  • the carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyols (eg, glycerol, propylene glycol, liquid polyethylene glycol, and the like) and suitable mixtures thereof.
  • isotonic agents such as sugars, polyalcohols (eg mannitol, sorbitol) and sodium chloride in the composition.
  • Sterile injectable solutions can be prepared by incorporating the oligonucleotide in the required amount in the selected solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • the pharmaceutical composition may contain a dose of at least about 0.1% of a therapeutic agent (eg, an antisense oligonucleotide for reducing expression of WFDC2) or more, but the percentage of active ingredient is about the weight or volume of the total composition. It is preferably from 1% to about 80%. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be taken into account in the preparation of the formulation.
  • the antisense compound or the conjugate containing the antisense compound according to the present invention is a pharmaceutical composition for preventing or treating cancer and can be used as a cancer therapeutic agent.
  • Cancer refers to a group of diseases characterized by overproliferation of cells and infiltration into surrounding tissues when the normal apoptosis balance is disrupted.
  • Treatment refers to all activities in which symptoms of cancer are improved, improved, or beneficially altered by administration of the pharmaceutical composition according to the present invention.
  • the cancer is gastric cancer, esophageal cancer, ovarian cancer, head and neck cancer, brain tumor, thyroid cancer, lung cancer, laryngeal cancer, colon/rectal cancer, liver cancer, gallbladder cancer, bile duct cancer, bladder cancer, pancreatic cancer, breast cancer, uterine cancer, cervical cancer, prostate cancer , carcinoma derived from epithelial cells such as kidney cancer and skin cancer, sarcoma derived from connective tissue cells such as bone cancer, muscle cancer, fat cancer, and fibrous cancer, hematopoiesis such as leukemia, lymphoma, and multiple myeloma It may be at least one selected from the group consisting of cell-derived blood cancer and nerve tissue-derived tumor.
  • the cancer may be a solid cancer.
  • a pharmaceutical composition according to the present invention involves administering to a subject an effective amount of the composition, ie, an amount capable of producing a desired therapeutic result.
  • a therapeutically acceptable amount is preferably an appropriate dose to treat a disease, which is dependent on the size of the subject, body surface area, age, the particular composition being administered, the active ingredient(s) in the composition, the time and route of administration, overall health, and It may depend on certain factors including other drugs being administered concurrently.
  • Administration of a composition according to the invention may be, for example, oral (e.g.
  • the antisense compound according to the present invention can be administered intravenously or subcutaneously, 0.1 mg/kg to 50 mg/kg, 0.1 mg/kg to 30 mg/kg, 0.1 mg/kg to 20 mg/kg. , 0.1 mg/kg to 5 mg/kg, or 0.5 mg/kg to 5 mg/kg.
  • the treatment subject is preferably a human or non-human primate or other mammalian subject, but may include a dog, cat, horse, cow, pig, sheep, goat, chicken, mouse, rat, guinea pig or hamster. .
  • the pharmaceutical composition may be administered together with one or more other drugs.
  • the one or more other agents may be designed to treat the same disease or condition as the subject of the present invention.
  • the one or more other agents may be designed to treat an undesirable effect of one or more pharmaceutical compositions of the present invention, or may be administered in combination with another agent that treats an undesirable effect of another therapeutic agent.
  • the pharmaceutical composition of the present invention may be administered simultaneously with one or more other agents, or administered at different times.
  • the pharmaceutical composition of the present invention and one or more other drugs may be prepared together in one formulation or separately.
  • the drugs administered together with the pharmaceutical composition of the present invention can enhance the therapeutic effect, resulting in an excellent therapeutic effect, that is, a synergistic effect.
  • the present invention can provide a pharmaceutical composition comprising an antisense compound and one or more agents acting by a non-antisense mechanism.
  • the agent may be a chemotherapeutic agent, for example, daunorvicin, daunormycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosphamide, Iforsamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mituramycin, predninsone, hydroxyprogesterone, testosterone, tamocifene, dacarbazine, procarban, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorabusil, methylcyclohexylnitrosurea, nitrogen mustard, melparan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, Cytarabine, 5-Azacytidine, Hydroxyurea, Deoxycoformycin
  • chemotherapeutic agents When used in combination with the antisense compounds of the present invention, they are used individually (eg, 5-FU and oligonucleotides), sequentially (eg, using 5-FU and oligonucleotides for a period of time, followed by MTX and oligonucleotides). nucleotides), or in combination with one or more other chemotherapeutic agents (eg, 5-FU, MTX and oligonucleotides, or 5-FU, radiotherapy and oligonucleotides).
  • chemotherapeutic agents eg, 5-FU, MTX and oligonucleotides, or 5-FU, radiotherapy and oligonucleotides.
  • Anti-inflammatory agents including but not limited to non-steroidal anti-inflammatory drugs and corticosteroids
  • anti-viral agents including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir
  • ribivirin, vidarabine, acyclovir and ganciclovir may also be incorporated into the compositions of the present invention.
  • Human-derived gastric cancer cell line SNU638 and glioblastoma cell line SF268 were mixed with 10% (v/v) FBS (#SH30084.03HI, Hyclone) and 1% (v/v) antibiotic (Penicillin-Streptomycin, #LS202-02, Welgene) solution.
  • RPM1-1640 #Sh30027.01, Hyclone containing this was used as a medium and cultured in a carbon dioxide concentration of 5% (v / v) in an incubator at 37 ° C.
  • the PANC-1 cell line derived from pancreatic cancer epithelial tissue was cultured in Dulbecco's modified Eagle's Medium (DMEM) medium containing 10% FBS and 1% antibiotic (Penicillin-Streptomycin, #LS202-02, Welgene) at 37°C at 5% CO2 concentration. v/v) conditions. Subculture was performed every 4 days, and only cells that had been subcultured within 5 to 10 times were used for transformation experiments.
  • DMEM Dulbecco's modified Eagle's Medium
  • ASOs antisense oligonucleotides
  • the antisense oligonucleotides (ASOs) used in this example were designed to target various regions in the pre-mRNA (SEQ ID NO: 1) or mRNA (SEQ ID NO: 2) of WFDC2, and were custom-made or automated in Integrated DNA technology.
  • Standardized phosphoramidite chemistry as shown in Table 1 below to a universal linker coupled to a Controlled-pore glass (CPG) solid phase support in a DNA synthesizer (BioAutomation model MerMade 12) or an automated peptide synthesizer (Biotage model Syro 1) It was synthesized by repeatedly applying the cycle.
  • 0.1M pyridine of 3-[(Dimethylamino-methylidene)amino]-3H-1,2,4-dithiazole-3-thione (DDTT) solution or a 0.05M pyridine-acetonitrile (Acetonitrile) 1:1 solution was used.
  • a concentrated ammonia solution was added and reacted at 60° C. for 12 to 18 hours to cleavage at CPG, and at the same time, all protection groups were removed. Then, CPG is removed by filtration, ammonia is appropriately concentrated, filtered through Sephadex (Sephdex model G-25) resin, desalted, and lyophilized for immediate use, or using preparative high-performance liquid chromatography (prep-HPLC). After purification, it was precipitated from a 0.3M sodium chloride (NaCl) or sodium acetate (NaOAc) solution with 2-3 times the volume of cooled ethanol (ethanol) and used.
  • NaCl sodium chloride
  • NaOAc sodium acetate
  • the synthesized-purified oligonucleotide was analyzed with analytical high-performance liquid chromatography (Analytical HPLC) to confirm that the purity was 80% or more, and the absorbance at 260 nm wavelength was measured with a UV-VIS spectrometer to quantify it. After that, the molecular weight of the oligonucleotide was confirmed through MALDI-TOF or Q-TOF mass spectrometry and then used.
  • the cell culture medium was collected in a 1.5 ml microtube (MCT-150-C, AXYGEN), and the residue contained in the cell culture medium was settled in a centrifuge at 4°C at a speed of 1,000 rpm for 20 minutes. Only the liquid was collected in a 1.5 ml microtube and the sample was stored in a -80°C cryogenic freezer.
  • the concentration of WFDC2 was measured according to the following protocol provided by the manufacturer.
  • Human WFDC2 capture antibody (#844347, R&D system) was diluted in PBS, then dispensed into a 96 well micro-plate (#DY990, R&D system), reacted at room temperature for 30 minutes, and then stored in a refrigerator at 4°C for one day. .
  • SNU638 cells grown under the cell culture conditions described in the above example were suspended in a 1:1 solution of Matrigel (#354230, Corning)/PBS (#ML 008-01, Welgene), and 8-week-old Male NOD.SCID subjected to respiratory anesthesia.
  • 3 x 10 6 cells were injected into mice (NOD.CB17-Prkdcsscid/NCrKoat). Thereafter, for cancer cell establishment and proliferation, monitoring was performed for 3 weeks after injection. After 3 weeks of cancer cell transplantation, Compound 3 was injected twice a week for 4 weeks at concentrations of 7.5 mpk and 30 mpk through the tail vein injection route (IV group) and subcutaneous injection route (SC group) (total 8 times).
  • IV group tail vein injection route
  • SC group subcutaneous injection route
  • IV 7.5 mpk group, IV 30 mpk group, SC 7.5 mpk group, and SC 30 mpk group each had N numbers of 8, and the control group was 5.
  • the cancer cell size (mm 3 ) was measured using a vernier caliper to confirm the cancer growth inhibitory effect by ASO.
  • SF268 cells grown under the cell culture conditions described in the above example were suspended in a 1:1 solution of Matrigel (#354230, Corning)/PBS (#ML 008-01, Welgene), and 8-week-old Male NOD.SCID subjected to respiratory anesthesia.
  • 5 x 10 6 cells were injected into mice (NOD.CB17-Prkdcsscid/NCrKoat). Thereafter, for cancer cell establishment and proliferation, monitoring was performed for 3 weeks after injection.
  • 20 mpk of Compound 3 was injected 3 times a week for 4 weeks (12 times in total) through the tail vein route (group IV). The number of N in the IV 20 mpk group was 8, and the control group was 4.
  • the cancer cell size (mm 3 ) was measured using a vernier caliper to confirm the cancer growth inhibitory effect by ASO.
  • the 5' and 3' wings are 5 consecutive 2'-MOE modified nucleosides, and the gap is composed of 8 to 10 consecutive natural DNA nucleosides 5-8-5 or 5-10-5 MOE gapmer antisense oligonucleotides in which all internucleoside linkages are modified with phosphorothioate, or the 5' and 3' wings are composed of three consecutive 2'-LNAs.
  • the gap consists of 10 consecutive natural DNA nucleosides, and the internucleoside linkages are all modified with phosphorothioate, including a 3-10-3 LNA gapmer antisense oligonucleotide, 380 species were synthesized, and the base sequence and gapmer motif including the start and stop sites of pre-mRNA (SEQ ID NO: 1) or mRNA (SEQ ID NO: 2) of WFDC2 are shown in Table 3 below.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Oncology (AREA)

Abstract

본 발명은 WFDC2의 발현을 조절하는 안티센스 화합물에 관한 것이다. 본 발명에 따른 WFDC2의 발현을 조절하는 안티센스 화합물은 다양한 암종에서 항암 효과를 나타낼 수 있다.

Description

WFDC2의 발현을 조절하는 안티센스 화합물
본 발명은 WFDC2의 발현을 조절하는 안티센스 화합물에 관한 것이다.
WFDC2는 인간 부고환 조직에서 최초로 관찰된 당화된 단백질로서, 난소암을 포함한 다양한 암에서 과발현되는 것으로 보고되어 있다. WFDC2 유전자 산물은 안정한 4-디설파이드 코어 단백질의 패밀리 멤버로서, WFDC2 단백질 및 이를 암호화하는 유전자에 관한 연구로는, 인간 부고환-특이 cDNA는 세포외 단백질분해효소 저해제들과 서열 상동성을 가지는 단백질을 인코딩하고, 난소암종에서 과발현된 유전자들의 발견을 위하여 난소 cDNA 어레이의 비교 혼성화하였으며, 부고환 단백질들의 분자적 특성을 분석하였고, 인간 부고환에서 특이적으로 발현된 mRNA의 클로닝 및 분석 등이 이루어져 왔으며, 이러한 연구를 통해 WFDC2의 과발현은 상기 단백질이 암, 특히, 난소암에 대한 바이오마커로 활용될 수 있음을 제시하고 있다.
미국 등록특허 제7,811,778호는 위장관계 암을 진단하는 방법에 관한 것으로서, 상기 문헌에서는 산화성 위축 후 주세포가 SPEM으로 전환 분화되는 동안 발현이 유의하게 증가하며, 상향 조절된 유전자 중 일부가 WFDC2임을 개시하고 있다.
또한, 한국 등록특허 제10-2055305호는 위식도 경계부선암의 진단 및 표적 치료를 위한 마커에 관한 것으로서, 발현량이 증가하는 다양한 유전자 중 하나인 WFDC2의 발현량이 BCCP (Bayesian Compound Covariate Predictor) 점수를 측정하는 유전자로서 위암 또는 식도암을 진단하는 바이오마커로서 가능성이 있다는 점을 개시하고 있다.
이처럼, WFDC2가 암 발생 시 발현이 증가하는 다양한 유전자 중 하나로서, 난소암, 위암 등의 바이오마커로 활용될 수 있다는 가능성을 보여주는 선행문헌들은 존재하나, 이의 발현을 억제 또는 저해하는 안티센스 화합물을 통해 암의 치료 효과를 확인한 연구는 거의 이루어지지 않고 있는 실정이다.
본 발명의 일 양상은 WFDC2(WAP Four-Disulfide Core Domain 2)를 암호화하는 유전자의 전사체 내의 핵산 염기서열에 상보적으로 결합하며, 10개 내지 30개의 연속적으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드를 포함하는 안티센스 화합물을 제공하는 것이다.
본 발명의 다른 양상은 하나 이상의 비-뉴클레오티드 모이어티에 상기 안티센스 화합물이 공유 결합된 접합체를 제공하는 것이다.
본 발명의 또 다른 양상은 상기 안티센스 화합물 또는 상기 접합체를 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 일 양상은 WFDC2(WAP Four-Disulfide Core Domain 2)를 암호화하는 유전자의 전사체 내의 핵산 염기서열에 상보적으로 결합하며, 10개 내지 30개의 연속적으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드를 포함하는 안티센스 화합물을 제공한다.
일 구체예에 따르면, 상기 WFDC2를 암호화하는 유전자의 전사체의 핵산 염기서열은 서열번호 1 또는 서열번호 2일 수 있다.
일 구체예에 따르면, 상기 안티센스 화합물은 16개 내지 20개의 연속적으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드를 포함할 수 있다.
일 구체예에 따르면, 상기 변형된 올리고뉴클레오티드는 하나 이상의 변형된 뉴클레오시드 간 연결기, 변형된 당 모이어티(moiety)를 포함하는 하나 이상의 변형된 뉴클레오시드 및 변형된 핵염기를 포함하는 하나 이상의 변형된 뉴클레오시드로부터 선택되는 하나 이상의 변형을 포함할 수 있다.
일 구체예에 따르면, 상기 변형된 뉴클레오시드는 2'-O-메틸(methyl), 2'-O-메톡시에틸(methoxyethyl), 2'-아미노(amino), 2'-플루오로(fluoro), 2'-아라비노(arabino)-플루오로(fluoro), 2'-O-벤질(benzyl) 및 2'-O-메틸(methyl)-4-피리딘(pyridine)으로 치환된 당 모이어티로 이루어진 군으로부터 선택되는 하나 이상의 변형된 당 모이어티를 포함할 수 있다.
일 구체예에 따르면, 상기 변형된 뉴클레오시드는 잠금 핵산(locked nucleic acid, LNA), 컨스트레인 에틸 바이시클릭 핵산(constrained ethyl bicyclic nucleic acid, cEt), 2'-O,4'-C- 에틸렌-브릿지 핵산(2'-O,4'-C-ethylene-bridged nucleic acid, ENA) 및 트리시클로(tricyclo)-DNA으로 이루어진 군으로부터 선택되는 하나 이상의 변형된 뉴클레오시드일 수 있다.
일 구체예에 따르면, 상기 변형된 뉴클레오시드는 6원 고리 또는 무고리 모이어티를 갖는 당 대용물을 포함하는 변형된 뉴클레오시드일 수 있다.
일 구체예에 따르면, 상기 변형된 뉴클레오시드는 슈도유리딘(psudouridine), 2'-티오유리딘(thiouridine), N6'-메틸아데노신(methyladenosine), 5'-메틸시티딘(methylcytidine), 5'-플루오로(fluoro)-2-디옥시유리딘(deoxyuridine), N-에틸피페리딘 7'-EAA 트리아졸 변형 아데닌(N-ethylpiperidine 7'-EAA triazol modified adenine), N-에틸피페리딘 6'-트리아졸 변형 아데닌(N-ethylpiperidine 6'-triazol modified adenine), 6'-페닐피롤로시토신(6'-phenylpyrrolocytosine), 2',4'-디플루오로톨루일리보뉴클레오시드(2',4'-difluorotoluylribonuleoside) 및 5'-니트로인돌(5'-nitroindole)로 이루어진 군으로부터 선택되는 하나 이상의 변형된 핵염기(nucleobase)를 포함하는 변형된 뉴클레오시드일 수 있다.
일 구체예에 따르면, 상기 변형된 뉴클레오시드 간 연결기는 포스포트리에스테르 (phosphotriester), 포스포르아미데이트 (phosphoramidate), 메실 포스포르아미데이트(mesyl phosphoramidate), 포스포로티오에이트(phosphorothioate), 포스포로다이티오에이트(phosphorodithioate), 메틸포스포네이트(methylphosphonate) 및 메톡시프로필-포스포네이트(methoxypropyl-phosphonate) 로 이루어진 군으로부터 선택되는 하나 이상의 변형된 뉴클레오시드 간 연결기일 수 있다.
일 구체예에 따르면, 상기 변형된 올리고뉴클레오티드는 연결된 데옥시뉴클레오시드로 구성된 갭 세그먼트, 연결된 뉴클레오시드로 구성된 5'윙 세그먼트 및 연결된 뉴클레오시드로 구성된 3'윙 세그먼트를 포함하는 것으로, 상기 갭 세그먼트는 5'윙 세그먼트 및 3'윙 세그먼트 사이에 위치하고, 각각의 윙 세그먼트의 뉴클레오시드는 변형된 당 모이어티 또는 당 대용물을 포함할 수 있다.
일 구체예에 따르면, 상기 변형된 올리고뉴클레오티드는 8개 내지 10개의 연결된 데옥시뉴클레오시드로 이루어진 갭 세그먼트;
3개 내지 5개의 연결된 뉴클레오시드로 이루어진 5' 윙 세그먼트; 및
3개 내지 5개의 연결된 뉴클레오시드로 이루어진 3' 윙 세그먼트를 포함하고, 상기 갭 세그먼트는 5' 윙 세그먼트과 3' 윙 세그먼트 사이에 위치하며, 각각의 윙 세그먼트의 각각의 뉴클레오시드는 변형된 당 모이어티를 포함할 수 있다.
일 구체예에 따르면, 상기 안티센스 화합물은 서열번호 1 또는 서열번호 2의 임의의 서열에 적어도 70% 이상, 적어도 80% 이상, 적어도 90% 이상 또는 완전히 상보적인 염기서열을 가지며, 상기 안티센스 화합물은 서열번호 1의 염기서열 시작부위 25에서 중단부위 46, 시작부위 284에서 중단부위 305, 시작부위 520에서 중단부위 545, 시작부위 2222에서 중단부위 2344, 시작부위 7334에서 중단부위 9301, 시작부위 9506에서 중단부위 9551, 시작부위 9733에서 중단부위 10143, 시작부위 10271에서 중단부위 10302, 시작부위 10360에서 중단부위 10905, 시작부위 10977에서 중단부위 11292, 시작부위 11448에서 중단부위 11563 및 시작부위 11633에서 중단부위 11773으로 이루어진 군으로부터 선택되는 올리고뉴클레오티드 염기서열 중 임의의 서열과 완전히 상보적인 적어도 8개 이상의 연속적인 인접 핵염기를 포함하는 염기서열을 갖는 변형된 올리고뉴클레오티드를 포함하며, 상기 변형된 올리고뉴클레오티드는 WFDC의 mRNA 수준 및 단백질 수준으로 이루어진 어느 하나 이상을 감소시키는 것일 수 있다
일 구체예에 따르면, 상기 안티센스 화합물은 서열번호 1 또는 서열번호 2와 상보적으로 결합하는 변형된 올리고뉴클레오티드로서, 서열번호 7, 서열번호 8, 서열번호 9, 서열번호 20, 서열번호 38, 서열번호 39, 서열번호 42, 서열번호 43, 서열번호 46, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 65, 서열번호 83, 서열번호 86, 서열번호 89, 서열번호 109, 서열번호 113, 서열번호 119, 서열번호 120, 서열번호 121, 서열번호 122, 서열번호 123, 서열번호 129, 서열번호 131, 서열번호 135, 서열번호 136, 서열번호 140, 서열번호 141, 서열번호 142, 서열번호 148, 서열번호 154, 서열번호 155, 서열번호 156, 서열번호 157, 서열번호 165, 서열번호 169, 서열번호 176, 서열번호 191, 서열번호 205, 서열번호 210, 서열번호 213, 서열번호 214, 서열번호 215, 서열번호 218, 서열번호 228, 서열번호 229, 서열번호 237, 서열번호 238, 서열번호 239, 서열번호 240, 서열번호 243, 서열번호 244, 서열번호 245, 서열번호 247, 서열번호 248, 서열번호 249, 서열번호 250, 서열번호 251, 서열번호 252, 서열번호 253, 서열번호 254, 서열번호 255, 서열번호 256, 서열번호 257, 서열번호 258, 서열번호 259, 서열번호 264, 서열번호 282, 서열번호 284, 서열번호 285, 서열번호 286, 서열번호 287, 서열번호 289, 서열번호 290, 서열번호 291, 서열번호 291, 서열번호 292, 서열번호 293, 서열번호 295, 서열번호 300, 서열번호 310, 서열번호 313, 서열번호 314, 서열번호 316, 서열번호 317, 서열번호 320, 서열번호 330, 서열번호 331, 서열번호 336, 서열번호 343, 서열번호 376, 서열번호 377, 서열번호 378, 서열번호 379, 서열번호 380, 서열번호 381, 서열번호 382 및 서열번호 383로 이루어진 군으로부터 선택되는 어느 하나의 올리고뉴클레오티드 염기서열과 완전히 일치하는 적어도 8개 이상의 연속적인 인접 핵염기를 포함하는 염기서열을 갖는 변형된 올리고뉴클레오티드를 포함하며, 상기 변형된 올리고뉴클레오티드는 WFDC의 mRNA 수준 및 단백질 수준으로 이루어진 어느 하나 이상을 감소시키는 것일 수 있다.
일 구체예에 따르면, 상기 안티센스 화합물은 서열번호 7, 서열번호 8, 서열번호 9, 서열번호 20, 서열번호 38, 서열번호 39, 서열번호 42, 서열번호 43, 서열번호 46, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 65, 서열번호 83, 서열번호 86, 서열번호 89, 서열번호 109, 서열번호 113, 서열번호 119, 서열번호 120, 서열번호 121, 서열번호 122, 서열번호 123, 서열번호 129, 서열번호 131, 서열번호 135, 서열번호 136, 서열번호 140, 서열번호 141, 서열번호 142, 서열번호 148, 서열번호 154, 서열번호 155, 서열번호 156, 서열번호 157, 서열번호 165, 서열번호 169, 서열번호 176, 서열번호 191, 서열번호 205, 서열번호 210, 서열번호 213, 서열번호 214, 서열번호 215, 서열번호 218, 서열번호 228, 서열번호 229, 서열번호 237, 서열번호 238, 서열번호 239, 서열번호 240, 서열번호 243, 서열번호 244, 서열번호 245, 서열번호 247, 서열번호 248, 서열번호 249, 서열번호 250, 서열번호 251, 서열번호 252, 서열번호 253, 서열번호 254, 서열번호 255, 서열번호 256, 서열번호 257, 서열번호 258, 서열번호 259, 서열번호 264, 서열번호 282, 서열번호 284, 서열번호 285, 서열번호 286, 서열번호 287, 서열번호 289, 서열번호 290, 서열번호 291, 서열번호 291, 서열번호 292, 서열번호 293, 서열번호 295, 서열번호 300, 서열번호 310, 서열번호 313, 서열번호 314, 서열번호 316, 서열번호 317, 서열번호 320, 서열번호 330, 서열번호 331, 서열번호 336, 서열번호 343, 서열번호 376, 서열번호 377, 서열번호 378, 서열번호 379, 서열번호 380, 서열번호 381, 서열번호 382 및 서열번호 383로 이루어진 군으로부터 선택되는 어느 하나의 염기서열을 갖는 변형된 올리고뉴클레오티드일 수 있다.
본 발명의 다른 양상은 하나 이상의 비-뉴클레오티드 모이어티에 상기 안티센스 화합물이 공유 결합된 접합체를 제공하는 것이다.
일 구체예에 따르면, 상기 비-뉴클레오티드 모이어티는 단백질, 지방산 쇄, 당 잔기, 당단백질, 중합체 또는 이들의 조합을 포함하는 것일 수 있다.
본 발명의 또 다른 양상은 상기 안티센스 화합물 또는 상기 접합체를 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
일 구체예에 따르면, 상기 암은 위암, 식도암, 담관암, 난소암, 자궁경부암, 두경부암, 뇌종양, 폐암, 간암, 갑상선암, 전립선암, 방광암, 신장암, 담낭암, 대장암 및 췌장암으로 이루어진 군으로부터 선택되는 것일 수 있다.
본 발명에 따른 WFDC2의 발현을 조절하는 안티센스 화합물은 다양한 암종에서 항암 효과를 나타낼 수 있다.
도 1은 SNU638 세포주 Xenograft 마우스 모델에서 일 구체예에 따른 안티센스 화합물의 피하 투여에 대한 암 증식 억제 효과(암세포 크기)를 보여주는 그래프이다.
도 2는 SNU638 세포주 Xenograft 마우스 모델에서 일 구체예에 따른 안티센스 화합물의 정맥 투여에 대한 암 증식 억제 효과(암세포 크기)를 보여주는 그래프이다.
도 3은 SNU638 세포주 Xenograft 마우스 모델에서 일 구체예에 따른 안티센스 화합물의 피하 또는 정맥 투여에 대한 암 증식 억제 효과(암세포 중량)를 보여주는 그래프이다.
도 4는 SNU638 세포주 Xenograft 마우스 모델에서 일 구체예에 따른 안티센스 화합물의 피하 또는 정맥 투여에 대한 암 증식 억제 효과를 보여주는 사진이다.
도 5는 SF268 세포주 Xenograft 마우스 모델에서 일 구체예에 따른 안티센스 화합물의 정맥 투여에 대한 암 증식 억제 효과(암세포 크기)를 보여주는 그래프이다.
도 6은 SF268 세포주 Xenograft 마우스 모델에서 일 구체예에 따른 안티센스 화합물의 정맥 투여에 대한 암 증식 억제 효과를 보여주는 사진이다.
본 발명의 일 양상은 WFDC2(WAP Four-Disulfide Core Domain 2)를 암호화하는 유전자의 전사체 내의 핵산 염기서열에 상보적으로 결합하며, 10개 내지 30개의 연속적으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드를 포함하는 안티센스 화합물을 제공한다.
WFDC2(WAP Four-Disulfide Core Domain 2)
WFDC2 유전자 산물은 WAP 4-디설파이드 코어 단백질들의 패밀리 구성원(family member)으로서, WFDC2는 인간 부고환 조직에서 처음 관찰되었던 분비 및 당화된 단백질이며, 난소암을 포함하는 일부 암종에서 과발현되는 것으로 알려져 있다. 암세포에서 WFDC2의 과발현은 본 단백질 및 그의 다양한 이소형(isoform)들이 암을 검출하거나, 암의 발병 가능성이 높은 환자들을 진단하기 위한 바이오마커가 될 수 있음을 제시한다.
안티센스 화합물
본 명세서에서, "뉴클레오티드(nucleotide)"는 핵염기(nucleobase), 당 모이어티(sugar moiety) 및 인산 그룹(phosphate group)의 결합으로 이루어진 핵산을 구성하는 단위체 분자를 의미하는 것으로, 상기 뉴클레오티드는 뉴클레오티드 유사체, 변형된 뉴클레오티드, 비-천연 뉴클레오티드, 비-표준 뉴클레오티드 등과 같이 핵염기, 당 모이어티 및/또는 인산 그룹의 비변형 또는 변형을 모두 포함하는 개념으로 해석될 수 있다.
본 명세서에서, "뉴클레오시드(nucleoside)"는 뉴클레오티드에서 인산 그룹을 제외한 부분으로 간주되는 글리코실아민(glycosylamine)으로, 핵염기 및 당 모이어티로 구성된 단위체 분자를 의미하며, 상기 뉴클레오시드는 뉴클레오티드와 마찬가지로 핵염기 "G/또는 당 모이어티가 변형되거나, 변형되지 않은 뉴클레오시드를 모두 포함하는 개념으로 해석될 수 있다.
본 명세서에서, "올리고뉴클레오티드(oligonucleotide)"는 리보핵산(ribonucleic acid, RNA) 또는 데옥시리보핵산(deoxyribonucleic acid, DNA) 또는 이들 유사체의 저중합체나 중합체를 의미하는 것으로, 상기 올리고뉴클레오티드는 일반적으로 생체 내에 존재하는 핵염기, 당 및 뉴클레오시드(골격)간 공유 결합으로 구성되는 올리고뉴클레오티드뿐만 아니라, 이와 유사하게 작용하는 뉴클레오티드 유사체, 변형된 뉴클레오티드, 비-천연 뉴클레오티드, 비-표준 뉴클레오티드로 이루어진 변형 또는 치환된 올리고뉴클레오티드를 포함한다. 이러한 변형 또는 치환된 올리고뉴클레오티드는 뉴클레아제 존재 하에, 변형 또는 치환되지 않은 올리고뉴클레오티드보다 세포 흡수 증진, 핵산 표적 친화성 증진 및 안정성 증가 등의 특성을 갖는다.
본 명세서에서, "안티센스 화합물(antisense compound)"은 수소 결합에 의해 표적 핵산 서열과 혼성화(hybridization)할 수 있는 올리고뉴클레오티드를 포함하는 것으로 해석된다. 안티센스 화합물은 표적 핵산 서열과 혼성화하여 그의 발현을 조절하는 올리고뉴클레오티드, 올리고뉴클레오티드 유사체, 올리고뉴클레오티드 모사체, 안티센스 올리고뉴클레오티드, siRNA, 단일가닥 siRNA (ss siRNA), 작은 헤어핀 RNA (short hairpin RNA, shRNA), 마이크로 RNA 모방체, 리보자임(ribozyme), 외부 가이드 서열(external guide sequence) 올리고뉴클레오티드 및 기타 올리고뉴클레오티드를 포함하지만, 이에 제한되지 않으며, 상기 안티센스 화합물은 단일 가닥 및 이중 가닥 올리고뉴클레오티드를 포함하는 개념으로 해석된다.
일 구체예에 따르면, 상기 안티센스 화합물은 5'에서 3' 방향으로 기재되어 있는 경우, 표적화되는 표적 핵산 서열의 표적 부분의 역 상보를 포함하는 핵산 염기서열을 갖는다. 바람직하게는, 상기 안티센스 화합물은 WFDC2를 암호화하는 유전자의 전사체 내의 핵산 염기서열에 상보적으로 결합할 수 있다. 상기 WFDC2를 암호화하는 유전자의 전사체는 상기 안티센스 화합물의 표적이 되는 핵산으로서, mRNA 및 인트론, 엑손 및 비번역 영역을 포함하는 프리(pre)-mRNA로부터 선택될 수 있다.
일 구체예에 따르면, 상기 WFDC2를 암호화하는 유전자의 전사체의 염기서열은 서열번호 1 또는 서열번호 2이며, 서열번호 1의 염기서열은 인간 WFDC2 게놈 서열(뉴클레오티드 45469753 내지 45481532으로부터 절단된 GenBank 수탁번호 NC_000020.11의 상보물, pre-mRNA 서열)이고, 서열번호 2는 인간 WFDC2 mRNA 서열(RefSeq 또는 GenBank 수탁번호 NM_006103.4)이다.
일 구체예에 따르면, 상기 안티센스 화합물은 WFDC2를 암호화하는 유전자의 전사체 내의 핵산 염기서열인 서열번호 1 또는 서열번호 2의 임의의 서열에 적어도 70% 이상, 적어도 80% 이상, 적어도 90% 이상 또는 완전히 상보적이며, 서열번호 1 또는 서열번호 2의 임의의 서열에 완전히 상보적인 적어도 8개 이상의 인접한 염기서열을 포함하는, 10개 내지 30개, 바람직하게는 12 개 내지 25개, 더욱 바람직하게는 14개 내지 23개, 가장 바람직하게는 16개 내지 20개의 연속적으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드를 포함할 수 있다.
일 구체예에 따르면, 상기 안티센스 화합물은 WFDC2를 암호화하는 유전자의 전사체 내의 핵산 염기서열인 서열번호 1 또는 서열번호 2의 임의의 서열에 적어도 70% 이상, 적어도 80% 이상, 적어도 90% 이상 또는 완전히 상보적인 염기서열을 가지며, 서열번호 7 내지 386 중 어느 하나의 핵산 염기서열의 일부를 포함하는 것으로서, 10개 내지 30개의 연속적으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드를 포함할 수 있다.
일 구체예에 따르면, 상기 안티센스 화합물은 서열번호 1 또는 서열번호 2의 임의의 서열에 적어도 70% 이상, 적어도 80% 이상, 적어도 90% 이상 또는 완전히 상보적인 염기서열을 가지며, 상기 안티센스 화합물은 서열번호 1의 염기서열 시작부위 25에서 중단부위 46, 시작부위 284에서 중단부위 305, 시작부위 520에서 중단부위 545, 시작부위 2222에서 중단부위 2344, 시작부위 7334에서 중단부위 9301, 시작부위 9506에서 중단부위 9551, 시작부위 9733에서 중단부위 10143, 시작부위 10271에서 중단부위 10302, 시작부위 10360에서 중단부위 10905, 시작부위 10977에서 중단부위 11292, 시작부위 11448에서 중단부위 11563 및 시작부위 11633에서 중단부위 11773으로 이루어진 군으로부터 선택되는 올리고뉴클레오티드 염기서열 중 임의의 서열과 완전히 상보적인 적어도 8개 이상의 연속적인 인접 핵염기를 포함하는 염기서열을 갖는 변형된 올리고뉴클레오티드를 포함할 수 있다.
일 구체예에 따르면, 상기 안티센스 화합물은 WFDC2를 암호화하는 유전자의 전사체 내의 핵산 염기서열 중 임의의 서열에 완전히 상보적인 염기서열을 갖는 것으로서, 상기 안티센스 화합물은 서열번호 7 내지 386 중 어느 하나의 핵산 염기서열 내의 임의의 서열과 완전히 상보적인 적어도 8개 이상의 인접한 핵염기를 포함하며, 10개 내지 30개의 연속적으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드를 포함할 수 있다.
일 구체예에 따르면, 상기 안티센스 화합물은 서열번호 1 또는 서열번호 2의 임의의 서열에 적어도 70% 이상, 적어도 80% 이상, 적어도 90% 이상 또는 완전히 상보적인 염기서열을 가지며, 서열번호 7, 서열번호 8, 서열번호 9, 서열번호 20, 서열번호 38, 서열번호 39, 서열번호 42, 서열번호 43, 서열번호 46, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 65, 서열번호 83, 서열번호 86, 서열번호 89, 서열번호 109, 서열번호 113, 서열번호 119, 서열번호 120, 서열번호 121, 서열번호 122, 서열번호 123, 서열번호 129, 서열번호 131, 서열번호 135, 서열번호 136, 서열번호 140, 서열번호 141, 서열번호 142, 서열번호 148, 서열번호 154, 서열번호 155, 서열번호 156, 서열번호 157, 서열번호 165, 서열번호 169, 서열번호 176, 서열번호 191, 서열번호 205, 서열번호 210, 서열번호 213, 서열번호 214, 서열번호 215, 서열번호 218, 서열번호 228, 서열번호 229, 서열번호 237, 서열번호 238, 서열번호 239, 서열번호 240, 서열번호 243, 서열번호 244, 서열번호 245, 서열번호 247, 서열번호 248, 서열번호 249, 서열번호 250, 서열번호 251, 서열번호 252, 서열번호 253, 서열번호 254, 서열번호 255, 서열번호 256, 서열번호 257, 서열번호 258, 서열번호 259, 서열번호 264, 서열번호 282, 서열번호 284, 서열번호 285, 서열번호 286, 서열번호 287, 서열번호 289, 서열번호 290, 서열번호 291, 서열번호 291, 서열번호 292, 서열번호 293, 서열번호 295, 서열번호 300, 서열번호 310, 서열번호 313, 서열번호 314, 서열번호 316, 서열번호 317, 서열번호 320, 서열번호 330, 서열번호 331, 서열번호 336, 서열번호 343, 서열번호 376, 서열번호 377, 서열번호 378, 서열번호 379, 서열번호 380, 서열번호 381, 서열번호 382 및 서열번호 383로 이루어진 군으로부터 선택되는 어느 하나의 올리고뉴클레오티드 염기서열과 완전히 일치하는 적어도 8개 이상의 연속적인 인접 핵염기를 포함하는 염기서열을 갖는 변형된 올리고뉴클레오티드를 포함할 수 있다.
일 구체예에 따르면, 상기 안티센스 화합물은 서열번호 7 내지 386 중 어느 하나의 염기서열로 이루어진 변형된 올리고뉴클레오티드를 포함할 수 있다.
일 구체예에 따르면, 상기 안티센스 화합물은 서열번호 7, 서열번호 8, 서열번호 9, 서열번호 20, 서열번호 38, 서열번호 39, 서열번호 42, 서열번호 43, 서열번호 46, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 65, 서열번호 83, 서열번호 86, 서열번호 89, 서열번호 109, 서열번호 113, 서열번호 119, 서열번호 120, 서열번호 121, 서열번호 122, 서열번호 123, 서열번호 129, 서열번호 131, 서열번호 135, 서열번호 136, 서열번호 140, 서열번호 141, 서열번호 142, 서열번호 148, 서열번호 154, 서열번호 155, 서열번호 156, 서열번호 157, 서열번호 165, 서열번호 169, 서열번호 176, 서열번호 191, 서열번호 205, 서열번호 210, 서열번호 213, 서열번호 214, 서열번호 215, 서열번호 218, 서열번호 228, 서열번호 229, 서열번호 237, 서열번호 238, 서열번호 239, 서열번호 240, 서열번호 243, 서열번호 244, 서열번호 245, 서열번호 247, 서열번호 248, 서열번호 249, 서열번호 250, 서열번호 251, 서열번호 252, 서열번호 253, 서열번호 254, 서열번호 255, 서열번호 256, 서열번호 257, 서열번호 258, 서열번호 259, 서열번호 264, 서열번호 282, 서열번호 284, 서열번호 285, 서열번호 286, 서열번호 287, 서열번호 289, 서열번호 290, 서열번호 291, 서열번호 291, 서열번호 292, 서열번호 293, 서열번호 295, 서열번호 300, 서열번호 310, 서열번호 313, 서열번호 314, 서열번호 316, 서열번호 317, 서열번호 320, 서열번호 330, 서열번호 331, 서열번호 336, 서열번호 343, 서열번호 376, 서열번호 377, 서열번호 378, 서열번호 379, 서열번호 380, 서열번호 381, 서열번호 382 및 서열번호 383로 이루어진 군으로부터 선택되는 어느 하나의 염기서열을 갖는 변형된 올리고뉴클레오티드일 수 있다.
일 구체예에 따르면, WFDC2를 암호화하는 유전자의 전사체 내의 핵산 염기서열에 상보적으로 결합할 수 있는 안티센스 화합물의 길이는 10개 내지 30개의 연속으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드를 포함할 수 있다. 바람직하게는, 상기 안티센스 화합물은 12개 내지 28개, 15개 내지 25개, 18개 내지 24개, 19개 내지 22개 또는 20개 길이의 연속으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드로 구성될 수 있으며, 바람직하게는, 상기 안티센스 화합물은 그 길이가 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30개 길이의 연속으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드일 수 있다.
일 구체예에 따르면, 상기 안티센스 화합물은 단일 가닥 또는 이중 가닥일 수 있다다. 상기 안티센스 화합물이 이중 가닥인 경우, 상기 이중 가닥은 표적 핵산과 상보적인 영역을 가지는 제1의 변형된 올리고뉴클레오티드 및 상기 제1의 변형된 올리고뉴클레오티드와 상보적인 영역을 갖는 제2의 변형된 올리고뉴클레오티드를 포함할 수 있다.
혼성화(hybridization)
상기 안티센스 화합물은 WFDC2를 암호화하는 유전자의 전사체 내의 핵산 염기서열에서 하나 이상의 표적 부위를 선택하고, 상기 표적과 충분히 상보적인 올리고뉴클레오티드를 선택하여, 표적 부위와 충분히 특이적으로 혼성화됨으로서, WFDC2의 발현 조절에 대한 소기의 효과를 얻을 수 있다.
본 명세서에서, "혼성화(hybridization)"는 상보적 뉴클레오시드나 뉴클레오티드 염기 간 왓슨-크릭(Watson-Crick), 후그스틴(Hoogsteen) 또는 역 후그스틴(Hoogsteen) 수소 결합일 수 있는 수소 결합을 의미한다. 예를 들면, 아데닌과 티민은 수소 결합을 형성하여 쌍을 이루는 상보적인 핵산 염기다.
본 발명에서 “혼성화 가능한" 또는 "상보적" 또는 "실질적으로 상보적"의 의미는, 온도 및 용액 이온 세기의 적절한 인 비트로 및/또는 인 비보 조건하에 핵산(예를 들면, RNA, DNA)이 다른 핵산에 서열-특이적, 역평행(antiparallel) 방식(즉, 핵산이 상보적 핵산에 특이적으로 결합)으로 비-공유적으로 결합하는, 즉 아데닌(A)과 티미딘(T)의 페어링, 아데닌(A)과 우라실(U)의 페어링, 및 구아닌(G)과 시토신(C)의 페어링을 형성하거나, "어닐링(anneal)"하거나, 또는 "혼성화(hybridization)" 할 수 있는 뉴클레오티드의 염기서열을 포함하는 것을 의미한다.
일 구체예에 따르면, 상기 혼성화는 본 명세서에 개시된 안티센스 화합물과 WFDC2를 암호화하는 유전자의 전사체 내의 핵산 염기서열 사이에서 일어난다. 혼성화의 가장 통상적인 메카니즘은 핵산 분자의 상보적인 핵산 염기 간 수소 결합을 수반한다.
혼성화는 다양한 조건에서 발생할 수 있다. 가혹한 조건(stringent condition)은 서열에 의존하고, 혼성화되는 핵산 분자의 성질과 조성에 따라 결정된다. 서열이 표적 핵산과 특이적으로 혼성화할 수 있는지 확인하는 방법은 당업계에 공지되어 있다.
상보성(complementarity)
본 명세서에서, "상보적(complementary)"이라는 용어는 두 뉴클레오티드 간 정교하게 쌍을 이룰 수 있는 특성을 말한다. 예를 들면, 올리고뉴클레오티드의 두 가지 서로 다른 핵산 또는 올리고뉴클레오티드의 염기서열이 5'에서 3' 방향으로 기재되어 있는 경우, 하나의 핵산 또는 올리고뉴클레오티드의 일정 부분의 염기서열을 반대방향으로 정렬했을 때, 나머지 하나의 핵산 또는 올리고뉴클레오티드의 일정 부분과 비-공유적으로 결합하는, 즉, 아데닌(A)과 티미딘(T)의 페어링, 아데닌(A)과 우라실(U)의 페어링, 및 구아닌(G)과 시토신(C)의 페어링을 형성하는 경우, 두 핵산 또는 올리고뉴클레오티드는 상보적이라고 한다.
따라서, "특이적으로 혼성화할 수 있는 (specifically hybridizable)"과 "상보적(complementary)"은 올리고뉴클레오티드와 DNA 또는 RNA 표적 사이에서 안정한 특이 결합이 발생할 수 있게 하는 상보성 또는 정교한 쌍 형성의 충분한 정도를 나타내는 데 이용되는 용어로 해석될 수 있다. 당업계에서 안티센스 화합물의 서열은 특이적으로 혼성화되는 표적 핵산의 서열과 100% 상보적일 필요는 없는 것으로 알려져 있다.
상기 안티센스 화합물은 표적 DNA 또는 RNA와의 결합이 특이적으로 혼성화되어 표적 DNA 또는 RNA의 정상적인 기능을 저해할 수 있으며, 특이적 결합이 바람직한 조건에서, 즉, 인 비보 분석 또는 치료의 경우 생리적 조건 하에, 인 비트로 분석의 경우 분석 수행 조건 하에, 안티센스 화합물의 비-표적 서열과의 비특이 결합을 방지하는 데 충분한 정도의 상보성이 있는 것으로 해석된다.
즉, 상기 안티센스 화합물은 표적 핵산과 특이적으로 혼성화할 수 있으면, 안티센스 화합물과 표적 핵산 사이의 비상보적인 핵산 염기는 용인될 수 있다. 게다가, 안티센스 화합물은 개재 또는 인접 부분이 혼성화에 관여하지 않도록 하나 이상의 핵산 부분과 혼성화될 수 있다(예를 들어, 루프 구조, 미스매치 또는 헤어핀 구조).
일 구체예에 따르면, 본 발명의 안티센스 화합물 또는 상기 안티센스 화합물을 이루고 있는 변형된 올리고뉴클레오티드는 WFDC2를 암호화하는 유전자의 전사체(예를 들어, 서열번호 1 또는 서열번호 2) 내의 핵산 염기서열과 적어도 70%, 적어도 75%, 적어도 80%, 적어도 85%, 적어도 90%, 적어도 95%, 적어도 96%, 적어도 97%, 적어도 98% 또는 적어도 99% 상보적일 수 있다. 안티센스 화합물의 표적 핵산과의 상보성 퍼센트는 당업계에 알려진 통상적인 방법으로 결정될 수 있다. 예를 들면, 안티센스 화합물의 20개의 핵산 염기 중에서 18개가 표적 영역과 상보적인 안티센스 화합물은 특이적으로 혼성화할 수 있고, 90%의 상보성을 지닌다. 상기 예시에서, 남은 비상보적인 핵산 염기는 상보적 핵산 염기와 군을 이루거나 그 내부에 배치되고, 서로 또는 상보적 핵산 염기와 인접할 필요가 없다. 이에 따라, 표적 핵산과 완전히 상보적인 두 영역의 양 측면에 배치되는 네 개의 비상보적 핵산 염기를 갖는 18개의 핵산 염기 길이의 안티센스 화합물은 표적 핵산과 77.8% 전체 상보성을 가지므로, 본 발명의 범주에 포함되는 것으로 해석된다. 표적 핵산 영역과의 안티센스 화합물의 상보성 퍼센트는 당업계에 알려진 BLAST 프로그램과 PowerBLAST 프로그램을 이용하여 통상적으로 결정될 수 있다(Altschul et al., J. MoI. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). 한편, 상동성 퍼센트, 서열 동일성 또는 상보성은 스미스와 워터맨의 알고리즘(Adv. Appl. Math., 1981, 2, 482 489)을 이용한 기본 설정을 이용하는 Gap 프로그램(Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) 등에 의해 결정될 수 있다.
일 구체예에 따르면, 본 발명의 안티센스 화합물 또는 상기 안티센스 화합물을 이루고 있는 변형된 올리고뉴클레오티드는 WFDC2를 암호화하는 유전자의 전사체(예를 들어, 서열번호 1 또는 서열번호 2) 내의 핵산 염기서열에 80% 이상 상보적일 수 있으며, 바람직하게는 90% 이상, 가장 바람직하게는 완전히 상보적(100% 상보적)일 수 있다. 본 명세서, "완전히 상보적(fully complementary)"은 안티센스 화합물의 각 핵산 염기가 표적 핵산의 대응 핵산 염기와 정교한 염기 쌍을 이룰 수 있음을 의미한다.
일 구체예에 따르면, 비상보적인 핵산 염기의 위치는 상기 안티센스 화합물의 5' 말단 또는 3' 말단에 위치할 수 있다. 또는, 비상보적 핵산 염기나 핵산 염기들은 상기 안티센스 화합물의 내부에 위치할 수 있다. 2 이상의 비상보적 핵산 염기가 존재하는 경우, 이들은 인접(즉, 결합)하거나 인접하지 않을 수 있다. 일 구체예에 따르면, 상기 비상보적 핵산 염기는 갭머(gapmer) 안티센스 올리고뉴클레오티드의 윙(wing) 부분에 위치할 수 있다.
일 구체예에 따르면, 본 발명의 안티센스 화합물은 WFDC2를 암호화하는 유전자의 전사체 내의 핵산 염기서열 부분에 상보적인 것들을 포함할 수 있다. 본 명세서에서, "부분(portion)"은 표적 핵산의 영역이나 부분 내에 인접(즉, 결합)하는 소정의 핵산 염기 수를 의미한다. 상기 부분은 안티센스 화합물의 인접하는 핵산 염기의 일정 수를 의미하기도 한다. 일 구체예에 따르면, 안티센스 화합물은 표적 부분의 적어도 8개의 핵산 염기 부분과 상보적일 수 있고, 적어도 12개의 핵산 염기 부분과 상보적일 수 있으며, 적어도 15개의 핵산 염기 부분과 상보적일 수 있다. 표적 부분의 적어도 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 또는 그 이상이나 이들 값들 중에서 두 개의 값으로 정의되는 범위의 핵산 염기 부분에 상보적인 안티센스 화합물도 상기 범위에 포함되는 것으로 해석된다.
변형(modification)된 뉴클레오티드
본 발명의 일 구체예에 따르면, 상기 안티센스 화합물은 변형된 올리고뉴클레오티드를 포함할 수 있으며, 상기 변형된 올리고뉴클레오티드는 하나 이상의 변형된 뉴클레오시드 간 연결기, 변형된 당 모이어티를 포함하는 하나 이상의 변형된 뉴클레오시드 및 변형된 핵염기를 포함하는 하나 이상의 변형된 뉴클레오시드로부터 선택되는 하나 이상의 변형을 포함할 수 있다.
당 모이어티(sugar moiety)의 변형
일 구체예에 따르면, 상기 변형된 뉴클레오시드는 비-바이시클릭 변형 당 모이어티 및/또는, 바이시클릭 또는 트리시클릭 당 모이어티, 및/또는 당 대용물 또는 당 모사체 등으로 변형된 당 모이어티를 포함하는 변형된 뉴클레오시드일 수 있다.
일 구체예에 따르면, 상기 변형된 뉴클레오시드는 예를 들어, 2'-O-메틸(methyl)과 같은 2'-O-알킬(alkyl), 예를 들어, 2'-O-메톡시에틸(methoxyethyl)과 같은 2'-O-알콕시알킬(alkoxyalkyl), 2'-아미노(amino), 2'-알릴(allyl), 2'-플루오로(fluoro), 2'-아라비노(arabino)-플루오로(fluoro), 예를 들어, 2'-OCH2C(=O)-NHCH3(NMA)와 같은 2'-O-N-치환 아세트아미드, 2'-O-벤질(benzyl) 및 2'-O-메틸(methyl)-4-피리딘(pyridine), 4'-O-메틸(methyl), 5'-메틸(methyl), 5'-비닐(vinyl) 및 5'-메톡시(methoxy)로 이루어진 군으로부터 선택되는 하나 이상의 치환체가 도입된 당 모이어티일 수 있으나, 이에 한정하지는 않는다.
본 발명의 일 구체예에 따른 안티센스 화합물은 선택적으로 치환 또는 변형된 당 모이어티를 갖는 하나 이상의 변형된 뉴클레오시드를 포함할 수 있다. 당 모이어티의 변형은 상기 안티센스 화합물에 뉴클레아제 안정성, 결합 친화성이나 기타 유리한 생물학적 특성을 부여한다. 상기 천연 뉴클레오시드의 (펜토)후라노실((pento)furanosyl) 당 고리는 치환기의 부가(특히, 2' 위치); 바이시클릭 핵산(BNA)을 형성하는 두 개의 다른 자리 고리 원자의 가교; 및 4'-위치의 고리 산소에 -S-, -N(R)- 또는 -C(R1)(R2) 등의 원자나 기의 치환을 포함하는 다양한 방법으로 변형될 수 있으나, 이에 한정하지 않는다. 변형된 당 모이어티는 치환 당, 특히, 2'-F, 2'-OCH2(2'-OMe) 또는 2'-O(CH2)2-OCH3(2'-O-메톡시에틸 또는 2'-MOE) 치환기를 갖는 2'-치환 당; 및 4'-(CH2)n-O-2'(n=l 또는 n=2) 가교를 갖는 바이시클릭 변형 당(BNA)을 포함하지만, 이에 한정하지 않는다. 이러한 변형된 당의 제조 방법은 당업계에 공지되어 있다. 변형된 당 모이어티를 포함하는 뉴클레오시드에서 염기 부분은 표적 핵산과 혼성화하도록 유지될 수 있다.
일 구체예에 따르면, 상기 변형된 뉴클레오시드는 2' 위치에서 F; O-, S-, 또는 N-알킬; O-, S- 또는 N-알케닐; O-, S- 또는 N-알키닐; O-알킬-O-알킬; O-알킬-O-알킬-N(디알킬); 또는 O-알킬-카르복실아미드 중 하나를 포함한다(여기서, 알킬, 알케닐 및 알키닐은 치환되거나 치환되지 않은 C1 내지 C10 알킬 또는 C2 내지 C10 알케닐 및 알키닐이다). O[(CH2)nO]m CH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, O(CH2)n0(CH2)nN[(CH2)mCH3]2, O(CH2)nC(=O)-NHCH3 및 O(CH2)n0N[(CH2)mCH3]2가 특히 바람직하다(여기서, n과 m은 0 내지 약 10이다). 기타 바람직한 변형된 올리고뉴클레오티드는 2' 위치에 C1 내지 C10 저급 알킬, 치환 저급 알킬, 알케닐, 알키닐, 알카릴, 아랄킬, O-알카릴 또는 O-아랄킬, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, 헤테로사이클로알킬, 헤테로사이클로알카릴, 아미노알킬아미노 또는 폴리알킬아미노 치환기 중 하나를 포함할 수 있다. 바람직하게는, 상기 변형은 2'-메톡시에톡시(2'-O-(2-메톡시에틸) 또는 2'-MOE로도 알려져 있는 2'-O-CH2CH2OCH3)(Martin et al., HeIv. Chim. Acta, 1995, 78, 486-504), 즉, 알콕시알콕시기를 포함할 수 있으며, 상기 변형은 2'-다이메틸아미노옥시에톡시(즉, 2'-DMAOE로도 알려져 있는 (CH2)2ON(CH3)2 기), 및 2'-다이메틸아미노에톡시에톡시[즉, 2'-O-다이메틸아미노에톡시에틸 또는 2'-DMAEOE로도 알려져 있는 2'-O(CH2)2O(CH2)2--N(CH3)2기]를 포함할 수 있다.
또 다른 바람직한 변형은 2'-메톡시(2'-O-CH3), 2'-아미노프로폭시(2'-OCH2CH2CH2NH2), 2'-알릴(2'-CH2-CH=CH2), 2'-O-알릴(2'-O-CH2-CH=CH2) 및 2'-플루오로(2'-F)를 포함할 수 있다. 2'-변형은 아라비노(상부) 위치나 리보(하부) 위치일 수 있다. 바람직한 2'-아라비노 변형은 2'-F이며, 뉴클레오시드의 다른 위치(특히, 3' 말단 뉴클레오시드의 당의 3' 위치 또는 5' 말단 뉴클레오시드의 5' 위치)도 유사하게 변형될 수 있다.
상기 바이시클릭 또는 트리시클릭 당 모이어티는 예를 들어, 잠금 핵산(locked nucleic acid, LNA), 컨스트레인 에틸 바이시클릭 핵산(constrained ethyl bicyclic nucleic acid, cEt), 2'-O,4'-C- 에틸렌-브릿지 핵산(2'-O,4'-C-ethylene-bridged nucleic acid, ENA) 및 트리시클로(tricyclo)-DNA로 이루어진 군으로부터 선택될 수 있으나, 이에 한정하지는 않는다.
일 구체예에 따르면, 상기 변형된 뉴클레오시드는 6원 고리 또는 무고리 모이어티를 갖는 당 대용물을 포함할 수 있다. 상기 당 대용물은 예를 들어, 포스포로디아미데이트 모르포리노 올리고머(phodphorodiamidate morpholino oligomer, PMO)와 같은 모르폴리노 고리, 사이클로헥세닐 고리, 사이클로헥실 고리 및 예를 들어, 헥시톨, 아니톨, 만니톨, 플루오르 헥시톨과 같은 테트라하이드로피라닐 고리로 이루어진 군으로부터 선택될 수 있으나, 이에 한정하지는 않는다. 본 발명에 따른 안티센스 화합물로 도입되는 뉴클레오시드를 변형하는 데 이용될 수 있는 기타 다양한 이환 및 삼환 당 치환 고리계는 당업계에 공지되어 있다. 이러한 고리계는 다양한 치환과정을 통해 활성이 증진될 수 있다.
또한, 상기 당 대용물은 예를 들어, 비잠금 핵산(unlocked nucleic acid, UNA)또는 펩타이드 핵산(peptide nucleic acid, PNA)과 같은 무고리 모이어티일 수 있으나, 이에 한정하지는 않는다.
펩타이드 핵산(Peptide nucleic acid, PNA)은 핵염기가 인산 결합이 아닌 펩타이드 결합으로 연결된 핵산 유사체의 일종으로, 포스포다이에스터 결합이 펩타이드 결합(peptide bond)으로 대체되어 있으며, 아데닌, 티민, 구아닌, 시토신과 같은 핵염기를 가지고 있어, 특이적으로 핵산과 혼성화 반응을 일으킬 수 있다. PNA는 자연계에서는 발견되지 않고, 인공적으로 화학적인 방법으로 합성되며, 상보적인 염기서열의 핵산과 혼성화 반응을 통해 이중가닥을 형성할 수 있다. 또한, PNA는 전기적으로 중성이기 때문에 화학적으로 안정할 뿐만 아니라, 핵산분해효소(nuclease)나 단백질분해효소(protease)에 의해 분해되지 않아 생물학적으로도 안정하다는 특징을 가지고 있다. PNA는 N-아미노에틸글리신 골격이 가장 널리 사용되지만, 당업계에 공지된 바에 따라, 변형된 골격을 갖는 PNA도 사용될 수 있다 (P.E. Nielsen and M. Egholm "An Introduction to PNA"in P.E. Nielsen (Ed.) "Peptide Nucleic Acids: Protocols and Applications" 2nd Ed. Page 9 (Horizon Bioscience, 2004)).
비잠금 핵산(unlocked nucleic acid, UNA)은 리보스(ribose)의 C2'-C3' 결합을 갖지 않는 변형된 뉴클레오시드로서, 개방 사슬 구조로 인하여 입체적 배치가 구속되지 않고, 올리고뉴클레오티드의 유연성을 조정할 수 있다. 안티센스 올리고뉴클레오티드 내에 UNA가 포함되는 경우, Tm 값을 5℃ 내지 10℃ 정도 저하시킬 수 있으며, 오프타깃을 감소시킬 수 있는 것으로 알려져 있다.
핵염기(nucleobase)의 변형
일 구체예에 따르면, 상기 변형된 뉴클레오시드는 슈도유리딘(psudouridine), 2'-티오유리딘(thiouridine), N6'-메틸아데노신(methyladenosine), 5'-메틸시티딘(methylcytidine), 5'-플루오로(fluoro)-2-디옥시유리딘(deoxyuridine), N-에틸피페리딘 7'-EAA 트리아졸 변형 아데닌(N-ethylpiperidine 7'-EAA triazol modified adenine), N-에틸피페리딘 6'-트리아졸 변형 아데닌(N-ethylpiperidine 6'-triazol modified adenine), 6'-페닐피롤로시토신(6'-phenylpyrrolocytosine), 2',4'-디플루오로톨루일리보뉴클레오시드(2',4'-difluorotoluylribonuleoside) 및 5'-니트로인돌(5'-nitroindole)로 이루어진 군으로부터 선택되는 하나 이상의 변형된 핵염기(nucleobase)를 포함하는 변형된 뉴클레오시드일 수 있다.
변형되지 않은 또는 자연 핵산 염기는 퓨린 염기인 아데닌(A) 및 구아닌(G), 및 피리미딘 염기인 티민(T), 시토신(C) 및 우라실(U)을 의미한다.
상기 변형된 뉴클레오시드는 핵염기 변형 또는 치환도 포함할 수 있다. 핵염기 변형 또는 치환은 구조적으로 구별되는 형태이지만, 자연 발생적이나 합성 변형되지 않은 핵염기와 기능적으로 서로 교환될 수 있다. 자연 발생 핵염기와 변형된 핵염기는 수소 결합에 참여할 수 있다. 이러한 핵염기 변형은 상기 안티센스 화합물에 뉴클레아제 안정성, 결합 친화성 또는 기타 유리한 생물학적 특성을 부여한다. 예를 들어, 5-메틸시토신 치환과 같은 특정한 핵염기 치환은 0.6-1.2℃까지 핵산 듀플렉스 안정성을 높이는 것으로 알려져 있어 표적 핵산에 대한 안티센스 화합물의 결합 친화성을 증진하는 데 특히 유용할 수 있다.
예를 들어, 상기 변형된 핵염기는 5'-히드록시메틸 시토신, 크산틴, 하이포크산틴, 2'-아미노아데닌, 아데닌과 구아닌의 6'-메틸 및 기타 알킬 유도체, 아데닌과 구아닌의 2'-프로필 및 기타 알킬 유도체, 2'-티오우라실, 2'-티오티민 및 2'-티오시토신, 5'-할로우라실 및 시토신, 5'-프로피닐(-C≡C-CH3) 우라실 및 시토신 및 피리미딘 염기의 타 알키닐 유도체, 6'-아조 우라실, 시토신 및 티민, 5'-우라실(유사 우라실), 4'-티오우라실, 8'-할로, 8'-아미노, 8'-티올, 8'-티오알킬, 8'-히드록시 및 기타 8'-치환된 아데닌 및 구아닌, 5'-할로(특히, 5'-브로모), 5'-트라이플루오로메틸 및 기타 5'-치환된 우라실 및 시토신, 7'-메틸구아닌 및 7'-메틸아데닌, 2'-F-아데닌, 2'-아미노-아데닌, 8'-아자구아닌 및 8'-아자아데닌, 7'-데아자구아닌 및 7'-데아자아데닌 및 3'-데아자구아닌 및 3-데아자아데닌, 페녹사진 사이티딘(lH-피리미도[5,4-b][1,4]벤조옥사진-2(3H)-온), 페노티아진 사이티딘(IH-피리미도[5,4-b][1,4]벤조티아진-2(3H)-온) 등 삼환 피리미딘, 9-(2-아미노에톡시)-H-피리미도[5,4-b][1,4]벤조옥사진-2(3H)-온), 카바졸 사이티딘(2H-피리미도[4,5-b]인돌-2-온), 피리도인돌 사이티딘(H-피리도[3',2':4,5]피롤로[2,3-d]피리미딘-2-온)와 같은 치환 페녹사진 사이티딘 등의 G-클램프를 포함하나, 이에 한정하지는 않는다.
또한, 이종환 염기기는 퓨린이나 피리미딘 염기가 다른 이종 고리로 치환되는 7'-데아자-아데닌, 7'-데아자구아노신, 2'-아미노피리딘 및 2'-피리돈 등의 이종환 염기기도 포함할 수 있다. 상기 안티센스 화합물의 결합 친화성을 높이는 데 특히 유용한 핵산 염기는 예를 들어, 5'-치환 피리미딘, 6'-아자피리미딘 및 2'-아미노프로필아데닌, 5'-프로피닐우라실 및 5'-프로피닐시토신을 포함하여 N-2, N-6 및 O-6 치환 퓨린을 포함하나, 이에 한정하지는 않는다. 아울러, 상기 변형된 핵염기는 미국 특허 제3,687,808호, 문헌[The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613], 및 문헌[Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC Press, 1993]에 개시되어 있는 핵염기를 포함한다.
변형된 뉴클레오시드 간 연결기
일 구체예에 따르면, 상기 안티센스 화합물에서, 변형된 뉴클레오시드 간 연결기는 포스포트리에스테르 (phosphotriester), 포스포르아미데이트 (phosphoramidate), 메실 포스포르아미데이트 (mesyl phosphoramidate), 포스포로티오에이트(phosphorothioate), 포스포로다이티오에이트(phosphorodithioate), 메틸포스포네이트(methylphosphonate) 및 메톡시프로필-포스포네이트(methoxypropyl-phosphonate) 로 이루어진 군으로부터 선택되는 하나 이상의 변형된 뉴클레오시드 간 연결기일 수 있다.
당업계에 공지되어 있는 바와 같이, 뉴클레오시드는 핵염기와 당 모이어티의 조합이다. 뉴클레오티드는 뉴클레오시드의 당 모이어티와 공유 결합하는 인산기를 더 포함한다. 펜토푸라노실 당을 포함하는 뉴클레오티드에 있어서, 인산기는 결합 당의 2', 3' 또는 5' 히드록시기와 결합할 수 있다. 올리고뉴클레오티드 형성에 있어, 인산기는 서로 인접하는 뉴클레오시드와 공유 결합하여 선형 중합체 화합물을 형성한다. 차례로, 선형 중합체 구조의 각 말단도 결합하여 원형 구조를 형성하지만, 개방형 선형 구조가 일반적으로 바람직하다. 올리고뉴클레오티드 구조에서, 인산기는 통상적으로 올리고뉴클레오티드의 뉴클레오시드 간 골격을 형성하며, RNA와 DNA의 자연 발생적인 결합과 골격은 3' 내지 5' 포스포다이에스터(phosphodiester) 결합이다. 일 구체예에 따른 안티센스 화합물은 자연 발생적 뉴클레오시드 간의 결합 이외에 하나 이상의 변형된 뉴클레오시드 간 결합을 포함할 수 있는데, 이는 세포 흡수 증진, 표적 핵산 친화성 증진, 뉴클레아제 존재 하 안정성 증가 등의 특성으로 인하여 자연 발생적 뉴클레오시드 간 결합을 포함하는 안티센스 화합물보다 자주 선택된다.
본 발명에서 이용될 수 있는 바람직한 안티센스 화합물의 일 구체예로는 변형된 골격이나 비자연적 뉴클레오시드 간 결합을 포함하는 올리고뉴클레오티드이다. 상기 정의한 바와 같이, 변형된 골격을 갖는 올리고뉴클레오티드는 골격에 인 원자를 함유하는 뉴클레오티드와 골격에 인 원자를 포함하지 않는 뉴클레오티드를 포함한다. 아울러, 당업계에서 원용되는 바와 같이, 본 명세서에서는 뉴클레오시드 간 골격에 인 원자를 포함하지 않는 변형된 올리고뉴클레오티드도 올리고뉴클레오티드인 것으로 해석된다.
일 구체예에 따른 안티센스 화합물에서 뉴클레오시드 간 변형된 결합은 인산을 보유하는 뉴클레오시드 사이의 결합뿐만 아니라 인산을 포함하지 않는 뉴클레오시드 사이의 결합을 포함할 수 있다. 대표적인 인산 함유 뉴클레오시드 사이의 결합은 포스포로티오에이트, 키랄 포스포로티오에이트, 포스포로다이티오에이트, 포스포트라이에스터, 아미노알킬포스포트라이에스터, 3'-알킬렌 포스포네이트, 5'-알킬렌 포스포네이트 및 키랄 포스포네이트를 포함하는 메틸 및 기타 알킬 포스포네이트, 포스피네이트, 이들의 정상적인 3'-5' 결합, 2'-5' 결합 유사체를 갖는 3'-아미노 포스포르아미데이트 및 아미노알킬포스포르아미데이트, 메실 포스포르아미데이트, 티오노포스포아미데이트, 티오노알킬포스포네이트, 티오노알킬포스포르트라이에스터, 세레노포스페이트 및 보라노포스페이드를 포함하는 포스포아미데이트 및 하나 이상의 뉴클레오티드간 결합이 3'-3', 5'-5' 또는 2'-2' 결합인 반대의 극성을 갖는 화합물일 수 있으나, 이에 한정하지는 않는다. 또한, 반대 극성을 갖는 올리고뉴클레오티드는 3'-대부분의 뉴클레오티드간 결합에서 단일 3'-3' 결합, 즉 염기 소실 부분일 수 있는 하나의 역전된 뉴클레오시드 잔부(핵산 염기가 누락되고, 그 대신 히드록시기를 지님)를 포함한다. 다양한 염, 염 혼합물 유리산 형태도 포함될 수 있다.
인을 포함하지 않는 바람직한 변형된 올리고뉴클레오티드의 골격은 단사슬 알킬이나 사이클로알킬 뉴클레오시드 간 결합, 혼합 이종원자와 알킬 또는 사이클로알킬 뉴클레오시드 간 결합이나, 하나 이상의 단사슬 이종원자 또는 이종환 뉴클레오시드 간 결합에 의해 형성되는 골격일 수 있다. 이들은 모폴린 결합(뉴클레오시드의 당 부분으로부터 일부 형성)을 갖는 골격; 실록산 골격; 설파이드, 설폭사이드 및 설폰 골격; 포름아세틸 및 티오포름아세틸 골격; 메틸렌 포름아세틸 및 티오포름아세틸 골격; 리보아세틸 골격; 알켄 함유 골격; 설파메이트 골격; 메틸렌이미노 및 메틸렌히드라지노 골격; 설포네이트 및 설폰아미드 골격; 아미드 골격; N, O, S 및 CH2 혼합 성분 요소를 갖는 골격을 포함하나, 이에 한정하지는 않는다. 이러한 인산 함유 뉴클레오시드 간 결합과 인산 비함유 뉴클레오시드 간 결합의 제조 방법은 당업계에 공지되어 있다.
다른 구체예에서, 상기 안티센스 화합물은 5' 말단의 히드록시기를 5'-(E)-비닐포스포네이트(vinylphosphonate), 5'-메틸포스포네이트(methylphosphonate), (S)-5'-C-메틸 위드 포스페이트(methyl with phosphate) 및 5'-포스포로티오에이트(phosphorothioate)로 이루어진 군으로부터 선택되는 하나로 치환할 수 있다. 이와 같이 변형된 안티센스 화합물은 RNA-유도 침묵 복합체(RISC)에 잘 로딩되어 단일가닥 짧은 간섭 RNA(ss siRNA) 또는 이중가닥 짧은 간섭 RNA(ds siRNA)로 작동한다고 알려져 있다.
안티센스 화합물 모티프
일 구체예에 따르면, 상기 안티센스 화합물은 Lx - Dy - Lz의 형태의 키메릭(chimeric) 형태를 갖는 것으로, L은 변형된 뉴클레오시드일 수 있다. 여기서, D는 DNA이며, x 및 z는 1 내지 7의 임의의 정수로서, 동일하거나 서로 다를 수 있고, y는 5 내지 25의 임의의 정수이다. 바람직하게는, 상기 x 및 z는 1 내지 5의 임의의 정수이고, y는 7 내지 24의 임의의 정수일 수 있으며, 더욱 바람직하게는, 상기 x 및 z는 3 내지 5의 임의의 정수이고, y는 8 내지 23의 임의의 정수일 수 있다. 적어도 D 영역과 가장 인접한 L 영역의 당 모이어티는 변형된 것으로 L 영역과 D 영역의 경계가 정의될 수 있다. 또한, 상기 모든 영역(L 영역 및 D 영역)에서 각 뉴클레오시드 간 연결기는 포스포다이에스터 또는 상기 설명한 변형된 뉴클레오시드 간 연결기(예를 들어, 포스포로티오에이트)가 하나 이상 포함될 수 있으며, 상기 뉴클레오시드 내의 핵염기 또한 천연 핵염기 또는 상기 설명한 변형된 핵염기를 하나 이상 포함할 수 있다.
일 구체예에 따르면, 상기 변형된 올리고뉴클레오티드는 연결된 데옥시뉴클레오시드로 구성된 갭 세그먼트, 연결된 뉴클레오시드로 구성된 5'윙 세그먼트 및 연결된 뉴클레오시드로 구성된 3'윙 세그먼트를 포함하는 것으로, 상기 갭 세그먼트는 5'윙 세그먼트 및 3'윙 세그먼트 사이에 위치하고, 각각의 윙 세그먼트의 뉴클레오시드는 변형된 당 모이어티 또는 당 대용물을 포함할 수 있다.
키메라 안티센스 화합물은 전형적으로 뉴클레아제 내분해성 증가, 세포 흡수 증가, 표적 핵산에 대한 결합 친화성 증가 및/또는 저해 활성 증가를 부여하도록 변형된 적어도 하나의 영역을 함유할 수 있다. 키메라 안티센스 화합물은 2 이상의 올리고뉴클레오티드 또는 변형된 올리고뉴클레오티드의 혼성 구조로 형성될 수 있다. 이와 같은 화합물은 또한, 당업계에에서 하이브리드(hybrid) 또는 갭머(gapmer)로 지칭되며, 갭머 구조의 제조에 대해서는 미국 특허 제5,013,830호; 제5,149,797호; 제5,220,007호; 제5,256,775호; 제5,366,878호; 제5,403,711호; 제5,491,133호; 제5,565,350호; 제5,623,065호; 제5,652,355호; 제5,652,356호; 및 제5,700,922호에 개시되어 있다.
갭머에서, RNaseH 절단을 지원하는 다수의 뉴클레오티드를 가지는 내부 영역은 내부 영역의 뉴클레오시드와 화학적으로 상이한 다수의 뉴클레오시드를 가지는 외부 영역 사이에 위치한다. 갭머 모티프를 가지는 안티센스 올리고뉴클레오티드의 경우, 갭(gap) 세그먼트(본 명세서의 안티센스 화합물에서, D 영역)는 표적 핵산의 분할을 지원하는 반면, 윙(wing) 세그먼트(본 명세서의 안티센스 화합물에서 L 영역)는 안정성, 친화성 및 엑소뉴클레아제 내성을 향상시키기 위한 변형된 뉴클레오시드를 포함하는 변형된 올리고뉴클레오티드를 포함할 수 있다. 필요에 따라서는, 상기 갭 세그먼트 역시 변형된 올리고뉴클레오티드를 포함할 수 있다. 상기 변형된 올리고뉴클레오티드는 하나 이상의 변형된 뉴클레오시드간 연결기, 변형된 당 모이어티를 포함하는 하나 이상의 변형된 뉴클레오시드 및 변형된 핵염기를 포함하는 하나 이상의 변형된 뉴클레오시드로부터 선택되는 하나 이상의 변형을 포함할 수 있으며, 각각의 변형에 대해서는 상기 설명한 바와 같다.
바람직하게는, 갭머에서 상이한 각 영역은 균일한 당 모이어티를 포함할 수 있다. 또한, 상이한 각 영역은 서로 다른 당 모이어티로 그 경계가 구분되나, 각 영역 안의 당 모이어티는 비-변형 뉴클레오티드 및 변형 뉴클레오티드에서 자유롭게 선택되는 믹스머(mixer) 형태가 될 수 있다. 본 발명의 일 구체예에 따르면, 이러한 윙 세그먼트-갭 세그먼트-윙 세그먼트 모티프는 Lx - Dy - Lz 과 같은 형태로 표현될 수 있다(여기에서, x는 5' 윙 세그먼트의 길이를 나타내고, y는 갭 세그먼트의 길이를 나타내며, z는 3' 윙 세그먼트의 길이를 나타낸다). 일 구체예에 따른 안티센스 화합물은 갭머 모티프를 가질 수 있다. 일 구체예에 따른 안티센스 화합물에서, x, y, z는 예를 들어, 5-10-5, 3-10-3, 1-12-1, 2-10-3, 3-9-4, 3-8-3, 1-9-2, 2-13-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-16-2, 1-18-1, 2-10-2, 1-10-1 또는 2-8-2를 포함하나 이에 한정하지는 않는다. 다른 구체예에 따르면, 상기 안티센스 화합물은 윙 세그먼트-갭 세그먼트 또는 갭 세그먼트-윙 세그먼트 구조, 즉, 상기 x 또는 z가 0인 경우, "윙머"(wingmer) 모티프를 가질 수 있다. 상기 윙머 구조는 예를 들어, 10-10, 8-10, 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10 또는 8-2를 포함하나 이에 한정하지는 않는다.
일 구체예에서, 상기 안티센스 화합물의 3'윙 세그먼트의 특징 및 5'윙 세그먼트의 특징은 독립적으로 선택될 수 있다. 또한, 상기 구체예에서, 5' 윙 세그먼트의 모노머 숫자(상기 Lx에서 x) 및 3' 윙 세그먼트의 모노머(상기 Lz에서 z)의 숫자는 동일하거나 다를 수 있다. 또한, 5' 윙 세그먼트의 변형(존재한다면)은 3' 윙 세그먼트의 변형(존재한다면)과 동일하거나, 상기 변형(존재한다면)은 다를 수 있고, 5' 윙 세그먼트의 모노머릭 연결 및 3' 윙 세그먼트의 모노머릭 연결은 동일하거나 다를 수 있다. 즉, 전 영역이 균일하게 변형되어야 하는 것은 아니며, 상기 변형 중 하나 이상이 안티센스 올리고뉴클레오티드 내부의 하나 이상의 뉴클레오티드에 도입될 수 있다.
접합체
본 발명의 일 양상은 하나 이상의 비-뉴클레오티드 모이어티에 상기 안티센스 화합물이 공유 결합된 접합체를 제공하며, 일 구체예에 따르면, 상기 비-뉴클레오티드 모이어티는 단백질, 지방산 쇄, 당 잔기, 당단백질, 중합체 또는 이들의 조합을 포함할 수 있다.
본 명세서에서, "접합체(conjugate)"는 비-뉴클레오티드 모이어티 (접합체 모이어티 또는 영역 C 또는 제3 영역)에 공유 연결된 안티센스 화합물 또는 안티센스 올리고뉴클레오티드를 의미한다. 이러한 접합은 예를 들어, 안티센스 올리고뉴클레오티드의 활성, 세포 분포, 세포 흡수 또는 안정성에 영향을 미쳐 안티센스 올리고뉴클레오티드의 약리학을 개선시킬 수 있다. 일 구체예에 따르면, 상기 비-뉴클레오티드 모이어티는 안티센스 올리고뉴클레오티드의 세포 분포, 생체이용률, 대사, 배설, 투과성, 및/또는 세포 흡수를 개선시켜 안티센스 올리고뉴클레오티드의 약동학적 특성을 변형시키거나 향상시킬 수 있다. 또한, 상기 비-뉴클레오티드 모이어티는 안티센스 올리고뉴클레오티드를 특이적 기관, 조직 또는 세포 유형에 표적화하고, 그에 의해 그 기관, 조직 또는 세포 유형에서 안티센스 올리고뉴클레오티드의 유효성을 향상시킬 수 있다. 아울러, 상기 비-뉴클레오티드 모이어티는 비-표적 세포 유형, 조직 또는 기관에서의 안티센스 올리고뉴클레오티드의 활성, 예를 들어, 오프 타겟 활성 또는 비-표적 세포 유형, 조직 또는 기관에서의 활성을 감소시킬 수 있다. 국제특허공보 WO93/07883 및 WO2013/033230은 적합한 비-뉴클레오티드 모이어티를 개시한다.
일 구체예에 따르면, 상기 비-뉴클레오티드 모이어티는 인터칼레이터, 리포터 분자, 폴리아민, 폴리아미드, 펩타이드, 탄수화물, 비타민 모이어티, 폴리에틸렌 글리콜, 티오에테르, 폴리에티르, 콜레스테롤, 콜산 모이어티, 폴레이트, 지질, 인지질, 비오틴, 페나진, 페난트리딘, 안트라퀴논, 아다만탄, 아크리딘, 플루오레신, 로다민, 쿠마린, 형광단 및 염료를 포함하나, 이에 한정되지 않는다.
일 구체예에 따르면, 상기 비-뉴클레오티드 모이어티는 활성 약물 물질, 예를 들어, 아스피린, 와파린, 케토프로펜, 카르프로펜, 디아제핀, 항균제, 항생제를 포함할 수 있다.
일 구체예에 따르면, 상기 비-뉴클레오티드 모이어티는 항체 (antibody)를 더 포함할 수 있다.
일 구체예에 따르면, 상기 비-뉴클레오티드 모이어티는 상기 안티센스 화합물 또는 안티센스 올리고뉴클레오티드의 5' 말단 또는 3'말단에 연결될 수 있다.
일 구체예에 따르면, 상기 비-뉴클레오티드 모이어티는 적어도 1개 내지 3개의 N-아세틸갈락토사민(GalNAc)을 포함할 수 있다.
제형
올리고뉴클레오티드의 사용을 용이하게 하기 위해, 예를 들어, 분해를 최소화하거나, 전달 및/또는 흡수를 용이하게 하거나, 또는 제형에서 올리고뉴클레오티드에 대해 또 다른 유익한 성질을 제공하는 제형을 이용하여 올리고뉴클레오티드를 대상체 또는 세포 환경으로 전달할 수 있는 다양한 제형이 개발되었다.
일 구체예에서, WFDC2의 발현을 감소시키기 위한 안티센스 올리고뉴클레오티드는 표적 세포의 직면한 환경으로 또는 전신으로 대상에게 투여될 때, 올리고뉴클레오티드의 충분한 부분이 세포에 들어가서 WFDC2의 발현을 감소시키도록 적합하게 제형화될 수 있다. 일 구체예에 따르면, 상기 안티센스 올리고뉴클레오티드는 완충제 용액, 예를 들어, 인산염 완충 식염수 용액, 리포좀, 미셀 구조체 또는 캡시드의 형태로 제형화될 수 있다. 또한, 네이키드(naked) 올리고뉴클레오티드 또는 그의 접합체는 물 또는 수성 용액 (예를 들어, pH가 조정된 물) 또는 염기성 완충된 수성 용액 (예를 들어, PBS) 내에서 제형화될 수 있다.
일 구체예에 따르면, 양이온성 지질을 갖는 올리고뉴클레오티드의 제형을 이용하여 올리고뉴클레오티드가 세포에 도입되는 것을 용이하게 할 수 있다. 예를 들어, 양이온성 지질, 예를 들어, 리포펙션, 양이온성 글리세롤 유도체, 및 다가 양이온성 분자(예를 들어, 폴리리신)를 이용할 수 있으며, 적합한 지질에는 올리고펙타민, 리포펙타민(Life Technologies), NC388(Ribozyme Pharmaceuticals, Inc.), 또는 퓨진(FuGene) 6 (Roche))이 포함될 수 있으며, 이는 모두 제조자의 프로토콜에 따라 사용될 수 있다. 이러한 제형에는 지질 나노입자를 포함할 수 있다.
또한, 상기 제형은 부형제를 포함할 수 있다. 부형제는 리포좀, 지질, 지질 복합체, 미세구, 미세입자, 나노구, 또는 나노입자를 포함하거나, 또는 그를 필요로 하는 대상체의 세포, 조직, 기관 또는 신체에 투여하기 위해 달리 제형화될 수 있다(예를 들어, Remington: The Science and Practice of Pharmacy, 22nd edition, Pharmaceutical Press, 2013 참고). 부형제는 조성물에게 활성성분의 개선된 안정성, 개선된 흡수, 개선된 가용성 및/또는 치료적 증강을 부여한다. 또한, 부형제는 완충제(예를 들어, 시트르산나트륨, 인산나트륨, 트리스 염기, 또는 수산화나트륨) 또는 비히클(예를 들어, 완충된 용액, 바셀린, 디메틸 술폭시드, 또는 광유)일 수 있다.
일부 실시양태에서, 올리고뉴클레오티드는 그의 보관 수명을 연장시키기 위해 동결건조된 다음, 사용하기 전에 용액으로 만들어질 수 있다. 따라서, 본 발명에 따른 안티센스 화합물을 이루고 있는 올리고뉴클레오티드를 포함하는 조성물 중의 부형제는 동결건조보호제(예를 들어, 만니톨, 락토스, 폴리에틸렌 글리콜, 또는 폴리비닐 피롤리돈), 또는 붕괴 온도 조정제(예를 들어, 덱스트란, 피콜 또는 젤라틴)가 사용될 수 있다.
주사 용도에 적합한 약학적 조성물은 멸균 주사 용액 또는 분산액의 즉석 제조를 위해 멸균 수성 용액 (수용성인 경우) 또는 분산액 및 멸균 분말을 포함할 수 있다. 정맥내 또는 피하 투여의 경우, 적합한 담체에는 생리 식염수, 정균수, 크레모포어(Cremophor) EL.TM. (BASF) 또는 인산염 완충된 식염수 (PBS)가 포함될 수 있다. 또한, 담체는 예를 들어, 물, 에탄올, 폴리올(예를 들어, 글리세롤, 프로필렌 글리콜, 및 액체 폴리에틸렌 글리콜 등) 및 이들의 적합한 혼합물을 함유하는 용매 또는 분산 매질일 수 있다. 여러 경우에, 조성물 중에 등장화제, 예를 들어, 당, 폴리알콜(예를 들어, 만니톨, 소르비톨) 및 염화나트륨을 포함하는 것이 바람직하다. 멸균성 주사 용액은 선택된 용매 중에 필요한 양의 올리고뉴클레오티드를 필요에 따라 상기 열거된 성분들 중 하나 또는 그들의 조합물과 함께 도입시킨 후에, 멸균 여과시킴으로써 제조될 수 있다. 상기 약학적 조성물은 적어도 약 0.1%의 치료제(예를 들어, WFDC2의 발현을 감소시키기 위한 안티센스 올리고뉴클레오티드) 또는 그 이상의 용량을 함유할 수 있지만, 활성 성분의 백분율은 총 조성물의 중량 또는 부피의 약 1% 내지 약 80%인 것이 바람직하다. 이는 가용성, 생체이용률, 생물학적 반감기, 투여 경로, 제품 보관 수명, 뿐만 아니라 다른 약리학적 고려사항과 같은 인자가 제형의 제조에 고려될 것이다.
치료 질환 및 방법
본 발명에 따른 안티센스 화합물 또는 이를 포함하는 접합체는 암 예방 또는 치료용 약학적 조성물로서, 암 치료제로 사용될 수 있다. "암(cancer)"이란 정상적인 세포사멸 균형이 깨지는 경우 세포가 과다 증식하고, 주변 조직으로 침윤할 수 있는 특징을 갖는 질병군을 의미한다. "치료(treatment)"는 본 발명에 따른 약학적 조성물의 투여에 의해 암에 대한 증세가 호전, 개선되거나, 이롭게 변경되는 모든 행위를 의미한다.
일 구체예에 따르면, 상기 암은 위암, 식도암, 난소암, 두경부암, 뇌종양, 갑상선암, 폐암, 후두암, 대장/직장암, 간암, 담낭암, 담관암, 방광암, 췌장암, 유방암, 자궁암, 자궁경부암, 전립선암, 신장암, 피부암 등의 상피세포 등에서 유래하는 암종(carcinoma), 골암, 근육암, 지방암, 섬유세포암 등의 결합조직세포에서 유래하는 육종(sarcoma), 백혈병, 림프종, 다발성골수종 등의 조혈세포에서 유래하는 혈액암, 신경조직에 발생하는 종양으로 이루어진 군으로부터 선택된 1종 이상일 수 있다. 바람직하게는, 상기 암은 고형암일 수 있다.
본 발명에 따른 약학적 조성물은 대상에게 조성물의 유효량, 즉, 바람직한 치료 결과를 생성할 수 있는 양을 투여하는 것을 수반한다. 치료적으로 허용가능한 양은 질환을 치료할 수 있는 적절한 용량인 것이 바람직하며, 이는 대상의 크기, 신체 표면적, 연령, 투여되는 특정한 조성물, 조성물 중의 활성 성분(들), 투여 시간 및 경로, 전반적인 건강, 및 동시에 투여되는 다른 약물을 비롯하여 특정 인자에 따라 좌우될 수 있다. 본 발명에 따른 조성물의 투여는 예를 들어, 경구(예를 들어, 위 공급관, 십이지장 공급관, 위루형성술 또는 직장) 또는 비경구(예를 들어, 피하 주사, 정맥내 주사 또는 주입, 동맥내 주사 또는 주입, 근육내 주사), 국소(예를 들어, 표피, 흡입, 점안 또는 점막), 또는 표적 기관(예를 들어, 대상체의 간)으로 직접 주사에 의해 투여될 수 있다. 바람직하게는, 본 발명에 따른 안티센스 화합물은 정맥내로 또는 피하로 투여할 수 있으며, 0.1 mg/kg 내지 50 mg/kg, 0.1 mg/kg 내지 30 mg/kg, 0.1 mg/kg 내지 20 mg/kg, 0.1 mg/kg 내지 5 mg/kg 범위, 또는 0.5 mg/kg 내지 5 mg/kg 범위의 용량으로 투여될 수 있다. 일부 구체예에서, 치료 대상은 사람 또는 비-인간 영장류 또는 다른 포유류 대상체인 것이 바람직하나, 개, 고양이, 말, 소, 돼지, 양, 염소, 닭, 마우스, 래트, 기니피그 또는 햄스터가 포함될 수 있다.
병용 치료
본 발명의 일 구체예에 따르면, 상기 약학적 조성물은 하나 이상의 다른 약제와 함께 투여될 수 있다. 일 구체예에 따르면, 상기 하나 이상의 다른 약제는 본 발명의 치료 대상과 동일한 질환이나 병태를 치료하도록 설계될 수 있다. 또는, 상기 하나 이상의 다른 약제는 하나 이상의 본 발명의 약학적 조성물의 바람직하지 않은 효과를 치료하도록 설계되거나, 다른 치료제의 바람직하지 않은 효과를 치료하는 다른 약제와 함께 투여될 수 있다.
일 구체예에 따르면, 본 발명의 약학적 조성물은 하나 이상의 다른 약제와 동시에 투여되거나, 상이한 시점에 투여될 수 있다. 아울러, 본 발명의 약학적 조성물과 하나 이상의 다른 약제는 하나의 제형으로 함께 제조되거나, 별도로 제조될 수 있다.
일 구체예에 따르면, 본 발명의 약학적 조성물과 함께 투여되는 약제는 치료 효과를 증진하여, 우수한 치료 효과, 즉, 시너지 효과를 초래할 수 있다. 다시 말해, 본 발명은 안티센스 화합물 및 비-안티센스 메카니즘에 의해 작용하는 하나 이상의 약제를 포함하는 약학적 조성물을 제공할 수 있다. 상기 약제는 화학치료제일 수 있으며, 상기 화학치료제는 예를 들어, 다우노르비신, 다우노르마이신, 닥티노마이신, 독소루비신, 에피루비신, 이다루비신, 에소루비신, 블레오마이신, 마포스프아미드, 이포르스아미드, 시토신 아라비노사이드, 비스-클로로에틸니트로수레아, 부술판, 미토마이신 C, 악티노마이신 D, 미쓰라마이신, 프레드닌손, 히드록시프로게스테론, 테스토스테론, 타모시펜, 다카르바진, 프로카르바진, 헥사메틸멜라민, 펜타메틸멜라민, 미토산트론, 암사크린, 클로라부실, 메틸사이클로헥실니트로수레아, 질소 머스타드, 멜파란, 사이클로포스파미드, 6-머캅토퓨린, 6-티오구아닌, 시타라빈, 5-아자사이티딘, 히드록시우레아, 데옥시코포르마이신, 4-히드록시페록시사이클로포스포르-아미드, 5-플루오로우라실(5-FU), 5-플루오로데옥시유리딘(5-FUdR), 메토트렉사트(MTX), 콜히친, 탁솔, 빈크리스틴, 빈블라스틴, 에토포시드(VP-16), 트라이메트렉사이트, 이리노테칸, 토포테칸, 젬시타빈, 테니포사이드, 시스플라틴 또는 다이에틸스틸베스트롤(DES)일 수 있으나, 이에 한정하지는 않는다. 상기 화학치료제를 본 발명의 안티센스 화합물과 함께 이용하는 경우, 이들은 개별적으로 (예를 들어, 5-FU 및 올리고뉴클레오티드), 차례로 (예를 들어, 일정 기간 5-FU 및 올리고뉴클레오티드 이용 후, MTX 및 올리고뉴클레오티드), 또는 하나 이상의 다른 화학치료제(예를 들어, 5-FU, MTX 및 올리고뉴클레오티드, 또는 5-FU, 방사선치료 및 올리고뉴클레오티드)와 병용하여 이용될 수 있다. 항염제 (비스테로이드 항염제 및 코르티코스테로이드를 포함하나, 이에 한정하지는 않음) 항바이러스제(리비비린, 비다라빈, 아사이클로비르 및 간시클로비르를 포함하나, 이에 한정하지는 않음)도 본 발명의 조성물에 혼합될 수 있다.
이하 하나 이상의 구체예를 실시예를 통해 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실험 방법
1. 세포배양
인간 유래의 위암세포주 SNU638, 교모세포종 세포주 SF268를 10%(v/v) FBS(#SH30084.03HI, Hyclone), 1%(v/v) 항생제(Penicillin-Streptomycin, #LS202-02, Welgene) 용액이 포함된 RPM1-1640(#Sh30027.01, Hyclone)를 배지로 하여 이산화탄소 농도 5%(v/v), 37℃의 배양기 내에서 배양하였다.
췌장암 상피성 조직에서 유래한 PANC-1 세포주는 10% FBS, 1% 항생제(Penicillin-Streptomycin, #LS202-02, Welgene)을 포함하는 Dulbecco's modified Eagle's Medium (DMEM) 배지에 37℃ 이산화탄소 농도 5%(v/v) 조건으로 배양하였다. 계대배양은 4일마다 진행하였고, 형질전환 실험에 사용되는 세포는 5 내지 10 회 내의 계대배양을 거친 세포만을 사용하였다.
2. 안티센스 올리고뉴클레오티드(ASO)의 제작
본 실시예에서 사용된 안티센스 올리고뉴클레오티드(ASO)들은 WFDC2의 pre-mRNA(서열번호 1) 또는 mRNA(서열번호 2)에서의 다양한 영역을 표적화하도록 디자인하였으며, Integrated DNA technology에서 주문 제작하거나, 자동화된 DNA 합성기(BioAutomation model MerMade 12) 또는 자동화된 펩타이드 합성기(Biotage model Syro 1)에서 Controlled-pore glass (CPG) 고체상 지지체에 결합되어 있는 유니버설 링커 (universal linker)에 하기 표 1에서와 같이 표준화된 phosphoramidite chemistry cycle을 반복적으로 적용하여 합성하였다.
Cycle step Reagent/ solvent
Wash Acetonitrile (ACN)
Detritylation 3% Tichloroacetic acid in Dichloromethane
Wash ACN
Coupling 0.07M DMT-X-CE Phosphoramidite (X= dA/dG/dC/dT for DNA or 2'-O-MOE-A/G/C/T or etc) in ACN0.25M 5-(Ethylthio)-1H-tetrazole (ETT) in ACN
Wash ACN
Oxidation OXIDIZER: 0.02M Iodine/H2O/pyridine/THF
Wash ACN
Capping CAP A: 10% Acetic anhydride in THFCAP B: 10% N-Methylimidazole in Pyrinde-THF
Wash ACN
포스포로티오에이트 링커를 위해서는, 상기 표 1의 Oxidation 단계 대신, 3-[(Dimethylamino-methylidene)amino]-3H-1,2,4-dithiazole-3-thione (DDTT)의 0.1M 피리딘(pyridine) 용액 또는 0.05M 피리딘-아세토니트릴(Acetonitrile) 1:1 용액을 사용하였다.
올리고뉴클레오티드 합성이 종결되면, 농축된 암모니아 용액을 넣고 60℃에서 12 내지 18시간 반응시켜, CPG에서 절단시키고, 동시에 보호그룹 (protection group)을 모두 제거하였다. 이후, CPG를 여과해 제거하고, 암모니아를 적절히 농축시킨 후, 세파덱스(Sephdex 모델 G-25) 레진에 여과해서 탈염시키고 동결 건조하여 바로 사용하거나, 분취 고성능 액체크로마토그래피(prep-HPLC)를 이용하여 정제한 다음, 0.3M 염화나트륨(NaCl) 또는 아세트산 나트륨(NaOAc) 용액으로부터 2-3배 용량의 냉각된 에탄올(ethanol)로 침전시켜 사용하였다.
합성-정제된 올리고뉴클레오티드는 분석용 고성능 액체크로마토그래피(Analytical HPLC)로 분석하여 순도가 80% 이상임을 확인하고, 자외선-가시광선 분광기(UV-VIS spectrometer)로 260nm 파장에서의 흡광도를 측정하여 정량한 후, MALDI-TOF 또는 Q-TOF 질량분석기를 통하여 올리고뉴클레오티드의 분자량을 확인한 다음 사용하였다.
3. 정량적 실시간 PCR(qRT-PCR)을 통한 ASO를 투여한 세포의 WFDC2 mRNA 발현량 분석
형질전환 하루 전 5 내지 10회 내의 계대배양을 거친 세포를 9 cm2(6 well) 배양접시(#3006, SPL)에 0.25 x 106 cell 만큼 세포를 배양하였다. 다음날 9 cm2(6 well) 배양접시 면적의 약 80% 정도 세포가 증식한 것을 확인한 뒤, 형질전환실험을 진행하였다. 형질전환 시약으로는 lipofectamine 3000(#L3000008, Thermofisher)를 사용하였다. 배양용액을 Opti-MEM(#A3635101, Gipco)로 교체해주고, lipofectamine 3000을 이용하여 제조사에 제공하는 프로토콜에 기초하여 0 nM(control) 내지 100 nM의 ASO를 각각 24시간 동안 처리 후 세포를 분석하였다.
형질전환 후 배양접시에서 배지를 제거한 뒤 PBS(#ML 008-01, Welgene)로 두 번 세척하였다. 그 다음 TRIzol(#15596018, Ambion)를 사용하여 제조사의 프로토콜에 따라 세포로부터 total RNA를 추출하였다. 추출된 RNA를 주형으로 ImProm-IITM Reverse Transcription System(#A3800, Promega)를 이용하여 제조사의 프로토콜에 따라 cDNA를 합성하였다. 이후 합성된 cDNA와 표 2의 프라이머 및 TB Green® Fast qPCR Mix(#RR430, Takara)를 이용하여 제조사의 프로토콜에 따라 qRT-PCR를 진행하였다. 분석용 기계는 StepOneTM Real-Time PCR System (#4376357, Applied biosystems) qRT-PCR의 결과를 바탕으로 0 nM(control) 대비 ASO 처리군의 WFDC2 발현량을 퍼센트로 환산하였다.
프라이머 명칭 염기서열 서열번호
WFDC2 1-F TGCTCTCTGCCCAATGATAA 3
WFDC2 1-R TTGGGAGTGACACAGGACAC 4
GAPDH-F CTGACTTCAACAGCGACACC 5
GAPDH-R GGTGGTCCAGGGGTCTTACT 6
4. Enzyme-Linked Immunosorbent Assay (ELISA)을 통한 ASO를 투여한 세포의 WFDC2 단백질 발현량 분석
형질전환 하루 전 5 내지 10회 내의 계대배양을 거친 세포를 1.9 cm2(24 well) 배양접시(#30024, SPL)에 5.0 x 104 cell 만큼 세포를 배양하였다. 다음날 1.9 cm2(24 well) 배양접시 면적의 약 80% 정도 세포가 증식한 것을 확인한 뒤, 형질전환실험을 진행하였다. 형질전환 시약으로는 lipofectamine 3000(#L3000008, Invitrogen)를 사용하였다. 배양용액을 Opti-MEM(#A3635101, Gipco)로 교체해주고, lipofectamine 3000을 이용하여 제조사에 제공하는 프로토콜에 기초하여 0 nM(control) 내지 400 nM의 ASO를 각각 48시간 동안 처리하였다. 48시간 뒤 세포배양액을 1.5 ㎖ 마이크로튜브 (MCT-150-C, AXYGEN)에 수집하여, 4℃ 상태의 원심분리기로 20분 동안 1,000 rpm의 속도로 세포배양액 속에 포함된 잔여물을 가라앉힌 후 상층액만 1.5 ㎖ 마이크로튜브에 수집하여 -80℃ 초저온 냉동고에 샘플을 보관하였다.
WFDC2에 대한 Duoset ELISA kit (DY6274-05, R&D system, Minneapolis, MN, USA)을 사용하여, 제조사에 제공하는 다음과 같은 프로토콜에 따라 WFDC2 농도를 측정하였다. Human WFDC2 capture Antibody(#844347, R&D system)을 PBS에 희석시킨 후, 96 well micro-plate(#DY990, R&D system)에 분주하여, 상온에서 30분간 반응시킨 후, 4℃ 냉장고에 하루동안 보관하였다. 이후, 96 well micro-plate에 Reagent diluent(#DY995, R&D system)로 2배 희석된 상기 세포 배양액 100 ㎕ 또는 WFDC2 재조합 단백질 표준용액 100 ㎕를 분주하여 상온에서 2시간 동안 반응시켰다. 그리고 각각의 96 well micro-plate에 Reagent diluent에 희석된 비오틴화된 Human WFDC2 detection antibody(#844348, R&D system)를 분주하여, 상온에서 2시간 동안 반응시킨 후, Streptavidin-peroxidase 용액(Streptavidin-HRP, #893975, R&D system) 100 ㎕를 분주 후, 상온에서 20분간 반응시켰다. 이후, 긱각의 96 well micro-plate에 Tetramethylbenzidine 용액(Substrate solution, #DY999, R&D system) 100 ㎕를 분주하여 7분 간 반응시킨 후, 2N 농도의 황산 용액 50 ㎕를 분주하여 반응을 억제시키고, microplate reader를 이용하여 450 nm 파장에서 흡광도를 측정하였다. 각 시료 내의 WFDC2의 농도는 알려진 농도의 WFDC2 재조합 단백질 표준용액의 흡광도로부터 만든 표준 곡선에 측정된 각 시료의 흡광도를 대입하여 계산하였다. 음성 대조군 대비 WFDC2 생성 억제율을 다음 식과 같이 계산하였다.
Figure PCTKR2022013783-appb-img-000001
5. SNU638 Xenograft 마우스 모델을 이용한 ASO의 암 증식 억제효과 확인
상기 실시예에서 기술한 세포배양 조건에서 자란 SNU638 세포를 Matrigel(#354230, Corning)/PBS(#ML 008-01, Welgene) 1:1 용액에 부유시킨 뒤, 호흡마취시킨 8주령 Male NOD.SCID 마우스(NOD.CB17-Prkdcsscid/NCrKoat)에 3 x 106 cell 만큼 주입하였다. 이후, 암세포 정착, 증식을 위해 주입 후 3주간 모니터링하였다. 암세포 이식 3주 후 꼬리정맥주사(tail vein injection) 경로(IV 군)와 피하주사(subcutaneous injection) 경로(SC 군)를 통해 7.5 mpk, 30 mpk 농도의 화합물 3을 주 2회 4주간 주사(총 8회)하였다. IV 7.5 mpk 군, IV 30 mpk 군, SC 7.5 mpk 군, SC 30 mpk 군의 N수는 각 8마리였으며, 대조군(control)은 5마리였다. 28일 동안 버니어 켈리퍼를 사용해 암세포의 사이즈(mm3)를 측정하여 ASO에 의한 암 증식 억제효과를 확인하였다.
6. SF268 Xenograft 마우스 모델을 이용한 ASO의 암 증식 억제효과 확인
상기 실시예에서 기술한 세포배양 조건에서 자란 SF268 세포를 Matrigel(#354230, Corning)/PBS(#ML 008-01, Welgene) 1:1 용액에 부유시킨 뒤, 호흡마취시킨 8주령 Male NOD.SCID 마우스(NOD.CB17-Prkdcsscid/NCrKoat)에 5 x 106 cell 만큼 주입하였다. 이후, 암세포 정착, 증식을 위해 주입 후 3주간 모니터링하였다. 암세포 이식 3주 후 꼬리정맥주사 경로(IV 군)를 통해 20 mpk의 화합물 3을 주 3회 4주간 주사(총 12회)하였다. IV 20 mpk 군의 N수는 8마리였으며, 대조군은 4마리였다. 24일 동안 버니어 켈리퍼를 사용해 암세포의 사이즈(mm3)를 측정하여 ASO에 의한 암 증식 억제효과를 확인하였다.
7. 통계적 분석
모든 통계적 분석은 GraphPad prism 9.0.0 통해 이루어 졌고, 유의성 검증은 Two-way ANOVA Multiple Comparisons test 로 진행하였으며, 통계적 유의성을 나타내는 값은 *, **, *** 로 기재하였다. *는 P ≤ 0.05, **는 P ≤ 0.01, ***는 P ≤0.001을 나타낸다.
실험 결과
1. ASO의 제조 결과
상기 실험 방법의 안티센스 올리고뉴클레오티드 제작 방법을 통해 5' 및 3'윙은 5개의 연속적인 2'-MOE로 변형된 뉴클레오시드로, 갭은 8개 내지 10개의 연속적인 천연 DNA 뉴클레오시드로 구성되고, 뉴클레오시드 간 연결기는 모두 포스포로티오에이트로 변형된 5-8-5 또는 5-10-5 MOE 갭머 안티센스 올리고뉴클레오티드, 또는 5' 및 3'윙은 3개의 연속적인 2'-LNA로 변형된 뉴클레오시드로, 갭은 10개의 연속적인 천연 DNA 뉴클레오시드로 구성되고, 뉴클레오시드 간 연결기는 모두 포스포로티오에이트로 변형된 3-10-3 LNA 갭머 안티센스 올리고뉴클레오티드를 포함하여 총 380종을 합성하였으며, WFDC2의 pre-mRNA(서열번호 1) 또는 mRNA(서열번호 2)의 시작부위 및 중단부위를 포함한 염기서열 및 갭머 모티프를 하기 표 3에 나타내었다.
화합물
번호
서열
번호
서열
번호 1
시작
부위
서열
번호 1
중단
부위
서열
번호 2
시작
부위
서열
번호 2
중단
부위
서열 (5'->3') 갭머 모티프
1 7 25 44 25 44 GCGACAAGCAGGCATGGTGC 5-10-5 MOE
2 8 27 46 27 46 AGGCGACAAGCAGGCATGGT 5-10-5 MOE
3 9 10285 10304 348 367 CCATTGCGGCAGCATTTCAT 5-10-5 MOE
4 10 99 118 N/A N/A CCCCACTCACCTGAGACTAG 5-10-5 MOE
5 11 194 213 N/A N/A AATTCCCACTTCCCCAGCCT 5-10-5 MOE
6 12 196 215 N/A N/A GGAATTCCCACTTCCCCAGC 5-10-5 MOE
7 13 258 277 N/A N/A CCACCTCCAGCACATTGGAC 5-10-5 MOE
8 14 259 278 N/A N/A TCCACCTCCAGCACATTGGA 5-10-5 MOE
9 15 261 280 N/A N/A TCTCCACCTCCAGCACATTG 5-10-5 MOE
10 16 262 281 N/A N/A CTCTCCACCTCCAGCACATT 5-10-5 MOE
11 17 268 287 N/A N/A AGTGGTCTCTCCACCTCCAG 5-10-5 MOE
12 18 277 296 N/A N/A GCAGCCATCAGTGGTCTCTC 5-10-5 MOE
13 19 282 301 N/A N/A AAATTGCAGCCATCAGTGGT 5-10-5 MOE
14 20 284 303 N/A N/A CCAAATTGCAGCCATCAGTG 5-10-5 MOE
15 21 293 312 N/A N/A AGAATCCTCCCAAATTGCAG 5-10-5 MOE
16 22 296 315 N/A N/A CACAGAATCCTCCCAAATTG 5-10-5 MOE
17 23 307 326 N/A N/A TCCGCGTTCAGCACAGAATC 5-10-5 MOE
18 24 311 330 N/A N/A AGTGTCCGCGTTCAGCACAG 5-10-5 MOE
19 25 412 431 N/A N/A CCCTCAGATCTCAGCCCTAG 5-10-5 MOE
20 26 441 460 N/A N/A CGAGAGCTCCCTAACCCTTG 5-10-5 MOE
21 27 442 461 N/A N/A ACGAGAGCTCCCTAACCCTT 5-10-5 MOE
22 28 443 462 N/A N/A TACGAGAGCTCCCTAACCCT 5-10-5 MOE
23 29 446 465 N/A N/A GAGTACGAGAGCTCCCTAAC 5-10-5 MOE
24 30 473 492 N/A N/A TCCAGACCAGGAGTCCCTGA 5-10-5 MOE
25 31 474 493 N/A N/A TTCCAGACCAGGAGTCCCTG 5-10-5 MOE
26 32 478 497 N/A N/A CTTCTTCCAGACCAGGAGTC 5-10-5 MOE
27 33 483 502 N/A N/A GACTCCTTCTTCCAGACCAG 5-10-5 MOE
28 34 486 505 N/A N/A AGAGACTCCTTCTTCCAGAC 5-10-5 MOE
29 35 489 508 N/A N/A CCCAGAGACTCCTTCTTCCA 5-10-5 MOE
30 36 514 533 N/A N/A TGGCCCTAGGAGTCCCCTTA 5-10-5 MOE
31 37 10258 10277 321 338 ACACTGGCTGTCCACCTG 5-8-5 MOE
32 38 10271 10290 334 353 TTTCATCTGGCCAGGACACT 5-10-5 MOE
33 39 726 743 198 215 GCAGCACTTGAGGTTGTC 5-8-5 MOE
34 40 19 36 19 36 CAGGCATGGTGCTATGCC 5-8-5 MOE
35 41 304 323 N/A N/A GCGTTCAGCACAGAATCCTC 5-10-5 MOE
36 42 380 399 N/A N/A AGCTGAGCGTCTCGGAGCTT 5-10-5 MOE
37 43 480 499 N/A N/A TCCTTCTTCCAGACCAGGAG 5-10-5 MOE
38 44 484 503 N/A N/A AGACTCCTTCTTCCAGACCA 5-10-5 MOE
39 45 511 530 N/A N/A CCCTAGGAGTCCCCTTACAG 5-10-5 MOE
40 46 520 539 N/A N/A AGTCTCTGGCCCTAGGAGTC 5-10-5 MOE
41 47 522 541 N/A N/A TCAGTCTCTGGCCCTAGGAG 5-10-5 MOE
42 48 525 544 N/A N/A TTCTCAGTCTCTGGCCCTAG 5-10-5 MOE
43 49 526 545 N/A N/A ATTCTCAGTCTCTGGCCCTA 5-10-5 MOE
44 50 532 551 N/A N/A CAAGGAATTCTCAGTCTCTG 5-10-5 MOE
45 51 534 553 N/A N/A CCCAAGGAATTCTCAGTCTC 5-10-5 MOE
46 52 536 555 N/A N/A ACCCCAAGGAATTCTCAGTC 5-10-5 MOE
47 53 538 557 N/A N/A TAACCCCAAGGAATTCTCAG 5-10-5 MOE
48 54 539 558 N/A N/A TTAACCCCAAGGAATTCTCA 5-10-5 MOE
49 55 541 560 N/A N/A CCTTAACCCCAAGGAATTCT 5-10-5 MOE
50 56 542 561 N/A N/A ACCTTAACCCCAAGGAATTC 5-10-5 MOE
51 57 543 562 N/A N/A AACCTTAACCCCAAGGAATT 5-10-5 MOE
52 58 546 565 N/A N/A CCAAACCTTAACCCCAAGGA 5-10-5 MOE
53 59 548 567 N/A N/A CTCCAAACCTTAACCCCAAG 5-10-5 MOE
54 60 554 573 N/A N/A CTCCTGCTCCAAACCTTAAC 5-10-5 MOE
55 61 561 580 N/A N/A TGCCCACCTCCTGCTCCAAA 5-10-5 MOE
56 62 562 581 N/A N/A ATGCCCACCTCCTGCTCCAA 5-10-5 MOE
57 63 10283 10302 346 365 ATTGCGGCAGCATTTCATCT 5-10-5 MOE
58 64 10284 10303 347 366 CATTGCGGCAGCATTTCATC 5-10-5 MOE
59 65 10286 10305 349 368 GCCATTGCGGCAGCATTTCA 5-10-5 MOE
60 66 10287 10306 350 369 AGCCATTGCGGCAGCATTTC 5-10-5 MOE
61 67 10288 10307 351 370 CAGCCATTGCGGCAGCATTT 5-10-5 MOE
62 68 10259 10278 322 341 AGGACACTGGCTGTCCACCT 5-10-5 MOE
63 69 10295 10314 358 377 CTTCCCACAGCCATTGCGGC 5-10-5 MOE
64 70 10258 10277 321 340 GGACACTGGCTGTCCACCTG 5-10-5 MOE
65 71 10260 10279 323 342 CAGGACACTGGCTGTCCACC 5-10-5 MOE
66 72 10256 10275 319 338 ACACTGGCTGTCCACCTGGC 5-10-5 MOE
67 73 10257 10276 320 339 GACACTGGCTGTCCACCTGG 5-10-5 MOE
68 74 19 38 19 38 AGCAGGCATGGTGCTATGCC 5-10-5 MOE
69 75 17 36 17 36 CAGGCATGGTGCTATGCCCG 5-10-5 MOE
70 76 N/A N/A 97 116 TCCTGTGCCTGAGACTAGGG 5-10-5 MOE
71 77 N/A N/A 99 118 GCTCCTGTGCCTGAGACTAG 5-10-5 MOE
72 78 636 655 108 127 GTCTTCTCTGCTCCTGTGCC 5-10-5 MOE
73 79 638 657 110 129 CAGTCTTCTCTGCTCCTGTG 5-10-5 MOE
74 80 10299 10318 362 381 ACACCTTCCCACAGCCATTG 5-10-5 MOE
75 81 10300 10319 363 382 GACACCTTCCCACAGCCATT 5-10-5 MOE
76 82 11627 11646 414 433 TCACTGCTCAGCCTGGTGGT 5-10-5 MOE
77 83 11633 11652 420 439 CTCTCCTCACTGCTCAGCCT 5-10-5 MOE
78 84 11636 11655 423 442 TTTCTCTCCTCACTGCTCAG 5-10-5 MOE
79 85 11641 11660 428 447 GAAACTTTCTCTCCTCACTG 5-10-5 MOE
80 86 11645 11664 432 451 GGCAGAAACTTTCTCTCCTC 5-10-5 MOE
81 87 11652 11671 439 458 AGGGCCAGGCAGAAACTTTC 5-10-5 MOE
82 88 11656 11675 443 462 ATGCAGGGCCAGGCAGAAAC 5-10-5 MOE
83 89 11670 11689 457 476 TGGGCTGGAACCAGATGCAG 5-10-5 MOE
84 90 11704 11723 491 510 GGGAATACAGAGTCCCGAAA 5-10-5 MOE
85 91 11710 11729 497 516 CCAAGAGGGAATACAGAGTC 5-10-5 MOE
86 92 11723 11742 510 529 AGCTGTGGTCAGCCCAAGAG 5-10-5 MOE
87 93 11748 11767 535 554 TACTTTATTGGTTGGGAAAG 5-10-5 MOE
88 94 11753 11772 540 559 GTGGTTACTTTATTGGTTGG 5-10-5 MOE
89 95 11758 11777 545 564 TGAAAGTGGTTACTTTATTG 5-10-5 MOE
90 96 11761 11780 548 567 TGCTGAAAGTGGTTACTTTA 5-10-5 MOE
91 97 N/A N/A 94 113 TGTGCCTGAGACTAGGGTGA 5-10-5 MOE
92 98 646 665 118 137 GCACACGCCAGTCTTCTCTG 5-10-5 MOE
93 99 669 688 141 160 TTCTGGTCAGCCTGGAGCTC 5-10-5 MOE
94 100 679 698 151 170 TTGCGTGCAGTTCTGGTCAG 5-10-5 MOE
95 101 719 738 191 210 ACTTGAGGTTGTCGGCGCAT 5-10-5 MOE
96 102 727 746 199 218 GCTGCAGCACTTGAGGTTGT 5-10-5 MOE
97 103 N/A N/A 236 255 TATCATTGGGCAGAGAGCAG 5-10-5 MOE
98 104 10209 10228 272 291 GAAAGTTAATGTTCACCTGG 5-10-5 MOE
99 105 10272 10291 335 354 ATTTCATCTGGCCAGGACAC 5-10-5 MOE
100 106 10320 10339 383 402 AGAAATTGGGAGTGACACAG 5-10-5 MOE
101 107 N/A N/A 240 259 TCCTTATCATTGGGCAGAGA 5-10-5 MOE
102 108 N/A N/A 248 267 AGGAACCCTCCTTATCATTG 5-10-5 MOE
103 109 10360 10379 N/A N/A TGGCCATCAATGCACTTTCT 5-10-5 MOE
104 110 10384 10403 N/A N/A TTTTCTCCTGTTTCCCACAA 5-10-5 MOE
105 111 10441 10460 N/A N/A TATACCTTTCCCAACTGTCC 5-10-5 MOE
106 112 10447 10466 N/A N/A CACTGGTATACCTTTCCCAA 5-10-5 MOE
107 113 10476 10495 N/A N/A CTTCTTTTAGAACAGGCTGA 5-10-5 MOE
108 114 10485 10504 N/A N/A CCTTTCACTCTTCTTTTAGA 5-10-5 MOE
109 115 10493 10512 N/A N/A ACTACCCACCTTTCACTCTT 5-10-5 MOE
110 116 10508 10527 N/A N/A AATGCAGCTCATCAGACTAC 5-10-5 MOE
111 117 10546 10565 N/A N/A TTGCTTATTCTGTTCCCTCT 5-10-5 MOE
112 118 10553 10572 N/A N/A CAAGCTCTTGCTTATTCTGT 5-10-5 MOE
113 119 10588 10607 N/A N/A TGCTGGGATTATAGGCATGA 5-10-5 MOE
114 120 10596 10615 N/A N/A TCCCAAAGTGCTGGGATTAT 5-10-5 MOE
115 121 10681 10700 N/A N/A GGTATTTTTAGTAGAGACGG 5-10-5 MOE
116 122 10771 10790 N/A N/A CAGGTTCAAGCAATTCTCCT 5-10-5 MOE
117 123 10848 10867 N/A N/A TTGAGATGGAGTTTCGCTCT 5-10-5 MOE
118 124 10923 10942 N/A N/A AAAGTAGCACATGACAACCA 5-10-5 MOE
119 125 10933 10952 N/A N/A GAAATTGTTAAAAGTAGCAC 5-10-5 MOE
120 126 10944 10963 N/A N/A TACTTTGCTGAGAAATTGTT 5-10-5 MOE
121 127 10956 10975 N/A N/A TTATCTTCAGGTTACTTTGC 5-10-5 MOE
122 128 10966 10985 N/A N/A ATTCTATCAGTTATCTTCAG 5-10-5 MOE
123 129 10977 10996 N/A N/A TGCACTATTGGATTCTATCA 5-10-5 MOE
124 130 10990 11009 N/A N/A AATTGCTCATCTCTGCACTA 5-10-5 MOE
125 131 10999 11018 N/A N/A CTAGATTTCAATTGCTCATC 5-10-5 MOE
126 132 11008 11027 N/A N/A ACCCCCTCTCTAGATTTCAA 5-10-5 MOE
127 133 11047 11066 N/A N/A TTAGAGAAACCATAGTTCCC 5-10-5 MOE
128 134 11059 11078 N/A N/A CCATAGCTTAGTTTAGAGAA 5-10-5 MOE
129 135 11108 11127 N/A N/A CAAAGCCTATCCATGCAGTT 5-10-5 MOE
130 136 11118 11137 N/A N/A TTCTTGACTGCAAAGCCTAT 5-10-5 MOE
131 137 11128 11147 N/A N/A AACCAAGGTCTTCTTGACTG 5-10-5 MOE
132 138 11136 11155 N/A N/A AACATTTGAACCAAGGTCTT 5-10-5 MOE
133 139 11146 11165 N/A N/A TGTCAGAGCTAACATTTGAA 5-10-5 MOE
134 140 11158 11177 N/A N/A AGGTTAGGTAAGTGTCAGAG 5-10-5 MOE
135 141 11167 11186 N/A N/A GAGGTGAGAAGGTTAGGTAA 5-10-5 MOE
136 142 11189 11208 N/A N/A AGCGAGATAACTGTGACTCA 5-10-5 MOE
137 143 11202 11221 N/A N/A GCTACATTTTATAAGCGAGA 5-10-5 MOE
138 144 11231 11250 N/A N/A GGATTATCTGATCAATTAGA 5-10-5 MOE
139 145 11238 11257 N/A N/A TAAAATGGGATTATCTGATC 5-10-5 MOE
140 146 11248 11267 N/A N/A TTCTTTAGGTTAAAATGGGA 5-10-5 MOE
141 147 11258 11277 N/A N/A CCATGCCTTCTTCTTTAGGT 5-10-5 MOE
142 148 11273 11292 N/A N/A TATTAGGAAGTTCTGCCATG 5-10-5 MOE
143 149 11281 11300 N/A N/A CCTTCTACTATTAGGAAGTT 5-10-5 MOE
144 150 11288 11307 N/A N/A CAAGAATCCTTCTACTATTA 5-10-5 MOE
145 151 11294 11313 N/A N/A TCTCCCCAAGAATCCTTCTA 5-10-5 MOE
146 152 11430 11449 N/A N/A AGACATACTCTTCTCCTTCA 5-10-5 MOE
147 153 11439 11458 N/A N/A ACAGGTTCTAGACATACTCT 5-10-5 MOE
148 154 11450 11469 N/A N/A TTGCATTTTCTACAGGTTCT 5-10-5 MOE
149 155 11458 11477 N/A N/A GGCTCTGCTTGCATTTTCTA 5-10-5 MOE
150 156 11533 11552 N/A N/A CAGCTTAAATCCTAGACCAG 5-10-5 MOE
151 157 11540 11559 N/A N/A GTACCTGCAGCTTAAATCCT 5-10-5 MOE
152 158 11561 11580 N/A N/A TATCCATTAGACTAGGCAGG 5-10-5 MOE
153 159 11571 11590 N/A N/A TCAACAACAATATCCATTAG 5-10-5 MOE
154 160 11581 11600 N/A N/A AACAATACCATCAACAACAA 5-10-5 MOE
155 161 906 925 N/A N/A ACTGACGGATCTGGTTTCAA 5-10-5 MOE
156 162 1004 1023 N/A N/A ATGCACCAGAGACTCGAATC 5-10-5 MOE
157 163 1246 1265 N/A N/A TGTAAAGTTCCTTTCCGCCT 5-10-5 MOE
158 164 1283 1302 N/A N/A ACACATCTTTAAGATGAGCG 5-10-5 MOE
159 165 1325 1344 N/A N/A TGACCTTGGGCAAGAACATT 5-10-5 MOE
160 166 1388 1407 N/A N/A AGTTGGCCTGAAAGGCAAAA 5-10-5 MOE
161 167 1407 1426 N/A N/A TTCTTCGAATCACTCAGCCA 5-10-5 MOE
162 168 1416 1435 N/A N/A TTCCTCACTTTCTTCGAATC 5-10-5 MOE
163 169 1424 1443 N/A N/A AGGGAGGATTCCTCACTTTC 5-10-5 MOE
164 170 1460 1479 N/A N/A ATTGACTGAAAGACGACGAA 5-10-5 MOE
165 171 1472 1491 N/A N/A AGAGTGGAAGAGATTGACTG 5-10-5 MOE
166 172 1481 1500 N/A N/A TCAATCCTTAGAGTGGAAGA 5-10-5 MOE
167 173 1488 1507 N/A N/A CGCTCACTCAATCCTTAGAG 5-10-5 MOE
168 174 1520 1539 N/A N/A CAGCAAGCACCTTTGAGAGA 5-10-5 MOE
169 175 1551 1570 N/A N/A TGTTCTGATAGCCTGGTGGA 5-10-5 MOE
170 176 1567 1586 N/A N/A TGTTTAAGCCACCCCCTGTT 5-10-5 MOE
171 177 1575 1594 N/A N/A TTCCATGCTGTTTAAGCCAC 5-10-5 MOE
172 178 1580 1599 N/A N/A TGAGATTCCATGCTGTTTAA 5-10-5 MOE
173 179 1593 1612 N/A N/A GAGAACGGAAAGCTGAGATT 5-10-5 MOE
174 180 1601 1620 N/A N/A TTCCTCTGGAGAACGGAAAG 5-10-5 MOE
175 181 1619 1638 N/A N/A CCTCTAATCCTCAGCATTTT 5-10-5 MOE
176 182 1630 1649 N/A N/A TCCTATCCCTGCCTCTAATC 5-10-5 MOE
177 183 1645 1664 N/A N/A TTGGTTCTCTCCAGGTCCTA 5-10-5 MOE
178 184 1657 1676 N/A N/A CATTACAGTACCTTGGTTCT 5-10-5 MOE
179 185 1664 1683 N/A N/A AGAACATCATTACAGTACCT 5-10-5 MOE
180 186 1674 1693 N/A N/A TTCTGGATAAAGAACATCAT 5-10-5 MOE
181 187 1681 1700 N/A N/A GGCTGTATTCTGGATAAAGA 5-10-5 MOE
182 188 1724 1743 N/A N/A TGCTGGCATCTTCAAGGAAA 5-10-5 MOE
183 189 1745 1764 N/A N/A ATTACAAACCTTCCCAGCCT 5-10-5 MOE
184 190 1757 1776 N/A N/A TTGGGTCACCGTATTACAAA 5-10-5 MOE
185 191 1762 1781 N/A N/A GTGTCTTGGGTCACCGTATT 5-10-5 MOE
186 192 1884 1903 N/A N/A TCCAAATCTTCCTCTCTCCT 5-10-5 MOE
187 193 1945 1964 N/A N/A AAGGAGGGAGTCTTTGCTGT 5-10-5 MOE
188 194 1967 1986 N/A N/A GAACAAATTCTTCATCCATC 5-10-5 MOE
189 195 1974 1993 N/A N/A GATAAGGGAACAAATTCTTC 5-10-5 MOE
190 196 1988 2007 N/A N/A GTCTGTCCATCTGAGATAAG 5-10-5 MOE
191 197 2100 2119 N/A N/A AAACAACATGCTCAGGATCA 5-10-5 MOE
192 198 2125 2144 N/A N/A TCTTAGAGCAGAGGCTCAGA 5-10-5 MOE
193 199 2134 2153 N/A N/A TTATTCCCATCTTAGAGCAG 5-10-5 MOE
194 200 2160 2179 N/A N/A TCATGCCAATCCTATAGAGT 5-10-5 MOE
195 201 2171 2190 N/A N/A TCATTTAGTCCTCATGCCAA 5-10-5 MOE
196 202 2194 2213 N/A N/A ATAGACACTTTAGATGCATT 5-10-5 MOE
197 203 2205 2224 N/A N/A TCTTCTCACTAATAGACACT 5-10-5 MOE
198 204 2215 2234 N/A N/A GTATGGAGTATCTTCTCACT 5-10-5 MOE
199 205 2222 2241 N/A N/A CCACTGTGTATGGAGTATCT 5-10-5 MOE
200 206 2230 2249 N/A N/A AAAACAAGCCACTGTGTATG 5-10-5 MOE
201 207 2238 2257 N/A N/A TTATGATCAAAACAAGCCAC 5-10-5 MOE
202 208 2247 2266 N/A N/A GGGAACCATTTATGATCAAA 5-10-5 MOE
203 209 2258 2277 N/A N/A GGAAATAAATAGGGAACCAT 5-10-5 MOE
204 210 2269 2288 N/A N/A TGGGCTGCCCTGGAAATAAA 5-10-5 MOE
205 211 2275 2294 N/A N/A TAATATTGGGCTGCCCTGGA 5-10-5 MOE
206 212 2285 2304 N/A N/A TAGGAACCTGTAATATTGGG 5-10-5 MOE
207 213 2293 2312 N/A N/A GAAAGGAGTAGGAACCTGTA 5-10-5 MOE
208 214 2304 2323 N/A N/A TTCATTCTCTTGAAAGGAGT 5-10-5 MOE
209 215 2325 2344 N/A N/A TGACTTCCTAATACAAAGAA 5-10-5 MOE
210 216 2334 2353 N/A N/A CAACAGTCTTGACTTCCTAA 5-10-5 MOE
211 217 2341 2360 N/A N/A AAGTTGCCAACAGTCTTGAC 5-10-5 MOE
212 218 892 911 N/A N/A TTTCAACCGCCTTGACTTTC 5-10-5 MOE
213 219 899 918 N/A N/A GATCTGGTTTCAACCGCCTT 5-10-5 MOE
214 220 950 969 N/A N/A TTCAACGACGCCTTTGTCTA 5-10-5 MOE
215 221 997 1016 N/A N/A AGAGACTCGAATCCCAGCTA 5-10-5 MOE
216 222 1263 1282 N/A N/A GGGCATTTTCCTAAATCTGT 5-10-5 MOE
217 223 1294 1313 N/A N/A GATGCTCCCTTACACATCTT 5-10-5 MOE
218 224 1302 1321 N/A N/A TTCTCACCGATGCTCCCTTA 5-10-5 MOE
219 225 1366 1385 N/A N/A TGAACCCTCACTATGACTCC 5-10-5 MOE
220 226 2061 2080 N/A N/A AACTAGGATTCAAACCTCCA 5-10-5 MOE
221 227 2154 2173 N/A N/A CAATCCTATAGAGTTTGGAA 5-10-5 MOE
222 228 9179 9198 N/A N/A GAACTGGGTGATTAGCTGTA 5-10-5 MOE
223 229 9282 9301 N/A N/A CATTCATCAACTGAGGTACA 5-10-5 MOE
224 230 9325 9344 N/A N/A CACTTCCCAGGTTAGATAGA 5-10-5 MOE
225 231 9339 9358 N/A N/A ACACAATCACACTCCACTTC 5-10-5 MOE
226 232 9365 9384 N/A N/A ACACGTCCTTCCACTAACAA 5-10-5 MOE
227 233 9388 9407 N/A N/A ATTCATCCATGCAGAGAGAA 5-10-5 MOE
228 234 9426 9445 N/A N/A TTGCAGTCTCTCAGCACCAT 5-10-5 MOE
229 235 9459 9478 N/A N/A AATCTTCACTCATACCCACA 5-10-5 MOE
230 236 9468 9487 N/A N/A CACACTTATAATCTTCACTC 5-10-5 MOE
231 237 9506 9525 N/A N/A ACTTAAAGTGTAAAGTACAG 5-10-5 MOE
232 238 9513 9532 N/A N/A TGCTGCCACTTAAAGTGTAA 5-10-5 MOE
233 239 9522 9541 N/A N/A TAAGCACTATGCTGCCACTT 5-10-5 MOE
234 240 9532 9551 N/A N/A CTGCCATGGTTAAGCACTAT 5-10-5 MOE
235 241 9696 9715 N/A N/A CAATAATCCTAAAAGAAGGG 5-10-5 MOE
236 242 9715 9734 N/A N/A TTAACTCTTCTAATTCTCAC 5-10-5 MOE
237 243 9733 9752 N/A N/A TCAAGCCCCTAACATATATT 5-10-5 MOE
238 244 9746 9765 N/A N/A TACATGCCAGGTATCAAGCC 5-10-5 MOE
239 245 9767 9786 N/A N/A GAACACTTAATTAGCTCTTA 5-10-5 MOE
240 246 9797 9816 N/A N/A TACTCTGTAGTTATGAGAAA 5-10-5 MOE
241 247 9802 9821 N/A N/A CAAACTACTCTGTAGTTATG 5-10-5 MOE
242 248 9807 9826 N/A N/A AATATCAAACTACTCTGTAG 5-10-5 MOE
243 249 9814 9833 N/A N/A TCCCTGAAATATCAAACTAC 5-10-5 MOE
244 250 9843 9862 N/A N/A AGCAGTGGGAAACAAACATA 5-10-5 MOE
245 251 9865 9884 N/A N/A TACAACATAGGGTTGTTGTG 5-10-5 MOE
246 252 9874 9893 N/A N/A AGTGCTAATTACAACATAGG 5-10-5 MOE
247 253 9885 9904 N/A N/A GCCAGTGGAACAGTGCTAAT 5-10-5 MOE
248 254 9895 9914 N/A N/A GTCTTTAGGTGCCAGTGGAA 5-10-5 MOE
249 255 10120 10139 N/A N/A TTAACTTGTACCTGCAGCAT 5-10-5 MOE
250 256 10124 10143 N/A N/A GAGATTAACTTGTACCTGCA 5-10-5 MOE
251 257 10287 10302 350 365 ATTGCGGCAGCATTTC 3-10-3 LNA
252 258 11706 11721 493 508 GAATACAGAGTCCCGA 3-10-3 LNA
253 259 11754 11769 541 556 GTTACTTTATTGGTTG 3-10-3 LNA
254 260 2350 2369 N/A N/A AATGTTGTTAAGTTGCCAAC 5-10-5 MOE
255 261 2732 2751 N/A N/A AAGGAAATGTGGCACGTCTA 5-10-5 MOE
256 262 2830 2849 N/A N/A ATGCCCAAGACACATGCACA 5-10-5 MOE
257 263 2838 2857 N/A N/A CAACGCAAATGCCCAAGACA 5-10-5 MOE
258 264 3117 3136 N/A N/A GTTAGAATGGAGATCCTTAA 5-10-5 MOE
259 265 3256 3275 N/A N/A TAGAACGTGGGCGAAGGATA 5-10-5 MOE
260 266 3421 3440 N/A N/A GATCCAATTAAACTACAGAG 5-10-5 MOE
261 267 3854 3873 N/A N/A GGAAGCATCACGCTAACTGA 5-10-5 MOE
262 268 4286 4305 N/A N/A TAAGAAACTGCAGTAAAGTC 5-10-5 MOE
263 269 4294 4313 N/A N/A TAAGCTGATAAGAAACTGCA 5-10-5 MOE
264 270 4999 5018 N/A N/A ACAAAGAGGAGTTGCTGGTA 5-10-5 MOE
265 271 5814 5833 N/A N/A AACACTAATTAGCAAATGCA 5-10-5 MOE
266 272 5960 5979 N/A N/A AAAGATATCCAAGACTTGAA 5-10-5 MOE
267 273 6015 6034 N/A N/A GAAACTTTAACCCCCACTGT 5-10-5 MOE
268 274 6038 6057 N/A N/A AGACTCCGACATAATAATAG 5-10-5 MOE
269 275 6548 6567 N/A N/A ACAACTGGAATCAGCAACTG 5-10-5 MOE
270 276 6553 6572 N/A N/A AAGGAACAACTGGAATCAGC 5-10-5 MOE
271 277 6610 6629 N/A N/A TTTTCTCATCAACAGGCCTG 5-10-5 MOE
272 278 6785 6804 N/A N/A CCCTTCAGACTAACTGCAGA 5-10-5 MOE
273 279 6811 6830 N/A N/A AAGGTTGGGTTACCCACTAT 5-10-5 MOE
274 280 7221 7240 N/A N/A TGAAGCCTATACAAGTATCA 5-10-5 MOE
275 281 7231 7250 N/A N/A GAGAACGTCATGAAGCCTAT 5-10-5 MOE
276 282 7334 7353 N/A N/A AAGAAAGGTAAGAACCTTGA 5-10-5 MOE
277 283 7347 7366 N/A N/A CTAACCCCAATGCAAGAAAG 5-10-5 MOE
278 284 7355 7374 N/A N/A AGCATGTTCTAACCCCAATG 5-10-5 MOE
279 285 7880 7899 N/A N/A ATTTCCGTGTCTCCTGACTG 5-10-5 MOE
280 286 7888 7907 N/A N/A AGTCCCTGATTTCCGTGTCT 5-10-5 MOE
281 287 8257 8276 N/A N/A AACTCTCAAGCTTGGTAGGG 5-10-5 MOE
282 288 8268 8287 N/A N/A AGTTGACCTGGAACTCTCAA 5-10-5 MOE
283 289 8590 8609 N/A N/A TCTGGAGCAGATACTACACT 5-10-5 MOE
284 290 8600 8619 N/A N/A AATAGTGCACTCTGGAGCAG 5-10-5 MOE
285 291 8614 8633 N/A N/A ACTGTGCCGTGAGGAATAGT 5-10-5 MOE
286 292 8770 8789 N/A N/A ATTTTCAAATGAGGTACGTG 5-10-5 MOE
287 293 8807 8826 N/A N/A TCCCAGTGAATCAATGCAGA 5-10-5 MOE
288 294 8860 8879 N/A N/A GATTTAGGTTCAGCTTTCAA 5-10-5 MOE
289 295 9153 9172 N/A N/A AAGGAAAGTGGCTGACAGAT 5-10-5 MOE
290 296 9171 9190 N/A N/A TGATTAGCTGTAGAGGACAA 5-10-5 MOE
291 297 9975 9994 N/A N/A CAAATGGAATCACAGGACCT 5-10-5 MOE
292 298 9983 10002 N/A N/A CCTGCTCCCAAATGGAATCA 5-10-5 MOE
293 299 10006 10025 N/A N/A AAGATCACCTGCAAATCCCT 5-10-5 MOE
294 300 10079 10098 N/A N/A TGGGCTTCACATACAGCAGA 5-10-5 MOE
295 301 10132 10151 N/A N/A GATACAGGGAGATTAACTTG 5-10-5 MOE
296 302 10155 10174 N/A N/A AGTAAGGGTAAGTGGGCAGA 5-10-5 MOE
297 303 10355 10374 N/A N/A ATCAATGCACTTTCTCTTTC 5-10-5 MOE
298 304 10357 10376 N/A N/A CCATCAATGCACTTTCTCTT 5-10-5 MOE
299 305 10362 10381 N/A N/A CCTGGCCATCAATGCACTTT 5-10-5 MOE
300 306 10470 10489 N/A N/A TTAGAACAGGCTGAGGGTCA 5-10-5 MOE
301 307 10474 10493 N/A N/A TCTTTTAGAACAGGCTGAGG 5-10-5 MOE
302 308 10478 10497 N/A N/A CTCTTCTTTTAGAACAGGCT 5-10-5 MOE
303 309 10581 10600 N/A N/A ATTATAGGCATGAGCCACCA 5-10-5 MOE
304 310 10649 10668 N/A N/A TTGGTCAGGCTGGTCTTGAA 5-10-5 MOE
305 311 10662 10681 N/A N/A GGGTTTCTCCATGTTGGTCA 5-10-5 MOE
306 312 10715 10734 N/A N/A CCACCACACCCATTAAATTT 5-10-5 MOE
307 313 10764 10783 N/A N/A AAGCAATTCTCCTGCCTCAG 5-10-5 MOE
308 314 10778 10797 N/A N/A TGTCTCCCAGGTTCAAGCAA 5-10-5 MOE
309 315 10799 10818 N/A N/A ATCTCAGCTCACCACAACCT 5-10-5 MOE
310 316 10813 10832 N/A N/A AGTGCAATGGCGTGATCTCA 5-10-5 MOE
311 317 10839 10858 N/A N/A AGTTTCGCTCTTGTTGCCCA 5-10-5 MOE
312 318 10858 10877 N/A N/A TGTTTTTAATTTGAGATGGA 5-10-5 MOE
313 319 10881 10900 N/A N/A CACCAAGCTGTTTTTTGTTT 5-10-5 MOE
314 320 10886 10905 N/A N/A GGTACCACCAAGCTGTTTTT 5-10-5 MOE
315 321 10899 10918 N/A N/A ATTTCAACCCAAGGGTACCA 5-10-5 MOE
316 322 10907 10926 N/A N/A ACCACGAGATTTCAACCCAA 5-10-5 MOE
317 323 10915 10934 N/A N/A ACATGACAACCACGAGATTT 5-10-5 MOE
318 324 10975 10994 N/A N/A CACTATTGGATTCTATCAGT 5-10-5 MOE
319 325 10979 10998 N/A N/A TCTGCACTATTGGATTCTAT 5-10-5 MOE
320 326 10997 11016 N/A N/A AGATTTCAATTGCTCATCTC 5-10-5 MOE
321 327 11000 11019 N/A N/A TCTAGATTTCAATTGCTCAT 5-10-5 MOE
322 328 11185 11204 N/A N/A AGATAACTGTGACTCAGGGA 5-10-5 MOE
323 329 11191 11210 N/A N/A TAAGCGAGATAACTGTGACT 5-10-5 MOE
324 330 11448 11467 N/A N/A GCATTTTCTACAGGTTCTAG 5-10-5 MOE
325 331 11452 11471 N/A N/A GCTTGCATTTTCTACAGGTT 5-10-5 MOE
326 332 11455 11474 N/A N/A TCTGCTTGCATTTTCTACAG 5-10-5 MOE
327 333 11538 11557 N/A N/A ACCTGCAGCTTAAATCCTAG 5-10-5 MOE
328 334 11542 11561 N/A N/A GAGTACCTGCAGCTTAAATC 5-10-5 MOE
329 335 11544 11563 N/A N/A AGGAGTACCTGCAGCTTAAA 5-10-5 MOE
330 336 4580 4599 N/A N/A GAAGGTATCTCAAAGTAACA 5-10-5 MOE
331 337 4942 4961 N/A N/A AGAGCCTCCTCCCTAATTCA 5-10-5 MOE
332 338 5362 5381 N/A N/A CACAAGCTGGGTTTTTGAAA 5-10-5 MOE
333 339 5714 5733 N/A N/A GCATAACCTTACATGGAAAC 5-10-5 MOE
334 340 5722 5741 N/A N/A TCAAGACCGCATAACCTTAC 5-10-5 MOE
335 341 9193 9212 N/A N/A AAAACACAGGCACAGAACTG 5-10-5 MOE
336 342 9201 9220 N/A N/A TTGTGTGTAAAACACAGGCA 5-10-5 MOE
337 343 9262 9281 N/A N/A TCATGGTTGCTTCCAACTTT 5-10-5 MOE
338 344 9290 9309 N/A N/A GCCAAATCCATTCATCAACT 5-10-5 MOE
339 345 9384 9403 N/A N/A AGAGAAACCACACGTCCTTC 5-10-5 MOE
340 346 9409 9428 N/A N/A CATGACCCTCCAAATACACT 5-10-5 MOE
341 347 9558 9577 N/A N/A CTGCAGAGTCTATGTGTTAA 5-10-5 MOE
342 348 9565 9584 N/A N/A AATCTAGCTGCAGAGTCTAT 5-10-5 MOE
343 349 9578 9597 N/A N/A TTGAACCCCAAGAAATCTAG 5-10-5 MOE
344 350 9851 9870 N/A N/A GTTGTGAAAGCAGTGGGAAA 5-10-5 MOE
345 351 10322 10341 385 404 TCAGAAATTGGGAGTGACAC 5-10-5 MOE
346 352 N/A N/A 396 415 GTGGCTGGAGCTCAGAAATT 5-10-5 MOE
347 353 11639 11658 426 445 AACTTTCTCTCCTCACTGCT 5-10-5 MOE
348 354 1382 1401 N/A N/A CCTGAAAGGCAAAAGCTGAA 5-10-5 MOE
349 355 4864 4883 N/A N/A AATTTCAGGTTAATATCCCT 5-10-5 MOE
350 356 5327 5346 N/A N/A GTCTGACTGCTAGCCATACT 5-10-5 MOE
351 357 5342 5361 N/A N/A AACATCAACAAAATAGTCTG 5-10-5 MOE
352 358 5370 5389 N/A N/A AATGAATTCACAAGCTGGGT 5-10-5 MOE
353 359 5423 5442 N/A N/A GATCAGAGAGAACTAAAGGA 5-10-5 MOE
354 360 5728 5747 N/A N/A ACTCACTCAAGACCGCATAA 5-10-5 MOE
355 361 7586 7605 N/A N/A AAGGCCCATCCAAAGATCAT 5-10-5 MOE
356 362 7895 7914 N/A N/A TCAAGTGAGTCCCTGATTTC 5-10-5 MOE
357 363 8542 8561 N/A N/A CAAGAGATTCCTTTGGGTGC 5-10-5 MOE
358 364 8694 8713 N/A N/A AGTAGGGTAGGGCATCATCT 5-10-5 MOE
359 365 8764 8783 N/A N/A AAATGAGGTACGTGGCTCAT 5-10-5 MOE
360 366 8855 8874 N/A N/A AGGTTCAGCTTTCAAGATGG 5-10-5 MOE
361 367 9163 9182 N/A N/A TGTAGAGGACAAGGAAAGTG 5-10-5 MOE
362 368 9270 9289 N/A N/A GAGGTACATCATGGTTGCTT 5-10-5 MOE
363 369 9374 9393 N/A N/A AGAGAAACCACACGTCCTTC 5-10-5 MOE
364 370 9401 9420 N/A N/A TCCAAATACACTCATTCATC 5-10-5 MOE
365 371 9595 9614 N/A N/A CAGAATTGAGGCAGAATTTG 5-10-5 MOE
366 372 9604 9623 N/A N/A AAGGTCACACAGAATTGAGG 5-10-5 MOE
367 373 9669 9688 N/A N/A CTGTTAATATTTCCTTGTGT 5-10-5 MOE
368 374 9676 9695 N/A N/A GAGGGATCTGTTAATATTTC 5-10-5 MOE
369 375 10318 10337 381 400 AAATTGGGAGTGACACAGGA 5-10-5 MOE
370 376 11642 11661 429 448 AGAAACTTTCTCTCCTCACT 5-10-5 MOE
371 377 11644 11663 431 450 GCAGAAACTTTCTCTCCTCA 5-10-5 MOE
372 378 11700 11719 487 506 ATACAGAGTCCCGAAAAAGG 5-10-5 MOE
373 379 11703 11722 490 509 GGAATACAGAGTCCCGAAAA 5-10-5 MOE
374 380 11751 11770 538 557 GGTTACTTTATTGGTTGGGA 5-10-5 MOE
375 381 11752 11771 539 558 TGGTTACTTTATTGGTTGGG 5-10-5 MOE
376 382 11754 11773 541 560 AGTGGTTACTTTATTGGTTG 5-10-5 MOE
377 383 286 305 N/A N/A TCCCAAATTGCAGCCATCAG 5-10-5 MOE
378 384 301 320 N/A N/A TTCAGCACAGAATCCTCCCA 5-10-5 MOE
379 385 527 546 N/A N/A AATTCTCAGTCTCTGGCCCT 5-10-5 MOE
380 386 531 550 N/A N/A AAGGAATTCTCAGTCTCTGG 5-10-5 MOE
2. mRNA 수준에서 미치는 ASO의 효과 확인
인간 유래의 교모세포종 세포주 SF268에서 상기 제조된 ASO가 WFDC2 mRNA의 발현을 감소시키는지 여부를 확인하였다. 0 nM(control) 대비 100 nM의 ASO 처리를 통해 WFDC2 발현량을 퍼센트로 환산한 결과를 표 4에 나타내었다.
화합물번호 서열번호 억제% (100 nM)
1 7 78
2 8 80
3 9 92
14 20 45
32 38 80
33 39 71
36 42 39
37 43 42
40 46 46
41 47 47
42 48 39
43 49 65
57 63 57
58 64 71
59 65 87
60 66 72
62 68 68
63 69 62
67 73 63
70 76 59
71 77 77
72 78 65
74 80 58
76 82 74
77 83 69
79 85 66
80 86 86
81 87 59
82 88 61
83 89 81
88 94 52
92 98 54
103 109 78
106 112 55
107 113 75
108 114 59
113 119 78
114 120 87
115 121 72
116 122 76
117 123 72
118 124 62
123 129 69
125 131 77
129 135 61
130 136 65
134 140 46
135 141 41
136 142 80
140 146 23
142 148 73
148 154 78
149 155 79
150 156 65
151 157 77
152 158 61
155 161 64
156 162 62
157 163 64
158 164 68
159 165 80
160 166 69
161 167 52
162 168 48
163 169 80
170 176 68
171 177 62
172 178 54
173 179 48
174 180 48
175 181 52
176 182 50
178 184 55
179 185 57
185 191 65
199 205 74
202 208 66
203 209 68
204 210 79
205 211 59
206 212 61
207 213 68
208 214 77
209 215 85
212 218 69
213 219 56
214 220 67
215 221 51
216 222 59
217 223 44
219 225 65
220 226 68
221 227 61
222 228 67
223 229 81
224 230 42
225 231 48
226 232 51
227 233 50
228 234 36
229 235 31
230 236 62
231 237 75
232 238 82
233 239 87
234 240 83
237 243 80
238 244 77
239 245 80
240 246 65
241 247 81
242 248 79
243 249 65
244 250 85
245 251 82
246 252 88
247 253 81
248 254 76
249 255 86
250 256 73
251 257 55
252 258 53
253 259 59
254 260 51
258 264 62
275 281 58
276 282 62
277 283 58
278 284 75
279 285 77
280 286 71
281 287 66
282 288 45
283 289 78
284 290 76
285 291 83
286 292 80
287 293 75
289 295 69
290 296 60
291 297 52
292 298 63
293 299 54
294 300 73
304 310 83
307 313 85
308 314 86
310 316 85
311 317 77
314 320 70
321 327 66
324 330 67
325 331 56
327 333 55
329 335 68
330 336 72
332 338 62
333 339 53
334 340 58
337 343 70
343 349 36
365 371 62
366 372 45
367 373 59
368 374 55
369 375 60
370 376 84
371 377 82
372 378 79
373 379 89
374 380 96
375 381 92
376 382 90
377 383 82
380 386 65
또한, SNU638 및 SF268 세포주에서 농도 의존적으로 mRNA의 생성 억제 효과를 나타낸 화합물은 표 5 및 표 6에 나타내었다.
화합물번호 서열번호 억제%
(1 nM)
억제%
(3 nM)
억제%
(10 nM)
억제%
(30 nM)
1 7 -6 -3 20 50
2 8 -2 0 11 34
3 9 4 31 75 93
화합물번호 서열번호 억제% (1 nM) 억제% (3 nM) 억제% (10 nM)
3 9 17.3 52.4 81
58 64 26.6 38.1 74.3
59 65 39.7 51.1 74.8
63 69 10.7 49.9 53.1
3. 단백질 수준에서 미치는 ASO의 효과 확인
인간 유래의 위암세포주 SNU638 및 췌장암세포주 PANC1에서 상기 제조된 ASO가 WFDC2 단백질의 발현을 감소시키는지 여부를 ELISA를 통해 확인하였다.
위암세포주 SNU638 및 췌장암세포주 PANC1에 대한 ASO의 WFDC2 단백질 발현 감소 정도를 ELISA를 통해 확인한 결과, 표 7 및 표 8에서 보는 바와 같이, 화합물 2, 화합물 3, 화합물 32, 화합물 43, 화합물 59, 화합물 80, 화합물 103, 화합물 113, 화합물 114, 화합물 115, 화합물 116, 화합물 117, 화합물 125, 화합물 130, 화합물 136, 화합물 142, 화합물 148, 화합물 149, 화합물 151, 화합물 159, 화합물 163, 화합물 199, 화합물 204, 화합물 208, 화합물 209, 화합물 223, 화합물 232, 화합물 233, 화합물 234, 화합물 237, 화합물 239, 화합물 244, 화합물 245, 화합물 246, 화합물 247, 화합물 248, 화합물 249, 화합물 279, 화합물 285, 화합물 286, 화합물 294, 화합물 304, 화합물 307, 화합물 308, 화합물 310, 화합물 311, 화합물 314, 화합물 324, 화합물 325, 화합물 330, 화합물 337, 화합물 370, 화합물 373, 화합물 374, 화합물 375, 화합물 376, 및 화합물 377이 SNU638 세포주 및 PANC1 세포주에서 각각 발현을 현저하게 감소시킴을 확인하였다.
화합물번호 서열번호 억제% (100 nM)
1 7 67
2 8 74
3 9 62
4 10 0
5 11 0
6 12 13
7 13 0
8 14 0
9 15 0
10 16 27
11 17 9
12 18 0
13 19 0
14 20 25
15 21 0
16 22 0
17 23 21
18 24 32
19 25 12
20 26 20
21 27 0
22 28 0
23 29 36
24 30 30
25 31 31
26 32 0
27 33 7
28 34 0
29 35 0
30 36 23
31 37 13
32 38 73
33 39 74
34 40 45
35 41 25
36 42 18
37 43 24
38 44 0
39 45 24
40 46 35
41 47 41
42 48 30
43 49 55
44 50 25
45 51 11
46 52 3
47 53 21
48 54 22
49 55 4
50 56 17
51 57 0
52 58 0
53 59 6
54 60 9
55 61 7
56 62 0
57 63 53
58 64 51
59 65 59
60 66 57
61 67 30
62 68 57
63 69 53
64 70 40
65 71 38
66 72 35
67 73 55
68 74 47
69 75 41
70 76 46
71 77 59
72 78 55
73 79 47
74 80 53
75 81 38
76 82 56
77 83 71
78 84 48
79 85 57
80 86 78
81 87 61
82 88 56
83 89 75
84 90 42
85 91 31
86 92 31
87 93 36
88 94 48
89 95 31
90 96 22
91 97 34
92 98 44
93 99 28
94 100 30
95 101 36
96 102 29
97 103 25
98 104 14
99 105 25
100 106 36
101 107 19
102 108 18
103 109 67
104 110 0
105 111 0
106 112 40
107 113 61
108 114 41
109 115 2
110 116 0
111 117 33
112 118 8
113 119 91
114 120 94
115 121 88
116 122 93
117 123 94
118 124 49
119 125 13
120 126 43
121 127 30
122 128 12
123 129 65
124 130 37
125 131 73
126 132 0
127 133 0
128 134 37
129 135 57
130 136 52
131 137 32
132 138 15
133 139 5
134 140 30
135 141 30
136 142 77
137 143 26
138 144 0
139 145 0
140 146 42
141 147 29
142 148 67
143 149 24
144 150 0
145 151 0
146 152 0
147 153 0
148 154 65
149 155 58
150 156 42
151 157 62
152 158 41
153 159 8
154 160 33
155 161 44
156 162 44
157 163 45
158 164 48
159 165 55
160 166 47
161 167 42
162 168 44
163 169 53
164 170 33
165 171 35
166 172 44
167 173 45
168 174 40
169 175 43
170 176 53
171 177 48
172 178 41
173 179 41
174 180 48
175 181 48
176 182 45
177 183 36
178 184 48
179 185 48
180 186 24
181 187 35
182 188 45
183 189 28
184 190 38
185 191 52
186 192 21
187 193 11
188 194 29
189 195 23
190 196 40
191 197 31
192 198 18
193 199 35
194 200 36
195 201 27
196 202 35
197 203 29
198 204 9
199 205 76
200 206 18
201 207 18
202 208 57
203 209 57
204 210 77
205 211 47
206 212 50
207 213 55
208 214 58
209 215 57
210 216 38
211 217 40
212 218 53
213 219 45
214 220 54
215 221 42
216 222 53
217 223 51
218 224 39
219 225 46
220 226 48
221 227 43
222 228 47
223 229 57
224 230 45
225 231 44
226 232 46
227 233 45
228 234 40
229 235 33
230 236 51
231 237 61
232 238 65
233 239 67
234 240 68
235 241 45
236 242 42
237 243 62
238 244 63
239 245 63
240 246 54
241 247 62
242 248 62
243 249 58
244 250 69
245 251 71
246 252 73
247 253 74
248 254 73
249 255 71
250 256 65
251 257 47
252 258 53
253 259 51
254 260 46
255 261 43
256 262 37
257 263 33
258 264 49
259 265 14
260 266 11
261 267 40
262 268 31
263 269 10
264 270 34
265 271 29
266 272 20
267 273 28
268 274 6
269 275 20
270 276 9
271 277 40
272 278 19
273 279 27
274 280 41
275 281 49
276 282 52
277 283 50
278 284 56
279 285 64
280 286 56
281 287 57
282 288 49
283 289 59
284 290 58
285 291 69
286 292 63
287 293 62
288 294 32
289 295 51
290 296 47
291 297 41
292 298 46
293 299 42
294 300 67
295 301 29
296 302 19
297 303 0
298 304 22
299 305 52
300 306 30
301 307 45
302 308 54
303 309 44
304 310 74
305 311 66
306 312 61
307 313 77
308 314 79
309 315 46
310 316 83
311 317 72
312 318 37
313 319 38
314 320 72
315 321 59
316 322 46
317 323 57
318 324 0
319 325 57
320 326 41
321 327 43
322 328 67
323 329 59
324 330 72
325 331 34
326 332 43
327 333 62
328 334 28
329 335 52
330 336 57
331 337 38
332 338 49
333 339 44
334 340 48
335 341 43
336 342 40
337 343 55
338 344 24
339 345 24
340 346 39
341 347 36
342 348 38
343 349 48
344 350 37
345 351 31
346 352 27
347 353 44
348 354 27
349 355 32
350 356 29
351 357 0
352 358 4
353 359 24
354 360 18
355 361 26
356 362 23
357 363 41
358 364 14
359 365 0
360 366 0
361 367 0
362 368 0
363 369 17
364 370 2
365 371 51
366 372 50
367 373 50
368 374 48
369 375 52
370 376 61
371 377 60
372 378 54
373 379 67
374 380 81
375 381 80
376 382 80
377 383 72
378 384 41
379 385 37
380 386 46
화합물번호 서열번호 억제% (100 nM)
1 7 86
2 8 61
3 9 52
4 10 0
5 11 1
6 12 50
7 13 29
8 14 30
9 15 18
10 16 36
11 17 0
12 18 0
13 19 0
14 20 78
15 21 0
16 22 0
17 23 21
18 24 42
19 25 0
20 26 46
21 27 0
22 28 26
23 29 61
24 30 74
25 31 43
26 32 42
27 33 14
28 34 0
29 35 0
30 36 84
31 37 57
32 38 84
33 39 53
34 40 62
35 41 79
36 42 91
37 43 88
38 44 0
39 45 76
40 46 98
41 47 99
42 48 93
43 49 89
44 50 42
45 51 37
46 52 40
47 53 0
48 54 0
49 55 45
50 56 24
51 57 0
52 58 0
53 59 0
54 60 0
55 61 35
56 62 22
57 63 0
58 64 12
59 65 64
60 66 23
61 67 0
62 68 0
63 69 15
64 70 7
65 71 5
66 72 0
67 73 12
68 74 21
69 75 15
70 76 17
71 77 25
72 78 20
73 79 10
74 80 22
75 81 8
76 82 30
77 83 64
78 84 27
79 85 35
80 86 85
81 87 31
82 88 32
83 89 55
84 90 26
85 91 71
86 92 0
87 93 9
88 94 11
89 95 0
90 96 0
91 97 7
92 98 15
93 99 0
94 100 62
95 101 55
96 102 41
97 103 44
98 104 32
99 105 27
100 106 12
101 107 39
102 108 0
103 109 68
104 110 43
105 111 32
106 112 62
107 113 56
108 114 83
109 115 34
110 116 21
111 117 33
112 118 0
113 119 97
114 120 99
115 121 97
116 122 97
117 123 98
118 124 59
119 125 0
120 126 0
121 127 77
122 128 18
123 129 62
124 130 18
125 131 79
126 132 30
127 133 28
128 134 22
129 135 72
130 136 85
131 137 70
132 138 78
133 139 65
134 140 82
135 141 80
136 142 91
137 143 72
138 144 60
139 145 27
140 146 72
141 147 49
142 148 92
143 149 63
144 150 53
145 151 65
146 152 29
147 153 31
148 154 91
149 155 97
150 156 83
151 157 91
152 158 62
153 159 44
154 160 58
155 161 67
156 162 56
157 163 69
158 164 71
159 165 88
160 166 65
161 167 54
162 168 62
163 169 82
164 170 50
165 171 56
166 172 60
167 173 58
168 174 50
169 175 51
170 176 78
171 177 50
172 178 49
173 179 35
174 180 21
175 181 33
176 182 21
177 183 10
178 184 15
179 185 31
180 186 0
181 187 12
182 188 29
183 189 35
184 190 24
185 191 69
186 192 0
187 193 5
188 194 15
189 195 0
190 196 22
191 197 40
192 198 25
193 199 33
194 200 21
195 201 16
196 202 17
197 203 14
198 204 0
199 205 95
200 206 75
201 207 63
202 208 44
203 209 47
204 210 92
205 211 65
206 212 69
207 213 71
208 214 79
209 215 88
210 216 66
211 217 51
212 218 69
213 219 65
214 220 47
215 221 38
216 222 63
217 223 52
218 224 44
219 225 61
220 226 58
221 227 76
222 228 78
223 229 84
224 230 60
225 231 62
226 232 58
227 233 49
228 234 45
229 235 28
230 236 57
231 237 69
232 238 72
233 239 82
234 240 78
235 241 55
236 242 50
237 243 77
238 244 61
239 245 72
240 246 38
241 247 70
242 248 72
243 249 70
244 250 85
245 251 93
246 252 98
247 253 95
248 254 92
249 255 95
250 256 72
251 257 63
252 258 66
253 259 67
254 260 22
255 261 31
256 262 40
257 263 28
258 264 56
259 265 0
260 266 10
261 267 27
262 268 25
263 269 0
264 270 12
265 271 9
266 272 5
267 273 17
268 274 0
269 275 21
270 276 0
271 277 15
272 278 0
273 279 16
274 280 39
275 281 59
276 282 69
277 283 63
278 284 71
279 285 78
280 286 65
281 287 30
282 288 61
283 289 75
284 290 67
285 291 83
286 292 79
287 293 70
288 294 0
289 295 69
290 296 26
291 297 19
292 298 39
293 299 25
294 300 79
295 301 0
296 302 0
297 303 0
298 304 18
299 305 64
300 306 32
301 307 61
302 308 59
303 309 77
304 310 82
305 311 43
306 312 75
307 313 87
308 314 94
309 315 87
310 316 89
311 317 82
312 318 29
313 319 58
314 320 69
315 321 74
316 322 65
317 323 55
318 324 54
319 325 51
320 326 57
321 327 86
322 328 79
323 329 46
324 330 88
325 331 95
326 332 51
327 333 86
328 334 74
329 335 88
330 336 68
331 337 65
332 338 71
333 339 61
334 340 66
335 341 52
336 342 58
337 343 79
338 344 42
339 345 39
340 346 51
341 347 50
342 348 49
343 349 55
344 350 43
345 351 25
346 352 19
347 353 33
348 354 15
349 355 18
350 356 18
351 357 0
352 358 0
353 359 12
354 360 6
355 361 13
356 362 18
357 363 22
358 364 10
359 365 0
360 366 0
361 367 0
362 368 0
363 369 0
364 370 0
365 371 33
366 372 65
367 373 67
368 374 44
369 375 56
370 376 79
371 377 82
372 378 75
373 379 84
374 380 95
375 381 92
376 382 88
377 383 77
378 384 50
379 385 42
380 386 59
또한, 표 9 및 표 10에서 보는 바와 같이, 화합물 1, 화합물 3, 화합물 57, 화합물 58, 화합물 76, 화합물 77, 화합물 79, 화합물 80, 화합물 88, 화합물 113, 화합물 114, 화합물 115, 화합물 116, 화합물 117, 화합물 125, 화합물 136이 SNU638 세포주에서, 화합물 2, 화합물 14, 화합물 24, 화합물 30, 화합물 32, 화합물 36, 화합물 37, 화합물 40, 화합물 41, 화합물 42, 및 화합물 43이 PANC1 세포주에서 농도 의존적으로 WFDC2의 발현을 감소시킴을 확인하였다.
화합물번호 서열번호 억제%
(12.5 nM)
억제%
(25 nM)
억제%
(50 nM)
억제%
(100 nM)
억제%
(200 nM)
억제%
(400 nM)
1 7 72 81 81 77 66 -
3 9 51 53 52 53 53 -
57 63 -  45 50 62 67 68
58 64 -  54 67 69 72 70
76 82 -  34 57 63 63 65
77 83 -  28 53 56 60 63
79 85 -  54 44 48 63 64
80 86 -  46 57 59 62 69
88 93 -  42 48 51 55 47
113 119 72 74 84 70 87 -
114 120 78 77 74 83 79 -
115 121 81 80 83 81 72 -
116 122 91 89 89 96 89 -
117 123 58 81 77 83 62 -
125 131 48 55 50 82 65 -
136 142 44 63 73 75 73 -
화합물번호 서열번호 억제%
(25 nM)
억제%
(50 nM)
억제%
(100 nM)
억제%
(200 nM)
억제%
(400 nM)
2 8 71 33 86 68 79
14 20 20 50 69 57 76
24 30 83 93 94 96 98
30 36 61 96 97 98 99
32 38 9 62 83 94 80
36 42 29 36 77 95 95
37 43 55 73 85 90 93
40 46 74 95 95 98 97
41 47 73 87 91 95 94
42 48 53 69 96 100 100
43 49 32 64 57 49 100
4. WFDC2 발현 저해에 따른 암 증식 억제 효과
위암세포주 SNU638 Xenograft 마우스 모델에 화합물 3을 투여한 결과, 투여 경로와 상관없이 농도 의존적으로 통계적 유의성을 가진 암 증식 억제 효과를 확인할 수 있었으며, 특히, 장기간 투여함에 따라 그 효과가 더욱 커짐을 확인할 수 있었다(도 1 내지 도 4).
또한, 교모세포종 세포주 SF638 Xenograft 마우스 모델에 화합물 3을 꼬리정맥주사로 투여한 결과, 20 mpk 농도에서 통계적 유의성을 가진 암 증식 억제 효과를 확인할 수 있었으며, 특히, 장기간 투여함에 따라 그 효과가 더욱 커짐을 확인할 수 있었다(도 5 및 도 6).
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.

Claims (18)

  1. WFDC2(WAP Four-Disulfide Core Domain 2)를 암호화하는 유전자의 전사체의 핵산 염기서열에 상보적으로 결합하며, 10개 내지 30개의 연속적으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드를 포함하는 안티센스 화합물.
  2. 청구항 1에 있어서,
    상기 WFDC2를 암호화하는 유전자의 전사체의 핵산 염기서열은 서열번호 1 또는 서열번호 2인 것인 안티센스 화합물.
  3. 청구항 1에 있어서,
    상기 안티센스 화합물은 16개 내지 20개의 연속적으로 연결된 뉴클레오시드로 구성된 변형된 올리고뉴클레오티드를 포함하는 것인 안티센스 화합물.
  4. 청구항 1에 있어서,
    상기 변형된 올리고뉴클레오티드는 하나 이상의 변형된 뉴클레오시드 간 연결기, 변형된 당 모이어티(moiety)를 포함하는 하나 이상의 변형된 뉴클레오시드 및 변형된 핵염기를 포함하는 하나 이상의 변형된 뉴클레오시드로부터 선택되는 하나 이상의 변형을 포함하는 것인 안티센스 화합물.
  5. 청구항 4에 있어서,
    상기 변형된 뉴클레오시드는 2'-O-메틸(methyl), 2'-O-메톡시에틸(methoxyethyl), 2'-아미노(amino), 2'-플루오로(fluoro), 2'-아라비노(arabino)-플루오로(fluoro), 2'-O-벤질(benzyl) 및 2'-O-메틸(methyl)-4-피리딘(pyridine)으로 치환된 당 모이어티로 이루어진 군으로부터 선택되는 하나 이상의 변형된 당 모이어티 포함하는 변형된 뉴클레오시드인 것인 안티센스 화합물.
  6. 청구항 4에 있어서,
    상기 변형된 뉴클레오시드는 잠금 핵산(locked nucleic acid, LNA), 컨스트레인 에틸 바이시클릭 핵산(constrained ethyl bicyclic nucleic acid, cEt), 2'-O,4'-C- 에틸렌-브릿지 핵산(2'-O,4'-C-ethylene-bridged nucleic acid, ENA) 및 트리시클로(tricyclo)-DNA으로 이루어진 군으로부터 선택되는 하나 이상의 변형된 뉴클레오시드인 것인 안티센스 화합물.
  7. 청구항 4에 있어서,
    상기 변형된 뉴클레오시드는 6원 고리 또는 무고리 모이어티를 갖는 당 대용물을 포함하는 변형된 뉴클레오시드인 것인 안티센스 화합물.
  8. 청구항 4에 있어서,
    상기 변형된 뉴클레오시드는 슈도유리딘(psudouridine), 2'-티오유리딘(thiouridine), N6'-메틸아데노신(methyladenosine), 5'-메틸시티딘(methylcytidine), 5'-플루오로(fluoro)-2-디옥시유리딘(deoxyuridine), N-에틸피페리딘 7'-EAA 트리아졸 변형 아데닌(N-ethylpiperidine 7'-EAA triazol modified adenine), N-에틸피페리딘 6'-트리아졸 변형 아데닌(N-ethylpiperidine 6'-triazol modified adenine), 6'-페닐피롤로시토신(6'-phenylpyrrolocytosine), 2',4'-디플루오로톨루일리보뉴클레오시드(2',4'-difluorotoluylribonuleoside) 및 5'-니트로인돌(5'-nitroindole)로 이루어진 군으로부터 선택되는 하나 이상의 변형된 핵염기(nucleobase)를 포함하는 변형된 뉴클레오시드인 것인 안티센스 화합물.
  9. 청구항 4에 있어서,
    상기 변형된 뉴클레오시드 간 연결기는 포스포트리에스테르 (phosphotriester), 포스포르아미데이트 (phosphoramidate), 메실 포스포르아미데이트(mesyl phosphoramidate), 포스포로티오에이트(phosphorothioate), 포스포로다이티오에이트(phosphorodithioate), 메틸포스포네이트(methylphosphonate) 및 메톡시프로필-포스포네이트(methoxypropyl-phosphonate) 로 이루어진 군으로부터 선택되는 하나 이상의 변형된 뉴클레오시드 간 연결기인 것인 안티센스 화합물.
  10. 청구항 1에 있어서,
    상기 변형된 올리고뉴클레오티드는 연결된 데옥시뉴클레오시드로 구성된 갭 세그먼트, 연결된 뉴클레오시드로 구성된 5'윙 세그먼트 및 연결된 뉴클레오시드로 구성된 3'윙 세그먼트를 포함하는 것으로, 상기 갭 세그먼트는 5'윙 세그먼트 및 3'윙 세그먼트 사이에 위치하고, 각각의 윙 세그먼트의 뉴클레오시드는 변형된 당 모이어티 또는 당 대용물을 포함하는 것인 안티센스 화합물.
  11. 청구항 1에 있어서,
    상기 변형된 올리고뉴클레오티드는 8개 내지 10개의 연결된 데옥시뉴클레오시드로 이루어진 갭 세그먼트;
    3개 내지 5개의 연결된 뉴클레오시드로 이루어진 5' 윙 세그먼트; 및
    3개 내지 5개의 연결된 뉴클레오시드로 이루어진 3' 윙 세그먼트를 포함하고, 상기 갭 세그먼트는 5' 윙 세그먼트과 3' 윙 세그먼트 사이에 위치하며, 각각의 윙 세그먼트의 각각의 뉴클레오시드는 변형된 당 모이어티를 포함하는 것인 안티센스 화합물.
  12. 청구항 1에 있어서,
    상기 안티센스 화합물은 서열번호 1 또는 서열번호 2와 상보적으로 결합하는 변형된 올리고뉴클레오티드로서, 상기 안티센스 화합물은 서열번호 1의 염기서열 시작부위 25에서 중단부위 46, 시작부위 284에서 중단부위 305, 시작부위 520에서 중단부위 545, 시작부위 2222에서 중단부위 2344, 시작부위 7334에서 중단부위 9301, 시작부위 9506에서 중단부위 9551, 시작부위 9733에서 중단부위 10143, 시작부위 10271에서 중단부위 10302, 시작부위 10360에서 중단부위 10905, 시작부위 10977에서 중단부위 11292, 시작부위 11448에서 중단부위 11563 및 시작부위 11633에서 중단부위 11773으로 이루어진 군으로부터 선택되는 올리고뉴클레오티드 염기서열 중 임의의 서열과 완전히 상보적인 8개 이상의 연속적인 인접 핵염기를 포함하는 염기서열을 갖는 변형된 올리고뉴클레오티드를 포함하며, 상기 변형된 올리고뉴클레오티드는 WFDC의 mRNA 수준 및 단백질 수준으로 이루어진 어느 하나 이상을 감소시키는 것인 안티센스 화합물.
  13. 청구항 1에 있어서,
    상기 안티센스 화합물은 서열번호 1 또는 서열번호 2와 상보적으로 결합하는 변형된 올리고뉴클레오티드로서, 서열번호 7, 서열번호 8, 서열번호 9, 서열번호 20, 서열번호 38, 서열번호 39, 서열번호 42, 서열번호 43, 서열번호 46, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 65, 서열번호 83, 서열번호 86, 서열번호 89, 서열번호 109, 서열번호 113, 서열번호 119, 서열번호 120, 서열번호 121, 서열번호 122, 서열번호 123, 서열번호 129, 서열번호 131, 서열번호 135, 서열번호 136, 서열번호 140, 서열번호 141, 서열번호 142, 서열번호 148, 서열번호 154, 서열번호 155, 서열번호 156, 서열번호 157, 서열번호 165, 서열번호 169, 서열번호 176, 서열번호 191, 서열번호 205, 서열번호 210, 서열번호 213, 서열번호 214, 서열번호 215, 서열번호 218, 서열번호 228, 서열번호 229, 서열번호 237, 서열번호 238, 서열번호 239, 서열번호 240, 서열번호 243, 서열번호 244, 서열번호 245, 서열번호 247, 서열번호 248, 서열번호 249, 서열번호 250, 서열번호 251, 서열번호 252, 서열번호 253, 서열번호 254, 서열번호 255, 서열번호 256, 서열번호 257, 서열번호 258, 서열번호 259, 서열번호 264, 서열번호 282, 서열번호 284, 서열번호 285, 서열번호 286, 서열번호 287, 서열번호 289, 서열번호 290, 서열번호 291, 서열번호 291, 서열번호 292, 서열번호 293, 서열번호 295, 서열번호 300, 서열번호 310, 서열번호 313, 서열번호 314, 서열번호 316, 서열번호 317, 서열번호 320, 서열번호 330, 서열번호 331, 서열번호 336, 서열번호 343, 서열번호 376, 서열번호 377, 서열번호 378, 서열번호 379, 서열번호 380, 서열번호 381, 서열번호 382 및 서열번호 383로 이루어진 군으로부터 선택되는 어느 하나의 올리고뉴클레오티드 염기서열과 완전히 일치하는 8개 이상의 연속적인 인접 핵염기를 포함하는 염기서열을 갖는 변형된 올리고뉴클레오티드를 포함하며, 상기 변형된 올리고뉴클레오티드는 WFDC의 mRNA 수준 및 단백질 수준으로 이루어진 어느 하나 이상을 감소시키는 것인 안티센스 화합물.
  14. 청구항 1에 있어서,
    상기 안티센스 화합물은 서열번호 7, 서열번호 8, 서열번호 9, 서열번호 20, 서열번호 38, 서열번호 39, 서열번호 42, 서열번호 43, 서열번호 46, 서열번호 47, 서열번호 48, 서열번호 49, 서열번호 65, 서열번호 83, 서열번호 86, 서열번호 89, 서열번호 109, 서열번호 113, 서열번호 119, 서열번호 120, 서열번호 121, 서열번호 122, 서열번호 123, 서열번호 129, 서열번호 131, 서열번호 135, 서열번호 136, 서열번호 140, 서열번호 141, 서열번호 142, 서열번호 148, 서열번호 154, 서열번호 155, 서열번호 156, 서열번호 157, 서열번호 165, 서열번호 169, 서열번호 176, 서열번호 191, 서열번호 205, 서열번호 210, 서열번호 213, 서열번호 214, 서열번호 215, 서열번호 218, 서열번호 228, 서열번호 229, 서열번호 237, 서열번호 238, 서열번호 239, 서열번호 240, 서열번호 243, 서열번호 244, 서열번호 245, 서열번호 247, 서열번호 248, 서열번호 249, 서열번호 250, 서열번호 251, 서열번호 252, 서열번호 253, 서열번호 254, 서열번호 255, 서열번호 256, 서열번호 257, 서열번호 258, 서열번호 259, 서열번호 264, 서열번호 282, 서열번호 284, 서열번호 285, 서열번호 286, 서열번호 287, 서열번호 289, 서열번호 290, 서열번호 291, 서열번호 291, 서열번호 292, 서열번호 293, 서열번호 295, 서열번호 300, 서열번호 310, 서열번호 313, 서열번호 314, 서열번호 316, 서열번호 317, 서열번호 320, 서열번호 330, 서열번호 331, 서열번호 336, 서열번호 343, 서열번호 376, 서열번호 377, 서열번호 378, 서열번호 379, 서열번호 380, 서열번호 381, 서열번호 382 및 서열번호 383로 이루어진 군으로부터 선택되는 어느 하나의 염기서열을 갖는 변형된 올리고뉴클레오티드인 것인 안티센스 화합물.
  15. 하나 이상의 비-뉴클레오티드 모이어티에 청구항 1 내지 청구항 14 중 어느 한 항의 안티센스 화합물이 공유 결합된 접합체.
  16. 청구항 15에 있어서,
    상기 비-뉴클레오티드 모이어티는 단백질, 지방산 쇄, 당 잔기, 당단백질, 중합체 또는 이들의 조합을 포함하는 것인 접합체.
  17. 청구항 1 내지 청구항 14 중 어느 한 항의 안티센스 화합물 또는 청구항 15 내지 청구항 16 중 어느 한 항의 접합체를 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물.
  18. 청구항 17에 있어서,
    상기 암은 위암, 식도암, 담관암, 난소암, 자궁경부암, 두경부암, 뇌종양, 폐암, 간암, 갑상선암, 전립선암, 방광암, 신장암, 담낭암, 대장암 및 췌장암으로 이루어진 군으로부터 선택되는 것인 조성물.
PCT/KR2022/013783 2021-09-16 2022-09-15 Wfdc2의 발현을 조절하는 안티센스 화합물 WO2023043220A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202280062781.XA CN117940567A (zh) 2021-09-16 2022-09-15 调控wfdc2的表达的反义化合物

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2021-0124349 2021-09-16
KR20210124349 2021-09-16
KR1020220116229A KR102613178B1 (ko) 2021-09-16 2022-09-15 Wfdc2의 발현을 조절하는 안티센스 화합물
KR10-2022-0116229 2022-09-15

Publications (1)

Publication Number Publication Date
WO2023043220A1 true WO2023043220A1 (ko) 2023-03-23

Family

ID=85603252

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/013783 WO2023043220A1 (ko) 2021-09-16 2022-09-15 Wfdc2의 발현을 조절하는 안티센스 화합물

Country Status (2)

Country Link
KR (2) KR102575703B1 (ko)
WO (1) WO2023043220A1 (ko)

Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US5013830A (en) 1986-09-08 1991-05-07 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
WO1993007883A1 (en) 1991-10-24 1993-04-29 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
US5491133A (en) 1987-11-30 1996-02-13 University Of Iowa Research Foundation Methods for blocking the expression of specifically targeted genes
US5565350A (en) 1993-12-09 1996-10-15 Thomas Jefferson University Compounds and methods for site directed mutations in eukaryotic cells
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
KR20040062534A (ko) * 2001-08-29 2004-07-07 퍼시픽 노쓰웨스트 리서치 인스티튜트 암 진단
US7811778B2 (en) 2006-09-06 2010-10-12 Vanderbilt University Methods of screening for gastrointestinal cancer
WO2012170513A2 (en) * 2011-06-06 2012-12-13 Women & Infants' Hospital Of Rhode Island He4 based therapy for malignant disease
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
KR102055305B1 (ko) 2018-02-20 2019-12-13 서울대학교병원 위식도경계부선암의 진단 및 표적 치료를 위한 마커

Patent Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US5013830A (en) 1986-09-08 1991-05-07 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5491133A (en) 1987-11-30 1996-02-13 University Of Iowa Research Foundation Methods for blocking the expression of specifically targeted genes
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5366878A (en) 1990-02-15 1994-11-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
WO1993007883A1 (en) 1991-10-24 1993-04-29 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5565350A (en) 1993-12-09 1996-10-15 Thomas Jefferson University Compounds and methods for site directed mutations in eukaryotic cells
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
KR20040062534A (ko) * 2001-08-29 2004-07-07 퍼시픽 노쓰웨스트 리서치 인스티튜트 암 진단
US7811778B2 (en) 2006-09-06 2010-10-12 Vanderbilt University Methods of screening for gastrointestinal cancer
WO2012170513A2 (en) * 2011-06-06 2012-12-13 Women & Infants' Hospital Of Rhode Island He4 based therapy for malignant disease
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
KR102055305B1 (ko) 2018-02-20 2019-12-13 서울대학교병원 위식도경계부선암의 진단 및 표적 치료를 위한 마커

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. NC_000020.11
"Remington: The Science and Practice of Pharmacy", 2013, PHARMACEUTICAL PRESS
"The Concise Encyclopedia Of Polymer Science And Engineering", 1990, JOHN WILEY & SONS, pages: 858 - 859
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990
CHEN YAO, HUANG LIPING, WANG SUIHAI, LI JI-LIANG, LI MING, WU YINGSONG, LIU TIANCAI: "WFDC2 contributes to epithelial–mesenchymal transition (EMT) by activating AKT signaling pathway and regulating MMP-2 expression", CANCER MANAGEMENT AND RESEARCH, vol. Volume 11, 31 January 2019 (2019-01-31), pages 2415 - 2424, XP093049433, DOI: 10.2147/CMAR.S192950 *
CHEN YAO, MU XIA, WANG SUIHAI, ZHAO LIANG, WU YINGSONG, LI JILIANG, LI MING: "WAP four-disulfide core domain protein 2 mediates the proliferation of human ovarian cancer cells through the regulation of growth- and apoptosis-associated genes", ONCOLOGY REPORTS, SPANDIDOS PUBL., vol. 29, no. 1, 1 January 2013 (2013-01-01), pages 288 - 296, XP093048868, ISSN: 1021-335X, DOI: 10.3892/or.2012.2114 *
ENGLISCH ET AL., ANGEWANDTE CHEMIE, INTERNATIONAL EDITION, vol. 30, 1991, pages 613
MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504
MOORE RICHARD G., HILL EMILY K., HORAN TIMOTHY, YANO NAOHIRO, KIM KYUKWANG, MACLAUGHLAN SHANNON, LAMBERT-MESSERLIAN GERALYN, TSENG: "HE4 (WFDC2) gene overexpression promotes ovarian tumor growth", SCIENTIFIC REPORTS, vol. 4, no. 1, pages 1 - 7, XP093049430, DOI: 10.1038/srep03574 *
P.E. NIELSENM. EGHOLM: "Peptide Nucleic Acids: Protocols and Applications", 2004, HORIZON BIOSCIENCE, article "An Introduction to PNA", pages: 9
SANGHVI, Y. S.: "Antisense Research and Applications", 1993, CRC PRESS, pages: 289 - 302
SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981
ZHANGMADDEN, GENOME RES., vol. 7, 1997

Also Published As

Publication number Publication date
KR20230042672A (ko) 2023-03-29
KR20230163998A (ko) 2023-12-01
KR102575703B1 (ko) 2023-09-07

Similar Documents

Publication Publication Date Title
CA2970801C (en) Ligand-modified double-stranded nucleic acids
CA2519860C (en) Short interfering rna (sirna) analogues
US8987435B2 (en) Oligomeric compounds and methods
EA031110B1 (ru) Конъюгаты бороновых кислот олигонуклеотидных аналогов
CN112055749A (zh) Fubp1抑制剂用于治疗乙型肝炎病毒感染的用途
CN112912500A (zh) 用于调节atxn2表达的寡核苷酸
CN111868245A (zh) 用于调节tmem106b表达的寡核苷酸
WO2016196670A1 (en) Antisense-induced exon exclusion in type vii collagen
WO2023043220A1 (ko) Wfdc2의 발현을 조절하는 안티센스 화합물
US20230002762A1 (en) Oligonucleotides comprising a phosphorodithioate internucleoside linkage
KR102613178B1 (ko) Wfdc2의 발현을 조절하는 안티센스 화합물
WO2021194179A1 (ko) Stat3 및 mtor를 이중 특이적으로 표적하는 핵산서열을 포함한 항암 바이러스
CN117916374A (zh) 用于寡核苷酸剂的基于寡核苷酸的递送载体及其使用方法
US20200385714A1 (en) Oligonucleotides for modulating fndc3b expression
US20200216845A1 (en) Antisense oligonucleotides for modulating rela expression
CN111615558A (zh) 用于调节erc1表达的寡核苷酸
WO2019103578A1 (ko) 올리고뉴클레오티드 및 이를 포함하는 암의 예방 또는 치료용 약학적 조성물
WO2019115417A2 (en) Oligonucleotides for modulating rb1 expression
US20210095274A1 (en) Oligonucleotides for modulating pias4 expression
US20210095275A1 (en) Oligonucleotides for modulating gsk3b expression
WO2019145386A1 (en) Oligonucleotides for modulating csnk1d expression
WO2024137543A1 (en) Advanced rna targeting (arnatar)
WO2023225495A2 (en) Compositions and methods for treatment of microsatellite dna expansion disorders
KR20240082367A (ko) 치료학적 물질로서 고리형 구조의 올리고뉴클레오티드
CN116370491A (zh) 反义寡核苷酸剂在治疗冠状病毒相关疾病中的应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22870304

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 202280062781.X

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 2022870304

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022870304

Country of ref document: EP

Effective date: 20240416