WO2023031934A1 - Agents ciblant le domaine riche en glycine et en arginine (gar) de la nucléoline et leurs utilisations - Google Patents

Agents ciblant le domaine riche en glycine et en arginine (gar) de la nucléoline et leurs utilisations Download PDF

Info

Publication number
WO2023031934A1
WO2023031934A1 PCT/IL2022/050958 IL2022050958W WO2023031934A1 WO 2023031934 A1 WO2023031934 A1 WO 2023031934A1 IL 2022050958 W IL2022050958 W IL 2022050958W WO 2023031934 A1 WO2023031934 A1 WO 2023031934A1
Authority
WO
WIPO (PCT)
Prior art keywords
agent
nucleolin
gar
domain
peptide
Prior art date
Application number
PCT/IL2022/050958
Other languages
English (en)
Inventor
Michael Fainzilber
Ofri ABRAHAM
Ida RISHAL
Ella DORON- MANDEL
Indrek Koppel
Stanley Thomas CARMICHAEL, Jr
Samuel Patrick BRIDGES
Original Assignee
Yeda Research And Development Co. Ltd.
Ucla Technology Development Group (Tdg)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yeda Research And Development Co. Ltd., Ucla Technology Development Group (Tdg) filed Critical Yeda Research And Development Co. Ltd.
Publication of WO2023031934A1 publication Critical patent/WO2023031934A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis

Definitions

  • the present invention in some embodiments thereof, relates to agents that bind to the glycine arginine rich (GAR) domain of nucleolin and uses thereof for the treatment of cancer and for the promotion of neural regeneration.
  • GAR glycine arginine rich
  • Nucleolin is a multifunctional, highly-conserved, abundant RNA Binding Protein (RBP) that is found in multiple subcellular compartments, including a relatively stable major nucleolar pool, and more dynamic nucleoplasmic, cytoplasmic and plasma membrane complexes (Berger et al, 2015).
  • the protein has been implicated in many cellular processes, including ribosome biogenesis, division and survival of cycling cells, oncogenesis and tumor growth, as well as size and length sensing in neurons and other large cells (Rishal & Fainzilber, 2019; Ugrinova et al, 2018) and has been shown to be essential for cell viability (Storck et al, 2009; Ugrinova et al, 2007). Its cell-surface localization in tumor cells has been exploited in development of anticancer therapies (Berger et al., 2015; Gilles et al, 2016; Romano et al, 2019).
  • Nucleolin is composed of a number of functional domains, including an amino-terminal charged region, a central region comprising four RNA-binding domains, and a carboxy-terminal glycine/arginine-rich (GAR) domain ( Figure 1A).
  • nucleolin is required for axonal trafficking of mRNAs that regulate neuronal growth or survival (Perry et al, 2016; Terenzio et al, 2018), and this RBP has been proposed as a key component in a cell size sensing mechanism based on transport of mRNA from cell center to periphery, and retrograde transport of locally synthesized proteins encoded by these mRNAs (Rishal & Fainzilber, 2019; Rishal et al, 2012). Nucleolin was shown to associate with the molecular motor kinesin 1 (Kif5a) during axonal transport (Perry et al., 2016).
  • AS 1411 is a 26-base pair guanine-rich oligonucleotide apatamer to nucleolin, which has been shown to have selective anticancer activity in a variety of tumor cell lines.
  • AS 1411 is the first aptamer to successfully progress to clinical trials. Previous studies have shown that AS 1411 induces a non-apoptotic mechanism of cell death known as methuosis. Anticancer effects of AS 1411 have been well described in breast, lung, prostate, and renal cell cancers (Bates et al., 2017). AS 1411 has been shown to perturb the association of nucleolin with the Kif5a motor complex (Perry et al., 2016).
  • a method of treating a neuronal injury in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an agent that specifically binds to the GAR domain of nucleolin, thereby treating the neuronal injury in the subject.
  • a method of treating a neuronal injury in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a GAR domain of nucleolin which competes with nucleolin binding to a target thereof, thereby treating the neuronal injury in the subject.
  • the agent is a peptide agent that comprises a sequence of the GAR domain of nucleolin.
  • an agent that specifically binds to the GAR domain of nucleolin, for use in treating a neuronal injury in a subject.
  • a peptide agent which comprises a GAR domain of nucleolin which competes with nucleolin binding to a target thereof, for use in treating a neuronal injury in a subject.
  • the agent is not (+)-Fangchinoline.
  • a method of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an agent that specifically binds to the GAR domain of nucleolin, thereby treating the cancer, with the proviso that the agent is not AS 1411.
  • an agent that specifically binds to the GAR domain of nucleolin for use in treating cancer in a subject, with the proviso that the agent is not AS 1411.
  • the agent is not (+)-Fangchinoline, palmatine, Obatoclax mesylate, BIX 01294 or CEP33779.
  • the agent binds with at least two fold higher affinity to the GAR domain of nucleolin than to a protein selected from the group consisting of BC12, G9a histone methyltransferase, Jak2, AChE and SIRT1.
  • the agent binds with at least two fold higher affinity to the GAR domain than to another domain of the nucleolin.
  • the agent is an aptamer.
  • the agent is a small molecule.
  • the neuronal injury is brought about by a neurodegenerative disease, stroke, a traumatic brain injury, a spinal cord injury, a peripheral nerve injury or an eye injury.
  • the neuronal injury is brought about by a stroke.
  • the neurodegenerative disease is selected from the group consisting of Amyotrophic Lateral Sclerosis (ALS), Parkinson's disease, Multiple System Atrophy (MSA), Huntington's disease, Alzheimer's disease, Rett Syndrome and Multiple Sclerosis (MS).
  • ALS Amyotrophic Lateral Sclerosis
  • MSA Multiple System Atrophy
  • MSA Huntington's disease
  • Alzheimer's disease Rett Syndrome
  • MS Multiple Sclerosis
  • the agent binds to the peptide having an amino acid sequence as set forth in FGGRGRGGFGGRGGF (SEQ ID NO: 1) with at least two fold higher affinity that to the peptide having an amino acid sequence as set forth in FGGAGAGGFGGAGGF (SEQ ID NO: 2).
  • the agent binds to the peptide having an amino acid sequence as set forth in FGGRGRGGFGGRGGFRGG (SEQ ID NO: 3) with at least two fold higher affinity that to the peptide having an amino acid sequence as set forth in FGGNGNGGFGGNGGFNGG (SEQ ID NO: 4).
  • the agent is selected from the group consisting of Cefepime Dihydrochloride Monohydrate, SRT1720 HC1, palmatine, Jatrorrhizine, Dehydroevodiamine, Obatoclax mesylate, BIX 01294 and CEP33779.
  • the agent is selected from the group consisting of Cefepime Dihydrochloride Monohydrate, SRT1720 HC1, Jatrorrhizine and Dehydroevodiamine, Obatoclax mesylate, BIX 01294 and CEP33779.
  • an aptamer that specifically binds to the GAR domain of nucleolin, with the proviso that the agent is not AS1411.
  • the nucleolin GAR domain binding agent is an aptamer.
  • the aptamer is AS 1411.
  • the peptide is conjugated to a detectable moiety.
  • the detectable moiety is a member of a Forster Resonance Energy Transfer (FRET) pair.
  • FRET Forster Resonance Energy Transfer
  • the nucleolin GAR domain binding agent is conjugated to a second member of said FRET pair.
  • the peptide comprises an amino acid sequence as set forth in SEQ ID NOs: 1 or 3.
  • the neuronal injury is brought about by a neurodegenerative disease, stroke, a traumatic brain injury, a spinal cord injury, a peripheral nerve injury or an eye injury.
  • the neurodegenerative disease is selected from the group consisting of Amyotrophic Lateral Sclerosis (ALS), Parkinson's disease, Multiple System Atrophy (MSA), Huntington's disease, Alzheimer's disease, Rett Syndrome and Multiple Sclerosis (MS).
  • ALS Amyotrophic Lateral Sclerosis
  • MSA Multiple System Atrophy
  • MS Huntington's disease
  • Alzheimer's disease Rett Syndrome
  • MS Multiple Sclerosis
  • FIGs. 1A-B The nucleolin GAR domain binds DNA aptamer AS1411.
  • A3 designates the R3 peptide with three arginines substituted with alanines
  • N4 designates the R4 peptide with four arginines substituted with asparagines.
  • FIGs. 2A-G Nucleolin-kinesin interaction is directly mediated by the GAR domain.
  • Co-immunoprecipitation analysis of Kif5a and HA-Dendra2-tagged nucleolin both overexpressed in HEK-293 cells. IP was performed with HA antibody and probed in Western blot with anti-Kif5a and anti-HA antibodies.
  • HA input blots for HA- Dendra2 (Dendra) and the other three constructs are from the same membrane, but shown discontinuously owing to the different migration of these proteins in PAGE.
  • B. Quantification of (A), n 3 independent biological repeats; means ⁇ SEM; **** p ⁇ 0.0001, ANOVA with Tukey’s post-test.
  • FIGs. 3A-G GAR domain interactions with phospholipid membranes.
  • n 3 independent biological repeats; means + SEM; * p ⁇ 0.05, paired Student’s t-test a. u. - arbitrary units.
  • Glyceraldehyde 3-phosphate dehydrogenase Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and importin
  • HEK-293 cells were transfected with plasmids expressing HA-Dendra2- full length nucleolin (Nel FL), HA-Dendra2-nucleolin with a GAR domain deletion (Nel AGAR) or HA- Dendra2-nucleolin with all 10 arginines in the GAR domain mutated to asparagines (Nel GAR(N)) and processed as in (E).
  • FIGs. 4A-D GAR domain and nucleolar localization of nucleolin.
  • FIGs. 5A-C Reduced levels of axonal nucleolin in nucleolin GAR +/ “ mice.
  • A Targeted deletion of nucleolin GAR domain by CRISPR-Cas9. Schematic shows mouse nucleolin exons targeted by single guide RNAs (sgRNAs) and resulting deletion in the GAR domain amino acid sequence. Wild-type (SEQ ID NO: 7), GAR deletion (SEQ ID NO: 15).
  • FIGs. 6A-D Reduced levels of full length axonal nucleolin increase axonal outgrowth in DRG neurons.
  • FIGs. 7A-B Essential roles for the GAR domain in subcellular localization of nucleolin.
  • the nucleolin GAR domain binds a kinesin light chain, directly linking nucleolin- mRNA complexes to kinesin motors for axonal transport (A).
  • the GAR domain further mediates membrane association of nucleolin.
  • GAR-mediated subcellular targeting of nucleolin complexes enables export of key mRNAs to the axon, and the local translation of their encoded proteins for local functions in the axon, or for retrograde transport to the cell body.
  • This reciprocal transport mechanism provides intrinsic regulation of axon length and growth, and indeed deletion or mutation of the GAR domain (B) perturbs mRNA localization to axons and increases axonal elongation.
  • FIGs. 8A-D Cell volume and proliferation measurements.
  • Cells were grown in the presence of 10 uM AS1411, 10 uM control aptamer or left untreated and grown for 48 or 96 h when cell volume was scored using forward scatter in FACS (A), and cell proliferation using the MTT assay (B).
  • A forward scatter in FACS
  • B cell proliferation using the MTT assay
  • three (of 9 tested) cell lines are shown that demonstrated cell volume increase at either 48 or 96 h or both.
  • Mean values ⁇ SEM of three independent experiments are shown, expressed as percentages relative to vehicle-treated controls. * p ⁇ 0.05, ** p ⁇ 0.01 - Student’s unpaired t-test.
  • FIGs. 9A-C Probing GAR-AS1411 interaction by TR-FRET assay
  • the TR-FRET assay is based on excitation of a donor Lanthanide (Terbium/Tb) at 340nm, which emits at multiple wavelength. Terbium is conjugated to Streptavidin, which allows tight coupling to molecular components via respective biotin conjugates.
  • Tebium/Tb donor Lanthanide
  • Streptavidin Streptavidin
  • AS 1411 is conjugated with Cy2 and when it binds to GAR, it comes in close proximity to Tb, therefore allowing energy transfer (FRET) between 340nm-excited Tb and Cy2, due to the emissionexcitation overlap at 490nm.
  • FRET signal is measured by normalizing the intensity of Cy2- specific emission (520nm) to that of the Tb donor (620nm).
  • C TR-FRET was measured every 15 minutes in the course of 120 minutes for different mixes of GAR & AS 1411 conjugated to donor and acceptor molecules. Unlabeled AS1411 was added at lOx concentration over AS1411- Cy2 to sequester the latter interaction with GAR and hence reduce the FRET signal between Cy2 and Tb.
  • FIG. 10 GAR-AS1411 interaction inhibitors from TR-FRET pre-screen Table containing effective molecules from 1190 compounds tested by automated TR-FRET assay. Compounds were selected based on a threshold FRET inhibitory effect of more than 3 standard deviations over undisturbed baseline FRET signal. Compounds with known Streptavidin binding or DNA chelation activity were omitted.
  • FIGs. 11A-C Axonal sprouting after stroke with viral overexpression of nucleolin GAR domain.
  • A Timeline of experiment. Stroke is induced in mice and the GAR-expressing or control virus is delivered in premotor cortex. After 30 days, mice are euthanized, and the axons of the neurons with GAR or control virus are mapped. The quantitative maps of axonal density and location were statistically compared in viral GAR delivery mice vs. control virus mice.
  • the axonal maps of the two conditions are statistically different (Hotelling’s t 2 statistic), with an increased axonal projection of premotor cortex in the viral GAR mice.
  • C Polar distribution map in register with connectional plot in the left panel. For each treatment condition, the x/y coordinate of every labeled axonal process was converted to an equivalent polar coordinate relative to the virus injection site as center. The increase in axonal projections in premotor cortex in the viral GAR (red) is apparent.
  • the present invention in some embodiments thereof, relates to agents that bind to the glycine arginine rich (GAR) domain of nucleolin and uses thereof for the treatment of cancer and for the promotion of neural regeneration.
  • GAR glycine arginine rich
  • Nucleolin is a multifunctional RNA Binding Protein (RBP) with diverse subcellular localizations, including the nucleolus in all eukaryotic cells, the plasma membrane in tumor cells, and the axon in neurons.
  • RBP RNA Binding Protein
  • the present inventors have now established that the GAR domain is a key determinant of nucleolin subcellular localization, most prominently directing its transport on kinesin motors to cytoplasmic extremities of the cell ( Figures 7A-B). Perturbation of GAR-mediated axonal localization of nucleolin was shown to enhance axon growth ( Figures 6A-D). Accordingly, the present inventors propose that agents capable of preventing kinesin and associated proteins from binding to the GAR domain of nucleolin should also stimulate neuronal growth and be useful in the treatment of neurodegenerative diseases and other neuronal damage. For example, a peptide agent that comprises the GAR domain itself was shown to be effective in the treatment of stroke ( Figures 11A-C).
  • the GAR domain In addition to associating with kinesin motor complexes, the GAR domain also enables nucleolin association with the plasma membrane, and contributes to maintaining nucleolin within the nucleolus, a canonical membraneless organelle.
  • a method of treating a neuronal injury in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an agent that specifically binds to the GAR domain of nucleolin, thereby treating the neuronal injury in the subject.
  • a method of treating a neuronal injury in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an agent that specifically reduces the amount of a nucleolin- binding moiety from binding to the GAR domain of nucleolin, thereby treating the neuronal injury in the subject.
  • the neuronal injury may be the result of a disease, such as for example a neurodegenerative disease.
  • neurodegenerative disease is used herein to describe a disease which is caused by damage to the central nervous system.
  • exemplary neurodegenerative diseases which may be treated using the cells and methods according to the present invention include for example: Amyotrophic Lateral Sclerosis (ALS), Parkinson's disease, Multiple System Atrophy (MSA), Huntington's disease, Alzheimer's disease, Rett Syndrome, lysosomal storage diseases ("white matter disease” or glial/demyelination disease, as described, for example by Folkerth, J. Neuropath. Exp. Neuro., September 1999, 58:9), including Sanfilippo, Gaucher disease, Tay Sachs disease (beta hexosaminidase deficiency), other genetic diseases, multiple sclerosis (MS).
  • Neurodegenerative diseases also include neurodevelopmental disorders including for example, autism-spectrum disorders and related neurological diseases such as schizophrenia, among numerous others.
  • the present invention may be used to reduce and/or eliminate the effects on the central nervous system of a stroke in a patient, which is otherwise caused by lack of blood flow or ischemia to a site in the brain of the patient or which has occurred from physical injury to the brain and/or spinal cord.
  • the neuronal injury may be a brain injury or trauma caused by ischemia, accidents, environmental insult, etc., spinal cord damage, ataxia.
  • Nucleolin is a multi-functional protein that binds to DNA, RNA and the external surface of the plasma membrane.
  • the human nucleolin gene consists of 14 exons with 13 introns and spans approximately 11 kb.
  • the nucleolin protein contains several functional domains that mediate its functions.
  • the N-terminal part contains multiple phosphorylation sites and is rich in acidic amino acids.
  • the central part of nucleolin includes four RNA binding domains (RBD) and the C-terminal part contains glycine and arginine rich domain (termed RGG or GAR domain).
  • nucleolin gene coding and protein sequences can be accessed at accession number NM_005381, XM_002342275, NP_005372 and XP_002342316.
  • Nucleolin is also known as C23, FLJ45706, FLJ59041 and NCL.
  • GAR domain refers to a domain of nucleolin which comprises spaced Arg- Gly-Gly (RGG) repeats interspersed with amino acids, which are often aromatics.
  • the GAR domain of nucleolin comprises the amino acid sequence as set forth in SEQ ID NOs: 1 or 3.
  • the mouse GAR domain comprises the sequence as set forth in SEQ ID NO: 5
  • mice GAR domain sequence is set forth in SEQ ID NO: 7
  • the agent used for treating the neuronal injury specifically binds to the GAR domain of nucleolin.
  • nucleolin As used herein “specifically” refers to a binding preference to the GAR domain of nucleolin as compared to other nucleolin domains.
  • the agent binds to the GAR domain of nucleolin with a KD of 10’ 6 M or less, such as approximately less than 10’ 7 M, 10’ 8 M, 10’ 9 M or IO’ 10 M or even lower.
  • the agents disclosed herein bind with at least two fold higher affinity, five fold higher affinity, 10 fold higher affinity to the GAR domain of nucleolin than to a protein selected from the group consisting of BCh, G9a histone methyltransferase, Jak2, AChE and SIRT1.
  • the agents disclosed herein binds with at least two fold higher affinity, 5 fold higher affinity or even 10 fold higher affinity to the GAR domain than to another domain of the nucleolin.
  • the agents disclosed herein may binds with at least two fold higher affinity, 5 fold higher affinity or even 10 fold higher affinity to the peptide having an amino acid sequence as set forth in SEQ ID NO: 1 than to the peptide having an amino acid sequence as set forth in SEQ ID NO: 2.
  • the agents disclosed herein may binds with at least two fold higher affinity, 5 fold higher affinity or even 10 fold higher affinity to the peptide having an amino acid sequence as set forth in SEQ ID NO: 3 than to the peptide having an amino acid sequence as set forth in SEQ ID NO: 4.
  • Exemplary small molecule agents that were shown to specifically bind to the GAR domain of nucleolin include Cefepime Dihydrochloride Monohydrate, SRT1720 HC1, palmatine, latrorrhizine, Dehydroevodiamine, Obatoclax mesylate, BIX 01294 and CEP33779.
  • the small molecule agent is not (+)-Fangchinoline.
  • the agent which binds specifically to the GAR domain of nucleolin is an aptamer.
  • aptamer refers to a single- stranded nucleic acid molecule typically no longer than 200 bases (more preferably 100 bases) which binds specifically to a target.
  • the aptamer is a G-rich DNA aptamer. In another embodiment the aptamer is an RNA aptamer.
  • the aptamer is between 3-20 kDa.
  • the aptamer is AS 1411 (GGTGGTGGTGGTTGTGGTGGTGGTGG; SEQ ID NO: 8).
  • Example 3 An exemplary method for identifying additional agents that bind to the nucleolin GAR domain is disclosed in Example 3. Further details of this assay are provided herein below.
  • the agent used for treating the neuronal injury specifically reduces the amount of at least one nucleolin-binding moiety from binding to the GAR domain of nucleolin.
  • agents include peptide agents or nucleic acid agents that encode the peptides, that sequester the nucleolin binding moieties, so as to reduce their binding to native nucleolin.
  • the agent comprises the amino acid sequence as set forth in SEQ ID NOs: 1 or 3.
  • an exemplary agent comprises the amino acid sequence as set forth in SEQ ID NO: 6.
  • the nucleolin-binding moiety is a protein.
  • nucleolin-binding moieties including components of a kinesin complex, such as kinesin light chain 2 (KLC2).
  • KLC2 kinesin light chain 2
  • the peptides of some embodiments of the invention may be synthesized by any techniques that are known to those skilled in the art of peptide synthesis.
  • solid phase peptide synthesis a summary of the many techniques may be found in J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, W. H. Freeman Co. (San Francisco), 1963 and J. Meienhofer, Hormonal Proteins and Peptides, vol. 2, p. 46, Academic Press (New York), 1973.
  • For classical solution synthesis see G. Schroder and K. Lupke, The Peptides, vol. 1, Academic Press (New York), 1965.
  • these methods comprise the sequential addition of one or more amino acids or suitably protected amino acids to a growing peptide chain.
  • amino acids or suitably protected amino acids Normally, either the amino or carboxyl group of the first amino acid is protected by a suitable protecting group.
  • the protected or derivatized amino acid can then either be attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complimentary (amino or carboxyl) group suitably protected, under conditions suitable for forming the amide linkage.
  • the protecting group is then removed from this newly added amino acid residue and the next amino acid (suitably protected) is then added, and so forth. After all the desired amino acids have been linked in the proper sequence, any remaining protecting groups (and any solid support) are removed sequentially or concurrently, to afford the final peptide compound.
  • a preferred method of preparing the peptide compounds of some embodiments of the invention involves solid phase peptide synthesis.
  • the peptides are purified (e.g. >80% purity, >85% purity, >90% purity, >95% purity).
  • the agent is a peptide agent and linked to a cell penetrating agent.
  • penetrating agent refers to an agent which enhances translocation of an attached polypeptide across a cell membrane.
  • the penetrating agent is a peptide and is attached to the C or N terminus of the peptide (either directly or non-directly) via a peptide bond.
  • cell penetrating peptides typically have an amino acid composition containing either a high relative abundance of positively charged amino acids such as lysine or arginine, or have sequences that contain an alternating pattern of polar/charged amino acids and non-polar, hydrophobic amino acids.
  • the peptides of the present invention are attached to the cell penetrating peptides via a linking moiety.
  • a myristoyl group (derived from myristic acid) is covalently attached via an amide bond to the alpha- amino group of an N-terminal amino acid of the peptide.
  • peptides can also be recombinantly produced using the nucleic acids described herein using standard recombinant methods. See, for instance, Green and Sambrook, Molecular Cloning: A Laboratory Manual, 4.sup.th ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2012).
  • the nucleic acids of the invention can be incorporated into a recombinant expression vector.
  • the term "recombinant expression vector” means a genetically- modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell.
  • the vectors of the invention are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring.
  • the inventive recombinant expression vectors can comprise any type of nucleotide, including, but not limited to DNA and RNA, which can be single- stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides.
  • the recombinant expression vectors can comprise naturally-occurring, non-naturally-occurring internucleotide linkages, or both types of linkages.
  • the non-naturally occurring or altered nucleotides or internucleotide linkages does not hinder the transcription or replication of the vector.
  • the recombinant expression vector of the invention can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host cell.
  • Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses.
  • the vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences), the pBluescript series (Stratagene, LaJolla, Calif.), the pET series (Novagen, Madison, Wis.), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, Calif.).
  • Bacteriophage vectors such as lamdaGTIO, lamdaGTl l, lamdaZapII (Stratagene), lamdaEMBL4, and lamdaNM1149, also can be used.
  • plant expression vectors include pBIOl, pBI101.2, pBI101.3, pBH21 and pBIN19 (Clontech).
  • animal expression vectors include pEUK-Cl, pMAM and pMAMneo (Clontech).
  • the recombinant expression vector is a viral vector, e.g., a retroviral vector.
  • a method of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an agent that specifically binds to the GAR domain of nucleolin, thereby treating the cancer, with the proviso that the agent is not AS 1411.
  • Agents for treating cancer include both peptide agents, nucleic acid based agents (e.g. aptamer) and small molecule agents.
  • small molecule agents include, but are not limited to Cefepime Dihydrochloride Monohydrate, SRT1720 HC1, Jatrorrhizine and Dehydroevodiamine, Obatoclax mesylate, BIX 01294 and CEP33779.
  • the small molecule agent is not (+)-Fangchinoline, palmatine, Obatoclax mesylate, BIX 01294 or CEP33779.
  • Exemplary cancers include but are not limited to adrenocortical carcinoma, hereditary; bladder cancer; breast cancer; breast cancer, ductal; breast cancer, invasive intraductal; breast cancer, sporadic; breast cancer, susceptibility to; breast cancer, type 4; breast cancer, type 4; breast cancer- 1; breast cancer-3; breast-ovarian cancer; triple negative breast cancer, Burkitt’s lymphoma; cervical carcinoma; colorectal adenoma; colorectal cancer; colorectal cancer, hereditary nonpolyposis, type 1; colorectal cancer, hereditary nonpolyposis, type 2; colorectal cancer, hereditary nonpolyposis, type 3; colorectal cancer, hereditary nonpolyposis, type 6; colorectal cancer, hereditary nonpolyposis, type 7; dermatofibrosarcoma protuberans; endometrial carcinoma; esophageal cancer; gastric cancer, fibrosarcoma, glio
  • the agents can be provided to the subject per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.
  • a "pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
  • the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
  • active ingredient refers to the multispecific antibody accountable for the biological effect.
  • physiologically acceptable carrier and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
  • An adjuvant is included under these phrases.
  • excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
  • excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
  • Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.
  • neurosurgical strategies e.g., intracerebral injection or intracerebroventricular infusion
  • molecular manipulation of the agent e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB
  • pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers)
  • the transitory disruption of the integrity of the BBB by hyperosmotic disruption resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide).
  • each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.
  • compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
  • physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
  • Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
  • Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
  • disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
  • compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
  • the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
  • a suitable vehicle e.g., sterile, pyrogen-free water based solution
  • compositions of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
  • compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (multispecific antibody) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., cancer) or prolong the survival of the subject being treated.
  • a therapeutically effective amount means an amount of active ingredients (multispecific antibody) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., cancer) or prolong the survival of the subject being treated.
  • the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
  • a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
  • Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
  • the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage may vary depending upon the dosage form employed and the route of administration utilized.
  • the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.l).
  • Dosage amount and interval may be adjusted individually to provide tissue levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC).
  • MEC minimum effective concentration
  • the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
  • dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
  • compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
  • compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
  • Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.
  • the present inventors have developed an assay which can be used to screen for agents which bind to the GAR domain of nucleolin that may be useful for treating a neuronal injury (as described herein above) or cancer (as described herein above).
  • a method of identifying an agent useful for treating a neuronal injury or cancer comprising:
  • the GAR domain peptide typically comprises a detectable moiety.
  • radioactive isotope such as [125]iodine
  • phosphorescent chemical such as [125]iodine
  • chemiluminescent chemical such as a chemiluminescent chemical
  • fluorescent chemical fluorophore
  • Fluorescence detection methods which can be used to detect binding include, for example, fluorescence activated flow cytometry (FACS), immunofluorescence confocal microscopy, fluorescence in-situ hybridization (FISH) and fluorescence resonance energy transfer (FRET).
  • FACS fluorescence activated flow cytometry
  • FISH fluorescence in-situ hybridization
  • FRET fluorescence resonance energy transfer
  • the detectable moiety is a member of a Forster Resonance Energy Transfer (FRET) pair, whereby a known GAR domain binding agent (e.g. AS 1411) is conjugated to a second member of the FRET pair.
  • FRET Forster Resonance Energy Transfer
  • the FRET pair comprises a donor moiety and an acceptor moiety as further described herein below.
  • FRET fluorescence technique e.g., proximity ligation (PLA), bimolecular fluorescence complementation (BiFC) and fluorescence cross-correlation spectroscopy (FCS)
  • PHA proximity ligation
  • BiFC bimolecular fluorescence complementation
  • FCS fluorescence cross-correlation spectroscopy
  • donor fluorophore refers to a light-sensitive, fluorescence emitting molecule, which initially in its electronic excited state, may transfer energy to "acceptor fluorophore" through non-radiative dipole-dipole coupling.
  • the donor fluorophore must be bright (having high quantum yield and high absorption coefficient), stable (having long-living fluorescent excited state and low photo bleaching), and insensitive to the acceptor fluorophore excitation light.
  • acceptor fluorophore refers to a light-sensitive molecule, which initially in its ground-level electronic state may accept energy from "donor fluorophore” through non-radiative dipole-dipole coupling.
  • the acceptor fluorophore must have a large Forster distance Ro from the donor fluorophore (high spectral overlap of the absorption spectrum of an acceptor fluorophore with the fluorescence emission spectrum of a donor fluorophore), low photobleaching, must be insensitive to the donor fluorophore excitation light, having no crosstalk of its fluorescence emission spectrum with the fluorescence emission spectrum of the donor fluorophore, and must be capable of undergoing reversible saturation of its fluorescence emission under light excitation.
  • Synthetic fluorophores used in the present invention may include, but are not limited to generic or proprietary fluorophores listed in Table 1 below:
  • donor fluorophores that can be used with the peptides of the present invention, and the known GAR domain-binding agent (e.g. AS 1411) include but are not limited to: CAL Fluor® Gold 540, CAL Fluor® Orange 560, Quasar® 670, Quasar® 705, 5-FAM (also called 5- carboxyfluorescein; also called Spiro(isobenzofuran-1(3H), 9'-(9H)xanthene)-5-carboxylic acid,3',6'-dihydroxy-3-oxo-6-carboxyfluorescein); 5-Hexachloro-Fluorescein ([4, 7, 2', 4', 5', 7'- hexachloro-(3',6'-dipivaloyl-fluoresceinyl)-6-carboxylic acid]); 6-Hexachloro-Fluorescein ([4,7,2',4',5',7'-hexach
  • fluorescein fluorescein chlorotriazinyl
  • rhodamine green rhodamine red
  • tetramethylrhodamine FITC
  • Alexa Fluor e.g. AF488
  • FAM FAM
  • JOE JOE
  • HEX Texas Red
  • TET TET
  • TRETC cyanine-based dye
  • thiadicarbocyanine dye e.g. thiadicarbocyanine dye.
  • the fluorophore is AF488 or EDANS.
  • the donor moiety is a quantum dot.
  • Quantum dots are coated nanocrystals fabricated from semiconductor materials in which the emission spectrum is controlled by the nanocrystal size. Quantum dots have a wide absorption spectrum, allowing simultaneous emission of fluorescence of various colours with a single excitation source. Quantum dots can be modified with large number of small molecules and linker groups such as conjugation of amino (PEG) or carboxyl quantum dots to streptavidin (Quantum Dot Corporation, Hayward, CA, USA).
  • the donor and acceptor moieties are attached to the peptide and known GAR domain-binding agent (e.g. AS 1411) in a configuration that permits energy transfer from the donor to the acceptor to result in quenching of the fluorescence by FRET.
  • GAR domain-binding agent e.g. AS 1411
  • FRET pairs contemplated by the present invention include fluorescein isothiocyanate/tetramethyl-6-carboxyrhodamine (FITC/TAMRA), fluorescein amidite/TAMRA (FAM/TAMRA), FAM/black hole quencher-1 (FAM/BHQ1), AF488 and BHQ1 (AF488/BHQ1) and EDANS and Dabcyl (EDANS/dabcyl).
  • FITC/TAMRA fluorescein isothiocyanate/tetramethyl-6-carboxyrhodamine
  • FAM/TAMRA fluorescein amidite/TAMRA
  • FAM/black hole quencher-1 FAM/black hole quencher-1
  • AF488 and BHQ1 AF488/BHQ1
  • EDANS/dabcyl EDANS/dabcyl
  • compositions, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
  • a compound or “at least one compound” may include a plurality of compounds, including mixtures thereof.
  • range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
  • a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range.
  • the phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
  • method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
  • treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
  • sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
  • mice All animal experiments were reviewed and approved by the Institutional Animal Care and Use Committee at the Weizmann Institute of Science or the University of South Carolina.
  • Adult C57BL6/01aHSD and BALB/c mice were purchased from Harlan Laboratories (Envigo, Israel) and male Sprague Dawley rats (175-250 g) were purchased from Charles Rivers Laboratories.
  • the C57BL/6YFP16 mice (Feng et al, 2000) were maintained at the Veterinary Resources of the Weizmann Institute. Nucleolin GAR +/ “ were generated and bred by the Weizmann Institute Veterinary Resources Department’s core facility for transgenics and knockouts as described in the detailed methods section.
  • mice All animals were housed in the Veterinary Resources Department of the Weizmann Institute or Animal Resource Facility of the University of South Carolina in a temperature-controlled room under a 12h light/dark cycle. Water and food were available ad libitum. Both female and male mice were used alternately in all experiments. Per biological replicate, mice for all conditions were sex and age matched, and littermates were used whenever possible. Tissue was extracted from animals 8-20 weeks of age.
  • DRG Dorsal root ganglia
  • DRG Dorsal root ganglia
  • the ganglia were mechanically triturated in HBSS supplemented with 10 mM Glucose, and 5 mM HEPES (pH 7.35), by aspiration in a glass Pasteur pipette whose opening was narrowed by fire polishing and was pre-covered in serum containing media.
  • Cells were then laid on a 20% Percoll cushion in Leibovitz LI 5 medium and recovered through centrifugation at 1000 g for 8 min. Cells were washed briefly in growth medium and plated on pre-coated glass coverslips or plates in growth medium (F12 supplemented with 10 % Fetal Bovine Serum and antibiotic formulation Primocin (Invivogen) according to manufacturer’s instructions). Pre-coating included a first step of coating with poly- L-lysine (P4832, Sigma) followed by laminin (23017-015, Invitrogen).
  • cells were treated with 10 pM AS 1411 (GGTGGTGGTGGTTGTGGTGGTGGTGG - SEQ ID NO: 8) or 10 pM control DNA (CCTCCTCCTCCTTCTCCTCCTCCTCC - SEQ ID NO: 9) oligonucleotides (Integrated DNA Technologies) as described before (Perry et al., 2016). All cells were incubated at 37° Celsius and 5% CO 2 .
  • HEK-293 human, female, RRID: CVCL_0045
  • U937 human, male, RRID: CVCL_0007
  • Neuro-2A mouse, male, RRID: CVCL_0470
  • ATCC Cat# CRL-1573, CRL-1593, CCL-131, respectively.
  • HEK-293 and Neuro-2A cells were cultured in DMEM (Gibco), supplemented with 10% fetal bovine serum (Gibco), 100 U/mL penicillin and 100 pg/mL streptomycin.
  • U937 cells were grown in RPMI-1640 medium (Biological Industries) supplemented with 10% fetal bovine serum (Gibco), 100 U/mL penicillin and 100 pg/mL streptomycin. All cells were incubated at 37° C (Farin et al, 2011) and 5% CO2. The cell lines used were not authenticated.
  • Plasmids and transfections Full-length mouse nucleolin ORF was subcloned into a pcDN A3.1 -based mammalian expression vector from a plasmid kindly provided by Ronit Pinkas-Kramarski (Farin et al., 2011). The sequence was modified using restriction-free cloning to generate GAR deletion (amino acids 646-697 from UniProt sequence P09405) and GAR(N) variants, and to introduce N-terminal HA-Dendra2 tags, as well as generating a construct expressing HA-Dendra2 alone. Phusion polymerase (Thermo Fisher) was used for mutagenesis, according to manufacturer’s instructions.
  • Dendra2 sequence was cloned from pDendra2 construct (Evrogen).
  • HA-Dendra2 fusions with full length nucleolin, nucleolin with deleted GAR deletion and domain were subcloned under the human synapsin (hSynl) promoter in a previously described AAV genomic vector (Mahn et al, 2018; Marvaldi et al, 2020), using PCR with primers tailed with Asci and and EcoRV restriction sites.
  • Kif5a expression plasmid was obtained from Addgene (#31607).
  • HEK-293 and N2a cells were purchased from ATCC (CCL-131) and cultured in DMEM (Gibco), supplemented with 10% fetal bovine serum (Gibco), 100 U/mL penicillin and 100 pg/mL streptomycin.
  • U937 cells were purchased from ATCC (CRL-1593.2) and grown in RPMI-1640 medium (Biological Industries) supplemented with 10% fetal bovine serum (Gibco), 100 U/mL penicillin and 100 pg/mL streptomycin.
  • jetPEI Polyplus -transfection
  • HA-Dendra2-nucleolin or HA- Dendra2 constructs were co-transfected with Kif5a, a 4:1 expression ratio was used to compensate for differences in expression levels.
  • Antibodies Following primary antibodies were used for this study: rabbit anti-nucleolin (Abeam, ab50279, 1:1000 for WB), rabbit anti-nucleolin (Proteintech, 10556-1-AP, 1:100 for IF), rabbit anti-Kif5a (Abeam, ab5628, 1:1000 for WB, 1:100 for Wes), rabbit anti-HA (Sigma, H6908, 1:1000 for WB), rabbit anti-LAMPl (Abeam, ab24170, 1:1000 for WB), mouse anti- GAPDH (Millipore, MAB374, 1:5000 for WB), mouse anti-P-III tubulin (R&D systems, MAB1195, 1 : 1000 for WB), mouse p-III tubulin (Tujl) (Biolegend 801202, 1:500 for IF), mouse anti-NFH (Developmental Studies Hybridoma Bank, RT97, 1:200 for IF), chicken anti- NFH (Abeam, ab72996, 1:1000 for
  • ELISA assay for AS1411-binding peptides Streptavidin-coated 96 well ELISA plates (R&D systems, CP004) were washed twice in PBS-T (PBS lx + 0.05% Tween-20), then incubated for 1 hour at room temperature with 0.025 pM Biotinylated peptides, blocked by incubation with 1% BSA (Sigma, A9647) in PBS for 30 minutes at 37°C, then incubated with 0.04 pM digoxigenin (3 ’-DIG) AS 1411 or control aptamer (Integrated DNA Technologies) in PBS for 1 hour at room temperature.
  • PBS-T PBS lx + 0.05% Tween-20
  • Axoplasm isolation' Mouse sciatic nerve axoplasm was isolated as previously described (Rishal et al., 2010). In brief, freshly dissected sciatic nerves were collected in Nuclear Transport buffer (TB) at a ratio of 1 SN/50 pl buffer (20 mM Hepes, 110 mM KAc, 5 mM MgAc, pH 7.4 supplemented with Complete protease inhibitor EDTA free, (Roche 1187358000), phosphatase inhibitor cocktail 2 (1/1000, Sigma 5726), phosphatase inhibitor cocktail 3 (1/1000, Sigma P0044) and RNAse inhibitors (200U/ml, RNAseln, Promega N251B). Tissue was manually ground with a micropestle in a microtube until it lost its fibrous consistency. Lysates were centrifuged 10,000 g for 10 minutes at 4°C and pellet was discarded.
  • TB Nuclear Transport buffer
  • Nucleolin immunoprecipitation from axoplasm was conducted as follows: approximately 200 pg of axoplasm/protein lysates were incubated with lOpg antibody for 3 h, then supplemented with 100 pl Protein G magnetic beads (Dynabeads, Thermo Fisher Scientific 10004D), pre-blocked with salmon sperm DNA (lOpl DNA per lOOpl beads for 1 hour 4°C), for additional 1 hour. Incubation buffer was adjusted to final 0.1% NP40 to avoid beads aggregation. All incubation steps were done at 4°C with overhead rotation.
  • Beads were washed with increasing NP40 concentration as follows: TB-0.1% NP40 for 3-5 minutes, TB-0.5% NP40 3-5 minutes, TB-1% NP40 1 minute, TB-no detergent 3-5 minutes, then transferred to a clean Eppendorf tube in TB without detergent. Elution from beads was conducted by denaturing the proteins from the beads with Laemmli sample buffer or WES sample buffer (see below) supplemented with DTT to a final concentration of 40mM for 5 minutes at 95 °C.
  • Axoplasm pulldown with biotinylated peptides Axoplasm lysates were incubated overnight at 4°C with streptavidin magnetic beads (Dynabeads M-280, Thermo Fisher Scientific 11205D) pre-conjugated to biotinylated peptides by incubation with 2 pM peptides in PBST for 1 hour at room temperature. A pre-cleaning step was added, clearing the sample with beads preconjugated to control peptide (A3 or N4) for 3 h at 4°C prior to the over-night incubation with target or control peptides. Washes were as indicated for immunoprecipitation, followed by
  • KLC Binding to R4 GAR and N4 GAR derived peptides was monitored by surface plasmon resonance (SPR) on a Biacore S200 system using a biotinylated streptavidin chip (Series S SA). Recombinant KLC2 was injected different concentrations (5-160 nM) in a single cycle kinetics mode on biotinylated R4 or N4 GAR derived peptides, or free biotin. Before data collection, a normalization cycle followed by a priming cycle were run to stabilize the instrament. Binding assays were performed in triplicates in PBST buffer with a flow rate of 30 pL/min at 25 °C.
  • DRG neurons expressing YFP under the Thyl promoter were cultured on a 4 Well Glass Bottom slide chamber (p-Slide, ibidi 80427) for 24 h prior to treatment.
  • p-Slide 4 Well Glass Bottom slide chamber
  • For cold treatment (4°C) plates were taken out of the incubator and onto ice and taken in to the cold room (2-8°C) to cool for 20 minutes. Then, medium was replaced with cold (4°C) growth medium supplemented with 5 pM R4 (FGGRGRGGFGGRGGFRGG - SEQ ID NO: 3) or N4 (FGGNGNGGFGGNGGFNGG - SEQ ID NO: 4) peptides N-terminally conjugated with TAMRA (Sigma).
  • peptide uptake into HEK-293 and U937 cells 5 pM TAMRA-conjugated peptides were added to the growth medium for 60 minutes. Then, cells were collected into 15 ml tubes for washing with cold PBS in pre-cooled centrifugation (2 x 2 min, 1,000 x g). Cells then were suspended in 400 pl cold PBS and filtered through a nylon mesh into 5 ml tube to obtain a uniform single-cell suspension. Cells were analyzed on a FACS-LSRII cytometer (BD Biosciences) using BD FACSDIVA software (BD Biosciences).
  • HEK-293 cells grown on 10 cm plates were washed twice with ice-cold PBS and treated with 0.5 mM sulfo-NHS-SS-biotin (Thermo Scientific 21331) in PBS for 30 min at 4°C with gentle rocking. Free sulfo-NHS-SS-biotin was removed and unreacted reagent was quenched by adding ice-cold 50 mM Tris-HCl in PBS pH 7.4. Cells were washed once with PBS and once with PBS + 0.1 mM oxidized glutathione (Sigma G4376).
  • Proteins were extracted 30 min lysis in RIPA buffer (50 mM Tris HC1, pH 8.0, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with Complete EDTA-free protease inhibitor cocktail (Roche 1187358000) and 0.1 mM oxidized glutathione. Lysates were centrifuged for 12000g to pellet debris and 1/20 of lysates was used for input samples. The remainder of the lysate was used for pulldown of biotinylated proteins with 30 pl of MyOne Streptavidin Cl Dynabeads (Thermo Scientific 65002) for Ih on a rotator at 4°C.
  • AAV-PHP.S vectors and transduction of cultured DRG neurons ORFs of HA-tagged nucleolin full-length, nucleolin AGAR, nucleolin GAR(N) and nucleolin-derived GAR domain were subcloned into an AAV plasmid under the human SynapsinI (hSynl) promoter to ensure neuronal specificity (Mahn et al., 2018; Marvaldi et al., 2020).
  • Virus titers (as determined by RT- qPCR) were in the range of 10 12 -10 13 viral genomes/mL.
  • cells were transduced with the viral stock at a 1:200 dilution simultaneously with seeding. The cells were replated on glass bottom 35 mm MatTek dish for hypoosmotic treatment experiment or coverslips for evaluation of neurite outgrowth 8-9 days after transduction. Aforementioned experiments were conducted on the next day after replating.
  • Images were acquired in DAPI, GFP, TRITC and DIC channels at X60 magnification with Nikon CFI plan apochromat 60X oil lambda objective. Medium was removed and the cells were immediately refocused and imaged or the t 0 image, followed by careful addition of 1 mL ddH2O by pipetting and image acquisition using a same setting with 42 seconds interval for 5 minutes. Images were analyzed by NIS-Elements software (Nikon).
  • GAR knockout lines were generated by using two sgRNAs to create a deletion in the nucleolin coding sequence.
  • the sgRNAs were designed to minimize off target deletions in nonspecific areas in the genome and to maximize the probability of Cas9 cleavages at the targeted sites, using CHOPCHOP (v.2, chopchop(dot)cbu(dot)uib(dot)no) and other tools detailed in the Benchling implementations (www(dot)benchling(dot)com).
  • Guides were designed to cut in exonl3 and exonl4, flanking all RGG repeats in the GAR domain.
  • sgRNAs were prepared in-house as previously described (Ran et al, 2013). In brief, sgRNA were cloned into px459 plasmid. T7 promotor sequence was fused to sgRNA target sequence by PCR reaction, and sgRNAs were in vitro transcribed with MEGAshortscript (Ambion cat. AM 1354) and cleaned with MEGAclear kit (Ambion cat. AM1908). sgRNAs ability to direct Cas9 recombinant protein to the appropriate DNA sites was tested in vitro using Guide-it sgRNA Screening Kit (Clontech Cat. No.
  • PCR product containing the relevant part of the gene 940 base pairs amplified from genomic DNA as template (primers: Fwd- GCATGGAGAACTTGGGTCTG - SEQ ID NO: 10, Rev- ATGAAGCTGTTCCCCACCAAT - SEQ ID NO: 11).
  • Cas9 mRNA was in vitro transcribed with mMESSAGE mMACHINE T7 Ultra Kit (Ambion cat. AM1345) from a linearized plasmid and cleaned with MEGAclear kit (Ambion cat. AM 1908). Genome edited animals were generated by the Weizmann Institute Transgenic Unit by microinjection.
  • Cas9 mRNA and the two sgRNAs (sgRNAa: GGCUUCCGAGGCGGCAGAGGAGG - SEQ ID NO: 12, cuts at position 666 of NM_O1O88O.3 (Refseq sequence), end of GAR; sgRNAb; GAAGGUGGCUUUGGUGGUCGAGG (SEQ ID NO: 13), cuts at position 898 of Refseq sequence, beginning of GAR) were microinjected into fertilized oocytes from superovulated CB6 Fl donor mice. Founders were crossed with WT C57BL/6J-01aHsd for multiple generations. Genotyping was done by PCR reaction on genomic DNA extracted from 3-4 weeks pups’ tails, using the screening primers indicated above. For each sgRNA, potential genomic alterations in off-targets within genes were further screened by PCR on DNA from tails of F3 progeny of the founder further bred for experiments.
  • Tissue sections were washed in 20mM glycine in PBS three times 10 minutes each time, washed in 0.25 M NaBFU three times 5 minutes each time, then permeabilized in 0.2% Triton X-100 in PBS. After three rinses in PBS, tissue sections were blocked in blocking buffer (10% donkey serum, 0.1% Tween-20, 20 mM glycine, PBS). Sections were incubated in rabbit nucleolin, mouse SMI-312, mouse Tujl, and mouse RT97 primary antibodies overnight at 4°C.
  • Dendra conversion time-lapse imaging Adult mouse DRG neurons transfected by Amaxa Nucleofector II with HA-Dendra2-GAR(WT) or with HA-Dendra2-GAR(N) expression plasmids were live imaged with the Nikon Ti-LAPP illumination system equipped with a temperature-controlled chamber, Digital Mirror Device (DMD) and an Andor EMCCD camera. Cells were grown 48 hours in complete F12 medium prior acquisition. Images were acquired in GFP, TRITC and DIC channels at X60 magnification with Nikon CFI plan apochromat 60X oil lambda objective. The photoconversion was performed in the cell body area by DAPI channel (50% of maximum led intensity for 20 seconds) using DMD module.
  • DMD Digital Mirror Device
  • the images were collected using GFP and TRITC channels at 10s interval for 20 minutes. DIC channel was used prior to photoconversion and in last four time points. Images were analyzed by NIS -Elements software (Nikon). A neurite segment located at a distance of 60-90 pm from the cell body was selected for the kinetic intensity analysis.
  • Image analysis Images were captured using a Leica SP8X confocal microscope with HyD detectors.
  • Leica SP8X with Lightning detection was used to capture images. Scrambled probes were used to set the image acquisition parameters to limit acquiring non-specific signals.
  • IF the no primary antibody control was used to set the image acquisition parameters.
  • xyz scans of three randomly chosen regions of interest 123.29 x 123.29 pm
  • a z depth of 4.5 pm (15 optical planes) were scanned with a 63X oil immersion objective (1.4 NA).
  • the colocalization plugin in ImageJ (www(dot)imagej(dot)nih(dot)gov/ij/plugins/colocalization(dot)html) was used to extract the mRNA or protein signal in each optical plane that overlapped with axonal markers (NF and Tujl).
  • the axon only mean intensity values were normalized to the NF and Tujl signals in each XY plane.
  • the average axon only scramble signal was subtracted from the axon only mRNA signals from each ROI average.
  • Axon outgrowth analysis For outgrowth analysis nucleolin GAR+/- and wild-type mice, were crossed with Thyl-YFP mice (Feng et al., 2000). DRG neurons from adult mice were plated on 35 mm glass bottom dishes (MatTek) coated with poly-L-lysine and laminin. After seeding, neurons were imaged every hour for 48 hours using Fluoview (FV10), a fully automated confocal laser- scanning microscope with a built-in CO2 incubator, at a 60X magnification. 3x3 neighbouring sites were montaged and analyzed using ImageJ, as previously described (Perry et al., 2016).
  • Fluoview Fluoview
  • the present inventors first tested whether the nucleolin GAR domain binds AS 1411. Synthetic peptides corresponding to different segments of the nucleolin GAR domain (Fig. 1A) were tested for AS 1411 binding by ELISA. The AS 1411 aptamer, but not the control DNA, showed binding to 22-28 residue peptides derived from N-terminal, middle and C-terminal segments of the GAR domain. The testing was further narrowed to sequences of 15 or 18 residue peptides (designated R3 or R4, respectively) and control peptides were designed corresponding R- to-A (A3) or R-to-N (N4). AS1411 bound to these shorter GAR-derived peptides but not the controls (Fig. IB).
  • the present inventors then set out to test direct binding of GAR-derived peptides with kinesin complex components, using surface plasmon resonance to assess binding of R4 versus N4 peptides with kinesin light chain 2 (KLC2) and with Kif5c. While there was no specific binding of the GAR- derived peptides to Kif5c; R4, but not the N4 control, bound KLC2 with a Kd of 57.9 nM (Fig. 2F). Recent work has linked transport of RBP-mRNA complexes in association with endosomes and lysosomes. However, the lysosome/endosome marker LAMP1 was not found in Kif5a-Ncl co-precipitates.
  • nucleolin has also been reported to reside at the plasma membrane and indeed, an appreciable fraction of the GAR protein interactors that were identified are membranal. Although nucleolin lacks any obvious membrane interaction domains or motifs, arginine -rich peptides are known to penetrate cellular membranes, raising the possibility that the arginine -rich GAR domain might enable nucleolin association with the plasma membrane.
  • the present inventors then proceeded to assess plasma membrane association of endogenous nucleolin by cell surface biotinylation in HEK-293 cells, first validating the assay by demonstrating membrane expression of a G protein-coupled inwardly- rectifying potassium channel. Endogenous nucleolin was readily detected in the biotinylated membrane protein pool (Fig. 3E). The role of the GAR domain in cell surface association of nucleolin was assessed in HEK-293 cells transfected with native nucleolin versus GAR domain deletion or GAR(N) mutants. Deletion or mutation of the GAR domain greatly reduced cell surface association of nucleolin (Figs. 3F, G).
  • a GAR deletion mouse line was generated by CRISPR/Cas9 gene editing, using two sgRNAs flanking the GAR domain (Figure 5A).
  • Four of the several founder mice generated were subsequently outbred on two genetic backgrounds, however, no Fl mice homozygous for the GAR deletion were identified from any of the founder lines.
  • Genotyping of more than 30 E10.5 embryos from timed pregnant females revealed that there were no homozygous embryos, suggesting that biallelic deletion of the nucleolin GAR domain is lethal at early stages of development.
  • subsequent analyses were conducted on animals heterozygous for the GAR deletion in nucleolin.
  • DRG neurons from GAR +/ “ mice were cultured in modified Boyden chambers, allowing subsequent protein extraction from axons and cell bodies separately.
  • Western blot quantification of nucleolin extracted from the cell soma compartment clearly showed that the mutant GAR deletion protein is expressed, while similar analysis of the axonal compartment revealed marked reduction of the deletion mutant band and a concomitant reduction of total nucleolin levels in the axon (Figs. 5B, C).
  • the present inventors compared the effect of AS 1411 on cell size in non-malignant 3T3 cells and a panel of tumor cell lines where AS 1411 has shown antiproliferative in previous studies. While AS 1411 increased the volume of 3T3 cells at both 48h and 96h from the start of treatment (Fig. 8A), it was found that out of 8 cancer lines tested, AS 1411 significantly increased cell volume only in 2 cancer lines 96 h after beginning the treatment (Fig. 8A) and none of the tested lines showed significant volume increase at 48h (Fig. 8A).
  • the AS 1411- GAR binding TR-FRET assay was transformed into an automated 1564-wells plate format, thereby minimizing run-time and reagent costs.
  • the automated assay was found to be extremely robust, providing Z’ scores of 0.71 & 0.9 in two separate trials, therefore validating the feasibility of the assay for automated high-throughput screen.
  • an initial prescreen was run, in which 1190 compounds from both known bioactive and diversity libraries were analyzed. 12 hits were identified, out of which 2 compounds (Mitoxantrone & Doxorubicin) were filtered out due to likely DNA-chelating activity, suggesting these interact directly with the AS 1411 DNA aptamer and are therefore irrelevant for further study or utilization.
  • Obatoclax mesylate which inhibits Bcl-2, an antiapoptotic factor overexpress in some types of cancer (Han et al., 2019, Biomed Res. Int. 2019).
  • the mechanisms of action of this molecule which has reached Phase III trials, resembles the one of AS 141 which promotes apoptosis through a destabilization of Bcl-2 mRNA.
  • nucleolin plays a role in axonal sprouting in the later, neural repair phase of stroke
  • stroke was induced in mice concomitantly with delivery of virus expressing the nucleolin GAR domain or mutated control to the premotor cortex. Euthanasia and brain mapping was carried out in these mice 30 days later ( Figure 11 A).
  • Overexpression of the GAR domain alone is expected to act as a dominant-negative for axonal growth-regulating functions of nucleolin, sequestering endogenous nucleolin-binding proteins such as kinesin in neuronal cell bodies and altering growth properties of transduced neurons.
  • the viral delivery means that this nucleolin loss of function will be produced at a delay, 7-10 days after the initial stroke.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Organic Chemistry (AREA)
  • Neurology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Neurosurgery (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La divulgation concerne une méthode de traitement d'une lésion neuronale chez un sujet. La méthode comprend l'administration au sujet d'une dose thérapeutiquement efficace d'un agent qui se lie spécifiquement au domaine GAR de la nucléoline. L'invention concerne en outre des méthodes de traitement du cancer.
PCT/IL2022/050958 2021-09-02 2022-09-01 Agents ciblant le domaine riche en glycine et en arginine (gar) de la nucléoline et leurs utilisations WO2023031934A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163240017P 2021-09-02 2021-09-02
US63/240,017 2021-09-02

Publications (1)

Publication Number Publication Date
WO2023031934A1 true WO2023031934A1 (fr) 2023-03-09

Family

ID=83508953

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2022/050958 WO2023031934A1 (fr) 2021-09-02 2022-09-01 Agents ciblant le domaine riche en glycine et en arginine (gar) de la nucléoline et leurs utilisations

Country Status (1)

Country Link
WO (1) WO2023031934A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6472505B1 (en) 1997-05-14 2002-10-29 Aventis Pharmaceuticals Inc. Peptide parathyroid hormone analogs
WO2011062997A2 (fr) * 2009-11-17 2011-05-26 Musc Foundation For Research Development Anticorps monoclonaux humains pour nucléoline humaine
US20140213636A1 (en) 2009-04-15 2014-07-31 Postech Academy-Industry Foundation Method of treating hyperproliferation of cells using a nucleolin specific aptamer
WO2019079164A1 (fr) * 2017-10-16 2019-04-25 University Of Cincinnati Combinaison d'as1411 et de sapc-dops pour le traitement du glioblastome multiforme
US20200283773A1 (en) 2017-09-08 2020-09-10 Duke University Nucleolin-targeting aptamers and methods of using the same

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6472505B1 (en) 1997-05-14 2002-10-29 Aventis Pharmaceuticals Inc. Peptide parathyroid hormone analogs
US20140213636A1 (en) 2009-04-15 2014-07-31 Postech Academy-Industry Foundation Method of treating hyperproliferation of cells using a nucleolin specific aptamer
WO2011062997A2 (fr) * 2009-11-17 2011-05-26 Musc Foundation For Research Development Anticorps monoclonaux humains pour nucléoline humaine
US20200283773A1 (en) 2017-09-08 2020-09-10 Duke University Nucleolin-targeting aptamers and methods of using the same
WO2019079164A1 (fr) * 2017-10-16 2019-04-25 University Of Cincinnati Combinaison d'as1411 et de sapc-dops pour le traitement du glioblastome multiforme
US20200237866A1 (en) 2017-10-16 2020-07-30 University Of Cincinnati Combination of AS1411 and SAPC-DOPS for the Treatment of Glioblastoma Multiforme

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
ALBUS ET AL., TRENDS CELL BIOL, vol. 23, 2013, pages 305 - 310
ANDERSSON, BIOPOLYMERS, vol. 55, no. 3, 2000, pages 227 - 50
DEGORCE ET AL., CURR. CHEM. GENOMICS, vol. 3, 2009, pages 22
G. SCHRODERK. LUPKE: "The Peptides", vol. 1, 1965, ACADEMIC PRESS
HAN ET AL., BIOMED RES. INT., 2019
J. M. STEWARTJ. D. YOUNG: "Solid Phase Peptide Synthesis", 1963, W. H. FREEMAN CO
J. MEIENHOFER: "Hormonal Proteins and Peptides", vol. 2, 1973, ACADEMIC PRESS, pages: 46
KOUTSIOUMPAPAPADIMITRIOU E, RECENT PAT ANTICANCER DRUG DISCOV, vol. 9, no. 2, May 2014 (2014-05-01), pages 137 - 52
PERRY ET AL., CELL REP, vol. 16, 2016, pages 1664 - 1676
RISHAL ET AL., CELL REP, vol. 1, 2012, pages 608 - 616
RISHALFAINZILBER, BMC BIOLOGY, vol. 17, 2019, pages 36
SHINJI SAYAKA ET AL: "Identification of the Myogenetic Oligodeoxynucleotides (myoDNs) That Promote Differentiation of Skeletal Muscle Myoblasts by Targeting Nucleolin", FRONTIERS IN CELL AND DEVELOPMENTAL BIOLOGY, vol. 8, 11 January 2021 (2021-01-11), XP093002128, DOI: 10.3389/fcell.2020.616706 *
TANG CHAOLIANG ET AL: "Palmatine Protects against Cerebral Ischemia/Reperfusion Injury by Activation of the AMPK/Nrf2 Pathway", OXIDATIVE MEDICINE AND CELLULAR LONGEVITY, vol. 2021, 11 March 2021 (2021-03-11), US, pages 1 - 12, XP093002116, ISSN: 1942-0900, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7981182/pdf/OMCL2021-6660193.pdf> DOI: 10.1155/2021/6660193 *
XING ET AL., PHYTHER. RES., vol. 27, 2013, pages 1790 - 1794
ZHANG MIAO ET AL: "Cognitive-enhancing effects of fibrauretine on A[beta]1-42-induced Alzheimer's disease by compatibilization with ginsenosides", NEUROPEPTIDES, CHURCHILL LIVINGSTONE, GB, vol. 82, 20 January 2020 (2020-01-20), XP086208496, ISSN: 0143-4179, [retrieved on 20200120], DOI: 10.1016/J.NPEP.2020.102020 *

Similar Documents

Publication Publication Date Title
JP7219791B2 (ja) Ｒｔｋ突然変異細胞を有する患者を処置するための組成物及び方法
US7973135B2 (en) Compositions and methods for targeting cancer-specific transcription complexes
US20060286575A1 (en) MCL-1 quadruplex nucleic acids and uses thereof
CN109072240A (zh) 使用piRNA诊断和治疗癌症的组合物和方法
WO2012090150A2 (fr) Nouveaux peptides pénétrant dans les cellules et leurs utilisations
US10240133B2 (en) ERK-derived peptides and uses thereof
US11904057B2 (en) Nanoparticle-hydrogel composite for nucleic acid molecule delivery
CN111417646B (zh) 用于治疗癌症的肽皂草素缀合物
JP2020536582A (ja) 遺伝子発現抑制剤
JP6566933B2 (ja) ガンを治療するための療法のための標的として使用するためのｆａｌｚ
US11505574B2 (en) Modulation of P53 for the treatment of cancer
WO2023031934A1 (fr) Agents ciblant le domaine riche en glycine et en arginine (gar) de la nucléoline et leurs utilisations
ES2398391T3 (es) Polinucleótidos relacionados con cáncer de colon
ES2873377T3 (es) Procedimientos y composiciones farmacéuticas para el tratamiento de cáncer de pulmón
US20100004169A1 (en) CCN3 peptide
EP4327818A2 (fr) Composés anti-sénescence améliorés et leurs utilisations pour le traitement du cancer
KR101732380B1 (ko) 상피성장인자 수용체를 표적으로 하는 신규 항암제
Yun et al. Targeting upregulated RNA binding protein RCAN1. 1: a promising strategy for neuroprotection in acute ischemic stroke
US20120172310A1 (en) Soluble Guanylyl Cyclase a1 and a-8r Peptide as Diagnostic Markers of and Therapeutic Targets for Prostate Cancer
JP7477886B2 (ja) 核酸アプタマー
US10201610B2 (en) Interference peptides and use thereof
TWI602572B (zh) 抗菌胜肽tp4治療癌症之用途
CN118240025A (zh) 用于治疗癌症的肽皂草素缀合物
CN114599375A (zh) 核酸递送促进剂
KR20210035643A (ko) Ｍｙｏ１ｄ의 발현 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 약학 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22783053

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE