WO2023027275A1 - Pgd2를 포함하는 난소 저자극 증후군 조기 진단용 바이오마커 및 이의 용도 - Google Patents

Pgd2를 포함하는 난소 저자극 증후군 조기 진단용 바이오마커 및 이의 용도 Download PDF

Info

Publication number
WO2023027275A1
WO2023027275A1 PCT/KR2022/003370 KR2022003370W WO2023027275A1 WO 2023027275 A1 WO2023027275 A1 WO 2023027275A1 KR 2022003370 W KR2022003370 W KR 2022003370W WO 2023027275 A1 WO2023027275 A1 WO 2023027275A1
Authority
WO
WIPO (PCT)
Prior art keywords
pgd2
expression level
ovarian
syndrome
hypostimulation
Prior art date
Application number
PCT/KR2022/003370
Other languages
English (en)
French (fr)
Inventor
곽규범
이재호
고정재
박용준
김명주
Original Assignee
차의과학대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 차의과학대학교 산학협력단 filed Critical 차의과학대학교 산학협력단
Publication of WO2023027275A1 publication Critical patent/WO2023027275A1/ko

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/689—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to pregnancy or the gonads
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/88—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving prostaglandins or their receptors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • prostaglandin is a physiologically active substance that has a prostanic acid skeleton structurally and is involved in various bodily functions such as regulation of cell growth and contraction and relaxation of smooth muscle tissue.
  • prostaglandin D2 is known to inhibit platelet aggregation and to be involved in inflammatory processes such as pain and fever.
  • the present inventors measured the expression level of PGD2 in the follicular fluid of patients with ovarian hypostimulation syndrome, and as a result, regardless of age, when the ovarian hormone response is low, the expression level of PGD2 appears below a certain level, so that the PGD2 is ovarian hypostimulation
  • the present invention was completed by confirming that it could be an early diagnostic material for syndrome.
  • One aspect is to provide a composition for early diagnosis of ovarian hypostimulation syndrome comprising an agent for measuring the expression level of PGD2.
  • Another aspect is to provide a kit for early diagnosis of ovarian hypostimulation syndrome comprising the composition.
  • Another aspect includes (a) measuring the expression level of PGD2 from an isolated biological sample
  • step (b) comparing the expression level of PGD2 measured in step (a) with that of a normal control sample;
  • Another aspect is (a) treating a candidate for the treatment of ovarian hypostimulation syndrome in an isolated biological sample or non-human animal;
  • step (c) selecting the candidate substance as a treatment for ovarian hypostimulation syndrome when the expression level of PGD2 measured in step (b) is increased compared to the expression level of PGD2 in a control group not treated with the candidate substance; It is to provide a screening method for hypoallergenic syndrome therapeutics.
  • the present inventors performed NGS analysis on the entire transcriptome of the ovaries of normal control mice and experimental mice, and found that prostaglandins were found in follicular development. It was confirmed that it acts as a key factor. Then, follicular fluid and cumulus cells were collected from normal controls and ovarian hypostimulation syndrome patients, and prostaglandin D2 (PGD2) expression levels were compared and analyzed. It was confirmed that the expression was low.
  • PPD2 prostaglandin D2
  • the present specification describes oocytes, cumulus cells, and follicular fluid obtained in vitro by in vitro fertilization (IVF) in order to provide information necessary for the diagnosis of ovarian hypostimulation syndrome.
  • a diagnostic composition comprising an agent for measuring the expression level of PGD2 in; And it provides an analysis method comprising the step of measuring the expression level.
  • One aspect provides a composition for early diagnosis of ovarian hypostimulation syndrome comprising an agent for measuring the expression level of PGD2.
  • the PGD2 may include a compound represented by Formula 1 (PubChem CID: 448457) or a pharmaceutically acceptable salt thereof.
  • diagnosis means confirming the presence or characteristics of a pathological condition.
  • diagnosis is to determine whether or not ovarian hypo-stimulation syndrome has occurred, and the onset of ovarian hypo-stimulation syndrome can be confirmed at an early stage.
  • biomarker is a substance that can be diagnosed by distinguishing between a normal group individual and an individual with ovarian hypostimulation syndrome, and a polypeptide or protein showing an increase or decrease in an individual with ovarian hypostimulation syndrome. , nucleic acids, genes, lipids, glycolipids, glycoproteins, or organic biomolecules such as sugars.
  • the level of PGD2 expression (eg, concentration, etc.) is significantly reduced in the follicular fluid of POR patients compared to young and old patients with normal ovarian response, so that PGD2 can diagnose ovarian hypostimulation syndrome. It was confirmed that it can be a possible biomarker.
  • measuring PGD2 expression level is a process of confirming the presence and expression level of PGD2, a diagnostic marker for ovarian hypostimulation syndrome, in a biological sample for diagnosis of ovarian hypostimulation syndrome.
  • the expression level of PGD2 can be confirmed using an antibody that specifically binds to the PGD2.
  • Methods for measuring or comparing the expression level of PGD2 include protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Desorption/Ionization Time of Flight Mass Spectrometry) analysis, SELDI-TOF (Sulface Enhanced Laser Desorption/Ionization) Time of Flight Mass Spectrometry) analysis, radiation immunoassay, radioimmunodiffusion method, Oukteroni immunodiffusion method, rocket immunoelectrophoresis, immunohistochemistry analysis, immunocytochemistry analysis, complement fixation assay, two-dimensional Electrophoretic analysis, liquid chromatography-Mass Spectrometry (LC-MS), LC-MS/MS (liquid chromatography-Mass Spectrometry/Mass Spectrometry), Western blot, and ELISA (enzyme linked immunosorbentassay), etc. can be used In one embodiment, the level of PGD2 expression can be measured via ELISA.
  • the agent for measuring the expression level of PGD2 may include an antibody specifically binding to PGD2.
  • the term "antibody” refers to a specific protein molecule directed against an antigenic site.
  • the antibody refers to an antibody that specifically binds to PGD2, and includes both polyclonal antibodies, monoclonal antibodies and recombinant antibodies.
  • Antibodies can be readily prepared using techniques well known in the art.
  • the antibody may include functional fragments of the antibody molecule as well as complete forms having two full-length light chains and two full-length heavy chains.
  • a functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and examples thereof include Fab, F(ab'), F(ab') 2 and Fv.
  • mRNA level measurement refers to a process of confirming the presence or absence of mRNA and expression levels of genes for diagnosis of ovarian hypostimulation syndrome in a biological sample in order to diagnose ovarian hypostimulation syndrome. Analysis methods for this include reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (Competitive RT-PCR), real-time reverse transcription polymerase reaction (Real-time RT-PCR), RNase protection assay , Northern blotting, DNA chips, etc., but are not limited thereto.
  • RT-PCR reverse transcription polymerase reaction
  • Competitive RT-PCR competitive reverse transcription polymerase reaction
  • Real-time RT-PCR real-time reverse transcription polymerase reaction
  • RNase protection assay a Northern blotting, DNA chips, etc., but are not limited thereto.
  • the agent for measuring the mRNA level of the gene is preferably a primer pair or probe, and a method for designing a primer or probe that specifically amplifies a specific region of these genes based on a known gene sequence is well known to those skilled in the art. .
  • An agent for measuring the mRNA level of the gene may include a primer pair, a probe, or an antisense nucleotide that specifically binds to the gene.
  • primer pair includes any combination of primer pairs consisting of forward and reverse primers that recognize a target gene sequence, but is preferably a primer pair that provides analysis results having specificity and sensitivity.
  • the nucleic acid sequence of the primer is a sequence that is inconsistent with the non-target sequence present in the sample, and the primer amplifies only the target gene sequence containing a complementary primer binding site and does not cause non-specific amplification, high specificity can be imparted. .
  • probe means a substance that can specifically bind to a target substance to be detected in a sample, and means a substance that can specifically confirm the presence of a target substance in a sample through the binding.
  • the type of probe molecule is not limited as a material commonly used in the art, but preferably may be peptide nucleic acid (PNA), locked nucleic acid (LNA), peptide, polypeptide, protein, RNA, or DNA. More specifically, the probe is a biomaterial, including one derived from or similar to a living organism or produced in vitro, for example, enzymes, proteins, antibodies, microorganisms, animal and plant cells and organs, nerve cells, DNA, and RNA.
  • PNA peptide nucleic acid
  • LNA locked nucleic acid
  • the probe is a biomaterial, including one derived from or similar to a living organism or produced in vitro, for example, enzymes, proteins, antibodies, microorganisms, animal and plant cells and organs, nerve cells, DNA, and RNA.
  • DNA includes cDNA, genomic DNA, and oligonucleotides
  • RNA includes genomic RNA, mRNA, and oligonucleotides
  • proteins may include antibodies, antigens, enzymes, peptides, and the like.
  • antisense oligonucleotide refers to DNA or RNA or derivatives thereof containing a nucleic acid sequence complementary to a specific mRNA sequence, which binds to a complementary sequence in mRNA and inhibits translation of the mRNA into a protein. It works.
  • An antisense oligonucleotide sequence refers to a DNA or RNA sequence that is complementary to the mRNA of the genes and capable of binding to the mRNA. This can inhibit translation of the gene mRNA, translocation into the cytoplasm, maturation or any other vital activity for overall biological function.
  • the length of the antisense oligonucleotide is 6 to 100 bases, 6 to 90 bases, 6 to 80 bases, 6 to 70 bases, 6 to 60 bases, 7 to 60 bases, 8 to 60 bases, 8 to 50 bases, 9 to 50 bases , 10 to 50 bases, 10 to 40 bases, 11 to 40 bases, 12 to 40 bases, 12 to 30 bases or 12 to 28 bases.
  • the antisense oligonucleotide may be synthesized in vitro by a conventional method and administered in vivo, or the antisense oligonucleotide may be synthesized in vivo.
  • One example of synthesizing antisense oligonucleotides in vitro is using RNA polymerase I.
  • antisense RNA is to be synthesized in vivo.
  • MCS multiple cloning site
  • the antisense RNA has a translational stop codon in the sequence so that it is not translated into a peptide sequence.
  • Another aspect provides a kit for early diagnosis of ovarian hypostimulation syndrome comprising the composition.
  • the kit may be an enzyme-linked immunosorbent assay (ELISA) kit, a protein chip kit, or a rapid kit.
  • ELISA enzyme-linked immunosorbent assay
  • kit may further comprise one or more other component compositions, solutions or devices suitable for the assay method.
  • the diagnostic kit may be a diagnostic kit characterized in that it includes essential elements required to perform ELISA.
  • the ELISA kit includes an antibody specific for PGD2.
  • An antibody is an antibody that has high specificity and affinity for each marker and little cross-reactivity with other markers, and is a monoclonal antibody, polyclonal antibody, or recombinant antibody.
  • the ELISA kit is capable of detecting bound antibodies, such as labeled secondary antibodies, chromophores, enzymes (eg, conjugated to antibodies) and their substrates or binding to antibodies. It may contain other substances, etc.
  • the diagnostic kit may be a rapid kit, characterized in that it includes essential elements required to perform a rapid test in which an analysis result can be known within 5 minutes.
  • Rapid kits contain antibodies specific for the markers.
  • An antibody is an antibody that has high specificity and affinity for each marker and little cross-reactivity with other markers, and is a monoclonal antibody, polyclonal antibody, or recombinant antibody.
  • the rapid kit includes a reagent capable of detecting the bound antibody, for example, a nitrocellulose membrane on which a specific antibody and a secondary antibody are immobilized, a membrane bound to antibody-coupled beads, an absorbent pad and a sample pad and other materials, etc.
  • Another aspect includes (a) measuring the expression level of PGD2 from an isolated biological sample
  • step (b) comparing the expression level of PGD2 measured in step (a) with that of a normal control sample;
  • biological sample refers to samples such as tissues, cells, body fluids, whole blood, serum, plasma, saliva, cerebrospinal fluid or urine whose gene expression level or protein expression level is different due to the onset of ovarian hypostimulation syndrome. Including, but not limited to.
  • the level of PGD2 in follicular fluid collected from cumulus cells of a patient with a normal ovarian response and a POR patient was analyzed. Since the expression level of PGD2 is significantly reduced in POR patients compared to young and old patients with normal ovarian response, the PGD2 expression level of the isolated biological sample and the PGD2 expression level of the normal control sample are compared to determine whether or not ovarian hypostimulation syndrome exists. can be diagnosed
  • the expression level of the PGD2 can be measured and compared using an antibody that specifically binds to the PGD2.
  • a method of allowing the antibody and the corresponding protein in the biological sample to form an antigen-antibody complex and detecting it is used.
  • the term "antigen-antibody complex” refers to a combination of an antigen in a biological sample and an antibody recognizing it. Detection of the antigen-antibody complex can be performed using a method known in the art, for example, spectroscopic, photochemical, biochemical, immunochemical, electrical, spectrophotometric, chemical, and other methods.
  • the antigen may be PGD2
  • the antibody may be an antibody that specifically binds to the PGD2.
  • the protein expression level measurement or comparative analysis method includes protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Desorption/Ionization Time of Flight Mass Spectrometry) analysis, SELDI-TOF (Sulface Enhanced Laser Desorption/Ionization Time of Flight Mass Spectrometry) analysis, radiation immunoassay, radioimmunodiffusion method, Oukteroni immunodiffusion method, rocket immunoelectrophoresis, immunohistochemistry analysis, immunocytochemistry analysis, complement Immobilization method, two-dimensional electrophoretic analysis, liquid chromatography-Mass Spectrometry (LCMS), liquid chromatography-Mass Spectrometry/Mass Spectrometry (LC-MS/MS), Western blot and ELISA (enzyme linked immunosorbentassay) etc., but is not limited thereto.
  • MALDI-TOF Microx Desorption/Ionization Time of Flight Mass Spectrometry
  • SELDI-TOF Surface Enhanced Laser Desorption
  • Ovarian hypostimulation syndrome when the expression level of PGD2 is at a concentration of 0.01 to 10 ng/ml, 0.01 to 5 ng/ml, 0.01 to 3 ng/ml, 0.01 to 2 ng/ml, or 0.01 to 1 ng/ml Ovarian hypostimulation syndrome can be diagnosed. (At this time, the reverse may be an average of 0.1 to 0.5 ng/ml, 0.2 to 0.3 ng/ml.)
  • ovarian hypostimulation syndrome can be diagnosed when the concentration of GD2 in the POR group is 0.01 to 0.2, 0.01 to 0.15, or 0.05 to 0.15 smaller than that in the young group.
  • ovarian hypostimulation syndrome can be diagnosed when the concentration of GD2 in the POR group is 0.01 to 0.5, 0.01 to 0.3, 0.05 to 0.3, or 0.1 to 0.3 lower than that in the old group.
  • ovarian hypostimulation occurs when the measured expression level of PGD2 is about 70% or less, about 50% or less, or about 30% or less compared to the PGD2 expression level of the normal control group. syndrome can be diagnosed.
  • ovarian hypostimulation syndrome can be diagnosed when the median GD2 concentration in the POR group is at least about 70% or less, about 50% or less, or about 30% or less compared to the median value in the younger group.
  • Another aspect is (a) treating a candidate for the treatment of ovarian hypostimulation syndrome in an isolated biological sample or non-human animal;
  • step (c) selecting the candidate substance as a treatment for ovarian hypostimulation syndrome when the expression level of PGD2 measured in step (b) is increased compared to the expression level of PGD2 in a control group not treated with the candidate substance;
  • a method for screening hypoallergenic syndrome therapeutics is provided.
  • the term “candidate for the treatment of ovarian hypostimulation syndrome” may be individual nucleic acids, proteins, other extracts or natural products, or compounds predicted to have potential for treatment of ovarian hypostimulation syndrome or randomly selected. .
  • control group refers to an isolated biological sample or non-human animal that is not treated with a candidate substance for the treatment of ovarian hypostimulation syndrome, excluding an isolated biological sample or human animal belonging to a parallel relationship with the group treated with the candidate substance. means animals.
  • the PGD2 expression level in the cumulus cell culture medium significantly increased when RGMc was treated with cumulus cells collected from POR patients, and a treatment for ovarian hypostimulation syndrome could be screened through a change in PGD2 expression level confirmed.
  • ovarian hypostimulation syndrome can be diagnosed at an early stage regardless of age by measuring and comparing the expression level of PGD2, which is significantly low in the follicular fluid of patients with ovarian hypostimulation syndrome. Furthermore, the diagnostic results can be used to establish individualized treatment strategies for infertility patients, and are ultimately expected to contribute to effective infertility treatment.
  • FIG. 1 is a diagram showing the result of confirming the expression profile of neogenin in the ovary.
  • (a) Results of immunostaining using anti-neogenin antibody. neogenin (green), p63 (red) and DAPI (blue). Arrows indicate follicles stained positive for neogenin.
  • (b) Results of confocal image analysis of mouse oocytes. Neogenin (red), DAPI (blue). GV: Germinal Vesicle, MII: Metaphase II, BF: Bright Field.
  • (c) Results of RT-PCR analysis of neogenin mRNA in mouse oocytes. GAPDH was used as an internal control.
  • (d) Western blot results of neogenin protein in mouse ovaries. Beta-actin was used as an internal control. Neo: Neogenin.
  • Figure 2 is a diagram showing the results of confirming the development of follicles in the ovaries after treating RGMc in mouse ovaries stimulated with PMSG.
  • CTL Total number of follicles in control
  • RGMc treated groups 100 ⁇ m.
  • CTL Total number of follicles in control
  • RGMc treated groups 100 ⁇ m.
  • Number of follicles Number of follicles.
  • FIG. 3 is a diagram illustrating the analysis of mRNA and protein expression in RGMc-treated ovaries.
  • FIG. 4 is a diagram showing NGS results of whole transcriptomes of RGMc-treated ovaries.
  • FIG. 5a is a diagram confirming the correlation between genes whose expression levels are up/down-regulated, showing an absolute fold-change of more than 4-fold in RGMc-treated ovaries.
  • 5b and 5c are diagrams confirming the association between genes whose expression levels were up/down-regulated, showing an absolute fold-change of more than 4-fold in RGMc-treated ovaries, with significantly enriched terms and up/down expression ( fold-change > 4)
  • Network-based analysis between genes Blue and red colors indicate up/down-expressed genes/terms in RGMc-treated ovaries, respectively, and gray indicates non-satisfied terms with more than 60% enrichment in up/down-expressed genes.
  • White, hatched arrows indicate target genes for validation analysis that were up/down-expressed following RGMc treatment.
  • FIG. 6 is a diagram showing the results of quantitative real-time PCR analysis for verifying NGS data of RGMc-treated ovaries.
  • FIG. 7 is a diagram showing the results of analyzing the level of PGD2 in the follicular fluid of a normal control group and a POR patient.
  • FIG. 8 is a view showing ELISA results of follicular fluid and cumulus cell culture medium according to RGMc treatment.
  • mice 6-8 weeks old ICR mice (Oriental Bio, Korea) weighing 20-25 g, and approved by the Animal Experimentation Ethics Committee of Cha University, a total of 60 animals were used, including 30 control groups and 30 experimental groups. .
  • RGMc serum gonadotropin
  • PMSG serum gonadotropin
  • neogenin was measured in mouse ovaries and oocytes.
  • the ovaries fixed with 4% paraformaldehyde were tissue processed using an automatic tissue processor, and then embedded in paraffin to make tissue sections.
  • the first tissue section and the 50th tissue section of each ovarian sample were stained with Hematoxylin & Eosin (H&E), and the number of follicles was counted while observing under an optical microscope.
  • H&E Hematoxylin & Eosin
  • each tissue was treated with xylene to be deparaffinized (deparaffinized), and rehydrated (rehydration) by incubating with high-concentration ethanol at low concentrations in sequence at room temperature.
  • Tissue sections were reacted with rabbit anti-neogenin antibody (diluted 1:100, Santa Cruz Biotechnology, USA) and mouse anti-p63 antibody (diluted 1:100, Santa Cruz Biotechnology, USA), and then stained with Alexa Fluor 488- and Alexa Fluor 594-conjugated secondary antibody (diluted at 1:200, Molecular Probes, USA), and reacted with Hoechst 33342 (Thermo Fisher Scientific, USA) for 5 minutes at room temperature to confirm cell nuclei. dyed during After washing with PBS, the plate was mounted with an anti-fade mounting solution (VECTASHIELD H-1000, USA), covered with a cover glass, and the immunostaining result was confirmed using a confocal microscope.
  • VECTASHIELD H-1000 an anti-fade mounting solution
  • oocytes In the case of oocytes, they were fixed in 4% paraformaldehyde at room temperature for 10 minutes, treated with 0.1% Triton-X, and then washed with PBS for 30 minutes at room temperature. Rabbit anti-neogenin antibody (diluted 1:100 in PBS with 0.1% BSA) was added and incubated overnight at 4°C. Then, they were incubated with a secondary antibody (anti-rabbit labeled 555) at room temperature for 2 hours and washed with PBS. Nuclei were stained with Hoechst 33342 for 5 minutes at room temperature, washed twice with PBS, and the stained oocytes were transferred to a dish and immunostaining results were confirmed using a confocal microscope.
  • RNA expression of RGMc-treated ovaries was analyzed. Specifically, 100 ng of total RNA was isolated from the ovary using TRIzol according to the manufacturer's protocol, reverse transcribed into cDNA using AccuPower CycleScript RT Premix (Bioneer, Korea), and using the cDNA as a template, mouse Neogenin, Oct3/ PCR was performed with AccuPower Taq PCR PreMix (Bioneer, Korea) using 4, Nanog, p63 and Beta-actin specific primer sets.
  • Protein expression of RGMc-treated ovaries was analyzed by Western blot. Specifically, ovarian tissue samples were homogenized in PRO-PREPTM protein extraction solution (iNtRON Biotechnology, Korea), proteins contained in Laemmli buffer were denatured by heating at 95°C for 5 minutes, and 10% SDS- After electrophoresis by PAGE, it was transferred to a 0.2 ⁇ m nitrocellulose membrane (Bio-Rad, USA).
  • the transferred membrane was blocked with TBST buffer containing 5% BSA for 1 hour at room temperature, and then the primary antibody diluted in TBST buffer containing 1% BSA, rabbit anti-neogenin polyclonal (1:2000 dilution) , Novus, USA), rabbit anti-Oct3/4 (diluted 1:2000, Santa Cruz Biotechnology, USA), mouse anti-Nanog (diluted 1:2000, Santa Cruz Biotechnology, USA), mouse anti-p63 (1 :2000 dilution, Santa Cruz Biotechnology, USA) and mouse anti-Beta-actin (1:2000 dilution, Invitrogen, USA) and incubated overnight at 4°C.
  • NGS Next Generation Sequencing
  • RNA was isolated from ovaries using TRIzol according to the manufacturer's protocol, and the purified mRNA was used for NGS.
  • Sequencing was performed on the mRNA using MiSeq sequencer (Illumina, USA), and NGS data was analyzed using REVIGO program and Gene Ontology.
  • DEG differentially expressed gene
  • enrichment analyzes were performed using 4 mouse ( Mus musculus ) samples per group.
  • Raw sequencing data were mapped, and transcript assembly was performed using HISAT2 (ver. 2.1.0), Bowtie2 (ver. 2.3.4.1) and StringTie (ver. 1.3.4d).
  • Sorted read counts were normalized by the Trimmed Mean of M-values (TMM) method, and genes exhibiting an absolute 4-fold or higher expression change were extracted and aggregated clustering analysis was performed using the Euclidean and Ward algorithms. did A database containing 20,196 reference genes was used for gene enrichment analysis. Cytoscape (ver. 3.7.2) ClueGO (ver. 2.5.5) module was used to analyze the pathway of each gene whose expression level was up/down-regulated in RGMc-treated ovaries. Statistical significance was determined by performing a two-sided hypergeometric test using Bonferroni step-down correction. GO terms with an enrichment percentage greater than 60% were selected for each gene cluster whose expression level was up/down-regulated. The relationship between terms was confirmed based on the kappa score.
  • TMM Trimmed Mean of M-values
  • RT-qPCR was performed to validate NGS data obtained from control and RGMc-treated ovaries. Based on the KEGG pathway, primers targeting upregulated ( Ptgs1, Edn2 and Hpgds ) and downregulated ( Tbxa2r, Oxtr and Adra1d ) genes were selected (Table 1 below).
  • RNA was isolated from ovaries using TRIzol, reverse transcribed into cDNA using AccuPower CycleScript RT Premix (Bioneer, Korea), and the cDNA was used as a template in SsoAdvanced Universal SYBR Green Supermix (Bio-Rad , USA) was used to perform qPCR.
  • 10 pmol/ ⁇ L of forward and reverse primers, 200 ng of template cDNA, and 2x SsoAdvanced Universal SYBR Green Supermix were added to the tube, distilled water was added to a total volume of 20 ⁇ L, and PCR reaction was carried out at 95°C for 3 minutes at 95°C.
  • neogenin is expressed in all stages of follicle development. Specifically, neogenin was expressed in all of the primordial follicle, primary follicle, secondary follicle and mature follicle (Fig. 1(a)), and germinal follicle (germinal follicle). Vesicle: GV) and neogenin stained with anti-neogenin antibody (red) in immature oocytes and metaphase II: MII (FIG. 1(b)). In addition, it was confirmed that the above results were the same in the mRNA and protein expression analysis of the mouse ovary (FIG. 1(c), FIG. 1(d)).
  • neogenin was expressed at all stages of follicle development, and therefore, the processing of neogenin ligand can be involved in both gonadotropin-independent and -dependent processes.
  • mRNA expression patterns were analyzed by RT-PCR. As shown in FIG. 3, it was confirmed that the mRNA expression levels of Oct3/4, Nanog, p63, and Neogenin were significantly increased in the RGMc-treated group compared to the control group (FIG. 3(a)). In particular, the mRNA expression levels of Oct3/4, Nanog , and p63 increased about 2-fold compared to the control group (Fig. 3(b)).
  • RGMc treatment increased the activity of primordial follicles.
  • Oct3/4, Nanog, and p63 regulate the proliferation of stromal cells and the differentiation of granulosa cells into prefollicles
  • treatment with RGMc significantly reduces the expression levels of Oct3/4 and Nanog. It was found that COS can be promoted by up-regulation, and through this, the survival of primordial follicles in the ovary can be improved.
  • p63 is a regulator of meiosis and plays an important role in regulating the cell cycle of primordial follicles, it was found that RGMc treatment can promote follicle development in the ovary.
  • FIG. 4 and 5 show the results of analyzing the whole transcriptomes of ovaries of the control group and the experimental group through Next Generation Sequencing (NGS).
  • NGS Next Generation Sequencing
  • 275 genes showed a difference in mRNA expression levels of 4-fold or more between the RGMc-treated ovaries and the control group.
  • the expression of 197 and 78 DEGs increased in ovaries and control ovaries, respectively (Fig. 4(a), Fig. 4(b)).
  • the thick solid line indicates association based on experimental evidence
  • the thin solid line indicates association based on other evidence
  • the size and color of the circle indicate the enrichment significance and percentage of up/down expressed genes, respectively.
  • 23 were associated with 8 terms associated with cilium and microtubule (cilium organization, cilium assembly, microtubule-based movement). ), microtubule bundle formation, axoneme assembly, axon-dynein complex assembly and inner dynein assembly), and it was confirmed that they are closely correlated with each other (Fig. 5b).
  • the remaining 12 DEGs that were up-expressed and a total of 19 DEGs that were down-expressed corresponded to 7 down-expressed, 7 up-expressed, and 2 non-satisfied terms (Fig. 5c).
  • RT-qPCR was performed to experimentally verify the NGS data analyzed in Example 4 above.
  • FIGS. 5A to 5C the results of real-time qPCR were performed on the three genes whose expression levels were upregulated (FIG. 5c, white arrows) and the three genes whose expression levels were downregulated (FIG. 5c, hatched arrows).
  • Hpgds And Edn2 mRNA expression levels were significantly increased by 13-fold in RGMc-treated ovaries compared to the control group, whereas mRNA expression levels of down-regulated genes such as Tbxa2r were significantly decreased in RGMc-treated ovaries compared to the control group (p ⁇ 0.05) (FIGS. 6A, 6B).
  • Edn2 is known to be involved in follicle rupture and corpus luteum formation in the ovary during the reproductive cycle.
  • Hpgds produce PGD1 and PGD2 to interfere with FSH activity in granulosa cells
  • PGD2 regulates the expression of FSH and LH receptors, and in both gonadotropin-independent and -dependent processes of follicle development, granulosa It regulates the balance between cell proliferation, differentiation and steroidogenic activity, and plays an important role in the ovulatory cascade including oocyte maturation, cumulus expansion and follicle maturation.
  • oxytocin and oxytocin receptor are associated with POR, and their expression levels are known to be increased in follicular fluid of patients with polycystic ovarian syndrome (PCOS).
  • PCOS polycystic ovarian syndrome
  • RGMc promotes follicle development through up-regulation of the expression levels of Edn2 and Hpgds , and at the same time, down-regulation of the expression levels of genes such as Tbxa2r inhibits early ovulation and promotes normal follicle development. expected to do.
  • prostaglandin acts as a key factor in follicular development. Therefore, the relationship between prostaglandins and ovarian hypostimulation syndrome (POR) was analyzed using human follicular fluid and cumulus cells (CC). With the approval of the Research Ethics Review Committee of Cha University, follicular fluid was collected during oocyte collection, oocytes were removed, and cumulus cells were collected. ELISA was performed using follicular fluid collected from patients with normal ovarian responses and POR patients with ⁇ 4 oocytes and AMH levels below 1 ng/mL. Response signals were measured with a microplate reader (BioTek Instruments, USA), and gene expression in cumulus cells was analyzed by real-time PCR.
  • the PGD2 expression level of follicular fluid collected from cumulus cells of patients with normal ovarian responses and POR patients was analyzed.
  • the analysis target 15 individuals were analyzed for each group.
  • the concentration of PGD2 in the follicular fluid of POR patients was significantly reduced compared to the elderly patients with normal ovarian responses.
  • the median value of PGD2 concentration in the POR group was reduced by at least 70% or less compared to the median value in the young group.
  • PGD2 can be used as a biomarker to diagnose POR through a significant difference in the expression level of PGD2 in follicular fluid between patients with normal ovarian response and POR patients confirmed.
  • the culture medium was changed to a medium containing 50 ng/mL of RGMc, and after one day, the culture medium was collected and the concentration of PGD2 in the medium was measured using an ELISA kit. The results are shown in FIG. 8 .

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gynecology & Obstetrics (AREA)
  • Pregnancy & Childbirth (AREA)
  • Reproductive Health (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

난소 저자극 증후군 조기 진단용 바이오마커 및 이의 용도에 관한 것이다. 일 양상에 따른 조성물을 이용하면 난소 저자극 증후군 환자의 난포액에서 유의성 있게 낮게 발현되는 PGD2의 발현 수준을 측정 및 비교하여 나이에 관계 없이 난소 저자극 증후군을 조기에 진단할 수 있다. 나아가, 상기 진단 결과를 난임 환자의 개별화된 치료 전략 수립에 사용할 수 있으며, 궁극적으로는 효과적인 난임 치료에 기여할 것으로 기대된다.

Description

PGD2를 포함하는 난소 저자극 증후군 조기 진단용 바이오마커 및 이의 용도
본 출원은 2021년 8월 26일 출원된 대한민국 특허출원 제 10-2021-0113411호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
난소 저자극 증후군 조기 진단용 바이오마커 및 이의 용도에 관한 것이다.
난소 저자극 증후군 (poor ovarian response: POR)은 불임 여성 환자의 9~24%에서 관찰되며, 낮은 임신 성공률과 밀접한 관련이 있다. 2010년 이탈리아 볼로냐에서 열린 유럽생식의학회 (European Society of Human Reproduction and Embryology: ESHRE)에서, 난소 저자극 증후군의 진단기준이 다음과 같이 제시되었다 (다음 3가지 기준 중 2가지 이상에 해당할 경우 난소 저반응군으로 진단함): 1) 고령 (40세 이상), 2) 조절된 난소 자극 (controlled ovarian stimulation: COS) 프로토콜에 따라 난자 채취 시 난자가 3개 이하로 나온 경우, 3) 동난포수 (Antral Follicle Count: AFH)가 5~7개 미만이거나 항뮬러관호르몬 (anti-Mullerian hormone: AMH) 수치가 0.5~1.1 ng/ml 미만인 경우. 그러나, AMH는 나이가 들면서 난소의 기능이 저하됨에 따라 낮아지므로, 젊은 나이에 난소 기능이 저해되거나 저해될 가능성이 있는 경우에 대해서는 아직까지 조기에 진단할 수 있는 방법이 전무하다.
한편, 프로스타글란딘 (Prostaglandin: PG)은 구조적으로 프로스탄산 골격을 가지며, 세포 성장의 조절, 평활근 조직의 수축과 이완 등 여러가지 신체 기능에 관여하는 생리활성물질로, 이 중 프로스타글란딘 D2 (Prostaglandin D2: PGD2)는 혈소판 응집을 억제하고 동통, 발열 등의 염증 과정에 관여한다고 알려져 있다.
본 발명자들은 난소 저자극 증후군 환자들의 난포액에서 PGD2의 발현 수준을 측정하고, 그 결과 나이에 상관 없이 난소의 호르몬 반응이 낮은 경우 PGD2의 발현 수준이 일정 수준 이하로 나타나므로, 상기 PGD2가 난소 저자극 증후군의 조기 진단 물질이 될 수 있음을 확인함으로써 본 발명을 완성하였다.
일 양상은 PGD2의 발현 수준을 측정하는 제제를 포함하는 난소 저자극 증후군 조기 진단용 조성물을 제공하는 것이다.
다른 양상은 상기 조성물을 포함하는 난소 저자극 증후군 조기 진단용 키트를 제공하는 것이다.
또 다른 양상은 (a) 분리된 생물학적 시료로부터 PGD2의 발현 수준을 측정하는 단계;
(b) 상기 (a) 단계에서 측정된 PGD2의 발현 수준을 정상 대조군 시료의 PGD2 발현 수준과 비교하는 단계; 및
(c) 상기 생물학적 시료의 PGD2의 발현 수준이 정상 대조군 시료의 PGD2의 발현 수준보다 낮을 경우 난소 저자극 증후군으로 진단하는 단계를 포함하는 난소 저자극 증후군 조기 진단에 필요한 정보를 제공하는 방법을 제공하는 것이다.
또 다른 양상은 (a) 분리된 생물학적 시료 또는 인간을 제외한 동물에 난소 저자극 증후군 치료제 후보물질을 처리하는 단계;
(b) 상기 후보물질 처리군에서 PGD2의 발현 수준을 측정하는 단계; 및
(c) 상기 (b) 단계에서 측정된 PGD2의 발현 수준이 후보물질을 처리하지 않은 대조군의 PGD2 발현 수준에 비해 증가한 경우, 상기 후보물질을 난소 저자극 증후군 치료제로 선택하는 단계;를 포함하는 난소 저자극 증후군 치료제의 스크리닝 방법을 제공하는 것이다.
본 발명자들은 난소 저자극 증후군 환자에서 특이적으로 발현이 변화되는 바이오마커를 찾기 위해 정상 대조군 마우스 및 실험군 마우스 난소의 전체 전사체를 대상으로 NGS 분석을 수행하고, 프로스타글란딘이 난포 발달 (follicular development)에서 핵심 인자로 작용함을 확인하였다. 그런 다음, 정상 대조군과 난소 저자극 증후군 환자로부터 난포액 및 난구세포를 수집하여 을 수집하여 프로스타글란딘 D2(Prostaglandin D2, PGD2) 발현 수준을 비교 분석하였고, 상기 PGD2가 난소 저자극 증후군 환자의 난포액에서 비정상적으로 낮게 발현됨을 확인하였다.
따라서, 본 명세서는 난소 저자극 증후군 진단에 필요한 정보를 제공하기 위하여, 체외 수정 (in vitro fertilization: IVF)에 의해 체외로 얻어지는 난모세포 (Oocytes), 난구세포 (Cumulus cells) 및 난포액 (Follicular fluid) 중 PGD2의 발현 수준을 측정하는 제제를 포함하는 진단용 조성물; 및 상기 발현 수준을 측정하는 단계를 포함하는 분석 방법을 제공한다.
일 양상은 PGD2 의 발현 수준을 측정하는 제제를 포함하는 난소 저자극 증후군 조기 진단용 조성물을 제공한다.
본 명세서에서, 상기 PGD2는 하기 화학식 1로 표시되는 화합물 (PubChem CID: 448457) 또는 이의 약학적으로 허용가능한 염을 포함할 수 있다.
[화학식 1]
Figure PCTKR2022003370-appb-img-000001
본 명세서에서 용어, "난소 저자극 증후군 (Poor ovarian response: POR)"은 "난소 저반응" 또는 "난소기능저하"와도 혼용되어 사용된다.
본 명세서에서 용어, "진단"은 병리 상태의 존재 또는 특징을 확인하는 것을 의미한다. 본 명세서의 목적상, 상기 진단은 난소 저자극 증후군의 발병 여부를 확인하는 것으로서, 난소 저자극 증후군의 발병 여부를 조기에 확인할 수 있다.
본 명세서에서 용어, "바이오마커 (biomarker)"란 정상군 개체와 난소 저자극 증후군을 갖는 개체를 구분하여 진단할 수 있는 물질로, 난소 저자극 증후군을 갖는 개체에서 증가 또는 감소를 보이는 폴리펩티드, 단백질, 핵산, 유전자, 지질, 당지질, 당단백질 또는 당 등과 같은 유기 생체 분자들을 모두 포함할 수 있다.
일 실시예에서는, 난소 반응이 정상인 젊은, 노령의 환자에 비해 POR 환자의 난포액에서 PGD2 발현 정도 (예를 들어, 농도 등)가 현저히 감소되어 있음을 확인하여, PGD2가 난소 저자극 증후군을 진단할 수 있는 바이오마커가 될 수 있음을 확인하였다.
본 명세서에서, "PGD2 발현 수준 측정"이란 난소 저자극 증후군 진단을 위하여 생물학적 시료에서 난소 저자극 증후군 진단용 마커인 PGD2의 존재 여부와 발현 정도를 확인하는 과정이다. 상기 PGD2에 대하여 특이적으로 결합하는 항체를 이용하여 PGD2의 발현 정도를 확인할 수 있다.
상기 PGD2의 발현 수준 측정 또는 비교 분석 방법으로는 단백질 칩 분석, 면역측정법, 리간드 바인딩 어세이, MALDI-TOF (Matrix Desorption/Ionization Time of Flight Mass Spectrometry) 분석, SELDI-TOF (Sulface Enhanced Laser Desorption/Ionization Time of Flight Mass Spectrometry) 분석, 방사선 면역분석, 방사 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 면역조직화학 (immunohistochemistry) 분석, 면역세포화학 (immunocytochemistry) 분석, 보체 고정 분석법, 2차원 전기영동 분석, 액상 크로마토그래피-질량분석 (liquid chromatography-Mass Spectrometry, LC-MS), LC-MS/MS (liquid chromatography-Mass Spectrometry/Mass Spectrometry), 웨스턴 블롯, 및 ELISA (enzyme linked immunosorbentassay) 등이 사용될 수 있다. 일 실시예에서, PGD2 발현 수준은 ELISA를 통해 측정될 수 있다.
예를 들어, 상기 PGD2의 발현 수준을 측정하는 제제는 PGD2 에 특이적으로 결합하는 항체를 포함할 수 있다.
본 명세서에서, 용어 "항체"는 항원성 부위에 대해서 지시되는 특이적인 단백질 분자를 의미한다. 본 명세서의 목적상, 상기 항체는 PGD2에 대해 특이적으로 결합하는 항체를 의미하며, 다클론 항체, 단클론 항체 및 재조합 항체를 모두 포함한다. 항체는 당업계에 널리 공지된 기술을 이용하여 용이하게 제조할 수 있다.
상기 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라, 항체 분자의 기능적인 단편을 포함할 수 있다. 항체분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 의미하며, 예를 들어 Fab, F(ab'), F(ab') 2 및 Fv 등이 있다.
본 명세서에서 용어, "mRNA 수준 측정"이란 난소 저자극 증후군을 진단하기 위하여 생물학적 시료에서 난소 저자극 증후군 진단용 유전자들의 mRNA 존재 여부와 발현 정도를 확인하는 과정을 의미한다. 이를 위한 분석 방법으로는 역전사중합효소반응 (RT-PCR), 경쟁적 역전사 중합효소반응 (Competitive RT-PCR), 실시간 역전사 중합효소반응 (Real-time RT-PCR), RNase 보호 분석법 (RNase protection assay), 노던 블롯팅 (Northern blotting), DNA 칩 등이 있으나, 이에 제한되는 것은 아니다.
상기 유전자의 mRNA 수준을 측정하는 제제는 바람직하게는 프라이머 쌍 또는 프로브이며, 공지된 유전자 서열을 바탕으로 이들 유전자의 특정 영역을 특이적으로 증폭하는 프라이머 또는 프로브를 디자인하는 방법은 당업자에게 잘 알려져 있다.
상기 유전자의 mRNA 수준을 측정하는 제제는 상기 유전자에 특이적으로 결합하는 프라이머 쌍, 프로브 또는 안티센스 뉴클레오티드를 포함할 수 있다.
본 명세서에서, 용어 "프라이머 쌍"은 표적 유전자 서열을 인지하는 정방향 및 역방향의 프라이머로 이루어진 모든 조합의 프라이머쌍을 포함하나, 바람직하게는, 특이성 및 민감성을 가지는 분석 결과를 제공하는 프라이머 쌍이다. 프라이머의 핵산 서열이 시료내 존재하는 비-표적 서열과 불일치하는 서열이어서, 상보적인 프라이머 결합 부위를 함유하는 표적 유전자 서열만 증폭하고 비특이적 증폭을 유발하지 않는 프라이머일 때, 높은 특이성을 부여할 수 있다.
본 명세서에서, 용어 "프로브"는 시료 내의 검출하고자 하는 표적 물질과 특이적으로 결합할 수 있는 물질을 의미하며, 상기 결합을 통하여 특이적으로 시료 내의 표적 물질의 존재를 확인할 수 있는 물질을 의미한다. 프로브 분자의 종류는 당업계에서 통상적으로 사용되는 물질로서 제한은 없으나, 바람직하게는 PNA (peptide nucleic acid), LNA (locked nucleic acid), 펩타이드, 폴리펩타이드, 단백질, RNA 또는 DNA 일 수 있다. 보다 구체적으로, 상기 프로브는 바이오 물질로서 생물에서 유래되거나 이와 유사한 것 또는 생체 외에서 제조된 것을 포함하는 것으로 예를 들어, 효소, 단백질, 항체, 미생물, 동식물 세포 및 기관, 신경세포, DNA, 및 RNA일 수 있으며, DNA는 cDNA, 게놈 DNA, 올리고뉴클레오타이드를 포함하며, RNA는 게놈 RNA, mRNA, 올리고뉴클레오타이드를 포함하며, 단백질의 예로는 항체, 항원, 효소, 펩타이드 등을 포함할 수 있다.
본 명세서에서, 용어 "안티센스 올리고뉴클레오티드"는 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체로서, mRNA 내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 작용을 한다. 안티센스 올리고뉴클레오티드 서열은 상기 유전자들의 mRNA에 상보적이고 상기 mRNA에 결합할 수 있는 DNA 또는 RNA 서열을 의미한다. 이는 상기 유전자 mRNA의 번역, 세포질 내로의 전위 (translocation), 성숙 (maturation) 또는 다른 모든 전체적인 생물학적 기능에 대한 필수적인 활성을 저해할 수 있다. 안티센스 올리고뉴클레오티드의 길이는 6 내지 100 염기, 6 내지 90 염기, 6 내지 80 염기, 6 내지 70 염기, 6 내지 60 염기, 7 내지 60 염기, 8 내지 60 염기, 8 내지 50 염기, 9 내지 50 염기, 10 내지 50 염기, 10 내지 40 염기, 11 내지 40 염기, 12 내지 40 염기, 12 내지 30 염기 또는 12 내지 28 염기일 수 있다. 상기 안티센스 올리고뉴클레오티드는 통상의 방법으로 시험관 내에서 합성되어 생체 내로 투여하거나 생체 내에서 안티센스 올리고뉴클레오티드가 합성되도록 할 수 있다. 시험관 내에서 안티센스 올리고뉴클레오티드를 합성하는 한가지 예는 RNA 중합효소 I를 이용하는 것이다. 생체 내에서 안티센스 RNA가 합성되도록 하는 한 가지 예는 다중클로닝부위 (MCS)의 기원이 반대 방향에 있는 벡터를 사용하여 안티센스 RNA가 전사되도록 하는 것이다. 상기 안티센스 RNA는 서열 내에 번역 중지 코돈이 존재하도록 하여 펩타이드 서열로 번역되지 않도록 하는 것이 바람직하다.
다른 양상은 상기 조성물을 포함하는 난소 저자극 증후군 조기 진단용 키트를 제공한다.
상기 키트에 있어서, 상기 조성물 및 난소 저자극 증후군에 대한 설명과 중복되는 부분은 그 설명을 생략한다.
상기 키트는 ELISA (Enzyme-linked immunosorbent assay) 키트, 단백질 칩 키트 또는 래피드 (rapid) 키트일 수 있다.
또한, 상기 키트는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성성분 조성물, 용액 또는 장치를 더 포함하여 구성될 수 있다.
또한, 상기 진단용 키트는 ELISA를 수행하기 위해 필요한 필수 요소를 포함하는 것을 특징으로 하는 진단 키트일 수 있다. ELISA 키트는 상기 PGD2에 대한 특이적인 항체를 포함한다. 항체는 각 마커에 대한 특이성 및 친화성이 높고 다른 마커에 대한 교차 반응성이 거의 없는 항체로, 단클론 항체, 다클론 항체 또는 재조합 항체이다. 그 외에, 상기 ELISA 키트는 결합된 항체를 검출할 수 있는 시약, 예를 들면, 표지된 2차 항체, 발색단 (chromophores), 효소 (예: 항체와 접합됨) 및 그의 기질 또는 항체와 결합할 수 있는 다른 물질 등을 포함할 수 있다.
또한, 상기 진단용 키트는 5분내 분석결과를 알 수 있는 신속한 테스트를 수행하기 위해 필요한 필수 요소를 포함하는 것을 특징으로 하는 래피드 (rapid) 키트일 수 있다. 래피드 키트는 마커에 대한 특이적인 항체를 포함한다. 항체는 각 마커에 대한 특이성 및 친화성이 높고 다른 마커에 대한 교차 반응성이 거의 없는 항체로, 단클론 항체, 다클론 항체 또는 재조합 항체이다. 그 외에, 상기 래피드 키트는 결합된 항체를 검출할 수 있는 시약, 예를 들면, 특이항체와 2차 항체가 고정된 나이트로 셀룰로오스 멤브레인, 항체가 결합된 비드에 결합된 멤브레인, 흡수패드와 샘플 패드 등 다른 물질 등을 포함할 수 있다.
또 다른 양상은 (a) 분리된 생물학적 시료로부터 PGD2의 발현 수준을 측정하는 단계;
(b) 상기 (a) 단계에서 측정된 PGD2의 발현 수준을 정상 대조군 시료의 PGD2 발현 수준과 비교하는 단계; 및
(c) 상기 생물학적 시료의 PGD2의 발현 수준이 정상 대조군 시료의 PGD2의 발현 수준보다 낮을 경우 난소 저자극 증후군으로 진단하는 단계를 포함하는 난소 저자극 증후군 조기 진단에 필요한 정보를 제공하는 방법을 제공한다.
상기 방법에 있어서, PGD2의 발현 수준의 측정 방법 및 난소 저자극 증후군에 대한 설명과 중복되는 부분은 그 설명을 생략한다.
본 명세서에서, 용어 "생물학적 시료"란 난소 저자극 증후군 발병에 의해 유전자 발현 수준 또는 단백질 발현 수준이 차이가 나는 조직, 세포, 체액, 전혈, 혈청, 혈장, 타액, 뇌척수액 또는 뇨와 같은 시료 등을 포함하나, 이에 제한되지 않는다.
일 실시예에서는, 난소 반응이 정상인 환자와 POR 환자의 난구세포에서 수집한 난포액의 PGD2 수준을 분석하였다. 상기 PGD2는 난소 반응이 정상인 젊은, 노령의 환자에 비해 POR 환자에서 발현 수준이 현저히 감소되어 있으므로, 분리된 생물학적 시료의 PGD2 발현 수준과 정상 대조군 시료의 PGD2 발현 수준을 비교하여 난소 저자극 증후군 여부를 진단할 수 있다.
상기 PGD2의 발현 수준은 상기 PGD2에 특이적으로 결합하는 항체를 이용하여 측정 및 비교할 수 있다. 상기 항체와 생물학적 시료 내의 해당 단백질이 항원-항체 복합체를 형성하도록 하고, 이를 검출하는 방법을 이용한다.
본 명세서에서, 용어 "항원-항체 복합체"는 생물학적 시료 중의 항원과 이를 인지하는 항체의 결합물을 의미한다. 상기 항원-항체 복합체의 검출은 당업계에 공지된 바와 같은 방법, 예를 들어 분광학적, 광화학적, 생물화학적, 면역화학적, 전기적, 흡광적, 화학적 및 기타 방법을 이용하여 검출할 수 있다. 일 구체예에서, 항원은 PGD2일 수 있으며, 항체는 상기 PGD2에 특이적으로 결합하는 항체일 수 있다.
본 명세서의 목적상, 상기 단백질 발현 수준 측정 또는 비교 분석 방법으로는 단백질 칩 분석, 면역측정법, 리간드 바인딩 어세이, MALDI-TOF (Matrix Desorption/Ionization Time of Flight Mass Spectrometry) 분석, SELDI-TOF (Sulface Enhanced Laser Desorption/Ionization Time of Flight Mass Spectrometry) 분석, 방사선 면역분석, 방사 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 면역조직화학 (immunohistochemistry) 분석, 면역세포화학 (immunocytochemistry) 분석, 보체 고정 분석법, 2차원 전기영동 분석, 액상 크로마토그래피-질량분석 (liquid chromatography-Mass Spectrometry, LCMS), LC-MS/MS (liquid chromatography-Mass Spectrometry/Mass Spectrometry), 웨스턴 블롯 및 ELISA (enzyme linked immunosorbentassay) 등이 있으나 이에 제한되는 것은 아니다.
일 실시예에서, PGD2의 발현 수준이 0.01 내지 10 ng/ml, 0.01 내지 5 ng/ml, 0.01 내지 3 ng/ml, 0.01 내지 2 ng/ml, 또는 0.01 내지 1 ng/ml 의 농도인 경우에 난소 저자극 증후군으로 진단할 수 있다. (이 때, 역은 평균 0.1 내지 0.5 ng/ml, 0.2 내지 0.3 ng/ml 일 수 있다.)
일 구체예에서, POR 그룹의 GD2 농도가 젊은(Young) 그룹의 농도에 비해 0.01 내지 0.2, 0.01 내지 0.15 또는 0.05 내지 0.15 작은 경우에 난소 저자극 증후군으로 진단할 수 있다.
일 구체예에서, POR 그룹의 GD2 농도가 늙은(Old) 그룹의 농도에 비해 0.01 내지 0.5, 0.01 내지 0.3, 0.05 내지 0.3, 0.1 내지 0.3 작은 경우에 난소 저자극 증후군으로 진단할 수 있다.
일 실시예에서, ELISA로 PGD2의 발현 수준을 측정하는 경우, 측정된 PGD2의 발현 수준이 정상 대조군의 PGD2 발현 수준에 비하여 약 70% 이하, 약 50% 이하 또는 약 30% 이하인 경우에 난소 저자극 증후군으로 진단할 수 있다.
일 구체예에서, POR 그룹의 GD2 농도의 중간값은 젊은 그룹의 중간값에 비해 적어도 약 70% 이하, 약 50% 이하, 또는 약 30% 이하인 경우에 난소 저자극 증후군으로 진단할 수 있다.
또 다른 양상은 (a) 분리된 생물학적 시료 또는 인간을 제외한 동물에 난소 저자극 증후군 치료제 후보물질을 처리하는 단계;
(b) 상기 후보물질 처리군에서 PGD2의 발현 수준을 측정하는 단계; 및
(c) 상기 (b) 단계에서 측정된 PGD2의 발현 수준이 후보물질을 처리하지 않은 대조군의 PGD2 발현 수준에 비해 증가한 경우, 상기 후보물질을 난소 저자극 증후군 치료제로 선택하는 단계;를 포함하는 난소 저자극 증후군 치료제의 스크리닝 방법을 제공한다.
상기 방법에 있어서, PGD2의 발현 수준의 측정 방법 및 난소 저자극 증후군에 대한 설명과 중복되는 부분은 그 설명을 생략한다.
본 명세서에서, 용어 "난소 저자극 증후군 치료제 후보물질"은 난소 저자극 증후군 치료의 가능성을 갖는 것으로 예상되거나 또는 무작위적으로 선정된 개별적인 핵산, 단백질, 기타 추출물 또는 천연물, 또는 화합물 등이 될 수 있다.
본 명세서에서, 용어 "대조군"이란 난소 저자극 증후군 치료제 후보물질을 처리하지 않은 분리된 생물학적 시료 또는 인간을 제외한 동물로 상기 후보물질을 처리한 군과 병렬 관계에 속하는 분리된 생물학적 시료 또는 인간을 제외한 동물을 의미한다.
일 실시예에서는, POR 환자들로부터 수집한 난구세포에 RGMc 처리 시 난구세포 배양 배지의 PGD2 발현 수준이 현저히 증가함을 확인하여, PGD2 발현 수준의 변화를 통해 난소 저자극 증후군 치료제를 스크리닝할 수 있음을 확인하였다.
일 양상에 따른 조성물을 이용하면 난소 저자극 증후군 환자의 난포액에서 유의성 있게 낮게 발현되는 PGD2의 발현 수준을 측정 및 비교하여 나이에 관계 없이 난소 저자극 증후군을 조기에 진단할 수 있다. 나아가, 상기 진단 결과를 난임 환자의 개별화된 치료 전략 수립에 사용할 수 있으며, 궁극적으로는 효과적인 난임 치료에 기여할 것으로 기대된다.
도 1은 난소에서 네오제닌의 발현 프로파일을 확인한 결과를 나타낸 도이다. (a) 항-네오제닌 항체를 사용한 면역염색 결과. 네오제닌 (녹색), p63 (빨간색) 및 DAPI (파란색). 화살표는 네오제닌이 양성으로 염색된 난포를 의미함. (b) 마우스 난모세포의 공초점 이미지 분석 결과. 네오제닌 (빨간색), DAPI (파란색). GV: 배 소포 (Germinal Vesicle), MⅡ: 유사분열 중기 Ⅱ기 (Metaphase Ⅱ), BF: 명시야 (Bright Field). (c) 마우스 난모세포에서 네오제닌 mRNA의 RT-PCR 분석 결과. GAPDH를 내부 대조군으로 사용. (d) 마우스 난소에서 네오제닌 단백질의 웨스턴 블롯 결과. Beta-actin을 내부 대조군으로 사용. Neo: 네오제닌 (Neogenin).
도 2는 PMSG로 자극한 마우스 난소에 RGMc를 처리하고, 난소의 난포 발달 양상을 확인한 결과를 나타낸 도이다. (a) H&E 염색 결과 (Scale bar = 200 μ m). (b) 대조군 (CTL) 및 RGMc 처리군의 총 난포 개수. (c) 동난포 수. (d) 수집된 난모세포의 수.
도 3은 RGMc 처리한 난소의 mRNA 및 단백질 발현을 분석한 도이다. (a) RT-PCR 분석 결과. (b) Quantitative real-time PCR 분석 결과. (c) 웨스턴 블롯 분석 결과.
도 4는 RGMc 처리한 난소의 전체 전사체 (whole transcriptomes) NGS 결과를 나타낸 도이다. (a) 대조군 및 RGMc 처리한 난소에서 발현 수준이 상향/하향 조절된 (fold-change > 4) 유전자의 벤 다이어그램. 총 24,255개 유전자가 RNA-시퀀싱 분석에 사용됨. (b) 발현 수준이 상향/하향 조절된 (fold-change > 4) 유전자들의 클러스터 맵 (cluster map).
도 5a는 RGMc 처리한 난소에서 절대적으로 4배 이상의 fold-change를 나타낸 발현 수준이 상향/하향 조절된 유전자 간의 연관성을 확인한 도이다. (a) RGMc 처리한 난소에서 유의적으로 농축된 term 및 상향/하향 발현된 유전자에 기반한 히트맵 (Heatmap). 상단 및 좌측 사이드 바의 파란색, 빨간색은 각각 RGMc 처리한 난소에서 상향/하향 발현된 term을 의미하며, 검은색은 상향/하향 발현된 유전자들에서 60% 이상의 농축을 나타낸 non-satisfied term을 의미. 히트맵의 빨간색, 녹색은 각각 유전자의 존재/부존재를 의미.
도 5b 및 도 5c는 RGMc 처리한 난소에서 절대적으로 4배 이상의 fold-change를 나타낸 발현 수준이 상향/하향 조절된 유전자 간의 연관성을 확인한 도로서, 유의적으로 농축된 terms와 상향/하향 발현된 (fold-change > 4) 유전자들 간의 네트워크 기반 분석. 파란색과 빨간색은 각각 RGMc 처리한 난소에서 상향/하향 발현된 유전자/term을 의미하며, 회색은 상향/하향 발현된 유전자들에서 60% 이상의 농축을 나타낸 non-satisfied term을 의미. 흰색, 빗금 화살표는 RGMc 처리에 따라 상향/하향 발현된, 타당성 분석을 위한 타겟 유전자를 의미.
도 6은 RGMc 처리한 난소의 NGS 데이터를 검증하기 위한 quantitative real-time PCR 분석 결과를 나타낸 도이다. (a) RT-PCR 분석 결과. (b) Quantitative real-time PCR 분석 결과. *p < 0.05 vs. 대조군.
도 7은 정상 대조군 및 POR 환자의 난포액에서의 PGD2 수준을 분석한 결과를 나타낸 도이다.
도 8은 RGMc 처리에 따른 난포액 및 난구세포 배양 배지의 ELISA 결과를 나타낸 도이다. (a, b) 난구세포 배양 배지에서의 PGD2 수준. *p < 0.05 vs. 젊은, 노령의 난소 반응이 정상인 그룹.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실험 방법
1. 실험동물의 준비 및 RGMc의 주입
실험 동물은 체중 20-25g의 생후 6-8주령 ICR 마우스 (Oriental Bio, Korea)를 사용하였고, 차의과대학교 동물실험윤리위원회의 승인을 받아 대조군 30마리, 실험군 30마리의 총 60마리를 사용하였다. In vivo 호르몬 자극을 위해, 실험군에 0.5 mg/kg RGMc를 주입하고, 12시간 후 75 IU 혈청성생식선자극호르몬 (pregnant mare serum gonadotropin: PMSG)을 주입하였다. 대조군의 경우, 75 IU PMSG만을 주입하였다. 마우스들을 챔버에서 CO2 가스 흡입법으로 안락사시킨 후, 양쪽 난소를 모두 채취하여 그 중 하나는 조직학적 분석을 위해 실온에서 밤새 4% 파라포름알데히드 (paraformaldehyde)로 고정시키고, 다른 하나는 -80℃에서 보관하였다.
2. 조직학적 분석 및 공초점 이미지 분석
마우스 난소 및 난모세포에서 네오제닌의 발현을 측정하였다. 먼저, 4% 파라포름알데히드로 고정시킨 난소를 자동조직처리기를 이용하여 조직처리를 한 후 파라핀에 포매하여 조직 절편을 만들었다. 각 난소 샘플의 첫번째 조직 절편 및 50번째 조직 절편을 헤마톡실린 & 에오신 (Hematoxylin & Eosin: H&E)으로 염색하여 광학현미경으로 관찰하면서 난포의 수를 계수하였다. 또한, 각 조직을 자일렌 처리하여 탈파라핀화하고 (deparaffinized), 실온에서 저농도에서 고농도의 에탄올과 차례대로 배양하여 재수화 (rehydration)시켰다. 조직 절편들을 토끼 항-네오제닌 항체 (1:100으로 희석, Santa Cruz Biotechnology, USA) 및 마우스 항-p63 항체 (1:100으로 희석, Santa Cruz Biotechnology, USA)로 반응시킨 후, Alexa Fluor 488- 및 Alexa Fluor 594-접합된 2차 항체 (1:200으로 희석, Molecular Probes, USA)를 처리하여 반응시켰으며, 세포의 핵을 확인하기 위해 Hoechst 33342 (Thermo Fisher Scientific, USA)로 실온에서 5분동안 염색하였다. PBS로 세척 후 anti-fade mounting 용액 (VECTASHIELD H-1000, USA)으로 마운팅하여 커버 글라스를 덮고 공초점 현미경으로 면역염색 결과를 확인하였다. 난모세포 (oocytes)의 경우, 4% 파라포름알데히드에 실온에서 10분동안 고정시킨 후, 0.1% Triton-X를 처리한 뒤 PBS로 실온에서 30분간 세척하였다. 토끼 항-네오제닌 항체 (0.1% BSA가 포함된 PBS에서 1:100으로 희석)를 첨가한 후, 4℃에서 밤새 배양하였다. 그런 다음, 2차 항체 (항-토끼 표지된 555)로 실온에서 2시간 동안 배양한 뒤 PBS로 세척하였다. 실온에서 5분간 Hoechst 33342로 핵을 염색하고, PBS로 2회 세척 후, 염색된 난모세포를 디쉬에 옮겨 공초점 현미경으로 면역염색 결과를 확인하였다.
3. 유전자 발현 분석
RGMc-처리된 난소의 유전자 발현을 분석하였다. 구체적으로, 제조사의 프로토콜에 따라 TRIzol을 사용하여 난소로부터 총 RNA 100ng를 분리하고, AccuPower CycleScript RT Premix (Bioneer, Korea)를 사용하여 cDNA로 역전사시킨 뒤, 상기 cDNA를 주형으로 하여 마우스 Neogenin, Oct3/4, Nanog, p63 및 Beta-actin 특이적 프라이머 세트를 사용하여 AccuPower Taq PCR PreMix (Bioneer, Korea)로 PCR을 수행하였다. 정방향 및 역방향 프라이머 10 pmol/μL, 주형 cDNA 200ng을 AccuPower Taq PCR PreMix 튜브에 첨가하고, 증류수를 총 부피 20 μL가 되도록 추가한 뒤, PCR 반응은 95℃에서 1분, 95℃에서 30초 (denaturation), 60℃에서 30초 (annealing) 및 72℃에서 50초 (extention)의 과정을 1회로 총 32사이클 수행하였다. PCR 산물을 2% 아가로즈 젤로 전기영동한 후, WSE-6100 LuminoGraph (ATTO, Japan)를 사용하여 UV를 조사하여 그 결과를 확인하였다.
4. 단백질 발현 분석
웨스턴 블롯을 통해 RGMc-처리된 난소의 단백질 발현을 분석하였다. 구체적으로, 난소 조직 샘플을 PRO-PREP쪠 단백질 추출 용액 (iNtRON Biotechnology, Korea) 내에서 균질화하고, 램리 버퍼 (Laemmli buffer)에 포함된 단백질을 95℃에서 5분간 가열하여 변성시키고, 10% SDS-PAGE로 전기영동한 뒤 0.2 μm 니트로셀룰로오스 막 (Bio-Rad, USA)에 트랜스퍼하였다. 트랜스퍼한 막은 5% BSA를 포함하는 TBST 버퍼로 실온에서 1시간 동안 블로킹한 후, 1% BSA를 포함하는 TBST 버퍼에 희석한 1차 항체인 토끼 항-네오제닌 폴리클로날 (1:2000으로 희석, Novus, USA), 토끼 항-Oct3/4 (1:2000으로 희석, Santa Cruz Biotechnology, USA), 마우스 항-Nanog (1:2000으로 희석, Santa Cruz Biotechnology, USA), 마우스 항-p63 (1:2000으로 희석, Santa Cruz Biotechnology, USA) 및 마우스 항-Beta-actin (1:2000으로 희석, Invitrogen, USA)과 함께 4℃에서 밤새 배양하였다. TBST 버퍼로 세척 후, 상기 막을 홀스래디쉬 퍼옥시다아제-접합된 항-마우스 및 항-토끼 IgG 2차 항체 (Bio-Rad)로 반응시켰다. 단백질 밴드는 Clarity쪠 Western ECL Substrate (Bio-Rad) 및 WSE-6100 LuminoGraph를 사용하여 시각화하였다.
5. NGS 분석
대조군 및 실험군 난소의 전체 전사체 (whole transcriptomes)를 NGS (Next Generation Sequencing)를 통해 분석하였다. 구체적으로, 제조사의 프로토콜에 따라 TRIzol을 사용하여 난소로부터 총 RNA를 분리하고, 정제된 mRNA를 NGS에 사용하였다. MiSeq sequencer (Illumina, USA)를 사용하여 상기 mRNA에 대하여 시퀀싱을 수행하고, REVIGO 프로그램 및 Gene Ontology를 이용하여 NGS 데이터를 분석하였다. 다음으로, 그룹 당 4마리의 마우스 (Mus musculus) 샘플을 사용하여 차별 발현 유전자 (Differentially expressed gene: DEG) 및 농축 분석 (enrichment analyses)을 수행하였다. Raw 시퀀싱 데이터를 맵핑하고, HISAT2 (ver. 2.1.0), Bowtie2 (ver. 2.3.4.1) 및 StringTie (ver. 1.3.4d)를 사용하여 전사체 어셈블리 (assembly)를 수행하였다. 정렬된 리드 (read) 카운트를 TMM (Trimmed Mean of M-values) 방법으로 정규화시키고, 절대적으로 4배 이상의 발현 변화를 나타낸 유전자를 추출하여 Euclidean 및 Ward 알고리즘을 통하여 병합 군집 (agglomerative clustering) 분석을 수행하였다. 유전자 농축 분석에는 20,196개의 참조 유전자를 포함하는 데이터베이스를 사용하였다. Cytoscape (ver. 3.7.2)의 ClueGO (ver. 2.5.5) 모듈을 이용하여 RGMc 처리된 난소에서 발현 수준이 상향/하향 조절된 각 유전자의 경로 (pathway)를 분석하였다. 통계적 유의성은 본페로니 (Bonferroni) step-down 교정을 사용한 two-sided hypergeometric test를 수행하여 결정하였다. 발현 수준이 상향/하향 조절된 각각의 유전자 클러스터에 대해 농축 백분율이 60%를 초과하는 GO term들이 선택되었다. 카파 점수 (kappa score)에 근거하여 term들 간의 관계를 확인하였다.
6. RT-qPCR
대조군 및 RGMc-처리된 난소에서 얻은 NGS 데이터를 검증하기 위해 RT-qPCR을 수행하였다. KEGG 경로를 바탕으로, 상향조절 (Ptgs1, Edn2 및 Hpgds) 및 하향조절된 (Tbxa2r, Oxtr 및 Adra1d) 유전자들을 표적으로 하는 프라이머를 선택하였다 (하기 표 1).
유전자 프라이머 서열 (5'-3')
Neogenin Neogenin 정방향 GTATGTCGCCTCGCTACCTG
역방향 GCCACAGAGAAGTCATCGGA
Oct3/4 Octamer-binding transcription factor 4 정방향 CACGAGTGGAAAGCAACTCA
역방향 AGATGGTGGTCTGGCTGAAC
Nanog Nanog 정방향 CACCCACCCATGCTAGTCTT
역방향 ACCCTCAAACTCCTGGTCCT
p63 p63 정방향 GTATCGGACAGCGCAAAGAACG
역방향 CTGGTAGGTACAGCAGCTCATC
Ptgs1 Prostaglandin-endoperoxide synthase 1 정방향 CCTCGACAACTACCAGTGTG
역방향 CACAAATTCCCAGAGCCAGT
Edn2 Endothelin 2 정방향 GACCTCCTCCGAAAGCTGAG
역방향 CCGTTTCCTCCTGTCTCCAC
Hpgds Hematopoietic Prostaglandin D Synthase 정방향 GGACACGCTGGATGACTTCA
역방향 TCCCAGTAGAAGTCTGCCCA
Oxtr Oxytocin Receptor 정방향 GTTCTCAACCATCCTCGGCA
역방향 CTAACCAGCCCAAGGACAGG
Tbxa2r Thromboxane receptor 정방향 TCGGGCTCATATTCGCACTC
역방향 AACCATCATCTCCACCTCGC
Andra1d Adrenergic
receptor, alpha 1d		 정방향 TCTTCGTCCTGTGCTGGTTC
역방향 AGATGAGCGGGTTCACACAG
Beta-actin Beta-Actin 정방향 CATTGCTGACAGGATGCAGAAGG
역방향 TGCTGGAAGGTGGACAGTGAGG
제조사의 프로토콜에 따라 TRIzol을 사용하여 난소로부터 총 RNA 100ng를 분리하고, AccuPower CycleScript RT Premix (Bioneer, Korea)를 사용하여 cDNA로 역전사시킨 뒤, 상기 cDNA를 주형으로 SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, USA)를 사용하여 qPCR을 수행하였다. 구체적으로, 정방향 및 역방향 프라이머 10 pmol/μL, 주형 cDNA 200ng 및 2x SsoAdvanced Universal SYBR Green Supermix를 튜브에 첨가하고, 증류수를 총 부피 20 μL가 되도록 추가한 뒤, PCR 반응은 95℃에서 3분, 95℃에서 10초 (denaturation), 60℃에서 30초 (annealing) 및 72℃에서 20초 (extention)의 과정을 1회로 총 40사이클 수행하였다. 각 유전자의 발현은 Beta-actin으로 정규화되었다. 모든 실험은 3회의 중복 실험 (triplicate)으로 수행하였다.
7. 통계적 분석
모든 실험에서 데이터는 3회 중복 실험의 평균 ± 표준오차(SEM) 값으로 나타내었고, 통계적인 비교는 본페로니 검정이 결합된 one-way ANOVA로 분석하였다. p value <0.05 (*), <0.01 (**) 및 <0.001 (***)의 값을 통계적으로 유의한 것으로 판단하였다.
실험 결과
실시예 1. 네오제닌의 발현 분석
마우스 난소 및 난모세포에서 네오제닌의 발현을 분석하고 그 결과를 도 1에 나타내었다. 도 1에 나타낸 바와 같이, 네오제닌은 난포 발달의 모든 단계에서 발현됨을 확인하였다. 구체적으로, 네오제닌은 원시 난포 (primordial follicle), 일차 난포 (primary follicle), 이차 난포 (secondary follicle) 및 성숙 난포 (graafian follicle) 모두에서 발현되었고 (도 1의 (a)), 배 소포 (Germinal Vesicle: GV)에서의 미성숙 난모세포와 유사분열 중기 Ⅱ기 (Metaphase Ⅱ: MⅡ)에서 항-네오제닌 항체 (빨간색)로 염색된 네오제닌을 확인하였다 (도 1의 (b)). 또한, 상기 결과는 마우스 난소의 mRNA 및 단백질 발현 분석에서도 동일하게 나타남을 확인하였다 (도 1의 (c), 도 1의 (d)).
상기 결과를 통해, 네오제닌이 난포 발달의 모든 단계에서 발현되어, 네오제닌 리간드의 처리는 생식선자극호르몬-비의존적 및 -의존적 과정 모두에 관여할 수 있음을 알 수 있었다.
실시예 2. RGMc 처리에 따른 난포 발달 분석
In vivo 호르몬 자극을 위해 마우스에 PMSG를 주입하고, RGMc 처리가 난소에 미치는 영향을 조직학적 분석을 통해 확인하였다. 도 2에 나타낸 바와 같이, H&E 염색 결과 전동난포 (preantral follicles) 및 동난포 (antral follicles)를 포함하는 총 난포 수가 대조군에 비해 현저히 증가하였고 (도 2의 (b)), 그 중에서도 동난포 수는 대조군에 비해 2.5배 증가하였고 (도 2의 (c)), 대조군 난소에 비하여 RGMc 처리한 난소에서 난모세포가 2배 가량 더 수집되었음을 확인하였다 (도 2의 (d)).
상기 결과를 통해, 네오제닌 리간드인 RGMc의 처리가 생식선자극호르몬-비의존적 및 -의존적 과정 모두를 통해 난소의 난포 발달을 촉진시킬 수 있음을 확인하였다.
실시예 3. 난포 발달 관련 유전자 및 단백질의 발현 변화 분석
원시 난포 인자인 Oct3/4, Nanog, p63 및 Neogenin에 대하여, RT-PCR을 통해 mRNA 발현 양상을 분석하였다. 도 3에 나타낸 바와 같이, Oct3/4, Nanog, p63 및 Neogenin의 mRNA 발현 수준이 대조군에 비해 RGMc 처리군에서 현저히 증가함을 확인하였다 (도 3의 (a)). 특히, Oct3/4, Nanog 및 p63의 mRNA 발현 수준은 대조군에 비해 2배 가량 증가하였다 (도 3의 (b)). 또한, 유전자 발현 분석 결과와 동일하게 단백질 발현 분석에서도 Oct3/4, Nanog, p63 및 Neogenin의 단백질 발현 수준이 대조군에 비해 RGMc 처리군에서 현저히 증가함을 확인하였다 (도 3의 (c)).
상기 결과를 통해, RGMc의 처리가 원시 난포의 활성을 증가시킴을 확인하였다. 또한, Oct3/4, Nanog 및 p63이 기질세포 (stromal cells)의 증식 및 과립막 세포 (granulosa cells)의 전동난포로의 분화를 조절한다는 점에서, RGMc의 처리는 Oct3/4, Nanog의 발현 수준을 상향 조절하여 COS를 촉진할 수 있고, 이를 통해 난소에서 원시 난포의 생존을 향상시킬 수 있음을 알 수 있었다. 또한, p63은 감수분열의 조절 인자이며 원시 난포의 세포주기 조절에 중요한 역할을 수행하므로, RGMc 처리가 난소에서 난포 발달을 촉진시킬 수 있음을 알 수 있었다.
실시예 4. 전체 전사체 및 유전자 농축 분석
대조군 및 실험군 난소의 전체 전사체 (whole transcriptomes)를 NGS (Next Generation Sequencing)를 통해 분석한 결과를 도 4 및 5에 나타내었다. 도 4에 나타낸 바와 같이, 275개 유전자들이 RGMc 처리한 난소 및 대조군에서 4배 이상의 mRNA 발현 수준 차이를 나타내었다. 상기 DEG들 중, 난소 및 대조군 난소에서 각각 197개, 78개 DEG의 발현이 증가하였다 (도 4의 (a), 도 4의 (b)).
또한, 도 5a 내지 도 5c에 나타낸 바와 같이, RGMc 처리한 난소의 과배란 (hyperovulation) 메커니즘을 보다 명확히 밝히기 위하여 상기 197개, 78개 DEG에 대하여 ClueGO를 사용하여 유전자 농축 분석을 수행한 결과, 총 275개 DEG 중, 35개의 상향발현된 DGE 및 19개의 하향발현된 DEG를 포함하는 54개 DEG가 23개 term에 해당되었다 (도 5a). Gene Ontology를 사용하여 이들 term 사이의 단백질-단백질 상호작용을 분석하였다. 핵심 유전자를 결정하기 위해, ClueGO 및 CluePedia를 이용하여 이들 term과 연관된 상향/하향 발현된 DEG들을 함께 플롯팅하였다 (도 5b, 도 5c). 두꺼운 실선은 실험적 증거에 기반한 연관성을, 얇은 실선은 그 외 증거에 기반한 연관성을 의미하며, 원의 크기 및 색깔은 각각 상향/하향 발현된 유전자들의 농축 유의도 및 백분율을 의미한다. 35개의 상향 발현된 DEG들 중, 23개는 섬모 (cilium) 및 미세소관 (microtubule)과 연관된 8개의 term (섬모 조직화 (organization), 섬모 어셈블리 (assembly), 미세소관에 의한 이동 (microtubule-based movement), 미세소관 번들 (bundle) 형성, 축사 (axoneme) 어셈블리, 축사-다이네인 (dynein) 복합체 어셈블리 및 내부 (inner) 다이네인 어셈블리)에 해당되고, 서로 밀접하게 상호연관되어 있음을 확인하였다 (도 5b). 상향 발현된 나머지 12개 DEG들 및 하향 발현된 총 19개 DEG들은 7개의 하향 발현, 7개의 상향 발현, 2개의 non-satisfied term에 해당되었다 (도 5c).
실시예 5. RGMc 처리에 따른 프로스타글란딘 및 근육 수축-관련 유전자들의 발현 변화 분석
상기 실시예 4에서 분석한 NGS 데이터를 실험적으로 검증하기 위해 RT-qPCR을 수행하였다. 도 5a 내지 5c에 나타낸 바와 같이, 발현 수준이 상향 조절된 3개 유전자 (도 5c, 하얀색 화살표)와 하향 조절된 3개 유전자 (도 5c, 빗금 화살표)에 대하여 real-time qPCR을 수행한 결과 Hpgds와 Edn2의 mRNA 발현 수준이 대조군에 비해 RGMc 처리된 난소에서 13배로 현저히 증가한 반면, Tbxa2r과 같은 하향 조절된 유전자의 경우 대조군에 비해 RGMc 처리된 난소에서 mRNA 발현 수준이 현저히 감소하였음을 확인하였다 (p < 0.05) (도 6a, 도 6b).
Edn2는 생식 주기 동안 난포 파열 (follicle rupture) 및 난소에서 황체 (corpus luteum) 형성에 관여하는 것으로 알려져 있다. 또한, Hpgds는 PGD1 및 PGD2를 생산하여 과립막 세포에서 FSH 활성을 방해하며, 상기 PGD2는 FSH 및 LH 수용체의 발현을 조절하고, 난포 발달의 생식선자극호르몬-비의존적 및 -의존적 과정 모두에서 과립막 세포의 증식, 분화 및 스테로이드 생성 (steroidogenic) 활성 간의 균형을 조절하여, 난모세포 성숙, 재개하 분산 (cumulus expansion) 및 난포 성숙을 포함하는 연속적인 배란 과정 (ovulatory cascade)에 중요하게 작용한다. 한편, 옥시토신 (Oxytocin) 및 옥시토신 수용체 (Oxtr)는 POR과 연관되며, 이들의 발현 수준은 다낭성 난소 증후군 (Polycystic Ovarian Syndrome: PCOS)을 가진 환자의 난포액에서 증가되어 있는 것으로 알려져 있다. 그러나, 난포 발달과의 관계에서 옥시토신 수용체의 역할은 아직 명확히 밝혀진 바가 없고, 내인성 옥시토신은 여성의 LH 조절에 관여할 것으로 보고된 바 있다.
따라서, 상기 결과를 통해 RGMc는 Edn2 및 Hpgds 발현 수준의 상향 조절을 통해 난포 발달을 촉진함을 확인함과 동시에, Tbxa2r과 같은 유전자의 발현 수준은 하향 조절함으로써 조기 배란을 억제하여 정상적인 난포 발달을 촉진할 것으로 예상하였다.
실시예 6. 난포액 및 난구세포에서의 PGD2 발현 수준 분석
상기 NGS 데이터를 통해 프로스타글란딘이 난포 발달 (follicular development)에서 핵심 인자로 작용함을 확인하였다. 이에, 인간 난포액 및 난구세포 (cumulus cells: CC)를 사용하여 프로스타글란딘과 난소 저자극 증후군 (POR)의 관계를 분석하였다. 차의과학대학교 연구윤리심의위원회의 승인을 받아 난자를 채취하는 동안 난포액을 수집하고 난모세포를 제거한 후 난구세포를 수집하였다. 난소 반응이 정상인 환자와 난모세포가 4개 미만이고 AMH 수준이 1ng/mL 이하인 POR 환자로부터 수집한 난포액을 사용하여 ELISA를 수행하였다. 반응 신호는 마이크로플레이트 리더 (BioTek Instruments, USA)로 측정하였고, 난구세포의 유전자 발현은 real-time PCR로 분석하였다. 각 샘플 mRNA는 난소 반응이 정상인 환자와 POR 환자의 난구세포에서 DynaBeads mRNA DIRECT Kit (Life Technologies, Norway)를 사용하여 분리하였다. mRNA는 NanoDrop ND-1000 분광 광도계 (Nyxor Biotech, France)를 사용하여 정량화하였다. 총 RNA는 poly-dT와 함께 AccuPower CycleScript RT PreMix (Bioneer)를 사용하여 cDNA로 역전사시킨 뒤, 상기 cDNA를 주형으로 PCR을 수행하였다. 구체적으로, 정방향 및 역방향 프라이머 10 pmol/μL, 주형 cDNA 200ng 및 2x SsoAdvanced Universal SYBR Green Supermix를 튜브에 첨가하고, 증류수를 총 부피 20 μL가 되도록 추가한 뒤, PCR 반응은 95℃에서 1분, 95℃에서 30초 동안 denaturation, 58℃에서 30초 동안 annealing 및 72℃에서 50초 동안 extention의 과정을 1회로 총 32사이클 수행하였다. PCR 산물을 2% 아가로즈 젤로 전기영동한 후, WSE-6100 LuminoGraph (ATTO, Japan)를 사용하여 UV를 조사하여 그 결과를 확인하였다. 사용한 프라이머 서열을 하기 표 2에 나타내었다.
유전자 프라이머 서열 (5'-3')
Neogenin 정방향 ATTTCCACTCCAGCAGCCTC
역방향 GTGGAATTGGCCCTGTCTGA
Beta-actin 정방향 ACAATGTGGCCGAGGACTTT
역방향 TGTGTGGACTTGGGAGAGGA
도 7에 나타낸 바와 같이, 난소 반응이 정상인 환자와 POR 환자의 난구세포에서 수집한 난포액의 PGD2 발현 수준을 분석하였다. 분석 대상은 각 군별로 15 개체를 대상으로 분석하였다. 그 결과, 난소 반응이 정상인 노령의 환자에 비해, POR 환자의 난포액에서 PGD2 농도가 현저히 감소되어 있음을 확인하였다. 또한, POR 그룹의 PGD2 농도의 중간값은 젊은 그룹의 중간값에 비해 적어도 70% 이하로 감소된 것을 확인하였다.
상기 결과를 통해, POR은 프로스타글란딘의 대사 결함과 연관이 있으며, 난소 반응이 정상인 환자 및 POR 환자의 난포액에서의 PGD2 발현 수준의 현저한 차이를 통해 PGD2를 POR을 진단할 수 있는 바이오마커로 사용할 수 있음을 확인하였다.
실시예 7. 난구세포에 대한 RGMc 처리의 효과
상기 실시예 6에서 확인한 POR 진단 물질로서의 PGD2 발현 수준이 난포 발달을 촉진하는 물질인 RGMc 처리에 따라 실제로 변화하는지 여부를 실험적으로 확인하였다. 구체적으로, 난구세포에 RGMc를 처리함에 따른 PGD2 수준의 변화를 확인하기 위하여, 8명의 대조군 환자 (난소 반응 및 기능이 정상) 및 8명의 POR 환자 (볼로냐 기준에 따른)에서 난구세포를 수집하였다. 모든 환자는 체외수정 (in vitro fertilization: IVF) 동안 생식샘자극호르몬분비호르몬 길항제 (gonadotropin-releasing hormone antagonist)를 투여하면서 전형적인 과배란 유도 (COS) 과정을 거쳤다. 수집한 난구세포들을 QCL 배지에서 104 cells/well로 하여 96-웰 플레이트에 시딩하였다. 다음 날, 배양 배지를 RGMc 50 ng/mL을 포함하는 배지로 바꾸어 준 뒤, 하루가 지난 후 배양 배지를 수집하여 ELISA 키트를 이용하여 배지 내의 PGD2 농도를 측정하였다. 그 결과를 도 8에 나타내었다.
도 8에 나타낸 바와 같이, 상기 POR 환자들로부터 수집한 난구세포에 RGMc 처리 시 난구세포 배양 배지의 PGD2 발현 수준이 4배로 현저히 증가하고 (도 8으ㅢ (a)), 난소 반응이 정상인 환자의 경우에도 RGMc 처리에 따라 난구세포 배양 배지의 PGD2 발현 수준이 현저히 증가함을 확인하였다 (도 8의 (b)).
상기 결과를 통해, 체외수정 시술에서의 호르몬 자극에 따른 정상적인 난포 발달에 있어서 PGD2 신호전달 경로가 핵심적인 역할을 수행하며, 상기 PGD2 발현 수준이 난소 저자극 증후군 진단에 적용될 수 있음을 다시 한 번 확인하였다.
전술한 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.

Claims (9)

  1. PGD2 의 발현 수준을 측정하는 제제를 포함하는 난소 저자극 증후군 조기 진단용 조성물.
  2. 청구항 1에 있어서,
    상기 PGD2의 발현 수준을 측정하는 제제는 상기 PGD2에 특이적으로 결합하는 항체를 포함하는 것인, 조성물.
  3. 청구항 1의 조성물을 포함하는 난소 저자극 증후군 조기 진단용 키트.
  4. 청구항 3에 있어서,
    상기 키트는 ELISA (Enzyme-linked immunosorbent assay) 키트, 단백질 칩 키트 또는 래피드 (rapid) 키트인 것인, 키트.
  5. (a) 분리된 생물학적 시료로부터 PGD2의 발현 수준을 측정하는 단계;
    (b) 상기 (a) 단계에서 측정된 PGD2의 발현 수준을 정상 대조군 시료의 PGD2 발현 수준과 비교하는 단계; 및
    (c) 상기 생물학적 시료의 PGD2의 발현 수준이 정상 대조군 시료의 PGD2의 발현 수준보다 낮을 경우 난소 저자극 증후군으로 진단하는 단계를 포함하는 난소 저자극 증후군 조기 진단에 필요한 정보를 제공하는 방법.
  6. 청구항 5에 있어서,
    상기 생물학적 시료는 난모세포 (Oocytes), 난구세포 (Cummulus cells)또는 난포액 (Follucular fluid)인 것인, 방법.
  7. 청구항 5에 있어서,
    상기 PGD2의 발현 수준 측정은 상기 PGD2에 특이적으로 결합하는 항체를 이용하는 것인, 방법.
  8. 청구항 5에 있어서,
    상기 PGD2의 발현 수준 측정은 ELISA (Enzyme-linked immunosorbent assay)를 이용하는 것인, 방법.
  9. (a) 분리된 생물학적 시료 또는 인간을 제외한 동물에 난소 저자극 증후군 치료제 후보물질을 처리하는 단계;
    (b) 상기 후보물질 처리군에서 PGD2의 발현 수준을 측정하는 단계; 및
    (c) 상기 (b) 단계에서 측정된 PGD2의 발현 수준이 후보물질을 처리하지 않은 대조군의 PGD2 발현 수준에 비해 증가한 경우, 상기 후보물질을 난소 저자극 증후군 치료제로 선택하는 단계;를 포함하는 난소 저자극 증후군 치료제의 스크리닝 방법.
PCT/KR2022/003370 2021-08-26 2022-03-10 Pgd2를 포함하는 난소 저자극 증후군 조기 진단용 바이오마커 및 이의 용도 WO2023027275A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0113411 2021-08-26
KR1020210113411A KR102531728B1 (ko) 2021-08-26 2021-08-26 Pgd2를 포함하는 난소 저자극 증후군 조기 진단용 바이오마커 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2023027275A1 true WO2023027275A1 (ko) 2023-03-02

Family

ID=85323233

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/003370 WO2023027275A1 (ko) 2021-08-26 2022-03-10 Pgd2를 포함하는 난소 저자극 증후군 조기 진단용 바이오마커 및 이의 용도

Country Status (2)

Country Link
KR (1) KR102531728B1 (ko)
WO (1) WO2023027275A1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140206572A1 (en) * 2011-07-28 2014-07-24 Universite Laval Ovarian markers of follicular maturity and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140206572A1 (en) * 2011-07-28 2014-07-24 Universite Laval Ovarian markers of follicular maturity and uses thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ALVES MARIANA, DO AMARAL NAYRA, MARCHI FABIO, SILVA FELIPE, DA COSTA ALEXANDRE, CARVALHO KATIA, BAIOCCHI GLAUCO, SOARES FERNANDO, : "Prostaglandin D2 expression is prognostic in high‑grade serous ovarian cancer", ONCOLOGY REPORTS, SPANDIDOS PUBL., 1 January 2019 (2019-01-01), XP093039571, ISSN: 1021-335X, DOI: 10.3892/or.2019.6984 *
CHOI K H, KIM Y J, KANG K Y, PARK E A, KIM M J, KIM H O, KOONG M K, YOON T K, KO J J, LEE J H: "Abstracts of the 37th Annual Meeting of the ESHRE, 26 June to 1 July 2021 i435 P-657Prostaglandin D2 is correlated with follicles development and a reliable marker of ovarian reserve of poor ovarian responder patients", 1 July 2021 (2021-07-01), pages i435, XP093039569, Retrieved from the Internet <URL:https://watermark.silverchair.com/deab130.656.pdf?token=AQECAHi208BE49Ooan9kkhW_Ercy7Dm3ZL_9Cf3qfKAc485ysgAAAwMwggL_BgkqhkiG9w0BBwagggLwMIIC7AIBADCCAuUGCSqGSIb3DQEHATAeBglghkgBZQMEAS4wEQQMJTFn64PtyksN6SFkAgEQgIICtqEIPINk79zOkrl2ZnUlSlfSiFnb3s-PxbgTscx0eEQ9kmTSeKuboAC3CeYKOtSKci2rqf30dLlSZKOPjN_d5GPvqG_iFRjfsy_xWtk0_kYtSe469zniYaWYRi3KH-BfL_Y0ps6V68U89WFk-eBtbq_9U7OjVXVsbMhv3OsTIb9GSKRVT9Q7y_f0ITVifbjHmIJuUnW7ndFpD7mgxACz_YpDorpUZNTAKkP2OX9VMawj05SUl5_Cj2_Far9DSjgW4iazIXYg6rI6YgofELT2mQrdcsRML6WOraaGPcHRjdti6gKE0J8ASLObqEl8UzMsXXUZhnQJplFJSWhiqbKrwLGFZnLlG19_-YOkGKJMnnLj6boVSAYBpmc6c_d5VJ9iZgn- *
KIM YU JIN, PARK YOUNGJOON, PARK YEO REUM, KIM YOUNG SANG, LEE HYE RAN, LEE SANG JIN, KIM MYUNG JOO, KWACK KYUBUM, KO JUNG JAE, LE: "Role of RGMc as a Neogenin Ligand in Follicular Development in the Ovary", BIOMEDICINES, vol. 9, no. 3, pages 280, XP093038945, DOI: 10.3390/biomedicines9030280 *
KIM YU JIN; KANG KI YE; CHOI KYOUNG HEE; PARK EUN A.; KIM YOUNG-SANG; KIM MYUNG JOO; HUR YUN JUNG; KIM HYEOK; KIM YOU SHIN; KO JUN: "PROSTAGLANDIN D2 ASSOCIATION WITH POOR OVARIAN RESPONDER IN FEMALE INFERTILITY", FERTILITY AND STERILITY, ELSEVIER, AMSTERDAM, NL, vol. 116, no. 3, 1 September 2021 (2021-09-01), NL , XP086781944, ISSN: 0015-0282, DOI: 10.1016/j.fertnstert.2021.07.999 *

Also Published As

Publication number Publication date
KR20230031042A (ko) 2023-03-07
KR102531728B1 (ko) 2023-05-11

Similar Documents

Publication Publication Date Title
US20120283125A1 (en) Ovarian Markers of Oocyte Competency and Uses Thereof
EP2064343A1 (en) Mammalian oocyte development competency granulosa markers and uses thereof
WO2018097646A1 (ko) 질환의 진단용 조성물
EP2956552B1 (en) Marker genes for oocyte competence
WO2021210905A1 (ko) 암의 예후 예측용 조성물
WO2021182838A1 (ko) 약제 내성 진단용 조성물 및 이를 이용한 진단 키트
WO2021201526A1 (ko) 면역항암요법에 대한 바이오마커 및 이의 용도
WO2023027275A1 (ko) Pgd2를 포함하는 난소 저자극 증후군 조기 진단용 바이오마커 및 이의 용도
WO2011081421A2 (en) Complement c9 as markers for the diagnosis of cancer
WO2020166992A1 (ko) 암의 진단용 조성물
WO2022215991A1 (ko) 암 예후 예측용 바이오마커
JP2002325600A (ja) 子宮内膜症のインビトロ診断法
WO2021025412A1 (ko) 보체 성분 c8 감마를 이용한 알츠하이머병의 진단방법
CN111518890B (zh) Galnt2作为子宫内膜增生或子宫内膜癌诊治标志物的应用
WO2016209013A1 (ko) 비만 진단용 마커 tm4sf19 및 이를 이용한 방법
WO2012060636A2 (ko) 위암 진단 방법
WO2024054087A1 (ko) 고령 여성의 난임 진단을 위한 바이오마커 및 이의 용도
CN106834496B (zh) Pnliprp3基因及其表达产物在舌鳞癌诊治中的应用
WO2022231386A1 (ko) 위암의 예후 예측 방법
WO2020138561A1 (ko) 뇌수막염 진단을 위한 정보제공방법
CN106893778B (zh) 一种诊治舌鳞癌的分子标志物
WO2022050763A1 (ko) 원발성 안구내 림프종의 진단을 위한 바이오마커 및 이의 용도
WO2024228553A1 (ko) 갑상선암의 진단을 위한 신규한 바이오 마커
WO2023158207A1 (ko) 심방세동 진단을 위한 엑소좀 내 긴 비암호화 rna 바이오마커 및 이의 용도
WO2024117714A1 (ko) 근감소증 진단용 바이오마커 및 이를 이용한 근감소증 진단방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22861491

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22861491

Country of ref document: EP

Kind code of ref document: A1