WO2022270978A1 - 지방분해효소 억제제를 포함하는 rna 바이러스 감염증 예방 또는 치료용 약제학적 조성물 - Google Patents

지방분해효소 억제제를 포함하는 rna 바이러스 감염증 예방 또는 치료용 약제학적 조성물 Download PDF

Info

Publication number
WO2022270978A1
WO2022270978A1 PCT/KR2022/009041 KR2022009041W WO2022270978A1 WO 2022270978 A1 WO2022270978 A1 WO 2022270978A1 KR 2022009041 W KR2022009041 W KR 2022009041W WO 2022270978 A1 WO2022270978 A1 WO 2022270978A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
dabpu
cells
sars
infection
Prior art date
Application number
PCT/KR2022/009041
Other languages
English (en)
French (fr)
Inventor
조경오
전태일
이선우
백영빈
권형준
최흥식
박상익
샤리프무하마드
임정아
Original Assignee
전남대학교 산학협력단
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220077063A external-priority patent/KR20230001534A/ko
Application filed by 전남대학교 산학협력단, 한국생명공학연구원 filed Critical 전남대학교 산학협력단
Priority to EP22828825.4A priority Critical patent/EP4360629A1/en
Publication of WO2022270978A1 publication Critical patent/WO2022270978A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/17—Amides, e.g. hydroxamic acids having the group >N—C(O)—N< or >N—C(S)—N<, e.g. urea, thiourea, carmustine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/402—1-aryl substituted, e.g. piretanide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4245—Oxadiazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention was made by the task identification number 1711128903 and detailed task number 2020R1A2B5B03002517 under the support of the Ministry of Science and ICT. ", The name of the research project is "Identification of correlation between host nuclear receptor and metabolism induced by RNA virus infection of livestock", lead institution is Chonnam National University, research period is 2021.03.01 ⁇ 2022.02.28.
  • the present invention was made by the task identification number 1711170603 and detailed task number KGM5242221 under the support of the Ministry of Science and ICT, and the research management institution of the above task is the Korea Research Institute of Bioscience and Biotechnology, the research project name is "Korea Research Institute of Bioscience and Biotechnology Research Operation Fund Support ( Major project costs)", research project name "Development and commercialization of high value-added functional biomaterials", supervising institution Korea Research Institute of Bioscience and Biotechnology, research period 2022.01.01 ⁇ 2022.12.31.
  • the present invention relates to a pharmaceutical composition for preventing or treating RNA virus infection comprising a lipolytic enzyme inhibitor, and more particularly, to a pharmaceutical composition for RNA virus infection comprising a derivative of an adipose triglyceride lipase (ATGL) inhibitor. It relates to a pharmaceutical composition for prevention or treatment.
  • a pharmaceutical composition for preventing or treating RNA virus infection comprising a lipolytic enzyme inhibitor
  • a pharmaceutical composition for RNA virus infection comprising a derivative of an adipose triglyceride lipase (ATGL) inhibitor. It relates to a pharmaceutical composition for prevention or treatment.
  • ATGL adipose triglyceride lipase
  • RNA viruses cause a variety of diseases in humans and animals.
  • severe acute respiratory syndrome coronavirus (SARS-CoV) type 1 and type 2 SARS-CoV-1, SARS-CoV-2
  • MERS coronavirus Middle East respiratory syndrome coronavirus
  • influenza virus Zika virus
  • dengue fever virus are all RNA viruses.
  • RNA polymerase used to amplify RNA virus genes does not have a proof reading function, so the mutation rate of RNA virus genes is very high compared to DNA viruses. As a result, mutations occur in viral proteins, resulting in the emergence of resistant viruses to therapeutic agents targeting them.
  • H3N2 influenza viruses show resistance to adamantane derivatives, a blocker of matrix-2 (M2) protein, a membrane ion channel protein of influenza virus, and the virus neuraminid Resistance to oseltamivir, an enzyme blocker, is also increasing.
  • M2 matrix-2
  • RNA viruses that mutate easily, and thus various genotypes or subtypes exist.
  • the alpha variant SARS-CoV-2 Alpha variant
  • the beta variant SARS-CoV-2 Beta variant
  • the delta variant SARS-CoV-2 variant in India
  • Detal variant SARS-CoV-2 Omicron variant
  • ATGL inhibitors 3-(4′-(dimethylamino)-(1,1′-biphenyl)-3-yl)-1,1-dimethylurea is CAY10499 (Cayman Chemicals; CAS Number : 359714-55-9), it shows superior antiviral efficacy in vitro and in vivo, especially its derivative 3-(4'-dimethylamino)-(1,1'-biphenyl)-3- It was confirmed that il) -1,1-diethylurea [DABPU-DE] exerted a more excellent broad-spectrum antiviral effect.
  • an object of the present invention is to provide a pharmaceutical composition for preventing or treating an RNA virus infection comprising a lipolytic enzyme inhibitor.
  • Another object of the present invention is to provide an antiviral composition comprising a lipolytic enzyme inhibitor.
  • Another object of the present invention relates to the prevention or treatment of RNA viral infection and antiviral use of a lipolytic enzyme inhibitor.
  • the present invention relates to a pharmaceutical composition for preventing or treating an RNA virus infection containing a lipolytic enzyme inhibitor, and the composition according to the present invention exhibits a preventive or therapeutic effect against an RNA virus infection.
  • RNA viruses 3-(4'-(dimethylamino)-, an inhibitor of adipose triglyceride lipase (ATGL) among lipolytic enzymes, (1,1'-biphenyl)-3-yl)-1,1-dimethylurea (Atglistatin [DABPU-DM]) is adipose triglyceride lipase (ATGL), hormone-sensitive lipolytic enzyme Compared to CAY10499 (Cayman Chemicals; CAS Number: 359714-55-9), which non-selectively inhibits (hormone-sensitive lipase; HSL) and monoacylglycerol lipase (MGL), in vitro and shows excellent broad-spectrum antiviral efficacy in vivo, especially its derivative 3-(4'-dimethylamino)-(1,1'-biphenyl)-3-yl)-1,1-dieth
  • RNA virus has an outer membrane, whether the gene is positive-sense, negative-sense, or double-sense, single-stranded ( It means to inhibit the proliferation of these RNA viruses regardless of whether they are single stranded linear or segmented.
  • One aspect of the present invention is a pharmaceutical composition for preventing or treating an RNA virus infection comprising a lipolytic enzyme inhibitor.
  • the lipolytic enzyme inhibitors are adipose triglyceride lipase (ATGL) inhibitors, hormone-sensitive lipase (HSL) inhibitors, and monoacylglycerol lipase (monoacylglycerol lipase) inhibitors.
  • AGL adipose triglyceride lipase
  • HSL hormone-sensitive lipase
  • MGL monoacylglycerol lipase
  • MGL may be one or more selected from the group consisting of inhibitors.
  • lipid triglyceride lipolytic enzyme in the present specification refers to an enzyme that hydrolyzes triglyceride into free fatty acid and diglyceride as an intracellular lipolytic enzyme.
  • hormone-sensitive lipolytic enzyme in the present specification refers to an intracellular neutral lipolytic enzyme that hydrolyzes diglyceride into free fatty acid and monoglyceride.
  • MDL monoacylglycerol lipase
  • the ATGL inhibitor is 3-(4'-(dimethylamino)-(1,1'-biphenyl)-3-yl)-1,1-dimethylurea (Atglistatin [DABPU-DM]) and its derivatives it could be
  • the derivative of 3-(4′-(dimethylamino)-(1,1′-biphenyl)-3-yl)-1,1-dimethylurea is 3-(4 '-dimethylamino)-(1,1'-biphenyl)-3-yl)-1,1-diethylurea [DABPU-DE], 3-(4'-(dimethylamino)-(1, 1'-biphenyl)-3-yl)-1-ethyl-1-methylurea [DABPU-EM], 3-(4'-dimethylamino)-(1,1'-biphenyl)-3-yl )-1,1-diphenylurea [DABPU-DPh], N-(4'-dimethylamino)-(1,1'-biphenyl)-3-yl)pyrrolidine-1-carboxamide [ DABPU-Pyrrol] and N-(4'-(4'-dimethylamino)-(
  • DABPU-EM 3-(4'-(dimethylamino)-(1,1'-biphenyl)-3-yl)-1-ethyl-1-methylurea [DABPU-EM]
  • DABPU-EM 1-( It refers to a compound in which 4'-dimethylamino)-[1,1'-biphenyl]-3-yl-urea is used as the basic skeleton and the urea side amine group of atglistatin is bonded with ethylmethylamine instead of dimethylamine.
  • 3-(4'-dimethylamino)-(1,1'-biphenyl)-3-yl)-1,1-diphenylurea [DABPU-DPh] in the present specification means 1-(4' -Dimethylamino)-[1,1'-biphenyl]-3-yl-Urea as a basic skeleton and one urea side amine group of atglistatin is bonded with diphenylamine instead of dimethylamine.
  • N-(4'-dimethylamino)-(1,1'-biphenyl)-3-yl)pyrrolidine-1-carboxamide [DABPU-Pyrrol] in the present specification It refers to a compound in which one urea side amine group of atglistatin is bonded with pyrrole instead of dimethylamine with '-dimethylamino)-[1,1'-biphenyl]-3-yl-urea as a basic skeleton.
  • N-(4'-(dimethylamino)-(1,1'-biphenyl)-3-yl)morpholine-4-carboxamide [DABPU-Morph] in the present specification means It refers to a compound in which one urea side amine group of atglistatin is bonded with morpholine instead of dimethylamine with '-dimethylamino)-[1,1'-biphenyl]-3-yl-urea as a basic skeleton.
  • the pharmaceutical composition may additionally contain at least one antiviral agent selected from the group consisting of oseltamivir and remdesivir, but is not limited thereto.
  • the pharmaceutical composition may contain a lipolytic enzyme inhibitor and oseltamivir in a volume ratio of 2:2 to 8:2, preferably a volume ratio of 3:2 to 7:2. It may be included as, for example, it may be included in a volume ratio of 4:2 to 6:2, but is not limited thereto.
  • the pharmaceutical composition may contain a lipolytic enzyme inhibitor and remdesivir in a volume ratio of 8:1 to 20:1, preferably a volume ratio of 10:1 to 18:1 It may be included as, for example, it may be included in a volume ratio of 15: 1 to 16: 1, but is not limited thereto.
  • the RNA virus is SARS Corona Virus type 1 and 2 (SARS-CoV-1, SARS-CoV-2), influenza A virus (IAV), bovine coronavirus BCoV), porcine epidemic diarrhea coronavirus (PEDV), bovine species A rotavirus (RVA), porcine reproductive and respiratory syndrome virus (PRRSV), porcine sapovirus ( Porcine sapovirus (PSaV), norovirus, feline infectious peritonitis virus (FIPV), MERS Corona Virus, Zika virus, dengue fever virus , And it may be at least one selected from the group consisting of A and C hepatitis viruses.
  • SARS Corona Virus type 1 and 2 SARS Corona Virus type 1 and 2
  • influenza A virus IAV
  • bovine coronavirus BCoV bovine coronavirus
  • PEDV bovine species A rotavirus
  • PRRSV porcine reproductive and respiratory syndrome virus
  • porcine sapovirus Porcine sapovirus (PSaV), norovirus
  • coronavirus in this specification is classified into four genera , alpha-, beta-, gamma-, and delta-coronavirus of the Orthocoronavirinae subfamily within the Coronaviridae family.
  • Alpha-coronavirus genus Within the genus, there are porcine epidemic diarrhea coronavirus, feline infectious peritonitis virus, etc., and within the beta-coronavirus genus, bovine coronavirus, SARS coronavirus types 1 and 2 (SARS-CoV-1, SARS-CoV-2) ,
  • SARS-CoV-1, SARS-CoV-2 SARS coronavirus types 1 and 2
  • MERS-CoV within the gamma-coronavirus genus there is chicken infectious bronchitis virus, and within the genus delta-coronavirus there are delta-coronaviruses of humans and pigs.
  • a nanometer-sized spike is embedded in the outer membrane, and bovine coronaviruses within the genus gamma-coronavirus have one more hemagglutinin/esterase protein spike embedded in the outer membrane. sense, single-stranded RNA genome).
  • influenza A virus in the present specification is a virus belonging to the Alphainfluenzavirus genus in the Orthomyxoviridae family and has a size of 80 to 120 nm.
  • the virus has hemagglutinin and neuraminidase spikes arranged toward the outside on the surface of the outer membrane, and contains 8 negative-sense 8 segments of genome within the outer membrane. there is.
  • Influenza A virus infects mammals such as humans, pigs, horses, and dogs, and various birds including chickens.
  • BCoV bovine coronavirus
  • PDV protein epidemic diarrhea virus
  • Rotavirus in the present specification generally means species A rotavirus (RVA).
  • RVA rotavirus
  • Species rotavirus has been reported to occur in other animals besides humans, with H-type infections in pigs, D, F, and G-types in birds, I-types in cats, and J-types in bats.
  • Rotavirus has 11 double-stranded 11 segments of genome within 3 capsid layers with a size of 80 nm. Rotavirus is a major cause of diarrhea in infants and young animals under the age of 5 in humans.
  • PRRSV human reproductive and respiratory syndrome virus
  • PRRSV has envelope protein and glycoprotein 4 spikes embedded in the outer membrane of 50-60 nm in size, and a positive-sense single-stranded gene about 15 kb long inside. stranded, positive-sense, RNA genome).
  • PRRSV causes reproductive disorders such as miscarriage and stillbirth in pregnant pigs and interstitial pneumonia in piglets.
  • sapovirus in the present specification is a virus belonging to the genus Sapovirus in the Caliciviridae family and is a cause of diarrhea in humans, pigs and minks.
  • feline infectious peritonitis virus in this specification is a viral agent that causes vasculitis in cats to cause severe pleural effusion and ascites, or chronic granulomatous nodules in various organs such as the kidneys.
  • caliciviruses as used herein means a caliciviridae family that has a linear positive sense single-stranded RNA genome within a 27-40 nm capsid layer. ) is a virus in There are a total of 11 genera in Calciviridae, such as Norovirus , Sapvorius, Vesivirus, Lagovirus , Nebovirus , Recovirus, Valovirus, Babovirus, Nacovirus, Salovirus, and Minovirus .
  • Another aspect of the present invention is an antiviral composition comprising a lipolytic enzyme inhibitor.
  • the lipolytic enzyme inhibitor may be one or more selected from the group consisting of an ATGL inhibitor, an HSL inhibitor, and an MGL inhibitor.
  • the ATGL inhibitor is 3-(4'-(dimethylamino)-(1,1'-biphenyl)-3-yl)-1,1-dimethylurea (Atglistatin [DABPU-DM]) and its derivatives it could be
  • the derivative of 3-(4′-(dimethylamino)-(1,1′-biphenyl)-3-yl)-1,1-dimethylurea is 3-(4 '-dimethylamino)-(1,1'-biphenyl)-3-yl)-1,1-diethylurea [DABPU-DE], 3-(4'-(dimethylamino)-(1, 1'-biphenyl)-3-yl)-1-ethyl-1-methylurea [DABPU-EM], 3-(4'-dimethylamino)-(1,1'-biphenyl)-3-yl )-1,1-diphenylurea [DABPU-DPh], N-(4'-dimethylamino)-(1,1'-biphenyl)-3-yl)pyrrolidine-1-carboxamide [ DABPU-Pyrrol] and N-(4'-(4'-dimethylamino)-(
  • the pharmaceutical composition may additionally contain at least one antiviral agent selected from the group consisting of oseltamivir and remdesivir, but is not limited thereto.
  • the pharmaceutical composition may contain a lipolytic enzyme inhibitor and oseltamivir in a volume ratio of 2:2 to 8:2, preferably a volume ratio of 3:2 to 7:2. It may be included as, for example, it may be included in a volume ratio of 4:2 to 6:2, but is not limited thereto.
  • the pharmaceutical composition may contain a lipolytic enzyme inhibitor and remdesivir in a volume ratio of 8:1 to 20:1, preferably a volume ratio of 10:1 to 18:1 It may be included as, for example, it may be included in a volume ratio of 15: 1 to 16: 1, but is not limited thereto.
  • the RNA virus is SARS-CoV-1, SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV, PSaV, norovirus, FIPV, MERS coronavirus, Zika virus, dengue fever virus, and A It may be one or more selected from the group consisting of hepatitis C virus and hepatitis C virus.
  • the present invention relates to a lipolytic enzyme inhibitor for the treatment of human and animal broad-spectrum RNA virus infection, and more specifically, a lipolytic enzyme inhibitor is used to treat influenza A virus infection and SARS coronavirus type 2 in humans and animals, and bovine corona in animals. It can be used as a treatment for viral infections, porcine epidemic diarrhea coronavirus infection, bovine rotavirus infection, porcine reproductive and respiratory syndrome virus infection and sapovirus infection, in addition to SARS coronavirus type 1, MERS coronavirus, Zika virus, and dengue fever virus It can be used as a treatment for various RNA virus infections occurring in humans and animals, such as , and hepatitis A and C viruses.
  • Figure 1a is a photograph and a graph showing the number of lipids in the cytoplasm of cultured cells infected with SARS Corona Virus type 2 (SARS-CoV-2) according to an embodiment of the present invention.
  • Figure 1b is a photograph and a graph showing the number of lipids in the cytoplasm of cultured cells infected with influenza A virus (IAV) according to an embodiment of the present invention.
  • IAV influenza A virus
  • 1c is a graph showing the amounts of triacylglyceride (TG) and cholesterol in the cytoplasm of cultured cells infected with SARS-CoV-2 according to an embodiment of the present invention.
  • Figure 1d is a graph showing the amount of neutral fat and cholesterol in the cytoplasm of cultured cells by IAV infection according to an embodiment of the present invention.
  • Figure 2a is a photograph and a graph showing the number of lipids in the cytoplasm of cultured cells caused by bovine coronavirus (BCoV) infection according to an embodiment of the present invention.
  • BCoV bovine coronavirus
  • Figure 2b is a photograph and a graph showing the number of fatty acids in the cytoplasm of cultured cells caused by porcine epidemic diarrhea coronavirus (PEDV) infection according to an embodiment of the present invention.
  • PEDV porcine epidemic diarrhea coronavirus
  • Figure 2c is a photograph and a graph showing the number of lipids in the cytoplasm of cultured cells infected with bovine rotavirus (RVA) according to an embodiment of the present invention.
  • Figure 2d is a photograph and a graph showing the number of lipids in the cytoplasm of cultured cells caused by porcine reproductive and respiratory syndrome virus (PRRSV) infection according to an embodiment of the present invention.
  • PRRSV porcine reproductive and respiratory syndrome virus
  • Figure 2e is a photograph and a graph showing the number of lipids in the cytoplasm of cultured cells by porcine sapovirus (PSaV) infection according to an embodiment of the present invention.
  • Figure 3a is a photograph showing an increase in fat in the cytoplasm of hamster alveolar epithelial cells caused by SARS-CoV-2 infection according to an embodiment of the present invention.
  • Figure 3b is a photograph showing an increase in fat in the cytoplasm of mouse bronchial epithelial cells caused by IAV infection according to an embodiment of the present invention.
  • Figure 3c is a graph showing the amount of triglyceride and cholesterol in the cytoplasm of hamster alveolar epithelial cells infected with SARS-CoV-2 according to an embodiment of the present invention.
  • Figure 3d is a graph showing the amount of triglyceride and cholesterol in the cytoplasm of mouse bronchial epithelial cells by IAV infection according to an embodiment of the present invention.
  • Figure 4a is a photograph and a graph showing the increase and decrease of phosphorylated hormone sensitive lipase (HSL) in the cytoplasm of cultured cells caused by SARS-CoV-2 infection according to an embodiment of the present invention.
  • HSL phosphorylated hormone sensitive lipase
  • Figure 4b is a photograph and a graph showing the increase and decrease of phosphorylated hormone-sensitive lipolytic enzyme in the cytoplasm of cultured cells by IAV infection according to an embodiment of the present invention.
  • 4c is a graph showing the amount of free fatty acid (FFA) and glycerol in the cytoplasm of cultured cells infected with SARS-CoV-2 according to an embodiment of the present invention.
  • FFA free fatty acid
  • Figure 4d is a graph showing the amount of free fatty acid and glycerol in the cytoplasm of cultured cells by IAV infection according to an embodiment of the present invention.
  • 5a is a photograph and a graph showing an increase or decrease in phosphorylated hormone-sensitive lipolytic enzyme in the cytoplasm of cultured cells caused by BCoV infection according to an embodiment of the present invention.
  • Figure 5b is a photograph and a graph showing the increase and decrease of phosphorylated hormone-sensitive lipolytic enzyme in the cytoplasm of cultured cells caused by PEDV infection according to an embodiment of the present invention.
  • Figure 5c is a photograph and a graph showing the increase and decrease of phosphorylated hormone-sensitive lipolytic enzyme in the cytoplasm of cultured cells by RVA infection according to an embodiment of the present invention.
  • Figure 5d is a photograph and a graph showing the increase and decrease of phosphorylated hormone-sensitive lipolytic enzyme in the cytoplasm of cultured cells caused by PRRSV infection according to an embodiment of the present invention.
  • Figure 5e is a photograph and a graph showing the increase and decrease of phosphorylated hormone-sensitive lipolytic enzyme in the cytoplasm of cultured cells by PSaV infection according to an embodiment of the present invention.
  • Figure 6a is a photograph showing the increase and decrease of phosphorylated hormone-sensitive lipolytic enzyme in the cytoplasm of hamster alveolar epithelial cells caused by SARS-CoV-2 infection according to an embodiment of the present invention.
  • Figure 6b is a photograph showing the increase and decrease of phosphorylated hormone-sensitive lipolytic enzyme in the cytoplasm of mouse bronchial epithelial cells by IAV infection according to an embodiment of the present invention.
  • 6c is a photograph and a graph showing an increase or decrease in phosphorylated hormone-sensitive lipolytic enzyme in hamster lung tissues caused by SARS-CoV-2 infection according to an embodiment of the present invention.
  • Figure 6d is a photograph and a graph showing the increase and decrease of phosphorylated hormone-sensitive lipolytic enzyme in mouse lung tissue by IAV infection according to an embodiment of the present invention.
  • Figure 6e is a graph showing the increase and decrease of free fatty acids and glycerol in hamster lung tissues caused by SARS-CoV-2 infection according to an embodiment of the present invention.
  • Figure 6f is a graph showing the increase and decrease of free fatty acids and glycerol in mouse lung tissue by IAV infection according to an embodiment of the present invention.
  • Figure 7a is a graph showing the increase and decrease of free fatty acids and glycerol in the cytoplasm of Vero E6 cells caused by SARS-CoV-2 infection according to an embodiment of the present invention.
  • Figure 7b is a graph showing the increase and decrease of free fatty acids and glycerol in the cytoplasm of A549 cells by IAV infection according to an embodiment of the present invention.
  • Figure 7c is a graph showing the increase and decrease of free fatty acids and glycerol in the cytoplasm of HRT-18G cells by BCoV infection according to an embodiment of the present invention.
  • Figure 7d is a graph showing the increase and decrease of free fatty acids and glycerol in the cytoplasm of Vero E6 cells by PEDV infection according to an embodiment of the present invention.
  • Figure 7e is a graph showing the increase and decrease of free fatty acid and glycerol in the cytoplasm of MA104 cells by RVA infection according to an embodiment of the present invention.
  • Figure 7f is a graph showing the increase and decrease of free fatty acids and glycerol in the cytoplasm of MARC-145 cells by PRRSV infection according to an embodiment of the present invention.
  • Figure 7g is a graph showing the increase and decrease of free fatty acids and glycerol in the cytoplasm of LLC-PK cells by PSaV infection according to an embodiment of the present invention.
  • Figure 8a shows atglistatin (MedChemExpress; CAS Number: 1469924-27-3) and CAY10499 (Cayman Chemicals; CAS Number: 359714-55-9) treatment in SARS-CoV-2 infected cells according to an embodiment of the present invention. It is a graph showing the number of viral genes.
  • Figure 8b is a graph showing the number of progeny viruses by atglistatin and CAY10499 treatment in SARS-CoV-2 infected cells according to an embodiment of the present invention.
  • Figure 8c is a graph showing free fatty acids and glycerol in the cytoplasm by atglistatin and CAY10499 treatment in SARS-CoV-2 infected cells according to an embodiment of the present invention.
  • Figure 8d is a photograph showing the amount of virus spike protein (spike; S) synthesis by atglistatin and CAY10499 treatment in SARS-CoV-2 infected cells according to an embodiment of the present invention.
  • 8E is a graph showing the number of viral genes by atglistatin and CAY10499 treatment in IAV-infected cells according to an embodiment of the present invention.
  • 8f is a graph showing the number of progeny viruses by atglistatin and CAY10499 treatment in IAV-infected cells according to an embodiment of the present invention.
  • Figure 8g is a graph showing free fatty acids and glycerol in the cytoplasm by atglistatin and CAY10499 treatment in IAV-infected cells according to an embodiment of the present invention.
  • Figure 8h is a photograph showing the amount of viral spike protein synthesis by atglistatin and CAY10499 treatment in IAV-infected cells according to an embodiment of the present invention.
  • Figure 8i is a photograph and a graph showing palmitoylation of spike protein by atglistatin and CAY10499 treatment in SARS-CoV-2 infected cells according to an embodiment of the present invention.
  • 8j is a photograph and a graph showing palmitoylation of hemagglutinin (H) and M2 protein by atglistatin and CAY10499 treatment in IAV-infected cells according to an embodiment of the present invention.
  • Figure 9a is a graph showing the virus inhibition effect of SARS-CoV-2 by atglistatin and CAY10499 treatment according to an embodiment of the present invention.
  • Figure 9b is a graph showing the virus inhibitory effect of IAV by atglistatin and CAY10499 treatment according to an embodiment of the present invention.
  • Figure 9c is a graph showing the virus inhibition effect of BCoV by atglistatin and CAY10499 treatment according to an embodiment of the present invention.
  • Figure 9d is a graph showing the virus inhibition effect of PEDV by atglistatin and CAY10499 treatment according to an embodiment of the present invention.
  • Figure 9e is a graph showing the virus inhibitory effect of RVA by atglistatin and CAY10499 treatment according to an embodiment of the present invention.
  • Figure 9f is a graph showing the virus inhibitory effect of PRRSV by atglistatin and CAY10499 treatment according to an embodiment of the present invention.
  • Figure 9g is a graph showing the virus inhibitory effect of PSaV by atglistatin and CAY10499 treatment according to an embodiment of the present invention.
  • 10A is a graph showing the number of viral genomes of SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV, and PSaV by atglistatin treatment according to an embodiment of the present invention.
  • 10B is a graph showing the number of viral genes of SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV, and PSaV by CAY10499 treatment according to an embodiment of the present invention.
  • 10c is a graph showing the number of progeny viruses of SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV, and PSaV by atglistatin treatment according to an embodiment of the present invention.
  • 10D is a graph showing the number of progeny viruses of SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV, and PSaV by CAY10499 treatment according to an embodiment of the present invention.
  • Figure 11a is a schematic diagram of a process for preparing IAV-infected mice by administration of atglistatin and CAY10499 according to an embodiment of the present invention.
  • Figure 11b is a graph showing the survival rate of IAV-infected mice by administration of atglistatin according to an embodiment of the present invention.
  • 11c is a graph showing body weight change of IAV-infected mice by administration of atglistatin according to an embodiment of the present invention.
  • 11D is a graph showing clinical symptoms of IAV-infected mice by administration of atglistatin according to an embodiment of the present invention.
  • Figure 11e is a graph showing the survival rate of IAV-infected mice by administration of CAY10499 according to an embodiment of the present invention.
  • Figure 11f is a graph showing the change in body weight of IAV-infected mice by administration of CAY10499 according to an embodiment of the present invention.
  • 11g is a graph showing clinical symptoms of IAV-infected mice by administration of CAY10499 according to an embodiment of the present invention.
  • 11h is a graph showing free fatty acid and glycerol concentrations in lung tissues of IAV-infected mice by administration of atglistatin and CAY10499 according to an embodiment of the present invention.
  • 11i is a graph showing the number of viral genes in lung tissue of IAV-infected mice by administration of atglistatin and CAY10499 according to an embodiment of the present invention.
  • 11j is a graph showing the number of progeny viruses in lung tissues of IAV-infected mice by administration of atglistatin and CAY10499 according to an embodiment of the present invention.
  • 11K is a photograph showing IAV-infected mouse bronchiolar epithelial cells by administration of atglistatin and CAY10499 according to an embodiment of the present invention.
  • 11L is a photograph showing the number of lung lesions and virus-positive cells in IAV-infected mice by administration of atglistatin and CAY10499 according to an embodiment of the present invention.
  • 12a is a schematic diagram of a process for preparing SARS-CoV-2 infected hamsters by administering atglistatin and CAY10499 according to an embodiment of the present invention.
  • Figure 12b is a graph showing the severity of pneumonia in SARS-CoV-2 infected hamsters by administration of atglistatin according to an embodiment of the present invention.
  • 12c is a graph showing the production of free fatty acids and glycerol in SARS-CoV-2 infected hamsters by administration of atglistatin according to an embodiment of the present invention.
  • 12d is a graph showing the number of viral genes in lung tissues of SARS-CoV-2 infected hamsters by administration of atglistatin according to an embodiment of the present invention.
  • 12E is a graph showing the number of progeny viruses in lung tissues of SARS-CoV-2 infected hamsters by administration of atglistatin according to an embodiment of the present invention.
  • Figure 12f is a graph showing the change in body weight of SARS-CoV-2 infected hamsters by administration of atglistatin according to an embodiment of the present invention.
  • 12g is a photograph showing alveolar epithelial cells of SARS-CoV-2 infected hamsters by administration of atglistatin according to an embodiment of the present invention.
  • 12h is a photograph showing the number of lung lesions and virus-positive cells in SARS-CoV-2 infected hamsters by administration of atglistatin according to an embodiment of the present invention.
  • FIG. 13A is a schematic diagram of a process for preparing IAV-infected mice by single or combined administration of atglistatin and oseltamivir according to an embodiment of the present invention.
  • Figure 13b is a graph showing the survival rate of IAV-infected mice by single or combined administration of atglistatin and oseltamivir according to an embodiment of the present invention.
  • Figure 13c is a graph showing the body weight change of IAV-infected mice by single or combined administration of atglistatin and oseltamivir according to an embodiment of the present invention.
  • Figure 13d is a graph showing clinical symptoms of IAV-infected mice by single or combined administration of atglistatin and oseltamivir according to an embodiment of the present invention.
  • FIG. 13E is a schematic diagram of a process for preparing SARS-CoV-2 infected hamsters by single or combined administration of atglistatin and remdesivir according to an embodiment of the present invention.
  • 13f is a graph showing the improvement rate of pneumonia in SARS-CoV-2 infected hamsters by single or combined administration of atglistatin and remdesivir according to an embodiment of the present invention.
  • 13g is a graph showing body weight changes of SARS-CoV-2 A lineage infected hamsters by single or combined administration of atglistatin and remdesivir according to an embodiment of the present invention.
  • 13H is a graph showing body weight changes of SARS-CoV-2 Alpha lineage infected hamsters by single or combined administration of atglistatin and remdesivir according to an embodiment of the present invention.
  • 13i is a graph showing body weight changes of SARS-CoV-2 Beta lineage infected hamsters by single or combined administration of atglistatin and remdesivir according to an embodiment of the present invention.
  • 14B is the chemical formula of 3-(4′-(dimethylamino)-(1,1′-biphenyl)-3-yl)-1-ethyl-1-methylurea [DABPU-EM], a derivative of atglistatin. .
  • 14c is a chemical formula of 3-(4′-dimethylamino)-(1,1′-biphenyl)-3-yl)-1,1-diethylurea [DABPU-DE], a derivative of atglistatin.
  • 14D is a chemical formula of 3-(4'-dimethylamino)-(1,1'-biphenyl)-3-yl)-1,1-diphenylurea [DABPU-DPh], a derivative of atglistatin.
  • 14e is a chemical formula of N-(4'-dimethylamino)-(1,1'-biphenyl)-3-yl)pyrrolidine-1-carboxamide [DABPU-Pyrrol], a derivative of atglistatin.
  • 14F is a chemical formula of N-(4′-(dimethylamino)-(1,1′-biphenyl)-3-yl)morpholine-4-carboxamide [DABPU-Morph], a derivative of atglistatin.
  • 15a is a photograph showing the expression level of viral antigens in SARS-CoV-2 infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 15B is a photograph showing the amount of viral antigen expression in IAV-infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 15c is a photograph showing the amount of viral antigen expression in BCoV-infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 15D is a photograph showing the amount of viral antigen expression in PEDV-infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 15E is a photograph showing the amount of viral antigen expression in RVA-infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 15F is a photograph showing the amount of viral antigen expression in PRRSV-infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 15g is a photograph showing the amount of viral antigen expression in PSaV-infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 16a is a graph showing the virus inhibitory effect in SARS-CoV-2 infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • Figure 16b is a graph showing the virus inhibitory effect in IAV-infected cells by the administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 16c is a graph showing the virus inhibitory effect in BCoV-infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 16D is a graph showing the virus inhibitory effect in PEDV-infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 16E is a graph showing the virus inhibition effect in infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 16F is a graph showing the virus inhibitory effect in PRRSV-infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • Figure 16g is a graph showing the virus inhibitory effect in PSaV-infected cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 17a is a graph showing the number of viral genes in cells infected with SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV and PSaV by administration of DABPU-EM according to an embodiment of the present invention.
  • 17B is a graph showing the number of viral genes in SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV and PSaV infected cells by administration of DABPU-DE according to an embodiment of the present invention.
  • 17C is a graph showing the number of progeny viruses produced in SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV and PSaV infected cells by administration of DABPU-EM according to an embodiment of the present invention.
  • 17D is a graph showing the number of offspring virus production in cells infected with SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV and PSaV by administration of DABPU-DE according to an embodiment of the present invention.
  • 18a is a schematic diagram of a process for preparing IAV-infected mice by administering DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 18B is a graph showing the survival rate of IAV-infected mice by administration of DABPU-EM according to an embodiment of the present invention.
  • 18c is a graph showing body weight change of IAV-infected mice by administration of DABPU-EM according to an embodiment of the present invention.
  • 18D is a graph showing clinical symptoms of IAV-infected mice by administration of DABPU-EM according to an embodiment of the present invention.
  • 18E is a graph showing the survival rate of IAV-infected mice by administration of DABPU-DE according to an embodiment of the present invention.
  • Figure 18f is a graph showing the change in body weight of IAV-infected mice by administration of DABPU-DE according to an embodiment of the present invention.
  • 18g is a graph showing clinical symptoms of IAV-infected mice by administration of DABPU-DE according to an embodiment of the present invention.
  • 18H is a graph showing free fatty acid and glycerol concentrations in lung tissues of IAV-infected mice by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 18i is a graph showing the number of viral genes in lung tissues of IAV-infected mice by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 18J is a graph showing the number of progeny viruses in the lung tissues of IAV-infected mice by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 18k is a photograph showing IAV-infected mouse bronchiolar epithelial cells by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 18L is a photograph showing lung lesions and the number of virus-positive cells in IAV-infected mice by administration of DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 19a is a schematic diagram of a process for preparing SARS-CoV-2 infected hamsters by administration of DABPU-DM and DABPU-DE according to an embodiment of the present invention.
  • 19B is a graph showing the severity of pneumonia in SARS-CoV-2 infected hamsters by administration of DABPU-DM and DABPU-DE in an embodiment of the present invention.
  • 19c is a graph showing the production of free fatty acids and glycerol in SARS-CoV-2 infected hamsters by administration of DABPU-DM and DABPU-DE according to an embodiment of the present invention.
  • 19D is a graph showing the number of viral genes in SARS-CoV-2 infected hamsters by administration of DABPU-DM and DABPU-DE according to an embodiment of the present invention.
  • 19E is a graph showing the number of progeny viruses in SARS-CoV-2 infected hamsters by administration of DABPU-DM and DABPU-DE according to an embodiment of the present invention.
  • Figure 19f is a graph showing the change in body weight of SARS-CoV-2 infected hamsters by administration of DABPU-DM and DABPU-DE according to an embodiment of the present invention.
  • Figure 20a is a schematic diagram of a process for preparing IAV-infected mice by single or combined administration of DABPU-DE and oseltamivir according to an embodiment of the present invention.
  • Figure 20b is a graph showing the survival rate of IAV-infected mice by single or combined administration of DABPU-DE and oseltamivir according to an embodiment of the present invention.
  • Figure 20c is a graph showing the body weight change of IAV-infected mice by single or combined administration of DABPU-DE and oseltamivir according to an embodiment of the present invention.
  • Figure 20d is a graph showing clinical symptoms of IAV-infected mice by single or combined administration of DABPU-DE and oseltamivir according to an embodiment of the present invention.
  • 20E is a schematic diagram of a process for preparing SARS-CoV-2 A lineage, Alpha lineage or Beta lineage infected hamsters by single or combined administration of DABPU-DE and remdesivir according to an embodiment of the present invention.
  • 20F is a graph showing the severity of pneumonia in SARS-CoV-2 A lineage, Alpha lineage or Beta lineage infected hamsters by single or combined administration of DABPU-DE and remdesivir according to an embodiment of the present invention.
  • 20g is a graph showing body weight changes of SARS-CoV-2 A lineage infected hamsters by single or combined administration of DABPU-DE and remdesivir according to an embodiment of the present invention.
  • Figure 20h is a graph showing the change in body weight of SARS-CoV-2 Alpha lineage infected hamsters by single or combined administration of DABPU-DE and remdesivir according to an embodiment of the present invention.
  • 20i is a graph showing body weight changes of SARS-CoV-2 Beta lineage infected hamsters by single or combined administration of DABPU-DE and remdesivir according to an embodiment of the present invention.
  • 21a is a graph showing the number of viral genes in SARS-CoV-2 infected Vero E6 cells by administration of DABPU-DM, DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 21B is a graph showing the number of viral genes in SARS-CoV-2 infected Caco-2 cells by administration of DABPU-DM, DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 21c is a graph showing the number of viral genes in SARS-CoV-2 infected Calu-3 cells by administration of DABPU-DM, DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 21D is a graph showing the number of progeny viruses in SARS-CoV-2 infected Vero E6 cells by administration of DABPU-DM, DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 21E is a graph showing the number of progeny viruses in SARS-CoV-2 infected Caco-2 cells by administration of DABPU-DM, DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 21f is a graph showing the number of progeny viruses in SARS-CoV-2 infected Calu-3 cells by administration of DABPU-DM, DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 21g is a graph showing the number of viral genes in IAV-infected MRC-5 cells by administration of DABPU-DM, DABPU-EM and DABPU-DE according to an embodiment of the present invention.
  • 21H is a graph showing the number of viral genes in IAV-infected NCI-H293 cells by administration of DABPU-DM, DABPU-EM, and DABPU-DE according to an embodiment of the present invention.
  • 21i is a graph showing the number of viral genes in IAV-infected WI-38 cells by administration of DABPU-DM, DABPU-EM, and DABPU-DE according to an embodiment of the present invention.
  • 21j is a graph showing the number of viral genes in IAV-infected Calu-3 cells by administration of DABPU-DM, DABPU-EM, and DABPU-DE according to an embodiment of the present invention.
  • 21K is a graph showing the number of progeny viruses in IAV-infected MRC-5 cells by administration of DABPU-DM, DABPU-EM, and DABPU-DE according to an embodiment of the present invention.
  • 21L is a graph showing the number of progeny viruses in IAV-infected NCI-H293 cells by administration of DABPU-DM, DABPU-EM, and DABPU-DE according to an embodiment of the present invention.
  • 21m is a graph showing the number of progeny viruses in IAV-infected WI-38 cells by administration of DABPU-DM, DABPU-EM, and DABPU-DE according to an embodiment of the present invention.
  • 21n is a graph showing the number of progeny viruses in IAV-infected Calu-3 cells by administration of DABPU-DM, DABPU-EM, and DABPU-DE according to an embodiment of the present invention.
  • the present invention relates to a pharmaceutical composition for preventing or treating an RNA virus infection comprising a lipolytic enzyme inhibitor.
  • % used to indicate the concentration of a particular substance is (weight/weight)% for solids/solids, (weight/volume)% for solids/liquids, and liquid/liquid is (volume/volume) %.
  • RNA viruses For the study using a wide range of RNA viruses, representative viruses that can be cultured in cells were used as shown in Table 1 below.
  • Virus information used virus strain names (genotypes) source Severe acute respiratory syndrome coronavirus 2; SARS-CoV-2 KCDC03 (Lineage A) A kind gift from Korea Disease Control and Prevention Agency SARS coronavirus type 2 (SARS-CoV-2) KDCA51463 (Alpha lineage) A kind gift from Korea Disease Control and Prevention Agency SARS coronavirus type 2 (SARS-CoV-2) KDCA55905 (Beta lineage) A kind gift from Korea Disease Control and Prevention Agency Influenza A virus A/Puerto Rico/8/1934 (H1N1) US American Type Culture Collection Bovine coronavirus KWD20 Isolated from fecal samples and propagated in HRT-18G and MDBK cells Porcine epidemic diarrhea coronavirus QIAP1401 (G2b) A kind gift from Animal and Plant Quarantine Agency, Korea Bovine species A rotavirus NCDV (G6P6[1]) American Type Culture Collection Porcine reproductive and respiratory syndrome virus LMY (North American type) A kind gift
  • Vero African green monkey renal epithelial cells for culture of SARS coronavirus type 2 KCDC03 strain (Lineage A), SARS coronavirus type 2 KDCA51463 strain (Alpha lineage) and SARS coronavirus type 2 KDCA55905 (Beta lineage) E6 cells, human colorectal adenocarcinoma epithelial cells, Caco-2 cells, and human lung adnocarcinoma epithelial cells, Calu-3 cells, were prepared.
  • A549 cells, human lung adnocarcinoma epithelial cells, MRC-5 cells, human lung fibroblasts, human lung mucoepidermoid carcinoma epithelial cells for culturing influenza A virus PR8 strain NCI-H292 cells, human lung fibroblasts, WI-38 cells, and Calu-3 cells were prepared.
  • HRT-18G cells which are human colorectal adenocarcinoma epithelial cells, were prepared for the cultivation of bovine coronavirus KWD20 strain.
  • Vero E6 cells were prepared for cultivation of porcine epidemic diarrhea coronavirus strain QIAP1401.
  • MARC-145 cells which are renal epithelial cells of African green monkeys, were prepared for the cultivation of porcine reproductive and respiratory syndrome virus strain LMY.
  • Porcine kidney epithelium LLC-PK cells were used for the cultivation of porcine sapovirus Cowden strain.
  • FBS fetal bovine serum
  • DMEM Dulbecco’s modified Eagle’s medium
  • EMEM Eagle’s Minimum Essential Medium
  • ⁇ -MEM Alpha Minimal Essential Medium
  • P/S 100 U/mL penicilin, 100 ⁇ g/mL streptomycin
  • LD cytoplasmic lipid droplet
  • Vero E6 cells which are African green monkey kidney epithelial cells, were mixed with 10% fetal bovine serum, 100 u/ml penicillin, 100 ug/ A549 human lung cancer cells were monolayer cultured in DMEM medium supplemented with 10% fetal bovine serum, 100 u/ml penicillin, and 100 ug/ml streptomycin.
  • TPCK-treated trypsin N-tosyl-L-phenylalanine chloromethyl ketone (TPCK)-treated trypsin, Sigma Aldrich, GCDCA: glycochenodeoxycholic acid
  • SARS coronavirus type 2 KCDC03 strain Lineage A
  • SARS coronavirus type 2 KDCA51463 strain Alpha lineage
  • SARS coronavirus type 2 KDCA55905 Beta lineage
  • monolayer cultured Vero E6 cells were cultured with SARS coronavirus.
  • TPCK N-tosyl-L-phenylalanine chloromethyl ketone
  • CCIF assay cell culture immunofluorescence assay
  • SARS coronavirus type 2 KCDC03 strain, SARS coronavirus type 2 KDCA51463 strain, and SARS coronavirus type 2 KDCA55905 titers were expressed in ffu/mL (fluorescence focus units per milliliter).
  • titer of influenza A virus PR8 strain In order to measure the titer of influenza A virus PR8 strain, monolayer cultured A549 cells were inoculated with influenza A virus PR8 strain, and TPCK-treated trypsin 1 ⁇ g/ml, 100 u/ml penicillin, and 100 ug/ml streptomycin were added. After addition of DMEM and incubation in a 37° C. CO 2 incubator for 24 hours, cell culture immunofluorescence antibody method using an antibody against influenza A virus nucleoprotein protein was performed. The titer of the influenza A virus PR8 strain was expressed as ffu/mL.
  • Vero E6 cells cultured in monolayer in an 8-well chamber were inoculated with SARS-CoV type 2 KCDC03 at a multiplicity of infection (MOI) of 0.1 ffu/mL.
  • MOI multiplicity of infection
  • A549 cells cultured as a monolayer in an 8-well chamber were inoculated or not inoculated with influenza A virus PR8 strain at a multiplicity of infection of 1 ffu/mL, and then 1 ⁇ g/ml TPCK-treated trypsin, 100 u/ml penicillin, After adding DMEM supplemented with 100 ug/ml streptomycin, the cells were cultured in a 37°C CO 2 incubator for 1, 4, 8, 12, 18, 24, and 36 hours.
  • BODIPY BODIPY 493/503; Sigma Aldrich staining for immunofluorescence staining/fatty area for SARS coronavirus type 2 nucleocapsid protein or immunofluorescence staining for influenza A virus M2 protein/local area was performed.
  • cells were fixed with 4% paraformaldehyde (Sigma Aldrich). The fixed cells were washed with phosphate-buffered saline (PBS, pH 7.4) at pH 7.4, blocked with 5% BSA (Bovine Serum Albumin) for 1 hour at 20 ° C, and then the primary antibodies against each virus were incubated in 4 Incubated overnight at °C.
  • PBS phosphate-buffered saline
  • BSA Bovine Serum Albumin
  • virus proliferation increased in a time-dependent manner in Vero E6 or A549 cells infected with SARS coronavirus type 2 or influenza A virus, but colocalization with fat and viral proteins was not.
  • the number of fat droplets in SARS coronavirus type 2-infected cells increased from the beginning of infection to 18 hours and decreased from 24 hours, compared to the virus-free control group.
  • the number of fat droplets increased from the beginning of infection to 12 hours, and decreased from 18 hours, compared to the virus-free control in cells infected with influenza A virus.
  • each cell was cultured as a monolayer in a 100 ⁇ cell culture dish, followed by immunofluorescence as described above. After infecting the virus under the same conditions as the antibody test method, cells were harvested using trypsin at the same time period, and the number of cells was measured with a hemocytometer . After washing with buffer to make a clean cell pellet, the cells were stored frozen at minus 20°C.
  • the cell pellet was mixed with the standard diluent provided in the kit, sonicated, and centrifuged to obtain the supernatant, respectively, with the enzyme mixture and at room temperature for 15 minutes. reacted Absorbance was analyzed with an ELISA reader at 570 nm, and quantified using standard samples reacted together.
  • the cell pellet was mixed with the Cholesterol assay buffer provided in the kit, vortexed on ice once a minute for 20 minutes, centrifuged, and the supernatant obtained was Cholesterol Reaction containing Cholesterol Esterase. Mix and reacted at 37 °C for 60 minutes.
  • the value measured by the ELISA reader at 570 nm was based on the function formula obtained from the standard sample, and the total cholesterol content was calculated.
  • intracellular triglyceride and cholesterol increased from the beginning of infection to 18 hours and then decreased.
  • BCoV bovine coronavirus
  • PEDV porcine epidemic diarrhea coronavirus
  • RVA bovine rotavirus
  • PRRSV porcine reproductive and respiratory syndrome virus
  • PSaV porcine sapovirus
  • RNA viruses such as cell cultureable bovine coronavirus KWD20 strain, swine epidemic diarrhea coronavirus QIAP1401 strain, bovine rotavirus NCDV strain, porcine reproductive and respiratory syndrome virus LMY strain, and porcine sapovirus Cowden strain After infection of the cultured cells, the local area was evaluated.
  • HRT-18G cells were monolayer cultured on a 96-well plate (SPL Life Science, Pocheon, South Korea), and then a separate 96-well plate was prepared and DMEM was used as a diluent.
  • the virus was serially diluted 10-fold, leaving only virus-free DMEM medium in the last well.
  • each step-diluted virus or virus-free DMEM medium was inoculated on the HRT-18G cells, and the virus was adsorbed to the cells in a 37°C CO 2 incubator for 1 hour. made it
  • DMEM fetal calf serum
  • porcine pancreatin Gibco, Fort Worth, TX, USA
  • 100 u/ml penicillin 100 ug/ml streptomycin was added, followed by 37
  • the virus was cultured in an incubator at °C. After 24 hours, the medium in which the virus was cultured was removed from the 96-well plate, washed with water in phosphate buffer, fixed with 4% paraformaldehyde at 20 ° C for 10 minutes, and antibodies against bovine coronavirus spike protein ( Immunofluorescence antibody method was performed using Native Antigen Company, Killington, UK).
  • the titer of the bovine coronavirus strain KWD20 used in this patent was expressed as ffu/mL.
  • HRT-18G cells were cultured as a monolayer in an 8-well chamber (SPL), the chamber was washed with phosphate buffer, and the multiplicity of infection (MOI) determined by the immunofluorescence antibody method was 0.1 ffu/cell.
  • the human bovine coronavirus strain KWD20 was inoculated.
  • the primary antibody against the bovine coronavirus spike protein and the secondary antibody conjugated with AF647 were reacted according to the above method, followed by BODIPY staining of the fat area. did Then, mounting was performed after nuclear staining with DAPI.
  • the immunofluorescence antibody test results for lipid and hormone-sensitive lipolytic enzymes according to each virus infection were analyzed in the same manner as in Experimental Example 1-1 using Adobe Photoshop CS6.
  • African green monkey renal epithelial cells purchased from ATCC for porcine epidemic diarrhea coronavirus culture, were monolayer cultured in EMEM supplemented with 10% fetal bovine serum, 100 u/ml penicillin, and 100 ug/ml streptomycin.
  • Vero E6 cells were monolayer cultured in a 96-well plate, the medium was removed from Vero E6, washed with phosphate buffer, and each 10-fold diluted virus or virus was EMEM medium without EMEM was inoculated onto the Vero E6 cells and the virus was adsorbed to the cells in a 37°C CO 2 incubator for 1 hour.
  • Bovine group A rotavirus NCDV (G6P6[1]) strain was purchased from ATCC, and rhesus monkey renal epithelial MA104 cells purchased from ATCC were used for virus culture in 10% fetal bovine serum, 100 u/ml Monolayer culture was performed in ⁇ -MEM supplemented with penicillin and 100 ug/ml streptomycin.
  • MA104 cells were monolayer cultured on a 96-well plate, and a separate 96-well plate was prepared, and the virus was diluted 10-fold with ⁇ -MEM as a diluent, and the last well Only virus-free ⁇ -MEM medium was present. After removing the medium from the monolayer cultured MA104 cells, washing with water in phosphate buffer, each diluted virus or virus-free ⁇ -MEM medium was inoculated on the MA104 cells, and the virus was adsorbed to the cells in a 37°C CO 2 incubator for 1 hour. .
  • MA104 cells were monolayer cultured in an 8-well chamber (SPL), washed with phosphate buffer, and the multiplicity of infection (MOI) determined by immunofluorescence antibody method was 0.1 ffu/cell.
  • Rotavirus NCDV strain was inoculated. After adsorbing the virus to the cells for 1 hour at 37°C, washing with phosphate buffer, adding ⁇ -MEM to which 5 ⁇ g/mL pancreatin and the above antibiotics were added, and incubating them in a CO 2 incubator at 37°C 12, 24, 36 Incubated for a period of time, each chamber was washed with phosphate buffer, fixed with 4% paraformaldehyde, and treated with 0.2% Trion-X at 20° C. for 10 minutes to perforate the cells.
  • SPL 8-well chamber
  • MOI multiplicity of infection
  • MARC-145 cells African green monkey cells purchased from ATCC, were monolayer cultured in DMEM supplemented with 10% fetal bovine serum, 100 u/ml penicillin, and 100 ug/ml streptomycin. .
  • MARC-145 cells were monolayer cultured on a 96-well plate (SPL Life Science, Pocheon, South Korea), and then a separate 96-well plate was prepared and DMEM was added. The virus was serially diluted 10-fold as the diluent, leaving only the virus-free DMEM medium in the last well. After removing the medium from the monolayer cultured MARC-145 and washing it with phosphate buffer, each step-diluted virus or virus-free DMEM medium was inoculated on the MARC-145 cells, and the virus was adsorbed to the cells in a 37°C CO 2 incubator for 1 hour. made it
  • MARC-145 cells were monolayer cultured in an 8-well chamber, washed with phosphate buffer, and porcine genitalia with a multiplicity of infection (MOI) of 0.1 ffu/cell determined by immunofluorescence antibody method. and respiratory syndrome virus strain LMY were inoculated. The virus was adsorbed to the cells for 1 hour at 37°C, washed with phosphate buffer, DMEM containing the above antibiotics was added, and incubated in a 37°C CO 2 incubator for 24, 48, and 72 hours, respectively. After washing with buffer, the cells were fixed with 4% paraformaldehyde and treated with 0.2% Triton-X at 20° C. for 10 minutes to perforate the cells.
  • MOI multiplicity of infection
  • Porcine kidney epithelium LLC-PK cells purchased from ATCC for porcine sapovirus culture were monolayer cultured in EMEM supplemented with 10% fetal bovine serum, 100 u/ml penicillin, and 100 ug/ml streptomycin. .
  • LLC-PK cells were monolayer cultured on a 96-well plate, and a separate 96-well plate was prepared and the virus was serially diluted 10-fold using EMEM as a diluent, and the last well Only virus-free EMEM medium was present. After removing the medium from the monolayer cultured LLC-PK cells, washing with water in phosphate buffer, inoculating each serially diluted virus or virus-free EMEM medium on the LLC-PK cells, and incubating the virus in the cells in a 37°C CO 2 incubator for 1 hour. adsorbed.
  • LLC-PK cells were monolayer cultured in an 8-well chamber (SPL), washed with phosphate buffer, and the multiplicity of infection (MOI) determined by the immunofluorescence antibody method was 0.1 ffu/cell.
  • MOI multiplicity of infection
  • Viruses were adsorbed to the cells for 1 hour at 37°C, washed with phosphate buffer, 3 ⁇ g/mL fosin pancreatic trypsin, and EMEM supplemented with the above antibiotics were added, and then in a CO 2 incubator at 37°C 18, 36, 54 After incubation for a period of time, each chamber was washed with phosphate buffer, fixed with 4% paraformaldehyde, and treated with 0.2% Triton-X at 20° C. for 10 minutes to perforate the cells.
  • SARS coronavirus type 2 SARS coronavirus type 2
  • IAV influenza A virus
  • hamsters were infected with SARS coronavirus type 2 KCDC03 strain or mice were infected with influenza A virus strain PR8 adapted for mice. Lung tissue was collected for each time period and the experiment was performed as follows.
  • hamsters were purchased from Janvier Labs (Saint-Berthevin, France) and used 11-week-old female Golden Syrian hamsters 7 days before the start of the experiment. In the breeding room, the night/day cycle was adjusted to 12 hours/12 hours, the temperature was 22-24 °C, the humidity was 40-55%, and the hamsters were allowed to freely consume solid feed and sterilized distilled water. Representative hamsters were blooded from the orbital vein and tested for antibodies to SARS coronavirus type 2 by ELISA. As a result, antibodies to SARS coronavirus type 2 were not detected in the blood.
  • a 50% tissue culture infectious dose assay (Median Tissue Culture Infectious Dose assay, TCID 50 ) was performed.
  • TCID 50 Median Tissue Culture Infectious Dose assay
  • the hamsters were euthanized three times a day on days 0 (negative control), 2, 4, 6, 8, and 10 after infection, and autopsies were performed. It was fixed at room temperature in formaldehyde for one week, and the right anterior lobe, middle lobe, dorsal lobe and dorsal lobe were all mixed to form an emulsion, and free fatty acid, triglyceride and glycerol measurement in the cytoplasm and SARS coronavirus type 2 spike protein and hormone sensitivity It was used to evaluate lipolytic enzyme.
  • wild-type C57BL/6J mice were purchased from Samtaco (Osan, South Korea) 7 days before the start of the experiment.
  • the night/day cycle was adjusted to 12 hours/12 hours, the temperature was 25° C., and the mice freely consumed solid feed and sterilized distilled water.
  • blood was collected from the orbital vein and an antibody test against influenza A virus was performed by ELISA. As a result, antibody against influenza A virus was not detected in the blood.
  • mice Female 8-week-old wild-type C57BL/6J mice were used to determine the half-lethal dose (50% Lethal Dose, LD 50 ) of the influenza A virus PR8 strain.
  • the experimental group was divided into a total of 5 experimental groups: no virus vaccination group, 10 1 PFU vaccination group, 10 2 PFU vaccination group, 10 3 PFU vaccination group, and 10 4 PFU vaccination group.
  • Mice of each experimental group were anesthetized with a mixture of xylene and zoletyl, and then inoculated with 50 ⁇ L of phosphate buffer or 50 ⁇ L of phosphate buffer containing the above-mentioned virus number by intranasal administration. After 15 days of observation, survival rate, body weight, clinical symptoms, etc. were recorded, and the number of dead mice was recorded and analyzed by the Reed and Muench method to calculate the LD 50 value.
  • mice 8-week-old female wild-type C57BL/6J mice were inoculated with a virus (10,000 PFU) corresponding to 20 times the LD 50 .
  • a virus 10,000 PFU
  • mice were euthanized daily on days 0 (negative control), 1, 2, 3, 4, 5, 6, and 7 after infection, and autopsies were performed. It was fixed at room temperature in 4% paraformaldehyde for one week, and the right anterior lobe, middle lobe, posterior lobe, and dermal lobe were all mixed to form an emulsion, and free fatty acid, neutral fat and glycerol in the cytoplasm were measured, and influenza A virus PB1 protein and hormone-sensitive lipolysis were measured. Enzymes were used to evaluate.
  • adiposity and SARS coronavirus type 2 or influenza A virus antigen in the lung tissue 3 ⁇ m frozen sections were made from the fixed tissue. After blocking with 5% BSA, primary antibodies against SARS coronavirus type 2 nucleocapsid (N) or influenza A virus M2 (membrane ion channel) antigen were incubated at 4 ° C for 16 hours, AF594-conjugated A mouse IgG (H+L) secondary antibody was reacted at 20°C for one hour.
  • tissue sections After washing the tissue sections with phosphate buffer, they were reacted with 10 ⁇ M BODIPY at 20 °C for 15 minutes for local staining, and after washing, nuclear staining and mounting were performed using Slow-Fade Gold antifade reagent.
  • the fat content of alveolar epithelial cells of hamsters infected with SARS coronavirus type 2 increased from the beginning of infection to 4 days of age compared to the virus-free control group, and decreased from 6 days of age, and influenza A virus infection
  • the fat content of lung bronchiolar epithelial cells of mice increased from the beginning of infection to 4 days of age, and decreased from 5 days of age, compared to the virus-free control group.
  • NP40 Substitute Assay Reagent 100 mg was mixed with 500 ⁇ L NP40 Substitute Assay Reagent, and a sonicator was used on ice at an intensity of 40%, 2 sec/10 After repeating 20 times in seconds (operating/resting) conditions, the supernatant was collected by centrifugation. The supernatant was diluted 5 times with NP40 Substitue Assay Reagent, transferred 10 ⁇ L to a 96-well plate, transferred 150 ⁇ L Triglyceride Enzyme Mixture to each well, reacted at 20 ° C for 15 minutes, and measured at 570 nm with an ELISA meter. Absorbance was measured.
  • the triglyceride and cholesterol concentrations in the lungs of hamsters infected with SARS coronavirus type 2 increased from the beginning of infection to 4 days of age and then decreased, and the neutral fat and cholesterol concentrations in the lungs of influenza A virus-infected mice Cholesterol concentration increased from the beginning of infection to 4 days of age and then decreased.
  • Vero E6 cells infected with SARS coronavirus type 2 KCDC03 strain and A549 cells infected with influenza A virus PR8 strain were prepared as in Experimental Example 1 described above.
  • influenza A virus with an infection multiplicity of 1 ffu/cell was induced in A549 cells cultured in a monolayer in an 8-well chamber. After inoculating the PR8 strain and culturing in a 37°C CO 2 incubator for 1, 4, 8, 12, 18, 24, and 36 hours as in the above experiment, the cells were fixed with 4% paraformaldehyde for the immunofluorescence antibody method. .
  • SARS coronavirus type 2 KCDC03 with a multiplicity of infection of 0.1 ffu/cell was inoculated into Vero E6 cells cultured in a monolayer in a 100 ⁇ cell culture dish to obtain free fatty acid (FFA) and glycerol levels in the cytoplasm. After culturing for 4, 8, 12, 18, 24, 36, and 48 hours in a 37° C. CO 2 incubator as in the above experiment, the cells were separated using trypsin and harvested.
  • FFA free fatty acid
  • A549 cells cultured in a monolayer on a 100 ⁇ cell culture dish were inoculated with influenza A virus PR8 with a multiplicity of infection of 1 ffu/cell, and as in the above experiment, 1, 4, 8, 12, 18, 24, After culturing for 36 hours, the cells were separated using trypsin and then harvested. Harvested cells were quantified with a hemocytometer, and 5 x 10 6 identical cells were dispensed into each ep-tube. After centrifugation, the cell pellet was washed with phosphate buffer and used for free fatty acid and glycerol content analysis.
  • the Fatty Acid Colorimetric Assay Kit was purchased from BioVision (Milpitas, CA, USA). According to the manufacturer's instructions, 500 ⁇ L Chlorform and 1% Triton-X were added to the cell pellet and vortexed every 5 minutes. After mixing homogeneously, the organic phase was recovered, dried in air, and the formed pellet was dissolved after adding 400 ⁇ L Fatty Acid Assay Buffer. After vortexing vigorously for 5 minutes, 50 ⁇ L of the extracted supernatant and 2 ⁇ L of ACS Reagent were mixed and transferred to the corresponding well of a 96-well plate. A mixture of 50 ⁇ L of the standard fatty acid solution and 2 ⁇ L of ACS Reagent provided as a positive control was also mixed with 96-well.
  • the Glycerol Colorimetric Assay Kit was purchased from BioVision (Milpitas, CA, USA), and the cell pellet was mixed with Glycerol Assay Buffer according to the manufacturer's instructions, followed by vigorous vortexing at 5-minute intervals for 20 minutes. 50 ⁇ L of the supernatant of each sample obtained after centrifugation was dispensed into the corresponding well of the 96-well plate, and 50 ⁇ L of the standard glycerol solution provided as a positive control was dispensed into the corresponding well of the 96-well plate. Thereafter, 50 ⁇ L of Reaction Mixture was added to each well containing each sample and positive control group and reacted at room temperature for 30 minutes. Absorbance was measured at 570 nm using an ELISA reader, and the glycerol concentration of each sample was measured by applying a calibration curve obtained through a standard glycerol solution according to the manufacturer's instructions.
  • HRT-18G cells were monolayer cultured in an 8-well chamber (SPL), and then the chamber was phosphoric acid After washing with buffer, KWD20 bovine coronavirus strain having a multiplicity of infection (MOI) of 0.1 ffu/cell determined by immunofluorescence antibody method was inoculated.
  • MOI multiplicity of infection
  • Vero E6 cells were monolayer cultured in an 8-well chamber (SPL), and the chamber was washed with phosphate buffer, Porcine epidemic diarrhea coronavirus strain Q1401 having a multiplicity of infection (MOI) of 0.1 ffu/cell determined by immunofluorescence antibody method was inoculated.
  • MOI multiplicity of infection
  • Viruses were adsorbed to the cells for 1 hour at 37°C, washed with phosphate buffer, 3 ⁇ g/mL fosin pancreatic trypsin, and EMEM supplemented with the above antibiotics were added, and then in a CO 2 incubator at 37°C 18, 36, 54 After incubation for an hour, each chamber was washed with water in phosphate buffer, fixed with 4% paraformaldehyde, and treated with 0.2% Triton-X at 20° C. for 10 minutes to perforate the cells. Thereafter, the primary antibody against the phosphorylated hormone-sensitive lipolytic enzyme (S563) and the secondary antibody coupled to AF647 were reacted. Then, local BODIPY staining was performed, followed by nuclear staining with DAPI, followed by mounting.
  • phosphate buffer 3 ⁇ g/mL fosin pancreatic trypsin, and EMEM supplemented with the above antibiotics were added, and then in a CO 2 incubator at 37°C
  • MA104 cells were monolayer cultured in an 8-well chamber (SPL) to achieve each purpose, and then the chamber was phosphate buffered After washing with water, a bovine rotavirus NCDV strain having a multiplicity of infection (MOI) of 0.1 ffu/cell determined by immunofluorescence antibody method was inoculated.
  • SPL 8-well chamber
  • MARC-145 cells were monolayer cultured in an 8-well chamber, washed with phosphate buffer, and then immunized.
  • Porcine reproductive and respiratory syndrome virus strain LMY having a multiplicity of infection (MOI) of 0.1 ffu/cell determined by the fluorescent antibody method was inoculated. The virus was adsorbed to the cells for 1 hour at 37°C, washed with phosphate buffer, DMEM containing the above antibiotics was added, and incubated in a 37°C CO 2 incubator for 24, 48, and 72 hours, respectively.
  • the cells were fixed with 4% paraformaldehyde and treated with 0.2% Triton-X at 20° C. for 10 minutes to perforate the cells. Thereafter, the primary antibody against the phosphorylated hormone-sensitive lipolytic enzyme (S563) and the secondary antibody coupled to AF647 were reacted. Then, local BODIPY staining was performed, followed by nuclear staining with DAPI, followed by mounting.
  • LLC-PK cells were monolayer cultured in an 8-well chamber (SPL), and the chamber was washed with phosphate buffer. Porcine sapovirus Cowden strain having a multiplicity of infection (MOI) of 0.1 ffu/cell determined by immunofluorescence antibody method was inoculated.
  • MOI multiplicity of infection
  • Immunofluorescence antibody test results for lipid and hormone-sensitive lipolytic enzymes according to each virus infection were obtained by comparing the images taken using Adobe Photoshop PS6 pixel by pixel in the same manner as in Experimental Example 1-1, and then phosphorylated
  • the colocalization positive signal area of hormone-sensitive lipolytic enzyme (S563)/BODIPY was calculated and evaluated as mean ⁇ standard error.
  • hamsters inoculated with SARS coronavirus type 2 KDCD03 strain corresponding to 10 5 TCID 50 were euthanized and necropsied every day at 0 (negative control), 2, 4, 6, 8, and 10 days after infection
  • the left lobe of the extracted lungs was fixed in 4% paraformaldehyde at room temperature for one week for histopathological analysis and frozen sections, and the right anterior lobe, middle lobe, posterior lobe, and lateral lobe were all mixed to form an emulsion, and then placed in the cytoplasm. It was used to evaluate free fatty acid and glycerol measurements, SARS coronavirus type 2 spike protein and hormone-sensitive lipolytic enzyme
  • mice inoculated with influenza A virus corresponding to 1,000 PFU were euthanized every day on days 0 (negative control), 1, 2, 3, 4, 5, 6, and 7 after infection, and then necropsy was performed.
  • the left lobe of the extracted lungs was fixed in 4% paraformaldehyde at room temperature for one week for histopathological analysis and frozen sections, and the right anterior lobe, middle lobe, posterior lobe, and lateral lobe were all mixed to form an emulsion, and free fatty acids in the cytoplasm were mixed. It was used to evaluate glycerol measurement, influenza A virus PB1 protein and hormone-sensitive lipolytic enzyme.
  • phosphorylated hormone-sensitive lipolytic enzyme S563
  • SARS coronavirus type 2 or influenza A virus antigen in the lung tissue
  • 3 ⁇ m frozen sections were made from the fixed tissue.
  • the primary antibody against the SARS coronavirus type 2 nucleocapsid (N) or influenza A virus M2 (membrane ion channel) antigen was incubated at 4 ° C for 16 hours, AF594-conjugated A mouse IgG (H+L) secondary antibody was reacted at 20°C for one hour.
  • tissue sections After washing the tissue sections with phosphate buffer, they were reacted with 10 ⁇ M BODIPY at 20 °C for 15 minutes for local staining, and after washing, nuclear staining and mounting were performed using Slow-Fade Gold antifade reagent.
  • phosphorylated hormone-sensitive lipase (HSL) and SARS coronavirus type 2 nucleocapsid (N) in alveolar epithelial cells of hamsters infected with SARS coronavirus type 2 It increased significantly at 2 and 4 days of infection in the virus-free control group, and then decreased from 6 days of age.
  • the phosphorylated hormone-sensitive lipolytic enzyme and influenza A virus M2 protein in the lung bronchiole epithelial cells of mice infected with influenza A virus were significantly increased until 5 and 6 days of age in the virus-free control group. Decreased at 7 days of age.
  • the dissolved protein was transferred to nitrocellulose membranes (GE Healthcare Life Sciences), and the transferred membrane was blocked in 5% Skim Milk solution for 1 hour at room temperature, washed with TBST, and then tested for SARS coronavirus.
  • S563 phosphorylated hormone sensitive lipase
  • S660 hormone sensitive lipase phosphorylated at serine residue 660
  • Primary antibodies against lipolytic enzyme, host GAPDH protein or host ⁇ -actin protein were applied at 4°C for 16 hours.
  • the expression levels of phosphorylated hormone-sensitive lipolytic enzyme and influenza A virus PB1 protein in the lung bronchiolar epithelial cells of influenza A virus-infected mice rapidly increased from the 4th day of infection and maintained high levels until the 7th day. .
  • Experimental Example 3 Hamster alveolar epithelial cells caused by SARS-CoV-2 infection and influenza A virus (IAV), bovine coronavirus (BCoV), porcine epidemic diarrhea coronavirus (PEDV), bovine rotavirus (RVA), Increase and decrease of free fatty acids and glycerol in the cytoplasm of cultured cells caused by porcine reproductive and respiratory syndrome virus (PRRSV) and porcine sapovirus (PSaV) infection
  • IAV influenza A virus
  • BCoV bovine coronavirus
  • PEDV porcine epidemic diarrhea coronavirus
  • RVA bovine rotavirus
  • PRRSV porcine reproductive and respiratory syndrome virus
  • PSaV porcine sapovirus
  • Vero E6 cells were monolayer cultured in a 100 ⁇ cell culture dish, washed with phosphate buffer, and the multiplicity of infection (MOI) determined by the immunofluorescence antibody method was 0.1 ffu/ SARS coronavirus type 2 KDCD03 strain, which is a cell, was inoculated. After culturing for 4, 8, 12, 18, 24, 36, and 48 hours after infection, the isolated cells were harvested using trypsin. The harvested cells were counted with a hemocytometer, and 5 ⁇ 10 6 cells were dispensed for each assay, centrifuged, washed with phosphate buffer to obtain clean cell pellets, and stored frozen at -20 °C.
  • MOI multiplicity of infection
  • A549 cells were monolayer cultured in a 100 ⁇ cell culture dish, washed with water in phosphate buffer, and influenza A virus PR8 strain with a multiplicity of infection (MOI) of 1 ffu/cell determined by immunofluorescence antibody method. was inoculated. After culturing for 1, 4, 8, 12, 18, 24, and 36 hours after infection, the isolated cells were harvested using trypsin. The harvested cells were counted with a hemocytometer, and 5 ⁇ 10 6 cells were dispensed for each assay, centrifuged, washed with phosphate buffer to obtain clean cell pellets, and stored frozen at -20 °C.
  • MOI multiplicity of infection
  • HRT-18G cells were monolayer cultured in a 100 ⁇ cell culture dish, washed with water in phosphate buffer, and bovine coronavirus with a multiplicity of infection (MOI) of 0.1 ffu/cell determined by immunofluorescence antibody method.
  • MOI multiplicity of infection
  • KWD20 strain was inoculated. After culturing for 18, 36, and 54 hours after infection, the isolated cells were harvested using trypsin. The harvested cells were counted with a hemocytometer, and 5 ⁇ 10 6 cells were dispensed for each assay, centrifuged, washed with phosphate buffer to obtain clean cell pellets, and stored frozen at -20 °C.
  • swine epidemic diarrhea corona with a multiplicity of infection (MOI) of 0.1 ffu/cell determined by immunofluorescence antibody method Virus Q1401 strain was inoculated. After culturing for 18, 36, and 54 hours after infection, the isolated cells were harvested using trypsin. The harvested cells were counted with a hemocytometer, and 5 ⁇ 10 6 cells were dispensed for each assay, centrifuged, washed with phosphate buffer to obtain clean cell pellets, and stored frozen at -20 °C.
  • MOI multiplicity of infection
  • bovine rotavirus NCDV strain with a multiplicity of infection (MOI) of 0.1 ffu/cell determined by immunofluorescence antibody method was inoculated. After culturing for 12, 24, and 36 hours after infection, the isolated cells were harvested using trypsin. The harvested cells were counted with a hemocytometer, and 5 ⁇ 10 6 cells were dispensed for each assay, centrifuged, washed with phosphate buffer to obtain clean cell pellets, and stored frozen at -20 °C.
  • MARC-145 cells monolayer culture of MARC-145 cells in a 100 ⁇ cell culture dish, washing the dish with phosphate buffer, and porcine genitalia with a multiplicity of infection (MOI) of 0.1 ffu/cell determined by immunofluorescence antibody method
  • MOI multiplicity of infection
  • the respiratory syndrome virus strain LMY was inoculated. After culturing for 24, 48, and 72 hours after infection, the isolated cells were harvested using trypsin. Harvested cells were counted with a hemocytometer, and 5 ⁇ 10 6 identical cell numbers were dispensed for each assay, centrifuged, washed with phosphate buffer to make clean cell pellets, and stored frozen at -20 ° C.
  • Intracellular free fatty acid analysis following infection with each virus was performed using the Fatty Acid Colorimetric Assay Kit (BioVision) as described above, and 500 ⁇ L Chlorform and 1% Triton-X were added to the cells according to the instructions. After putting it in the pellet and vortexing every 5 minutes to mix it homogeneously, the organic phase was recovered, dried in air, and the formed pellet was dissolved after adding 400 ⁇ L Fatty Acid Assay Buffer. After vortexing vigorously for 5 minutes, 50 ⁇ L of the extracted supernatant and 2 ⁇ L of ACS Reagent were mixed and transferred to the corresponding well of a 96-well plate.
  • a mixture of 50 ⁇ L of the standard fatty acid solution and 2 ⁇ L of ACS Reagent provided as a positive control was also mixed with 96-well. It was transferred to the corresponding well of the well plate. After adding 50 ⁇ L Enzyme Mix to each well and reacting at 37° C. for 30 minutes, absorbance was measured at 570 nm using an ELISA reader. The fatty acid concentration of each sample was measured by applying a calibration curve obtained through a standard fatty acid solution according to the manufacturer's instructions.
  • the Glycerol Colorimetric Assay Kit (BioVision) was used as described above, and the cell pellet was mixed with Glycerol Assay Buffer according to the manufacturer's instructions and then observed vigorously for 20 minutes at 5-minute intervals. texing was done. 50 ⁇ L of the supernatant of each sample obtained after centrifugation was dispensed into the corresponding well of the 96-well plate, and 50 ⁇ L of the standard glycerol solution provided as a positive control was dispensed into the corresponding well of the 96-well plate. Thereafter, 50 ⁇ L of Reaction Mixture was added to each well containing each sample and positive control group and reacted at room temperature for 30 minutes. Absorbance was measured at 570 nm using an ELISA reader, and the glycerol concentration of each sample was measured by applying a calibration curve obtained through a standard glycerol solution according to the manufacturer's instructions.
  • the levels of free fatty acids and glycerol in the cytoplasm of A549 cells infected with influenza A virus increased rapidly at 24 and 36 hours after infection.
  • the levels of free fatty acids and glycerol in the cytoplasm of bovine coronavirus-infected HRT-18G cells increased rapidly at 36 and 54 hours of infection.
  • the levels of free fatty acids and glycerol in the cytoplasm of bovine rotavirus-infected MA104 cells rapidly increased at 24 and 36 hours after infection.
  • the levels of free fatty acids and glycerol in the cytoplasm of MARC-145 cells infected with porcine reproductive and respiratory syndrome virus rapidly increased at 48 and 72 hours after infection.
  • Atglistatin MedChemExpress; CAS Number: 1469924-27-3
  • CAY10499 Cyman Chemicals; CAS Number: 359714-55-9
  • SARS coronavirus type 2 KCDC03 strain with a multiplicity of infection of 0.1 ffu/cell was inoculated into Vero E6 cells cultured in a monolayer in a 6-well plate, and the virus was inoculated in a 37°C CO 2 incubator for 1 hour. adsorbed on. After washing with phosphate buffer, 1 ⁇ g/ml TPCK-treated trypsin, 100 u/ml penicillin, and 100 ug/ml streptomycin were added to DMEM, followed by incubation in a 37°C CO 2 incubator for 18 hours.
  • each well was washed three times with phosphate buffered saline, and then replaced with a medium containing 20 ⁇ M atglistatin and CAY10499 at final concentrations. Thereafter, after culturing for 18 hours, the medium supernatant was used in a cell culture immunofluorescence assay (CCIF assay) to measure the number of progeny viruses, and RNA was extracted to measure the number of viral genes.
  • CCIF assay cell culture immunofluorescence assay
  • RNA was extracted from cell pellets for viral gene count testing using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions, and the concentration and purity of the extracted RNA were measured and the primary cDNA was synthesized.
  • the synthesized cDNA was subjected to real-time PCR using TOPrealTM qPCR 2X PreMix (Enzynomics) as a primer for the SARS coronavirus type 2 nucleocapsid gene and L32 primer for 60S ribosome as an internal control. performed.
  • the CT value was measured using the LineGene 9600 Plus Real-time PCR detection system (Bioer, Hangzhou, China), and the expression level of the nucleocapsid gene compared to the internal control was measured. It is expressed as standard error.
  • CCIF assay To perform the cell culture immunofluorescence antibody assay (CCIF assay), the virus supernatant was serially diluted in 10-fold increments using EMEM medium, and finally, virus-free medium was prepared. 100 ⁇ L of each diluted virus and negative control inoculum was inoculated into Vero E6 cells monolayer cultured in a 96-well plate and incubated at 37° C. for 1 hour. After dispensing 100 ⁇ L of a medium containing 1 ⁇ g/mL TPCK trypsin in EMEM to each well, the cells were cultured for 18 hours, and after removing the culture medium, the cells were fixed with 4% paraformaldehyde at 20° C. for 10 minutes. Thereafter, cell culture immunofluorescence antibody method using an antibody against SARS coronavirus type 2 nucleocapsid (N) protein was performed.
  • N cell culture immunofluorescence antibody assay
  • Vero E6 cells cultured in a monolayer in a 100 ⁇ cell culture dish were inoculated with SARS coronavirus type 2 KCDC03 strain with a multiplicity of infection of 0.1 ffu / cell, and then atglistatin and CAY10499 were inoculated at 18 hours. The medium was dripped so that the final concentration of the drug was 20 ⁇ M. After culturing for 18 hours, the cells were harvested using trypsin, the number of cells was quantified with a hemacytometer, and 5 x 10 6 identical cells were dispensed into each ep-tube. After centrifugation, the cell pellet was washed with phosphate buffer and used for free fatty acid and glycerol content analysis.
  • SARS coronavirus type 2 KCDC03 strain with a multiplicity of infection of 0.1 ffu/cell was inoculated into Vero E6 cells cultured in a monolayer in an 8-well chamber, and the virus was inoculated in a 37°C CO 2 incubator for 1 hour. adsorbed on. After washing with phosphate buffer, 1 ⁇ g/ml TPCK-treated trypsin, 100 u/ml penicillin, and 100 ug/ml streptomycin were added to DMEM, followed by incubation in a 37°C CO 2 incubator for 18 hours.
  • each well was washed three times with phosphate buffered saline, and then replaced with a medium containing 20 ⁇ M atglistatin and CAY10499 at final concentrations. After further culturing for 18 hours, the cells were fixed with 4% paraformaldehyde at 20° C. for 10 minutes. Thereafter, an immunofluorescence antibody method was performed using an antibody against the SARS coronavirus type 2 spike protein and local BODIPY staining.
  • A549 cells cultured in a monolayer in a 6-well plate were inoculated with influenza A virus PR8 strain with a multiplicity of infection of 1 ffu/cell, and the virus was adsorbed to the cells in a 37°C CO 2 incubator for 1 hour. .
  • 1 ⁇ g/ml TPCK-treated trypsin, 100 u/ml penicillin, and 100 ug/ml streptomycin were added to DMEM, followed by incubation in a 37°C CO 2 incubator for 12 hours.
  • each well was washed three times with phosphate buffered saline, and then replaced with a medium containing 20 ⁇ M atglistatin and CAY10499 at final concentrations. After additional 12 hours of culture, the medium supernatant was used in a cell culture plaque assay to measure the number of progeny viruses, and RNA was extracted to measure the number of viral genes.
  • Virus gene number test was performed in the same manner as described above, but real-time PCR was performed using primers for the influenza A virus PB1 gene.
  • the virus supernatant was serially diluted in 10-fold increments using a DMEM medium, and finally, a virus-free medium was prepared.
  • 200 ⁇ L of each diluted virus and negative control inoculum was inoculated into MDCK cells monolayered in a 6-well plate and incubated at 37° C. for 1 hour.
  • a medium containing 1 ⁇ g/mL TPCK trypsin and 0.5% agarose (ultrapure agarose, Thermo Scientific) in DMEM was dispensed in 4 ml each well and cultured for 3 days. After removing the culture medium, the cells were immersed in 4% paraform. It was fixed with aldehyde at 20 °C for 10 min. Then, after washing with phosphate buffer, 0.1 mg/mL crystal violet was treated at 20° C. for 30 minutes to stain the cells and used for plaque analysis.
  • A549 cells cultured in a monolayer on a 100 ⁇ cell culture dish were inoculated with influenza A virus PR8 strain with a multiplicity of infection of 1 ffu/cell, and at 12 hours, atglistatin and CAY10499 were instilled into the medium. Thus, the final concentration of the drug was 20 ⁇ M. After culturing for 12 hours, cells were harvested using trypsin, the number of cells was quantified with a hemacytometer, and 5 x 10 6 identical cells were dispensed into each ep-tube. After centrifugation, the cell pellet was washed with phosphate buffer and used for free fatty acid and glycerol content analysis.
  • A549 cells cultured in a monolayer in an 8-well chamber were inoculated with influenza A virus PR8 strain having a multiplicity of infection of 1 ffu/cell. After culturing the virus at 37° C. for 12 hours, each well was washed three times with phosphate buffered saline, and then replaced with a medium containing 20 ⁇ M atglistatin and CAY10499 at final concentrations. After further culturing for 12 hours, the cells were fixed with 4% paraformaldehyde at 20° C. for 10 minutes. Thereafter, an immunofluorescence antibody method was performed using an antibody against the influenza A virus M2 protein and local BODIPY staining.
  • the atglistatin and CAY10499 treatment group showed higher levels of viral genes (e), progeny virus numbers (f), free fatty acids and glycerol (g) in the cytoplasm, compared to the vehicle treatment group. ), the amount of viral M2 protein synthesis (h) was significantly decreased, but the number of fat droplets was not significantly decreased (h).
  • Palmitoylation the attachment of free fatty acids (FFA) to SARS coronavirus type 2 spike protein, influenza A virus hemagglutinin protein and influenza A virus M2 protein, promotes fusion of the viral outer membrane with the host cell and viral assembly and release, important for pathogenicity.
  • FFA free fatty acids
  • influenza A virus hemagglutinin protein and influenza A virus membrane protein according to lipolytic enzyme inhibition were mixed with DMSO. 20 mM was prepared by dissolution.
  • Vero E6 cells were inoculated with SARS coronavirus type 2 KCDC03 strain with a multiplicity of infection of 0.1 ffu/cell, and the virus was adsorbed to the cells in a 37°C CO 2 incubator for 1 hour. After washing with phosphate buffer, 1 ⁇ g/ml TPCK-treated trypsin, 100 u/ml penicillin, and 100 ug/ml streptomycin were added to DMEM, followed by incubation in a 37°C CO 2 incubator for 18 hours. Then, each well was washed three times with phosphate buffered saline, and then replaced with a medium containing 20 ⁇ M atglistatin and CAY10499 at final concentrations.
  • the cells were further cultured for 18 hours, washed with phosphate buffer, trypsinized, harvested, centrifuged, and subjected to Palmitoylation Assay (Badrilla, Leeds, UK) according to the manufacturer's instructions.
  • A549 cells were inoculated with influenza A virus PR8 strain having a multiplicity of infection of 1 ffu/cell, and the virus was adsorbed to the cells in a 37°C CO 2 incubator for 1 hour. After washing with phosphate buffer, 1 ⁇ g/ml TPCK-treated trypsin, 100 u/ml penicillin, and 100 ug/ml streptomycin were added to DMEM, followed by incubation in a 37°C CO 2 incubator for 12 hours. Then, each well was washed three times with phosphate buffered saline, and then replaced with a medium containing 20 ⁇ M atglistatin and CAY10499 at final concentrations. Thereafter, the cells were further cultured for 12 hours, washed with phosphate buffer, treated with trypsin, harvested, centrifuged, and subjected to palmitoylation analysis according to the manufacturer's instructions.
  • the total protein supernatant was reacted with CAPTUREomeTM Capture Resin and Thio Cleavage Reagent for 3 hours at 20 ° C on a rotary mixer.
  • the palmitoylated protein bound to the resin was eluted from the resin by adding Laemmli Sample Buffer.
  • Total protein control and palmitoylated proteins were analyzed by Western blotting using antibodies against SARS coronavirus type 2 spike protein, influenza A virus hemagglutinin and M2 protein.
  • the fatty droplets induced by infection with SARScoronavirus type 2 and influenza A virus are degraded in the late stage of infection, and the free fatty acids released by this are related to SARScoronavirus type 2 spike protein, influenza A virus hemagglutinin protein and influenza A virus Causes palmitoylation of the M2 protein.
  • atglistatin and CAY10499 inhibit the degradation of lipid droplets and free fatty acids are not produced, they inhibit palmitoylation of viral proteins and thus inhibit viral proliferation.
  • -PK cells were prepared and placed.
  • the culture medium was prepared by diluting the final concentration of atglistatine by 2-fold stepwise from 160 ⁇ M to form a concentration gradient (each 160, 80, 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.373, 0.186, 0.093, 0.046 ⁇ M), the final concentration of CAY10499 was diluted 2-fold from 80 ⁇ M to prepare a culture medium by forming a concentration gradient (80, 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.373, 0.186, 0.093 respectively). , 0.046 ⁇ M).
  • SARS coronavirus type 2 KCDC03 strain with a multiplicity of infection of 0.01 ffu/cell was applied to Vero E6 cells cultured as a monolayer in a 96-well plate, and influenza virus with a multiplicity of infection of 0.01 ffu/cell was applied to A549 cells.
  • the half-maximal cytotoxic concentration of atglistatin in A549, Vero E6, MDCK, HRT18G, MA04, MARC, and LLC-PK cells was as high as 182.5 ⁇ 268.6, and the half-maximal cytotoxic concentration of CAY10499 was 101.4 ⁇ 110.0, but slightly lower than the half maximal cytotoxic concentration of agtlistatin.
  • SARS coronavirus type 2 was subsequently treated at 18 hours, influenza A virus at 12 hours, bovine coronavirus at 18 hours, and porcine epidemic diarrhea.
  • influenza A virus 12 hours bovine coronavirus 18 hours, swine epidemic diarrhea coronavirus 18 hours, bovine rotavirus 12 hours, porcine reproductive and respiratory syndrome virus 18 hours, swine sandpaper
  • the virus was additionally incubated for 18 hours, and after removing the supernatant, it was fixed with 4% paraformaldehyde solution for 15 minutes.
  • each well was washed three times with phosphate buffered saline and then treated with 0.2% Triton X-100 (Sigma Aldrich) at 20°C for 10 minutes.
  • Triton X-100 Sigma Aldrich
  • the spike protein of SARS coronavirus type 2 the nucleoprotein protein of influenza A virus, the spike protein of bovine coronavirus, and the nucleocapsid of porcine epidemic diarrhea coronavirus Protein, VP6 protein of bovine rotavirus, matrix protein of porcine reproductive and respiratory syndrome virus, and primary antibodies diluted 100 to 200 times against VPg protein of porcine sapovirus were dispensed into each well, and then in a refrigerator at 4°C for 12 hours. worked
  • Atglistatin had half maximum inhibitory concentrations of 1.07 to 6.70, and CAY10499 had 1.54 to 20.85.
  • atglistatin was 0.82 and 1.47, and CAY10499 was 4.13 and 1.54. This means that agtlistatin and CAY10499 have high inhibitory abilities against influenza A virus and SARS coronavirus type 2 even at low concentrations.
  • SARS coronavirus type 2 KCDC03 strain in the selection index showing infection inhibition against cytotoxicity, SARS coronavirus type 2 KCDC03 strain, influenza A virus PR8 strain, bovine coronavirus KWD20 strain, swine epidemic diarrhea coronavirus QIAP1401 strain, bovine rotavirus NCDV strain, pig genital respiratory syndrome
  • the selection index (SI) for LMY strain and porcine sapovirus Cowden strain was 154, 251, 152, 116, 32, 84, 72 for atglistatin and 62, 27, 14, 30, 5, 24, 9 for CAY10499. . This means that atglistatin and CAY10499 have low cytotoxicity and high infection inhibition ability.
  • SARS coronavirus type 2 (SARS-CoV-2 with a multiplicity of infection of 0.01 ffu/cell) was applied to Vero E6 cells cultured in a monolayer in a 12-well plate to detect the inhibitory effect of each virus genome number and progeny virus production by Atglistatin and CAY10499.
  • each well was washed three times with phosphate buffered saline, and each virus culture medium was added for 18 hours for SARS coronavirus type 2, 12 hours for influenza A virus, 18 hours for bovine coronavirus, and 18 hours for porcine epidemic diarrhea coronavirus.
  • bovine rotavirus was cultured for 12 hours, porcine reproductive and respiratory syndrome virus for 18 hours, and porcine sapovirus for 18 hours.
  • the culture medium was replaced with culture medium containing 1, 10, or 20 ⁇ M of atglistatin and CAY10499, and the plate infected with SARS coronavirus type 2 was cultured for 18 hours, the plate infected with influenza A virus was cultured for 12 hours, and the plate infected with bovine coronavirus was cultured for 18 hours. Additional incubation of 18 hours for plates infected with porcine epidemic diarrhea coronavirus, 12 hours for plates infected with bovine rotavirus, 18 hours for plates infected with porcine reproductive and respiratory syndrome virus, and 18 hours for plates infected with porcine sapovirus did Then, each plate was frozen and thawed three times to remove cells from each well, and the next experiment was performed.
  • the cDNA synthesized in TOPrealTM qPCR 2X PreMix (Enzynomics) solution was used for SARS coronavirus type 2 nucleocapsid (N), influenza A virus PB1, bovine coronavirus spike (S), porcine epidemic diarrhea coronavirus nucleocapsid (N), primers specific for bovine rotavirus VP6, porcine reproductive and respiratory syndrome virus matrix (M), and porcine sapovirus VPg were added, respectively, and then real- Time PCR was performed.
  • the supernatant obtained through three freezing and thawing processes was serially diluted 10 times. Then, the supernatant of SARS coronavirus type 2 KCDC03 strain was added to Vero E6 cells cultured in a monolayer in a 96-well plate, the supernatant of influenza A virus PR8 strain to A549 cells, and the supernatant of bovine coronavirus KWD20 strain to HRT-18G cells.
  • SARS coronavirus type 2 for 12 hours influenza A virus for 8 hours, bovine coronavirus for 12 hours, porcine epidemic diarrhea coronavirus for 12 hours, bovine rotavirus for 8 hours, porcine reproductive and respiratory syndrome virus for 18 hours, pig Sapovirus was further incubated for 12 hours. Then, after removing the supernatant, fixing with 4% paraformaldehyde solution for 15 minutes, washing each well three times with phosphate buffered saline, and then treating with 0.2% Triton X-100 at 20 °C for 10 minutes.
  • spike protein of SARS coronavirus type 2 After washing each well three times with phosphate-buffered saline, spike protein of SARS coronavirus type 2, nucleoprotein protein of influenza A virus, bovine coronavirus spike protein, nucleocapsid protein of porcine epidemic diarrhea coronavirus, bovine Primary antibodies diluted 100 to 200 times against VP6 protein of rotavirus, matrix protein of porcine reproductive and respiratory syndrome virus, and VPg protein of porcine sapovirus were dispensed into each well and then applied in a refrigerator at 4° C. for 12 hours.
  • each well was washed three times with phosphate buffered saline, and Alexa Fluor 488 diluted 100 to 200 times or secondary antibody conjugated with fluorescein isothiocyanate was added to each well. After dispensing into the wells, they were allowed to act at room temperature for 2 hours. After removing the supernatant, the nuclei were stained with a propidium iodide solution, and a 60% glycerol solution was added to each well, and each virus-positive cell was examined under a fluorescence microscope.
  • mice were inoculated with virus and untreated (No virus + vehicle), influenza A virus PR8 strain inoculated and untreated group (IAV + vehicle), influenza A virus PR8 strain inoculated and 0.01 mg/kg/day atglistatin treatment group (IAV + atglistatin (0.01 mg kg -1 day -1 )), influenza A virus PR8 week inoculation and 0.1 mg/kg/day atglistatin treatment group (IAV + atglistatin (0.1 mg kg -1 ) 1 day -1 )), virus inoculation and 1 mg/kg/day atglistatin treatment group (IAV + atglistatin (1 mg kg -1 day -1 )), virus inoculation and 5 mg/kg/day atglistatin treatment group (IAV + A total of 7 experimental groups including atglistatin (5 mg kg -1 day -1 )), virus inoculation and 10 mg/kg/day Atglistatin treatment group (IAV + atglistatin (10 mg kg -1 day -1 )), virus inoculation and 10
  • mice 16 7-week-old female wild-type C57BL/6J mice were placed, and the mice were moored under the above-described conditions for 1 week and then used for experiments at 8 weeks of age.
  • a mouse group was prepared by replacing atglistatin with CAY10499 in the same manner.
  • Influenza A virus inoculation was inoculated intranasally with 1,000 PFU per mouse in anesthetized mice in the same manner as in the above experiment, and in the case of non-virus inoculation, only phosphate buffer was inoculated. After observing for 15 days, survival rate, body weight, clinical symptoms, etc. were observed and recorded daily, and mice showing severe weight loss (30% or more) were euthanized and recorded as dead due to viral infection.
  • Drug treatment was administered by intraperitoneal injection using a syringe at 100 ⁇ L twice a day at 12-hour intervals in the morning/afternoon every day from 2 days after inoculation with influenza A virus, for a total of 4 days.
  • a mixture of drug diluting solvent DMSO/40% PEG/H2O was administered intraperitoneally (FIG. 11a).
  • Mortality was measured every day for 15 days based on the survival rate of 100% and mortality rate of 0% on the 0th day of infection, and the survival rate was compared with the virus inoculated and untreated groups. Statistical significance was analyzed by the Log Rank Test, and significance was evaluated when the p value was 0.05 or higher.
  • the experimental groups were group without virus inoculation (No virus + vehicle), influenza A virus PR8 inoculation and no treatment group (IAV + vehicle), influenza A virus PR8 inoculation and 5 mg/kg/day atglistatin treatment group ( IAV + atglistatin (5 mg kg -1 day -1 )), influenza A virus PR 8 week inoculation and 5 mg/kg/day CAY10499 treatment group (IAV + CAY10499 (5 mg kg -1 day -1 )) were placed.
  • Each group consisted of four 7-week-old female wild-type C57BL/6J mice, which were used in this experiment at the age of 8 weeks after being moored for 1 week.
  • mice were inoculated with the influenza A virus strain PR8 in the same manner as described above, treated with drugs for 4 days from the 2nd day after virus infection, and euthanized on the 6th day after infection, and necropsy was performed.
  • the left lobe of the extracted lung was fixed in 4% paraformaldehyde at 4°C for one week for histopathological analysis and frozen sections, and the right anterior lobe, middle lobe, posterior lobe, and lateral lobe were all mixed and cut into small pieces to obtain free fatty acids and glycerol in the cytoplasm. , were used to evaluate viral genome numbers and progeny viruses.
  • Real-time PCR was performed on the influenza A virus PB1 gene and the ⁇ -actin gene of the host to determine the number of viral genes, and the effect of the drug on suppressing viral genes was evaluated.
  • a plaque assay 100 mg mouse lung tissue was added to the beads and lung tissue emulsion was prepared using a Precellys 23 instrument homogenizer purchased from Bertin Technologies (Montigny-le-Bretonneux, France), followed by centrifugation. The supernatant was collected. The obtained supernatant was serially diluted and, as described above, a plaque assay was performed on MDCK cells monolayer cultured in a 6-well plate to evaluate the effect of each drug on inhibiting progeny virus growth.
  • adiposity and influenza A virus antigen in the lung tissue 3 ⁇ m frozen sections were made from the fixed tissue. After blocking with 5% BSA, the primary antibody against the influenza A virus M2 antigen was incubated at 4°C for 16 hours, and the AF594-conjugated mouse IgG (H+L) secondary antibody was reacted at 20°C for 1 hour. After washing the tissue sections with phosphate buffer, they were reacted with 10 ⁇ M BODIPY at 20 °C for 15 minutes for local staining, and after washing, nuclear staining and mounting were performed using Slow-Fade Gold antifade reagent.
  • Atglistatin and CAY10499 which are lipolytic enzyme inhibitors
  • bronchiole epithelial cells of the experimental group treated with the drug after virus inoculation compared to mice of the untreated virus inoculated group.
  • Viral antigens were significantly reduced, but the number of fatty acids was not significantly reduced.
  • the fixed tissue was dehydrated with graded alcohol, infiltrated with xylene, and paraffin-embedded, and then cut into 3 ⁇ m.
  • Tissue sections were deparaffinized through xylene and rehydrated through washing with alcohol and water. The rehydrated sections were stained with Hematoxylin & Eosin, dehydrated with graded alcohol, polymerized and sealed with xylene, and histologically examined under an optical microscope.
  • influenza A virus antigen in the lung tissue, 3 ⁇ m tissue sections were deparaffinized, washed and rehydrated, and then placed in 1 mM citrate at pH 6.0 and autoclaved.
  • Influenza A virus virions purchased from Virostat (Portland, ME, USA) after treating endogenous peroxidase with 3% hydrogen peroxide (H 2 O 2 ) through antigen retrieval by ) and blocking with 5% BSA. The primary antibody against (virion) was incubated at 4°C for 16 hours. The next day, after washing with phosphate buffer, a secondary antibody against HRP-conjugated Goat IgG (H+L) was reacted at 20° C. for one hour, and color was developed with DAB.
  • H+L HRP-conjugated Goat IgG
  • Atglistatin and CAY10499 which are lipolytic enzyme inhibitors
  • atglistatin and CAY10499 which are lipolytic enzyme inhibitors
  • interstitial pneumonia in mice in the experimental group treated with the drug after virus inoculation compared to mice in the untreated virus inoculation group.
  • Lung lesions and virus-positive cells, including were alleviated and reduced by the two drugs, and atglistatin was particularly effective compared to CAY10499.
  • Atglistatin and CAY10499 lipolytic enzyme inhibitors, were effective in protecting mice infected with influenza A virus, and when atglistatin and CAY10499 were administered at 10 mg kg -1 day -1 , survival rate compared to the control group showing 100% mortality increased to 62.5% and 50%, respectively.
  • atglistatin showed higher virus inhibition than CAY10499.
  • Experimental Example 8 Severity of pneumonia, viral growth, weight loss and lesion improvement effect in hamsters infected with SARS-CoV-2 by administration of atglistatin, a lipolysis inhibitor
  • hamsters were vaccinated and untreated as follows (No virus + vehicle), SARS coronavirus type 2 KCDC03 inoculated and untreated group (SARS-CoV-2 + vehicle), and SARS.
  • Coronavirus type 2 KCDC03 weeks inoculation and 20 mg/kg/day atglistatin treatment group SARS-CoV-2 + atglistatin (20 mg kg -1 day -1 )
  • SARS coronavirus type 2 KCDC03 weeks inoculation and 40 mg/kg /day atglistatin treatment group SARS-CoV-2 + atglistatin (40 mg kg -1 day -1 )
  • SARS coronavirus type 2 KCDC03 week inoculation and 80 mg/kg/day atglistatin treatment group SARS-CoV-2 +
  • a total of 5 experimental groups including atglistatin (80 mg kg -1 day -1 )) were made.
  • five 12-week-old female golden Syrian hamsters were placed, and the hamsters were moored for 1 week under the above-described conditions, and then the experiment was conducted at 13 weeks of age (FIG. 12a).
  • Inoculation of SARS coronavirus type 2 KCDC03 strain was inoculated by intratracheal administration at 100,000 TCID 50 per hamster in anesthetized hamsters in the same manner as in the above experiment, and in the case of virus non-inoculation, only phosphate buffer was inoculated. While observing for 5 days thereafter, survival rate, body weight, clinical symptoms, etc. were observed and recorded every day.
  • Drug treatment was administered by intraperitoneal injection using a syringe at 400 ⁇ L twice a day at the same time every morning/afternoon at 12 hour intervals, starting immediately after SARS coronavirus type 2 inoculation, for a total of 4.5 days.
  • a mixture of drug diluting solvent DMSO/40% PEG/H2O was administered intraperitoneally.
  • An autopsy was performed on the 5th day of infection. First, the entire lung tissue was photographed with a camera, and the left lobe of the extracted lung was fixed in 4% paraformaldehyde for one week at 4°C for histopathological analysis and frozen sections, and the right anterior lobe , Mesenchyme, posterior lobe and epitaxial lobe were all mixed and chopped and used to evaluate free fatty acids and glycerol in the cytoplasm, number of viral genomes, and progeny viruses.
  • Real-time PCR was performed on the SARS coronavirus type 2 nucleocapsid gene and the ⁇ -actin gene of the host to determine the number of viral genes to evaluate the drug's inhibitory effect on viral genes.
  • hamster lung tissue was added to beads and a lung tissue emulsion was prepared using a Precellys 23 instrument homogenizer purchased from Bertin Technologies (Montigny-le-Bretonneux, France). Then, the supernatant was collected by centrifugation. The obtained supernatant was serially diluted, inoculated into Vero E6 cells cultured in a monolayer in a 96-well plate as described above, and cultured for 12 hours, followed by cell culture immunofluorescence using an antibody against SARS coronavirus type 2 nucleocapsid. An antibody method was performed to evaluate the effect of each drug on inhibiting progeny virus growth.
  • adiposity and SARS coronavirus type 2 antigen in the lung tissue 3 ⁇ m frozen sections were made with the fixed tissue. After blocking with 5% BSA, the primary antibody against the SARS coronavirus type 2 spike antigen was incubated at 4°C for 16 hours, and the AF594-conjugated mouse IgG (H+L) secondary antibody was reacted at 20°C for 1 hour. After washing the tissue sections with phosphate buffer, they were reacted with 10 ⁇ M BODIPY at 20 °C for 15 minutes for local staining, and after washing, nuclear staining and mounting were performed using Slow-Fade Gold antifade reagent.
  • Atglistatin a lipolytic enzyme inhibitor
  • SARS coronavirus type 2 alveolar epithelial cells of hamsters in the experimental group treated with the drug after virus inoculation compared to hamsters in the untreated virus inoculated group.
  • Viral antigens were significantly reduced in , but the number of fatty acids was not significantly reduced.
  • the fixed tissue was dehydrated with graded alcohol, infiltrated with xylene, and paraffin-embedded, and then cut into 3 ⁇ m.
  • Tissue sections were deparaffinized through xylene, and rehydrated through washing with various alcohols. The rehydrated sections were stained with Hematoxylin & Eosin, dehydrated with graded alcohol, polymerized and sealed with xylene, and histologically examined under an optical microscope.
  • Atglistatin a lipolytic enzyme inhibitor
  • SARS coronavirus type 2 SARS coronavirus type 2
  • pneumonia severity was improved by 73%. This is attributable to the fact that atglistatin inhibits the degradation of lipids and the production of free fatty acids, thereby suppressing viral proliferation.
  • Experimental Example 9 Survival rate, weight loss, clinical symptoms, viral proliferation and lesion improvement effect of infected mice by single or combined administration of atglistatin and influenza A virus (IAV) antiviral agent and SARS coronavirus type 2 (SARS-CoV-2 ) Pneumonia improvement rate, virus proliferation, weight loss and lesion improvement effect of infected hamsters according to single or combined administration of antiviral drugs
  • IAV influenza A virus
  • SARS-CoV-2 SARS coronavirus type 2
  • mice were inoculated and untreated (No virus + vehicle), and inoculated with influenza A virus PR8 strain and untreated (IAV + vehicle).
  • influenza A total of 5 experimental groups were created, including inoculation with PR8 strains of A virus and treatment groups with 2 mg/kg/day oseltamivir and 5 mg/kg/day atglistatin (IAV + oseltamivir + atglistatin).
  • IAV + oseltamivir influenza A virus PR8 week inoculation and 2 mg/kg/day oseltamivir treatment group
  • IAV + atglistatin influenza A total of 5 experimental groups were created, including inoculation with PR8 strains of A virus and treatment groups with 2 mg/kg/day oseltamivir and 5 mg/kg/day atglistatin (IAV + oseltamivir + atglistatin).
  • 16 7-week-old female wild-type C57BL/6J mice were placed, and the mice were moored under the above-described conditions for 1 week, and then experiments were
  • Influenza A virus inoculation was inoculated intranasally with 1,000 PFU per mouse in anesthetized mice in the same manner as in the above experiment, and in the case of non-virus inoculation, only phosphate buffer was inoculated. After observing for 15 days, survival rate, body weight, clinical symptoms, etc. were observed and recorded daily, and mice showing severe weight loss (30% or more) were euthanized and recorded as dead due to viral infection.
  • Oseltamivir drug treatment was administered orally by oral administration using 100 ⁇ L for a total of 4 days, twice a day at the same time every morning/afternoon 12 hours apart, immediately after influenza A virus inoculation, and atglistatin drug treatment was From 2 days after influenza A virus inoculation, inoculation was performed by intraperitoneal injection using a syringe at 100 ⁇ L twice a day at 12-hour intervals in the morning/afternoon every day for a total of 4 days.
  • the drug diluting solvent DMSO/40% PEG/H 2 O mixture was administered intraperitoneally (FIG. 13a).
  • Mortality was measured every day for 15 days based on the survival rate of 100% and mortality rate of 0% on the 0th day of infection, and the survival rate was compared with the virus inoculated and untreated groups. Statistical significance was analyzed by the Log Rank Test, and significance was evaluated when the p value was 0.05 or higher.
  • SARS coronavirus type 2 KCDC03 lineage A lineage
  • KDCA51463 lineage Alpha lineage
  • KDCA55905 lineage Beta lineage
  • Remdesivir and atglistatin drug treatment is administered by intraperitoneal injection using a syringe at 400 ⁇ L for a total of 4.5 days, twice a day at the same time every morning/afternoon 12 hours apart, immediately after SARS coronavirus type 2 inoculation. Inoculated.
  • a drug diluting solvent DMSO/40% PEG/H 2 O mixture was administered intraperitoneally.
  • An autopsy was performed on the 5th day of infection. First, the entire lung tissue was photographed with a camera, and the left lobe of the extracted lung was fixed in 4% paraformaldehyde for one week at 4°C for histopathological analysis and frozen sections, and the right anterior lobe , Mesenchyme, posterior lobe and epitaxial lobe were all mixed and chopped and used to evaluate free fatty acids and glycerol in the cytoplasm, number of viral genomes, and progeny viruses.
  • Atglistatin a lipolytic enzyme inhibitor
  • oseltamivir compared to oseltamivir alone in influenza A virus infection
  • SARS coronavirus including several mutant strains.
  • type 2 infections the combined administration with remdesivir showed a more significant SARS coronavirus type 2 infection treatment effect than remdesivir alone.
  • CAY10499 an inhibitor of hormone-sensitive lipase (HSL), was purchased from Cayman Chemicals (Ann Arbor, Michigan, USA), and Atglistatin, an inhibitor of adipose triglyceride lipase (ATGL), was obtained from MedChemExpress (Monmouth Junction, NJ, USA).
  • the synthesized reaction intermediate was injected into a new reaction vessel without separate separation and purification to prepare for the next reaction.
  • N,N-dialkylcarbamic chloride or N,N-diarylcarbamic chloride (2.0 mmol) was mixed with 5.0 mL pyridine and the solution was stirred at 40°C for 4 hours.
  • Water was injected into the reaction mixture, and the organic matter was extracted with an ethyl acetate solvent and then concentrated. Derivative compounds were separated from the concentrated reaction mixture using column chromatography filled with silica gel.
  • DABPU-DPh is an abbreviation for 3-(4'-dimethylamino)-(1,1'-biphenyl)-3-yl)-1,1-diphenylurea.
  • the analytical data of the product are as follows.
  • N-(4'-dimethylamino)-(1,1'-biphenyl)-3-yl)pyrrolidine-1-carboxamide N-(4'-(Dimethylamino)-[1,1' Synthesis of -biphenyl]-3-yl)pyrrolidine-1-carboxamide: [DABPU-Pyrrol])
  • SARS coronavirus type 2 SARS coronavirus type 2 (SARS-CoV-2), influenza A virus (IAV), bovine coronavirus (BCoV), pig by DABPU-EM and DABPU-DE, which are derivatives of atglistatin (DABPU-DM) Inhibiting the proliferation of epidemic diarrhea coronavirus (PEDV), bovine rotavirus (RVA), porcine reproductive and respiratory syndrome virus (PRRSV) and porcine sapovirus (PSaV)
  • DABPU-DM atglistatin
  • PEDV epidemic diarrhea coronavirus
  • RVA bovine rotavirus
  • PRRSV porcine reproductive and respiratory syndrome virus
  • PSaV porcine sapovirus
  • CAY10499 and Atglistatin to verify the antiviral effect of lipolytic enzyme inhibition in SARS coronavirus type 2 influenza A virus, bovine coronavirus, porcine epidemic diarrhea coronavirus, bovine rotavirus, porcine reproductive and respiratory syndrome virus, and porcine sapovirus were prepared at concentrations of 1 mM, 10 mM and 20 mM using DMSO as a solvent.
  • SARS coronavirus type 2 KCDC03 strain with a multiplicity of infection of 0.1 ffu/cell was inoculated into Vero E6 cells cultured in a monolayer in a 6-well plate and an 8-well chamber. After incubating the virus at 37°C for 18 hours, the medium was replaced with a medium containing DABPU-EM or DABPU-DE at a final concentration of 1 ⁇ M, 10 ⁇ M, or 20 ⁇ M, and after further incubation for 18 hours, Vero in a 6-well plate E6 cells were washed with phosphate buffer, scraped with a scraper, and then centrifuged to make cell pellets.
  • the cell pellet was subjected to Western blotting according to the above method, and the amount of SARS coronavirus type 2 spike protein detected compared to beta actin, which is an internal control of host cells, was evaluated by calculating the amount of positive signal with ImageJ.
  • Vero E6 cells in an 8-well chamber were washed with phosphate buffer, fixed with 4% paraformaldehyde, and then subjected to immunofluorescence staining for SARS coronavirus type 2 spike protein as described above.
  • A549 cells cultured in a monolayer in a 6-well plate and an 8-well chamber were inoculated with influenza A virus PR8 strain having a multiplicity of infection of 0.1 ffu/cell. After incubating the virus at 37°C for 12 hours, the medium was replaced with a medium containing DABPU-EM or DABPU-DE at a final concentration of 1 ⁇ M, 10 ⁇ M, or 20 ⁇ M, and after further incubation for 12 hours, A549 in a 6-well plate Cells were washed with phosphate buffer, scraped with a scraper, and then centrifuged to make cell pellets.
  • the cell pellet was subjected to Western blotting according to the above method, and the amount of influenza A virus M2 protein detected relative to beta actin, which is an internal control of host cells, was evaluated by calculating the amount of positive signal with ImageJ.
  • A549 cells in an 8-well chamber were washed with phosphate buffer, fixed with 4% paraformaldehyde, and immunofluorescent staining for influenza A virus M2 protein was performed as described above.
  • HRT-18G cells cultured in a monolayer in a 6-well plate and an 8-well chamber were inoculated with bovine coronavirus KWD20 strain with a multiplicity of infection of 0.1 ffu/cell. After incubating the virus at 37°C for 18 hours, the medium was replaced with a medium containing DABPU-EM or DABPU-DE at a final concentration of 1 ⁇ M, 10 ⁇ M, or 20 ⁇ M, and after further incubation for 18 hours, HRT in a 6-well plate -18G cells were washed with phosphate buffer, scraped with a scraper, and then centrifuged to make cell pellets.
  • the cell pellet was subjected to Western blotting according to the above method, and the amount of detected bovine coronavirus spike protein compared to beta actin, which is an internal control of host cells, was evaluated by calculating the amount of positive signal with ImageJ.
  • HRT-18G cells in an 8-well chamber were washed with phosphate buffer, fixed with 4% paraformaldehyde, and immunofluorescence staining for spike protein was performed on bovine coronavirus KWD20 strain as described above.
  • Vero E6 cells cultured in monolayers in 6-well plates and 8-well chambers were inoculated with porcine epidemic diarrhea coronavirus strain QIAP1401 with a multiplicity of infection of 0.1 ffu/cell. After incubating the virus at 37°C for 18 hours, the medium was replaced with a medium containing DABPU-EM or DABPU-DE at a final concentration of 1 ⁇ M, 10 ⁇ M, or 20 ⁇ M, and after further incubation for 18 hours, Vero in a 6-well plate E6 cells were washed with phosphate buffer, scraped with a scraper, and then centrifuged to make cell pellets.
  • the cell pellet was subjected to Western blotting according to the above method, and the amount of porcine epidemic diarrhea coronavirus nucleocapsid protein detected compared to beta actin, which is an internal control of host cells, was evaluated by calculating the amount of positive signal with ImageJ.
  • the Vero E6 cells in the 8-well chamber were washed with phosphate buffer, fixed with 4% paraformaldehyde, and immunofluorescence staining for porcine epidemic diarrhea coronavirus nucleocapsid protein was performed as described above.
  • MA104 cells cultured as a monolayer in a 6-well plate and an 8-well chamber were inoculated with a bovine rotavirus NCDV strain with a multiplicity of infection of 0.1 ffu/cell. After incubating the virus at 37°C for 12 hours, the medium was replaced with a medium containing DABPU-EM or DABPU-DE at a final concentration of 1 ⁇ M, 10 ⁇ M, or 20 ⁇ M, and after further incubation for 12 hours, MA104 in a 6-well plate Cells were washed with phosphate buffer, scraped with a scraper, and then centrifuged to make cell pellets.
  • the cell pellet was subjected to Western blotting according to the above method, and the amount of detected bovine rotavirus VP6 protein compared to beta actin, which is an internal control of host cells, was evaluated by calculating the amount of positive signal with ImageJ.
  • MA104 cells in an 8-well chamber were washed with phosphate buffer and fixed with 4% paraformaldehyde, followed by immunofluorescence staining for bovine rotavirus VP6 protein as described above.
  • MARC-145 cells cultured in monolayers in 6-well plates and 8-well chambers were inoculated with porcine reproductive and respiratory syndrome virus strain LMY with a multiplicity of infection of 0.1 ffu/cell. After incubating the virus at 37°C for 24 hours, the medium was replaced with a medium containing DABPU-EM or DABPU-DE at a final concentration of 1 ⁇ M, 10 ⁇ M, or 20 ⁇ M, and after further incubation for 24 hours, MARC in a 6-well plate -145 cells were washed with phosphate buffer, scraped with a scraper, and then centrifuged to make cell pellets.
  • the cell pellet was subjected to Western blotting according to the above method, and the amount of porcine reproductive and respiratory syndrome virus matrix protein detected relative to beta actin, which is an internal control of host cells, was evaluated by calculating the amount of positive signal with ImageJ.
  • MARC-145 cells in an 8-well chamber were washed with phosphate buffer, fixed with 4% paraformaldehyde, and then subjected to immunofluorescence staining for porcine reproductive and respiratory syndrome virus matrix protein as described above.
  • LLC-PK cells monolayer cultured in 6-well plates and 8-well chambers were inoculated with Cowden strain from porcine sapovirus with a multiplicity of infection of 0.1 ffu/cell. After incubating the virus at 37°C for 24 hours, the medium was replaced with a medium containing DABPU-EM or DABPU-DE at a final concentration of 1 ⁇ M, 10 ⁇ M, or 20 ⁇ M, and after further incubation for 18 hours, LLC in a 6-well plate -PK cells were washed with phosphate buffer, scraped with a scraper, and then centrifuged to make cell pellets.
  • the cell pellet was subjected to Western blotting according to the above method, and the amount of porcine sapovirus VPg protein detected compared to beta actin, which is an internal control of host cells, was evaluated by calculating the amount of positive signal with ImageJ.
  • the LLC-PK cells in the 8-well chamber were washed with phosphate buffer and fixed with 4% paraformaldehyde, followed by immunofluorescence staining for porcine sapovirus VPg protein as described above.
  • DABPU-EM and DABPU-DE which are derivatives of atglistatin (DABPU-DM), a lipolytic enzyme inhibitor, half maximum inhibitory concentration of viruses for lipolytic enzyme inhibitors, and selectivity index
  • Atglistatin derivatives DABPU-EM and DABPU-DE half maximal cytotoxic concentration (CC50) Cell line CC 50 ( ⁇ M) DABPU-EM DABPU-DE A549 206.3 213.3 Vero E6 209.7 222.2 HRT18G 186.1 177.4 MA104 223.3 208.8 MARC 209.7 216.5 LLC-PK 231.2 225.5
  • the half-maximal cytotoxic concentration of DABPU-EM in A549, Vero E6, MDCK, HRT18G, MA04, MARC, and LLC-PK cells was as high as 186.1 to 231.2.
  • A549 from DABPU-DE The half-maximal cytotoxic concentration in Vero E6, MDCK, HRT18G, MA04, MARC, and LLC-PK cells was high, ranging from 177.4 to 225.5, but slightly lower than that of DABPU-EM.
  • DABPU-EM and DABPU-DE derivatives of atglistatin, half maximal inhibitory concentration and selectivity index Virus family Virus (strain) IC 50 ( ⁇ M) SI (CC 50 /IC 50 ) a DABPU-EM DABPU-DE DABPU-EM DABPU-DE Orthomyxoviridae Influenza A virus (H1N1) (PR8) 1.63 1.03 127 207 Coronaviridae SARS-CoV-2 (KCDC03) 1.71 1.20 122 185 Coronaviridae Bovine coronavirus (KWD20) 3.44 1.12 54 158 Coronaviridae Porcine epidemic diarrhea coronavirus (QIAP1401) 1.94 1.62 108 128 Reoviridae Species A Rotavirus (NCDV) 7.08 5.22 32 36 Arteriviridae Porcine respiratory reproductive syndrome virus (LMY) 2.70 2.29 78 95 Caliciviridae Porcine sapovirus (Cowden) 3.70 2.77 62 81
  • the half maximum inhibitory concentrations of DABPU-EM were 1.63 to 7.08, and that of DABPU-DE were 1.03 to 5.22.
  • DABPU-EM was 1.63 and 1.71
  • DABPU-DE was 1.03 and 1.20 for influenza A virus and SARS coronavirus type 2, which cause enormous damage worldwide. This means that DABPU-EM and DABPU-DE have high inhibitory abilities against influenza A virus and SARS coronavirus type 2 even at low concentrations.
  • DABPU-EM was effective against cytotoxicity against SARS coronavirus type 2 KCDC03 strain, influenza A virus PR8 strain, bovine coronavirus KWD20 strain, porcine epidemic diarrhea coronavirus QIAP1401 strain, bovine rotavirus NCDV strain, and porcine genital respiratory syndrome.
  • Virus LMY strain and porcine sapovirus Cowden strain were inhibited, and the selection indices (SI) for each virus were 122, 127, 54, 108, 32, 78, and 62.
  • SARS coronavirus type 2 KCDC03 strain influenza A virus PR8 strain, bovine coronavirus KWD20 strain, porcine epidemic diarrhea coronavirus QIAP1401 strain, bovine rotavirus NCDV strain, and porcine reproductive and respiratory syndrome virus LMY strain were efficiently compared to DABPU-DE cytotoxicity.
  • each culture medium was added to the plate infected with SARS coronavirus type 2. 18 hours for plates infected with influenza A virus, 12 hours for plates infected with bovine coronavirus, 18 hours for plates infected with porcine epidemic diarrhea coronavirus, 12 hours for plates infected with bovine rotavirus, 12 hours for porcine reproductive and respiratory syndrome virus Infected plates were further incubated for 18 hours, and plates infected with porcine sapovirus were further incubated for 18 hours.
  • DABPU-EM and DABPU-DE significantly and concentration-dependently reduced the number of genomes and progeny virus production of each virus at all concentrations of 1, 10, and 20 ⁇ M. Therefore, it was confirmed that there is a wide range of antiviral effects in various RNA viruses by using lipolytic enzyme inhibitors.
  • Atglistatin derivatives DABPU-EM and DABPU-DE
  • administration of atglistatin derivatives, DABPU-EM and DABPU-DE, to mice infected with influenza A virus improved survival rate, weight loss, and clinical symptoms in a concentration-dependent manner.
  • DABPU-DM 5 mg kg -1 day -1 atglistatin
  • 50% survival rate in the 10 mg kg -1 day -1 DABPU-EM experimental group, 5 mg kg -1 day -1 and 10 mg kg -1 day -1 DABPU-DE experimental group showed 68.8% improvement in survival rate.
  • DABPU-DE showed a better therapeutic effect than atglistatin (DABPU-DM) in influenza A virus infection.
  • mice in the experimental group treated with the drug after virus inoculation were compared to mice in the untreated virus inoculation group.
  • Viral antigens were significantly reduced in bronchiole epithelial cells, but the number of fatty droplets was not significantly decreased.
  • the tissue fixed for histopathological analysis in the lung tissue was dehydrated through graded alcohol, infiltrated with xylene, and paraffin encapsulated in the same manner as in Experimental Example 7, and then cut into 3 ⁇ m and histologically examined under an optical microscope. performed.
  • mice in the experimental group treated with the drug after virus inoculation were compared to mice in the untreated virus inoculation group.
  • lung lesions including interstitial pneumonia and number of virus-positive cells were alleviated and reduced by the two drugs, and DABPU-DE was particularly effective compared to DABPU-DE.
  • Atglistatin derivatives DABPU-EM and DABPU-DE, were effective in protecting mice infected with influenza A virus, and when administered with 10 mg kg -1 day -1 of DABPU-EM and DABPU-DE, mortality was 100%. The survival rates increased to 50% and 68.8%, compared to the control group. In particular, DABPU-DE showed higher virus inhibition than DABPU-EM.
  • Experimental Example 15 Pneumonia severity, virus growth, weight loss and lungs in hamsters infected with SARS-CoV-2 by administration of DABPU-DE, a derivative of atglistatin (DABPU-DM), a lipolytic enzyme inhibitor lesion improvement effect
  • hamsters were grouped as follows: no virus inoculation and no treatment group (No virus + vehicle), SARS coronavirus type 2 KCDC03 inoculation and no treatment group (SARS -CoV-2 + vehicle), SARS coronavirus type 2 KCDC03 week inoculation and 40 mg/kg/day atglistatin (DABPU-DM) treatment group (SARS-CoV-2 + DM (40 mg kg -1 day -1 )) , SARS coronavirus type 2 KCDC03 weeks vaccination and 20 mg/kg/day DABPU-DE treatment group (SARS-CoV-2 + DE (40 mg kg -1 day -1 )), SARS coronavirus type 2 KCDC03 weeks vaccination and 40 mg/kg/day DABPU-DE treatment group (SARS-CoV-2 + DE (40 mg kg -1 day -1 )), SARS coronavirus type 2 KCDC03 weeks vaccination and 40 mg/kg/day DABPU-DE treatment group (SARS-CoV-2 + DE (40 mg kg -1
  • Atglistatin (DABPU-DM) and the atglistatin derivative, DABPU-DE were effective in protecting hamsters infected with SARS coronavirus type 2, especially in the experimental group administered with 80 mg kg -1 day -1 DABPU-DE.
  • the % pneumonia severity improvement rate was shown, and the pneumonia severity improvement rate was superior to that of the experimental group administered with 80 mg kg -1 day -1 atglistatin (DABPU-DM).
  • the experimental group administered with 80 mg kg -1 day -1 DABPU-DE had lower free fatty acid and glycerol contents in lung tissue than the experimental group administered with 80 mg kg -1 day -1 atglistatin (DABPU-DM).
  • Atglistatin inhibits the generation of free fatty acids by inhibiting the decomposition of lipid droplets, thereby inhibiting viral proliferation, indicating that DABPU-DE has a greater inhibitory effect than atglistatin (DABPU-DM).
  • Experimental Example 16 Survival rate, weight loss, clinical symptoms, virus proliferation and lesion improvement effect of infected mice according to single or combined administration of DABPU-DE and influenza A virus (IAV) antiviral agent and SARS coronavirus type 2 (SARS-CoV -2) Pneumonia improvement rate, virus growth, weight loss and lesion improvement effect in infected hamsters according to single or combined administration of antiviral drugs
  • IAV influenza A virus
  • SARS-CoV -2 SARS coronavirus type 2
  • DABPU-DE a derivative of atglistatin (DABPU-DM), and oseltamivir, an antiviral agent, in animals infected with influenza A virus
  • 150 mg/ml DABPU-DE in DMSO was dissolved in, and 10 mg/ml oseltamivir was dissolved in H 2 O.
  • DMSO:40% PEG:H 2 O was diluted 1:4:5 as a solvent, respectively. mixture or H 2 O was used.
  • the final concentrations were 5 mg kg -1 day -1 DABPU-DE and 2 mg kg -1 day -1 oseltamivir, respectively (FIG. 20a).
  • mice were inoculated and untreated (No virus (+ vehicle)), inoculated with influenza A virus PR8 strain and untreated ( IAV + vehicle), influenza A virus PR8 week inoculation and 2 mg/kg/day oseltamivir treatment group (IAV + oseltamivir), influenza A virus PR8 week vaccination and 5 mg/kg/day DABPU-DE treatment group (IAV + DE), influenza A virus PR8 strain inoculation, and 2 mg/kg/day oseltamivir and 5 mg/kg/day DABPU-DE treatment group (IAV + oseltamivir + DE).
  • IAV + oseltamivir + DE In each group, 16 7-week-old female wild-type C57BL/6J mice were placed, and the mice were moored under the conditions described above for 1 week, and then the experiment was conducted in the same manner as in Experimental Example 9.
  • DABPU-DE a lipolytic enzyme inhibitor
  • oseltamivir compared to oseltamivir alone in influenza A virus infection
  • remdesivir showed a more significant SARS coronavirus type 2 infection treatment effect than remdesivir alone.
  • the experimental group administered with 40 mg kg -1 day -1 DABPU-DE alone had all SARS coronavirus type 2 infections compared to the experimental group administered with 40 mg kg -1 day -1 atglistatin alone.
  • Pneumonia severity was further improved.
  • the experimental group in which 40 mg kg -1 day -1 DABPU-DE and remdesivir were administered in combination showed all SARS coronavirus type 2 infections compared to the experimental group in which 40 mg kg -1 day -1 atglistatin and remdesivir were administered in combination.
  • the severity of pneumonia was further improved.
  • SARS coronavirus type 2 KCDC03 strain Lineage A
  • SARS coronavirus type 2 KDCA51463 strain Alpha lineage, British variant
  • SARS coronavirus type 2 KDCA55905 strain Beta lineage, South African variant
  • influenza A virus infected PR8 strain To verify the antiviral effect of DABPU-DE, a derivative of atglistatin (DABPU-DM), in human-derived cultured cells, atglistatin (DABPU-DM), DABPU-EM, and DABPU-DE were dissolved in DMSO, and 1, 10, 20 mM DABPU-DM, DABPU-EM and DABPU-DE were prepared. Then, the mixture was diluted in a culture medium to have final concentrations of 1, 10, and 20 ⁇ M DABPU-DM, DABPU-EM, and DABPU-DE, respectively.
  • SARS coronavirus type 2 KCDC03 strain SARS coronavirus type 2 KDCA51463 strain, and SARS coronavirus type 2 KDCA51463 strain with a multiplicity of infection of 0.01 ffu/cell were added to Vero E6 cells cultured in a monolayer in a 12-well plate.
  • 2 KDCA55905 strains were inoculated and the virus was adsorbed to the cells in a 37°C CO 2 incubator for 1 hour.
  • TPCK-treated trypsin 100 u/ml penicillin, and 100 ug/ml streptomycin were added to DMEM, followed by incubation in a 37°C CO 2 incubator for 18 hours. Then, each well was washed three times with phosphate buffered saline, and then replaced with a medium containing 20 ⁇ M DABPU-DM, DABPU-EM or DABPU-DE at a final concentration.
  • the DABPU-DM, DABPU-EM or DABPU-DE treatment group significantly increased the number of viral genes compared to the vehicle treatment group. reduced to
  • influenza A virus PR8 strain with a multiplicity of infection of 0.01 ffu/cell was applied to MRC-5 cells, NCI-H293 cells, WI-38 cells and Calu-3 cells cultured in a monolayer in a 12-well plate. After inoculation, the virus was adsorbed to the cells in a 37°C CO 2 incubator for 1 hour. After washing with phosphate buffer, 1 ⁇ g/ml TPCK-treated trypsin, 100 u/ml penicillin, and 100 ug/ml streptomycin were added to DMEM, followed by incubation in a 37°C CO 2 incubator for 12 hours.
  • each well was washed three times with phosphate-buffered saline and then replaced with a medium containing DABPU-DM, DABPU-EM or DABPU-DE at final concentrations of 1, 10, or 20 ⁇ M. After additional 12 hours of culture, the medium supernatant was used in a cell culture plaque assay to measure the number of progeny viruses, and RNA was extracted in the same manner as in Experimental Example 4 to measure the number of viral genes.
  • DABPU-DM, DABPU-EM or DABPU-3 cells in MRC-5 cells, NCI-H293 cells, WI-38 cells, and Calu-3 cells, which are human-derived cultured cells infected with influenza A virus.
  • the DE-treated group significantly reduced the number of viral genes and progeny viruses compared to the vehicle-treated group.
  • atglistatin (DABPU-DM) as well as its derivatives, DABPU-DE and DABPU-EM, can be used as therapeutic agents for influenza A virus infections occurring in humans.
  • Atglistatin (DABPU-DM) and its derivatives, DABPU-EM or DABPU-DE inhibit the growth of infected SARS coronavirus type 2 and influenza A viruses in various human-derived cultured cells.
  • atglistatin (DABPU-DM) and its derivatives, DABPU-EM or DABPU-DE can be used as therapeutic agents to treat SARS-CoV type 2 and influenza A virus infections in humans.
  • the present invention relates to a pharmaceutical composition for preventing or treating RNA virus infection comprising a lipolytic enzyme inhibitor, and more particularly, to a pharmaceutical composition for RNA virus infection comprising a derivative of an adipose triglyceride lipase (ATGL) inhibitor. It relates to a pharmaceutical composition for prevention or treatment.
  • a pharmaceutical composition for preventing or treating RNA virus infection comprising a lipolytic enzyme inhibitor
  • a pharmaceutical composition for RNA virus infection comprising a derivative of an adipose triglyceride lipase (ATGL) inhibitor. It relates to a pharmaceutical composition for prevention or treatment.
  • ATGL adipose triglyceride lipase

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

본 발명은 지방분해효소 억제제의 인체 및 동물용 광범위 RNA 바이러스 감염증 치료제에 관한 것으로서, 보다 구체적으로는 지방분해효소 억제제를 동물의 인플루엔자 A 바이러스 감염증, 소 코로나바이러스 감염증, 돼지 유행성 설사 코로나바이러스 감염증, 소 로타바이러스 감염증, 돼지 생식기 호흡기 증후군 바이러스 감염증 및 사포바이러스 감염증의 치료제로 사용할 수 있으며, 이 외에도 사스코로나바이러스 유형 1, 메르스코로나바이러스, 지카바이러스, 뎅기열 바이러스, 및 A형 및 C형 간염 바이러스 등 인간 및 동물에서 발생하는 다양한 RNA 바이러스 감염증 치료제로 활용할 수 있다.

Description

지방분해효소 억제제를 포함하는 RNA 바이러스 감염증 예방 또는 치료용 약제학적 조성물
본 발명은 과학기술정보통신부의 지원 하에서 과제고유번호 1711128903, 세부과제번호 2020R1A2B5B03002517에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 한국연구재단, 연구사업명은 "개인기초연구(과기정통부)(R&D)", 연구과제명은 "가축의 RNA 바이러스 감염에 유도된 숙주 핵수용체와 물질대사와의 상관관계 규명", 주관기관은 전남대학교, 연구기간은 2021.03.01~2022.02.28이다.
또한 본 발명은 과학기술정보통신부의 지원 하에서 과제고유번호 1711170603, 세부과제번호 KGM5242221에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 한국생명공학연구원, 연구사업명은 "한국생명공학연구원연구운영비지원(주요사업비)", 연구과제명은 "고부가가치 기능성 바이오소재 개발 및 사업화", 주관기관은 한국생명공학연구원, 연구기간은 2022.01.01~2022.12.31이다.
본 특허출원은 2021년 6월 25일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2021-0083385호 및 2022년 6월 23일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2022-0077063호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
본 발명은 지방분해효소 억제제를 포함하는 RNA 바이러스 감염증 예방 또는 치료용 약제학적 조성물에 관한 것으로서, 더욱 상세하게는 지방질 중성지방 지방분해효소(adipose triglyceride lipase; ATGL) 억제제의 유도체를 포함하는 RNA 바이러스 감염증 예방 또는 치료용 약제학적 조성물에 관한 것이다.
RNA 바이러스들은 인간과 동물에 다양한 질병을 일으킨다. 특히 최근 인간에서 발생하고 있는 사스코로나바이러스(severe acute respiratory syndrome coronavirus; SARS-CoV) 유형 1 및 유형 2(SARS-CoV-1, SARS-CoV-2), 메르스코로나바이러스(Middle East respiratory syndrome coronavirus, MERS-CoV), 인플루엔자 바이러스(influenza virus), 지카바이러스(Zika virus), 뎅기열 바이러스(dengue fever virus) 등은 모두 RNA 바이러스이다.
RNA 바이러스 유전자를 증폭하기 위해 사용하는 RNA 중합효소는 proof reading 기능이 없어, DNA 바이러스에 비해 RNA 바이러스 유전자의 돌연변이 비율이 매우 높다. 이로 인해 바이러스 단백질에 변이가 발생하여, 이를 표적으로 하는 치료제에 대한 저항성 바이러스들이 출현한다.
대표적인 예로는 인플루엔자 바이러스의 막 이온 채널 단백질(membrane ion channel protein)인 matrix-2(M2) 단백질 차단제인 아다만탄(adamantane) 유도체에 대하여 H3N2 인플루엔자 바이러스 93%가 저항성을 보이고 있으며, 바이러스 뉴라미니다아제 차단제인 오셀타미비르(oseltamivir)에 대한 저항성도 증가하고 있다.
인플루엔자, 사스, 메르스, 에볼라, 지카 등 전 세계적으로 인수공통 바이러스 감염병들에 의해 인류의 건강이 크게 위협받고 막대한 사회경제적 피해가 유발되고 있다. 세계 항바이러스 시장규모는 2018년 361억 달러에서 2026년 약 442억 달러로 연평균 3.2%의 성장을 할 것으로 예상되고 있다.
인플루엔자의 경우에도 전 세계 시장규모는 2018년 8.6억 달러에서 2026년 약 11.2억 달러로 연평균 4.5%의 성장을 할 것으로 예상되고 있다. 코로나19(SARS-CoV-2에 의한 감염증)에 의한 전 세계 사망자 수가 623만명(‘22. 4. 30 기준)이며, 경제적 피해액만 매달 440조원(’20. 8. 1 기준) 손실이 발생하고, 2년간 지속 시 그 피해액만 1.4경 원을 넘어설 것으로 추산되고 있다. 또한, 바이러스성 인수공통감염병은 전 세계적으로 산업동물에도 막대한 경제적 피해를 일으키고 있는데, 특히 국내 발생 고병원성 조류인플루엔자는 2017년 3천만 마리 이상의 살처분과 1조원 이상의 경제적 피해를 일으켰다.
이들 원인체의 대부분은 RNA 바이러스로써 돌연변이가 쉽게 발생하여, 다양한 유전형 혹은 유전아형이 존재한다. 대표적인 예로서 코로나19의 경우도 최초 발병 이후 영국에서 알파 변이주(SARS-CoV-2 Alpha variant), 남아프리카 공화국에서 베타 변이주(SARS-CoV-2 Beta variant), 인도에서 델타 변이주(SARS-CoV-2 Detal variant), 남아프리카 공화국에서 오미크론 변이주(SARS-CoV-2 Omicron variant)가 발생하여, 현재 전 세계적으로 재확산되고 있다.
이에 최근 연구의 경향은 바이러스가 증식 시 필요한 세포의 인자를 표적으로 하는 치료제 개발이다.
이에 본 발명자들은 RNA 바이러스의 특성을 대표할 수 있는 바이러스들을 세포에 감염 시, 감염 초기부터 중기까지는 지방적(lipid droplet)이 증가한 후, 감염 후기에는 감소하는 것을 확인하였고, 지방분해 효소 중 ATGL 억제제인 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이메틸유레아(Atglistatin[DABPU-DM])가 CAY10499(Cayman Chemicals; CAS Number: 359714-55-9)에 비해 in vitro 및 in vivo에서 우수한 광범위 항바이러스 효능을 보이고, 특히 이의 유도체인 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아[DABPU-DE]가 더욱 우수한 광범위 항바이러스 효능을 발휘함을 확인하였다.
이에, 본 발명의 목적은 지방분해효소 억제제를 포함하는 RNA 바이러스 감염증 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 지방분해효소 억제제를 포함하는 항바이러스용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 지방분해효소 억제제의 RNA 바이러스 감염증 예방 또는 치료, 및 항바이러스 용도에 관한 것이다.
본 발명은 지방분해효소 억제제를 포함하는 RNA 바이러스 감염증 예방 또는 치료용 약제학적 조성물에 관한 것으로, 본 발명에 따른 조성물은 RNA 바이러스 감염증에 대한 예방 또는 치료 효과를 나타낸다.
본 발명자들은 RNA 바이러스의 특성을 대표할 수 있는 바이러스들을 세포에 감염 시, 지방분해효소 중 지방질 중성지방 지방분해효소(adipose triglyceride lipase; ATGL) 억제제인 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이메틸유레아(Atglistatin[DABPU-DM])가 지방질 중성지방 지방분해효소(adipose triglyceride lipase; ATGL), 호르몬 감수성 지방분해효소(hormone-sensitive lipase; HSL), 모노아실글리세롤 지방분해효소(monoacylglycerol lipase; MGL)을 비선택적(non-selective)으로 억제하는 CAY10499(Cayman Chemicals; CAS Number: 359714-55-9)에 비해 in vitro 및 in vivo에서 우수한 광범위 항바이러스 효능을 보이고, 특히 이의 유도체인 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아[DABPU-DE]가 더욱 우수한 광범위 항바이러스 효능을 발휘함을 확인하였다.
본 명세서상의 용어 “광범위 항바이러스 효능”이란 RNA 바이러스가 외막을 가지고 있는지 여부, 유전자가 양성 쇄(positive-sense), 음성 쇄(negative-sense) 혹은 이중 쇄(double-sense) 여부, 단일쇄(single stranded linear) 혹은 분절 쇄(segmented)에 상관없이 이러한 RNA 바이러스의 증식을 억제하는 것을 의미한다.
이하 본 발명을 더욱 자세히 설명하고자 한다.
본 발명의 일 양태는 지방분해효소 억제제를 포함하는 RNA 바이러스 감염증 예방 또는 치료용 약제학적 조성물이다.
본 발명에 있어서 상기 지방분해효소 억제제는 지방질 중성지방 지방분해효소(adipose triglyceride lipase; ATGL) 억제제, 호르몬 감수성 지방분해효소(hormone-sensitive lipase; HSL) 억제제, 및 모노아실글리세롤 지방분해효소(monoacylglycerol lipase, MGL) 억제제로 이루어진 군으로부터 선택되는 1종 이상인 것일 수 있다.
본 명세서상의 용어 “지방질 중성지방 지방분해효소”란 세포 내 지방분해효소로서 중성지방(triglyceride)을 유리지방산(free fatty acid)과 디글리세리드(diglyceride)로 가수분해하는 효소를 의미한다.
본 명세서상의 용어 “호르몬 감수성 지방분해효소”란 세포 내 중성 지방분해효소로서 디글리세리드(diglyceride)를 유리지방산(free fatty acid)과 모노글리세리드(monoglyceride)로 가수분해하는 효소를 의미한다.
본 명세서상의 용어 “모노아실글리세롤 지방분해효소(monoacylglycerol lipase, MGL)”란 세포 내 중성 지방분해효소로서 모노글리세리드(monoglyceride)를 유리지방산(free fatty acid)과 글리세롤(glycerol)로 가수분해하는 효소를 의미한다.
상기 ATGL 억제제는 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이메틸유레아(Atglistatin[DABPU-DM]) 및 이의 유도체인 것일 수 있다.
본 명세서상의 용어 “3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이메틸유레아(Atglistatin[DABPU-DM])”란 1-(4‘-다이메틸아미노)-[1,1’-바이페닐]-3-일-유레아를 기본골격으로 하여 유레아기의 한쪽 아민기가 다이메틸아민으로 결합된 화합물을 의미한다.
상기 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이메틸유레아(Atglistatin[DABPU-DM])의 유도체는 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아[DABPU-DE], 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1-에틸-1-메틸유레아[DABPU-EM], 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이페닐유레아[DABPU-DPh], N-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)피롤리딘-1-카르복스아마이드[DABPU-Pyrrol] 및 N-(4'-(다이메틸아미노)-(1,1‘-바이페닐)-3-일)모폴린-4-카르복스아마이드[DABPU-Morph]로 이루어진 군으로부터 선택되는 1종 이상인 것일 수 있고, 바람직하게는 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아[DABPU-DE] 또는 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1-에틸-1-메틸유레아[DABPU-EM]인 것일 수 있고, 예를 들어, 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아[DABPU-DE]인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서상의 용어 “3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아[DABPU-DE]”란 1-(4‘-다이메틸아미노)-[1,1’-바이페닐]-3-일-유레아를 기본골격으로 하여 atglistatin의 한쪽 유레아쪽 아민기가 다이메틸아민 대신 다이에틸아민으로 결합된 화합물을 의미한다.
본 명세서상의 용어 “3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1-에틸-1-메틸유레아[DABPU-EM]”란 1-(4‘-다이메틸아미노)-[1,1’-바이페닐]-3-일-유레아를 기본골격으로 하여 atglistatin의 한쪽 유레아쪽 아민기가 다이메틸아민 대신 에틸메틸아민으로 결합된 화합물을 의미한다.
본 명세서상의 용어 “3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이페닐유레아[DABPU-DPh]”란 1-(4‘-다이메틸아미노)-[1,1’-바이페닐]-3-일-유레아를 기본골격으로 하여 atglistatin의 한쪽 유레아쪽 아민기가 다이메틸아민 대신 다이페닐아민으로 결합된 화합물을 의미한다.
본 명세서상의 용어 “N-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)피롤리딘-1-카르복스아마이드[DABPU-Pyrrol]”란 1-(4‘-다이메틸아미노)-[1,1’-바이페닐]-3-일-유레아를 기본골격으로 하여 atglistatin의 한쪽 유레아쪽 아민기가 다이메틸아민 대신 피롤으로 결합된 화합물을 의미한다.
본 명세서상의 용어 “N-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)모폴린-4-카르복스아마이드[DABPU-Morph]”란 1-(4‘-다이메틸아미노)-[1,1’-바이페닐]-3-일-유레아를 기본골격으로 하여 atglistatin의 한쪽 유레아쪽 아민기가 다이메틸아민 대신 모포린으로 결합된 화합물을 의미한다.
상기 약제학적 조성물은 오셀타미비르(oseltamivir) 및 렘데시비르(remdesivir)로 이루어진 군으로부터 선택되는 1종 이상의 항바이러스제를 추가적으로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에서, 상기 약제학적 조성물은 지방분해효소 억제제 및 오셀타미비르를 2:2 내지 8:2의 부피비로 포함하는 것일 수 있고, 바람직하게는 3:2 내지 7:2의 부피비로 포함하는 것일 수 있고, 예를 들어, 4:2 내지 6:2의 부피비로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에서, 상기 약제학적 조성물은 지방분해효소 억제제 및 렘데시비르를 8:1 내지 20:1의 부피비로 포함하는 것일 수 있고, 바람직하게는 10:1 내지 18:1의 부피비로 포함하는 것일 수 있고, 예를 들어, 15:1 내지 16:1의 부피비로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 상기 RNA 바이러스는 사스코로나바이러스 유형 1 및 2(SARS Corona Virus; SARS-CoV-1, SARS-CoV-2), 인플루엔자 A 바이러스(influenza A virus; IAV), 소 코로나바이러스(bovine coronavirus; BCoV), 돼지 유행성 설사 코로나바이러스(porcine epidemic diarrhea coronavirus; PEDV), 소 로타바이러스(Bovine species A rotavirus; RVA), 돼지 생식기 호흡기 증후군 바이러스(porcine reproductive and respiratory syndrome virus; PRRSV), 돼지 사포바이러스(Porcine sapovirus; PSaV), 노로바이러스(norovirus), 고양이 전염성 복막염 코로나바이러스(feline infectious peritonitis virus; FIPV), 메르스코로나바이러스(MERS Corona Virus), 지카바이러스(Zika virus), 뎅기열 바이러스(dengue fever virus), 및 A형 및 C형 간염 바이러스(Hepatitis viruses)로 이루어진 군으로부터 선택되는 1종 이상인 것일 수 있다.
본 명세서상의 용어 “코로나바이러스(coronavirus)"란 Coronaviridae 과(family) 내의 Orthocoronavirinae 아과(subfamily)의 alpha-, beta-, gamma-, delta-coronavirus 4개의 속(genus)으로 분류된다. Alpha-coronavirus 속 내에는 돼지 유행성 설사 코로나바이러스, 고양이 전염성 복막염 바이러스 등이 있으며, beta-coronavirus 속 내에는 소 코로나바이러스(bovine coronavirus), 사스코로나바이러스 유형 1 및 2(SARS-CoV-1, SARS-CoV-2), 메르스코로나바이러스(MERS-CoV)가 있으며, gamma-coronavirus 속 내에는 닭 전염성 기관지염 바이러스가 있고, delta-coronavirus 속 내에는 인간, 돼지 등의 델타코로나바이러스가 속해 있다. 코로나바이러스는 80-120 nm크기로서 외막에는 spike가 박혀있으며, gamma-coronavirus 속 내 소 코로나바이러스 등에는 외막에 hemagglutinin/esterase 단백질 spike가 하나 더 박혀있다. 외막 내에는 양성쇄(positive-sense)의 단일 가닥 유전자(positive-sense, single-stranded RNA genome)가 들어있다.
본 명세서상의 용어 “인플루엔자 A 바이러스(influenza A virus)”란 Orthomyxoviridae 과(family) 내의 Alphainfluenzavirus 속(genus)의 바이러스로서 80~120 nm 크기의 바이러스이다. 바이러스는 외막 표면에는 혈구응집소(hemagglutinin)와 뉴라미다제(neuraminidase) spike가 외부를 향해 배열되어 있으며, 외막 내에는 8개의 분절(segment)화된 음성쇄 유전자 (negative-sense 8 segments of genome)가 들어있다. 인플루엔자 A 바이러스는 인간, 돼지, 말, 개 등의 포유류와 닭을 비롯하여 다양한 조류에 감염된다.
본 명세서상의 용어 “소 코로나바이러스(bovine coronavirus, BCoV)”란 국내는 물론 전 세계적으로 송아지 및 다 자란 소에 심한 설사를 일으키는 바이러스이다.
본 명세서상의 용어 “돼지 유행성 설사 코로나바이러스(porcine epidemic diarrhea virus, PEDV)”란 국내는 물론 전 세계적으로 전 연령에 걸쳐 설사를 일으키고, 포유자돈에 60% 이상의 폐사율을 일으키는 바이러스이다.
본 명세서상의 용어 “로타바이러스(rotavirus)”란 일반적으로 A 종 로타바이러스(species A rotavirus; RVA)를 의미하는 것이다. Reoviridae 과(family) 내의 Rotavirus 속(genus)에는 A, B, C, D, F, G, H, I, J 9개의 속이 있으며, 이 중 인간은 A종 로타바이러스에 주로 감염되고, A~I종 로타바이러스는 인간 외에도 다른 동물에서 발병하고, H형은 돼지, D, F, G형은 조류에, I형은 고양이, J형은 박쥐에서 감염이 보고되었다. 로타바이러스는 80 nm 크기의 3개의 캡시드 층 내에 11개의 분절(segment)화된 양쇄의 유전자(double-stranded 11 segments of genome)를 가지고 있다. 로타바이러스는 인간의 경우 5세 이하 영유아 및 어리 가축 설사의 주요 원인체이다.
본 명세서상의 용어 “돼지 생식기 호흡기 증후군 바이러스(porcine reproductive and respiratory syndrome virus; PRRSV)'란 Arteriviridae 과(family) 내의 Arterivirus 속(genus) 내의 바이러스로서, 유형 1(European type)과 유형 2(North American type)으로 분류된다. PRRSV는 50-60 nm 크기의 외막에 외막 단백질(envelope protein)과 당단백질 4(glycoprotein 4) spike가 박혀 있으며, 내부에 약 15 kb 길이의 양성(positive-sense)의 단일가닥의 유전자(single-stranded, positive-sense, RNA genome)가 들어있다. PRRSV는 임신돈에 유산, 사산 등 번식장애를 일으키고, 자돈 등에 간질성 폐렴을 일으킨다.
본 명세서상의 용어 “사포바이러스(sapovirus)"란 Caliciviridae 과(family) 내의 사포바이러스 속(genus Sapovirus)에 속하는 바이러스로서 인간, 돼지, 밍크에 설사를 일으키는 원인체이다.
본 명세서상의 용어 “고양이 전염성 복막염 바이러스(feline infectious peritonitis virus; FIPV)”란 고양이에 혈관염을 일으켜 심한 흉수 및 복수 등을 일으키거나, 신장 등 다양한 장기에 만성 육아종성 결절을 일으키는 바이러스 원인체이다.
본 명세서상의 용어 “칼리시바이러스(caliciviruses)”란 27~40 nm 크기의 캡시드 층 내에 선상(linear)의 양성 (positive sense)의 단일 가닥(single-stranded) RNA 유전체을 가지고 있는 칼리시바이러스과(Caliciviridae family) 내의 바이러스이다. 칼리시바이러스과 내에는 현재까지 Norovirus, Sapvorius, Vesivirus, Lagovirus, Nebovirus, Recovirus, Valovirus, Babovirus, Nacovirus, Salovirus, Minovirus와 같이 총 11개의 속(11 genera)이 있다.
본 발명의 다른 양태는 지방분해효소 억제제를 포함하는 항바이러스용 조성물이다.
본 발명에 있어서 상기 지방분해효소 억제제는 ATGL 억제제, HSL 억제제 및 MGL 억제제로 이루어진 군으로부터 선택되는 1종 이상인 것일 수 있다.
상기 ATGL 억제제는 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이메틸유레아(Atglistatin[DABPU-DM]) 및 이의 유도체인 것일 수 있다.
상기 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이메틸유레아(Atglistatin[DABPU-DM])의 유도체는 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아[DABPU-DE], 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1-에틸-1-메틸유레아[DABPU-EM], 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이페닐유레아[DABPU-DPh], N-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)피롤리딘-1-카르복스아마이드[DABPU-Pyrrol] 및 N-(4'-(다이메틸아미노)-(1,1‘-바이페닐)-3-일)모폴린-4-카르복스아마이드[DABPU-Morph]로 이루어진 군으로부터 선택되는 1종 이상인 것일 수 있고, 바람직하게는 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아[DABPU-DE] 또는 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1-에틸-1-메틸유레아[DABPU-EM]인 것일 수 있고, 예를 들어, 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아[DABPU-DE]인 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 약제학적 조성물은 오셀타미비르 및 렘데시비르로 이루어진 군으로부터 선택되는 1종 이상의 항바이러스제를 추가적으로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에서, 상기 약제학적 조성물은 지방분해효소 억제제 및 오셀타미비르를 2:2 내지 8:2의 부피비로 포함하는 것일 수 있고, 바람직하게는 3:2 내지 7:2의 부피비로 포함하는 것일 수 있고, 예를 들어, 4:2 내지 6:2의 부피비로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에서, 상기 약제학적 조성물은 지방분해효소 억제제 및 렘데시비르를 8:1 내지 20:1의 부피비로 포함하는 것일 수 있고, 바람직하게는 10:1 내지 18:1의 부피비로 포함하는 것일 수 있고, 예를 들어, 15:1 내지 16:1의 부피비로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 상기 RNA 바이러스는 SARS-CoV-1, SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV, PSaV, 노로바이러스, FIPV, 메르스코로나바이러스, 지카바이러스, 뎅기열 바이러스, 및 A형 및 C형 간염 바이러스로 이루어진 군으로부터 선택되는 1종 이상인 것일 수 있다.
본 발명은 지방분해효소 억제제의 인체 및 동물용 광범위 RNA 바이러스 감염증 치료제에 관한 것으로서, 보다 구체적으로는 지방분해효소 억제제를 인간과 동물의 인플루엔자 A 바이러스 감염증 및 사스코로나바이러스 유형 2, 및 동물의 소 코로나바이러스 감염증, 돼지 유행성 설사 코로나바이러스 감염증, 소 로타바이러스 감염증, 돼지 생식기 호흡기 증후군 바이러스 감염증 및 사포바이러스 감염증의 치료제로 사용할 수 있으며, 이 외에도 사스코로나바이러스 유형 1, 메르스코로나바이러스, 지카바이러스, 뎅기열 바이러스, 및 A형 및 C형 간염 바이러스 등 인간 및 동물에서 발생하는 다양한 RNA 바이러스 감염증 치료제로 활용할 수 있다.
도 1a는 본 발명의 실시예에 따른 사스코로나바이러스 유형 2 (SARS Corona Virus; SARS-CoV-2) 감염에 의한 배양 세포의 세포질 내 지방적 수를 나타내는 사진 및 그래프이다.
도 1b는 본 발명의 실시예에 따른 인플루엔자 A 바이러스(influenza A virus; IAV) 감염에 의한 배양 세포의 세포질 내 지방적 수를 나타내는 사진 및 그래프이다.
도 1c는 본 발명의 실시예에 따른 SARS-CoV-2 감염에 의한 배양 세포의 세포질 내 중성지방(triacylglyceride; TG) 및 콜레스테롤(cholesterol)의 양을 나타내는 그래프이다.
도 1d는 본 발명의 실시예에 따른 IAV 감염에 의한 배양 세포의 세포질 내 중성지방 및 콜레스테롤의 양을 나타내는 그래프이다.
도 2a는 본 발명의 실시예에 따른 소 코로나바이러스(bovine coronavirus; BCoV) 감염에 의한 배양 세포의 세포질 내 지방적 수를 나타내는 사진 및 그래프이다.
도 2b는 본 발명의 실시예에 따른 돼지 유행성 설사 코로나바이러스(porcine epidemic diarrhea coronavirus; PEDV) 감염에 의한 배양 세포의 세포질 내 지방적 수를 나타내는 사진 및 그래프이다.
도 2c는 본 발명의 실시예에 따른 소 로타바이러스(bovine rotavirus; RVA) 감염에 의한 배양 세포의 세포질 내 지방적 수를 나타내는 사진 및 그래프이다.
도 2d는 본 발명의 실시예에 따른 돼지 생식기 호흡기 증후군 바이러스(porcine reproductive and respiratory syndrome virus; PRRSV) 감염에 의한 배양 세포의 세포질 내 지방적 수를 나타내는 사진 및 그래프이다.
도 2e는 본 발명의 실시예에 따른 돼지 사포바이러스(porcine sapovirus; PSaV) 감염에 의한 배양 세포의 세포질 내 지방적 수를 나타내는 사진 및 그래프이다.
도 3a는 본 발명의 실시예에 따른 SARS-CoV-2 감염에 의한 햄스터 폐포상피세포의 세포질 내 지방적 증감을 나타내는 사진이다.
도 3b는 본 발명의 실시예에 따른 IAV 감염에 의한 마우스 세기관지 상피세포의 세포질 내 지방적 증감을 나타내는 사진이다.
도 3c는 본 발명의 실시예에 따른 SARS-CoV-2 감염에 의한 햄스터 폐포상피세포의 세포질 내 중성지방 및 콜레스테롤의 양을 나타내는 그래프이다.
도 3d는 본 발명의 실시예에 따른 IAV 감염에 의한 마우스 세기관지 상피세포의 세포질 내 중성지방 및 콜레스테롤의 양을 나타내는 그래프이다.
도 4a는 본 발명의 실시예에 따른 SARS-CoV-2 감염에 의한 배양 세포의 세포질 내 인산화 된 호르몬 감수성 지방분해효소(hormone sensitive lipase, HSL) 증감을 나타내는 사진 및 그래프다.
도 4b는 본 발명의 실시예에 따른 IAV 감염에 의한 배양 세포의 세포질 내 인산화 된 호르몬 감수성 지방분해효소 증감을 나타내는 사진 및 그래프다.
도 4c는 본 발명의 실시예에 따른 SARS-CoV-2 감염에 의한 배양 세포의 세포질 내 유리지방산(free fatty acid, FFA) 및 글리세롤(glycerol)의 양을 나타내는 그래프이다.
도 4d는 본 발명의 실시예에 따른 IAV 감염에 의한 배양 세포의 세포질 내 유리지방산 및 글리세롤의 양을 나타내는 그래프이다.
도 5a는 본 발명의 실시예에 따른 BCoV 감염에 의한 배양 세포의 세포질 내 인산화 된 호르몬 감수성 지방분해효소 증감을 나타내는 사진 및 그래프이다.
도 5b는 본 발명의 실시예에 따른 PEDV 감염에 의한 배양 세포의 세포질 내 인산화 된 호르몬 감수성 지방분해효소 증감을 나타내는 사진 및 그래프이다.
도 5c는 본 발명의 실시예에 따른 RVA 감염에 의한 배양 세포의 세포질 내 인산화 된 호르몬 감수성 지방분해효소 증감을 나타내는 사진 및 그래프이다.
도 5d는 본 발명의 실시예에 따른 PRRSV 감염에 의한 배양 세포의 세포질 내 인산화 된 호르몬 감수성 지방분해효소 증감을 나타내는 사진 및 그래프이다.
도 5e는 본 발명의 실시예에 따른 PSaV 감염에 의한 배양 세포의 세포질 내 인산화 된 호르몬 감수성 지방분해효소 증감을 나타내는 사진 및 그래프이다.
도 6a는 본 발명의 실시예에 따른 SARS-CoV-2 감염에 의한 햄스터 폐포상피세포의 세포질 내 인산화 된 호르몬 감수성 지방분해효소 증감을 나타내는 사진이다.
도 6b는 본 발명의 실시예에 따른 IAV 감염에 의한 마우스 세기관지 상피세포의 세포질 내 인산화 된 호르몬 감수성 지방분해효소 증감을 나타내는 사진이다.
도 6c는 본 발명의 실시예에 따른 SARS-CoV-2 감염에 의한 햄스터 폐 조직에서 인산화 된 호르몬 감수성 지방분해효소 증감을 나타내는 사진 및 그래프이다.
도 6d는 본 발명의 실시예에 따른 IAV 감염에 의한 마우스 폐 조직에서 인산화 된 호르몬 감수성 지방분해효소 증감을 나타내는 사진 및 그래프이다.
도 6e는 본 발명의 실시예에 따른 SARS-CoV-2 감염에 의한 햄스터 폐 조직에서의 유리지방산 및 글리세롤의 증감을 나타낸 그래프이다.
도 6f는 본 발명의 실시예에 따른 IAV 감염에 의한 마우스 폐 조직에서의 유리지방산과 글리세롤의 증감을 나타낸 그래프이다.
도 7a는 본 발명의 실시예에 따른 SARS-CoV-2 감염에 의한 Vero E6 세포의 세포질 내 유리지방산과 글리세롤의 증감을 나타낸 그래프이다.
도 7b는 본 발명의 실시예에 따른 IAV 감염에 의한 A549 세포의 세포질 내 유리지방산과 글리세롤의 증감을 나타낸 그래프이다.
도 7c는 본 발명의 실시예에 따른 BCoV 감염에 의한 HRT-18G 세포의 세포질 내 유리지방산과 글리세롤의 증감을 나타낸 그래프이다.
도 7d는 본 발명의 실시예에 따른 PEDV 감염에 의한 Vero E6 세포의 세포질 내 유리지방산과 글리세롤의 증감을 나타낸 그래프이다.
도 7e는 본 발명의 실시예에 따른 RVA 감염에 의한 MA104 세포의 세포질 내 유리지방산과 글리세롤의 증감을 나타낸 그래프이다.
도 7f는 본 발명의 실시예에 따른 PRRSV 감염에 의한 MARC-145 세포의 세포질 내 유리지방산과 글리세롤의 증감을 나타낸 그래프이다.
도 7g는 본 발명의 실시예에 따른 PSaV 감염에 의한 LLC-PK 세포의 세포질 내 유리지방산과 글리세롤의 증감을 나타낸 그래프이다.
도 8a는 본 발명의 실시예에 따른 SARS-CoV-2 감염 세포에서의 atglistatin (MedChemExpress; CAS Number: 1469924-27-3) 및 CAY10499(Cayman Chemicals; CAS Number: 359714-55-9) 처리에 의한 바이러스 유전자 수를 나타낸 그래프이다.
도 8b는 본 발명의 실시예에 따른 SARS-CoV-2 감염 세포에서의 atglistatin 및 CAY10499 처리에 의한 자손 바이러스 수를 나타낸 그래프이다.
도 8c는 본 발명의 실시예에 따른 SARS-CoV-2 감염 세포에서의 atglistatin 및 CAY10499 처리에 의한 세포질 내 유리지방산과 글리세롤을 나타낸 그래프이다.
도 8d는 본 발명의 실시예에 따른 SARS-CoV-2 감염 세포에서의 atglistatin 및 CAY10499 처리에 의한 바이러스 스파이크 단백질(spike; S) 합성량을 나타낸 사진이다.
도 8e는 본 발명의 실시예에 따른 IAV 감염 세포에서의 atglistatin 및 CAY10499 처리에 의한 바이러스 유전자 수를 나타낸 그래프이다.
도 8f는 본 발명의 실시예에 따른 IAV 감염 세포에서의 atglistatin 및 CAY10499 처리에 의한 자손 바이러스 수를 나타낸 그래프이다.
도 8g는 본 발명의 실시예에 따른 IAV 감염 세포에서의 atglistatin 및 CAY10499 처리에 의한 세포질 내 유리지방산과 글리세롤을 나타낸 그래프이다.
도 8h는 본 발명의 실시예에 따른 IAV 감염 세포에서의 atglistatin 및 CAY10499 처리에 의한 바이러스 스파이크 단백질 합성량을 나타낸 사진이다.
도 8i는 본 발명의 실시예에 따른 SARS-CoV-2 감염 세포에서의 atglistatin 및 CAY10499 처리에 의한 스파이크 단백질의 팔미토일화(palmitoylation)를 나타낸 사진 및 그래프이다.
도 8j는 본 발명의 실시예에 따른 IAV 감염 세포에서의 atglistatin 및 CAY10499 처리에 의한 혈구응집소(hemagglutinin; H) 및 M2 단백질의 팔미토일화를 나타낸 사진 및 그래프이다.
도 9a는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 처리에 의한 SARS-CoV-2의 바이러스 억제 효과를 나타낸 그래프이다.
도 9b는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 처리에 의한 IAV의 바이러스 억제 효과를 나타낸 그래프이다.
도 9c는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 처리에 의한 BCoV의 바이러스 억제 효과를 나타낸 그래프이다.
도 9d는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 처리에 의한 PEDV의 바이러스 억제 효과를 나타낸 그래프이다.
도 9e는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 처리에 의한 RVA의 바이러스 억제 효과를 나타낸 그래프이다.
도 9f는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 처리에 의한 PRRSV의 바이러스 억제 효과를 나타낸 그래프이다.
도 9g는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 처리에 의한 PSaV의 바이러스 억제 효과를 나타낸 그래프이다.
도 10a는 본 발명의 실시예에 따른 atglistatin 처리에 의한 SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV, 및 PSaV의 바이러스 게놈 수를 나타낸 그래프이다.
도 10b는 본 발명의 실시예에 따른 CAY10499 처리에 의한 SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV, 및 PSaV의 바이러스 유전자 수를 나타낸 그래프이다.
도 10c는 본 발명의 실시예에 따른 atglistatin 처리에 의한 SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV, 및 PSaV의 자손 바이러스 수를 나타낸 그래프이다.
도 10d는 본 발명의 실시예에 따른 CAY10499 처리에 의한 SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV, 및 PSaV의 자손 바이러스 수를 나타낸 그래프이다.
도 11a는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 투여에 의한 IAV 감염 마우스를 제작하는 과정의 모식도이다.
도 11b는 본 발명의 실시예에 따른 atglistatin 투여에 의한 IAV 감염 마우스의 생존율을 나타낸 그래프이다.
도 11c는 본 발명의 실시예에 따른 atglistatin 투여에 의한 IAV 감염 마우스의 체중 변화를 나타낸 그래프이다.
도 11d는 본 발명의 실시예에 따른 atglistatin 투여에 의한 IAV 감염 마우스의 임상 증상을 나타낸 그래프이다.
도 11e는 본 발명의 실시예에 따른 CAY10499 투여에 의한 IAV 감염 마우스의 생존율을 나타낸 그래프이다.
도 11f는 본 발명의 실시예에 따른 CAY10499 투여에 의한 IAV 감염 마우스의 체중 변화를 나타낸 그래프이다.
도 11g는 본 발명의 실시예에 따른 CAY10499 투여에 의한 IAV 감염 마우스의 임상 증상을 나타낸 그래프이다.
도 11h는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 투여에 의한 IAV 감염 마우스 폐 조직에서의 유리 지방산 및 글리세롤 농도를 나타낸 그래프이다.
도 11i는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 투여에 의한 IAV 감염 마우스 폐 조직에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 11j는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 투여에 의한 IAV 감염 마우스 폐 조직에서의 자손 바이러스 수를 나타낸 그래프이다.
도 11k는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 투여에 의한 IAV 감염 마우스 세기관지 상피세포를 나타낸 사진이다.
도 11l는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 투여에 의한 IAV 감염 마우스에서의 폐 병변 및 바이러스 양성세포 수를 나타낸 사진이다.
도 12a는 본 발명의 실시예에 따른 atglistatin 및 CAY10499 투여에 의한 SARS-CoV-2 감염 햄스터를 제작하는 과정의 모식도이다.
도 12b는 본 발명의 실시예에 따른 atglistatin 투여에 의한 SARS-CoV-2 감염 햄스터의 폐렴 중증도를 나타낸 그래프이다.
도 12c는 본 발명의 실시예에 따른 atglistatin 투여에 의한 SARS-CoV-2 감염 햄스터에서의 유리지방산 및 글리세롤의 생성량을 나타낸 그래프이다.
도 12d는 본 발명의 실시예에 따른 atglistatin 투여에 의한 SARS-CoV-2 감염 햄스터 폐 조직에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 12e는 본 발명의 실시예에 따른 atglistatin 투여에 의한 SARS-CoV-2 감염 햄스터 폐 조직에서의 자손 바이러스 수를 나타낸 그래프이다.
도 12f는 본 발명의 실시예에 따른 atglistatin 투여에 의한 SARS-CoV-2 감염 햄스터의 체중 변화를 나타낸 그래프이다.
도 12g는 본 발명의 실시예에 따른 atglistatin 투여에 의한 SARS-CoV-2 감염 햄스터의 폐포 상피세포를 나타낸 사진이다.
도 12h는 본 발명의 실시예에 따른 atglistatin 투여에 의한 SARS-CoV-2 감염 햄스터에서의 폐 병변 및 바이러스 양성세포 수를 나타낸 사진이다.
도 13a는 본 발명의 실시예에 따른 atglistatin 및 오셀타미비르(oseltamivir)의 단독 또는 병용 투여에 의한 IAV 감염 마우스를 제작하는 과정의 모식도이다.
도 13b는 본 발명의 실시예에 따른 atglistatin 및 오셀타미비르의 단독 또는 병용 투여에 의한 IAV 감염 마우스의 생존율을 나타낸 그래프이다.
도 13c는 본 발명의 실시예에 따른 atglistatin 및 오셀타미비르의 단독 또는 병용 투여에 의한 IAV 감염 마우스의 체중 변화를 나타낸 그래프이다.
도 13d는 본 발명의 실시예에 따른 atglistatin 및 오셀타미비르의 단독 또는 병용 투여에 의한 IAV 감염 마우스의 임상 증상을 나타낸 그래프이다.
도 13e는 본 발명의 실시예에 따른 atglistatin 및 렘데시비르(remdesivir)의 단독 또는 병용 투여에 의한 SARS-CoV-2 감염 햄스터를 제작하는 과정의 모식도이다.
도 13f는 본 발명의 실시예에 따른 atglistatin 및 렘데시비르의 단독 또는 병용 투여에 의한 SARS-CoV-2 감염 햄스터의 폐렴 개선률을 나타낸 그래프이다.
도 13g는 본 발명의 실시예에 따른 atglistatin 및 렘데시비르의 단독 또는 병용 투여에 의한 SARS-CoV-2 A lineage 감염 햄스터의 체중 변화를 나타낸 그래프이다.
도 13h는 본 발명의 실시예에 따른 atglistatin 및 렘데시비르의 단독 또는 병용 투여에 의한 SARS-CoV-2 Alpha lineage 감염 햄스터의 체중 변화를 나타낸 그래프이다.
도 13i는 본 발명의 실시예에 따른 atglistatin 및 렘데시비르의 단독 또는 병용 투여에 의한 SARS-CoV-2 Beta lineage 감염 햄스터의 체중 변화를 나타낸 그래프이다.
도 14a는 atglistatin의 화학식이다.
도 14b는 atglistatin의 유도체인 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1-에틸-1-메틸유레아[DABPU-EM]의 화학식이다.
도 14c는 atglistatin의 유도체인 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아[DABPU-DE]의 화학식이다.
도 14d는 atglistatin의 유도체인 3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이페닐유레아[DABPU-DPh]의 화학식이다.
도 14e는 atglistatin의 유도체인 N-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)피롤리딘-1-카르복스아마이드[DABPU-Pyrrol]의 화학식이다.
도 14f는 atglistatin의 유도체인 N-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)모폴린-4-카르복스아마이드[DABPU-Morph]의 화학식이다.
도 15a는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 SARS-CoV-2 감염 세포에서의 바이러스 항원 발현량을 나타낸 사진이다.
도 15b는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 IAV 감염 세포에서의 바이러스 항원 발현량을 나타낸 사진이다.
도 15c는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 BCoV 감염 세포에서의 바이러스 항원 발현량을 나타낸 사진이다.
도 15d는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 PEDV 감염 세포에서의 바이러스 항원 발현량을 나타낸 사진이다.
도 15e는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 RVA 감염 세포에서의 바이러스 항원 발현량을 나타낸 사진이다.
도 15f는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 PRRSV 감염 세포에서의 바이러스 항원 발현량을 나타낸 사진이다.
도 15g는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 PSaV 감염 세포에서의 바이러스 항원 발현량을 나타낸 사진이다.
도 16a는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 SARS-CoV-2 감염 세포에서의 바이러스 억제 효과를 나타낸 그래프이다.
도 16b는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 IAV 감염 세포에서의 바이러스 억제 효과를 나타낸 그래프이다.
도 16c는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 BCoV 감염 세포에서의 바이러스 억제 효과를 나타낸 그래프이다.
도 16d는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 PEDV 감염 세포에서의 바이러스 억제 효과를 나타낸 그래프이다.
도 16e는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 감염 세포에서의 바이러스 억제 효과를 나타낸 그래프이다.
도 16f는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 PRRSV 감염 세포에서의 바이러스 억제 효과를 나타낸 그래프이다.
도 16g는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE의 투여에 의한 PSaV 감염 세포에서의 바이러스 억제 효과를 나타낸 그래프이다.
도 17a는 본 발명의 실시예에 따른 DABPU-EM의 투여에 의한 SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV 및 PSaV 감염 세포에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 17b는 본 발명의 실시예에 따른 DABPU-DE의 투여에 의한 SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV 및 PSaV 감염 세포에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 17c는 본 발명의 실시예에 따른 DABPU-EM의 투여에 의한 SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV 및 PSaV 감염 세포에서의 자손 바이러스 생산 수를 나타낸 그래프이다.
도 17d는 본 발명의 실시예에 따른 DABPU-DE의 투여에 의한 SARS-CoV-2, IAV, BCoV, PEDV, RVA, PRRSV 및 PSaV 감염 세포에서의 자손 바이러스 생산 수를 나타낸 그래프이다.
도 18a는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE 투여에 의한 IAV 감염 마우스를 제작하는 과정의 모식도이다.
도 18b는 본 발명의 실시예에 따른 DABPU-EM 투여에 의한 IAV 감염 마우스의 생존율을 나타낸 그래프이다.
도 18c는 본 발명의 실시예에 따른 DABPU-EM 투여에 의한 IAV 감염 마우스의 체중 변화를 나타낸 그래프이다.
도 18d는 본 발명의 실시예에 따른 DABPU-EM 투여에 의한 IAV 감염 마우스의 임상 증상을 나타낸 그래프이다.
도 18e는 본 발명의 실시예에 따른 DABPU-DE 투여에 의한 IAV 감염 마우스의 생존율을 나타낸 그래프이다.
도 18f는 본 발명의 실시예에 따른 DABPU-DE 투여에 의한 IAV 감염 마우스의 체중 변화를 나타낸 그래프이다.
도 18g는 본 발명의 실시예에 따른 DABPU-DE 투여에 의한 IAV 감염 마우스의 임상 증상을 나타낸 그래프이다.
도 18h는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE 투여에 의한 IAV 감염 마우스 폐 조직 내에서의 유리지방산과 글리세롤 농도를 나타낸 그래프이다.
도 18i는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE 투여에 의한 IAV 감염 마우스 폐 조직 내에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 18j는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE 투여에 의한 IAV 감염 마우스 폐 조직 내에서의 자손 바이러스 수를 나타낸 그래프이다.
도 18k는 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE 투여에 의한 IAV 감염 마우스 세기관지 상피세포를 나타낸 사진이다.
도 18l은 본 발명의 실시예에 따른 DABPU-EM 및 DABPU-DE 투여에 의한 IAV 감염 마우스에서의 폐 병변과 바이러스 양성세포 수를 나타낸 사진이다.
도 19a는 본 발명의 실시예에 따른 DABPU-DM 및 DABPU-DE 투여에 의한 SARS-CoV-2 감염 햄스터를 제작하는 과정의 모식도이다.
도 19b는 본 발명의 실시예에 DABPU-DM 및 DABPU-DE 투여에 의한 SARS-CoV-2 감염 햄스터의 폐렴 중증도를 나타낸 그래프이다.
도 19c는 본 발명의 실시예에 따른 DABPU-DM 및 DABPU-DE 투여에 의한 SARS-CoV-2 감염 햄스터의 유리지방산 및 글리세롤의 생성을 나타낸 그래프이다.
도 19d는 본 발명의 실시예에 따른 DABPU-DM 및 DABPU-DE 투여에 의한 SARS-CoV-2 감염 햄스터에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 19e는 본 발명의 실시예에 따른 DABPU-DM 및 DABPU-DE 투여에 의한 SARS-CoV-2 감염 햄스터에서의 자손 바이러스 수를 나타낸 그래프이다.
도 19f는 본 발명의 실시예에 따른 DABPU-DM 및 DABPU-DE 투여에 의한 SARS-CoV-2 감염 햄스터의 체중 변화를 나타낸 그래프이다.
도 20a는 본 발명의 실시예에 따른 DABPU-DE 및 오셀타미비르의 단독 또는 병용 투여에 의한 IAV 감염 마우스를 제작하는 과정의 모식도이다.
도 20b는 본 발명의 실시예에 따른 DABPU-DE 및 오셀타미비르의 단독 또는 병용 투여에 의한 IAV 감염 마우스의 생존율을 나타낸 그래프이다.
도 20c는 본 발명의 실시예에 따른 DABPU-DE 및 오셀타미비르의 단독 또는 병용 투여에 의한 IAV 감염 마우스의 체중 변화를 나타낸 그래프이다.
도 20d는 본 발명의 실시예에 따른 DABPU-DE 및 오셀타미비르의 단독 또는 병용 투여에 의한 IAV 감염 마우스의 임상 증상을 나타낸 그래프이다.
도 20e는 본 발명의 실시예에 따른 DABPU-DE 및 렘데시비르의 단독 또는 병용 투여에 의한 SARS-CoV-2 A lineage, Alpha lineage 혹은 Beta lineage 감염 햄스터를 제작하는 과정의 모식도이다.
도 20f는 본 발명의 실시예에 따른 DABPU-DE 및 렘데시비르의 단독 또는 병용 투여에 의한 SARS-CoV-2 A lineage, Alpha lineage 혹은 Beta lineage 감염 햄스터의 폐렴 중증도를 나타내는 그래프이다.
도 20g는 본 발명의 실시예에 따른 DABPU-DE 및 렘데시비르의 단독 또는 병용 투여에 의한 SARS-CoV-2 A lineage 감염 햄스터의 체중 변화를 나타낸 그래프이다.
도 20h는 본 발명의 실시예에 따른 DABPU-DE 및 렘데시비르의 단독 또는 병용 투여에 의한 SARS-CoV-2 Alpha lineage 감염 햄스터의 체중 변화를 나타낸 그래프이다.
도 20i는 본 발명의 실시예에 따른 DABPU-DE 및 렘데시비르의 단독 또는 병용 투여에 의한 SARS-CoV-2 Beta lineage 감염 햄스터의 체중 변화를 나타낸 그래프이다.
도 21a는 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 SARS-CoV-2 감염 Vero E6 세포에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 21b는 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 SARS-CoV-2 감염 Caco-2 세포에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 21c는 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 SARS-CoV-2 감염 Calu-3 세포에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 21d는 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 SARS-CoV-2 감염 Vero E6 세포에서의 자손 바이러스 수를 나타낸 그래프이다.
도 21e는 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 SARS-CoV-2 감염 Caco-2 세포에서의 자손 바이러스 수를 나타낸 그래프이다.
도 21f는 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 SARS-CoV-2 감염 Calu-3 세포에서의 자손 바이러스 수를 나타낸 그래프이다.
도 21g는 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 IAV 감염 MRC-5 세포에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 21h는 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 IAV 감염 NCI-H293 세포에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 21i는 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 IAV 감염 WI-38 세포에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 21j는 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 IAV 감염 Calu-3 세포에서의 바이러스 유전자 수를 나타낸 그래프이다.
도 21k는 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 IAV 감염 MRC-5 세포에서의 자손 바이러스 수를 나타낸 그래프이다.
도 21l은 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 IAV 감염 NCI-H293 세포에서의 자손 바이러스 수를 나타낸 그래프이다.
도 21m은 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 IAV 감염 WI-38 세포에서의 자손 바이러스 수를 나타낸 그래프이다.
도 21n은 본 발명의 실시예에 따른 DABPU-DM, DABPU-EM 및 DABPU-DE의 투여에 의한 IAV 감염 Calu-3 세포에서의 자손 바이러스 수를 나타낸 그래프이다.
본 발명은 지방분해효소 억제제를 포함하는 RNA 바이러스 감염증 예방 또는 치료용 약제학적 조성물에 관한 것이다.
이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 한정되는 것은 아니다.
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 "%"는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량)%, 고체/액체는 (중량/부피)%, 그리고 액체/액체는 (부피/부피)%이다.
동일한 조건에서 결과의 신뢰도를 높이기 위한 방법으로 세 번의 독립적인 실험을 하였으며, 각 그룹의 수치는 평균 ± 표준오차로 변환하였다. 상기 결과의 통계학적 유의성은 One-Way ANOVA test(GraphPad Prism software version 8.4.2)로 분석하였으며, p value가 0.05 이상인 경우 통계학적으로 유의성이 높은 것으로 평가하였다.
준비예 1: 바이러스 정보
광범위 RNA 바이러스를 활용한 연구를 위해 하기 표 1과 같이 세포 배양이 가능하고 대표성 있는 바이러스들을 사용하였다.
사용된 바이러스 정보
바이러스 균주명(genotypes) 출처
사스코로나바이러스 유형 2(Severe acute respiratory syndrome coronavirus 2; SARS-CoV-2) KCDC03 (Lineage A) A kind gift from Korea Disease Control and Prevention Agency
사스코로나바이러스 유형 2(SARS-CoV-2) KDCA51463 (Alpha lineage) A kind gift from Korea Disease Control and Prevention Agency
사스코로나바이러스 유형 2(SARS-CoV-2) KDCA55905 (Beta lineage) A kind gift from Korea Disease Control and Prevention Agency
인플루엔자 A 바이러스(Influenza A virus) A/Puerto Rico/8/1934 (H1N1) US American Type Culture Collection
소 코로나바이러스(Bovine coronavirus) KWD20 Isolated from fecal samples and propagated in HRT-18G and MDBK cells
돼지 유행성 설사 코로나바이러스(Porcine epidemic diarrhea coronavirus) QIAP1401 (G2b) A kind gift from Animal and Plant Quarantine Agency, Korea
소 로타바이러스(Bovine species A rotavirus) NCDV (G6P6[1]) American Type Culture Collection
돼지 생식기 호흡기 증후군 바이러스(Porcine reproductive and respiratory syndrome virus) LMY (North American type) A kind gift from Animal and Plant Quarantine Agency, Korea
돼지 사포바이러스(Porcine sapovirus) Cowden (GIII.1) A kind gift from Dr. K.O. Chang, Kansas State University A
준비예 2: 세포 정보
사스코로나바이러스 유형 2 KCDC03주(Lineage A), 사스코로나바이러스 유형 2 KDCA51463주(Alpha lineage) 및 사스코로나바이러스 유형 2 KDCA55905(Beta lineage) 배양을 위해 아프리카녹색원숭이(African green monkey) 신장상피세포인 Vero E6 세포, 사람 직결장암(Human colorectal adenocarcinoma) 상피세포인 Caco-2 세포 및 사람 폐 선암종(Human lung adnocarcinoma) 상피세포인 Calu-3 세포를 준비하였다.
인플루엔자 A 바이러스 PR8주의 배양을 위해 사람 폐암세포(Human lung adnocarcinoma) 상피세포인 A549 세포, 사람 폐 섬유아세포(Human lung fibroblast)인 MRC-5 세포, 사람 폐 점막표피모양 암종(Human lung mucoepidermoid carcinoma) 상피세포인 NCI-H292 세포, 사람 폐 섬유아세포 (Human lung fibroblast)인 WI-38 세포, 및 Calu-3 세포를 준비하였다.
소 코로나바이러스 KWD20주의 배양을 위해 사람 직결장암(Human colorectal adenocarcinoma) 상피세포인 HRT-18G 세포를 준비하였다.
돼지 유행성 설사 코로나바이러스 QIAP1401주의 배양을 위해 Vero E6 세포를 준비하였다.
소 로타바이러스 NCDV주의 배양을 위해 레서스 원숭이(Rhesus monkey) 신장상피세포인 MA104 세포를 준비하였다.
돼지 생식기 호흡기 증후군 바이러스 LMY주의 배양을 위해 아프리카녹색원숭이 신장상피세포인 MARC-145 세포를 준비하였다.
돼지 사포바이러스 Cowden 주의 배양을 위해 돼지 신장상피세포(Porcine kidney epithelium)인 LLC-PK 세포를 이용하였다.
(FBS: fetal bovine serum, DMEM: Dulbecco’s modified Eagle’s medium, EMEM: Eagle’s Minimum Essential Medium, α-MEM: Alpha Minimal Essential Medium, 1% P/S: 100 U/mL penicilin, 100 μg/mL streptomycin)
사용된 세포 정보
Cell line Origin Source Medium Supplementation*
Vero E6 아프리카녹색원숭이 신장상피세포 ATCC EMEM 10% FBS, 1% P/S
Caco-2 사람 직결장암 상피세포 ATCC DMEM 10% FBS, 1% P/S
Calu-3 사람 폐 선암종 상피세포 ATCC EMEM 10% FBS, 1% P/S
A549 사람 폐암세포 상피세포 ATCC DMEM 10% FBS, 1% P/S
MRC-5 사람 폐 섬유아세포 ATCC EMEM 10% FBS, 1% P/S
NCI-H292 사람 폐 점막표피모양 암종 상피세포 ATCC RPMI 10% FBS, 1% P/S
WI-38 사람 폐 섬유아세포 ATCC EMEM 10% FBS, 1% P/S
HRT-18G 사람 직결장암 상피세포 ATCC DMEM 10% FBS, 1% P/S
MA104 레서스 원숭이 신장상피세포 ATCC α-MEM 10% FBS, 1% P/S
MARC-145 아프리카녹색원숭이 신장상피세포 ATCC DMEM 10% FBS, 1% P/S
LLC-PK 돼지 신장상피세포 ATCC EMEM 10% FBS, 1% P/S
상술한 호르몬 의존성 지방분해 효소 억제제가 가지는 광범위 항바이러스 억제 효과와 증식 제어기전 규명을 위해 다양한 실험법을 수행하였다.
준비예 3: 항체 정보
Antibodies* Company Country Solvent*
Primary antibodies
HSL(hormone-sensitive lipase) Cell Signaling USA 5% BSA in 1xTBST(Tris-Buffered Saline containing 0.1% Tween®20 Detergent)
pHSL(phosphorylated HSL)(S563) Cell Signaling USA 5% BSA in 1xTBST
pHSL(S660) Cell Signaling USA 5% BSA in 1xTBST
PLIN1(perilipin 1) Santa Cruz USA 5% BSA in 1xTBST
PLIN3(perilipin 3) Abcam UK 5% BSA in 1xTBST
SARS-CoV-2 S(spike protein) Prosci USA 5% BSA in 1xTBST
SARS-CoV-2 N(nucleoprotein) Prosci USA 5% BSA in 1xTBST
IAV M2(matrix-2 protein) Abcam UK 5% BSA in 1xTBST
IAV HA(hemagglutinin) Santa Cruz USA 5% BSA in 1xTBST
IAV virion Virostat USA 5% BSA in 1xTBST
β-actin Thermo Scientific USA 5% BSA in 1xTBST
GAPDH(glyceraldehyde 3-phosphate dehydrogenase) Santa Cruz USA 5% BSA in 1xTBST
BCoV S Native Antigen Company UK 5% BSA in 1xTBST
PEDV N Medgene Labs USA 5% BSA in 1xTBST
RVA VP6(viral structural protein 6) Median Diagnostic South Korea 5% BSA in 1xTBST
RVA NSP5a(nonstructural protein 5) Kindly gifteda 5% BSA in 1xTBST
PRRSV M(matrix protein) Bioss Antibodies USA 5% BSA in 1xTBST
PSaV VPgb(viral genome-linked protein) Manufactured in the labb 5% BSA in 1xTBST
Secondary antibodies
Rabbit IgG(H+L) Cell Signaling USA 1xTPBT
Goat IgG(H+L) Cell Signaling USA 1xTPBT
Mouse IgGκ Santa Cruz USA 1xTPBT
AF647 rabbit IgG Thermo Scientific USA 1xPBS
AF594 rabbit IgG Thermo Scientific USA 1xPBS
AF488 rabbit IgG Thermo Scientific USA 1xPBS
AF647 mouse IgG Thermo Scientific USA 1xPBS
AF594 mouse IgG Thermo Scientific USA 1xPBS
AF488 mouse IgG Thermo Scientific USA 1xPBS
준비예 4: 프라이머 정보
서열번호 명칭 서열(5’-3’)
1 SARS-CoV-2 N F TAATCAGACAAGGAACTGATTA
2 SARS-CoV-2 N R CGAAGGTGTGACTTCCATG
3 IAV PB1 F CTGCCAGAAGACAATGAACC
4 IAV PB1 R GGCCATTGCTTCCAATACAC
5 RVA VP6 F TAGACCAAATAACGTTGAAGTTGA
6 RVA VP6 R GATTCACAAACTGCAGATTCAA
7 PEDV F GCTATGCTCAGATCGCCAGT
8 PEDV R TCTCGTAAGAGTCCGCTAGCTC
9 PRRSV M F CACCTCCAGATGCCGTTTG
10 PRRSV M R ATGCGTGGTTATCATTTGCC
11 PSaV VPg F CGAAAGGGAAAAACAAACGC
12 PSaV VPg R TCACTCACTGTCATAGGTGTCACC
13 BCoV N F TGGATCAAGATTAGAGTTGGC
14 BCoV N R CCTTGTCCATTCTTCTGACC
15 L32 F TCTGGTGAAGCCCAAGATCG
16 L32 R CTCTGGGTTTCCGCCAGT
17 Human GAPDH F ATTCCACCCATGGCAAATTC
18 Human GAPDH R CGCTCCTGGAAGATGGTGAT
19 Mouse GAPDH F AAGGTCATCCCAGAGCTGAA
20 Mouse GAPDH R CTGCTTCACCACCTTCTTGA
21 Porcine GAPDH F ACCTCCACTACATGGTCTACA
22 Porcine GAPDH R ATGACAAGCTTCCCGTTCTC
실험예 1: 바이러스 감염에 의한 세포의 세포질 내 지방적 증감
9종의 바이러스를 대상으로 감염에 의한 세포의 세포질 내 지방적(lipid droplet, LD) 증감을 확인하였다.
사스코로나바이러스 유형 2, 인플루엔자 A 바이러스, 소 코로나바이러스, 돼지 유행성 설사 바이러스, 소 로타바이러스, 돼지 생식기 호흡기 증후군 바이러스, 돼지 사포바이러스 배양을 위한 세포 정보
Viruses Cell lines Activation of viruses Medium Supplementation*
SARS-CoV-2 Vero E6 N/A EMEM 1 μg/mL TPCK-treated trypsin, 1% P/S
Caco-2 N/A DMEM 1 μg/mL TPCK-treated trypsin, 1% P/S
Calu-3 N/A EMEM 1 μg/mL TPCK-treated trypsin, 1% P/S
Influenza A virus A549 N/A DMEM 1 μg/mL TPCK-treated trypsin, 1% P/S
MRC-5 N/A EMEM 1 μg/mL TPCK-treated trypsin, 1% P/S
NCI-H292 N/A RPMI 1 μg/mL TPCK-treated trypsin, 1% P/S
WI-38 N/A EMEM 1 μg/mL TPCK-treated trypsin, 1% P/S
Calu-3 N/A EMEM 1 μg/mL TPCK-treated trypsin, 1% P/S
Bovine coronavirus HRT-18G N/A DMEM 5 μg/mL pancreatin, 1% P/S
Porcine epidemic diarrhea coronavirus Vero E6 N/A EMEM 3 μg/mL porcine pancreatic trypsin, 1% P/S
Bovine species A rotavirus MA104 Preactivation with 10 μg/mL crystalized trypsin α-MEM 1 μg/mL crystalized trypsin, 1% P/S
Porcine reproductive and respiratory syndrome virus MARC-145 N/A DMEM 1% P/S
Porcine sapovirus LLC-PK N/A EMEM 2.5% FBS, 200 μM GCDCA, 1% P/S
1-1. 사스코로나바이러스 유형 2(SARS-CoV-2) 및 인플루엔자 A 바이러스(IAV) 감염에 의한 배양 세포의 세포질 내 지방적 증감
사스코로나바이러스 유형 2 및 인플루엔자 A 바이러스 감염에 의한 배양 세포의 세포질 내 지방적 증감을 확인하기 위하여, 아프리카 녹색원숭이 신장 상피세포인 Vero E6 세포를 10% 소태아혈청, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 EMEM 배지에서 단층 배양하였고, 사람 폐암세포인 A549 세포를 10% 소태아혈청, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM 배지에서 각각 단층 배양하였다. (TPCK-treated trypsin: N-tosyl-L-phenylalanine chloromethyl ketone (TPCK)-treated trypsin, Sigma Aldrich, GCDCA: glycochenodeoxycholic acid)
사스코로나바이러스 유형 2 KCDC03주(Lineage A), 사스코로나바이러스 유형 2 KDCA51463주(Alpha lineage) 및 사스코로나바이러스 유형 2 KDCA55905(Beta lineage) 역가를 측정하기 위하여, 단층 배양된 Vero E6 세포에 사스코로나바이러스 유형 2를 접종 후, 트립신의 일종인 N-tosyl-L-phenylalanine chloromethyl ketone (TPCK)-treated trypsin 1 μg/ml, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 EMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 24시간 배양 후, 사스코로나바이러스 유형 2 뉴클레오캡시드(nucleocapsid, N) 단백질에 대한 항체를 이용한 세포 배양 면역형광항체법(cell culture immunofluorescence assay, CCIF assay)을 수행하였다. 사스코로나바이러스 유형 2 KCDC03주, 사스코로나바이러스 유형 2 KDCA51463주 및 사스코로나바이러스 유형 2 KDCA55905 역가는 ffu/mL(fluorescence focus units per milliliter)로 표시하였다.
인플루엔자 A 바이러스 PR8주의 역가를 측정하기 위하여, 단층 배양된 A549 세포에 인플루엔자 A 바이러스 PR8주를 접종 후, TPCK-treated trypsin 1 μg/ml, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 24시간 배양 후, 인플루엔자 A 바이러스 뉴클레오프로테인(nucleoprotein) 단백질에 대한 항체를 이용한 세포 배양 면역형광항체법을 수행하였다. 인플루엔자 A 바이러스 PR8주의 역가는 ffu/mL 로 표시하였다.
8-well 챔버(chamber)(SPL Life Science, Pocheon, South Korea)에 단층 배양된 Vero E6 세포에 사스코로나바이러스 유형 2 KCDC03주를 감염다중도(multiplicity of infection, MOI)가 0.1 ffu/mL이 되게 접종 혹은 무접종한 후, 1 μg/ml TPCK-treated trypsin, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 4, 8, 12, 18, 24, 36, 48시간 동안 배양하였다.
또한 8-well 챔버에 단층 배양된 A549 세포에 인플루엔자 A 바이러스 PR8주를 감염다중도가 1 ffu/mL이 되게 접종 혹은 무접종한 후, 1 μg/ml TPCK-treated trypsin, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 1, 4, 8, 12, 18, 24, 36시간 동안 배양하였다.
상기 실험에 대해 사스코로나바이러스 유형 2 뉴클레오캡시드 단백질에 대한 면역형광염색/지방적에 대한 BODIPY(BODIPY 493/503; Sigma Aldrich) 염색을 수행하거나 인플루엔자 A 바이러스 M2 단백질에 대한 면역형광염색/지방적에 대한 BODIPY 염색을 수행하기 위해 4% 파라포름알데히드(paraformaldehyde, Sigma Aldrich)로 세포를 고정하였다. 고정된 세포는 pH 7.4의 인산완충액 (phosphate-buffered saline, PBS, pH 7.4)으로 수세 후에 5% BSA(Bovine Serum Albumin)로 20℃에서 1시간 블로킹(blocking) 후 각 바이러스에 대한 일차항체를 4℃에서 오버나이트(overnight) 배양시켰다. 다음날 인산완충액으로 수세 후, 2차항체로써 Alexa Fluorescence(AF) 647이 결합된 2차항체를 37℃에서 1시간 동안 배양시켰고, Slow-Fade Gold antifade reagent with 4', 6-diamidino-2-phenylindole(DAPI)(Molecular Probes, Eugene, OR, USA)를 이용해 핵 염색 및 마운팅(mounting)을 수행하였다.
면역형광염색된 샘플은 LSM 800 공초점현미경(Carl Zeiss; Jena, Germany) 및 LSM software을 사용하여 400배의 배율로 10개 위치에서 무작위로 촬영하였다. 인플루엔자 A 바이러스 감염에 따른 A549 세포의 지방적 변화는 Adobe Photoshop CS6을 이용해 다음과 같이 분석하였다.
1) BODIPY로 염색된 지방적의 개수는 NIH ImageJ software ImageJ particle analysis 방식을 이용해 집계하여, 평균(mean) ± 표준오차(Standard Deviation, S.D.)로 변환하였다.
2) 각 바이러스의 단백질의 양성 시그널과 BODIPY 양성 시그널은 각 픽셀로 수치화하여, 평균(mean) ± 표준오차(Standard Deviation, S.D.)로 변환하였다.
3) 상기 결과의 통계학적 유의성은 One-Way ANOVA test(GraphPad Prism software version 8.4.2)로 분석하였으며, p value가 0.05 이상인 value는 통계학적으로 유의성이 높은 것으로 평가하였다.
도 1a 및 1b에서 확인할 수 있듯이, 사스코로나바이러스 유형 2 혹은 인플루엔자 A 바이러스가 감염된 Vero E6 혹은 A549 세포에서 바이러스 증식이 시간의존적으로 증가하였지만, 지방적과 바이러스 단백질과는 공존(colocalization)은 되어 있지 않았다.
도 1a에서 확인할 수 있듯이, 사스코로나바이러스 유형 2가 감염된 세포에서 바이러스 무접종 대조군에 비해 감염된 세포에서 지방적의 수가 감염초부터 18시간까지 증가하다, 24시간부터 감소하였다.
또한 도 1b에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 세포에서 바이러스 무접종 대조군에 비해 감염된 세포에서 지방적의 수가 감염초부터 12시간까지 증가하다, 18시간부터 감소하였다.
사스코로나바이러스 유형 2 KCDC03주 혹은 인플루엔자 A 바이러스 PR8주의 감염에 따른 세포내 중성지방과 총 콜레스테롤의 변화를 보기 위해 각 세포를 100π 세포배양접시(100π cell culture dish)에 단층배양한 뒤 상술한 면역형광항체시험법과 동일한 조건으로 바이러스를 감염시킨 후 동일한 시간대에서 트립신을 이용해 세포를 수확한 뒤, hemocytometer로 세포수를 측정하였고, 각 분석에 5 × 106 개의 동일한 세포 수를 분주하여, 원심분리하고 인산완충액으로 수세하여 깨끗한 세포 펠렛으로 만든 뒤 영하 20℃에 냉동보관하였다.
사스코로나바이러스 유형 2 KCDC03주 혹은 인플루엔자 A 바이러스 PR8주의 배양 시간대별로 채취한 세포는 Cayman Chemicals에서 구입한 Colorimetric Triglyceride Assay와 Abcam에서 구입한 Colorimetric Cholesterol Assay를 이용해 제조사의 지침에 따라 아래와 같이 실험을 수행하였다.
중성지방(triacylglyceride; TG) 측정을 위해 세포 펠렛을 키트에서 제공된 Standard Diluent와 섞고, 음파처리(sonication)를 하고, 원심분리한 상층액을 각각 획득한 후 효소 믹스(Enzyme mixture)와 15분간 상온에서 반응시켰다. 흡광도는 570 nm에서 ELISA 판독기(reader)로 분석하였고, 같이 반응한 스탠다드 샘플을 이용해 정량하였다.
총 콜레스테롤(cholesterol) 측정을 위해 세포 펠렛을 키트에서 제공된 Cholesterol assay buffer와 섞고, 얼음 위에서 1분에 한 번씩 20분 동안 볼텍싱을 하여, 원심분리한 뒤 상층액을 얻어 Cholesterol Esterase가 포함된 Cholesterol Reaction Mix와 37℃에서 60분간 반응시켰다. 570 nm에서 ELISA reader에서 측정된 수치는 스탠다드 샘플에서 얻어낸 함수식을 기반으로, 총 콜레스테롤 함량을 계산하였다.
도 1c에서 확인할 수 있듯이, 사스코로나바이러스 유형 2가 감염된 Vero E6세포에서 세포질 내 중성지방 및 콜레스테롤이 감염초기부터 18시간까지는 증가하다 이후 감소하였다.
또한 도 1d에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 A549 세포에서 세포질 내 중성지방이 및 콜레스테롤 감염초기부터 18시간까지는 증가하다 이후 감소하였다.
결론적으로, 사스코로나바이러스 유형 2 및 인플루엔자 A 바이러스는 배양된 감염 세포에서는 초기부터 중기까지 지방적의 수 및 이의 구성 성분인 중성지방과 콜레스테롤이 증가된 후 감염 후기에는 감소하였다.
1-2. 소 코로나바이러스(BCoV), 돼지 유행성 설사 코로나바이러스(PEDV), 소 로타바이러스(RVA), 돼지 생식기 및 호흡기 증후군 바이러스(PRRSV), 돼지 사포바이러스(PSaV) 감염에 의한 배양 세포의 세포질 내 지방적 증감
상기의 목적을 달성하기 위해 세포 배양이 가능한 소 코로나바이러스 KWD20주, 돼지 유행성 설사 코로나바이러스 QIAP1401주, 소 로타바이러스 NCDV주, 돼지 생식기 호흡기 증후군 바이러스 LMY주, 돼지 사포바이러스 Cowden주와 같은 대표적인 RNA 바이러스들을 배양 세포에 감염시킨 후 지방적을 평가하였다.
소 코로나바이러스 배양을 위해 ATCC에서 구입한 사람 직결장암(human colorectal adenocarcinoma) 세포인 HRT-18G 세포를 10% 소태아혈청, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM에서 단층 배양하였다.
소 코로나바이러스 KWD20주의 역가를 측정하기 위해, 96-well plate(SPL Life Science, Pocheon, South Korea)에 HRT-18G 세포를 단층배양한 뒤, 별도의 96-well plate를 준비하여 DMEM을 희석액으로 하여 바이러스를 10배씩 계단 희석하고 마지막 well의 바이러스가 없는 DMEM 배지만 남게 하였다. 단층 배양된 HRT-18G로부터 배지를 제거하고 인산완충액으로 수세 후 각각의 계단 희석된 바이러스 혹은 바이러스가 없는 DMEM 배지를 HRT-18G 세포 위에 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다.
이후 인산완충액으로 수세하고, 5 μg/mL 포신 판크레아틴(porcine pancreatin)(Gibco, Fort Worth, TX, USA), 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ 인큐베이터에서 바이러스를 배양하였다. 24시간 후, 96-well plate에서 바이러스가 배양된 배지를 제거하고 인산완충액으로 수세한 다음 4% 파라포름알데히드로 20℃에서 10분 동안 고정시키고, 소 코로나바이러스 스파이크(spike) 단백질에 대한 항체(Native Antigen Company, Killington, UK)를 이용하여 면역형광항체법을 수행하였다. 본 특허에 사용된 소 코로나바이러스 KWD20주의 역가는 ffu/mL로 표시하였다.
상기의 목적을 달성하기 위해 HRT-18G 세포를 8-well 챔버(SPL)에 단층 배양 후, 챔버를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 소 코로나바이러스 KWD20주를 접종하였다. 37℃에서 1시간 동안 바이러스를 세포에 흡착시킨 다음 인산완충액으로 수세 후, 5 μg/mL 포신 판크레아틴(porcine pancreatin), 상기의 항생제가 첨가된 DMEM을 넣어준 후에 37℃ CO2 인큐베이터에서 18, 36, 54시간 동안 배양하고, 각기 챔버를 인산완충액으로 수세 후 4% 파라포름알데히드로 고정하고, 0.2% Triton-X를 20℃에서 10분 동안 처리하여 세포를 천공(permeabilization)하였다.
먼저 소 코로나바이러스 KWD20주의 감염에 따른 바이러스 단백질 및 지방적의 변화를 보기 위해, 상기의 방법에 따라 소 코로나바이러스의 스파이크 단백질에 대한 일차항체 및 AF647이 결합된 이차항체를 반응시킨 다음 지방적의 BODIPY 염색을 하였다. 그 다음 DAPI로 핵 염색을 한 후 마운팅을 수행했다.
각 바이러스 감염에 따른 지방적 및 호르몬 감수성 지방분해효소에 대한 면역형광항체시험법 결과는 Adobe Photoshop CS6을 이용해 실험예 1-1에서와 같은 방법으로 분석하였다.
도 2a에서 확인할 수 있듯이, 소 코로나바이러스 KWD20주를 단층배양된 HRT-18G 세포주에 무접종 혹은 접종한 결과, 바이러스 항원은 시험종료 54시간까지 지속적으로 증가되었지만, 지방적의 수는 증가하였다가 감염 36시간 이후 감소되었다.
돼지 유행성 설사 코로나바이러스 배양을 위해 ATCC에서 구입한 아프리카녹색원숭이 신장상피세포인 Vero E6 세포를 10% 소태아혈청, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 EMEM에서 단층 배양하였다.
돼지 유행성 설사 코로나바이러스 Q1401주의 역가를 측정하기 위해, 96-well plate에 Vero E6 세포를 단층배양한 뒤, Vero E6로부터 배지를 제거하고 인산완충액으로 수세 후 각각의 10배 계단 희석된 바이러스 혹은 바이러스가 없는 EMEM 배지를 Vero E6 세포 위에 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다.
이후 인산완충액으로 수세하고, 3 μg/mL 포신 판크레아틱 트립신(porcine pancreatic trypsin)(Sigma, St. Louis, MO, USA), 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 EMEM을 첨가한 후에 37℃ 인큐베이터에서 바이러스를 배양하였다. 24시간 후, 96-well plate에서 바이러스가 배양된 배지를 제거하고 인산완충액으로 수세한 다음 4% 파라포름알데히드로 20℃에서 10분 동안 고정시키고, 돼지 유행성 설사 코로나바이러스 뉴클레오캡시드(nucleocapsid, N) 단백질에 대한 항체(Medgene Labs, Brookings, SD, USA)를 이용하여 면역형광항체법을 수행하였다. 본 특허에 사용된 돼지 유행성 설사 코로나바이러스 Q1401주의 역가는 ffu/mL로 표시하였다.
상기의 목적을 달성하기 위해 Vero E6 세포를 8-well 챔버(SPL)에 단층 배양 후, 챔버를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 돼지 유행성 설사 코로나바이러스 Q1401주를 접종하였다. 37℃에서 1시간 바이러스를 세포에 흡착시킨 다음 인산완충액으로 수세 후, 3 μg/mL 포신 판크레아틴 트립신, 상기의 항생제가 첨가된 EMEM을 넣어준 후에 37℃ CO2 인큐베이터에서 18, 36, 54시간 동안 배양하고, 각기 챔버를 인산완충액으로 수세 후 4% 파라포름알데히드로 고정하고, 0.2% Triton-X를 20℃에서 10분 동안 처리하여 세포를 천공하였다.
먼저 돼지 유행성 설사 코로나바이러스 Q1401주의 감염에 따른 바이러스 단백질 및 지방적의 변화를 보기 위해, 상기의 방법에 따라 돼지 유행성 설사 코로나바이러스의 뉴클레오캡시드 단백질에 대한 일차항체 및 AF647이 결합된 이차항체를 반응시킨 다음 지방적의 BODIPY 염색을 하였다. 그 다음 DAPI로 핵 염색을 한 후 마운팅을 수행했다.
도 2b에서 확인할 수 있듯이, 돼지 유행성 설사 코로나바이러스 QIAP1401주를 단층배양된 Vero E6 세포주에 무접종 혹은 접종한 결과, 바이러스 항원은 시험종료 54시간까지 지속적으로 증가되었지만, 지방적의 수는 증가하였다가 감염 36시간 이후 감소되었다.
소 로타바이러스(bovine group A rotavirus) NCDV (G6P6[1])주는 ATCC에서 구입하였고, 바이러스 배양을 위해 ATCC에서 구입한 레서스 원숭이 신장상피세포인 MA104 세포를 10% 소태아혈청, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 α-MEM에서 단층 배양하였다.
소 로타바이러스 NCDV주의 역가를 측정하기 위해, 96-well plate에 MA104 세포를 단층배양한 뒤, 별도의 96-well plate를 준비하여 α-MEM을 희석액으로 하여 바이러스를 10배씩 계단 희석하고 마지막 웰의 바이러스가 없는 α-MEM 배지만 있게 하였다. 단층 배양된 MA104 세포로부터 배지를 제거하고 인산완충액으로 수세 후 각각의 계단 희석된 바이러스 혹은 바이러스가 없는 α-MEM 배지를 MA104 세포 위에 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다.
이후 인산완충액으로 수세하고, 10 μg/mL 결정화 트립신(crystalized trypsin)(Gibco), 100 μ/ml 페니실린, 100 μg/ml 스트렙토마이신이 첨가된 α-MEM을 첨가한 후에 37℃ 인큐베이터에서 바이러스를 배양하였다. 24시간 후, 96-well plate에서 바이러스가 배양된 배지를 제거하고 인산완충액으로 수세한 다음 4% 파라포름알데히드로 20℃에서 10분 동안 고정시키고, 소 로타바이러스 VP6 단백질에 대한 항체(Median Diagnostic, Chuncheon, South Korea)를 이용하여 면역형광항체법을 수행하였다. 사용된 소 로타바이러스 NCDV주의 역가는 ffu/mL로 표시하였다.
상기의 목적을 달성하기 위해 MA104 세포를 8-well 챔버(SPL)에 단층 배양 후, 챔버를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 소 로타바이러스 NCDV주를 접종하였다. 37℃에서 1시간 동안 바이러스를 세포에 흡착시킨 다음 인산완충액으로 수세 후, 5 μg/mL 판크레아틴, 상기의 항생제가 첨가된 α-MEM을 넣어준 후에 37℃ CO2 인큐베이터에서 12, 24, 36시간 동안 배양하고, 각기 챔버를 인산완충액으로 수세 후 4% 파라포름알데히드로 고정하고, 0.2% Trion-X를 20℃에서 10분 동안 처리하여 세포를 천공하였다.
먼저 소 로타바이러스 NCDV주의 감염에 따른 바이러스 단백질 및 지방적의 변화를 보기 위해, 상기의 방법에 따라 소 로타바이러스의 VP6 단백질에 대한 일차항체 및 AF647이 결합된 이차항체를 반응시킨 다음 지방적의 BODIPY 염색을 하였다. 그 다음 DAPI로 핵 염색을 한 후 마운팅을 수행하였다.
도 2c에서 확인할 수 있듯이, 소 로타바이러스 NCDV주를 단층배양된 MA104 세포주에 무접종 혹은 접종한 결과, 바이러스 항원은 시험종료 36시간까지 지속적으로 증가되었지만, 지방적의 수는 증가하였다가 감염 24시간 이후 감소되었다.
돼지 생식기 및 호흡기 증후군 바이러스의 배양을 위해 ATCC에서 구입한 아프리카녹색원숭이 세포인 MARC-145 세포를 10% 소태아혈청, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM에서 단층 배양하였다.
돼지 생식기 및 호흡기 증후군 바이러스 LMY주의 역가를 측정하기 위해, 96-well plate(SPL Life Science, Pocheon, South Korea)에 MARC-145 세포를 단층배양한 뒤, 별도의 96-well plate를 준비하여 DMEM을 희석액으로 하여 바이러스를 10배씩 계단 희석하고 마지막 웰의 바이러스가 없는 DMEM 배지만 있게 하였다. 단층 배양된 MARC-145로부터 배지를 제거하고 인산완충액으로 수세 후 각각의 계단 희석된 바이러스 혹은 바이러스가 없는 DMEM 배지를 MARC-145 세포 위에 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다.
이후 인산완충액으로 수세하고, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ 인큐베이터에서 바이러스를 배양하였다. 24시간 후, 96-well plate에서 바이러스가 배양된 배지를 제거하고 인산완충액으로 수세한 다음 4% 파라포름알데히드로 20℃에서 10분 동안 고정시키고, 돼지 생식기 및 호흡기 증후군 바이러스 매트릭스(matrix) 단백질에 대한 항체(Bioss Antibodies, Woburn, MA, USA)를 이용하여 면역형광항체법을 수행하였다. 본 특허에 사용된 돼지 생식기 및 호흡기 증후군 바이러스 LMY주의 역가는 ffu/mL로 표시하였다.
상기의 목적을 달성하기 위해 MARC-145 세포를 8-well 챔버에 단층 배양 후, 챔버를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 돼지 생식기 및 호흡기 증후군 바이러스 LMY주를 접종하였다. 37℃에서 1시간 동안 바이러스를 세포에 흡착시킨 다음 인산완충액으로 수세 후, 상기의 항생제가 첨가된 DMEM을 넣어준 후에 37℃ CO2 인큐베이터에서 24, 48, 72시간 동안 배양하고, 각기 챔버를 인산완충액으로 수세 후 4% 파라포름알데히드로 고정하고, 0.2% Triton-X를 20℃에서 10분 동안 처리하여 세포를 천공하였다.
먼저 돼지 생식기 및 호흡기 증후군 바이러스 LMY주의 감염에 따른 바이러스 단백질 및 지방적의 변화를 보기 위해, 상기의 방법에 따라 돼지 생식기 및 호흡기 증후군 바이러스의 매트릭스 단백질에 대한 일차항체 및 AF647이 결합된 이차항체를 반응시킨 다음 지방적의 BODIPY 염색을 하였다. 그 다음 DAPI로 핵 염색을 한 후 마운팅을 수행하였다.
도 2d에서 확인할 수 있듯이, 돼지 생식기 및 호흡기 증후군 바이러스 LMY주를 단층배양된 MARC-145 세포주에 무접종 혹은 접종한 결과, 바이러스 항원은 시험종료 72시간까지 지속적으로 증가되었지만, 지방적의 수는 증가하였다 감염 48시간 이후 감소되었다.
돼지 사포바이러스 배양을 위해 ATCC에서 구입한 돼지 신장상피세포 (Porcine kidney epithelium) LLC-PK 세포를 10% 소태아혈청, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 EMEM에서 단층 배양하였다.
돼지 사포바이러스 Cowden주의 역가를 측정하기 위해, 96-well plate에 LLC-PK 세포를 단층배양한 뒤, 별도의 96-well plate를 준비하여 EMEM을 희석액으로 하여 바이러스를 10배씩 계단 희석하고 마지막 well의 바이러스가 없는 EMEM 배지만 있게 하였다. 단층 배양된 LLC-PK 세포로부터 배지를 제거하고 인산완충액으로 수세 후 각각의 계단 희석된 바이러스 혹은 바이러스가 없는 EMEM 배지를 LLC-PK 세포 위에 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다.
이후 인산완충액으로 수세하고, 200 μM GCDCA(Sigma Aldrich), 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 LLC-PK을 첨가한 후에 37℃ 인큐베이터에서 바이러스를 배양하였다. 24시간 후, 96-well plate에서 바이러스가 배양된 배지를 제거하고 인산완충액으로 수세한 다음 4% 파라포름알데히드로 20℃에서 10분 동안 고정시키고, 돼지 사포바이러스 VPg 단백질에 대한 항체(실험실에서 직접 제조)를 이용하여 면역형광항체법을 수행하였다. 본 특허에 사용된 돼지 사포바이러스 Cowden주의 역가는 ffu/mL로 표시하였다.
상기의 목적을 달성하기 위해 LLC-PK 세포를 8-well 챔버(SPL)에 단층 배양 후, 챔버를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 돼지 사포바이러스 Cowden주를 접종하였다. 37℃에서 1시간 바이러스를 세포에 흡착시킨 다음 인산완충액으로 수세 후, 3 μg/mL 포신 판크레아틱 트립신, 상기의 항생제가 첨가된 EMEM을 넣어준 후에 37℃ CO2 인큐베이터에서 18, 36, 54시간 동안 배양하고, 각기 챔버를 인산완충액으로 수세 후 4% 파라포름알데히드로 고정하고, 0.2% Triton-X를 20℃에서 10분간 처리하여 세포를 천공하였다.
먼저 돼지 사포바이러스 Cowden주의 감염에 따른 바이러스 단백질 및 지방적의 변화를 보기 위해, 상기의 방법에 따라 돼지 사포바이러스의 VPg 단백질에 대한 일차항체 및 AF647이 결합된 이차항체를 반응시킨 다음 지방적의 BODIPY 염색을 하였다. 그 다음 DAPI로 핵 염색을 한 후 마운팅을 수행하였다.
도 2e에서 확인할 수 있듯이, 돼지 사포바이러스 Cowden주를 단층배양된 LLC-PK 세포주에 무접종 혹은 접종한 결과, 바이러스 항원은 시험종료 54시간까지 지속적으로 증가되었지만, 지방적의 수는 증가하였다가 감염 36시간 이후 감소되었다.
1-3. 사스코로나바이러스 유형 2(SARS-CoV-2) 감염에 의한 햄스터 폐포상피세포 및 인플루엔자 A 바이러스(IAV) 감염에 의한 마우스 세기관지 상피세포의 세포질 내 지방적 증감
각 바이러스에 감염된 배양 세포에서 관찰된 지방적의 변화가 바이러스가 감염된 동물에서도 나타나는지 확인하기 위해 사스코로나바이러스 유형 2 KCDC03주를 햄스터에 감염시키거나 혹은 마우스에 적응된 인플루엔자 A 바이러스 PR8주를 마우스에 감염시켜 시간대 별로 폐 조직을 채취하여 아래와 같이 실험을 수행하였다.
동물실험을 위한 모든 절차와 실험법은 실험에 사용되는 동물수를 최소화하고 유발할 수 있는 고통을 최소화하는 방향으로 진행하였으며, 한국생명공학연구원 및 전남대학교 동물실험윤리위원회의 승인을 받아 진행하였다(승인번호: KRIBB-AEC-21203, KRIBB-IBC-20210206, CNU IACUC-YB-2018-41).
각 실험동물로서 햄스터는 실험 시작 7일 전에 암컷 11주령 골든 시리안 햄스터(Golden Syrian hamsters)를 Janvier Labs (Saint-Berthevin, France)에서 구입하여 사용하였다. 사육실은 밤/낮 주기가 12시간/12시간으로 조절됐으며, 온도는 22-24℃, 습도는 40-55%였고, 햄스터는 고형사료와 멸균된 증류수를 자유섭취시켰다. 대표 햄스터는 안와정맥을 채혈하여 사스코로나바이러스 유형 2에 대한 항체검사를 ELISA로 수행하였으며, 그 결과 사스코로나바이러스 유형 2에 대한 항체는 혈액에서 검출되지 않았다.
사스코로나바이러스 유형 2 KCDC03주의 역가를 결정하기 위해 50% 조직 배양 감염 용량시험법(Median Tissue Culture Infectious Dose assay, TCID50)을 수행하였다. 먼저 96-well plate를 준비하여 DMEM을 희석액으로 하여 바이러스를 10배씩 계단 희석하고 마지막 well의 바이러스가 없는 DMEM배지만 있게 하였다. 96-well plate에 단층 배양된 Vero E6 세포로부터 배지를 제거하고 인산완충액으로 수세 후 각각의 계단 희석된 바이러스 혹은 바이러스가 없는 DMEM 배지를 Vero E6 세포 위에 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다. 이후 인산완충액으로 수세하고, 1 μg/ml TPCK-treated trypsin, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 EMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 96시간 배양 후 세포변성효과(cytopathic effect)를 기록하였다. 그 다음 Reed and Muench 법으로 분석하여 사스코로나바이러스 유형 2 KCDC03주의 역가를 TCID50/ml 로 산출하였다.
사스코로나바이러스 유형 2에 의해 햄스터에서 폐 병변을 확인하기 위해, 12주령 암컷 골든 시리안 햄스터를 자일렌과 졸레틸이 합제된 약재로 마취시킨 뒤, 100 μL의 인산완충액 혹은 105 TCID50 바이러스 수가 들어있는 100 μL의 인산완충액을 기도내투여법(intratracheal administration)으로 접종하였다.
햄스터는 감염 후 0(음성 대조군), 2, 4, 6, 8, 10 일째 매일 3마리씩 안락사시킨 후 부검을 수행하였고, 적출된 폐 중 좌측 엽은 조직병리분석 및 동결절편을 만들기 위해 4% 파라포름알데히드에서 일주일간 상온에서 고정시켰고, 우측 전엽, 중간엽, 후엽 및 덧엽은 모두 섞어 유제를 만든 후 세포질 내 유리지방산, 중성지방과 글리세롤 측정 및 사스코로나바이러스 유형 2 스파이크(Spike) 단백질 및 호르몬 감수성 지방분해효소를 평가하는데 사용하였다.
각 실험동물로서 마우스는 실험 시작 7일 전에 wild-type C57BL/6J 마우스를 샘타코(Osan, South Korea)에서 구입하였다. 사육실은 밤/낮 주기가 12시간/12시간으로 조절됐으며, 온도는 25℃였고, 마우스는 고형사료와 멸균된 증류수를 자유섭취시켰다. 대표 마우스는 안와정맥에서 혈액을 채혈하여 인플루엔자 A 바이러스에 대한 항체검사를 ELISA로 수행하였으며, 그 결과 인플루엔자 A 바이러스에 대한 항체는 혈액에서 검출되지 않았다.
인플루엔자 A 바이러스 PR8주의 반수치사량(50% Lethal Dose, LD50)을 결정하기 위해 암컷 8주령 wild-type C57BL/6J 마우스를 이용하였다. 실험군은 바이러스 무접종군, 101 PFU접종군, 102 PFU접종군, 103 PFU접종군, 104 PFU접종군 등 총 5개 실험군으로 나누었다. 각각 실험군의 마우스는 자일렌과 졸레틸이 합제된 약재로 마취시킨 뒤, 50 μL의 인산완충액 혹은 상술한 바이러스 수가 들어있는 50 μL의 인산완충액을 비강내투여법(intranasal administration)으로 접종하였다. 이후 15일간 관찰하면서, 생존율, 몸무게, 임상증상 등을 기록하였고, 죽은 마우스의 숫자를 기록하여 Reed and Muench 법으로 분석하여 LD50값을 산출하였다.
상기와 같이 인플루엔자 A 바이러스에 의해 마우스에 유도되는 폐 병변을 확인하기 위해 LD50의 20배에 해당하는 바이러스(10,000 PFU)를 8주령 암컷 wild-type C57BL/6J 마우스에 접종하였다. 마우스는 감염 후 0(음성 대조군), 1, 2, 3, 4, 5, 6, 7 일째 매일 4마리씩 안락사하여 부검을 수행하였고, 적출된 폐 중 좌측 엽은 조직병리분석 및 동결절편을 만들기 위해 4% 파라포름알데히드에서 일주일간 상온에서 고정시켰고, 우측 전엽, 중간엽, 후엽 및 덧엽은 모두 섞어 유제를 만든 후 세포질 내 유리지방산, 중성지방과 글리세롤 측정 및 인플루엔자 A 바이러스 PB1 단백질 및 호르몬 감수성 지방분해효소를 평가하는데 사용하였다.
상기 폐 조직에서 지방적 및 사스코로나바이러스 유형 2의 혹은 인플루엔자 A 바이러스 항원 평가를 위해, 고정된 조직을 가지고 3 ㎛ 동결절편 조직을 만들었다. 5% BSA로 블로킹을 한 이후 사스코로나바이러스 유형 2의 뉴클레오캡시드(nucleocapsid, N) 혹은 인플루엔자 A 바이러스 M2(membrane ion channel) 항원에 대한 일차항체를 4℃에서 16시간 동안 배양하였고, AF594-conjugated mouse IgG(H+L) 2차 항체를 20℃에서 한시간 동안 반응시켰다. 조직절편을 인산완충액으로 수세 후 지방적 염색을 위해 10 μM BODIPY로 20℃에서 15분 동안 반응시키고, 수세후 Slow-Fade Gold antifade reagent를 이용해 핵 염색 및 마운팅을 수행하였다.
도 3a 및 3b에서 확인할 수 있듯이, 사스코로나바이러스 유형 2에 감염된 햄스터의 폐포상피세포의 지방적이 바이러스 무접종 대조군에 비해 감염초부터 4일령까지 증가하다, 6일령부터 감소하였으며, 인플루엔자 A 바이러스가 감염된 마우스의 폐 세기관지 상피세포의 지방적이 바이러스 무접종 대조군에 비해 감염초부터 4일령까지 증가하다, 5일령부터 감소하였다.
상기 햄스터와 마우스에서 채취한 폐 조직에서 중성지방 검사를 수행하기 위해 100 mg 폐 조직에 500 μL NP40 Substitute Assay Reagent와 섞어 얼음 위에서 초음파균질화기(sonicator)를 강도(amplication) 40%, 2초/10초(작동/휴식) 조건 속에서 20번 반복 후, 원심분리하여 상층액을 채취하였다. 상층액은 NP40 Substitue Assay Reagent을 가지고 5배 희석하여, 10 μL를 96-well plate에 옮긴 뒤 150 μL Triglyceride Enzyme Mixture를 각 웰에 옮겨 20℃에서 15분 동안 반응시킨 뒤, ELISA 측정기로 570 nm에서 흡광도를 측정하였다.
상기의 햄스터와 마우스에서 채취한 폐 조직에서 콜레스테롤 검사를 수행하기 위해 100 mg 폐 조직을 상기의 세포 내 콜레스테롤 검사 방법과 동일하게 수행하여, ELISA 측정기로 570 nm에서 흡광도를 측정하였다.
도 3c 및 3d에서 확인할 수 있듯이, 사스코로나바이러스 유형 2에 감염된 햄스터의 폐에서 중성지방과 콜레스테롤 농도가 감염초기부터 4일령까지는 증가하다 이후 감소하였으며, 인플루엔자 A 바이러스가 감염된 마우스의 폐에서 중성지방과 콜레스테롤 농도가 감염초기부터 4일령까지는 증가하다 이후 감소하였다.
실험예 2: 세포질 내 호르몬 감수성 지방분해효소 증감
2-1. 사스코로나바이러스 유형 2(SARS-CoV-2)와 인플루엔자 A 바이러스(IAV) 감염에 의한 배양 세포의 세포질 내 호르몬 감수성 지방분해효소 증감
상기의 기술된 실험예 1과 같이 사스코로나바이러스 유형 2 KCDC03주에 감염된 Vero E6 세포 및 인플루엔자 A 바이러스 PR8주에 감염된 A549 세포를 준비하였다.
사스코로나바이러스 유형 2에 유도된 지방적에서 감염 후기 지방분해효소(hormone sensitive lipase, HSL) 활성에 의해 지방적 분해가 유도되는 것을 확인하기 위해, 8-well 챔버에 단층배양된 Vero E6 세포에 감염다중도가 0.1 ffu/cell인 사스코로나바이러스 유형 2 KCDC03주를 접종하여 상기 실험과 같이 37℃ CO2 인큐베이터에서 4, 8, 12, 18, 24, 36, 48시간 동안 배양한 후, 면역형광항체법을 위해 4% 파라포름알데히드로 세포를 고정하였다.
또한 인플루엔자 A 바이러스에 유도된 지방적에서 감염 후기 지방분해효소 활성에 의해 지방적 분해가 유도되는 것을 확인하기 위해, 8-well 챔버에 단층배양된 A549 세포에 감염다중도가 1 ffu/cell인 인플루엔자 A 바이러스 PR8주를 접종하여 상기 실험과 같이 37℃ CO2 인큐베이터에서 1, 4, 8, 12, 18, 24, 36시간 동안 배양한 후, 면역형광항체법을 위해 4% 파라포름알데히드로 세포를 고정하였다.
고정된 세포는 인산완충액으로 세포를 수세 후에 5% BSA로 20℃에서 1시간 블로킹 후 563번째 세린(Serine) 잔기에서 인산화된 호르몬 감수성 지방분해효소(phosphorylated hormone sensitive lipase (S563))에 대한 1차항체와 지방적 연관 단백질(lipid droplet-associated protein)인 perilipin3(PLIN3)에 대한 1차항체를 적용해 4℃에서 16시간 동안 배양시켰다. 다음날 인산완충액으로 수세 후, 2차항체로써 Alexa Fluorescence(AF) 488 혹은 AF594가 결합된 2차항체를 37℃에서 1시간 동안 반응시켰고, Slow-Fade Gold antifade reagent with DAPI를 이용해 핵염색 및 마운팅을 수행하였다.
바이러스 감염 시간에 따른 지방분해 변화양상은 실험예 1-1에서와 같은 방법으로 Adobe Photoshop PS6을 이용하여 촬영된 이미지를 픽셀단위로 호환시킨 다음, 인산화 된 호르몬 감수성 지방분해효소/PLIN3의 colocalization 양성 시그널 면적을 계산하여, 평균 ± 표준오차로 나타내 평가하였다.
도 4a 및 4b에서 확인할 수 있듯이, 사스코로나바이러스 유형 2가 감염된 Vero E6 세포 및 인플루엔자 A 바이러스가 감염된 A549 세포에서 인산화 HSL과 PLIN3이 공존(colocalization)한 지방적은 감염중기부터 증가하였는데, 이는 인산화된 HSL이 감염중기부터 지방적의 분해를 유도한다는 것을 의미한다.
세포질 내 유리지방산(Free Fatty Acid; FFA)과 글리세롤(Glycerol) 수치를 구하기 위해 100π 세포배양접시에 단층배양 된 Vero E6 세포에 감염다중도가 0.1 ffu/cell인 사스코로나바이러스 유형 2 KCDC03를 접종하여 상기 실험과 같이 37℃ CO2 인큐베이터에서 4, 8, 12, 18, 24, 36, 48시간 동안 배양한 후, 트립신을 이용해 세포를 분리후 수확하였다.
또한 100π 세포배양접시에 단층배양 된 A549 세포에 감염다중도가 1 ffu/cell인 인플루엔자 A 바이러스 PR8를 접종하여 상기 실험과 같이 37℃ CO2 인큐베이터에서 1, 4, 8, 12, 18, 24, 36시간 동안 배양한 후, 트립신을 이용해 세포를 분리후 수확하였다. 수확된 세포는 혈구계산기(hemocytometer)로 정량하였고 5 x 106 개의 동일한 세포를 각 ep-tube에 분주하였다. 원심분리 후 세포 펠렛은 인산완충액으로 수세를 마치고 유리지방산 및 글리세롤 함량분석에 사용되었다.
Fatty Acid Colorimetric Assay Kit는 BioVision(Milpitas, CA, USA)에서 구입하였으며, 제조사의 지침에 따라 500 μL 클로르포름(Chlorform)과 1% 트리톤(Triton-X)을 세포 펠렛에 넣어 5분마다 볼텍싱하여 균질하게 섞은 뒤 유기물층(organic phase)를 회수하여 공기 중 건조하고 형성된 펠렛을 400 μL Fatty Acid Assay Buffer을 넣은 뒤 용해시켰다. 5분 동안 강하게 볼텍싱하고 추출된 상층액 50 μL과 2 μL ACS Reagent을 섞어 96-well plate의 해당된 웰에 옮겼고, 양성대조군으로 제공된 표준 지방산 용액 50 μL과 2 μL ACS Reagent를 섞은 것도 96-well plate의 해당된 웰에 옮겼다. 각 웰은 50 μL Enzyme Mix을 첨가하여 37℃에서 30분간 반응시킨 후 ELISA 판독기를 이용해 570 nm에서 흡광도를 측정하였다. 제조사 지침에 따라 표준 지방산 용액을 통해 얻은 검량선을 적용해 각 샘플의 지방산 농도를 측정하였다.
Glycerol Colorimetric Assay Kit는 BioVision(Milpitas, CA, USA)에서 구입하였으며, 제조사의 지침에 따라 세포 펠렛은 Glycerol Assay Buffer와 섞은 후 5분 간격으로 20분간 강하게 볼텍싱을 하였다. 원심분리 후 획득한 각 샘플의 50 μL 상층액을 96-well plate의 해당된 웰에 분주하였고, 또한 양성대조군으로 제공된 표준 글리세롤 용액 50 μL을 96-well plate의 해당된 웰에 분주하였다. 이 후 50 μL의 Reaction Mixture을 각 샘플 및 양성대조군이 있는 각 웰에 첨가하여 상온에서 30분간 반응시켰다. 흡광도는 ELISA 판독기를 이용해 570 nm에서 측정하였고, 제조사 지침에 따라 표준 글리세롤 용액을 통해 얻은 검량선을 적용해 각 샘플의 글리세롤 농도를 측정하였다.
도 4c 및 4d에서 확인할 수 있듯이, 사스코로나바이러스 유형 2에 감염된 Vero E6 세포의 세포질 내 유리지방산과 글리세롤의 수치가 감염 24시간, 36시간 및 48시간에 급격히 증가하였고, 인플루엔자 A 바이러스가 감염된 A549 세포의 세포질 내 유리지방산과 글리세롤의 수치가 감염 24시간 및 36시간에 급격히 증가하였다. 이는 사스코로나바이러스 유형 2 및 인플루엔자 A 바이러스에 의해 감염 후기 세포질 내 지방적의 분해가 증가했고, 그로 인해 세포 내 지방적의 최종 분해 산물인 유리지방산과 글리세롤이 증가한 것임을 의미한다.
2-2. 소 코로나바이러스(BCoV), 돼지 유행성 설사 코로나바이러스(PEDV), 소 로타바이러스(RVA), 돼지 생식기 및 호흡기 증후군 바이러스(PRRSV), 돼지 사포바이러스(PSaV) 감염에 의한 배양 세포의 세포질 내 호르몬 감수성 지방분해효소 증감
소 코로나바이러스 KWD20주의 감염에 따른 지방적과 호르몬 감수성 지방분해효소(hormone-sensitive lipase, HSL)의 변화를 평가하기 위해, HRT-18G 세포를 8-well 챔버(SPL)에 단층 배양 후, 챔버를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 소 코로나바이러스 KWD20주를 접종하였다. 37℃에서 1시간 동안 바이러스를 세포에 흡착시킨 다음 인산완충액으로 수세 후, 5 μg/mL 판크레아틴(pancreatin), 상기의 항생제가 첨가된 DMEM을 넣어준 후에 37℃ CO2 인큐베이터에서 18, 36, 54시간 동안 배양하고, 각기 챔버를 인산완충액으로 수세 후 4% 파라포름알데히드로 고정하고, 0.2% Triton-X를 20℃에서 10분 동안 처리하여 세포를 천공하였다. 이 후 인산화 된 호르몬 감수성 지방분해효소(S563)에 대한 일차항체 및 AF647이 결합된 이차항체를 반응시켰다. 그 다음 지방적의 BODIPY 염색을 한 다음 DAPI로 핵 염색 한 후 마운팅을 수행했다.
도 5a에서 확인할 수 있듯이, 소 코로나바이러스 KWD20주를 단층배양된 HRT-18G 세포주에 무접종 혹은 접종한 결과, 지방적의 수는 감염 36시간 이후 감소되었고, 반면에 인산화된 HSL은 감염 36시간에 최고치로 확인되었다.
돼지 유행성 설사 바이러스 Q1401주의 감염에 따른 지방적과 호르몬 감수성 지방분해효소(HSL)의 변화를 평가하기 위해, Vero E6 세포를 8-well 챔버(SPL)에 단층 배양 후, 챔버를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 돼지 유행성 설사 코로나바이러스 Q1401주를 접종하였다. 37℃에서 1시간 바이러스를 세포에 흡착시킨 다음 인산완충액으로 수세 후, 3 μg/mL 포신 판크레아틱 트립신, 상기의 항생제가 첨가된 EMEM을 넣어준 후에 37℃ CO2 인큐베이터에서 18, 36, 54시간 동안 배양하고, 각기 챔버를 인산완충액으로 수세 후 4% 파라포름알데히드로 고정하고, 0.2% Triton-X를 20℃에서 10분 동안 처리하여 세포를 천공하였다. 이 후 인산화 된 호르몬 감수성 지방분해효소(S563)에 대한 1차항체 및 AF647이 결합된 2차항체를 반응시켰다. 그 다음 지방적의 BODIPY 염색을 한 다음 DAPI로 핵 염색 한 후 마운팅을 수행했다.
도 5b에서 확인할 수 있듯이, 돼지 유행성 설사 코로나바이러스 QIAP1401주를 단층배양된 Vero E6 세포주에 무접종 혹은 접종한 결과, 바이러스 항원은 시험종료 36시간까지 지속적으로 증가되었지만, 지방적의 수는 감염 36시간 이후 감소되었고, 반면에 인산화된 HSL은 감염 36시간에 최고치로 확인되었다.
소 로타바이러스 NCDV주의 감염에 따른 지방적과 호르몬 감수성 지방분해효소(HSL)의 변화를 평가하기 위해, 각 목적을 달성하기 위해 MA104 세포를 8-well 챔버(SPL)에 단층 배양 후, 챔버를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 소 로타바이러스 NCDV주를 접종하였다. 37℃에서 1시간 동안 바이러스를 세포에 흡착시킨 다음 인산완충액으로 수세 후, 5 μg/mL 판크레아틴, 상기의 항생제가 첨가된 α-MEM을 넣어준 후에 37℃ CO2 인큐베이터에서 12, 24, 36시간 동안 배양하고, 각기 챔버를 인산완충액으로 수세 후 4% 파라포름알데히드로 고정하고, 0.2% Trion-X를 20℃에서 10분 동안 처리하여 세포를 천공하였다. 이 후 인산화 된 호르몬 감수성 지방분해효소(S563)에 대한 1차항체 및 AF647이 결합된 2차항체를 반응시켰다. 그 다음 지방적의 BODIPY 염색을 한 다음 DAPI로 핵 염색 한 후 마운팅을 수행했다.
도 5c에서 확인할 수 있듯이, 소 로타바이러스 NCDV주를 단층배양된 MA104 세포주에 무접종 혹은 접종한 결과, 지방적의 수는 감염 24시간 이후 감소되었고, 반면에 인산화된 HSL은 감염 24시간에 최고치로 확인되었다.
돼지 생식기 호흡기 증후군 바이러스 LYM주의 감염에 따른 지방적과 호르몬 감수성 지방분해효소(HSL)의 변화를 평가하기 위해, MARC-145 세포를 8-well 챔버에 단층 배양 후, 챔버를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 돼지 생식기 및 호흡기 증후군 바이러스 LMY주를 접종하였다. 37℃에서 1시간 동안 바이러스를 세포에 흡착시킨 다음 인산완충액으로 수세 후, 상기의 항생제가 첨가된 DMEM을 넣어준 후에 37℃ CO2 인큐베이터에서 24, 48, 72시간 동안 배양하고, 각기 챔버를 인산완충액으로 수세 후 4% 파라포름알데히드로 고정하고, 0.2% Triton-X를 20℃에서 10분 동안 처리하여 세포를 천공하였다. 이 후 인산화 된 호르몬 감수성 지방분해효소(S563)에 대한 1차항체 및 AF647이 결합된 2차항체를 반응시켰다. 그 다음 지방적의 BODIPY 염색을 한 다음 DAPI로 핵 염색 한 후 마운팅을 수행했다.
도 5d에서 확인할 수 있듯이, 돼지 생식기 및 호흡기 증후군 바이러스 LMY주를 단층배양된 MARC-145 세포주에 무접종 혹은 접종한 결과, 지방적의 수는 감염 48시간 이후 감소되었고, 반면에 인산화된 HSL은 감염 48시간에 최고치로 확인되었다.
돼지 사포바이러스 Cowden주의 감염에 따른 지방적과 호르몬 감수성 지방분해효소(HSL)의 변화를 평가하기 위해, LLC-PK 세포를 8-well 챔버(SPL)에 단층 배양 후, 챔버를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 돼지 사포바이러스 Cowden주를 접종하였다. 37℃에서 1시간 바이러스를 세포에 흡착시킨 다음 인산완충액으로 수세 후, 3 μg/mL 포신 판크레아틱 트립신, 200 μM glycochenodeoxycholic acid(GCDCA), 상기의 항생제가 첨가된 EMEM을 넣어준 후에 37℃ CO2 인큐베이터에서 18, 36, 54시간 동안 배양하고, 각기 챔버를 인산완충액으로 수세 후 4% 파라포름알데히드로 고정하고, 0.2% Triton-X를 20℃에서 10분간 처리하여 세포를 천공하였다. 이 후 인산화 된 호르몬 감수성 지방분해효소(S563)에 대한 1차항체 및 AF647이 결합된 2차항체를 반응시켰다. 그 다음 지방적의 BODIPY 염색을 한 다음 DAPI로 핵 염색 한 후 마운팅을 수행했다.
도 5e에서 확인할 수 있듯이, 돼지 사포바이러스 Cowden주를 단층배양된 LLC-PK 세포주에 무접종 혹은 접종한 결과, 지방적의 수는 감염 36시간 이후 감소되었고, 반면에 인산화된 HSL은 감염 36시간에서 최고치로 확인되었다.
각 바이러스 감염에 따른 지방적 및 호르몬 감수성 지방분해효소에 대한 면역형광항체시험법 결과는 실험예 1-1에서와 같은 방법으로 Adobe Photoshop PS6을 이용하여 촬영된 이미지를 픽셀단위로 호환시킨 다음, 인산화 된 호르몬 감수성 지방분해효소(S563)/BODIPY의 colocalization 양성 시그널 면적을 계산하여, 평균 ± 표준오차로 나타내 평가하였다.
결론적으로, 사스코로나바이러스 유형 2 및 인플루엔자 A 바이러스와 동일하게 소 코로나바이러스, 돼지 유행성 설사 코로나바이러스, 소 로타바이러스, 돼지 생식기 및 호흡기 증후군 바이러스, 돼지 사포바이러스도 배양된 감염 세포에서 감염 중기까지 지방적의 수가 증가된 후 감염 후기에는 감소하였으며, 지방적의 수가 감소된 이유는 감염 중기이후 활성화된 지방분해효소인 인산화된 HSL에 의해서였다.
2-3. 사스코로나바이러스 유형 2(SARS-CoV-2) 감염에 의한 햄스터 폐포 상피세포와 인플루엔자 A 바이러스(IAV) 감염에 의한 마우스 세기관지에서 상피세포의 세포질 내 호르몬 감수성 지방분해효소 증감
상기에서 상술한 바와 같이 105 TCID50에 해당하는 사스코로나바이러스 유형 2 KDCD03주를 접종한 햄스터는 감염 후 0(음성 대조군), 2, 4, 6, 8, 10일째 매일 3마리씩 안락사 후 부검을 수행하였고, 적출된 폐 중 좌측 엽은 조직병리분석 및 동결절편을 만들기 위해 4% 파라포름알데히드에서 일주일간 상온에서 고정시켰고, 우측 전엽, 중간엽, 후엽 및 덧엽은 모두 섞어 유제를 만든 후 세포질 내 유리지방산과 글리세롤 측정, 사스코로나바이러스 유형 2 스파이크(Spike) 단백질 및 호르몬 감수성 지방분해효소를 평가하는데 사용하였다
상기에서 상술한 바와 같이 1,000 PFU에 해당하는 인플루엔자 A 바이러스를 접종한 마우스는 감염 후 0(음성 대조군), 1, 2, 3, 4, 5, 6, 7일째 매일 4마리씩 안락사 후 부검을 수행하였고, 적출된 폐 중 좌측 엽은 조직병리분석 및 동결절편을 만들기 위해 4% 파라포름알데히드에서 일주일간 상온에서 고정시켰고, 우측 전엽, 중간엽, 후엽 및 덧엽은 모두 섞어 유제를 만든 후 세포질 내 유리지방산 글리세롤 측정, 인플루엔자 A 바이러스 PB1 단백질 및 호르몬 감수성 지방분해효소를 평가하는데 사용하였다.
상기 폐 조직에서 인산화된 호르몬 감수성 지방분해효소(S563) 및 사스코로나바이러스 유형 2의 혹은 인플루엔자 A 바이러스 항원 평가를 위해, 고정된 조직을 가지고 3 ㎛ 동결절편 조직을 만들었다. 5% BSA로 블로킹을 한 이후 사스코로나바이러스 유형 2의 뉴클레오캡시드(nucleocapsid, N) 혹은 인플루엔자 A 바이러스 M2(membrane ion channel) 항원에 대한 1차항체를 4℃ 16시간 동안 배양하였고, AF594-conjugated mouse IgG(H+L) 2차항체를 20℃에서 한시간 동안 반응시켰다. 조직절편을 인산완충액으로 수세 후 지방적 염색을 위해 10 μM BODIPY로 20℃에서 15분 동안 반응시키고, 수세후 Slow-Fade Gold antifade reagent를 이용해 핵염색 및 마운팅을 수행하였다.
도 6a에서 확인할 수 있듯이, 사스코로나바이러스 유형 2에 감염된 햄스터의 폐포 상피세포에서 인산화 된 호르몬 감수성 지방분해효소(hormone-sensitive lipase, HSL) 및 사스코로나바이러스 유형 2 뉴클레오캡시드(nucleocapsid, N)이 바이러스 무접종 대조군에 감염 2일령과 4일령에서 크게 증가하였다가 6일령부터 감소하였다.
또한 도 6b에서 확인할 수 있듯이, 인플루엔자 A 바이러스에 감염된 마우스의 폐 세기관지 상피세포에서 인산화 된 호르몬 감수성 지방분해효소 및 인플루엔자 A 바이러스 M2 단백질이 바이러스 무접종 대조군에 감염 5일령 및 6일령까지 크게 증가하였다가 7일령에 감소하였다.
바이러스 및 세포의 단백질 검사를 위한 웨스턴블롯(western blotting)을 수행하기 위해 햄스터 혹은 마우스 100 mg 폐 조직을 단백분해효소 및 포스파타아제 억제제가 포함되어 있는 RIPA 버퍼를 넣어 융해시킨 뒤, 비드를 넣고 Precellys 23 instrument 호모게나이져(homogenizer)를 사용하여 유제를 만든 다음 원심분리하여 상층액을 획득하였다. 상층액에 있는 총 단백질량은 BCA Assay Kit(Thermo Scientific)로 정량하였고, 정량된 단백질은 SDS-PAGE(sodium dodecyl sulfate-polyacrylamide gel)에서 전기영동 하였다.
용해된 단백질은 나이트로셀룰로오스스 멤브레인(nitrocellulose membranes, GE Healthcare Life Sciences)으로 전이시켰고, 전이된 멤브레인은 5% Skim Milk 용액에서 상온에서 1시간 블로킹을 한 뒤, TBST로 수세한 다음, 사스코로나바이러스 유형 2 스파이크, 인플루엔자 A 바이러스 PB1, 563번째 세린 잔기에서 인산화된 호르몬 감수성 지방분해효소(phosphorylated hormone sensitive lipase (S563)), 660번째 세린 잔기에서 인산화된 호르몬 감수성 지방분해효소(S660), 전체 호르몬 감수성 지방분해효소, 숙주 GAPDH 단백질 또는 숙주 β-actin 단백질에 대한 1차항체를 4℃에서 16시간 적용시켰다.
다음날 HRP(horse raddish peroxidase)가 결합된 마우스 혹은 토끼 IgG에 대한 2차항체를 20℃에서 한시간 적용 후, HRP의 효소반응은 chemoluminescence reaction kit(DoGen, Seoul, south Korea)을 사용하여 증강시켰으며, 각각의 표적 단백질에 대한 반응상은 Davinch-Western Imaging System(Young Ltd., Seoul, South Korea)을 이용하여 측정하였다. 또한 동량의 단백질이 검사되었는지를 확인하기 위해, 단백질이 전이된 멤브레인에 GAPDH 또는 β-actin에 대한 항체로 작용시킨 후, 표적 단백질의 강도와 비교하였다. 또한 표적 단백질인 인산화 된 호르몬 감수성 지방분해효소는 단백질의 면역반응 강도는 ImageJ를 이용하여 호르몬 감수성 지방분해효소 강도와 비교하여 도표로 나타내었다.
도 6c에서 확인할 수 있듯이, 사스코로나바이러스 유형 2가 감염된 햄스터 폐포상피세포에서 인산화 된 호르몬 감수성 지방분해효소와 사스코로나바이러스 유형 2 스파이크 단백질 발현량이 감염 2일째부터 급속히 증가하여 4일째까지 높은 수치를 유지하였다.
또한 도 6d에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 마우스의 폐 세기관지 상피세포에서 인산화된 호르몬 감수성 지방분해효소와 인플루엔자 A 바이러스 PB1 단백질 발현량이 감염 4일째부터 급속히 증가하여 7일째까지 높은 수치를 유지하였다.
상기 햄스터 및 마우스에서 채취한 조직의 유리지방산 검사를 수행하기 위해 1% Triton-X 100이 들어있는 클로르포름과 섞어 잘 섞은 뒤, 상기의 세포 내 유리지방산 검사 방법과 동일하게 수행하여, ELISA 측정기로 570 nm에서 흡광도를 측정하였다.
상기 햄스터 및 마우스에서 채취한 조직의 글리세롤 검사를 수행하기 위해 Glycerol Assay Buffer와 잘 섞은 뒤, 상기의 세포 내 글리세롤 검사 방법과 동일하게 수행하여, ELISA 측정기로 570 nm에서 흡광도를 측정하였다.
도 6e에서 확인할 수 있듯이, 사스코로나바이러스 유형 2가 감염된 햄스터 폐에서 유리지방산과 글리세롤이 감염 6일째까지 증가하였다.
또한 도 6f에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 마우스의 폐에서 유리지방산과 글리세롤이 감염 6일째까지 증가하였다.
결론적으로, 사스코로나바이러스 유형 2에 감염된 햄스터의 폐포상피세포에와 인플루엔자 A 바이러스에 감염된 마우스 폐 세기관지 상피세포의 감염 중후기 지방적의 감소는 인산화된 HLS과 같은 지방분해효소의 활성화에 기인하였으며, 지방적의 분해에 의해 유리지방산과 글리세롤이 증가하였다.
실험예 3: 사스코로나바이러스 유형 2(SARS-CoV-2) 감염에 의한 햄스터 폐포 상피세포와 인플루엔자 A 바이러스(IAV), 소 코로나바이러스(BCoV), 돼지 유행성 설사 코로나바이러스(PEDV), 소 로타바이러스(RVA), 돼지 생식기 및 호흡기 증후군 바이러스(PRRSV), 돼지 사포바이러스(PSaV) 감염에 의한 배양 세포의 세포질 내 유리지방산과 글리세롤의 증감
각 목적을 달성하기 위해 Vero E6 세포를 100π 세포배양접시(100π cell culture dish)에 단층배양 후, dish를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 사스코로나바이러스 유형 2 KDCD03주를 접종하였다. 감염 후 4, 8, 12, 18, 24, 36, 48시간 동안 배양한 후, 트립신을 이용해 분리된 세포를 수확하였다. 수확된 세포는 혈구계산기로 숫자를 측정하였고, 각 분석에 5 × 106 개의 동일한 세포 수를 분주하여, 원심분리하고 인산완충액으로 수세하여 깨끗한 세포 펠렛으로 만든 뒤 영하 20℃에 냉동보관하였다.
각 목적을 달성하기 위해 A549 세포를 100π 세포배양접시에 단층배양 후, dish를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 1 ffu/cell인 인플루엔자 A 바이러스 PR8주를 접종하였다. 감염 후 1, 4, 8, 12, 18, 24, 36시간 동안 배양한 후, 트립신을 이용해 분리된 세포를 수확하였다. 수확된 세포는 혈구계산기로 숫자를 측정하였고, 각 분석에 5 × 106 개의 동일한 세포 수를 분주하여, 원심분리하고 인산완충액으로 수세하여 깨끗한 세포 펠렛으로 만든 뒤 영하 20℃에 냉동보관하였다.
각 목적을 달성하기 위해 HRT-18G 세포를 100π 세포배양접시에 단층배양 후, dish를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 소 코로나바이러스 KWD20주를 접종하였다. 감염 후 18, 36, 54시간 동안 배양한 후, 트립신을 이용해 분리된 세포를 수확하였다. 수확된 세포는 혈구계산기로 숫자를 측정하였고, 각 분석에 5 × 106 개의 동일한 세포 수를 분주하여, 원심분리하고 인산완충액으로 수세하여 깨끗한 세포 펠렛으로 만든 뒤 영하 20℃에 냉동보관하였다.
각 목적을 달성하기 위해 Vero E6 세포를 100π 세포배양접시에 단층배양 후, dish를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 돼지 유행성 설사 코로나바이러스 Q1401주를 접종하였다. 감염 후 18, 36, 54시간 동안 배양한 후, 트립신을 이용해 분리된 세포를 수확하였다. 수확된 세포는 혈구계산기로 숫자를 측정하였고, 각 분석에 5 × 106 개의 동일한 세포 수를 분주하여, 원심분리하고 인산완충액으로 수세하여 깨끗한 세포 펠렛으로 만든 뒤 영하 20℃에 냉동보관하였다.
각 목적을 달성하기 위해 MA104 세포를 100π 세포배양접시에 단층배양 후, dish를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 소 로타바이러스 NCDV주를 접종하였다. 감염 후 12, 24, 36시간 동안 배양한 후, 트립신을 이용해 분리된 세포를 수확하였다. 수확된 세포는 혈구계산기로 숫자를 측정하였고, 각 분석에 5 × 106 개의 동일한 세포 수를 분주하여, 원심분리하고 인산완충액으로 수세하여 깨끗한 세포 펠렛으로 만든 뒤 영하 20℃에 냉동보관하였다.
각 목적을 달성하기 위해 MARC-145 세포를 100π 세포배양접시에 단층배양 후, dish를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 돼지 생식기 및 호흡기 증후군 바이러스 LMY주를 접종하였다. 감염 후 24, 48, 72시간 동안 배양한 후, 트립신을 이용해 분리된 세포를 수확하였다. 수확된 세포는 혈구계산기로 숫자를 측정하였고, 각 분석에 5 × 106 개의 동일한 세포 수를 분주하여, 원심분리하고 인산완충액으로 수세하여 깨끗한 세포 펠렛으로 만든 뒤 영하 20℃에 냉동보관하였다
각 목적을 달성하기 위해 LLC-PK 세포를 100π 세포배양접시에 단층배양 후, dish를 인산완충액으로 수세 후, 면역형광항체법에 의해서 결정된 감염다중도(MOI)가 0.1 ffu/cell인 돼지 사포바이러스 Cowden주를 접종하였다. 감염 후 18, 36, 54 시간 동안 배양한 후, 트립신을 이용해 분리된 세포를 수확하였다. 수확된 세포는 혈구계산기로 숫자를 측정하였고, 각 분석에 5 × 106 개의 동일한 세포 수를 분주하여, 원심분리하고 인산완충액으로 수세하여 깨끗한 세포 펠렛으로 만든 뒤 영하 20℃에 냉동보관하였다.
각 바이러스에 감염에 따른 세포내 유리지방산 분석은 위에서 상술한 것과 같이 Fatty Acid Colorimetric Assay Kit(BioVision)를 이용하였으며, 지침에 따라 500 μL 클로르포름(Chlorform)과 1% 트리톤(Triton-X)을 세포 펠렛에 넣어 5분마다 볼텍싱하여 균질하게 섞은 뒤 유기물층(organic phase)을 회수하여 공기 중 건조하고 형성된 펠렛을 400 μL Fatty Acid Assay Buffer을 넣은 뒤 용해시켰다. 5분 동안 강하게 볼텍싱하고 추출된 상층액 50 μL과 2 μL ACS Reagent을 섞어 96-well plate의 해당된 웰에 옮겼고, 양성대조군으로 제공된 표준 지방산 용액 50 μL과 2 μL ACS Reagent를 섞은 것도 96-well plate의 해당된 웰에 옮겼다. 각 웰은 50 μL Enzyme Mix을 첨가하여 37℃에서 30분간 반응시킨 후 ELISA 판독기를 이용해 570 nm에서 흡광도를 측정하였다. 제조사 지침에 따라 표준 지방산 용액을 통해 얻은 검량선을 적용해 각 샘플의 지방산 농도를 측정하였다.
각 바이러스에 감염에 따른 세포내 글리세롤 분석은 위에서 상술한 것과 같이 Glycerol Colorimetric Assay Kit는(BioVision)를 이용하였으며, 제조사의 지침에 따라 세포 펠렛은 Glycerol Assay Buffer와 섞은 후 5분 간격으로 20분간 강하게 볼텍싱을 하였다. 원심분리 후 획득한 각 샘플의 50 μL 상층액을 96-well plate의 해당된 웰에 분주하였고, 또한 양성대조군으로 제공된 표준 글리세롤 용액 50 μL을 96-well plate의 해당된 웰에 분주하였다. 이 후 50 μL의 Reaction Mixture을 각 샘플 및 양성대조군이 있는 각 웰에 첨가하여 상온에서 30분간 반응시켰다. 흡광도는 ELISA 판독기를 이용해 570 nm에서 측정하였고, 제조사 지침에 따라 표준 글리세롤 용액을 통해 얻은 검량선을 적용해 각 샘플의 글리세롤 농도를 측정하였다.
도 7a에서 확인할 수 있듯이, 사스코로나바이러스 유형 2에 감염된 Vero E6 세포의 세포질 내 유리지방산과 글리세롤의 수치가 감염 24시간, 36시간 및 48시간에 급격히 증가하였다.
또한 7b에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 A549 세포의 세포질 내 유리지방산과 글리세롤의 수치가 감염 24시간 및 36시간에 급격히 증가하였다.
또한 7c에서 확인할 수 있듯이, 소 코로나바이러스가 감염된 HRT-18G 세포의 세포질 내 유리지방산과 글리세롤의 수치가 감염 36시간 및 54시간에 급격히 증가하였다.
또한 7d에서 확인할 수 있듯이, 돼지 유행성 설사 코로나바이러스가 감염된 Vero E6 세포의 세포질 내 유리지방산과 글리세롤의 수치가 감염 36시간 및 54시간에 급격히 증가하였다.
또한 7e에서 확인할 수 있듯이, 소 로타바이러스가 감염된 MA104 세포의 세포질 내 유리지방산과 글리세롤의 수치가 감염 24시간 및 36시간에 급격히 증가하였다.
또한 7f에서 확인할 수 있듯이, 돼지 생식기 및 호흡기 증후군 바이러스가 감염된 MARC-145 세포의 세포질 내 유리지방산과 글리세롤의 수치가 감염 48시간 및 72시간에 급격히 증가하였다.
또한 7g에서 확인할 수 있듯이, 돼지 사포바이러스가 감염된 LLC-PK 세포의 세포질 내 유리지방산과 글리세롤의 수치가 감염 36시간 및 54시간에 급격히 증가하였다.
결론적으로, 사스코로나바이러스 유형 2, 인플루엔자 A 바이러스, 소 코로나바이러스, 돼지 유행성 설사 코로나바이러스, 소 로타바이러스, 돼지 생식기 및 호흡기 증후군 바이러스, 돼지 사포바이러스 감염 세포에서 후반기에 관찰되는 세포질 내 유리지방산과 글리세롤의 증가는 지방적의 분해에 의한 것임을 의미한다.
실험예 4: atglistatin 및 CAY10499의 사스코로나바이러스 유형 2(SARS-CoV-2) 및 인플루엔자 A 바이러스(IAV)의 증식 억제, 및 사스코로나바이러스 유형 2 스파이크 단백질과 인플루엔자 A 바이러스 혈구응집소(HA) 및 M2 단백질의 팔미토일화 억제
지방분해효소 억제에 따른 항바이러스효과를 검증하기 위해 지방질 중성지방 지방분해효소 억제제인 atglistatin(MedChemExpress; CAS Number: 1469924-27-3)와 지방분해효소 비선택적 억제제인 CAY10499(Cayman Chemicals; CAS Number: 359714-55-9)를 DMSO을 용매로 하여 20 mM을 준비하였다.
상기의 목적을 달성하기 위해 6-well plate에 단층배양 된 Vero E6 세포에 감염다중도가 0.1 ffu/cell인 사스코로나바이러스 유형 2 KCDC03주를 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다. 이후 인산완충액으로 수세하고, 1 μg/ml TPCK-treated trypsin, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 18시간 동안 배양하였다. 그 다음 인산완충생리식염수로 3번 각 웰을 수세한 다음 최종농도가 20 μM atglistatin 및 CAY10499이 포함된 배지로 교체하였다. 이후 18시간을 추가적으로 배양하여 배지 상층액은 자손 바이러스 수를 측정하기 위한 세포 배양 면역형광항체법(cell culture immunofluorescence assay, CCIF assay)에 사용하였고, RNA를 추출하여 바이러스 유전자수를 측정하였다.
바이러스 유전자 수 검사를 위해 세포 펠렛에서 RNeasy Mini Kit(Qiagen)을 사용하여 제조사의 지침에 따라 RNA를 추출하였으며, 추출된 RNA는 농도 및 순도를 측정하여 TOPscript™ cDNA Synthesis kit(Enzynomics)를 사용해 일차적인 cDNA를 합성하였다. 합성된 cDNA는 TOPreal™ qPCR 2X PreMix(Enzynomics)와 함께 사스코로나바이러스 유형 2 뉴클레오캡시드 유전자에 대한 프라이머(primer) 및 내부컨트롤(internal control)로서 60S 리보좀에 대한 L32 프라이머를 사용해 real-time PCR을 수행하였다. LineGene 9600 Plus Real-time PCR detection system(Bioer, Hangzhou, China)을 이용해 CT값을 측정하였으며, 내부컨트롤 대비 뉴클레오캡시드 유전자의 발현량을 측정하였고, 그 수치를 음성대조군과 비교한 값은 평균 ± 표준오차로 나타내었다.
세포 배양 면역형광항체법(CCIF assay)수행을 위해 바이러스 상층액을 EMEM 배지를 사용해 10배 단위로 계단희석한 뒤 마지막은 바이러스가 없는 배지를 준비하였다. 각 희석된 바이러스 및 음성 대조군 접종액 100 μL를 96-well plate에 단층배양된 Vero E6 세포에 접종하여 37℃에서 1시간 동안 배양하였다. EMEM에 1 μg/mL TPCK 트립신이 포함된 배지를 각 웰에 100 μL씩 분주 후 18시간 동안 배양하고, 배양배지를 제거 후 세포는 4% 파라포름알데하이드로 20℃에서 10분 동안 고정하였다. 이후 사스코로나바이러스 유형 2 뉴클레오캡시드(nucleocapsid, N) 단백질에 대한 항체를 이용한 세포 배양 면역형광항체법을 수행하였다.
세포질 내 유리지방산과 글리세롤 수치를 구하기 위해 100π 세포배양접시에 단층배양 된 Vero E6 세포에 감염다중도가 0.1 ffu/cell인 사스코로나바이러스 유형 2 KCDC03주를 접종 후 18시간째 상기의 atglistatin 및 CAY10499을 배지에 점적하여 약물의 최종농도가 20 μM가 되게 하였다. 이후 18시간을 배양하여 트립신을 이용해 세포를 수확하여 혈구계산기로 세포 수를 정량하고 5 x 106 개의 동일한 세포를 각 ep-tube에 분주하였다. 원심분리 후 세포 펠렛은 인산완충액으로 수세를 마치고 유리지방산 및 글리세롤 함량분석에 사용되었다.
상기의 목적을 달성하기 위해 8-well 챔버에 단층배양 된 Vero E6 세포에 감염다중도가 0.1 ffu/cell인 사스코로나바이러스 유형 2 KCDC03주를 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다. 이후 인산완충액으로 수세하고, 1 μg/ml TPCK-treated trypsin, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 18시간 동안 배양하였다. 그 다음 인산완충생리식염수로 3번 각 웰을 수세한 다음 최종농도가 20 μM atglistatin 및 CAY10499이 포함된 배지로 교체하였다. 이후 18시간을 추가적으로 배양 후 세포를 4% 파라포름알데하이드로 20℃에서 10분 동안 고정하였다. 이후 사스코로나바이러스 유형 2 스파이크 단백질에 대한 항체 및 지방적 BODIPY 염색을 이용하여 면역형광항체법을 수행하였다.
도 8a 내지 8d에서 확인할 수 있듯이, 사스코로나바이러스 유형 2 접종 후 atglistatin 및 CAY10499 처리군은 용매(vehicle) 처리군에 비해 바이러스 유전자 수(a), 자손 바이러스 수(b), 세포질 내 유리지방산과 글리세롤(c), 바이러스 스파이크 단백질 합성량(d)이 유의적으로 모두 감소하였으나, 지방적의 수는 유의성 있게 감소하지 않았다(d).
상기의 목적을 달성하기 위해 6-well plate에 단층배양 된 A549 세포에 감염다중도가 1 ffu/cell인 인플루엔자 A 바이러스 PR8주를 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다. 이후 인산완충액으로 수세하고, 1 μg/ml TPCK-treated trypsin, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 12시간 동안 배양하였다. 그 다음 인산완충생리식염수로 3번 각 웰을 수세한 다음 최종농도가 20 μM atglistatin 및 CAY10499이 포함된 배지로 교체하였다. 이후 12시간을 추가적으로 배양하여 배지 상층액은 자손 바이러스 수를 측정하기 위한 세포 배양 플라그어세이(plaque assay)에 사용하였고, RNA를 추출하여 바이러스 유전자수를 측정하였다.
바이러스 유전자 수 검사는 상기 방법과 동일하게 수행하되, 인플루엔자 A 바이러스 PB1 유전자에 대한 프라이머를 사용해 real-time PCR을 수행하였다.
플라크 어세이(plaque assay) 수행을 위해 바이러스 상층액을 DMEM 배지를 사용해 10배 단위로 계단희석한 뒤 마지막은 바이러스가 없는 배지를 준비하였다. 각 희석된 바이러스 및 음성 대조군 접종액 200 μL를 6-well plate에 단층배양된 MDCK 세포에 접종하여 37℃에서 1시간 동안 배양하였다. DMEM에 1 μg/mL TPCK 트립신, 0.5% 아가로즈(ultrapure agarose, Thermo Scientific)가 포함된 배지를 각 웰에 4 ml씩 분주 후 3일 동안 배양하고, 배양배지를 제거 후 세포는 4% 파라포름알데하이드로 20℃에서 10분 동안 고정하였다. 이후 인산완충액으로 수세 후 0.1 mg/mL 크리스탈 바이올렛(crystal violet)을 20℃에서 30분 동안 처리하여 세포를 염색하여 플라크 분석에 사용하였다.
세포질 내 유리지방산과 글리세롤 수치를 구하기 위해 100π 세포배양접시에 단층배양 된 A549 세포에 감염다중도가 1 ffu/cell인 인플루엔자 A 바이러스 PR8주를 접종 후 12시간째 상기의 atglistatin 및 CAY10499을 배지에 점적하여 약물의 최종농도가 20 μM가 되게 하였다. 이후 12시간을 배양하여 트립신을 이용해 세포를 수확하여 혈구계산기로 세포 수를 정량하고 5 x 106 개의 동일한 세포를 각 ep-tube에 분주하였다. 원심분리 후 세포 펠렛은 인산완충액으로 수세를 마치고 유리지방산 및 글리세롤 함량분석에 사용되었다.
바이러스 항원 및 지방적 분석을 위해 8-well 챔버에 단층 배양된 A549 세포에 감염다중도가 1 ffu/cell인 인플루엔자 A 바이러스 PR8주를 접종하였다. 37℃에서 바이러스를 12시간 동안 배양 후, 인산완충생리식염수로 3번 각 웰을 수세한 다음 최종농도가 20 μM atglistatin 및 CAY10499이 포함된 배지로 교체하였다. 이후 12시간을 추가적으로 배양 후 세포를 4% 파라포름알데하이드로 20℃에서 10분 동안 고정하였다. 이후 인플루엔자 A 바이러스 M2 단백질에 대한 항체 및 지방적 BODIPY 염색을 이용하여 면역형광항체법을 수행하였다.
도 8e 내지 8h에서 확인할 수 있듯이, 인플루엔자 A 바이러스 접종 후 atglistatin 및 CAY10499 처리군은 용매(vehicle) 처리군에 비해 바이러스 유전자 수(e), 자손 바이러스 수(f), 세포질 내 유리지방산과 글리세롤(g), 바이러스 M2 단백질 합성량(h)이 유의적으로 모두 감소하였지만, 지방적의 수는 유의성 있게 감소하지 않았다(h).
사스코로나바이러스 유형 2 스파이크 단백질, 인플루엔자 A 바이러스 혈구응집소 단백질 및 인플루엔자 A 바이러스 M2 단백질에 유리지방산(free fatty acid, FFA)이 붙는 팔미토일화(palmitoylation)는 바이러스 외막의 숙주세포와의 융합, 바이러스 조립 및 방출, 병원성에 중요하다.
지방분해효소 억제에 따른 사스코로나바이러스 유형 2 스파이크(spike) 단백질, 인플루엔자 A 바이러스 혈구응집소(hemagglutinin) 단백질과 인플루엔자 A 바이러스 막(membrane) 단백질의 팔미토일화 억제를 검증하기 위해 atglistatin 및 CAY10499를 DMSO을 용해하여 20 mM을 준비하였다.
각 목적을 달성하기 위해 Vero E6 세포에 감염다중도가 0.1 ffu/cell인 사스코로나바이러스 유형 2 KCDC03주를 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다. 이후 인산완충액으로 수세하고, 1 μg/ml TPCK-treated trypsin, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 18시간 동안 배양하였다. 그 다음 인산완충생리식염수로 3번 각 웰을 수세한 다음 최종농도가 20 μM atglistatin 및 CAY10499이 포함된 배지로 교체하였다. 이후 18시간을 더 배양하고 인산완충액으로 수세 후 트립신 처리 후 수확한 세포를 수확하여 원심분리하여 제조사의 지침에 따라 팔미토일화 분석(Palmitoylation Assay)(Badrilla, Leeds, UK)를 수행하였다.
각 목적을 달성하기 위해 A549 세포에 감염다중도가 1 ffu/cell인 인플루엔자 A 바이러스 PR8주를 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다. 이후 인산완충액으로 수세하고, 1 μg/ml TPCK-treated trypsin, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 12시간 동안 배양하였다. 그 다음 인산완충생리식염수로 3번 각 well을 수세한 다음 최종농도가 20 μM atglistatin 및 CAY10499이 포함된 배지로 교체하였다. 이후 12시간을 더 배양하고 인산완충액으로 수세 후 트립신 처리 후 수확한 세포를 수확하여 원심분리하여 제조사의 지침에 따라 팔미토일화 분석을 수행하였다.
즉, 세포 펠렛을 인산완충액으로 수세 후 Thiol Blocking Reagent가 포함된 Buffer A를 넣어 섞은 뒤, 지속적으로 교반한 채로 40℃에서 4시간 동안 배양하였다. 이후 70% 아세톤을 넣어 단백질을 침전시키고 상층액을 버리고, 다시 아세톤을 넣는 과정을 5회 반복한 후, 충분히 수세된 펠렛을 Binding buffer을 넣어 40℃에서 3시간 동안 용출시켰다. 원심분리 후 용출된 상층액 일부는 Laemmli Sample Buffer와 섞어 총 단백질 대조군(input control)로 사용하였으며, 나머지는 팔미토일화 된 단백질을 분리정제하는 단계를 거쳤다.
먼저 총 단백질 상층액을 CAPTUREomeTM Capture Resin과 Thio Cleavage Reagent을 넣어 20℃에서 3시간 동안 로터리 믹서(rotary mixer) 위에서 반응시켰다. 이후 레진을 획득하여 수세한 후, 레진에 결합한 팔미토일화 된 단백질은 Laemmli Sample Buffer을 넣어 레진으로부터 용출시켰다. 총 단백질 대조군과 팔미토일화 된 단백질은 사스코로나바이러스 유형 2 스파이크 단백질, 인플루엔자 A 바이러스 혈구응집소 및 M2 단백질에 대한 항체를 이용해 웨스턴블롯법으로 분석하였다.
도 8i에서 확인할 수 있듯이, 사스코로나바이러스 유형 2 접종 후 atglistatin 및 CAY10499 처리군은 용매(vehicle) 처리군에 비해 스파이크(S) 단백질의 팔미토일화를 유의적으로 감소시켰다.
또한 도 8j에서 확인할 수 있듯이, 인플루엔자 A 바이러스 접종 후 atglistatin 및 CAY10499 처리군은 용매 처리군에 비해 혈구응집소(H) 및 M2 단백질의 팔미토일화를 유의적으로 모두 감소시켰다.
결론적으로, 사스코로나바이러스 유형 2 및 인플루엔자 A 바이러스 감염에 의해 유도된 지방적은 감염 후기에 분해되며, 이로 인해 방출된 유리지방산은 사스코로나바이러스 유형 2 스파이크 단백질, 인플루엔자 A 바이러스 혈구응집소 단백질 및 인플루엔자 A 바이러스 M2 단백질에 팔미토일화를 일으킨다. 그러나 atglistatin 및 CAY10499은 지방적의 분해를 억제하여 유리지방산이 생성되지 않으므로, 바이러스 단백질의 팔미토일화를 억제하여 바이러스의 증식을 억제한다.
실험예 5: 지방분해효소 억제제인 atglistatin 및 CAY10499에 의한 반수 최대 세포 독성 농도, 지방분해효소 억제제에 대한 바이러스의 반수 최대 억제 농도, 및 선택지수
지방분해효소 억제제인 atglistatin 및 CAY10499의 반수 최대 세포 독성 농도(half maximal cytotoxic concentration, CC50)를 검사하기 위해서 96-well plate에 단층배양된 Vero E6, A549, HRT-18G, MA104, MARC-145 및 LLC-PK 세포를 준비하여 놓았다. 또한 atglistatine의 최종 농도가 160 μM 부터 2배씩 계단 희석하여 농도구배를 형성하여 배양배지를 준비하고(각 160, 80, 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.373, 0.186, 0.093, 0.046 μM), CAY10499의 최종 농도가 80 μM 부터 2배씩 계단 희석하여 농도구배를 형성하여 배양배지를 준비하였다(각 80, 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.373, 0.186, 0.093, 0.046 μM).
약물을 각 세포에 처리한 후 24시간 배양한 다음 각각의 배양액을 제거한 후, 200 μL의 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide(MTT) 용액을 넣은 후 36℃의 5% CO2 인큐베이터(incubator)에서 4시간 배양하였다. 이 후 150 μL의 DMSO 용액을 각 웰에 추가한 후 20℃에서 작용시켰다. 이 후 optical density(OD)는 enzyme-linked immunosorbent assay(ELISA) reader로 570 nm 파장에서 측정하였다.
상기의 목적을 달성하기 위해 96-well plate에 단층배양된 Vero E6 세포에 감염다중도가 0.01 ffu/cell인 사스코로나바이러스 유형 2 KCDC03주를, A549 세포에 감염다중도가 0.01 ffu/cell인 인플루엔자 A 바이러스 PR8주를, HRT-18G 세포에 감염다중도가 0.01 ffu/cell인 소 코로나바이러스 KWD20주를, Vero E6 세포에 감염다중도가 0.01 ffu/cell인 돼지 유행성 설사 코로나바이러스 QIAP1401주를, MA104 세포에 감염다중도가 0.01 ffu/cell인 소 로타바이러스 NCDV주를, MARC-145 세포에 감염다중도가 0.01 ffu/cell인 돼지 생식기 호흡기 증후군 바이러스 LMY주를, LLC-PK 세포에 감염다중도가 0.01 ffu/cell인 돼지 사포바이러스 Cowden주를 접종한 후 1시간 동안 바이러스를 흡착시켰다. 이후 인산완충생리식염수로 3번 각 웰을 수세한 다음 각 바이러스 배양배지로 교체해 주었다.
Atglistatin 및 CAY10499 반수 최대 세포 독성 농도 (μM)
Cell line CC50 (μM)
Atglistatin CAY10499
A549 205.9 105.7
Vero E6 226.4 101.8
MDCK 268.6 110.0
HRT18G 182.5 103.5
MA104 214.5 107.1
MARC 211.6 101.4
LLC-PK 224.2 108.9
표 6에서 확인할 수 있듯이, A549, Vero E6, MDCK, HRT18G, MA04, MARC, LLC-PK 세포에서의 atglistatin의 반수 최대 세포 독성 농도는 182.5~268.6로 높았고, CAY10499의 반수 최대 세포 독성 농도는 101.4~110.0로 높았지만, agtlistatin의 반수 최대 세포 독성 농도보다는 약간 낮았다.
Atglistatin 및 CAY10499의 바이러스에 대한 반수 최대 억제 농도(half maximal inhibitory concentration, IC50)를 검사하기 위해서 이후 사스코로나바이러스 유형 2를 18시간, 인플루엔자 A 바이러스를 12시간, 소 코로나바이러스를 18시간, 돼지 유행성 설사 코로나바이러스를 18시간, 소 로타바이러스를 12시간, 돼지 생식기 호흡기 증후군 바이러스를 18시간, 돼지 사포바이러스를 18시간 배양한 다음, 160, 80, 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.373, 0.186, 0.093 및 0.046 μM atglistatin이 포함된 배양배지 및 80, 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.373, 0.186, 0.093 및 0.046 μM CAY10499가 포함된 배양배지로 교체해 주었다. 그리고 사스코로나바이러스 유형 2를 18시간, 인플루엔자 A 바이러스를 12시간, 소 코로나바이러스를 18시간, 돼지 유행성 설사 코로나바이러스를 18시간 소 로타바이러스를 12시간, 돼지 생식기 호흡기 증후군 바이러스를 18시간, 돼지 사포바이러스를 18시간을 추가로 배양하고 상층액을 제거 후, 4% 파라포름알데하이드 용액으로 15분간 고정하였다.
고정을 마친 세포는 인산완충생리식염수로 3번 각 웰을 수세한 다음 0.2% Triton X-100(Sigma Aldrich)로 20℃에서 10분간 처리하였다. 인산완충생리식염수로 3번 각 웰을 수세한 후, 사스코로나바이러스 유형 2의 스파이크 단백질, 인플루엔자 A 바이러스의 뉴클레오프로테인(nucleoprotein) 단백질, 소 코로나바이러스 스파이크 단백질, 돼지 유행성 설사 코로나바이러스의 뉴클레오캡시드 단백질, 소 로타바이러스의 VP6 단백질, 돼지 생식기 호흡기 증후군 바이러스의 매트릭스 단백질, 돼지 사포바이러스의 VPg 단백질에 대한 100~200배 희석된 1차항체를 각각의 웰에 분주 후, 12시간 동안 4℃ 냉장고에서 작용시켰다.
이 후 상층액을 제거한 후, 인산완충생리식염수로 3번 각 웰을 수세한 다음 100~200배 희석된 Alexa Fluor 488(AF488) 혹은 fluorescein isothiocyanate(FITC)가 결합된 2차항체를 각각의 웰에 분주 후, 2시간 동안 실온에서 작용시켰다. 이 후 상층액을 제거한 후, propidium iodide 용액으로 핵을 염색 후, 60% 글리세롤 용액을 각각의 웰에 넣은 후, 형광현미경에서 각각의 바이러스 양성 세포들을 검사하였다. 이상의 실험을 바탕으로 CC50 값과 IC50 값을 계산한 후, 선택지수(selective index [SI = CC50/IC50]) 값은 CC50 값을 IC50 값으로 나누어서 계산하였다.
Atglistatin 및 CAY10499 반수 최대 억제 농도 및 선택지수
Virus family Virus (strain) IC50 (μM) SI (CC50/IC50)a
Atglistatin CAY10499 Atglistatin CAY10499
Orthomyxoviridae Influenza A virus (H1N1) (PR8) 1.07 4.13 251 27
Coronaviridae SARS-CoV-2 (KCDC03) 1.47 1.54 154 62
Coronaviridae Bovine coronavirus (KWD20) 1.20 7.30 152 11
Coronaviridae Porcine epidemic diarrhea coronavirus (QIAP1401) 1.96 3.19 116 30
Reoviridae Species A Rotavirus (NCDV) 6.70 20.85 32 4
Arteriviridae Porcine respiratory reproductive syndrome virus (LMY) 2.53 4.21 84 21
Caliciviridae Porcine sapovirus (Cowden) 3.11 11.76 72 8
표 7, 도 9a 내지 9g에서 확인할 수 있듯이, atglistatin는 반수 최대 억제 농도가 1.07~6.70 였으며, CAY10499는 1.54~20.85 였다. 특히 전 세계적으로 막대한 피해를 일으키고 있는 인플루엔자 A 바이러스와 사스코로나바이러스 유형 2에 대해 atglistatin은 0.82와 1.47였으며, CAY10499는 4.13와 1.54였다. 이는 인플루엔자 A 바이러스와 사스코로나바이러스 유형 2에 대해 agtlistatin과 CAY10499가 저농도에서도 높은 억제능력이 있다는 것을 의미한다.
또한 세포독성 대비 감염 억제력을 보여주는 선택지수에 있어서도 사스코로나바이러스 유형 2 KCDC03주, 인플루엔자 A 바이러스 PR8주, 소 코로나바이러스 KWD20주, 돼지 유행성 설사 코로나바이러스 QIAP1401주, 소 로타바이러스 NCDV주, 돼지 생식기 호흡기 증후군 바이러스 LMY주 및 돼지 사포바이러스 Cowden주에 대한 선택지수(SI)가 atglistatin은 154, 251, 152, 116, 32, 84, 72 였으며, CAY10499는 62, 27, 14, 30, 5, 24, 9 였다. 이는 atglistatin 및 CAY10499가 세포독성이 낮고 감염 억제능이 높다는 것을 의미한다.
실험예 6: 지방분해효소 억제제인 atglistatin 및 CAY10499에 의한 바이러스 게놈 수 및 자손 바이러스 생산 억제 효과
Atglistatin 및 CAY10499에 의한 각 바이러스 게놈 수 및 자손 바이러스 생산 억제 효과를 검출하기 위해 12-well plate에 단층배양된 Vero E6 세포에 감염다중도가 0.01 ffu/cell인 사스코로나바이러스 유형 2(SARS-CoV-2) KCDC03주를, A549 세포에 감염다중도가 0.01 ffu/cell인 인플루엔자 A 바이러스(IAV) PR8주를, HRT-18G 세포에 감염다중도가 0.01 ffu/cell인 소 코로나바이러스(BCoV) KWD20주를, Vero E6 세포에 감염다중도가 0.01 ffu/cell인 돼지 유행성 설사 코로나바이러스(PEDV) QIAP1401주를, MA104 세포에 감염다중도가 0.01 ffu/cell인 소 로타바이러스(RVA) NCDV주를, MARC0145 세포에 감염다중도가 0.01 ffu/cell인 돼지 생식기 호흡기 증후군 바이러스(PRRSV) LMY주를, LLC-PK 세포에 감염다중도가 0.01 ffu/cell인 돼지 사포바이러스 Cowden주를 접종 후, 1시간 동안 바이러스를 흡착시켰다.
이후 인산완충생리식염수로 3번 각 웰을 수세한 다음 각 바이러스 배양배지를 첨가해 사스코로나바이러스 유형 2를 18시간, 인플루엔자 A 바이러스를 12시간, 소 코로나바이러스를 18시간, 돼지 유행성 설사 코로나바이러스를 18시간, 소 로타바이러스를 12시간, 돼지 생식기 호흡기 증후군 바이러스를 18시간, 돼지 사포바이러스를 18시간 배양하였다.
이후 1, 10, 20 μM의 atglistatin 및 CAY10499가 포함된 배양배지로 교체한 후, 사스코로나바이러스 유형 2가 감염된 플레이트는 18시간, 인플루엔자 A 바이러스가 감염된 플레이트는 12시간, 소 코로나바이러스가 감염된 플레이트는 18시간, 돼지 유행성 설사 코로나바이러스가 감염된 플레이트는 18시간, 소 로타바이러스가 감염된 플레이트는 12시간, 돼지 생식기 호흡기 증후군 바이러스가 감염된 플레이트는 18시간, 돼지 사포바이러스가 감염된 플레이트는 18시간을 추가로 배양하였다. 그 다음 각 플레이트를 3번의 냉동 및 해동 과정을 통해 세포를 각 웰에서 떼어내어 다음 실험을 수행하였다.
각 바이러스에서 atglistatin 및 CAY10499에 의한 게놈 수 억제효과를 분석하기 위해 RNeasy mini kit(Qiagen)을 이용하여 RNA를 추출하였다. 추출한 RNA는 Random hexamer와 poly(rA)-oligo(dT)가 포함된 TOPscript™cDNA Synthesis kit(Enzynomics)를 이용해 cDNA를 합성하였다. 이 후, TOPreal™qPCR 2X PreMix(Enzynomics) 용액 내에 합성한 cDNA를 사스코로나바이러스 유형 2 뉴클레오캡시드(N), 인플루엔자 A 바이러스 PB1, 소 코로나바이러스 스파이크(S), 돼지 유행성 설사 코로나바이러스 뉴클레오캡시드(N), 소 로타바이러스 VP6, 돼지 생식기 호흡기 증후군 바이러스 매트릭스(M) 및 돼지 사포바이러스 VPg에 특이적인 프라이머를 각각 넣은 후 LineGene 9600 Plus Real-time PCR detection system(Bioer, Hangzhou, China)에서 real-time PCR을 수행하였다.
각 바이러스에서 atglistatin 및 CAY10499에 의한 자손 바이러스 생산 억제효과를 분석하기 위해 3번의 냉동 및 해동 과정을 통해 얻은 상층액을 10배 계단희석하였다. 그 다음 96-well plate에 단층배양된 Vero E6 세포에 사스코로나바이러스 유형 2 KCDC03주의 상층액을, A549 세포에 인플루엔자 A 바이러스 PR8주 상층액을, HRT-18G 세포에 소 코로나바이러스 KWD20주 상층액을, Vero E6 세포에 돼지 유행성 설사 코로나바이러스 QIAP1401주 상층액을, MA104 세포에 소 로타바이러스 NCDV주 상층액을, MARC-145 세포에 돼지 생식기 호흡기 증후군 바이러스 LMY주 상층액을, LLC-PK 세포에 돼지 사포바이러스 Cowden주 상층액을 흡착시킨 뒤, 각 웰을 인산완충식염수(pH 7.4)로 2회 세척 후, 각 배양배지를 첨가해 주었다.
이후 사스코로나바이러스 유형 2를 12시간, 인플루엔자 A 바이러스를 8시간, 소 코로나바이러스를 12시간, 돼지 유행성 설사 코로나바이러스를 12시간, 소 로타바이러스를 8시간, 돼지 생식기 호흡기 증후군 바이러스를 18시간, 돼지 사포바이러스를 12시간을 추가로 배양하였다. 그 다음 상층액을 제거 후, 4% 파라포름알데하이드 용액으로 15분간 고정한 후, 인산완충생리식염수로 3번 각 웰을 수세한 다음 0.2% Triton X-100로 20℃에서 10분간 처리하였다.
인산완충생리식염수로 3번 각 웰을 수세한 후, 사스코로나바이러스 유형 2의 스파이크 단백질, 인플루엔자 A 바이러스의 뉴클레오프로테인 단백질, 소 코로나바이러스 스파이크 단백질, 돼지 유행성 설사 코로나바이러스의 뉴클레오캡시드 단백질, 소 로타바이러스의 VP6 단백질, 돼지 생식기 호흡기 증후군 바이러스의 매트릭스 단백질, 돼지 사포바이러스의 VPg 단백질에 대한 100~200배 희석된 1차 항체를 각각의 웰에 분주 후, 12시간 동안 4℃ 냉장고에서 적용시켰다.
이후 상층액을 제거한 후, 인산완충생리식염수로 3번 각 웰을 수세한 다음 100~200배 희석된 Alexa Fluor 488 혹은 플루오레세인이소티오시안산염(fluorescein isothiocyanate)가 결합된 2차 항체를 각각의 웰에 분주 후, 2시간 동안 실온에서 작용시켰다. 이 후 상층액을 제거한 후, 프로피디움 요오드화물(propidium iodide) 용액으로 핵을 염색 후, 60% 글리세롤(glycerol) 용액을 각각의 웰에 넣은 후, 형광현미경에서 각각의 바이러스 양성 세포들을 검사하였다.
도 10a 내지 10d에서 확인할 수 있듯이, atglistatin 및 CAY10499는 1, 10, 20 μM 모든 농도에서 각 바이러스의 게놈 수 및 자손 바이러스 생산 수를 유의성 있게 그리고 농도의존적으로 감소시켰다. 따라서 지방분해효소 억제제를 사용함으로써 다양한 RNA 바이러스에서 광범위한 항바이러스 효과가 있음을 확인하였다.
실험예 7: 지방분해효소 억제제인 atglistatin 및 CAY10499 투여에 의한 인플루엔자 A 바이러스(IAV) 감염 마우스의 생존율, 체중저하, 임상증상, 바이러스 증식 및 병변 개선효과
인플루엔자 A 바이러스가 감염된 동물에서 지방분해효소 억제에 따른 항바이러스효과를 검증하기 위해 150 mg/ml atglistatin 및 150 mg/ml CAY10499을 DMSO에 용해하였다. 이후 농도에 따른 항바이러스 효과를 평가하기 위해 약물을 1.000, 0.500, 0.100, 0.010, 0.001 mg/ml 준비하였으며 이때 용매로서 DMSO:40% PEG:H2O가 1:4:5로 희석된 합제를 사용하였고, 약물이 완전히 녹을 때까지 볼텍싱을 하였다. 이 약물을 마우스에 200 μL 접종하면 각각 최종농도가 10.00, 5.00, 1.00, 0.10, 0.01 mg/kg/day가 되었다(도 11a).
Atglistatin의 항바이러스 효능평가를 위해 다음과 같이 마우스를 바이러스 무접종 및 무처치 그룹(No virus + vehicle), 인플루엔자 A 바이러스 PR8주 접종 및 무처치 그룹(IAV + vehicle), 인플루엔자 A 바이러스 PR8주 접종 및 0.01 mg/kg/day atglistatin 처치 그룹(IAV + atglistatin (0.01 mg kg-1 day-1)), 인플루엔자 A 바이러스 PR8주 접종 및 0.1 mg/kg/day atglistatin 처치 그룹(IAV + atglistatin (0.1 mg kg-1 day-1)), 바이러스 접종 및 1 mg/kg/day atglistatin 처치 그룹(IAV + atglistatin (1 mg kg-1 day-1)), 바이러스 접종 및 5 mg/kg/day atglistatin 처치 그룹(IAV + atglistatin (5 mg kg-1 day-1)), 바이러스 접종 및 10 mg/kg/day Atglistatin 처치 그룹(IAV + atglistatin (10 mg kg-1 day-1)) 등 총 7개의 실험군을 만들었다. 각 군은 7주령 암컷 wild-type C57BL/6J 마우스를 16마리씩 배치하였으며, 상술한 조건으로 1주일간 마우스를 계류한 후 8주령때 실험에 사용하였다. 또한 CAY10499의 항바이러스 효능평가를 위해 동일한 방법으로 atglistatin을 CAY10499로 대체하여 마우스 그룹을 준비하였다.
인플루엔자 A 바이러스 접종은 상기 실험과 동일한 방법으로 마취된 마우스에서 마우스 당 1,000 PFU로 비강내투여법으로 접종하였고, 바이러스 비접종의 경우 인산완충액만을 접종하였다. 이후 15일간 관찰하면서, 생존율, 몸무게, 임상증상 등을 매일 관찰 및 기록하였고 심각한 정도의 체중감소(30% 이상)를 보이는 마우스의 경우 안락사하여, 바이러스 감염에 의한 폐사한 것으로 기록하였다.
약물처치는 인플루엔자 A 바이러스 접종 2일 후부터, 매일 오전/오후 12시간 간격으로 동일한 시간에 하루 2회, 총 4일간 100 μL씩 주사기를 사용해 복강내투여법(intraperitoneal injection)으로 접종하였다. 무처치 그룹의 경우 약물 희석 용매 DMSO/40% PEG/H2O 합재를 복강내 투여하였다(도 11a).
감염 0일째 생존율 100%, 폐사율 0%를 기준으로 15일 동안 매일 폐사율을 측정하였고 바이러스 접종 및 무처치 그룹과의 생존율을 비교하였다. 통계적인 유의성은 Log Rank Test으로 분석하였으며, p value가 0.05 이상인 경우 유의성이 높다고 평가하였다.
도 11b 내지 11g에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 마우스에 지방분해효소 억제제인 atglistatin 및 CAY10499을 투여한 결과, 농도의존성으로 생존율, 체중저하, 임상증상이 개선되었다. 특히, atglistatin을 10 mg kg-1 day-1로 4일간 투여한 실험군에서는 생존율이 60%에 이르렀다.
그 다음 atglistatin 혹은 CAY10499을 처치하였을 때 폐 조직 내 유리지방산과 글리세롤, 바이러스 유전자의 수, 자손 바이러스 수에 미치는 영향을 평가하고자 하였다. 또한, 인플루엔자 A 바이러스 감염에 의한 폐렴을 얼마나 완화시킬 수 있는지, 마우스 폐 조직에서 바이러스 항원 및 지방적에 대한 면역형광염색을 통한 분석, 조직병리학적 분석, 바이러스 항원에 대한 면역조직화학염색을 통한 분석을 아래와 같이 실시하였다.
즉, 실험군을 바이러스 비접종 무처치 그룹(No virus + vehicle), 인플루엔자 A 바이러스 PR8주 접종 및 무처치 그룹(IAV + vehicle), 인플루엔자 A 바이러스 PR8주 접종 및 5 mg/kg/day atglistatin 처치 그룹(IAV + atglistatin (5 mg kg-1 day-1)), 인플루엔자 A 바이러스 PR8주 접종 및 5 mg/kg/day CAY10499 처치 그룹(IAV + CAY10499 (5 mg kg-1 day-1))을 두었다. 각 군은 7주령 암컷 wild-type C57BL/6J 마우스를 4마리씩으로 구성되었으며, 1주간 계류 후 8주령 때 본 실험에 사용하였다.
위에 상술한 것과 동일한 방법으로 인플루엔자 A 바이러스 PR8주를 마우스에 접종하였고, 바이러스 감염 후 2일째부터 4일 동안 약물처치를 하고 감염 후 6일째 안락사하여 부검을 실시하였다. 적출된 폐 중 좌측 엽은 조직병리분석 및 동결절편을 만들기 위해 4% 파라포름알데히드에서 일주일간 4℃에서 고정시켰고, 우측 전엽, 중간엽, 후엽 및 덧엽은 모두 섞어 잘게 잘라 세포질 내 유리지방산과 글리세롤, 바이러스 게놈 수 및 자손 바이러스 평가하는데 사용했다.
상기 조직의 유리지방산 검사를 수행하기 위해 1% Triton-X 100이 들어있는 클로르포름과 섞어 잘 섞은 뒤, 상기의 세포 내 유리지방산 검사 방법과 동일하게 수행하여, ELISA 측정기로 570 nm에서 흡광도를 측정하였다.
상기의 글리세롤 검사를 수행하기 위해 Glycerol Assay Buffer와 잘 섞은 뒤, 상기의 세포 내 글리세롤 검사 방법과 동일하게 수행하여, ELISA 측정기로 570 nm에서 흡광도를 측정하였다.
인플루엔자 A 바이러스 PB1 유전자 및 숙주의 β-액틴 유전자에 대해 real-time PCR을 수행해 바이러스의 유전자 수를 구하여 약물의 바이러스 유전자 억제 효과를 평가하였다.
플라그 어세이를 수행하기 위해 마우스 100 mg 폐 조직을 비드를 넣고 Bertin Technologies(Montigny-le-Bretonneux, France)에서 구입한 Precellys 23 instrument 호모게나이져(homogenizer)를 사용하여 폐 조직 유제를 만든 다음 원심분리하여 상층액을 채취하였다. 획득한 상층액은 계단 희석하여 위에 상술한 바와 같이 6-well plate에 단층배양된 MDCK 세포에서 플라크 어세이를 수행하여 각각의 약물에 의한 자손 바이러스 증식 억제 효과를 평가하였다.
도 11h 내지 11j에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 마우스에 지방분해효소 atglistatin 및 CAY10499을 투여한 결과, 폐 조직에서 유리지방산과 글리세롤 농도(h), 바이러스 유전자 수(i), 자손 바이러스 수(j)가 유의성 있게 감소시켰지만, atglistatin이 CAY10499 보다 더 많이 감소시켰다.
상기 폐 조직에서 지방적 및 인플루엔자 A 바이러스 항원 평가를 위해, 고정된 조직을 가지고 3 ㎛ 동결절편 조직을 만들었다. 5% BSA로 블로킹을 한 이후 인플루엔자 A 바이러스 M2 항원에 대한 일차항체를 4℃ 16시간 동안 배양하였고, AF594-conjugated mouse IgG(H+L) 2차 항체를 20℃에서 한시간 동안 반응시켰다. 조직절편을 인산완충액으로 수세 후 지방적 염색을 위해 10 μM BODIPY로 20℃에서 15분 동안 반응시키고, 수세후 Slow-Fade Gold antifade reagent를 이용해 핵염색 및 마운팅을 수행하였다.
도 11k에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 마우스에 지방분해효소 억제제인 atglistatin 및 CAY10499을 투여한 결과, 무처치 바이러스 접종군의 마우스에 비해 바이러스 접종 후 약물을 처치한 실험군의 마우스 세기관지 상피세포에서 바이러스 항원은 유의성 있게 크게 감소하였지만, 지방적의 수는 유의성 있게 감소하지 않았다.
상기 폐 조직에서 병리조직학적 분석을 위해 고정된 조직을 각급 알코올을 통한 탈수, 자일렌(xylene) 침투, 파라핀 봉입 후에 3 ㎛로 세절하였다. 조직 절편은 자일렌을 통하여 탈파라핀 하였고, 각급 알코올과 수세를 통하여 재함수 하였다. 재함수된 절편은 Hematoxylin & Eosin 염색을 하였고, 각급 알코올을 통하여 탈수와 자일렌을 통하여 중합과 봉입을 한 후 광학현미경으로 조직학적 검사를 수행하였다.
상기 폐 조직에서 인플루엔자 A 바이러스 항원에 대한 면역조직화학염색(immunohistochemistry)를 수행하기 위해 3 ㎛ 조직 절편을 탈파라핀, 수세 및 재함수를 거치고 pH 6.0 1 mM 시트레이트(citrate)에 넣어 고압멸균(autoclave)에 의한 항원복원(antigen retrieval)을 통해 3% 과산화수소(H2O2)로 내인성 peroxidase를 처리하고, 5% BSA로 블로킹 한 후 Virostat(Portland, ME, USA)에서 구입한 인플루엔자 A 바이러스 비리온(virion)에 대한 일차항체를 4℃에서 16시간 동안 배양하였다. 다음날 인산완충액으로 수세 후 HRP-conjugated Goat IgG(H+L)에 대한 2차 항체를 20℃에서 한시간 동안 반응시키고, DAB로 발색시켰다.
도 11l에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 마우스에 지방분해효소 억제제인 atglistatin 및 CAY10499을 투여한 결과, 무처치 바이러스 접종군의 마우스에 비해 바이러스 접종 후 약물을 처치한 실험군의 마우스에서 간질성 폐렴을 포함한 폐 병변과 바이러스 양성세포 수가 두 약물에 의해 완화 및 감소되었으며, 특히 atglistatin이 CAY10499에 비해 효과가 높았다.
결론적으로, 지방분해효소 억제제인 atglistatin 및 CAY10499은 인플루엔자 A 바이러스에 감염된 마우스를 방어하는 효능이 있었으며, 10 mg kg-1 day-1 로 atglistatin 및 CAY10499을 투여 시, 100% 폐사율을 보인 대조군에 비해 생존율이 각각 62.5%와 50%로 증가하였다. 특히 atglistatin이 CAY10499보다 높은 바이러스 억제능을 보였다.
실험예 8: 지방분해효소 억제제인 atglistatin 투여에 의한 사스코로나바이러스 유형 2(SARS-CoV-2) 감염 햄스터의 폐렴 중증도, 바이러스 증식, 체중저하 및 병변 개선효과
사스코로나바이러스 유형 2에 감염된 동물에서 지방분해효소 억제에 따른 항바이러스효과를 검증하기 위해 150 mg/ml atglistatin을 DMSO에 용해하였다. 이후 농도에 따른 항바이러스 효과를 평가하기 위해 약물을 15, 7.5, 3.75 mg/ml 준비하였으며 이때 용매로서 DMSO:40% PEG:H2O가 1:4:5로 희석된 합제를 사용하였고, 약물이 완전히 녹을 때까지 볼텍싱을 하였다. 이 약물을 햄스터에 800 μL 접종하면 각각 최종농도가 80, 40, 20 mg kg-1 day-1가 되었다(도 12a).
Atglistatin의 항바이러스 효능평가를 위해 다음과 같이 햄스터를 바이러스 무접종 및 무처치 그룹(No virus + vehicle), 사스 코로나바이러스 유형 2 KCDC03주 접종 및 무처치 그룹(SARS-CoV-2 + vehicle), 사스 코로나바이러스 유형 2 KCDC03주 접종 및 20 mg/kg/day atglistatin 처치 그룹(SARS-CoV-2 + atglistatin (20 mg kg-1 day-1)), 사스 코로나바이러스 유형 2 KCDC03주 접종 및 40 mg/kg/day atglistatin 처치 그룹(SARS-CoV-2 + atglistatin (40 mg kg-1 day-1)), 사스 코로나바이러스 유형 2 KCDC03주 접종 및 80 mg/kg/day atglistatin 처치 그룹(SARS-CoV-2 + atglistatin (80 mg kg-1 day-1)) 등 총 5개의 실험군을 만들었다. 각 군은 12주령 암컷 골든 시리안 햄스터를 5마리씩 배치하였으며, 상술한 조건으로 1주일간 햄스터를 계류한 후 13주령 때 실험을 실시하였다(도 12a).
사스 코로나바이러스 유형 2 KCDC03주의 접종은 상기 실험과 동일한 방법으로 마취된 햄스터에서 햄스터 당 100,000 TCID50로 기관내투여법으로 접종하였고, 바이러스 비접종의 경우 인산완충액만을 접종하였다. 이후 5일간 관찰하면서, 생존율, 몸무게, 임상증상 등을 매일 관찰 및 기록하였다.
약물처치는 사스 코로나바이러스 유형 2 접종 직후부터, 매일 오전/오후 12시간 간격으로 동일한 시간에 하루 2회, 총 4.5 일간 400 μL씩 주사기를 사용해 복강내투여법(intraperitoneal injection)으로 접종하였다. 무처치 그룹의 경우 약물 희석 용매 DMSO/40% PEG/H2O 합재를 복강내 투여하였다.
감염 5일째 부검을 실시하였으며, 먼저 전체 폐 조직은 카메라로 촬영하였고, 적출된 폐 중 좌측 엽은 조직병리분석 및 동결절편을 만들기 위해 4% 파라포름알데히드에서 일주일간 4℃에서 고정시켰고, 우측 전엽, 중간엽, 후엽 및 덧엽은 모두 섞어 잘게 잘라 세포질 내 유리지방산과 글리세롤, 바이러스 게놈 수 및 자손 바이러스 평가하는데 사용했다.
상기 조직의 유리지방산 검사를 수행하기 위해 1% Triton-X 100이 들어있는 클로르포름과 섞어 잘 섞은 뒤, 상기의 세포 내 유리지방산 검사 방법과 동일하게 수행하여, ELISA 측정기로 570 nm에서 흡광도를 측정하였다.
상기의 글리세롤 검사를 수행하기 위해 Glycerol Assay Buffer와 잘 섞은 뒤, 상기의 세포 내 글리세롤 검사 방법과 동일하게 수행하여, ELISA 측정기로 570 nm에서 흡광도를 측정하였다.
도 12b 및 12c에서 확인할 수 있듯이, 사스코로나바이러스 유형 2에 감염된 햄스터에 지방분해효소 억제제인 atglistatin을 투여한 결과, 농도의존성으로 폐렴 중증도가 개선되었으며 유리지방산 및 글리세롤의 생성이 유의성있게 감소하였다. 특히, atglistatin을 80 mg kg-1 day-1로 4.5일간 투여한 실험군에서는 폐렴 중증도 개선률이 73%에 이르렀다.
상기의 폐 조직 내 atglistatin 처치에 의한 바이러스 유전자의 수, 자손 바이러스 수에 미치는 영향을 평가하고자 하였다. 또한, 사스코로나바이러스 유형 2감염에 의한 폐렴을 얼마나 완화시킬 수 있는지, 햄스터 폐 조직에서 조직병리학적 분석, 바이러스 항원에 대한 면역조직화학염색을 통한 분석, 바이러스 항원 및 지방적에 대한 면역형광염색을 통한 분석을 아래와 같이 실시하였다.
사스코로나바이러스 유형 2 뉴클레오캡시드 유전자 및 숙주의 β-액틴 유전자에 대해 real-time PCR을 수행해 바이러스의 유전자 수를 구하여 약물의 바이러스 유전자 억제 효과를 평가하였다.
세포 배양 면역형광항체법을 수행하기 위해 햄스터 100 mg 폐 조직을 비드를 넣고 Bertin Technologies (Montigny-le-Bretonneux, France)에서 구입한 Precellys 23 instrument 호모게나이져(homogenizer)를 사용하여 폐 조직 유제를 만든 다음 원심분리하여 상층액을 채취하였다. 획득한 상층액은 계단 희석하여 위에 상술한 바와 같이 96-well plate에 단층배양된 Vero E6 세포에 접종 후 12시간 배양한 다음, 사스코로나바이러스 유형 2 뉴클레오캡시드에 대한 항체를 이용해 세포 배양 면역형광항체법을 수행하여 각각의 약물에 의한 자손 바이러스 증식 억제 효과를 평가하였다.
도 12d 내지 12f에서 확인할 수 있듯이, 사스코로나바이러스 유형 2에 감염된 햄스터에 지방분해효소 억제제인 atglistatin을 투여한 결과, 폐 조직에서 바이러스 유전자 수(d), 자손 바이러스 수(e)가 유의성 있게 감소시켰으며, 결과적으로 햄스터의 체중저하(f)를 개선시켰다.
상기 폐 조직에서 지방적 및 사스코로나바이러스 유형 2 항원 평가를 위해, 고정된 조직을 가지고 3 ㎛ 동결절편 조직을 만들었다. 5% BSA로 블로킹을 한 이후 사스코로나바이러스 유형 2 스파이크 항원에 대한 일차항체를 4℃ 16시간 동안 배양하였고, AF594-conjugated mouse IgG(H+L) 2차 항체를 20℃에서 한시간 동안 반응시켰다. 조직절편을 인산완충액으로 수세 후 지방적 염색을 위해 10 μM BODIPY로 20℃에서 15분 동안 반응시키고, 수세후 Slow-Fade Gold antifade reagent를 이용해 핵염색 및 마운팅을 수행하였다.
도 12g에서 확인할 수 있듯이, 사스코로나바이러스 유형 2가 감염된 햄스터에 지방분해효소 억제제인 atglistatin을 투여한 결과, 무처치 바이러스 접종군의 햄스터에 비해 바이러스 접종 후 약물을 처치한 실험군의 햄스터의 폐포상피세포에서 바이러스 항원은 유의성 있게 크게 감소하였지만, 지방적의 수는 유의성 있게 감소하지 않았다.
상기 폐 조직에서 병리조직학적 분석을 위해 고정된 조직을 각급 알코올을 통한 탈수, 자일렌(xylene) 침투, 파라핀 봉입 후에 3 ㎛로 세절하였다. 조직 절편은 xylene을 통하여 탈파라핀 하였고, 각급 알코올과 수세를 통하여 재함수 하였다. 재함수된 절편은 Hematoxylin & Eosin 염색을 하였고, 각급 알코올을 통하여 탈수와 자일렌을 통하여 중합과 봉입을 한 후 광학현미경으로 조직학적 검사를 수행하였다.
상기 폐 조직에서 사스코로나바이러스 유형 2 뉴클레오캡시드 항원에 대한 면역조직화학염색(immunohistochemistry)를 수행하기 위해 3 ㎛ 조직 절편을 탈파라핀, 수세 및 재함수를 거치고 pH 6.0 1 mM 시트레이트(citrate)에 넣어 고압멸균(autoclave)에 의한 항원복원(antigen retrieval)을 통해 3% 과산화수소(H2O2)로 내인성 과산화효소(peroxidase)를 처리하고, 5% BSA로 블로킹 한 후 Prosci(San Diego, CA, USA)에서 구입한 사스코로나바이러스 유형 2 뉴클레오캡시드(nucleocapsid, N)에 대한 일차항체를 4℃에서 16시간 동안 배양하였다. 다음날 인산완충액으로 수세 후 HRP-conjugated Goat IgG(H+L)에 대한 2차 항체를 20℃에서 한시간 동안 반응시키고, DAB로 발색시켰다.
도 12h에서 확인할 수 있듯이, 사스코로나바이러스 유형 2가 감염된 햄스터에 지방분해효소 억제제인 atglistatin을 투여한 결과, 무처치 바이러스 접종군의 햄스터에 비해 바이러스 접종 후 약물을 처치한 실험군의 햄스터에서 간질성 폐렴을 포함한 폐 병변과 바이러스 양성세포 수가 두 약물에 의해 완화 및 감소되었다.
결론적으로, 지방분해효소 억제제인 atglistatin은 사스코로나바이러스 유형 2에 감염된 햄스터를 방어하는 효능이 있었으며, 80 mg kg-1 day-1 로 atglistatin을 투여 시, 폐렴 중증도가 73% 개선되었다. 이는 atglistatin은 지방적의 분해를 억제하여, 유리지방산이 생성을 억제함으로써 바이러스 증식을 억제하는 것에서 기인한다.
실험예 9: atglistatin 및 인플루엔자 A 바이러스(IAV) 항바이러스제의 단독 혹은 병용 투여에 따른 감염된 마우스의 생존율, 체중저하, 임상증상, 바이러스 증식 및 병변 개선효과와 사스코로나바이러스 유형 2(SARS-CoV-2) 항바이러스제의 단독 혹은 병용 투여에 따른 감염된 햄스터의 폐렴 개선률, 바이러스 증식, 체중저하 및 병변 개선효과
인플루엔자 A 바이러스가 감염된 동물에서 상기 지방분해효소 억제제인 atglistatin과 항바이러스제인 오셀타미비르(oseltamivir)와의 단독 혹은 혼합투여에 따른 항바이러스효과를 검증하기 위해 150 mg/ml atglistatin을 DMSO에 용해하였고, 10 mg/ml 오셀타미비르를 H2O에 용해하였다. 이후 농도에 따른 항바이러스 효과를 평가하기 위해 0.5 mg/ml atglistatin와 0.2 mg/ml 오셀타미비르를 준비하였으며 이때 용매로서 각각 DMSO:40% PEG:H2O가 1:4:5로 희석된 합제 또는 H2O를 사용하였다. 이 약물을 마우스에 200 μL 접종하면 각각 최종농도가, 5 mg kg-1 day-1 atglistatin과 2 mg kg-1 day-1 오셀타미비르가 되었다(도 13a).
오셀타미비르와 atglistatin과 단독 혹은 혼합투여에 따른 항바이러스 효능평가를 위해 다음과 같이 마우스를 바이러스 무접종 및 무처치 그룹(No virus + vehicle), 인플루엔자 A 바이러스 PR8주 접종 및 무처치 그룹(IAV + vehicle), 인플루엔자 A 바이러스 PR8주 접종 및 2 mg/kg/day 오셀타미비르 처치 그룹(IAV + oseltamivir), 인플루엔자 A 바이러스 PR8주 접종 및 5 mg/kg/day atglistatin 처치 그룹(IAV + atglistatin), 인플루엔자 A 바이러스 PR8주 접종 및 2 mg/kg/day 오셀타미비르와 5 mg/kg/day atglistatin 처치 그룹(IAV + oseltamivir + atglistatin)등 총 5개의 실험군을 만들었다. 각 군은 7주령 암컷 wild-type C57BL/6J 마우스를 16마리씩 배치하였으며, 상술한 조건으로 1주일간 마우스를 계류한 후 8주령 때 실험을 실시하였다.
인플루엔자 A 바이러스 접종은 상기 실험과 동일한 방법으로 마취된 마우스에서 마우스 당 1,000 PFU로 비강내투여법으로 접종하였고, 바이러스 비접종의 경우 인산완충액만을 접종하였다. 이후 15일간 관찰하면서, 생존율, 몸무게, 임상증상 등을 매일 관찰 및 기록하였고 심각한 정도의 체중감소(30% 이상)를 보이는 마우스의 경우 안락사하여, 바이러스 감염에 의하여 폐사한 것으로 기록하였다.
오셀타미비르 약물처치는 인플루엔자 A 바이러스 접종 직후부터, 매일 오전/오후 12시간 간격으로 동일한 시간에 하루 2회, 총 4일간 100 μL씩 경구존대를 사용해 구강 투여(oral administration)하였고, atglistatin 약물처치는 인플루엔자 A 바이러스 접종 2일 후부터, 매일 오전/오후 12시간 간격으로 동일한 시간에 하루 2회, 총 4일간 100 μL씩 주사기를 사용해 복강내투여법(intraperitoneal injection)으로 접종하였다. 무처치 그룹의 경우 약물 희석 용매 DMSO/40% PEG/H2O 합재를 복강내 투여하였다(도 13a).
감염 0일째 생존율 100%, 폐사율 0%를 기준으로 15일 동안 매일 폐사율을 측정하였고 바이러스 접종 및 무처치 그룹과의 생존율을 비교하였다. 통계적인 유의성은 Log Rank Test으로 분석하였으며, p value가 0.05 이상인 경우 유의성이 높다고 평가하였다.
도 13b 내지 13d에서 확인할 수 있듯이, 오셀타미비르와 atglistatin 혼합투여의 경우 100% 생존율을 보였고, 오셀타미비르 혹은 atglistatin 단독 투여에 비해 오셀타미비르/atglistatin 혼합투여가 생존율, 몸무게, 임상증상을 더욱 개선시켰으며, 인플루엔자 A 바이러스 감염증의 치료에 더욱 뚜렷한 효과가 있음을 보여주었다.
사스 코로나바이러스 유형 2 KCDC03주(A lineage), KDCA51463주(Alpha lineage) 혹은 KDCA55905주(Beta lineage)에 감염된 동물에서 상기 지방분해효소 억제제인 atglistatin과 항바이러스제인 렘데시비르(remdesivir)와의 단독 혹은 혼합투여에 따른 항바이러스효과를 검증하기 위해 150 mg/ml atglistatin와 50 mg/ml 렘데시비르를 DMSO에 용해하였다. 이후 농도에 따른 항바이러스 효과를 평가하기 위해 7.5 mg/ml atglistatin와 0.47 mg/ml 렘데시비르를 준비하였으며 이때 용매로서 각각 DMSO: 40% PEG: H2O가 1:4:5로 희석된 합제 또는 DMSO:Corn oil이 1:9로 희석된 합제를 사용하였다. 이 약물을 햄스터에 800 μL 접종하면 각각 최종농도가, 40 mg kg-1 day-1 atglistatin과 2.5 mg kg-1 day-1 렘데시비르가 되었다(도 13e).
사스 코로나바이러스 유형 2 KCDC03주(A lineage), KDCA51463주(Alpha lineage), KDCA55905주(Beta lineage) 각각에 대한 렘데시비르와 atglistatin과 단독 혹은 혼합투여에 따른 항바이러스 효능평가를 위해 다음과 같이 햄스터를 바이러스 무접종 및 무처치 그룹(No virus + vehicle), 사스 코로나바이러스 유형 2 접종 및 무처치 그룹(SARS-CoV-2 + vehicle), 사스 코로나바이러스 유형 2 접종 및 2.5 mg/kg/day 렘데시비르 처치 그룹(SARS-CoV-2 + remdesivir), 사스 코로나바이러스 유형 2 접종 및 40 mg/kg/day atglistatin 처치 그룹(SARS-CoV-2 + atglistatin), 사스 코로나바이러스 유형 2 및 2.5 mg/kg/day 렘데시비르와 40 mg/kg/day atglistatin 처치 그룹(SARS-CoV-2 + oseltamivir + atglistatin)등 총 5개의 실험군을 만들었다. 각 군은 암컷 11주령 골든 시리안 햄스터를 5마리씩 배치하였으며, 상술한 조건으로 1주일간 햄스터를 계류한 후 실험을 실시하였다.
사스 코로나바이러스 유형 2 KCDC03주(A lineage), KDCA51463주(Alpha lineage), KDCA55905주(Beta lineage)의 접종은 상기 실험과 동일한 방법으로 마취된 햄스터에서 햄스터 당 100,000 TCID50로 기관내투여법으로 접종하였고, 바이러스 비접종의 경우 인산완충액만을 접종하였다. 이후 5일간 관찰하면서, 생존율, 몸무게, 임상증상 등을 매일 관찰 및 기록하였다.
렘데시비르 및 atglistatin 약물처치는 사스 코로나바이러스 유형 2 접종 직후부터, 매일 오전/오후 12시간 간격으로 동일한 시간에 하루 2회, 총 4.5 일간 400 μL씩 주사기를 사용해 복강내투여법(intraperitoneal injection)으로 접종하였다. 무처치 그룹의 경우 약물 희석 용매 DMSO/40% PEG/H2O 합재를 복강내 투여하였다.
감염 5일째 부검을 실시하였으며, 먼저 전체 폐 조직은 카메라로 촬영하였고, 적출된 폐 중 좌측 엽은 조직병리분석 및 동결절편을 만들기 위해 4% 파라포름알데히드에서 일주일간 4℃에서 고정시켰고, 우측 전엽, 중간엽, 후엽 및 덧엽은 모두 섞어 잘게 잘라 세포질 내 유리지방산과 글리세롤, 바이러스 게놈 수 및 자손 바이러스 평가하는데 사용했다.
도 13f 내지 13i에서 확인할 수 있듯이, 렘데시비르와 atglistatin 혼합투여의 경우 사스 코로나바이러스 유형 2 lineage A 감염증에서는 폐렴 중증도를 83%, 사스 코로나바이러스 유형 2 lineage Alpha 감염증에서는 폐렴 중증도를 67%, 사스 코로나바이러스 유형 2 lineage Beta 감염증에서는 폐렴 중증도를 69% 개선시켰다. 렘데시비르 혹은 atglistatin 단독 투여에 비해 렘데시비르/atglistatin 혼합투여가 폐렴 중증도 및 체중저하를 더욱 유의적으로 개선시켰으며, 사스 코로나바이러스 유형 2의 여러 변이주에 관계없이 유의적인 치료효과를 보여주었다.
결론적으로, 지방분해효소 억제제인 atglistatin은 인플루엔자 A 바이러스 감염증에서 오셀타미비르와의 혼합투여 시 오셀타미비르 단독투여에 비해 더욱 유의적인 인플루엔자 A 바이러스 감염증 치료효과를 보여주었으며, 여러 변이주를 포함한 사스 코로나바이러스 유형 2 감염증에서 렘데시비르와의 혼합투여 시 렘데시비르 단독투여에 비해 더욱 유의적인 사스 코로나바이러스 유형 2 감염증 치료효과를 보여주었다.
실험예 10: 지방분해효소 억제제인 atglistatin 및 그 유도체 구조 및 제작
호르몬 감수성 지방분해효소(hormone-sensitive lipase, HSL)의 억제제인 CAY10499는 Cayman Chemicals(Ann Arbor, Michigan, USA)에서 구입했으며 지방질 중성지방 지방분해효소(adipose triglyceride lipase, ATGL)의 억제제인 Atglistatin은 MedChemExpress(Monmouth Junction, NJ, USA)에서 구입하였다.
Atglistatin 유도체인 3-(4‘-다이메틸아미노)-(1,1’-바이페닐)-3-일)-1-에틸-1-메틸유레아3-(4'-(Dimethylamino)-[1,1'-biphenyl]-3-yl)-1-ethyl-1-methylurea[DABPU-EM] 및 3-(4‘-다이메틸아미노)-(1,1’-바이페닐)-3-일)-1,1-다이에틸유레아 3-(4'-(Dimethylamino)-[1,1'-biphenyl]-3-yl)-1,1-diethylurea[DABPU-DE] 합성을 위해 아래와 같이 수행하였다.
10-1.
3-브로모아닐린(3-bromoaniline)(172 mg), 4-(다이메틸아미노)페닐보론산(4-(dimethylamino)phenyl)boronic acid)(182 mg), 제삼인산칼륨(K3PO4)(445 mg), 팔라듐아세테이트(Pd(OAc)2)(4.5 mg)을 5.0 mL 물에 넣고 100℃에서 2시간 동안 교반하였다. 반응 혼합물에 과량의 물과 에틸아세테이트(ethyl acetate)를 주입하고 에틸아세테이트 층을 분별깔대기를 이용하여 분리하였다. 분리한 유기용매 층을 황산마그네슘(MgSO4)로 수분을 제거하고 농축하여 반응 중간체 화합물을 합성하였다. 합성된 반응 중간체를 별도의 분리 및 정제 과정 없이 새로운 반응 용기에 주입하여 다음 반응을 준비하였다. N,N-다이알킬카바믹 클로라이드 또는 N,N-다이아릴카바믹 클로라이드(2.0 mmol)을 5.0 mL 피리딘(pyridine)과 같이 혼합하고 이 용액을 40℃에서 4시간 동안 교반하였다. 반응 혼합물에 물을 주입하고 에틸아세테이트 용매로 유기물을 추출한 뒤 농축하였다. 농축한 반응 혼합물을 실라카겔이 충진된 관크로마토그래피를 이용하여 유도체 화합물을 분리하였다.
10-2. 3-(4‘-(다이메틸아미노)-(1,1’-바이페닐)-3-일)-1,1-다이메틸유레아((3-(4'-(Dimethylamino)-[1,1'-biphenyl]-3-yl) -1,1-dimethylurea: [DABPU-DM])의 합성
상기 실험예 10-1에서 N,N-다이알킬카바믹 클로라이드로 다이메틸카바믹 클로라이드(214 mg)와 반응시켜 도 14a와 같이 최종 생성물 DABPU-DM를 96 mg (34% 수율) 얻었다. DABPU-DM은 3-(4‘-(다이메틸아미노)-(1,1’-바이페닐)-3-일)-1,1-다이메틸유레아를 줄인 이름이다. 생성물의 분석 데이터는 다음과 같다.
1H NMR (500 MHz, CDCl3) δ 7.58-7.55 (m, 1H), 7.53-7.48 (m, 2H), 7.31-7.28 (m, 2H), 7.25-7.21 (m, 1H), 6.80-6.75 (m, 2H), 6.42 (s, 1H), 3.03 (s, 6H), 2.98 (s, 6H); 13C NMR (126 MHz, CDCl3) δ 155.9, 150.1, 142.0, 139.6, 129.2, 129.0, 127.8, 121.1, 117.8, 117.7, 112.8, 40.7, 36.6; MS (ESI, m/z): 283.1 [M]+
10-3. 3-(4‘-(다이메틸아미노)-(1,1’-바이페닐)-3-일)-1-에틸-1-메틸유레아(3-(4'-(Dimethylamino)-[1,1'-biphenyl]-3-yl)-1-ethyl-1-methylurea: [DABPU-EM])의 합성
상기 실험예 10-1에서 N,N-다이알킬카바믹 클로라이드로 에틸(메틸)카바믹 클로라이드 (Ethyl(methyl)carbamic chloride)(243 mg)와 반응시켜 도 14b와 같이 최종 생성물 DABPU-EM을 122 mg (41% 수율) 얻었다. DABPU-EM은 3-(4‘-다이메틸아미노)-(1,1’-바이페닐)-3-일)-1-에틸-1-메틸유레아를 줄인 이름이다. 생성물의 분석 데이터는 다음과 같다.
1H NMR (500 MHz, CDCl3) δ 7.59-7.57 (m, 1H), 7.53-7.48 (m, 2H), 7.33-7.27 (m, 2H), 7.24-7.21 (m, 1H), 6.80-6.74 (m, 2H), 6.45 (s, 1H), 3.41 (q, J = 7.2 Hz, 2H), 2.99 (s, 3H), 2.98 (s, 6H), 1.18 (t, J = 7.2 Hz, 3H); 13C NMR (126 MHz, CDCl3) δ 155.4, 150.1, 141.9, 139.6, 129.2, 129.0, 127.8, 121.0, 117.8, 117.7, 112.8, 43.7, 40.7, 34.0, 13.1; HRMS (FD) cacld. for C18H23N3O [M]+: 297.1841, found:297.1839.
10-4. 3-(4‘-다이메틸아미노)-(1,1’-바이페닐)-3-일)-1,1-다이에틸유레아(3-(4'-(Dimethylamino)-[1,1'-biphenyl]-3-yl)-1,1-diethylurea: [DABPU-DE])의 합성
상기 실험예 10-1에서 N,N-다이알킬카바믹 클로라이드로 다이에틸카바믹 클로라이드 (Diethylcarbamic chloride)(271 mg)와 반응시켜 도 14c와 같이 최종 생성물 DABPU-DE를 97 mg (31 % 수율) 얻었다. DABPU-DE는 3-(4‘-다이메틸아미노)-(1,1’-바이페닐)-3-일)-1,1-다이에틸유레아를 줄인 이름이다. 생성물의 분석 데이터는 다음과 같다.
1H NMR (500 MHz, CDCl3) δ 7.59 (s, 1H), 7.50 (d, J = 8.8 Hz, 2H), 7.33-7.25 (m, 2H), 7.24-7.19 (m, 1H), 6.75 (d, J = 8.8 Hz, 2H), 6.43 (s, 1H), 3.36 (q, J = 7.1 Hz, 4H), 2.96 (s, 6H), 1.20 (t, J = 7.1 Hz, 6H); 13C NMR (126 MHz, CDCl3) δ 154.7, 150.0, 141.8, 139.7, 129.1, 129.0, 127.8, 120.8, 117.7, 117.6, 112.7, 41.7, 40.6, 14.0; HRMS (FD) cacld. for C19H25N3O [M]+: 311.1998, found:311.2001.
10-5. 3-(4‘-다이메틸아미노)-(1,1’-바이페닐)-3-일)-1,1-다이페닐유레아(3-(4'-(Dimethylamino)-[1,1'-biphenyl]-3-yl)-1,1-diphenylurea: [DABPU-DPh])의 합성
상기 실험예 10-1에서 N,N-다이아릴카바믹 클로라이드로 다이페닐카바믹 클로라이드 (462 mg)와 반응하여 도 14d와 같이 최종 생성물 DABPU-DPh를 102 mg (25% 수율) 얻었다. DABPU-DPh는 3-(4‘-다이메틸아미노)-(1,1’-바이페닐)-3-일)-1,1-다이페닐유레아를 줄인 이름이다. 생성물의 분석 데이터는 다음과 같다.
1H NMR (500 MHz, CDCl3) δ 7.56 (t, J = 1.8 Hz, 1H), 7.50-7.46 (m, 2H), 7.43-7.39 (m, 4H), 7.38-7.34 (m, 4H), 7.31-7.26 (m, 3H), 7.25-7.20 (m, 2H), 6.76 (d, J = 8.8 Hz, 2H), 6.50 (s, 1H), 2.98 (s, 6H); 13C NMR (126 MHz, CDCl3) δ 153.7, 150.1, 142.5, 142.1, 138.9, 129.7, 129.3(2C), 127.9, 127.7, 126.8, 121.4, 117.3, 117.1, 112.8, 40.7; HRMS (FD) cacld. for C27H25N3O [M]+: 407.1998, found: 407.1974
10-6. N-(4’-다이메틸아미노)-(1,1‘-바이페닐)-3-일)피롤리딘-1-카르복스아마이드(N-(4'-(Dimethylamino)-[1,1'-biphenyl]-3-yl)pyrrolidine-1-carboxamide: [DABPU-Pyrrol])의 합성
상기 실험예 10-1에서 N,N-다이알킬카바믹 클로라이드로 피롤이딘-1-카보닐 클로라이드 (Pyrrolidine-1-carbonyl chloride)(266 mg)와 반응시켜 도 14e와 같이 최종 생성물 DABPU-Pyrrol를 108 mg (35% 수율) 얻었다. DABPU-Pyrrol는 N-(4’-다이메틸아미노)-(1,1‘-바이페닐)-3-일)피롤리딘-1-카르복스아마이드를 줄인 이름이다. 생성물의 분석 데이터는 다음과 같다.
1H NMR (500 MHz, CDCl3) δ 7.61 (t, J = 1.8 Hz, 1H), 7.55-7.47 (m, 2H), 7.36-7.27 (m, 2H), 7.24-7.19 (m, 1H), 6.82-6.72 (m, 2H), 6.26 (s, 1H), 3.47 (t, J = 6.7 Hz, 4H), 2.98 (s, 6H), 1.99-1.92 (m, 4H); 13C NMR (126 MHz, CDCl3) δ 154.1, 150.1, 142.0, 139.6, 129.2, 129.1, 127.8, 120.9, 117.5, 117.4, 112.8, 45.9, 40.7, 25.7; HRMS (FD) cacld. for C19H23N3O [M]+: 309.1841 found: 309.1843
10-7. N-(4’-(다이메틸아미노)-(1,1‘-바이페닐)-3-일)모폴린-4-카르복스아마이드(N-(4'-(Dimethylamino)-[1,1'-biphenyl]-3-yl)morpholine-4-carboxamide: [DABPU-Morph])의 합성
상기 실험예 10-1에서 N,N-다이알킬카바믹 클로라이드로 모폴린-4-카보닐 클로라이드 (Morpholine-4-carbonyl chloride)(299 mg)와 반응시켜 도 14f와 같이 최종 생성물 DABPU-Morph를 140 mg (43% 수율) 얻었다. DABPU-Morph는 N-(4’-(다이메틸아미노)-(1,1‘-바이페닐)-3-일)모폴린-4-카르복스아마이드를 줄인 이름이다. 생성물의 분석 데이터는 다음과 같다.
1H NMR (500 MHz, CDCl3) δ 7.53 (t, J = 1.8 Hz, 1H), 7.51-7.46 (m, 2H), 7.33-7.28 (m, 1H), 7.28-7.26 (m, 1H), 7.26-7.23 (m, 1H), 6.82-6.70 (m, 2H), 6.59 (s, 1H), 3.69 (t, J = 4.9 Hz, 4H), 3.46 (t, J = 4.9 Hz, 4H), 2.98 (s, 6H); 13C NMR (126 MHz, CDCl3) δ 155.4, 150.1, 142.1, 139.2, 129.3, 128.8, 127.8, 121.5, 118.2, 118.1, 112.8, 66.6, 44.4, 40.7; MS (ESI, m/z): 325.2 [M]+
실험예 11: atglistatin(DABPU-DM)의 유도체인 DABPU-EM 및 DABPU-DE에 의한 사스코로나바이러스 유형 2(SARS-CoV-2), 인플루엔자 A 바이러스(IAV), 소 코로나바이러스(BCoV), 돼지 유행성 설사 코로나바이러스(PEDV), 소 로타바이러스(RVA), 돼지 생식기 호흡기 증후군 바이러스(PRRSV) 및 돼지 사포바이러스(PSaV)의 증식 억제
사스코로나바이러스 유형 2, 인플루엔자 A 바이러스, 소 코로나바이러스, 돼지 유행성 설사 코로나바이러스, 소 로타바이러스, 돼지 생식기 호흡기 증후군 바이러스 및 돼지 사포바이러스에서 지방분해효소 억제에 따른 항바이러스효과를 검증하기 위해 CAY10499와 Atglistatin을 DMSO을 용매로 하여 1 mM, 10 mM 및 20 mM의 농도로 준비하였다.
각 목적을 달성하기 위해 6-well plate와 8-well 챔버에 단층 배양된 Vero E6 세포에 감염다중도가 0.1 ffu/cell인 사스코로나바이러스 유형 2 KCDC03주를 접종하였다. 37℃에서 바이러스를 18시간 동안 배양 후, 최종농도가 1 μM, 10 μM, 20 μM DABPU-EM 혹은 DABPU-DE이 포함된 배지로 교체하였고, 18시간 동안 추가적으로 배양 후 6-well plate에 있는 Vero E6 세포는 인산완충액으로 수세 후 스크래퍼로 긁어낸 다음 원심분리하여 세포펠렛을 만들었다. 세포펠렛은 상기의 방법에 따라 웨스턴블롯을 수행하였고, 숙주세포의 내부 컨트롤인 베타액틴 대비 검출된 사스코로나바이러스 유형 2 스파이크 단백질은 양은 ImageJ로 양성 시그널 양을 계산하여 평가하였다. 동 시간에 8-well 챔버에 있는 Vero E6 세포는 인산완충액으로 수세 후 4% 파라포름알데히드로 고정 후, 상기의 방법대로 사스코로나바이러스 유형 2 스파이크 단백질에 대한 면역형광염색을 수행하였다.
도 15a에서 확인할 수 있듯이, DABPU-EM 혹은 DABPU-DE에 의한 바이러스 항원 발현 및 감염 세포 내 바이러스 항원의 발현량을 검사한 결과, 농도의존성으로 사스코로나바이러스 유형 2 억제 효과가 있었으며, DABPU-DE가 DABPU-EM에 비해 더 높은 바이러스 억제 효과를 보였다.
각 목적을 달성하기 위해 6-well plate와 8-well 챔버에 단층 배양된 A549 세포에 감염다중도가 0.1 ffu/cell인 인플루엔자 A 바이러스 PR8주를 접종하였다. 37℃에서 바이러스를 12시간 동안 배양 후, 최종농도가 1 μM, 10 μM, 20 μM DABPU-EM 혹은 DABPU-DE이 포함된 배지로 교체하였고, 12시간 동안 추가적으로 배양 후 6-well plate에 있는 A549 세포는 인산완충액으로 수세 후 스크래퍼로 긁어낸 다음 원심분리하여 세포펠렛을 만들었다. 세포펠렛은 상기의 방법에 따라 웨스턴블롯을 수행하였고, 숙주세포의 내부 컨트롤인 베타액틴 대비 검출된 인플루엔자 A 바이러스 M2 단백질은 양은 ImageJ로 양성 시그널 양을 계산하여 평가하였다. 동 시간에 8-well 챔버에 있는 A549 세포는 인산완충액으로 수세 후 4% 파라포름알데히드로 고정 후, 상기의 방법대로 인플루엔자 A 바이러스 M2 단백질에 대한 면역형광염색을 수행하였다.
도 15b에서 확인할 수 있듯이, DABPU-EM 혹은 DABPU-DE에 의한 바이러스 항원 발현 및 감염 세포 내 바이러스 항원의 발현량을 검사한 결과, 농도의존성으로 인플루엔자 A 바이러스 억제 효과가 있었으며, DABPU-DE가 DABPU-EM에 비해 더 높은 바이러스 억제 효과를 보였다.
각 목적을 달성하기 위해 6-well plate와 8-well 챔버에 단층 배양된 HRT-18G 세포에 감염다중도가 0.1 ffu/cell인 소 코로나바이러스 KWD20주를 접종하였다. 37℃에서 바이러스를 18시간 동안 배양 후, 최종농도가 1 μM, 10 μM, 20 μM DABPU-EM 혹은 DABPU-DE이 포함된 배지로 교체하였고, 18시간 동안 추가적으로 배양 후 6-well plate에 있는 HRT-18G 세포는 인산완충액으로 수세 후 스크래퍼로 긁어낸 다음 원심분리하여 세포펠렛을 만들었다. 세포펠렛은 상기의 방법에 따라 웨스턴블롯을 수행하였고, 숙주세포의 내부 컨트롤인 베타액틴 대비 검출된 소 코로나바이러스 스파이크 단백질은 양은 ImageJ로 양성 시그널 양을 계산하여 평가하였다. 동 시간에 8-well 챔버에 있는 HRT-18G 세포는 인산완충액으로 수세 후 4% 파라포름알데히드로 고정 후, 상기의 방법대로 소 코로나바이러스 KWD20주를 스파이크 단백질에 대한 면역형광염색을 수행하였다.
도 15c에서 확인할 수 있듯이, DABPU-EM 혹은 DABPU-DE에 의한 바이러스 항원 발현 및 감염 세포 내 바이러스 항원의 발현량을 검사한 결과, 농도의존성으로 소 코로나바이러스 억제 효과가 있었으며, DABPU-DE가 DABPU-EM에 비해 더 높은 바이러스 억제 효과를 보였다.
각 목적을 달성하기 위해 6-well plate와 8-well 챔버에 단층 배양된 Vero E6 세포에 감염다중도가 0.1 ffu/cell인 돼지 유행성 설사 코로나바이러스 QIAP1401주를 접종하였다. 37℃에서 바이러스를 18시간 동안 배양 후, 최종농도가 1 μM, 10 μM, 20 μM DABPU-EM 혹은 DABPU-DE이 포함된 배지로 교체하였고, 18시간 동안 추가적으로 배양 후 6-well plate에 있는 Vero E6 세포는 인산완충액으로 수세 후 스크래퍼로 긁어낸 다음 원심분리하여 세포펠렛을 만들었다. 세포펠렛은 상기의 방법에 따라 웨스턴블롯을 수행하였고, 숙주세포의 내부 컨트롤인 베타액틴 대비 검출된 돼지 유행성 설사 코로나바이러스 뉴클레오캡시드 단백질은 양은 ImageJ로 양성 시그널 양을 계산하여 평가하였다. 동 시간에 8-well 챔버에 있는 Vero E6 세포는 인산완충액으로 수세 후 4% 파라포름알데히드로 고정 후, 상기의 방법대로 돼지 유행성 설사 코로나바이러스 뉴클레오캡시드 단백질에 대한 면역형광염색을 수행하였다.
도 15d에서 확인할 수 있듯이, DABPU-EM 혹은 DABPU-DE에 의한 바이러스 항원 발현 및 감염 세포 내 바이러스 항원의 발현량을 검사한 결과, 농도의존성으로 돼지 유행성 설사 코로나바이러스 억제 효과가 있었으며, DABPU-DE가 DABPU-EM에 비해 더 높은 바이러스 억제 효과를 보였다.
각 목적을 달성하기 위해 6-well plate와 8-well 챔버에 단층 배양된 MA104 세포에 감염다중도가 0.1 ffu/cell인 소 로타바이러스 NCDV주를 접종하였다. 37℃에서 바이러스를 12시간 동안 배양 후, 최종농도가 1 μM, 10 μM, 20 μM DABPU-EM 혹은 DABPU-DE이 포함된 배지로 교체하였고, 12시간 동안 추가적으로 배양 후 6-well plate에 있는 MA104 세포는 인산완충액으로 수세 후 스크래퍼로 긁어낸 다음 원심분리하여 세포펠렛을 만들었다. 세포펠렛은 상기의 방법에 따라 웨스턴블롯을 수행하였고, 숙주세포의 내부 컨트롤인 베타액틴 대비 검출된 소 로타바이러스 VP6 단백질은 양은 ImageJ로 양성 시그널 양을 계산하여 평가하였다. 동 시간에 8-well 챔버에 있는 MA104 세포는 인산완충액으로 수세 후 4% 파라포름알데히드로 고정 후, 상기의 방법대로 소 로타바이러스 VP6 단백질에 대한 면역형광염색을 수행하였다.
도 15e에서 확인할 수 있듯이, DABPU-EM 혹은 DABPU-DE에 의한 바이러스 항원 발현 및 감염 세포 내 바이러스 항원의 발현량을 검사한 결과, 농도의존성으로 소 로타바이러스 억제 효과가 있었으며, DABPU-DE가 DABPU-EM에 비해 더 높은 바이러스 억제 효과를 보였다.
각 목적을 달성하기 위해 6-well plate와 8-well 챔버에 단층 배양된 MARC-145 세포에 감염다중도가 0.1 ffu/cell인 돼지 생식기 호흡기 증후군 바이러스 LMY주를 접종하였다. 37℃에서 바이러스를 24시간 동안 배양 후, 최종농도가 1 μM, 10 μM, 20 μM DABPU-EM 혹은 DABPU-DE이 포함된 배지로 교체하였고, 24시간 동안 추가적으로 배양 후 6-well plate에 있는 MARC-145 세포는 인산완충액으로 수세 후 스크래퍼로 긁어낸 다음 원심분리하여 세포펠렛을 만들었다. 세포펠렛은 상기의 방법에 따라 웨스턴블롯을 수행하였고, 숙주세포의 내부 컨트롤인 베타액틴 대비 검출된 돼지 생식기 호흡기 증후군 바이러스 매트릭스 단백질은 양은 ImageJ로 양성 시그널 양을 계산하여 평가하였다. 동 시간에 8-well 챔버에 있는 MARC-145 세포는 인산완충액으로 수세 후 4% 파라포름알데히드로 고정 후, 상기의 방법대로 돼지 생식기 호흡기 증후군 바이러스 매트릭스 단백질에 대한 면역형광염색을 수행하였다.
도 15f에서 확인할 수 있듯이, DABPU-EM 혹은 DABPU-DE에 의한 바이러스 항원 발현 및 감염 세포 내 바이러스 항원의 발현량을 검사한 결과, 농도의존성으로 소 로타바이러스 억제 효과가 있었으며, DABPU-EM가 DABPU-DE에 비해 더 높은 바이러스 억제 효과를 보였다.
각 목적을 달성하기 위해 6-well plate와 8-well 챔버에 단층 배양된 LLC-PK 세포에 감염다중도가 0.1 ffu/cell인 돼지 사포바이러스에서 Cowden주를 접종하였다. 37℃에서 바이러스를 24시간 동안 배양 후, 최종농도가 1 μM, 10 μM, 20 μM DABPU-EM 혹은 DABPU-DE이 포함된 배지로 교체하였고, 18시간 동안 추가적으로 배양 후 6-well plate에 있는 LLC-PK 세포는 인산완충액으로 수세 후 스크래퍼로 긁어낸 다음 원심분리하여 세포펠렛을 만들었다. 세포펠렛은 상기의 방법에 따라 웨스턴블롯을 수행하였고, 숙주세포의 내부 컨트롤인 베타액틴 대비 검출된 돼지 사포바이러스 VPg 단백질은 양은 ImageJ로 양성 시그널 양을 계산하여 평가하였다. 동 시간에 8-well 챔버에 있는 LLC-PK 세포는 인산완충액으로 수세 후 4% 파라포름알데히드로 고정 후, 상기의 방법대로 돼지 사포바이러스 VPg 단백질에 대한 면역형광염색을 수행하였다.
도 15g에서 확인할 수 있듯이, DABPU-EM 혹은 DABPU-DE에 의한 바이러스 항원 발현 및 감염 세포 내 바이러스 항원의 발현량을 검사한 결과, 농도의존성으로 돼지 사포바이러스 억제 효과가 있었으며, DABPU-EM이 DABPU-DE에 비해 더 높은 바이러스 억제 효과를 보였다.
실험예 12: 지방분해효소 억제제인 atglistatin(DABPU-DM)의 유도체인 DABPU-EM 및 DABPU-DE에 의한 반수 최대 세포 독성 농도, 지방분해효소 억제제에 대한 바이러스의 반수 최대 억제 농도, 및 선택지수
상기 실험예 5와 동일한 방법으로 Atglistatin의 유도체인 DABPU-EM 및 DABPU-DE의 반수 최대 세포 독성 농도를 검사하였다.
Atglistatin 유도체 DABPU-EM 및 DABPU-DE 반수 최대 세포 독성 농도(half maximal cytotoxic concentration, CC50)
Cell line CC50 (μM)
DABPU-EM DABPU-DE
A549 206.3 213.3
Vero E6 209.7 222.2
HRT18G 186.1 177.4
MA104 223.3 208.8
MARC 209.7 216.5
LLC-PK 231.2 225.5
표 8에서 확인할 수 있듯이, DABPU-EM의 A549, Vero E6, MDCK, HRT18G, MA04, MARC, LLC-PK 세포에서의 반수 최대 세포 독성 농도는 186.1~231.2로 높았다. DABPU-DE의 A549. Vero E6, MDCK, HRT18G, MA04, MARC, LLC-PK 세포에서의 반수 최대 세포 독성 농도는 177.4~225.5로 높았지만, DABPU-EM의 반수 최대 세포 독성 농도보다는 약간 낮았다.
Atglistatin의 유도체인 DABPU-EM 및 DABPU-DE 반수 최대 억제 농도 및 선택지수
Virus family Virus (strain) IC50 (μM) SI (CC50/IC50)a
DABPU-EM DABPU-DE DABPU-EM DABPU-DE
Orthomyxoviridae Influenza A virus (H1N1) (PR8) 1.63 1.03 127 207
Coronaviridae SARS-CoV-2 (KCDC03) 1.71 1.20 122 185
Coronaviridae Bovine coronavirus (KWD20) 3.44 1.12 54 158
Coronaviridae Porcine epidemic diarrhea coronavirus (QIAP1401) 1.94 1.62 108 128
Reoviridae Species A Rotavirus (NCDV) 7.08 5.22 32 36
Arteriviridae Porcine respiratory reproductive syndrome virus (LMY) 2.70 2.29 78 95
Caliciviridae Porcine sapovirus (Cowden) 3.70 2.77 62 81
표 9, 도 16a 내지 16g에서 확인할 수 있듯이, DABPU-EM은 반수 최대 억제 농도가 1.63~7.08였으며, DABPU-DE는 1.03~5.22 였다. 특히 전 세계적으로 막대한 피해를 일으키고 있는 인플루엔자 A 바이러스와 사스코로나바이러스 유형 2에 대해 DABPU-EM은 1.63와 1.71였으며, DABPU-DE는 1.03와 1.20였다. 이는 인플루엔자 A 바이러스와 사스코로나바이러스 유형 2에 대해 DABPU-EM과 DABPU-DE가 저농도에서도 높은 억제능력이 있다는 것을 의미한다.
구체적으로, DABPU-EM는 세포 독성 대비 효율적으로 사스코로나바이러스 유형 2 KCDC03주, 인플루엔자 A 바이러스 PR8주, 소 코로나바이러스 KWD20주, 돼지 유행성 설사 코로나바이러스 QIAP1401주, 소 로타바이러스 NCDV주, 돼지 생식기 호흡기 증후군 바이러스 LMY주 및 돼지 사포바이러스 Cowden주를 억제하였으며, 각 바이러스에 대한 선택지수(SI)는 122, 127, 54, 108, 32, 78, 62 였다.
또한 DABPU-DE 세포 독성 대비 효율적으로 사스코로나바이러스 유형 2 KCDC03주, 인플루엔자 A 바이러스 PR8주, 소 코로나바이러스 KWD20주, 돼지 유행성 설사 코로나바이러스 QIAP1401주, 소 로타바이러스 NCDV주, 돼지 생식기 호흡기 증후군 바이러스 LMY주 및 돼지 사포바이러스 Cowden주를 억제하였으며, 각 바이러스에 대한 선택지수(SI)는 185, 207, 158, 128, 36, 95, 81 였으며, 전반적으로 DABPU-DE가 DABPU-EM에 비해 더 높은 바이러스 억제 능력을 가지고 있었다.
실험예 13: 지방분해효소 억제제인 DABPU-EM 및 DABPU-DE에 의한 바이러스 게놈 수 및 자손 바이러스 생산 억제 효과
실험예 6과 동일한 방법으로 DABPU-EM 및 DABPU-DE에 의한 각 바이러스 게놈 수 및 자손 바이러스 생산 억제효과를 검출하였다. 각각의 바이러스를 흡착시켜 배양한 후 DABPU-EM 및 DABPU-DE 포함된 배양배지로 교체하여 배양하고, 이후 세포를 웰에서 떼어내어 다음 실험을 수행하였다.
각 바이러스에서 DABPU-EM 및 DABPU-DE에 의한 자손 바이러스 생산 억제효과를 분석하기 위해 실험예 6과 동일한 방법으로 수행하되, 상층액 흡착 후 각 배양배지를 첨가하여 사스코로나바이러스 유형 2가 감염된 플레이트는 18시간, 인플루엔자 A 바이러스가 감염된 플레이트는 12시간, 소 코로나바이러스가 감염된 플레이트는 18시간, 돼지 유행성 설사 코로나바이러스가 감염된 플레이트는 18시간, 소 로타바이러스가 감염된 플레이트는 12시간, 돼지 생식기 호흡기 증후군 바이러스가 감염된 플레이트는 18시간, 돼지 사포바이러스가 감염된 플레이트는 18시간을 추가로 배양하였다. 그 다음 상층액을 제거 후, 4% 파라포름알데하이드 용액으로 15분간 고정한 후, 인산완충생리식염수로 3번 각 well을 수세한 다음 0.2% Triton X-100로 20℃에서 10분간 처리하고, 염색을 통해 바이러스 양성 세포들을 검사하였다.
도 17a 내지 17d에서 확인할 수 있듯이, DABPU-EM 및 DABPU-DE는 1, 10, 20 μM 모든 농도에서 각 바이러스의 게놈 수와 자손 바이러스 생산 수를 유의성 있게 그리고 농도의존적으로 감소시켰다. 따라서 지방분해효소 억제제를 사용함으로써 다양한 RNA 바이러스에서 광범위한 항바이러스 효과가 있음을 확인하였다.
실험예 14: 지방분해효소 억제제인 atglistatin(DABPU-DM)의 유도체인 DABPU-DE 및 DABPU-EM 투여에 의한 인플루엔자 A 바이러스(IAV) 감염 마우스의 생존율, 체중저하, 임상증상, 바이러스 증식 및 병변 개선효과
인플루엔자 A 바이러스가 감염된 동물에서 DABPU-EM 및 DABPU-DE에 의한 지방분해효소 억제에 따른 항바이러스효과를 검증하기 위해 상기 실험예 7과 동일한 방법으로 수행하였다.
도 18b 내지 18g에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 마우스에 atglistatin 유도체인 DABPU-EM 및 DABPU-DE을 투여한 결과, 농도의존성으로 생존율, 체중저하, 임상증상이 개선되었다. 특히, 5 mg kg-1 day-1 atglistatin(DABPU-DM) 실험군에서는 62.5% 생존율, 10 mg kg-1 day-1 DABPU-EM 실험군은 50% 생존율, 5 mg kg-1 day-1 및 10 mg kg-1 day-1 DABPU-DE 실험군은 68.8% 생존율 개선효과를 보여주었다. 결론적으로, 인플루엔자 A 바이러스 감염증에서 DABPU-DE는 atglistatin(DABPU-DM) 보다 더 좋은 치료효과를 보여주었다.
다음 상기 실험예 7과 동일한 방법으로 DABPU-EM 혹은 DABPU-DE를 처치하였을 때 폐 조직 내 유리지방산과 글리세롤, 바이러스 유전자의 수, 자손 바이러스 수에 미치는 영향을 수행하여 평가하고, 또한, 인플루엔자 A 바이러스 감염에 의한 폐렴을 얼마나 완화시킬 수 있는지, 마우스 폐 조직에서 바이러스 항원 및 지방적에 대한 면역형광염색을 통한 분석, 조직병리학적 분석, 바이러스 항원에 대한 면역조직화학염색을 통한 분석을 실시하였다.
도 18h 내지 18j에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 마우스에 지방분해효소 DABPU-EM 및 DABPU-DE을 투여한 결과, 폐 조직에서 유리지방산과 글리세롤 농도(h), 바이러스 유전자 수(i), 자손 바이러스 수(j)가 유의성 있게 감소시켰지만, DABPU-DE가 DABPU-EM 보다 더 많이 감소시켰다.
상기 폐 조직에서 지방적 및 인플루엔자 A 바이러스 항원 평가를 위해, 상기 실험예 7과 동일한 방법으로 고정된 조직을 가지고 3 ㎛ 동결절편 조직을 만들었다.
도 18k에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 마우스에 지방분해효소 억제제인 DABPU-EM 및 DABPU-DE을 투여한 결과, 무처치 바이러스 접종군의 마우스에 비해 바이러스 접종 후 약물을 처치한 실험군의 마우스 세기관지 상피세포에서 바이러스 항원은 유의성 있게 크게 감소하였지만, 지방적의 수는 유의성 있게 감소하지 않았다.
상기 폐 조직에서 병리조직학적 분석을 위해 고정된 조직을 상기 실험예 7과 동일한 방법으로 각급 알코올을 통한 탈수, 자일렌(xylene) 침투, 파라핀 봉입 후에 3 ㎛로 세절하여 광학현미경으로 조직학적 검사를 수행하였다.
도 18l에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 마우스에 지방분해효소 억제제인 DABPU-EM 및 DABPU-DE을 투여한 결과, 무처치 바이러스 접종군의 마우스에 비해 바이러스 접종 후 약물을 처치한 실험군의 마우스에서 간질성 폐렴을 포함한 폐 병변과 바이러스 양성세포 수가 두 약물에 의해 완화 및 감소되었으며, 특히 DABPU-DE이 DABPU-DE에 비해 효과가 높았다.
결론적으로, atglistatin 유도체인 DABPU-EM 및 DABPU-DE은 인플루엔자 A 바이러스에 감염된 마우스를 방어하는 효능이 있었으며, 10 mg kg-1 day-1 로 DABPU-EM 및 DABPU-DE을 투여 시, 100% 폐사율을 보인 대조군에 비해 생존율이 50%와 68.8%로 증가하였다. 특히 DABPU-DE이 DABPU-EM 보다 높은 바이러스 억제능을 보였다.
실험예 15: 지방분해효소 억제제인 atglistatin(DABPU-DM)의 유도체인 DABPU-DE의 투여에 의한 사스코로나바이러스 유형 2(SARS-CoV-2) 감염 햄스터의 폐렴 중증도, 바이러스 증식, 체중저하 및 폐 병변 개선효과
사스코로나바이러스 유형 2에 감염된 동물에서 지방분해효소 억제에 따른 항바이러스효과를 검증하기 위해 상기 실험예 8과 동일한 방법으로 수행하였다(도 19a).
Atglistatin(DABPU-DM) 및 DABPU-DE의 항바이러스 효능평가를 위해 다음과 같이 햄스터를 바이러스 무접종 및 무처치 그룹(No virus + vehicle), 사스 코로나바이러스 유형 2 KCDC03주 접종 및 무처치 그룹(SARS-CoV-2 + vehicle), 사스 코로나바이러스 유형 2 KCDC03주 접종 및 40 mg/kg/day atglistatin(DABPU-DM) 처치 그룹(SARS-CoV-2 + DM (40 mg kg-1 day-1)), 사스 코로나바이러스 유형 2 KCDC03주 접종 및 20 mg/kg/day DABPU-DE 처치 그룹(SARS-CoV-2 + DE (40 mg kg-1 day-1)), 사스 코로나바이러스 유형 2 KCDC03주 접종 및 40 mg/kg/day DABPU-DE 처치 그룹(SARS-CoV-2 + DE (40 mg kg-1 day-1)), 사스 코로나바이러스 유형 2 KCDC03주 접종 및 80 mg/kg/day DABPU-DE 처치 그룹(SARS-CoV-2 + DE (80 mg kg-1 day-1)) 등 총 6개의 실험군을 만들었다. 각 군은 암컷 11주령 골든 시리안 햄스터를 5마리씩 배치하였으며, 상술한 조건으로 1주일간 햄스터를 계류한 후 실험을 실시하였다(도 19a).
도 19b 및 19c에서 확인할 수 있듯이, 사스코로나바이러스 유형 2에 감염된 햄스터에 atglistatin(DABPU-DM) 및 DABPU-DE을 투여한 결과, 농도의존성으로 폐렴 중증도가 개선되었으며 유리지방산 및 글리세롤의 생성이 유의성있게 감소하였다. 특히, 80 mg kg-1 day-1 atglistatin(DABPU-DM)을 4.5일간 투여한 실험군에서는 70% 폐렴 중증도 개선률을 보였고, 80 mg kg-1 day-1 DABPU-DE을 4.5일간 투여한 실험군에서는 75% 폐렴 중증도 개선률을 보였다. 결론적으로, 사스코로나바이러스 유형 2 감염증에서 DABPU-DE는 atglistatin(DABPU-DM) 보다 더 좋은 치료효과를 보여주었다.
이어서 상기의 폐 조직 내 atglistatin(DABPU-DM) 및 DABPU-DE 처치에 의한 바이러스 유전자의 수, 자손 바이러스 수에 미치는 영향을 평가하기 위하여 상기 실험예 8과 동일한 방법으로 수행하고, 사스코로나바이러스 유형 2 뉴클레오캡시드 유전자 및 숙주의 β-액틴 유전자에 대해 real-time PCR을 수행해 바이러스의 유전자 수를 구하여 약물의 바이러스 유전자 억제 효과를 평가하였다.
도 19d 내지 19f에서 확인할 수 있듯이, 사스코로나바이러스 유형 2에 감염된 햄스터에 지방분해효소 억제제인 atglistatin(DABPU-DM) 및 DABPU-DE를 투여한 결과, 폐 조직에서 바이러스 유전자 수(d), 자손 바이러스 수(e)가 유의성 있게 감소시켰으며, 결과적으로 햄스터의 체중저하(f)를 개선시켰다.
결론적으로, atglistatin(DABPU-DM) 및 atglistatin 유도체인 DABPU-DE는 사스코로나바이러스 유형 2에 감염된 햄스터를 방어하는 효능이 있었으며, 특히 80 mg kg-1 day-1 DABPU-DE를 투여한 실험군에서는 75% 폐렴 중증도 개선률을 보여, 80 mg kg-1 day-1 atglistatin(DABPU-DM)을 투여한 실험군보다 더 뛰어난 폐렴 중증도 개선률을 보였다. 또한 80 mg kg-1 day-1 DABPU-DE를 투여한 실험군이 80 mg kg-1 day-1 atglistatin(DABPU-DM)을 투여한 실험군에 비해 폐 조직 내 유리지방산 및 글리세롤 함량이 더 적었다. 이는 atglistatin은 지방적의 분해를 억제하여, 유리지방산이 생성을 억제함으로써 바이러스 증식을 억제하는 것에서 기인하는 것으로, DABPU-DE가 atglistatin(DABPU-DM) 보다 억제효과가 더 큼을 나타낸다.
실험예 16: DABPU-DE 및 인플루엔자 A 바이러스(IAV) 항바이러스제의 단독 혹은 병용 투여에 따른 감염된 마우스의 생존율, 체중저하, 임상증상, 바이러스 증식 및 병변 개선효과와 사스코로나바이러스 유형 2(SARS-CoV-2) 항바이러스제의 단독 혹은 병용 투여에 따른 감염된 햄스터의 폐렴 개선률, 바이러스 증식, 체중저하 및 병변 개선효과
인플루엔자 A 바이러스가 감염된 동물에서 atglistatin(DABPU-DM)의 유도체인 DABPU-DE와 항바이러스제인 오셀타미비르와의 단독 혹은 혼합투여에 따른 항바이러스효과를 검증하기 위해 150 mg/ml DABPU-DE을 DMSO에 용해하였고, 10 mg/ml 오셀타미비르를 H2O에 용해하였다. 이후 농도에 따른 항바이러스 효과를 평가하기 위해 0.5 mg/ml DABPU-DE와 0.2 mg/ml 오셀타미비르를 준비하였으며 이때 용매로서 각각 DMSO:40% PEG:H2O가 1:4:5로 희석된 합제 또는 H2O를 사용하였다. 이 약물을 마우스에 200 μL 접종하면 각각 최종농도가, 5 mg kg-1 day-1 DABPU-DE과 2 mg kg-1 day-1 오셀타미비르가 되었다(도 20a).
DABPU-DE와 atglistatin과 단독 혹은 혼합투여에 따른 항바이러스 효능평가를 위해 다음과 같이 마우스를 바이러스 무접종 및 무처치 그룹(No virus(+ vehicle)), 인플루엔자 A 바이러스 PR8주 접종 및 무처치 그룹(IAV + vehicle), 인플루엔자 A 바이러스 PR8주 접종 및 2 mg/kg/day 오셀타미비르 처치 그룹(IAV + oseltamivir), 인플루엔자 A 바이러스 PR8주 접종 및 5 mg/kg/day DABPU-DE 처치 그룹(IAV + DE), 인플루엔자 A 바이러스 PR8주 접종 및 2 mg/kg/day 오셀타미비르와 5 mg/kg/day DABPU-DE 처치 그룹(IAV + oseltamivir + DE)등 총 5개의 실험군을 만들었다. 각 군은 7주령 암컷 wild-type C57BL/6J 마우스를 16마리씩 배치하였으며, 상술한 조건으로 1주일간 마우스를 계류한 후 상기 실험예 9와 동일한 방법으로 실험을 실시하였다.
도 20b 내지 20d에서 확인할 수 있듯이, 오셀타미비르와 DABPU-DE 혼합투여의 경우 100% 생존율을 보였고, DABPU-DE 혹은 atglistatin 단독 투여에 비해 오셀타미비르/DABPU-DE 혼합투여가 생존율, 몸무게, 임상증상을 더욱 개선시켰으며, 인플루엔자 A 바이러스 감염증의 치료에 더욱 뚜렷한 효과가 있음을 보여주었다.
각 목적을 달성하기 위해 사스 코로나바이러스 유형 2 KCDC03주(A lineage), KDCA51463주(Alpha lineage) 혹은 KDCA55905주(Beta lineage)에 감염된 동물에서 상기 atglistatin(DABPU-DM)의 유도체인 DABPU-DE와 항바이러스제인 렘데시비르와의 단독 혹은 혼합투여에 따른 항바이러스효과를 검증하기 위해 150 mg/ml DABPU-DE와 50 mg/ml 렘데시비르를 DMSO에 용해하였다. 이후 농도에 따른 항바이러스 효과를 평가하기 위해 7.5 mg/ml DABPU-DE와 0.47 mg/ml 렘데시비르를 준비하였으며 이때 용매로서 각각 DMSO:40% PEG: H2O가 1:4:5로 희석된 합제 또는 DMSO: Corn oil이 1:9로 희석된 합제를 사용하였다. 이 약물을 햄스터에 800 μL 접종하면 각각 최종농도가, 40 mg kg-1 day-1 DABPU-DE과 2.5 mg kg-1 day-1 렘데시비르가 되었다(도 20e).
사스 코로나바이러스 유형 2 KCDC03주(A lineage), KDCA51463주(Alpha lineage), KDCA55905주(Beta lineage) 각각에 대한 렘데시비르와 DABPU-DE과 단독 혹은 혼합투여에 따른 항바이러스 효능평가를 위해 다음과 같이 햄스터를 바이러스 무접종 및 무처치 그룹(No virus + vehicle), 사스 코로나바이러스 유형 2 접종 및 무처치 그룹(SARS-CoV-2 + vehicle), 사스 코로나바이러스 유형 2 접종 및 2.5 mg/kg/day 오셀타미비르 처치 그룹(SARS-CoV-2 + oseltamivir), 사스 코로나바이러스 유형 2 접종 및 40 mg/kg/day DABPU-DE 처치 그룹(SARS-CoV-2 + DE), 사스 코로나바이러스 유형 2 및 2.5 mg/kg/day 렘데시비르와 40 mg/kg/day DABPU-DE 처치 그룹(IAV + oseltamivir + DE)등 총 5개의 실험군을 만들었다. 각 군은 암컷 11주령 골든 시리안 햄스터를 5마리씩 배치하였으며, 상술한 조건으로 1주일간 햄스터를 계류한 후 상기 실험예 9와 동일한 방법으로 실험을 실시하였다.
도 20f 내지 20i에서 확인할 수 있듯이, 렘데시비르와 DABPU-DE 혼합투여의 경우 사스 코로나바이러스 유형 2 lineage A 에서는 폐렴 중증도를 84%, 사스 코로나바이러스 유형 2 lineage Alpha 에서는 폐렴 중증도를 80%, 사스 코로나바이러스 유형 2 lineage Beta 에서는 폐렴 중증도를 87% 개선시켰다. 렘데시비르 혹은 DABPU-DE 단독 투여에 비해 렘데시비르/DABPU-DE 혼합투여가 폐렴 중증도 및 체중저하를 더욱 개선시켰으며, 여러 변이주의 사스 코로나바이러스 유형 2 감염증에서도 더욱 뚜렷한 치료효과를 보여주었다.
결론적으로, 지방분해효소 억제제인 DABPU-DE은 인플루엔자 A 바이러스 감염증에서 오셀타미비르와의 혼합투여 시 오셀타미비르 단독투여에 비해 더욱 유의적인 인플루엔자 A 바이러스 감염증 치료효과를 보여주었으며, 여러 변이주의 사스 코로나바이러스 유형 2 감염증에서 렘데시비르와의 혼합투여 시 렘데시비르 단독투여에 비해 더욱 유의적인 사스 코로나바이러스 유형 2 감염증 치료효과를 보여주었다.
이를 실험예 9의 결과와 비교하면 40 mg kg-1 day-1 DABPU-DE를 단독 투여한 실험군은 40 mg kg-1 day-1 atglistatin을 단독 투여한 실험군에 비해 모든 사스 코로나바이러스 유형 2 감염증에서 폐렴 중증도가 더욱 개선되었다. 특히, 40 mg kg-1 day-1 DABPU-DE와 렘데시비르를 병용 투여한 실험군은 40 mg kg-1 day-1 atglistatin와 렘데시비르를 병용 투여한 실험군에 비해 모든 사스 코로나바이러스 유형 2 감염증에서 폐렴 중증도가 더욱 개선되었다.
즉, 인플루엔자 A 바이러스 및 사스 코로나바이러스 유형 2 감염증에서 지방적의 분해를 억제함으로써 바이러스 증식을 억제할 수 있었으며, 그 억제효과는 atglistatin 보다 DABPU-DE에서 더 크게 나타났다.
실험예 17: atglistatin(DABPU-DM) 및 이의 유도체인 DABPU-DE 및 DABPU-EM의 다양한 세포에 대한 사스코로나바이러스 유형 2(SARS-CoV-2) 및 인플루엔자 A 바이러스(IAV)의 증식 억제효과
사스코로나바이러스 유형 2 KCDC03주(Lineage A), 사스코로나바이러스 유형 2 KDCA51463주(Alpha lineage, British variant), 사스코로나바이러스 유형 2 KDCA55905주(Beta lineage, South African variant), 인플루엔자 A 바이러스가 PR8주가 감염된 사람 유래의 배양세포에서 atglistatin(DABPU-DM)의 유도체인 DABPU-DE과 바이러스 억제 효과를 검증하기 위해 atglistatin(DABPU-DM), DABPU-EM 및 DABPU-DE을 DMSO에 용해하여, 1, 10, 20 mM DABPU-DM, DABPU-EM 및 DABPU-DE을 준비하였다. 이후 배양배지에 희석하여 각각 최종농도가 1, 10, 20 μM DABPU-DM, DABPU-EM 및 DABPU-DE가 되게 하였다.
상기의 목적을 달성하기 위해 12-well plate에 단층배양 된 Vero E6 세포에 감염다중도가 0.01 ffu/cell인 사스코로나바이러스 유형 2 KCDC03주를, 사스코로나바이러스 유형 2 KDCA51463주를, 사스코로나바이러스 유형 2 KDCA55905주를 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다. 이후 인산완충액으로 수세하고, 1 μg/ml TPCK-treated trypsin, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 18시간 동안 배양하였다. 그 다음 인산완충생리식염수로 3번 각 well을 수세한 다음 최종농도가 20 μM DABPU-DM, DABPU-EM 혹은 DABPU-DE이 포함된 배지로 교체하였다. 이후 18시간을 추가적으로 배양하여 배지 상층액은 자손 바이러스 수를 측정하기 위한 세포 배양 면역형광항체법(cell culture immunofluorescence assay, CCIF assay)에 사용하였고, 상기 실험예 4와 동일한 방법으로 RNA를 추출하여 바이러스 유전자수를 측정하였다.
도 21a 내지 21f에서 확인할 수 있듯이, 사스코로나바이러스 유형 2가 감염된 사람 유래의 배양세포에서 DABPU-DM, DABPU-EM 혹은 DABPU-DE 처리군은 용매 (vehicle) 처리군에 비해 바이러스 유전자 수를 유의적으로 감소시켰다.
결론적으로, atglistatin(DABPU-DM) 및 그 유도체인 DABPU-EM 혹은 DABPU-DE는 사스코로나바이러스 유형 2에 대한 유의적인 바이러스 증식 억제 효과를 보여주었으며, 이것은 사스코로나바이러스 유형 2 KCDC03주(Lineage A), 사스코로나바이러스 유형 2 KDCA51463주(Alpha lineage, British variant), 사스코로나바이러스 유형 2 KDCA55905주(Beta lineage, South African variant)에서 공통적으로 관찰되었다. 특히, DABPU-DE의 경우 atglistatin(DABPU-DM)보다 더 우수한 바이러스 억제 효과를 나타내었다. 이는 atglistatin(DABPU-DM)뿐만 아니라 이의 유도체인 DABPU-DE와 DABPU-EM을 인간에서 발생하고 있는 사스코로나바이러스 유형 2 감염증에 치료제로서 활용할 수 있다는 것을 의미한다.
상기의 목적을 달성하기 위해 12-well plate에 단층배양 된 MRC-5 세포, NCI-H293 세포, WI-38 세포 및 Calu-3 세포에 감염다중도가 0.01 ffu/cell인 인플루엔자 A 바이러스 PR8주를 접종하고 1시간 동안 37℃ CO2 인큐베이터에서 바이러스를 세포에 흡착시켰다. 이후 인산완충액으로 수세하고, 1 μg/ml TPCK-treated trypsin, 100 u/ml 페니실린, 100 ug/ml 스트렙토마이신이 첨가된 DMEM을 첨가한 후에 37℃ CO2 인큐베이터에서 12시간 동안 배양하였다. 그 다음 인산완충생리식염수로 3번 각 well을 수세한 다음 최종농도가 1, 10, 20 μM DABPU-DM, DABPU-EM 혹은 DABPU-DE이 포함된 배지로 교체하였다. 이후 12시간을 추가적으로 배양하여 배지 상층액은 자손 바이러스 수를 측정하기 위한 세포 배양 플라그어세이(plaque assay)에 사용하였고, 상기 실험예 4와 동일한 방법으로 RNA를 추출하여 바이러스 유전자수를 측정하였다.
도 21g 내지 21n에서 확인할 수 있듯이, 인플루엔자 A 바이러스가 감염된 사람 유래의 배양세포인 MRC-5 세포, NCI-H293 세포, WI-38 세포 및 Calu-3 세포에서 DABPU-DM, DABPU-EM 혹은 DABPU-DE는 처리군은 용매(vehicle) 처리군에 비해 바이러스 유전자 수 및 자손 바이러스를 유의적으로 감소시켰다. 이는 atglistatin(DABPU-DM)뿐만 아니라 이의 유도체인 DABPU-DE와 DABPU-EM이 인간에서 발생하고 있는 인플루엔자 A 바이러스 감염증에 치료제로서 활용할 수 있다는 것을 의미한다.
이상의 결과를 요약하면, atglistatin(DABPU-DM) 및 그 유도체인 DABPU-EM 혹은 DABPU-DE는 인간 유래의 다양한 배양세포에서 감염된 사스코로나바이러스 유형 2 및 인플루엔자 A 바이러스 증식을 억제하는 효능을 발휘한다. 이는 atglistatin(DABPU-DM) 및 그 유도체인 DABPU-EM 혹은 DABPU-DE가 인간에서 발생하고 있는 사스코로나바이러스 유형 2 및 인플루엔자 A 바이러스 감염증을 치료할 수 있는 치료제로 사용할 수 있다는 것을 의미한다.
본 발명은 지방분해효소 억제제를 포함하는 RNA 바이러스 감염증 예방 또는 치료용 약제학적 조성물에 관한 것으로서, 더욱 상세하게는 지방질 중성지방 지방분해효소(adipose triglyceride lipase; ATGL) 억제제의 유도체를 포함하는 RNA 바이러스 감염증 예방 또는 치료용 약제학적 조성물에 관한 것이다.

Claims (12)

  1. 지방분해효소 억제제를 포함하는 RNA 바이러스 감염증 예방 또는 치료용 약제학적 조성물.
  2. 제1항에 있어서, 상기 지방분해효소 억제제는 지방질 중성지방 지방분해효소(adipose triglyceride lipase; ATGL) 억제제, 호르몬 감수성 지방분해효소(hormone-sensitive lipase; HSL) 억제제, 및 모노아실글리세롤 지방분해효소(monoacylglycerol lipase; MGL) 억제제로 이루어진 군으로부터 선택되는 1종 이상인 것인, 약제학적 조성물.
  3. 제2항에 있어서, 상기 ATGL 억제제는 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이메틸유레아 및 이의 유도체인 것인, 약제학적 조성물.
  4. 제3항에 있어서, 상기 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이메틸유레아의 유도체는
    3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아,
    3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1-에틸-1-메틸유레아,
    3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이페닐유레아,
    N-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)피롤리딘-1-카르복스아마이드, 및
    N-(4'-(다이메틸아미노)-(1,1‘-바이페닐)-3-일)모폴린-4-카르복스아마이드
    로 이루어진 군으로부터 선택되는 1종 이상인 것인, 약제학적 조성물.
  5. 제1항에 있어서, 상기 약제학적 조성물은 오셀타미비르(oseltamivir) 및 렘데시비르(remdesivir)로 이루어진 군으로부터 선택되는 1종 이상의 항바이러스제를 추가적으로 포함하는 것인, 약제학적 조성물.
  6. 제1항에 있어서, 상기 RNA 바이러스는 사스코로나바이러스 유형 1 및 2(SARS Corona Virus; SARS-CoV-1, SARS-CoV-2), 인플루엔자 A 바이러스(influenza A virus; IAV), 소 코로나바이러스(bovine coronavirus; BCoV), 돼지 유행성 설사 코로나바이러스(porcine epidemic diarrhea coronavirus; PEDV), 소 로타바이러스(Bovine species A rotavirus; RVA), 돼지 생식기 호흡기 증후군 바이러스(porcine reproductive and respiratory syndrome virus; PRRSV), 돼지 사포바이러스(Porcine sapovirus; PSaV), 노로바이러스(norovirus), 고양이 전염성 복막염 코로나바이러스(feline infectious peritonitis virus; FIPV), 메르스코로나바이러스(MERS Corona Virus), 지카바이러스(Zika virus), 뎅기열 바이러스(dengue fever virus), 및 A형 및 C형 간염 바이러스(Hepatitis viruses)로 이루어진 군으로부터 선택되는 1종 이상인 것인, 약제학적 조성물.
  7. 지방분해효소 억제제를 포함하는 항바이러스용 조성물.
  8. 제7항에 있어서, 상기 지방분해효소 억제제는 지방질 중성지방 지방분해효소(adipose triglyceride lipase; ATGL) 억제제, 호르몬 감수성 지방분해효소(hormone-sensitive lipase; HSL) 억제제, 및 모노아실글리세롤 지방분해효소(monoacylglycerol lipase; MGL) 억제제로 이루어진 군으로부터 선택되는 1종 이상인 것인, 항바이러스용 조성물.
  9. 제8항에 있어서, 상기 ATGL 억제제는 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이메틸유레아 및 이의 유도체인 것인, 항바이러스용 조성물.
  10. 제9항에 있어서, 상기 3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이메틸유레아의 유도체는
    3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이에틸유레아,
    3-(4'-(다이메틸아미노)-(1,1'-바이페닐)-3-일)-1-에틸-1-메틸유레아,
    3-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)-1,1-다이페닐유레아,
    N-(4'-다이메틸아미노)-(1,1'-바이페닐)-3-일)피롤리딘-1-카르복스아마이드, 및
    N-(4'-(다이메틸아미노)-(1,1‘-바이페닐)-3-일)모폴린-4-카르복스아마이드
    로 이루어진 군으로부터 선택되는 1종 이상인 것인, 항바이러스용 조성물.
  11. 제7항에 있어서, 상기 항바이러스 조성물은 오셀타미비르(oseltamivir) 및 렘데시비르(remdesivir)로 이루어진 군으로부터 선택되는 1종 이상의 항바이러스제를 추가적으로 포함하는 것인, 항바이러스용 조성물.
  12. 제7항에 있어서, 상기 항바이러스는 사스코로나바이러스 유형 1 및 2(SARS Corona Virus; SARS-CoV-1, SARS-CoV-2), 인플루엔자 A 바이러스(influenza A virus; IAV), 소 코로나바이러스(bovine coronavirus; BCoV), 돼지 유행성 설사 코로나바이러스(porcine epidemic diarrhea coronavirus; PEDV), 소 로타바이러스(Bovine species A rotavirus; RVA), 돼지 생식기 호흡기 증후군 바이러스(porcine reproductive and respiratory syndrome virus; PRRSV), 돼지 사포바이러스(Porcine sapovirus; PSaV), 노로바이러스(norovirus), 고양이 전염성 복막염 코로나바이러스(feline infectious peritonitis virus; FIPV), 메르스코로나바이러스(MERS Corona Virus), 지카바이러스(Zika virus), 뎅기열 바이러스(dengue fever virus), 및 A형 및 C형 간염 바이러스(Hepatitis viruses)로 이루어진 군으로부터 선택되는 1종 이상에 대한 활성인 것인, 항바이러스용 조성물.
PCT/KR2022/009041 2021-06-25 2022-06-24 지방분해효소 억제제를 포함하는 rna 바이러스 감염증 예방 또는 치료용 약제학적 조성물 WO2022270978A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP22828825.4A EP4360629A1 (en) 2021-06-25 2022-06-24 Pharmaceutical composition comprising lipase inhibitor for treatment or treatment of rna viral infections

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2021-0083385 2021-06-25
KR20210083385 2021-06-25
KR1020220077063A KR20230001534A (ko) 2021-06-25 2022-06-23 지방분해효소 억제제를 포함하는 rna 바이러스 감염증 예방 또는 치료용 약제학적 조성물
KR10-2022-0077063 2022-06-23

Publications (1)

Publication Number Publication Date
WO2022270978A1 true WO2022270978A1 (ko) 2022-12-29

Family

ID=84544668

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/009041 WO2022270978A1 (ko) 2021-06-25 2022-06-24 지방분해효소 억제제를 포함하는 rna 바이러스 감염증 예방 또는 치료용 약제학적 조성물

Country Status (2)

Country Link
EP (1) EP4360629A1 (ko)
WO (1) WO2022270978A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140040676A (ko) * 2010-10-15 2014-04-03 바이오크리스트파마슈티컬즈,인코포레이티드 폴리머라아제 억제를 위한 방법 및 조성물
US9206115B2 (en) * 2010-05-21 2015-12-08 Technische Universität Graz ATGListatin and pharmaceutical composition comprising the same
US20180256623A1 (en) * 2015-09-16 2018-09-13 University Of Virginia Patent Foundation Compositions and method for regulating adipose tissue lipolysis, insulin-resistance, and hyperglycemia
KR20210083385A (ko) 2012-01-19 2021-07-06 브이아이디 스케일, 인크. 비디오 코딩 기준 화상 목록들을 시그널링하고 구성하는 방법 및 장치
KR20220077063A (ko) 2020-12-01 2022-06-08 주식회사 글로벌테크놀로지 디스플레이를 위한 백라이트 장치의 전류 제어 집적회로

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9206115B2 (en) * 2010-05-21 2015-12-08 Technische Universität Graz ATGListatin and pharmaceutical composition comprising the same
KR20140040676A (ko) * 2010-10-15 2014-04-03 바이오크리스트파마슈티컬즈,인코포레이티드 폴리머라아제 억제를 위한 방법 및 조성물
KR20210083385A (ko) 2012-01-19 2021-07-06 브이아이디 스케일, 인크. 비디오 코딩 기준 화상 목록들을 시그널링하고 구성하는 방법 및 장치
US20180256623A1 (en) * 2015-09-16 2018-09-13 University Of Virginia Patent Foundation Compositions and method for regulating adipose tissue lipolysis, insulin-resistance, and hyperglycemia
KR20220077063A (ko) 2020-12-01 2022-06-08 주식회사 글로벌테크놀로지 디스플레이를 위한 백라이트 장치의 전류 제어 집적회로

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LAUFMAN ORLY; PERRINO JOHN; ANDINO RAUL: "Viral Generated Inter-Organelle Contacts Redirect Lipid Flux for Genome Replication", CELL, ELSEVIER, AMSTERDAM NL, vol. 178, no. 2, 13 June 2019 (2019-06-13), Amsterdam NL , pages 275, XP085739926, ISSN: 0092-8674, DOI: 10.1016/j.cell.2019.05.030 *
LI XINHONG, WANG MINGSHU, CHENG ANCHUN, WEN XINGJIAN, OU XUMIN, MAO SAI, GAO QUN, SUN DI, JIA RENYONG, YANG QIAO, WU YING, ZHU DEK: "Enterovirus Replication Organelles and Inhibitors of Their Formation", FRONTIERS IN MICROBIOLOGY, vol. 11, XP093017255, DOI: 10.3389/fmicb.2020.01817 *
no. 1469924-27-3

Also Published As

Publication number Publication date
EP4360629A1 (en) 2024-05-01

Similar Documents

Publication Publication Date Title
WO2017116205A1 (ko) 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체의 지속형 결합체
WO2011043584A2 (ko) 형질전환 식물 유래의 고병원성 조류독감 바이러스 단백질 백신 및 그 제조방법
WO2017030292A1 (ko) P62 zz 도메인에 결합하는 리간드 또는 아르기닌화된 bip에 의해 매개되는 오토파지 활성을 통한 신경변성 질환 예방 및 치료
WO2017030410A1 (ko) 검정콩잎 추출물 및 이로부터 분리한 플라보놀배당체를 유효성분으로 함유하는 대사증후군의 예방 또는 치료용, 또는 항산화용 조성물
WO2021177519A1 (ko) 바이구아나이드 계열 화합물 및 플라본, 하이드록시플라본, 플라바논, 플라본 유도체, 하이드록시플라본 유도체, 플라바논 유도체의 복합제를 유효성분으로 함유하는 암 예방 또는 치료용 약학적 조성물
WO2018062978A1 (ko) 신규 헤테로아릴 화합물, 이의 거울상 이성질체, 부분 입체 이성질체 또는 약학적으로 허용가능한 염, 및 이를 유효성분으로 함유하는 항바이러스용 조성물
WO2021162451A1 (ko) 담즙산 또는 이의 유도체, 바이구아나이드 계열 화합물 및 항바이러스제 중 2종 이상을 유효성분으로 함유하는 암 예방 또는 치료용 약학적 조성물
WO2019182370A1 (ko) Cox2 아세틸화제를 유효성분으로 포함하는 퇴행성 신경질환의 예방 또는 치료용 약학적 조성물
WO2020262996A1 (ko) 신규한 아미노알칸산에 바이페닐기를 도입한 유도체 화합물 및 이를 포함하는 항진균성 약학적 조성물
WO2021010715A1 (ko) 골질환 예방 또는 치료용 약학 조성물
WO2010120013A1 (ko) 신규한 로다민 유도체 및 이를 포함한 차아염소산 검출 센서
WO2022270978A1 (ko) 지방분해효소 억제제를 포함하는 rna 바이러스 감염증 예방 또는 치료용 약제학적 조성물
WO2022035197A1 (ko) 안정한 약제학적 제제
WO2022019671A1 (ko) 사스-코로나바이러스-2 스파이크 단백질의 에피토프에 결합하는 사스-코로나바이러스-2 중화 결합 분자
WO2021145552A1 (ko) 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체의 지속형 결합체의 폐질환의 치료 용도
WO2014054927A1 (ko) 엠피레귤린 특이적 이중 나선 올리고 rna, 그러한 이중나선 올리고 rna를 포함하는 이중나선 올리고 rna 구조체 및 이를 포함하는 호흡기 질환의 예방 또는 치료용 조성물
WO2009148280A2 (ko) 바이러스 억제제로서 유용한 디아릴 헤파토노이드계 화합물
WO2022015115A1 (ko) 3중 작용성 지속형 결합체 또는 3중 작용제를 포함하는 조합물의 치료학적 용도
WO2020080682A1 (ko) 신규 퀴놀리논 유도체, 이의 제조방법, 및 이를 유효성분으로 함유하는 항바이러스용 조성물
WO2018016901A1 (ko) 골질환의 예방 또는 치료용 약학적 조성물
WO2024106940A1 (ko) 신규 항바이러스 펩타이드
WO2020139001A1 (ko) 세포 내 atp 생성 촉진을 위한 약제학적 조성물
WO2023038413A1 (ko) 담팔수 추출물, 분획물 또는 이들 유래 페놀화합물을 유효성분으로 포함하는, 인플루엔자 바이러스 감염증 예방, 치료 또는 개선용 조성물
WO2020040343A1 (en) Isoxazole derivatives and preparation process thereof
WO2021125905A1 (ko) 신규한 티아졸 유도체 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22828825

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2022828825

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022828825

Country of ref document: EP

Effective date: 20240125