WO2022250503A1 - Cas13 단백질 및 crrna를 포함하는 코로나바이러스감염증-19 예방 또는 치료용 약학적 조성물 - Google Patents

Cas13 단백질 및 crrna를 포함하는 코로나바이러스감염증-19 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2022250503A1
WO2022250503A1 PCT/KR2022/007599 KR2022007599W WO2022250503A1 WO 2022250503 A1 WO2022250503 A1 WO 2022250503A1 KR 2022007599 W KR2022007599 W KR 2022007599W WO 2022250503 A1 WO2022250503 A1 WO 2022250503A1
Authority
WO
WIPO (PCT)
Prior art keywords
crrna
cov
sars
covid
rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2022/007599
Other languages
English (en)
French (fr)
Inventor
허원도
유다슬이
유정혜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Advanced Institute of Science and Technology KAIST
Original Assignee
Korea Advanced Institute of Science and Technology KAIST
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Advanced Institute of Science and Technology KAIST filed Critical Korea Advanced Institute of Science and Technology KAIST
Publication of WO2022250503A1 publication Critical patent/WO2022250503A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating COVID-19 comprising Cas13 protein and crRNA.
  • Coronaviruses which cause severe respiratory illness and cause death, are classified as RNA viruses belonging to Coronaviridae, and are defined as respiratory syndrome caused by coronavirus infection.
  • viruses belonging to Coronaviridae there are a total of 7 viruses known to infect humans: 4 types that cause colds (229E, OC43, NL63, HKU1), 2 types that cause severe pneumonia (SARS-CoV, MERS-CoV), and this time There is SARS-CoV-2, the virus responsible for the pandemic.
  • SARS-CoV The three viruses (SARS-CoV, MERS-CoV, and SARS-CoV-2) that cause severe pneumonia, starting with SARS-CoV in 2002 and followed by MERS-CoV in 2012, are highly homologous in gene sequence with SARS-CoV. Until the current SARS-CoV-2, a global pandemic is underway.
  • SARS-CoV-2 was first reported in late 2019. Compared to SARS-CoV that occurred in 2002, the severity of SARS-CoV is high, but the transmission power of SARS-CoV-2 is much higher. . This has resulted in a worldwide pandemic. Common signs of infection include respiratory symptoms, fever, cough, shortness of breath and shortness of breath. In more severe cases, infection can cause pneumonia, severe acute respiratory syndrome, kidney failure and even death.
  • SARS-CoV-2's spike protein binds to the host cell's angiotensin-converting enzyme 2 (ACE2) receptor
  • ACE2 angiotensin-converting enzyme 2
  • ACE2 is an enzyme that acts on heart function and blood pressure control, and is present in large quantities in the heart, kidneys, gastrointestinal mucosa, and lungs. Among them, it is more likely to be infected through the respiratory tract than through the internal organs that have to travel through the bloodstream.
  • SARS-CoV-2 genome is replicated and proteins are synthesized by viral polymerase, and viral particles are formed and released to the outside of the cell, resulting in symptoms of viral infection.
  • CRISPR/Cas system Bacterial response to viral infection includes the CRISPR/Cas system.
  • the CRISPR-Cas system has specificity for a target through CRISPR RNA (crRNA), and when used experimentally, guide RNA (gRNA) It is used slightly modified.
  • crRNA CRISPR RNA
  • gRNA guide RNA
  • a part called a spacer of crRNA recognizes and binds to a target sequence, and at this time, the target sequence must exist adjacent to a sequence called Protospacer Adjacent Motif (PAM). After the crRNA binds to the target, the Cas protein cuts the target genome.
  • PAM Protospacer Adjacent Motif
  • CRISPR-Cas13 has the potential to be used as a therapeutic agent for RNA viruses by targeting single-stranded RNA.
  • the CRISPR/Cas13 system has been used as a treatment method for plant virus infections (Plant J. 2018 Jun;94(5):767-775.) and can be an effective antiviral agent against single-stranded RNA (ssRNA) viruses (Molecuar Cell, Volume 76, Issue 5, 5 December 2019, Pages 826-837.e11) has been disclosed.
  • ssRNA single-stranded RNA
  • the present inventors completed the present invention by confirming that the crRNA and Cas13 enzyme capable of recognizing the target RNA of SARS-CoV-2 can treat COVID-19 by degrading the genome of SARS-CoV-2.
  • An object of the present invention is to provide a pharmaceutical composition for preventing or treating coronavirus infection-19 (COVID-19).
  • the present invention provides a Cas13 protein or a polynucleotide encoding the same; And it provides a pharmaceutical composition for preventing or treating coronavirus infection-19 (COVID-19) containing crRNA (CRISPR RNA).
  • COVID-19 coronavirus infection-19
  • CRISPR RNA crRNA
  • the present invention relates to a pharmaceutical composition for preventing or treating COVID-19 comprising a Cas13 protein and crRNA, and specifically, a crRNA targeting the Cas13b of the present invention and the RdRp gene portion of ORF1b of SARS-CoV-2 or
  • the crRNA targeting the pseudoknot region located upstream of RdRp has an excellent ability to degrade RNA of SARS-CoV-2, so it can be usefully used as a treatment for COVID-19.
  • RNA-dependent RNA polymerase RNA-dependent RNA polymerase (2.7 kb)
  • 2 fragment Helicase (1.8 kb)
  • 3 fragment exonuclease + endoRNase + 2'O-ribose methyltransferase (3.5 kb) is a schematic diagram.
  • Figure 2 is a schematic diagram showing the results of sequence homology analysis of coronavirus and the crRNA target site in the SARS-CoV-2 ORF1b gene.
  • Figure 3a is a schematic diagram of the dual-luciferase assay.
  • Figure 3b is a schematic diagram of the dual-luciferase assay for the crRNA of the present invention.
  • 3c is a diagram confirming that crRNAs 2, 5, 9, and 11 show relatively low levels of light emission, indicating that SARS-CoV-2 has excellent RNA degradation ability.
  • Figure 3d is a diagram showing the results of selection as potential crRNA candidates showing excellent RNA degradation ability of SARS-CoV-2 in the order of 2, 5, 11, and 9.
  • 5 is a schematic diagram showing synthesized PspCas13b mRNA and crRNA modified with 2'-O-methyl 3'phosphorothioate.
  • Figure 6a is a diagram showing that the expression of PspCas13b protein steadily increased from 2 hours after transfection.
  • 6B is a diagram confirming that uniform expression of PspCas13b is induced in most cells through HA tag staining.
  • FIG. 7 is a diagram confirming that cells expressing PspCas13b mRNA gradually divide after 24 and 48 hours, and the number of cells visible on one image screen increases, thereby confirming that there is no cytotoxicity.
  • Figure 8a is a schematic diagram showing the location where the crRNA target site in the SARS-CoV-2 ORF1b gene can be amplified with RT-qPCR primers.
  • each crRNA spacer 1, 2, 3, and 4 can degrade the targeting portion of RdRp mRNA together with PspCas13b.
  • each crRNA spacer 5, 6, 7, and 8 8) can degrade the targeting portion of RdRp mRNA together with PspCas13b.
  • each crRNA spacer 9, 10, 11, and 12
  • PspCas13b PspCas13b
  • 9a is a diagram confirming that all four crRNAs (Nos. 2, 5, 9, and 11) showed a significant decrease in the level of RdRp mRNA by PspCas13b, compared to the non-target (NT) experimental group.
  • Figure 9b is a diagram confirming the mRNA degradation activity according to the ratio of PspCas13b and crRNA No. 2 or No. 5.
  • 10A is a diagram showing the results of immunostaining to confirm whether each crRNA expresses spike protein.
  • 10B is a diagram illustrating the effect of each crRNA on the SARS-CoV-2 RNA gene level in cell culture medium (supernant) or cell lysate (cell) of SARS-CoV-2 infected Vero E6 cells.
  • 10c is a diagram analyzing the effect of each crRNA on the number of SARS-CoV-2 genomes in Vero E6 cells infected with SARS-CoV-2.
  • 10D is a diagram illustrating the effect of each crRNA on the level of SARS-CoV-2 RNA gene in Vero E6 cells infected with SARS-CoV-2.
  • Figure 10e is a diagram analyzing the effect of each crRNA on the level of SARS-CoV-2 RdRp, nucleotide gene in Calu-3 cells infected with SARS-CoV-2.
  • 11a is a diagram showing the structure of crRNA targeting a pseudoknot region.
  • 11b is a diagram confirming through immunostaining whether pseudoknot-targeting crRNA inhibits spike protein expression.
  • 11c is a diagram confirming through western blot whether pseudoknot-targeting crRNA inhibits spike protein expression.
  • 11d is a diagram illustrating the effect of each crRNA on the level of RdRp and nucleocapsid genes in cell culture medium (supernant) or cell lysate (cell) of SARS-CoV-2-infected Vero E6 cells.
  • 12a is a diagram confirming whether spike protein expression is inhibited using dead PspsCas13b.
  • Figure 12b is a diagram confirming whether the RdRp, nucleocapsid gene levels of SARS-CoV-2 are reduced in the treatment group using dead PspsCas13b.
  • Figure 12c is a plaque assay measuring the change in the level of live SARS-CoV-2 replication according to the treatment for each concentration of Cas13b mRNA and crRNA.
  • Figure 12d is a diagram showing the results of analyzing plaque assay measuring the change in the level of live SARS-CoV-2 replication according to the treatment for each concentration of Cas13b mRNA and crRNA.
  • 13a is a SARS-CoV-2 variant It is a diagram showing the results of analyzing sequence variation between (alpha, beta, gamma and delta).
  • Figure 13b is a diagram confirming whether crRNA targeting the pseudoknot region reduces the expression of spike protein in cells infected with SARS-CoV-2 mutants.
  • 13c is a diagram confirming whether crRNA targeting the pseudoknot region reduces subgenomic RNA levels of N and nsp2 genes in SARS-CoV-2 mutant virus-infected cells.
  • 14 is a diagram confirming whether crRNA targeting the pseudoknot region inhibits viral infection in mice infected with SARS-CoV-2 mutant virus.
  • the present invention relates to a Cas13 protein or a polynucleotide encoding the same; And it provides a pharmaceutical composition for preventing or treating coronavirus infection-19 (COVID-19) containing crRNA (CRISPR RNA).
  • COVID-19 coronavirus infection-19
  • CRISPR RNA crRNA
  • the Cas13 protein is a type of Cas protein.
  • Cas protein is a CRISPR-associated protein, and is an enzyme capable of recognizing and cleaving double-stranded or single-stranded nucleic acids such as DNA or RNA (dsDNA/RNA and ssDNA/RNA). Specifically, they can recognize double-stranded or single-stranded nucleic acids bound to crRNA or guide RNA and cleave them. That is, the endonuclease function is activated by recognizing that the crRNA is bound to the target site. In addition, as the endonuclease function is activated, it may have exonuclease activity capable of non-specifically cutting double-stranded and/or single-stranded DNA and/or RNA.
  • the Cas13 protein can be any one protein selected from the group consisting of Cas13a, Cas13b, Cas13c and Cas13d, can naturally recognize and cut 'RNA', and is known as "C2c2" in bacteria.
  • Cas13 is a class 2, type VI CRISPR protein that is activated by recognizing ssRNA targets.
  • Cas13a found in Leptotrichia wadei and Prevotella sp.
  • Cas13b (PspCas13b) found at P5-125 is representative, and both do not require a specific motif like PAM.
  • the Cas13b protein is associated with one or more functional domains, and the effector protein contains one or more mutations in the HEPN domain, so that the complex can deliver epigenetic modifiers or transcriptional or translational activation or inhibition signals.
  • Complexes can be formed in vitro or ex vivo, introduced into cells or contacted with RNA; or in vivo.
  • the polynucleotide encoding the Cas13 protein may be DNA or mRNA, and according to a specific embodiment of the present invention, it is mRNA.
  • the crRNA is CRISPR RNA and may be single strand RNA.
  • crRNA may be used in the form of guide RNA combined with tracrRNA (trans-activating CRISPR RNA).
  • the crRNA may have a sequence complementary to a gene sequence specifically present in the target.
  • the crRNA may be RNA composed of 15 to 40 nucleic acids.
  • the polynucleotide may be composed of 18 to 30 nucleic acids.
  • crRNA may consist of 30 nucleic acids.
  • the crRNA may include an additional sequence 3' to make the CRISPR-associated protein active.
  • the crRNA can be chemically modified.
  • chemical transformations include, but are not limited to, 2'-O-methyl 3'phosphorothioate (MS), 2'-O-methyl ( M), or incorporation of 2'-O-methyl 3'thio PACE (MSP).
  • Such chemically modified crRNAs have unpredictable on-target (on-target, on-target) specificity versus off-target (off-target, off-target) specificity, but unmodified It may include increased stability and increased activity compared to crRNA.
  • Chemically modified crRNAs include without limitation RNAs with locked nucleic acid (LNA) nucleotides comprising phosphorothioate linkages and methylene bridges between the 2' and 4' carbons of the ribose ring.
  • LNA locked nucleic acid
  • the target RNA sequence of the SARS-CoV-2 gene is RNA-dependent RNA polymerase (RdRp) in ORF1b, a ribosomal frameshift site located upstream of RdRp, Helicase, 3' to 5' exonuclease, endoRNase or It may be a 2'O-ribose methyltransferase, preferably a ribosome reading frame displacement site located upstream of RdRp or RdRp.
  • RdRp RNA-dependent RNA polymerase
  • the crRNA can hybridize to a target site including a nucleic acid sequence selected from SEQ ID NOs: 1 to 12.
  • the guide RNA may include nucleic acid sequences represented by SEQ ID NOs: 13 to 24.
  • a vector may be used to synthesize the polynucleotide and crRNA encoding the Cas13b protein included in the composition of the present invention.
  • a "vector” is a tool that permits or facilitates the transfer of an entity from one environment to another. It is a replicon, such as a plasmid, phage, or cosmid, into which another segment of DNA can be inserted, causing replication of the inserted segment.
  • vectors are capable of replication when associated with appropriate control elements.
  • vector refers to a nucleic acid molecule capable of delivering another nucleic acid to which it has been linked.
  • Vectors include, without limitation, nucleic acid molecules that are single-stranded, double-stranded or partially double-stranded; nucleic acid molecules that do not contain free ends (eg, circular), including one or more free ends; nucleic acid molecules including DNA, RNA or both; and other types of polynucleotides known in the art.
  • plasmid refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, eg, by standard molecular cloning techniques.
  • viral vector which exists in vectors in which virus-derived DNA or RNA sequences are enclosed in viruses (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno- Associated virus (AAV) viral vectors also include polynucleotides carried by viruses for transfection into host cells.
  • viruses e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno- Associated virus (AAV) viral vectors also include polynucleotides carried by viruses for transfection into host cells.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
  • vectors e.g., non-episomal mammalian vectors
  • Other vectors are capable of autonomous replication in a host cell into which they are introduced. Upon introduction into the host cell, it integrates into the host cell's genome and is thereby replicated along with the host genome.
  • certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors".
  • Common expression vectors useful in recombinant DNA technology often exist in the form of plasmids.
  • a recombinant expression vector may contain a nucleic acid of the present invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vector contains one or more regulatory elements, wherein the one or more regulatory elements are used in the host cell to be used for expression. and is operably linked to the nucleic acid sequence to be expressed.
  • "operably linked" means that the nucleotide sequence of interest allows expression of the nucleotide sequence (e.g., within an in vitro transcription/translation system, or within a host cell when the vector is introduced into a host cell). It is intended to mean connected to the controlling element in such a way as to make it possible.
  • the vector may be any one selected from the group consisting of plasmids and viruses.
  • plasmid DNA examples include commercial plasmids such as pCMV3, pET28a, pUC57 and pET.
  • Other examples of plasmids that can be used in the present invention include Escherichia coli-derived plasmids (pUC57, pCMV3, pET28a, pET, pGEX, pQE, pDEST and pCOLD), Bacillus subtilis -derived plasmids (pUB110 and pTP5) and yeast -Derived plasmids (YEp13, YEp24 and YCp50). Since these plasmids show different amounts of protein expression and modification depending on the host cell, a host cell most suitable for the purpose may be selected and used.
  • suitable vectors include, but are not limited to, microinjection, electroporation, sonoporation, biolistics, calcium phosphate-mediated transfection, cation transfection , liposome transfection, dendrimer transfection, heat shock transfection, nucleofection transfection, magnetofection, lipofection, impalefection, optical transfection, dedicated formulation-enhanced uptake of nucleic acids, and liposomes, It can be introduced into cells through one or more methods known in the art, including delivery via immunoliposomes, virosomes or artificial virions.
  • vectors are introduced into cells by microinjection.
  • the vector or vectors can be microinjected into the nucleus or cytoplasm.
  • the vector or vectors can be introduced into cells by nucleofection.
  • Vectors can be designed for expression of CRISPR transcripts (eg, nucleic acid transcripts, proteins or enzymes) in prokaryotic or eukaryotic cells.
  • CRISPR transcripts eg, nucleic acid transcripts, proteins or enzymes
  • CRISPR transcripts can be expressed in bacterial cells such as Escherichia coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells.
  • Recombinant expression vectors can be transcribed and translated in vitro using, for example, T7 promoter regulatory sequences and T7 polymerase.
  • the present invention provides a method for treating COVID-19 by administering the pharmaceutical composition to a subject.
  • “individual” means all animals, including humans, that can be infected with coronavirus.
  • the vaccine of the present invention By administering the vaccine of the present invention to a subject, the above diseases can be effectively treated.
  • COVID-19 can be treated with the pharmaceutical composition of the present invention.
  • the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is dependent on the type and severity of the subject, age, sex, infected virus type, drug activity, drug sensitivity, administration time, route of administration, excretion rate, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical field.
  • the pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And it can be single or multiple administrations. It is important to administer the amount that can obtain the maximum effect with the minimum amount without side effects in consideration of all the above factors, and can be easily determined by those skilled in the art.
  • the term "effective amount" refers to a dose sufficient to provide the desired therapeutic effect in the subject being treated, eg sufficient to generate or induce an immune response against a pathogen or antigen in its receptor.
  • the effective amount may vary for various reasons, such as the route and frequency of administration, the body weight and species of the individual receiving the drug, and the purpose of administration. A person skilled in the art can determine the dosage in each case based on the disclosure herein, established methods and their own experience.
  • the dosage form of the pharmaceutical composition of the present invention may be for parenteral use.
  • preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • composition of the present invention can be administered parenterally, intratumorally, intravenously, intramuscularly, intracutaneously, subcutaneously, intraperitoneally, intraarterially, intraventricularly, intralesionally, intrathecally, topically, and combinations thereof. It may be administered by any one route selected from the group consisting of
  • the dosage of the pharmaceutical composition of the present invention varies in its range depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate and severity of the disease, and can be appropriately selected by those skilled in the art.
  • the pharmaceutical composition of the present invention may be administered at 0.01 ug/kg to 100 mg/kg per day, specifically at 1 ug/kg to 1 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. Accordingly, the dosage is not intended to limit the scope of the present invention in any way.
  • ORF1b mRNA of SARS-CoV-2 which is a target of crRNA, was synthesized to be used as a template (see FIG. 1).
  • sequence variation between SARS-CoV2, MERS-CoV and SARS-CoV-2 was analyzed, focusing on genes of non-structural proteins with little sequence variation (see Figure 2).
  • the front gene of ORF1b ranging from the ribosomal frameshift site to the RNA-dependent RNA polymerase (RdRp), was selected as the target site (see Table 2), and 12 crRNAs capable of hybridizing to the target site were selected. design (see Table 3).
  • Nos. 1 to 3 target the peudoknot region
  • Nos. 4 to 12 target RdRp.
  • crRNAs 2, 5, 11, and 9 were found to have relatively excellent RNA degradation ability of SARS-CoV-2 (see FIGS. 3A to 3D), and in particular, crRNA No. 2 had the highest RNA degradation activity. It was shown (see Fig. 4).
  • mRNA encoding the Cas13b protein was synthesized (see FIG. 5), and the synthesized PspCas13b mRNA was transfected into cells to confirm high transfection efficiency (see FIGS. 6a and 6b), and PspCas13b mRNA was cytotoxic. It was confirmed that there was no (see FIG. 7).
  • the SARS-CoV-2 mRNA degrading efficacy of the Cas13b mRNA and crRNA was confirmed.
  • crRNA could degrade the target region of RdRp mRNA together with PspCas13b by using primers that amplify the region targeted by crRNA (see FIGS. 8A and 8D ).
  • crRNAs 2, 5, 9, and 11 induced degradation of RdRp mRNA by PspCas13b, resulting in a decrease in the level of RdRp mRNA (see FIG. 9a).
  • it showed the highest mRNA degradation activity
  • crRNA No. 5 was treated at a ratio of 1:36, it was confirmed that the highest mRNA degradation activity was shown (see FIG. 9b).
  • the pharmaceutical composition of the present invention can be usefully used as a therapeutic agent for COVID-19.
  • the SARS-CoV-2 ORF1b portion which is the target of the crRNA, was cloned so that it could be used as a template.
  • the entire (about 8 kb, 8,135 bp) cDNA library of ORF1b was divided into three fragments (1 fragment: RNA-dependent RNA polymerase (2.7 kb), 2 fragment: Helicase (1.8 kb), 3 fragment: exonuclease + endoRNase + 2'O). -ribose methyltransferase (3.5 kb)) and PCR cloning was performed (Fig. 1).
  • each fragment was extracted from the cDNA library through a PCR process using the primers in Table 1 below capable of PCR of 1, 2, and 3 fragments.
  • ORF1b in the form of DNA was synthesized by conducting PCR under conditions where all fragments were mixed using 1 the forward primer of the fragment and 3 the reverse primer of the fragment.
  • Sequence (5' ⁇ 3') sequence number 1 Fragment forward primer GCTACCGGACTCAGATCTCGAGaccatgCGGGTTTGCGGTGTAAGTGCAGCC SEQ ID NO: 25 1 Reverse fragmentation primer CCCAACAGCCTGTAAGACTGTATGCGGTGTGTACATAGCC SEQ ID NO: 26 2 Fragment forward primer CTTACAGGCTGTTGGGGCTTGTGTTCTTTGCA SEQ ID NO: 27 2 Reverse fragmentation primer TTTCAGCTTGTAAAGTTGCCACATTCCTACGTGGAATTTCAAGAC SEQ ID NO: 28 3 Fragment forward primer GCAACTTTACAAGCTGAAAATGTAACAGGACTCTTTAAAGATTGTAGTAAGGTAATCAC SEQ ID NO: 29 3 Reverse fragmentation primer GGGCCCGCGGTACCGTCGACccGTTGTTAACAAGAACATCACTAGAAATAACAACTCTGTTGTTTTCTCTAATT SEQ ID NO: 30
  • the entire genome of a coronavirus patient sample was obtained using open source data (GISAID) and sequence alignment was performed using the MAFFT method for association between genome sequences.
  • the structural protein of the coronavirus had a relatively large amount of sequence variation compared to the non-structural protein. Therefore, the present inventors focused on genes of non-structural proteins involved in the viral replication system in order to completely block viral genome replication.
  • Example 2-1 Based on the sequence homology analysis of Example 2-1, the front gene of ORF1b ranging from the ribosomal frameshift site to the RNA-dependent RNA polymerase (RdRp) was selected as the crRNA target site (FIG. 2). After deriving a target sequence using a program (CHOPCHOP, Benchling) to predict Cas13a and Cas13d crRNA, it was arbitrarily matched to a length of 30 bp to be suitable for Cas13b crRNA.
  • a program (CHOPCHOP, Benchling)
  • a crRNA targeting the target site of Example 2-2 was prepared.
  • crRNAs numbered 1 to 12 were prepared.
  • crRNAs 1 to 3 were designed to target the peudoknot region of the ribosome reading frame displacement site located upstream of RdRp, and crRNAs 4 to 12 were designed to target RdRp (FIG. 2).
  • 2'-0-methyl 3'phophorothioate modification was introduced to 3 nucleotides at each of the 5' and 3' ends of crRNA.
  • HEK293T cells were transfected with DNA capable of expressing PspCas13b and crRNA together with DNA encoding the firefly-conjugated RdRp fragment. After 48 hours, the luminescence was measured using a dual-luciferase reporter assay system (FIGS. 3a and 3b).
  • RNA degradation ability of SARS-CoV-2 was excellent in the order of 2, 5, 11, and 9.
  • RdRp DNA, Cas13b DNA, and crRNA DNA were injected into HEK293T cells, 24 hours later, total RNA from the cells was extracted and RdRp mRNA values were measured by qRT-PCR.
  • qRT-PCR primers that can detect the RdRp part targeted by each crRNA were used, and based on the RdRp mRNA value of the crRNA (NT) treatment group that does not target RdRp, crRNA #2, #5, # The values of the 9 and #11 treatment groups were normalized.
  • RNA having a T7 promoter was synthesized by PCR, and RNA was synthesized using the Hiscribe T7 ARCA mRNA synthesis kit (with tailing). T7 RNA polymerase mix and ARCA/NTP mix were mixed with PspCas13b DNA with T7 promoter and reacted at 37°C. DNase was treated to remove PspCas13b DNA, followed by poly(A) tailing. The synthesized RNA was purified using an RNA purification kit.
  • PspCas13b mRNA was synthesized as shown in FIG. 5 .
  • the Cas13b protein encoded by the mRNA can induce rapid and transient expression of the Cas13b protein in cells.
  • PspCas13b mRNA was introduced into HEK293T cells, and the cells were collected and protein extracted at 2, 4, 8, and 12 hours. The same amount for each time period was Western blotted through protein quantification.
  • the PspCas13b protein was targeted using rabbit anti-HA tag antibody, and the GAPDH protein was targeted using mouse anti-GAPDH antibody.
  • each protein was imaged as a secondary target using goat anti-rabbit IgG H&L (IRDye 680RD) and goat anti-mouse IgG H&L (IRDye 800CW).
  • HEK293T cells transfected with PspCas13b mRNA were confirmed to express PspCas13b by HA tag staining 48 hours after transfection.
  • HEK293T into which PspCas13b mRNA was introduced was fixed with 4% formaldehyde and then permeabilized with 0.2% Triton X-100.
  • Rabbit anti-HA tag antibody was used to target the PspCas13b protein for 24 hours, and goat anti-rabbit IgG (H+L) and alexa fluor 488 were used as secondary targets and imaged using ImagExfluorer.
  • PspCas13 mRNA was expressed in HEK293T cells and observed under a microscope for 48 hours.
  • HEK293T cells were transfected with DNA expressing PspCas13b and crRNA, and cells were harvested 48 hours later. RNA was extracted from harvested cells, and cDNA was synthesized using random hexamer and oligo dT as primers. As shown in FIG. 8a, primers capable of amplifying the RT-qPCR detection region were prepared and RT-qPCR was performed using cDNA as a template. In the case of the experimental group that was recognized by the corresponding crRNA and degraded by PspCas13b, it was confirmed whether each crRNA and PspCas13b could degrade the RNA of SARS-CoV-2 because it was not detected by the RT-qPCR primer.
  • the gray bar is the non-targeted experimental group (using Non-target crRNA)
  • the blue bar is the targeted experimental group
  • the red bar is the amplification of the part targeted by the crRNA.
  • the groups in which the primers were used were indicated, and in most cases, it was confirmed that the lowest RdRp mRNA expression level was shown in the RT-qPCR result group.
  • HEK29T cells were transfected with PspCas13b mRNA, crRNA, and RdRp mRNA, and 24 hours later, the cells were harvested and RNA was extracted. After synthesizing cDNA from RNA, RT-qPCR was performed using primers that detect the site targeted by the corresponding crRNA.
  • crRNA No. 2 showed the highest mRNA degradation activity when PspCas13b and crRNA were treated at a ratio of 1:20, but when treated at a ratio of 1:36 and 1:50, There was no statistically significant difference, and crRNA 5 showed the highest mRNA degradation activity when treated at a ratio of 1:36, but there was a statistically significant difference between treatment at a ratio of 1:20 and 1:50. there was no
  • Cells were fixed with 4% formaldehyde and then permeabilized with 2% Triton X-100.
  • the spike protein was first targeted using rabbit anti-2019-nCoV spike protein, and the second target was goat anti-rabbit IgG (H+L) and alexa fluor 488. After staining the cells with DAPI, DAPI and GFP imaging were performed, and the number of cells stained with DAPI and GFP was measured relative to the number of cells stained with DAPI, and expressed as a percentage.
  • the number of cells expressing spike protein was significantly reduced in the crRNA #2 and #9 treated groups compared to the non-treated control group (Non).
  • the number was 99.9 It was confirmed that % spike protein was not expressed.
  • crRNA #2 targeting the pseudoknot region has an excellent effect of inhibiting viral replication.
  • SARS-CoV-2 gene was analyzed through qPCR.
  • RNA from SARS-CoV-2 infected Vero E6 cells After extracting total RNA from SARS-CoV-2 infected Vero E6 cells, it was fragmented, and a library was created by attaching the sequences necessary for sequencing to both ends of the fragment.
  • the data generated after sequencing was mapped using STAR and HTSeq tools, using the sample-derived species Vero cell (GCF_015252025.1_Vero_WHO_p1.0) and SARS-CoV-2 (MW466791.1) as a reference. To check the number of read coverages, BAM files were used and adjusted to cover each location within the genome of SARS-CoV-2.
  • the SARS-CoV-2 genome was significantly reduced in the crRNA #2, 9, and 11 treated groups compared to the non-RdRp non-targeted crRNA (NT) treated group.
  • the crRNA #2 treatment group targeting the pseudoknot part showed complete SARS-CoV-2 genome reduction.
  • Calu-3 cells transfected with Cas13b mRNA and crRNA #2 were infected with SARS-CoV-2, and 24 hours later, total RNA was extracted from the infected cells and the SARS-CoV-2 gene was analyzed by qRT-PCR.
  • crRNA #2 which showed a strong virus inhibitory effect in Experimental Example 2, targets the pseudoknot region of the ribosomal reading frame displacement site of ORF1b.
  • the ribosome reading frame displacement site has a highly conserved 3-stemmed pseudoknot structure in SARS-CoV-2, and crRNA #1 and #3 also target the pseudoknot region and cover the entire 3-stemmed structure (Fig. 11a).
  • crRNA #1 targeted sequences forming stem 1 and 3
  • crRNA #2 and #3 targeted sequences from stem 1-3 and stem 2, respectively. Accordingly, we spiked cells transfected with crRNAs (#1, #2, #3) and Cas13b mRNA targeting the peudoknot region to confirm that targeting the pseudoknot region is important for blocking viral replication. Protein expression and subgenomic RNA levels were confirmed.
  • the culture medium and cell lysates of cells transfected with crRNA #1, #2, and #3 compared to the control group treated with crRNA not treated or non-targeted crRNA (Non-target). It was confirmed that the spike protein did not appear in .
  • crRNA #1, #2 and #3 and PspCas13b inhibit viral replication of SARS-CoV-2.
  • each time period was Western blotted through protein quantification.
  • rabbit anti-2019-nCoV spike protein and rabbit anti-2019-nCoV nucleotide were used to target spike protein and nucleocapsid protein, respectively, and mouse anti-GAPDH was used to target GAPDH protein.
  • each protein was imaged as a secondary target using goat anti-rabbit IgG H&L (IRDye 680RD) and goat anti-mouse IgG H&L (IRDye 800CW).
  • crRNA #1, #2 and #3 and PspCas13b effectively inhibit viral replication of SARS-CoV-2.
  • RNA levels were confirmed by qPCR.
  • translation start sites such as the pseudoknot region
  • the pseudoknot region in SARS-CoV-2 has a 3-stemmed RNA structure and is located at a frameshifting site, playing an important role in viral protein expression.
  • SARS-CoV-2 proliferation is inhibited by cleavage of the SARS-CoV-2 genome, rather than inhibition of SARS-CoV-2 proliferation by inhibiting the frameshifting site function by binding to the pseudoknot region of the PspCas13b protein, the cleavage effect A dead PspsCas13b was produced and tested for suppression of SARS-CoV-2.
  • crRNA #5 was used as a control.
  • PspCas13b mRNA and crRNA #2 and dead PspCas13b mRNA and crRNA #2 were introduced into Vero E6 cells, respectively, and Spike protein was stained 24 hours after infection with SARS-CoV-2.
  • Triton X-100 Cells were fixed with 4% formaldehyde and then permeabilized with 2% Triton X-100.
  • the spike protein was first targeted using rabbit anti-2019-nCoV spike protein, and the second target was goat anti-rabbit IgG (H+L) and alexa fluor 488. After DAPI staining of the cells, DAPI and GFP imaging were performed.
  • spike protein was increased in both crRNA #2 and #5 treatment groups in the dead PspCas13b mRNA treatment group.
  • the number of stained cells was not reduced at all.
  • qRT-PCR was performed using primers that amplify RdRp and nucleotide genes of SARS-CoV-2 by extracting total RNA from infected Vero E6 cells.
  • a plaque assay was performed to measure the change in the level of live SARS-CoV-2 replication according to the concentrations of Cas13b mRNA and crRNA.
  • Vero E6 cells were treated with 0 ng: 0 ng, 50 ng: 25 ng, 100 ng: 50 ng, 200 ng: 100 ng, and 400 ng: 200 ng Cas13b mRNA and crRNA, respectively, followed by SARS-CoV-2 infection. induced. After 24 hours, SARS-CoV-2 was isolated from the infected cells and infected with it into new Vero E6 cells. These cells were subjected to plaque assay.
  • SARS-CoV-2 variants Sequence variation between (alpha, beta, gamma and delta) was analyzed.
  • the entire SARS-CoV-2 genome corresponding to the variant was obtained from each of 10 patient samples using open source data (GISAID), and sequence alignment was performed using the MAFFT method to confirm the association between genome sequences. .
  • ORF1a and structural proteins of SARS-CoV-2 mutants had a relatively large amount of mutations compared to ORF1b.
  • ORF1b is the most conserved region in the SARS-CoV-2 genome, and the sequence and structure of the pseudoknot region of ORF1b are known to be highly conserved in coronaviruses.
  • SARS-CoV-2 viral genome-based antiviral agents are faced with the challenge of overcoming mutations.
  • Drugs designed to recognize the gene of a structural protein have a high mutation rate, which risks reducing targeting efficiency. Therefore, it suggests that the crRNA targeting the RdRp or pseudoknot region in ORF1b of the present invention can effectively inhibit viral replication even in SARS-CoV-2 mutants.
  • PspCas13b mRNA and crRNA #2 were introduced into Vero E6 cells and SARS-CoV-2, SARS-CoV-2 alpha, SARS-CoV-2 beta, SARS-CoV-2 gamma, SARS-CoV-2 delta mutants 24 hours after each infection, the spike protein was stained.
  • Cells were fixed with 4% formaldehyde and then permeabilized with 2% Triton X-100.
  • the spike protein was first targeted using rabbit anti-2019-nCoV spike protein, and the second target was goat anti-rabbit IgG (H+L) and alexa fluor 488. After DAPI staining of the cells, DAPI and GFP imaging were performed.
  • qRT-PCR was performed to confirm the subgenomic RNA levels of nucleocapsid (N) and non-structural protein 2 (nsp2) genes.
  • Vero E6 cells were infected with each SARS-CoV-2 mutant virus, and 24 hours later, total RNA was extracted from the infected cells and nucleocapsid (N) or non-structural protein 2 (nsp2) of SARS-CoV-2 was extracted. qRT-PCR was performed using primers for amplification.
  • the subgenomic amount of the N and nsp2 genes was higher in the pseudoknot region than in the non-treated or non-targeted crRNA-treated control group. It was confirmed that all types of SARS-CoV-2 viruses were reduced by Cas13-mediated degradation of crRNA #2.
  • SARS-CoV-2 As an animal model for SARS-CoV, human ACE2 transgenic mice were introduced with PspCas13b mRNA and crRNA #2 via tracheal intubation, and SARS-CoV-2 infection was induced. After 24 hours, SARS-CoV-2 was isolated from lung tissues of infected mice and the virus was quantified through TCID 50 analysis.
  • virus detection was very insignificant in mice targeting the pseudoknot region (#2), unlike mice not treated with mRNA (Non) and mice not targeting RdRp (NT).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 Cas13 단백질 및 crRNA를 포함하는 코로나바이러스감염증-19 예방 또는 치료용 약학적 조성물에 관한 것으로, 구체적으로 본 발명의 Cas13b 및 SARS-CoV-2의 ORF1b의 RdRp 유전자 부분을 표적으로 하는 scRNA는 세포 독성이 없고, SARS-CoV-2의 RNA를 분해하는 능력이 우수하므로 코로나바이러스감염증-19의 치료제로 유용하게 사용될 수 있다.

Description

CAS13 단백질 및 CRRNA를 포함하는 코로나바이러스감염증-19 예방 또는 치료용 약학적 조성물
본 발명은 Cas13 단백질 및 crRNA를 포함하는 코로나바이러스감염증-19 예방 또는 치료용 약학적 조성물에 관한 것이다.
심각한 호흡기 질환을 유발하여 사망을 초래하는 코로나바이러스감염증은 Coronaviridae에 속하는 RNA 바이러스로 분류되며, 코로나바이러스 감염에 의한 호흡기 증후군으로 정의된다. Coronaviridae에 속하는 바이러스 중 사람에게 감염을 일으키다고 알려진 바이러스는 총 7종으로 감기를 일으키는 4종(229E, OC43, NL63, HKU1), 중증 폐렴을 일으키는 2종(SARS-CoV, MERS-CoV) 및 이번 팬데믹 사태의 원인 바이러스인 SARS-CoV-2가 있다. 중증 폐렴을 일으키는 3종의 바이러스(SARS-CoV, MERS-CoV 및 SARS-CoV-2)는 2002년 SARS-CoV를 시작으로 2012년 MERS-CoV에 이어 SARS-CoV와 유전자 서열의 상동성이 높은 현재의 SARS-CoV-2까지 전세계적 대유행이 진행되고 있다.
SARS-CoV-2는 2019년 후반에 최초 보고되었다. 2002년 발생한 SARS-CoV와 비교했을 때 중증도는 SARS-CoV가 높지만 전파력은 SARS-CoV-2가 월등히 높은데, 이는 SARS-CoV-2의 세포 수용체 결합부위인 스파이크 단백질의 돌연변이에 의한 것으로 분석하고 있다. 이러한 결과로 전세계적인 대유행을 초래하게 되었다. 감염의 일반적인 징후로는 호흡기 증상, 발열, 기침, 호흡 곤란 및 호흡 곤란이 있다. 더 심한 경우 감염은 폐렴, 심각한 급성 호흡기 증후군, 신부전 및 심지어 사망을 유발할 수 있다.
SARS-CoV-2의 스파이크 단백질과 숙주세포의 앤지오텐신전환효소2(ACE2) 수용체와 결합하면 바이러스가 숙주 세포 내로 침투할 수 있다. ACE2는 심장 기능과 혈압조절에 작용하는 효소로 심장과 콩팥, 위장 점막 또는 폐에 많이 존재한다. 그중에서 혈류를 타고 가야 하는 내장기관보다 호흡기를 통해 감염될 확률이 더 높다. 숙주 내로 바이러스 유전체가 유입되면 바이러스 중합효소에 의하여 SARS-CoV-2 유전체 복제 및 단백질이 합성되고, 바이러스 입자가 형성되어 세포 외로 배출되어 바이러스 감염증 증상이 나타난다.
현재 수많은 국가와 기관에서 COVID-19 팬데믹 사태를 근절하기 위한 백신 개발에 진력하고 있어, 단백질 서브유닛 백신(subunit vaccine), 바이러스 벡터 기반 백신(viral vector based vaccine), DNA 백신, mRNA 백신과 같은 백신이 개발중이거나 이미 개발되어 있다. 그러나 COVID-19 예방 백신은 코로나바이러스의 변이에 빠르게 대처할 수 없고, 기존 백신 개발 시장은 이미 포화상태이다. 현재 COVID-19의 치료제로 공식화된 것은 없는 상황이고, 기존 치료제로 환자에게 투여하여 치료 효과를 기대하고 있는 실정이다.
바이러스 감염에 대응하는 박테리아의 대응 체계에는 CRISPR/Cas 시스템이 있는데, CRISPR-Cas 시스템은 CRISPR RNA(crRNA)를 통해 타겟에 대한 특이성을 가지고 실험적으로 사용되는 경우에는 가이드 RNA(guide RNA, gRNA)로 약간 변형되어 사용된다. crRNA의 스페이서(spacer)라는 부분이 타겟서열을 인지하고 결합하는데, 이 때 타겟서열은 Protospacer Adjacent Motif (PAM) 라는 서열에 인접하여 존재해야한다. crRNA와 타겟이 결합한 이후, Cas 단백질이 타겟 유전체를 절단한다.
CRISPR-Cas13은 단일 가닥 RNA를 타겟으로 하여 RNA 바이러스에 대한 치료제로 사용될 수 있는 가능성이 있다. 실제로 CRISPR/Cas13 시스템이 식물 바이러스 감염에 대한 치료 방법으로 사용됨(Plant J. 2018 Jun;94(5):767-775.)과 단일 가닥 RNA(ssRNA) 바이러스에 효과적인 항 바이러스제가 될 수 있음(Molecuar Cell, Volume 76, Issue 5, 5 December 2019, Pages 826-837.e11)이 개시된 바 있다. 그러나 CRISPR/Cas13b 시스템을 SARS-CoV-2에 직접적으로 적용하여 치료효과를 확인한 예는 개시된 바 없다.
이에, 본 발명자들은 SARS-CoV-2의 타겟 RNA를 인지할 수 있는 crRNA와 Cas13 효소가 SARS-CoV-2의 유전체를 분해하여 COVID-19를 치료할 수 있음을 확인함으로써 본 발명을 완성하였다.
본 발명의 목적은 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
상기 목적을 달성하기 위해, 본 발명은 Cas13 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및 crRNA(CRISPR RNA)를 포함하는, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명은 Cas13 단백질 및 crRNA를 포함하는 코로나바이러스감염증-19 예방 또는 치료용 약학적 조성물에 관한 것으로, 구체적으로 본 발명의 Cas13b 및 SARS-CoV-2의 ORF1b의 RdRp 유전자 부분을 표적으로 하는 crRNA 또는 RdRp의 상류에 위치한 pseudoknot 영역을 표적으로 하는 crRNA는 SARS-CoV-2의 RNA를 분해하는 능력이 우수하므로 코로나바이러스감염증-19의 치료제로 유용하게 사용될 수 있다.
도 1은 crRNA의 표적이 되는 SARS-CoV-2 ORF1b의 ① 절편: RNA-dependent RNA polymerase(2.7kb), ② 절편: Helicase(1.8kb), ③ 절편: exonuclease+endoRNase+2'O-ribose methyltransferase(3.5kb)을 나타낸 모식도이다.
도 2는 코로나 바이러스의 서열 상동성 분석 결과 및 SARS-CoV-2 ORF1b 유전자 내의 crRNA 표적 부위를 나타낸 모식도이다.
도 3a는 dual-luciferase assay 모식도이다.
도 3b는 본 발명의 crRNA에 대한 dual-luciferase assay 모식도이다.
도 3c는 2, 5, 9, 11번 crRNA가 상대적으로 낮은 발광 정도를 보여 SARS-CoV-2의 RNA 분해 능력이 우수한 것을 확인한 도이다.
도 3d는 2, 5, 11, 9번 순서로 우수한 SARS-CoV-2의 RNA 분해 능력을 보여 유력한 crRNA 후보로 선별한 결과를 나타낸 도이다.
도 4는 2번 crRNA가 가장 우수한 RNA 분해 활성을 나타나는 것을 확인한 도이다.
도 5는 합성한 PspCas13b mRNA 및 2'-O-methyl 3'phosphorothioate로 변형된 crRNA를 나타낸 모식도이다.
도 6a은 PspCas13b 단백질은 형질감염 후 2시간부터 발현이 꾸준히 증가함을 나타낸 도이다.
도 6b는 HA tag 염색을 통해서 대부분의 세포에서 균일한 PspCas13b 발현이 유도됨을 확인한 도이다.
도 7은 PspCas13b mRNA 발현 세포는 24, 48 시간 후 점차 세포 분열을 하여 하나의 이미지 화면에 보이는 세포의 수가 증가하여 세포독성이 없음을 확인한 도이다.
도 8a는 RT-qPCR 프라이머로 SARS-CoV-2 ORF1b 유전자 내의 crRNA 표적 부위를 증폭시킬 수 있는 위치를 나타낸 모식도이다.
도 8b는 각 crRNA (spacer 1, 2, 3 및 4)가 RdRp mRNA의 표적하는 부분을 PspCas13b와 함께 분해할 수 있음을 확인한 도이다.
도 8c는 각 crRNA(spacer 5, 6, 7 및 8)가 RdRp mRNA의 표적하는 부분을 PspCas13b와 함께 분해할 수 있음을 확인한 도이다.
도 8d는 각 crRNA(spacer 9, 10, 11 및 12)가 RdRp mRNA의 표적하는 부분을 PspCas13b와 함께 분해할 수 있음을 확인한 도이다.
도 9a는 타겟하지 않는 NT (Non-target) 실험군 대비 4가지 crRNA(2, 5, 9, 11번) 모두 PspCas13b에 의한 RdRp mRNA 분해가 이루어져 유의미한 RdRp mRNA 수준 감소를 보이는 것을 확인한 도이다.
도 9b는 PspCas13b와 2번 또는 5번 crRNA의 비율에 따른 mRNA 분해 활성을 확인한 도이다.
도 10a는 각 crRNA가 스파이크 단백질의 발현하는 지 확인하기 위해 면역염색을 수행한 결과를 나타내는 도이다.
도 10b는 SARS-CoV-2 감염 Vero E6 세포의 세포 배양액 (supernant) 혹은 세포 용해물 (cell)에서 각 crRNA가 SARS-CoV-2 RNA 유전자 수준에 미치는 영향을 분석한 도이다.
도 10c는 SARS-CoV-2 감염 Vero E6 세포에서 각 crRNA가 SARS-CoV-2 유전체 수에 미치는 영향을 분석한 도이다.
도 10d는 SARS-CoV-2 감염 Vero E6 세포에서 각 crRNA가 SARS-CoV-2 RNA 유전자 수준에 미치는 영향을 분석한 도이다.
도 10e는 SARS-CoV-2 감염 Calu-3 세포에서 각 crRNA가 SARS-CoV-2 RdRp, nucleotide 유전자 수준에 미치는 영향을 분석한 도이다.
도 11a는 pseudoknot 영역을 표적으로 하는 crRNA의 구조를 나타낸 도이다.
도 11b는 pseudoknot-targeting crRNA가 스파이크 단백질 발현을 억제하는 지 면역염색을 통해 확인한 도이다.
도 11c는 pseudoknot-targeting crRNA가 스파이크 단백질의 발현을 억제하는 지 웨스턴블랏을 통해 확인한 도이다.
도 11d는 SARS-CoV-2 감염 Vero E6 세포의 세포 배양액 (supernant) 혹은 세포 용해물 (cell)에서 각 crRNA가 RdRp, nucleocapsid 유전자 수준에 미치는 영향을 분석한 도이다.
도 12a는 dead PspsCas13b을 이용하여 스파이크 단백질 발현 억제 여부를 확인한 도이다.
도 12b는 dead PspsCas13b을 이용하여처리군에서는 SARS-CoV-2의 RdRp, nucleocapsid 유전자 수준감소 여부를 확인한 도이다.
도 12c는 Cas13b mRNA와 crRNA 농도별 처리에 따른 살아있는 SARS-CoV-2 복제 수준 변화를 측정한 plaque assay 이다.
도 12d는 Cas13b mRNA와 crRNA 농도별 처리에 따른 살아있는 SARS-CoV-2 복제 수준 변화를 측정한 plaque assay를 분석한 결과를 나타낸 도이다.
도 13a는 SARS-CoV-2 변이체 (알파, 베타, 감마 및 델타) 간의 서열 변이를 분석한 결과를 나타낸 도이다.
도 13b는 pseudoknot 영역을 표적으로 하는 crRNA가 SARS-CoV-2 변이체에 감염된 세포에서 스파이크 단백질의 발현을 감소시키는지 확인한 도이다.
도 13c는 pseudoknot 영역을 표적으로 하는 crRNA가 SARS-CoV-2 변이체 바이러스 감염된 세포에서 N 및 nsp2 유전자의 subgenomic RNA 수준을 감소시키는 지 확인한 도이다.
도 14는 pseudoknot 영역을 표적으로 하는 crRNA가 SARS-CoV-2 변이체 바이러스 감염된 마우스에서 바이러스 감염을 억제시키는 지 확인한 도이다.
이하, 본 발명을 상세히 설명한다.
본 발명은 Cas13 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및 crRNA(CRISPR RNA)를 포함하는, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물을 제공한다.
상기 Cas13 단백질은 Cas 단백질의 일종이다. Cas 단백질은 CRISPR 연관 단백질로, DNA 또는 RNA와 같은 핵산이 이중 가닥 혹은 단일 가닥을 가질 경우(dsDNA/RNA 및 ssDNA/RNA) 이를 인식하여 절단할 수 있는 효소이다. 구체적으로, 이들은 crRNA 또는 가이드 RNA와 결합된 이중가닥 혹은 단일가닥 핵산을 인식하여 이를 절단할 수 있다. 즉, crRNA가 표적 부위와 결합된 것을 인식하여 엔도뉴클레아제 기능이 활성화된다. 또한, 엔도뉴클레아제 기능이 활성화됨에 따라, 이중가닥 및/또는 단일가닥 DNA 및/또는 RNA를 비특이적 절단할 수 있는 엑소뉴클레아제 활성을 가지는 것일 수 있다.
Cas13 단백질은 Cas13a, Cas13b, Cas13c 및 Cas13d로 구성되는 군으로부터 선택되는 어느 하나의 단백질일 수 있고, 자연적으로 'RNA'를 인지하여 자를 수 있고, 박테리아에서 "C2c2" 라고 알려져 있다. Cas13은 클래스2, 타입 VI CRISPR 단백질인데, ssRNA 타겟을 인지하여 활성화된다. Leptotrichia wadei에서 발견된 Cas13a와 Prevotella sp. P5-125에서 발견된 Cas13b (PspCas13b)가 대표적이며, 이 둘은 PAM과 같은 특정 모티프를 필요로 하지 않는다.
Cas13b 단백질은 하나 이상의 기능성 도메인과 연합되고, 이펙터 단백질은 HEPN 도메인 내에 하나 이상의 돌연변이를 함유하며, 그리하여 복합체가 후생유전적 변형인자 또는 전사 또는 번역 활성화 또는 억제 신호를 전달할 수 있다. 복합체는 시험관 내 또는 생체 외에서 형성될 수 있고, 세포 내로 도입되거나 RNA와 접촉될 수 있으며; 또는 생체 내에서 형성될 수 있다.
상기 Cas13 단백질을 암호화하는 폴리뉴클레오티드는 DNA 또는 mRNA일 수 있고, 본 발명의 구체적인 실시예에 따르면 mRNA 이다.
상기 crRNA는 CRISPR RNA로, 단일 가닥 RNA (single strand RNA) 일 수 있다. 또한, crRNA는 tracrRNA (trans-activating CRISPR RNA)와 결합된 가이드 RNA (guide RNA) 형태로 이용될 수 있다. 이때, crRNA는 타겟에 특이적으로 존재하는 유전자 서열에 상보적인 서열을 가질 수 있다. 상기 crRNA는 15 내지 40개의 핵산으로 구성된 RNA 일 수 있다. 이 때, 상기 폴리뉴클레오티드는 18 내지 30개의 핵산으로 구성될 수 있다. 일 구체예로 crRNA는 30개의 핵산으로 구성될 수 있다. 또한, crRNA는 크리스퍼 연관 단백질이 활성을 갖게 하기 위해 3'에 추가적인 서열을 포함할 수 있다.
상기 crRNA는 화학적으로 변형될 수 있다. 화학 변형의 예로는, 이로 제한되지는 않지만, 하나 이상의 말단 뉴클레오티드에서 2'-O-메틸 3'포스포로티오에이트(2'-O-methyl 3'phosphorothioate, MS), 2'-O-메틸(M), 또는 2'-O-메틸 3'티오 PACE(MSP)의 혼입을 포함한다. 이러한 화학적으로 변형된 crRNA는, 온-표적 (on-target; 표적상, 표적-적중) 특이성 대 오프-표적 (off-target; 표적외, 표적-외) 특이성은 예측가능하지 않지만, 비변형된 crRNA에 비하여 증가된 안정성 및 증가된 활성을 포함할 수 있다. 화학적으로 변형된 crRNA는 포스포로티오에이트 연결 및 리보스 고리의 2' 및 4' 탄소 사이의 메틸렌 브릿지를 포함하는 잠금 핵산 (LNA) 뉴클레오티드를 갖는 RNA를 제한없이 포함한다.
상기 SARS-CoV-2 유전자의 표적 RNA 서열은 ORF1b 내의 RNA-dependent RNA polymerase(RdRp), RdRp의 상류에 위치한 리보솜 해독틀 변위 부위 (ribosomal frameshift site), Helicase, 3' to 5' exonuclease, endoRNase 또는 2'O-ribose methyltransferase일 수 있고, 바람직하게는 RdRp 또는 RdRp의 상류에 위치한 리보솜 해독틀 변위 부위일 수 있다.
일 실시예로 상기 crRNA는 서열번호 1 내지 12 중에서 선택되는 핵산 서열을 포함하는 표적 부위에 혼성화 가능하다.
일 실시예로 상기 가이드 RNA 는 서열번호 13 내지 24로 표시되는 핵산 서열을 포함할 수 있다.
본 발명의 조성물에 포함된 Cas13b 단백질을 코딩하는 폴리뉴클레오티드 및 crRNA를 합성하기 위하여 벡터를 이용할 수 있다. 본원에 사용되는 바와 같이, "벡터"는 엔티티를 하나의 환경에서 또 다른 환경으로 전달하는 것을 허용 또는 촉진하는 도구이다. 이는 레플리콘, 예컨대 플라스미드, 파지, 또는 코스미드로, 또 다른 DNA 분절이 그 안에 삽입될 수 있어서, 삽입된 분절의 복제를 유발한다. 일반적으로, 벡터는 적절한 제어 요소와 관련되었을 때 복제가 가능하다.
일반적으로, 용어 "벡터"는 그것이 연결되어 있는 다른 핵산을 전달할 수 있는 핵산 분자를 지칭한다. 벡터는 제한 없이, 단일 가닥, 이중 가닥 또는 부분 이중 가닥인 핵산 분자; 하나 이상의 자유 말단을 포함하는, 자유 말단을 포함하지 않는 (예: 환형) 핵산 분자; DNA, RNA 또는 둘 다를 포함하는 핵산 분자; 및 당업계에 공지된 다른 종류의 폴리뉴클레오티드를 포함한다. 하나의 유형의 벡터는 "플라스미드"이며, 이는 추가의 DNA 절편이 예를 들어, 표준 분자 클로닝 기술에 의해 삽입될 수 있는 환형 이중 가닥 DNA 루프를 지칭한다. 벡터의 다른 종류는 바이러스 벡터로서, 바이러스-유래된 DNA 또는 RNA 서열이 바이러스에 봉입되는 벡터에 존재한다(예를 들어, 레트로바이러스, 복제 결함 레트로바이러스, 아데노바이러스, 복제 결함 아데노바이러스, 및 아데노-관련 바이러스(AAV)) 바이러스 벡터는 또한 숙주 세포 내로의 트랜스펙션을 위한, 바이러스가 보유하는 폴리뉴클레오티드를 포함한다. 특정 벡터는 그것이 도입된 숙주 세포에서 자율적 복제가 가능하다(예를 들어, 박테리아 복제 기원을 가진 박테리아 벡터 및 에피솜 포유류 벡터) 다른 벡터(예를 들어, 비-에피솜 포유동물 벡터)는 숙주 세포 내로 도입시 숙주 세포의 게놈에 통합되며, 이에 의해 숙주 게놈과 함께 복제된다. 더욱이, 특정 벡터는 그것이 작동가능하게 연결된 유전자의 발현을 지시할 수 있다. 이러한 벡터는 본원에서 "발현 벡터"로 지칭된다. 재조합 DNA 기술에 유용한 통상적인 발현 벡터는 종종 플라스미드의 형태로 존재한다. 재조합 발현 벡터는 숙주 세포에서 핵산의 발현에 적합한 형태로 본 발명의 핵산을 포함할 수 있는데, 이는 재조합 발현 벡터가 하나 이상의 조절 요소를 포함하는 것을 의미하며, 하나 이상의 조절 요소는 발현에 사용될 숙주 세포에 기반하여 선택될 수 있고, 발현될 핵산 서열에 작동 가능하게 연결된다. 재조합 발현 벡터 내에서, "작동가능하게 연결된"은 대상 뉴클레오티드 서열이 (예를 들어, 시험관 내 전사/번역 시스템 내에서, 또는 벡터가 숙주 세포 내로 도입되는 경우 숙주 세포 내에서) 뉴클레오티드 서열의 발현을 가능하게 하는 방식으로 조절 요소에 연결된 것을 의미하는 의도이다.
상기 벡터는 플라스미드는 및 바이러스로 이루어진 군으로부터 선택되는 어느 1종일 수 있다.
플라스미드 DNA의 구체적인 예로는 pCMV3, pET28a, pUC57 및 pET 같은 상업적인 플라스미드를 포함한다. 본 발명에 사용될 수 있는 플라스미드의 다른 예로는 대장균 유래 플라스미드(pUC57, pCMV3, pET28a, pET, pGEX, pQE, pDEST 및 pCOLD), 바실러스 서브틸리스(Bacillus subtilis)-유래 플라스미드(pUB110 및 pTP5) 및 효모-유래 플라스미드(YEp13, YEp24 및 YCp50)가 있다. 이러한 플라스미드는 숙주 세포에 따라서 단백질의 발현량과 수식 등이 다르게 나타나므로, 목적에 가장 적합한 숙주 세포를 선택하여 사용하면 된다.
본 명세서에 개시된 임의의 방법의 실시에 있어서, 적합한 벡터가, 이로 제한되지는 않지만, 미세주입, 전기천공, 소노포레이션(sonoporation), 바이오리스틱스, 칼슘 포스페이트-매개 트랜스펙션, 양이온 트랜스펙션, 리포좀 트랜스펙션, 덴드리머 트랜스펙션, 열 충격 트랜스펙션, 뉴클레오펙션 트랜스펙션, 마그네토펙션, 리포펙션, 임페일펙션, 광학 트랜스펙션, 핵산의 전용 제제-증진 흡수, 및 리포좀, 면역리포좀, 비로좀 또는 인공 비리온을 통한 전달을 포함하는 해당 분야에 알려진 하나 이상의 방법을 통해서 세포에 도입될 수 있다.
일부 방법에서, 벡터는 마이크로인젝션에 의해서 세포에 도입된다. 벡터 또는 벡터들은 핵 또는 세포질에 마이크로인젝션될 수 있다. 일부 방법에서, 벡터 또는 벡터들은 뉴클레오펙션에 의해서 세포에 도입될 수 있다.
벡터는 원핵 또는 진핵 세포에서 CRISPR 전사물(예를 들어, 핵산 전사물, 단백질 또는 효소)의 발현을 위해 디자인될 수 있다. 예를 들어, CRISPR 전사물은 박테리아 세포, 예를 들어, 에스케리키아 콜라이, 곤충 세포(배큘로바이러스 발현 벡터 사용), 효모 세포 또는 포유동물 세포에서 발현될 수 있다.
재조합 발현 벡터는 예를 들어, T7 프로모터 조절 서열 및 T7 폴리머라제를 사용하여 시험관내에서 전사되고 번역될 수 있다.
또한, 본 발명은 상기 약학적 조성물을 개체에 투여하여 코로나바이러스감염증-19를 치료하는 방법을 제공한다.
본 발명에 있어서, "개체"란 코로나바이러스에 감염될 수 있는 인간을 포함한 모든 동물을 의미한다. 본 발명의 백신을 개체에 투여함으로써, 상기 질환을 효율적으로 치료할 수 있다. 예를 들어, 본 발명의 약학적 조성물로 코로나바이러스감염증-19을 치료할 수 있다.
본 발명의 약학적 조성물은 약제학적으로 유효한 양으로 투여한다. 용어 "약제학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체의 종류 및 중증도, 연령, 성별, 감염된 바이러스 종류, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로, 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다.
용어 "유효한 양"은 치료되는 대상자에게 요망되는 치료 효과를 제공하기에 충분한, 예를 들어, 이의 수용체에서의 병원체 또는 항원에 대항하는 면역 반응을 생성시키거나 유도하기에 충분한 용량을 나타낸다. 유효량은 다양한 이유, 예컨대, 투여 경로 및 빈도, 상기 약제를 수용하는 개개의 체중 및 종, 및 투여 목적에 따라서 변화될 수 있다. 당업자는 본원에서의 개시내용, 확립된 방법 및 그들 자신의 경험을 기초로 하여 각각의 경우에서의 투여량을 결정할 수 있다.
본 발명의 약학적 조성물의 제형은 비경구용일 수 있다. 특히, 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제 및 현탁용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
본 발명의 약학적 조성물은 비경구로 투여될 수 있으며, 종양내 투여, 정맥내, 근육내, 피내, 피하, 복강내, 소동맥내, 심실내, 병변내, 척추강내, 국소, 및 이들의 조합으로 구성된 군으로부터 선택되는 어느 하나의 경로로 투여될 수 있다.
본 발명의 약학적 조성물의 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도에 따라 그 범위가 다양하며, 당업자에 의해 적절하게 선택될 수 있다. 바람직한 효과를 위해서, 본 발명의 약학적 조성물을 1일 0.01 ug/kg 내지 100 mg/kg으로, 구체적으로는 1 ug/kg 내지 1 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수 있다. 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 구체적인 실시예에서, 주형으로 사용할 수 있도록 crRNA의 표적이 되는 SARS-CoV-2의 ORF1b mRNA를 합성하였다 (도 1 참조). 분해하고자 하는 SARS-CoV-2의 표적 부위를 선별하기 위해, SARS-CoV2, MERS-CoV 및 SARS-CoV-2 간의 서열 변이를 분석하여 서열변이가 적은 비구조 단백질의 유전자에 초점을 맞추었다 (도 2 참조). 특히, 표적부위로 해독틀 변위 부위 (ribosomal frameshift site)에서 RNA-dependent RNA polymerase (RdRp)에 이르는 ORF1b의 앞쪽 유전자를 선정하였고 (표2 참조), 상기 표적 부위에 혼성화할 수 있는 crRNA 12개를 디자인하였다 (표 3 참조). 이 중 1번 내지 3번은 peudoknot 영역을 표적으로 하고, 4번 내지 12번은 RdRp를 표적으로 한다. 상기 crRNA 중 2, 5, 11, 9번 crRNA가 상대적으로 SARS-CoV-2의 RNA 분해 능력이 우수한 것으로 나타났으며 (도 3a 내지 도 3d 참조), 특히, 2번 crRNA가 가장 우수한 RNA 분해 활성을 나타내었다 (도 4 참조). 다음으로, Cas13b 단백질을 코딩하는 mRNA를 합성하고 (도 5 참조), 합성된 PspCas13b mRNA를 세포에 형질감염시켜 형질감염 효율이 높음을 확인하였으며 (도 6a 및 도 6b 참조), PspCas13b mRNA가 세포독성이 없음을 확인하였다 (도 7 참조).
본 발명의 구체적인 실험예에서는 상기 Cas13b mRNA 및 crRNA의 SARS-CoV-2 mRNA 분해 효능을 확인하였다. 먼저, crRNA가 표적하는 부분을 증폭시키는 프라이머를 사용하여, crRNA가 RdRp mRNA의 표적하는 부분을 PspCas13b와 함께 분해할 수 있음을 확인하였다 (도 8a 및 도 8d 참조). 또한, 2, 5, 9, 11번 crRNA가 PspCas13b에 의해 RdRp mRNA 분해를 유도하여 RdRp mRNA 수준 감소를 보이는 것을 확인하였으며 (도 9a 참조), 2번 crRNA는 PspCas13b와 crRNA가 1:20의 비율로 처리되었을 때, 가장 높은 mRNA 분해 활성을 보이고, 5번 crRNA는 1:36의 비율로 처리되었을 때, 가장 높은 mRNA 분해 활성을 보임을 확인하였다 (도 9b 참조).
본 발명의 Cas13b mRNA 및 crRNA가 SARS-CoV-2 복제를 억제하는 지 확인하기 위해, SARS-CoV-2를 두번 감염시킨 Vero E6 세포에서 그 효능을 관찰하였다. 그 결과, crRNA #2 처리군에서 스파이크 단백질이 거의 발현되지 않았으며 (도 10a 및 도 10b 참조), SARS-CoV-2의 envelope (E), non-structural protein 2(nsp2), nucleocapsid (N) RNA 유전자수준이 크게 감소하였고 (도 10c 참조), SARS-CoV-2 유전체 수가 완벽하게 억제되었다 (도 10d 참조). Vero E6 뿐만 아니라 human 폐세포 유래종인 Calu-3 세포에서도 SARS-CoV-2 RdRp, nucleotide 유전자 수준이 감소됨을 확인하였다 (도 10e 참조).
ORF1b의 리보솜 해독틀 변위 부위의 pseudoknot 영역을 표적으로 하는 crRNA #1, #2, #3 (도 11a 참조) 및 Cas13b mRNA로 형질감염된 세포에서 스파이크 단백질 및 뉴클레오캡시드 단백질의 발현이 거의 나타나지 않았으며 (도 11b 및 도 11c 참조), SARS-CoV-2의 RdRp, nucleocapsid의 RNA 수준이 감소을 확인하였다 (도 11d 참조).
또한, 절단효과가 없는 dead PspCas13b mRNA 처리군에서는 crRNA #2, #5 처리군 모두에서 스파이크 단백질의 감소가 관찰되지 않았으며, RdRp 및 nucleocapsid 유전자 수준의 감소도 관찰되지 않았는데, 이러한 결과들은 PspCas13b 단백질이 pseudoknot 부위와 결합하여 frameshifting site의 기능을 저해하는 것이 아닌 SARS-CoV-2 유전체를 절단하여 SARS-CoV-2 증식을 억제시키는 것임을 증명한다 (도 12a 내지 도 12b 참조).
또한, Cas13b mRNA와 crRNA 처리한 군은 농도에 관계없이 대조군에 대비하여 plaque가 형성되지 않음을 확인하였는데, 이는 Cas13b mRNA와 crRNA 처리한 군에서 SARS-CoV-2 복제가 일어나지 않음을 의미한다 (도 12c 내지 도 12d 참조).
본 발명의 Cas13b mRNA 및 crRNA가 SARS-CoV-2 변이체 바이러스에 대해 분해 효능이 있는 지 확인하였다. 먼저, SARS-CoV-2 변이체 (알파, 베타, 감마 및 델타)간에 ORF1b 영역에서는 서열 변이가 적음을 확인하였다 (도 13a 참조). pseudoknot 영역을 표적으로 하는 crRNA #2로 형질감염된 세포에서는 모든 유형의 변이체에서 스파이크 단백질로 염색되는 세포 수가 명확하게 감소하였고, N 및 nsp2 유전자의 RNA 수준도 감소하였다 (도 13b 및 도 13c 참조). 따라서, 상기의 결과를 통래 SARS-CoV-2 돌연변이에서도 효과적으로 바이러스 복제를 억제할 수 있음을 시사한다.
마지막으로, SARS-CoV의 동물모델을 이용하여 본 발명의 PspCas13b mRNA와 crRNA의 치료 효과를 확인한 결과, pseudoknot 부분을 타겟하는 crRNA #2는 대조군 마우스와 비교하여 바이러스 검출이 미미함을 확인하였다 (도 14 참조).
따라서, 본 발명의 약학적 조성물은 코로나바이러스감염증-19의 치료제로 유용하게 사용될 수 있다.
이하, 본 발명을 하기 실시예 및 실험예에 의해 상세히 설명한다.
단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 의해 한정되는 것은 아니다.
<실시예 1> SARS-CoV-2의 ORF1b 클로닝
주형으로 사용할 수 있도록 crRNA의 표적이 되는 SARS-CoV-2 ORF1b 부분을 클로닝하였다. ORF1b의 cDNA 라이브러리에서 전체(약 8kb, 8,135bp)를 3개의 절편(① 절편: RNA-dependent RNA polymerase(2.7kb), ② 절편: Helicase(1.8kb), ③ 절편: exonuclease+endoRNase+2'O-ribose methyltransferase(3.5kb))으로 나누어 PCR 클로닝을 수행하였다 (도 1).
구체적으로, ①, ②, ③ 절편을 PCR 할 수 있는 하기 표 1의 프라이머를 이용해 cDNA 라이브러리에서 PCR 과정을 통해 각 절편을 추출하였다. ① 절편의 정방향 프라이머와 ③ 절편의 역방향 프라이머를 이용하여 모든 절편이 섞인 조건에서 PCR을 진행하여 DNA 형태의 ORF1b 를 합성하였다.
그 결과, ORF1b의 ① 절편 및 ② 절편을 포함한 RdRp+Helicase 부분의 mRNA를 합성하였다.
서열(5'→3') 서열번호
① 절편 정방향 프라이머 GCTACCGGACTCAGATCTCGAGaccatgCGGGTTTGCGGTGTAAGTGCAGCC 서열번호 25
① 절편 역방향 프라이머 CCCAACAGCCTGTAAGACTGTATGCGGTGTGTACATAGCC 서열번호 26
② 절편 정방향 프라이머 CTTACAGGCTGTTGGGGCTTGTGTTCTTTGCA 서열번호 27
② 절편 역방향 프라이머 TTTCAGCTTGTAAAGTTGCCACATTCCTACGTGGAATTTCAAGAC 서열번호 28
③ 절편 정방향 프라이머 GCAACTTTACAAGCTGAAAATGTAACAGGACTCTTTAAAGATTGTAGTAAGGTAATCAC 서열번호 29
③ 절편 역방향 프라이머 GGGCCCGCGGTACCGTCGACccGTTGTTAACAAGAACATCACTAGAAATAACAACTCTGTTGTTTTCTCTAATT 서열번호 30
<실시예 2> SARS-CoV-2 RNA 분해를 위한 crRNA의 선별
<2-1> 코로나바이러스 균주 간의 서열 변이 분석
SARS-CoV-2 감염에 대한 CRISPR-Cas13 시스템을 개발하기 위해 먼저 코로나바이러스 균주 (SARS-CoV2, MERS-CoV 및 SARS-CoV-2) 간의 서열 변이를 분석하였다.
구체적으로, 오픈소스데이터 (GISAID)를 이용하여 코로나바이러스 환자 샘플의 전체 유전체를 얻어 유전체 서열 사이의 연관성을 위해 MAFFT 방법을 이용해 서열정렬을 수행하였다.
그 결과, 도 2에 나타난 바와 같이, 코로나바이러스의 구조 단백질은 비구조 단백질에 비해 상대적으로 많은 양의 서열 변이를 가지고 있었다. 이에, 본 발명자들은 바이러스 게놈 복제를 완전히 차단하기 위해 바이러스 복제 시스템에 관여하는 비구조 단백질의 유전자에 초점을 맞추었다.
<2-2> SARS-CoV-2 RNA 분해를 위한 ORF1b 유전자 내의 표적 부위 예측
실시예 2-1의 서열 상동성 분석에 기초하여 crRNA 표적 부위로 리보솜 해독틀 변위 부위(ribosomal frameshift site)에서 RNA-dependent RNA polymerase(RdRp)에 이르는 ORF1b의 앞쪽 유전자를 선택하였다 (도 2). Cas13a와 Cas13d의 crRNA를 예측하는 프로그램 (CHOPCHOP, Benchling)을 이용하여 표적 서열을 도출 후, Cas13b crRNA 에 적합하도록 임의로 30bp의 길이로 맞추었다.
그 결과, 하기 표 2의 SARS-CoV-2 ORF1b 유전자 내의 서열번호 1 내지 12의 표적 부위 12개를 선별하였다 (도 2).
서열(5'→3') 서열번호
CGGGTTTGCGGTGTAAGTGCAGCCCGTCTT 서열번호 1
AAGTGCAGCCCGTCTTACACCGTGCGGCAC 서열번호 2
GGCACTAGTACTGATGTCGTATACAGGGCT 서열번호 3
GCTGGTTTTGCTAAATTCCTAAAAACTAAT 서열번호 4
GATATATTACGCGTATACGCCAACTTAGGT 서열번호 5
CAATTCTGTGATGCCATGCGAAATGCTGGT 서열번호 6
CGGTGATTTCATACAAACCACGCCAGGTAG 서열번호 7
GGATACCACTTCAGAGAGCTAGGTGTTGTA 서열번호 8
TCAGGATGTAAACTTACATAGCTCTAGACT 서열번호 9
TGATAAGTACTTTGATTGTTACGATGGTGG 서열번호 10
AAAGAATAGAGCTCGCACCGTAGCTGGTGT 서열번호 11
AAATCAATAGCCGCCACTAGAGGAGCTACT 서열번호 12
<2-3> SARS-CoV-2 ORF1b 유전자 내의 표적 부위를 타켓으로 하는 crRNA의 제작
실시예 2-2의 표적 부위를 타겟으로 하는 crRNA를 제작하였다.
그 결과, 하기 표 3에 나타난 바와 같이, 1번 내지 12번 (서열번호 13 내지 24)의 12개 crRNA를 제작하였다. crRNA 1번 내지 3번은 RdRp의 상류에 위치한 리보솜 해독틀 변위 부위의 peudoknot 영역을 표적으로 제작되었고, crRNA 4번 내지 12번은 RdRp를 표적으로 제작되었다 (도 2). 또한, crRNA의 5',3' 말단 각각의 3개 뉴클레오타이드에 2'-0-methyl 3'phophorothioate modification 을 도입하였다.
no. 서열(5'→3') 서열번호
1 CGGGTTTGCGGTGTAAGTGCAGCCCGTCTTgttgtggaaggtccagttttgaggggctattacaac 서열번호 13
2 AAGTGCAGCCCGTCTTACACCGTGCGGCACgttgtggaaggtccagttttgaggggctattacaac 서열번호 14
3 GGCACTAGTACTGATGTCGTATACAGGGCTgttgtggaaggtccagttttgaggggctattacaac 서열번호 15
4 GCTGGTTTTGCTAAATTCCTAAAAACTAAT gttgtggaaggtccagttttgaggggctattacaac 서열번호 16
5 GATATATTACGCGTATACGCCAACTTAGGT gttgtggaaggtccagttttgaggggctattacaac 서열번호 17
6 CAATTCTGTGATGCCATGCGAAATGCTGGT gttgtggaaggtccagttttgaggggctattacaac 서열번호 18
7 CGGTGATTTCATACAAACCACGCCAGGTAG gttgtggaaggtccagttttgaggggctattacaac 서열번호 19
8 GGATACCACTTCAGAGAGCTAGGTGTTGTA gttgtggaaggtccagttttgaggggctattacaac 서열번호 20
9 TCAGGATGTAAACTTACATAGCTCTAGACT gttgtggaaggtccagttttgaggggctattacaac 서열번호 21
10 TGATAAGTACTTTGATTGTTACGATGGTGG gttgtggaaggtccagttttgaggggctattacaac 서열번호 22
11 AAAGAATAGAGCTCGCACCGTAGCTGGTGT gttgtggaaggtccagttttgaggggctattacaac 서열번호 23
12 AAATCAATAGCCGCCACTAGAGGAGCTACT gttgtggaaggtccagttttgaggggctattacaac 서열번호 24
<2-3> 루시퍼레이즈 분석을 통한 SARS-CoV-2 mRNA 수준 측정
HEK293T 세포에 PspCas13b와 crRNA를 발현할 수 있는 DNA를 RdRp 단편 (firefly-conjugated RdRp fragment)을 암호화하는 DNA와 함께 형질 감염시켰다. 48시간 후, dual-luciferase reporter assay system을 이용해 발광도를 측정하였다 (도 3a 및 도 3b).
그 결과, 도 3c에 나타난 바와 같이, RdRp 또는 peudoknot 영역을 표적으로 하는 모든 crRNA는 발광이 유의하게 감소된 것을 확인할 수 있었으며, 특히 2, 5, 9, 11번 crRNA가 상대적으로 낮은 발광 정도를 보여 SARS-CoV-2의 RNA 분해 능력이 우수한 것으로 나타났다.
또한, 도 3d에 나타난 바와 같이, 2, 5, 11, 9 순서로 우수한 SARS-CoV-2의 RNA 분해 능력을 보였다.
HEK293T 세포에 RdRp DNA와 Cas13b DNA, crRNA DNA를 유입 후 24시간 후 해당 세포의 total RNA 를 추출하여 qRT-PCR 을 통해 RdRp mRNA 값을 측정하였다. 이때 각각의 crRNA가 표적으로 하는 RdRp 부분을 감지할 수 있는 qRT-PCR primer 들을 이용하였고, RdRp 를 표적으로 하지 않는 crRNA (NT) 처리군의 RdRp mRNA 값을 기준으로 crRNA #2, #5, #9, #11 처리군의 값을 정규화 (normalization)하였다.
또한, 도 4에 나타난 바와 같이, 2번 crRNA가 가장 우수한 RNA 분해 활성을 나타나는 것을 확인하였다.
<실시예 3> Cas13b mRNA의 제작
<3-1> PspCas13b RNA 합성
CRISPR-Cas13 시스템의 안전하고 치료적인 사용을 위해 mRNA로 인코딩된 Cas13b 단백질을 합성하였다.
구체적으로, T7 promoter를 가진 PspCas13b DNA를 PCR을 통해 합성하고, Hiscribe T7 ARCA mRNA synthesis kit (with tailing) 을 사용하여 RNA 합성을 하였다. T7 RNA polymerase mix와 ARCA/NTP mix 를 T7 promoter를 가진 PspCas13b DNA를 함께 섞어 37℃에서 반응하였다. DNase를 처리해 PspCas13b DNA 를 없애고, poly(A) tailing을 진행하였다. 합성된 RNA는 RNA 정제 키트를 이용해 정제하였다.
그 결과, 도 5에 나타난 바와 같이 PspCas13b mRNA를 합성하였다.
상기 mRNA로 인코딩된 Cas13b 단백질은 세포에서 Cas13b 단백질의 빠르고 일시적인 발현을 유도할 수 있다.
<3-2> 웨스턴블롯을 이용한 형질감염 효율 측정
상기 실시예 3-1에서 합성한 PspCas13b mRNA를 세포에 형질감염시켜 시간대 별로 형질감염 효율을 측정하기 위하여 웨스턴블롯을 수행하였다.
구체적으로, HEK293T 세포에 PspCas13b mRNA를 유입시키고 2, 4, 8, 12시간별로 세포를 모아 단백질을 추출하였다. 단백질 정량을 통해 시간대별 동일한 양을 웨스턴블롯하였다. 이때 rabbit anti-HA tag antibody를 이용해 PspCas13b 단백질, mouse anti-GAPDH antibody를 이용해 GAPDH 단백질을 표적하였다. 이후 goat anti-rabbit IgG H&L (IRDye 680RD)과 goat anti-mouse IgG H&L (IRDye 800CW)를 이용해 각각의 단백질을 2차 표적하여 이미징하였다.
그 결과, 도 6a에 나타난 바와 같이, PspCas13b 단백질은 형질감염 후 2시간부터 발현이 꾸준히 증가함을 확인하였다.
<3-3> 형광 현미경을 이용한 형질감염 효율 측정
또한, PspCas13b mRNA로 형질감염된 HEK293T 세포는 형질감염 48시간 후 HA tag 염색을 통해서 PspCas13b 발현을 확인하였다.
구체적으로, 4% 폼알데하이드 (formaldehyde)로 PspCas13b mRNA가 유입된 HEK293T를 고정한 후 0.2% Triton X-100을 이용해 permeabilization하였다. Rabbit anti-HA tag antibody를 이용해 24시간 동안 PspCas13b 단백질을 표적하였고, goat anti-rabbit IgG (H+L), alexa fluor 488을 이용해 2차 표적하여 ImagExfluorer 을 이용해 이미징하였다.
그 결과, 도 6b에 나타난 바와 같이, 대부분의 세포에서 균일한 PspCas13b 발현이 유도됨을 확인하였다.
<3-4> 세포 독성 측정
형질감염 후 세포 독성이 나타나면 세포는 분열하지 않으므로, 세포가 분열하는지 여부를 확인하였다.
구체적으로, HEK293T 세포에 PspCas13 mRNA를 발현시키고 현미경을 이용하여 48시간 동안 관찰하였다.
그 결과, 도 7에 나타난 바와 같이, PspCas13b mRNA 발현 세포는 24, 48 시간 후 점차 세포 분열을 하여 하나의 이미지 화면에 보이는 세포의 수가 증가하는 것을 확인하였다.
상기의 결과는 PspCas13 mRNA가 세포 독성이 없음을 시사한다.
<실험예 1> Cas13b 및 crRNA의 SARS-CoV-2 RdRp mRNA 분해 수준 측정
<1-1> 역전사 정량적 중합효소연쇄반응 (RT-qPCR)을 통한 SARS-CoV-2 RdRp mRNA 수준 측정
HEK293T 세포에 PspCas13b와 crRNA를 발현하는 DNA를 형질감염 시킨 후 48시간 뒤에 세포를 수확하였다. 수확한 세포의 RNA를 추출하고, random hexamer와 oligo dT를 프라이머로 이용해 cDNA를 합성하였다. 도 8a에 나타난 바와 같이 RT-qPCR detection region을 증폭시킬 수 있는 프라이머를 제작하여 cDNA를 주형으로 RT-qPCR을 수행하였다. 해당 crRNA로 인지되어 PspCas13b에 의해 분해된 실험군의 경우 RT-qPCR 프라이머로 감지되지 않기 때문에 각 crRNA 및 PspCas13b가 SARS-CoV-2의 RNA를 분해할 수 있는지 여부를 확인하였다.
그 결과, 도 8b 내지 도 8d에 나타난 바와 같이, 회색 bar는 타겟되지 않은 실험군 (Non-target crRNA 이용), 파란색 bar는 타겟된 실험군으로, 그 중 빨간색 bar는 해당 crRNA가 표적하는 부분을 증폭시키는 프라이머가 사용된 군을 표시한 것이며 대부분의 경우 RT-qPCR 결과 군에서 가장 낮은 RdRp mRNA 발현 수준을 보이는 것을 확인할 수 있었다.
상기 결과는 각 crRNA가 RdRp mRNA의 표적하는 부분을 PspCas13b와 함께 분해할 수 있음을 제시한다.
<1-2> 선별한 crRNA에 대한 SARS-CoV-2 RdRp RNA 분해 활성 측정
HEK29T 세포에 PspCas13b mRNA, crRNA, RdRp mRNA를 형질감염시킨후, 24시간 뒤 해당 세포를 수확하여 RNA를 추출하였다. RNA에서 cDNA를 합성한 후 해당 crRNA가 표적하는 부위를 감지하는 프라이머를 이용해 RT-qPCR을 수행하였다.
그 결과, 도 9a에 나타난 바와 같이, 타겟하지 않는 NT (Non-target) 실험군 대비 4가지 crRNA (2, 5, 9, 11번) 모두 PspCas13b에 의한 RdRp mRNA 분해가 이루어져 유의미한 RdRp mRNA 수준 감소를 보이는 것을 확인할 수 있었다.
또한, 도 9b에 나타난 바와 같이, 2번 crRNA는 PspCas13b와 crRNA가 1:20의 비율로 처리되었을 때, 가장 높은 mRNA 분해 활성을 보였으나, 1:36 및 1:50의 비율로 처리되었을 때와 통계적으로 유의한 차이는 없었고, 5번 crRNA는 1:36의 비율로 처리되었을 때, 가장 높은 mRNA 분해 활성을 보였으나, 1:20 및 1:50의 비율로 처리되었을 때와 통계적으로 유의한 차이는 없었다.
<실험예 2> SARS-CoV-2 복제 억제 효과 확인
Cas13b mRNA 및 crRNA가 SARS-CoV-2 복제를 억제하는 지 확인하기 위한 실험을 수행하였다.
구체적으로, Cas13b mRNA 및 crRNA (2, 5, 9, 11번) 형질감염된 Vero E6 세포를 SARS-CoV-2의 MOI = 0.05(1 x 106 TCID50/ml)으로 감염시켰다. 감염 24시간 후 세포 배양액 혹은 세포 용해물에서 수확한 SARS-CoV-2를 수득하여 두번째로 감염시켰으며, 이 때 Cas13b mRNA 및 crRNA (2, 5, 9, 11번)을 다시 형질감염시켰다. 두번째 감염 24시간 후 세포 배양액 또는 세포 용해물에서 수확한 SARS-CoV-2을 분리하였다.
<2-1> 스파이크 단백질의 발현 확인
두번째 감염군의 세포 배양액 (supernant) 혹은 세포 용해물 (cell)에서 분리된 바이러스를 새로운 Vero E6세포에 감염시킨 후 24시간 뒤 먼저, 스파이크 단백질의 발현을 확인하기 위하여 면역염색을 수행하였다.
4% 포름알데하이드 (formaldehyde)로 세포를 고정 후 2% Triton X-100으로 permeabilization하였다. Rabbit anti-2019-nCoV spike protein을 이용해 스파이크 단백질을 1차 표적하였고, goat anti-rabbit IgG (H+L), alexa fluor 488로 2차 표적하였다. 해당 세포를 DAPI로 염색한 후 DAPI와 GFP 이미징을 하였으며, DAPI 염색된 세포 수 대비 DAPI와 GFP 함께 염색된 세포 수를 측정하여 이를 백분율로 나타내었다.
그 결과, 도 10a 및 도 10b에 나타난 바와 같이, crRNA #2, #9 처리군은 아무 처리하지 않은 대조군 (Non)에 비하여 스파이크 단백질 발현 세포 수가 현저하게 줄어들었고, 특히 crRNA #2 처리군에서는 99.9% 스파이크 단백질이 발현되지 않음을 확인하였다.
상기의 결과는, pseudoknot 영역을 표적으로 하는 crRNA #2의 바이러스 복제 억제 효과가 우수함을 시사한다.
<2-2> SARS-CoV-2 유전자 수준 확인
또한, qPCR을 통해 SARS-CoV-2 유전자를 분석하였다.
두번째 감염군의 세포 배양액 (supernant) 혹은 세포 용해물 (cell)에서 분리된 바이러스를 이용한 새로운 Vero E6 세포에 감염시킨 후 24시간 뒤 감염 세포에서 total RNA 를 추출하여 SARS-CoV-2의 envelope (E), nucleocapsid (N) 또는 non-structural protein 2 (nsp2)를 증폭시키는 프라이머를 이용해 qRT-PCR 을 진행하였다.
그 결과, 도 10c에 나타난 바와 같이, pseudoknot 영역을 표적하는 crRNA #2 처리군에서 99.9%의 SARS-CoV-2 유전자의 감소를 확인하였다.
<2-3> SARS-CoV-2 유전체 수 확인
또한, bulk RNA-시퀀싱 (sequencing)을 통해 SARS-CoV-2 유전체 수를 정밀 분석하였다.
SARS-CoV-2 감염 Vero E6 세포에서 total RNA를 추출 후 조각내어 fragment 양 끝단에 시퀀싱에 필요한 서열들을 붙여 라이브러리를 만들었다. 시퀀싱 이후 생성된 데이터는 샘플 유래 생물종인 Vero cell (GCF_015252025.1_Vero_WHO_p1.0) 및 SARS-CoV-2 (MW466791.1)을 추가한 서열을 reference 삼아 STAR과 HTSeq tool을 이용해 mapping을 진행하였다. Read coverage 수를 확인하기 위해 BAM 파일을 활용하였으며 SARS-CoV-2 유전체 내의 위치별로 cover 할 수 있도록 맞추었다.
그 결과, 도 10d에 나타난 바와 같이, RdRp 타겟하지 않는 crRNA (NT) 처리군에 비해 crRNA #2, 9, 11 처리군에서 유의미한 SARS-CoV-2 유전체 감소를 확인하였다. 특히 pseudoknot 부분을 타겟하는 crRNA #2 처리군에서는 완벽한 SARS-CoV-2 유전체 감소가 나타났다.
<2-4> Calu-3 세포에서 SARS-CoV-2 RdRp 또는 nucleocapsid 유전자 수준 확인
Vero E6 뿐만 아니라 human 폐세포 유래종인 Calu-3 세포에서 Cas13b mRNA 및 crRNA #2가 SARS-CoV-2 복제를 억제하는 지 확인하기 위한 실험을 수행하였다.
구체적으로, Cas13b mRNA 및 crRNA #2 형질감염된 Calu-3 세포를 SARS-CoV-2 감염시켜 24시간 후 감염세포에서 total RNA 를 추출하여 qRT-PCR을 통해 SARS-CoV-2 유전자를 분석하였다.
그 결과, 도 10e에 나타난 바와 같이, RdRp 표적하지 않는 crRNA (NT) 처리군에 비해 crRNA #2 처리군에서 유의미한 SARS-CoV-2 RdRp, nucleocapsid 유전자 저해 효과를 보았다.
<실험예 3> peudoknot 영역을 표적으로 하는 crRNA의 SARS-CoV-2 복제 억제 효과 확인
실험예 2에서 강력한 바이러스 억제 효과를 보인 crRNA #2는 ORF1b의 리보솜 해독틀 변위 부위의 pseudoknot 영역을 표적으로 한다. 리보솜 해독틀 변위 부위는 SARS-CoV-2에서 고도로 보존된 3-stemmed pseudoknot 구조를 가지고 있는데 crRNA #1과 #3도 pseudoknot 영역을 표적으로 하여 전체 3-stemmed 구조를 덮고 있다 (도 11a). crRNA #1은 stem 1과 3을 형성하는 서열을 표적으로 하였고, crRNA #2와 #3은 각각 stem 1-3과 stem 2의 서열을 표적으로 하였다. 이에, 본 발명자들은 pseudoknot 영역을 표적으로 하는 것이 바이러스 복제를 차단하는 데 중요함을 확인하기 위해 peudoknot 영역을 표적으로 하는 crRNA (#1, #2, #3) 및 Cas13b mRNA로 형질감염된 세포에서 스파이크 단백질의 발현 및 subgenomic RNA 수준을 확인하였다.
<3-1> 면역염색을 이용한 스파이크 단백질의 발현 확인
Cas13b mRNA 및 pseudoknot-targeting crRNA가 스파이크 단백질 발현을 억제하는 지 확인하기 위하여, 실험예 2-1과 같은 방법으로 면역염색을 수행하였다.
그 결과, 도 11b에 나타난 바와 같이, crRNA 를 처리하지 않거나, 타겟하지 않는 crRNA (Non-target)를 처리한 대조군에 비하여 crRNA #1, #2 및 #3으로 형질감염된 세포의 배양액 및 세포 용해물에서는 스파이크 단백질이 나타나지 않음을 확인하였다.
상기의 결과는 crRNA #1, #2 및 #3 및 PspCas13b가 SARS-CoV-2의 바이러스 복제를 억제함을 시사한다.
<3-2> 웨스턴블롯을 이용한 스파이크 및 뉴클레오캡시드 단백질의 발현 확인
또한, Cas13b mRNA 및 pseudoknot-targeting crRNA가 스파이크 단백질의 발현을 억제하는 지 확인하기 위하여, 웨스턴블롯 실험을 수행하였다.
단백질 정량을 통해 시간대별 동일한 양을 웨스턴블롯 하였다. 이때 Rabbit anti-2019-nCoV spike protein, rabbit anti-2019-nCoV nucleotide 를 이용해 각각 스파이크 단백질, 뉴클레오캡시드 단백질을 표적하고 mouse anti-GAPDH 를 이용해 GAPDH 단백질을 표적하였다. 이후 goat anti-rabbit IgG H&L (IRDye 680RD)과 goat anti-mouse IgG H&L (IRDye 800CW)를 이용해 각각의 단백질을 2차 표적하여 이미징하였다.
그 결과, 도 11c에 나타난 바와 같이, crRNA 를 처리하지 않거나 (Non), 타겟하지 않는 crRNA (NT)를 처리한 대조군에 비하여 crRNA #1, #2 및 #3으로 형질감염된 세포의 배양액 및 세포 용해물에서는 스파이크 단백질 및 뉴클레오캡시드 단백질의 발현이 전혀 나타나지 않음을 확인하였다.
상기의 결과는 crRNA #1, #2 및 #3 및 PspCas13b가 SARS-CoV-2의 바이러스 복제를 효과적으로 억제함을 시사한다.
<3-3> RNA 유전자 수준 확인
또한, qPCR을 통해 subgenomic RNA 수준을 확인하였다.
두번째 감염군의 세포 배양액 (supernant) 혹은 세포 용해물 (cell)에서 분리된 바이러스를 이용한 새로운 Vero E6세포에 감염시킨 후 24시간 뒤 감염 세포에서 total RNA 를 추출하여 SARS-CoV-2의 RdRp, nucleocapsid를 증폭시키는 프라이머를 이용해 qRT-PCR을 진행하였다.
그 결과, 도 11d에 나타난 바와 같이, crRNA 를 처리하지 않거나 (Non), 타겟하지 않는 crRNA (NT)를 처리한 대조군에 비하여 crRNA #1, #2 및 #3으로 형질감염된 세포의 배양액 및 세포 용해물에서는 subgenomic RNA의 양이 감소하였다. 특히, crRNA #2 및 #3을 통한 바이러스 복제는 완벽하게 차단되었음을 확인하였다.
상기의 결과는 pseudoknot 영역과 같은 번역 시작점이 ORF의 다른 영역을 대상으로 하는 것보다 SARS-CoV-2의 복제를 억제하는 가장 좋은 표적이 될 수 있음을 시사한다.
<실험예 4> dead PspsCas13b를 이용한 SARS-CoV-2 유전체 절단 효과의 확인
SARS-CoV-2 내 pseudoknot 부위는 3-stemmed RNA 구조를 가지며 frameshifting site 에 위치하여 바이러스 단백질 발현에 중요한 기능을 한다. PspCas13b 단백질이 pseudoknot 부위와 결합하여 frameshifting site의 기능을 저해해 SARS-CoV-2 증식을 억제하는 것이 아닌 SARS-CoV-2 유전체의 절단에 의해 SARS-CoV-2 증식이 억제됨을 증명하기 위하여 절단효과가 없는 dead PspsCas13b를 제작하였고 SARS-CoV-2 억제 여부 실험을 진행하였다. 이때 crRNA #5 는 대조군으로 사용하였다.
<4-1> 면역염색을 이용한 스파이크 단백질의 발현 확인
Vero E6 세포에 PspCas13b mRNA와 crRNA #2, dead PspCas13b mRNA와 crRNA #2를 각각 유입하고 SARS-CoV-2 감염 후 24시간 뒤 스파이크 단백질을 염색하였다.
4% formaldehyde로 세포를 fixation 후 2% Triton X-100으로 permeabilization 하였다. Rabbit anti-2019-nCoV spike protein 을 이용해 스파이크 단백질을 1차 표적하였고, goat anti-rabbit IgG (H+L), alexa fluor 488로 2차 표적하였다. 해당 세포를 DAPI staining 을 한 후 DAPI와 GFP 이미징을 하였다.
그 결과, 도 12a에 나타난 바와 같이, PspCas13b mRNA와 crRNA #2, #5 처리군에서 스파이크 단백질 발현 세포수가 감소한 것과 달리, dead PspCas13b mRNA 처리군에서는 crRNA #2, #5 처리군 모두에서 스파이크 단백질로 염색된 세포수가 전혀 감소되지 않았다.
<4-2> RNA 수준 확인
또한, 감염된 Vero E6 세포의 total RNA를 추출하여 SARS-CoV-2의 RdRp, nucleotide 유전자를 증폭시키는 프라이머를 이용해 qRT-PCR을 진행하였다.
그 결과, 도 12b에 나타난 바와 같이, dead PspCas13b mRNA를 처리한 군에서는 SARS-CoV-2 유전자 감소가 전혀 관찰되지 않았다.
이는 PspCas13b 단백질에 의한 SARS-CoV-2 유전체 절단이 있어야 SARS-CoV-2 증식 억제가 가능하다는 것을 의미한다.
<실험예 5> PspCas13b mRNA 또는 crRNA의 농도에 따른 살아있는 SARS-CoV-2 복제 수준 변화 확인
Cas13b mRNA와 crRNA 농도별 처리에 따른 살아있는 SARS-CoV-2 복제 수준 변화를 측정하기 위해 플라그 에세이(plaque assay)를 수행하였다.
구체적으로, Vero E6 세포에 Cas13b mRNA와 crRNA를 각각 0 ng:0 ng, 50 ng: 25 ng, 100 ng:50 ng, 200 ng:100 ng, 400 ng: 200 ng 처리 후 SARS-CoV-2 감염을 유도하였다. 24시간 뒤 감염 세포에서 SARS-CoV-2 를 분리 후 이를 새로운 Vero E6 세포에 감염을 유도하였다. 이 세포를 plaque assay 하였다.
그 결과, 도 12c와 같이 RdRp 타겟하지 않는 crRNA 의 경우 Cas13b mRNA와 crRNA 처리 농도에 관계없이 세포 사멸에 의한 플라그가 형성되었다. 하지만 crRNA #2의 경우 처리 농도가 높아지면서 플라그의 형성이 감소하였다.
플라그의 수를 분석하여 0 ng Cas13b mRNA:0 ng crRNA 군을 기준 (100%)으로 하여 백분율로 나타낸 결과, 도 12d 와 같이 RdRp 타겟하지 않는 crRNA에 비해 crRNA #2를 처리한 군의 플라그 수가 현저히 감소함을 확인하였다. 이는 Cas13b mRNA 와 crRNA 처리한 군에서 살아있는 SARS-CoV-2 복제가 일어나지 않는 것을 의미한다.
<실험예 6> SARS-CoV-2 변이체에 대한 바이러스 분해 효능 확인
<6-1> SARS-CoV-2 변이체 간의 서열 변이 분석
SARS-CoV-2 변이체 (알파, 베타, 감마 및 델타) 간의 서열 변이를 분석하였다.
구체적으로, 오픈소스데이터 (GISAID)를 이용하여 변이체에 해당하는 SARS-CoV-2 전체 유전체를 각 10명의 환자 샘플에서 얻었고, 유전체 서열 사이의 연관성을 확인하기 위해 MAFFT 방법을 이용해 서열정렬을 수행하였다.
그 결과, 도 13a에 나타난 바와 같이, SARS-CoV-2 변이체의 ORF1a 및 구조 단백질은 ORF1b에 비해 상대적으로 많은 양의 돌연변이를 가지고 있었다.
ORF1b는 SARS-CoV-2 게놈에서 가장 잘 보존된 영역이며, 또한 ORF1b의 pseudoknot 영역의 서열과 구조는 코로나바이러스에서 고도로 보존된 것으로 알려져 있다. SARS-CoV-2의 변이형이 빠르게 출현하면서 바이러스 게놈 기반 항바이러스제는 돌연변이를 극복해야 하는 과제에 직면해 있는데, 구조 단백질의 유전자를 인식하도록 설계된 약물은 돌연변이율이 높아 표적화 효율이 떨어질 위험이 있다. 따라서, 본 발명의 ORF1b 내 RdRp 또는 pseudoknot 영역을 표적으로 하는 crRNA는 SARS-CoV-2 돌연변이에서도 효과적으로 바이러스 복제를 억제할 수 있음을 시사한다.
pseudoknot 영역을 표적으로 하는 SARS-CoV-2 변이체에 대한 효과를 확인하기 위하여 SARS-CoV-2 변이체에 감염된 세포에서 스파이크 단백질의 발현을 분석하였다.
구체적으로, Vero E6 세포에 PspCas13b mRNA 와 crRNA #2 를 유입하고 SARS-CoV-2, SARS-CoV-2 alpha, SARS-CoV-2 beta, SARS-CoV-2 gamma, SARS-CoV-2 delta 변이주를 각각 감염시킨 후 24시간 뒤 스파이크 단백질을 염색하였다. 4% formaldehyde 로 세포를 fixation 후 2% Triton X-100으로 permeabilization 하였다. Rabbit anti-2019-nCoV spike protein 을 이용해 스파이크 단백질을 1차 표적하였고, goat anti-rabbit IgG (H+L), alexa fluor 488로 2차 표적하였다. 해당 세포를 DAPI staining 을 한 후 DAPI와 GFP 이미징을 하였다.
그 결과, 도 13b에 나타난 바와 같이, crRNA 를 처리하지 않거나 (non-treated), 타겟하지 않는 (Non-target) crRNA를 처리한 대조군에서는 대부분의 세포가 변이체 감염에 의해 스파이크 단백질을 발현하였다. 그러나, crRNA #2로 형질감염된 세포에서는 모든 유형의 변이체에서 스파이크 단백질로 염색되는 세포 수가 명확하게 감소함을 확인하였다.
<6-3> SARS-CoV-2 변이체 바이러스 감염된 세포에서 N 및 nsp2 유전자의 subgenomic RNA 수준 확인
Nucleocapsid (N) 및 non-structural protein 2 (nsp2) 유전자의 subgenomic RNA 수준을 확인하기 위해 qRT-PCR을 수행하였다.
구체적으로, Vero E6 세포에 각 SARS-CoV-2 변이체 바이러스를 감염시키고, 24시간 뒤 감염 세포에서 total RNA 를 추출하여 SARS-CoV-2의 nucleocapsid (N) 또는 non-structural protein 2 (nsp2)를 증폭시키는 프라이머를 이용해 qRT-PCR 을 진행하였다.
그 결과, 도 13c에 나타난 바와 같이, N 및 nsp2 유전자의 서브게놈 양은 crRNA를 처리하지 않거나 (non-treated), 타겟하지 않는 (Non-target) crRNA를 처리한 대조군에 비하여 pseudoknot 영역을 표적으로 하는 crRNA #2의 Cas13 매개 분해에 의해 모든 유형의 SARS-CoV-2 바이러스에서 감소됨을 확인하였다.
<실험예 7> SARS-CoV-2 감염된 마우스에서 치료 효과 확인
Pseudoknot 부위 타겟 PspCas13b 단백질의 SARS-CoV-2 감염병 치료 효과를 보기 위한 실험을 진행하였다.
SARS-CoV의 동물모델로서 Human ACE2 형질전환 마우스에 PspCas13b mRNA와 crRNA #2를 기관내삽입을 통해 유입하고 SARS-CoV-2 감염을 유도하였다. 24시간 뒤 감염마우스의 폐조직에서 SARS-CoV-2를 분리하여 TCID50 분석을 통해 바이러스를 정량하였다.
그 결과, 도 14에 나타난 바와 같이, mRNA가 처리되지 않은 마우스 (Non)와 RdRp를 타겟하지 않는 마우스 (NT)와는 달리 pseudoknot 부분을 타겟하는 마우스 (#2)에서는 바이러스 검출이 매우 미미하였다.
상기의 결과는 본 발명의 PspCas13b mRNA와 crRNA #2를 코로나바이러스감염증-19의 치료제로 유용하게 사용할 수 있음을 시사한다.

Claims (14)

  1. Cas13 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및 crRNA (CRISPR RNA)를 유효성분으로 포함하는, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서, 상기 Cas13 단백질은 crRNA와 복합체를 형성하는 것인, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  3. 제1항에 있어서, 상기 Cas13 단백질을 암호화하는 폴리뉴클레오티드는 DNA 또는 mRNA인 것인, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  4. 제1항에 있어서, 상기 crRNA는 tracrRNA (trans-activating CRISPR RNA)와 결합된 가이드 RNA (guide RNA) 형태인 것인, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  5. 제1항에 있어서, 상기 Cas13 단백질은 Cas13a, Cas13b, Cas13c 및 Cas13d로 구성되는 군으로부터 선택되는 어느 하나 이상인 것인, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  6. 제1항에 있어서, 상기 crRNA는 SARS-CoV-2 유전자의 ORF1b를 표적으로 하는 것인, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  7. 제1항에 있어서, 상기 crRNA는 SARS-CoV-2 유전자의 ORF1b 내의 RNA-dependent RNA polymerase(RdRp)를 표적으로 하는 것인, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  8. 제1항에 있어서, 상기 crRNA는 SARS-CoV-2 유전자의 ORF1b 내의 리보솜 리보솜 해독틀 변위 부위 (ribosomal frame shifting site)의 pseudoknot 영역을 표적으로 하는 것인, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  9. 제1항에 있어서, 상기 crRNA는 서열번호 1 내지 12 중에서 선택되는 핵산 서열을 포함하는 표적 부위에 혼성화 가능한 것인, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  10. 제4항에 있어서, 상기 가이드 RNA는 서열번호 13 내지 24 중에서 선택되는 핵산 서열을 포함하는 것인, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  11. 제2항에 있어서, 상기 복합체는 SARS-CoV-2의 RNA 유전체를 분해하여 코로나바이러스감염증-19의 치료 효과를 나타내는 것인, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  12. Cas13 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및 crRNA (CRISPR RNA)를 포함하는, 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료용 약학적 조성물.
  13. Cas13 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및 crRNA (CRISPR RNA)를 개체에 투여하는 단계를 포함하는 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료 벙법.
  14. 코로나바이러스감염증-19(COVID-19)의 예방 또는 치료를 위한 약제의 제조에 사용하기 위한 Cas13 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및 crRNA (CRISPR RNA)의 용도.
PCT/KR2022/007599 2021-05-27 2022-05-27 Cas13 단백질 및 crrna를 포함하는 코로나바이러스감염증-19 예방 또는 치료용 약학적 조성물 Ceased WO2022250503A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0068113 2021-05-27
KR20210068113 2021-05-27

Publications (1)

Publication Number Publication Date
WO2022250503A1 true WO2022250503A1 (ko) 2022-12-01

Family

ID=84228915

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/007599 Ceased WO2022250503A1 (ko) 2021-05-27 2022-05-27 Cas13 단백질 및 crrna를 포함하는 코로나바이러스감염증-19 예방 또는 치료용 약학적 조성물

Country Status (2)

Country Link
KR (1) KR102839248B1 (ko)
WO (1) WO2022250503A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4737568A1 (en) * 2023-06-30 2026-05-06 Nsage Corp. Novel crispr/cas13 system and use thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111363847A (zh) * 2020-02-12 2020-07-03 广州微远基因科技有限公司 基于CRISPR技术的2019-nCoV快速检测引物组及其用途
CN112159817A (zh) * 2020-10-09 2021-01-01 天津医科大学总医院 靶向新型冠状病毒棘突的基因、试剂盒、筛选方法及应用
WO2021016453A1 (en) * 2019-07-23 2021-01-28 University Of Rochester Targeted rna cleavage with crispr-cas

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021016453A1 (en) * 2019-07-23 2021-01-28 University Of Rochester Targeted rna cleavage with crispr-cas
CN111363847A (zh) * 2020-02-12 2020-07-03 广州微远基因科技有限公司 基于CRISPR技术的2019-nCoV快速检测引物组及其用途
CN112159817A (zh) * 2020-10-09 2021-01-01 天津医科大学总医院 靶向新型冠状病毒棘突的基因、试剂盒、筛选方法及应用

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ABBOTT TIMOTHY R., DHAMDHERE GIRIJA, LIU YANXIA, LIN XUEQIU, GOUDY LAINE, ZENG LEIPING, CHEMPARATHY AUGUSTINE, CHMURA STEPHEN, HEA: "Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and Influenza", CELL, vol. 181, no. 4, 14 May 2020 (2020-05-14), Amsterdam NL , pages 865 - 876+12, XP055854857, ISSN: 0092-8674, DOI: 10.1016/j.cell.2020.04.020 *
FAREH MOHAMED, ZHAO WEI, HU WENXIN, CASAN JOSHUA M. L., KUMAR AMIT, SYMONS JORI, ZERBATO JENNIFER M., FONG DANIELLE, VOSKOBOINIK I: "Reprogrammed CRISPR-Cas13b suppresses SARS-CoV-2 replication and circumvents its mutational escape through mismatch tolerance", NATURE COMMUNICATIONS, vol. 12, no. 1, 1 January 2021 (2021-01-01), pages 1 - 16, XP093008405, DOI: 10.1038/s41467-021-24577-9 *
KELLY JAMIE A., OLSON ALEXANDRA N., NEUPANE KRISHNA, MUNSHI SNEHA, EMETERIO JOSUE SAN, POLLACK LOIS, WOODSIDE MICHAEL T., DINMAN J: "Structural and functional conservation of the programmed −1 ribosomal frameshift signal of SARS-CoV-2", BIORXIV, 15 June 2020 (2020-06-15), pages 1 - 13, XP093008404, DOI: 10.1101/2020.03.13.991083 *

Also Published As

Publication number Publication date
KR102839248B1 (ko) 2025-07-28
KR20220160510A (ko) 2022-12-06

Similar Documents

Publication Publication Date Title
JP7522088B2 (ja) 単純ヘルペス１型および他の関連するヘルペスウイルスのｒｎａガイド除去
US8163292B2 (en) Herpes simplex viruses and methods of viral replication
US20180334688A1 (en) Genome engineering with type i crispr systems in eukaryotic cells
WO2010041913A2 (ko) Grs 단백질 또는 이의 단편의 신규한 용도
US20050226847A1 (en) Adeno-associated virus producer system
Liu et al. Development and in vivo evaluation of MGF100-1R deletion mutant in an African swine fever virus Chinese strain
WO2023282688A1 (ko) 산화스트레스 저항성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
Ma et al. The foot-and-mouth disease virus Lb protease cleaves intracellular transcription factors STAT1 and STAT2 to antagonize IFN-β–induced signaling
Donne et al. Potential risk factors associated with the use of cidofovir to treat benign human papillomavirus-related disease
KR20220160510A (ko) Cas13 단백질 및 crRNA를 포함하는 코로나바이러스감염증-19 예방 또는 치료용 약학적 조성물
US20240271128A1 (en) Rna guided eradication of herpes simplex type i and other related human herpesviruses
US20220235348A1 (en) Crispr methods for treating cancers
JP2023544382A5 (ko)
JP7075653B2 (ja) αヘルペスウイルス感染を処置する方法及び医薬組成物
WO2020139031A1 (ko) Crispr-cas를 기반으로 하는 유전자 교정용 조성물
WO2025230111A1 (ko) 유전자 편집 활성이 증가된 cas12f1 변이체 및 이의 용도
WO2020242278A1 (ko) 바이러스 감염 및 활성 억제 방법
US20250332284A1 (en) Modified plant virus system for delivery of nucleic acids into mammalian cells
WO2023244048A1 (ko) 한국 분리주 gh 계통 사스코로나바이러스2 유래의 리포터 유전자 발현 사스코로나바이러스2 재조합 벡터 및 이의 제조방법
WO2025225968A1 (en) Composition for preventing or treating inflammatory bowel disease
WO2023179781A1 (zh) 用于治疗病毒感染的方法和药物组合物
Liu et al. An Efficient and Safe Trans-complementation System of Mpox Virus Reproduces Authentic Viral Architecture and Infection
WO2023244044A1 (ko) 변형된 코로나바이러스 스파이크 항원 단백질 및 이의 용도
WO2023234661A1 (ko) 신규한 변형 폴리아데닌 서열 및 이의 용도
WO2024014770A1 (ko) mRNA 백신 및 치료제의 제조를 위한 변형된 RNA

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22811694

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22811694

Country of ref document: EP

Kind code of ref document: A1