WO2020242278A1 - 바이러스 감염 및 활성 억제 방법 - Google Patents

바이러스 감염 및 활성 억제 방법 Download PDF

Info

Publication number
WO2020242278A1
WO2020242278A1 PCT/KR2020/007100 KR2020007100W WO2020242278A1 WO 2020242278 A1 WO2020242278 A1 WO 2020242278A1 KR 2020007100 W KR2020007100 W KR 2020007100W WO 2020242278 A1 WO2020242278 A1 WO 2020242278A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
rna
tent4a
cells
tent4b
Prior art date
Application number
PCT/KR2020/007100
Other languages
English (en)
French (fr)
Inventor
김빛내리
여진아
김동완
이영석
정수진
Original Assignee
서울대학교 산학협력단
기초과학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교 산학협력단, 기초과학연구원 filed Critical 서울대학교 산학협력단
Priority to US17/614,795 priority Critical patent/US20220220483A1/en
Priority to EP20813525.1A priority patent/EP3984558A4/en
Priority to CN202080039725.5A priority patent/CN113874042A/zh
Priority to JP2021571026A priority patent/JP7403777B2/ja
Publication of WO2020242278A1 publication Critical patent/WO2020242278A1/ko
Priority to JP2023021944A priority patent/JP2023058675A/ja
Priority to JP2023021943A priority patent/JP2023058674A/ja

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07019—Polynucleotide adenylyltransferase (2.7.7.19)

Definitions

  • the present invention was made by the project number 1711079098 under the support of the Ministry of Science, Technology and Communication of the Republic of Korea.
  • the research management institution for the project is the Research Institute of Basic Science
  • the name of the research project is "Support for research operation expenses”
  • the name of the research project is Cell Fate Control Research”
  • the main institution is the Research Institute of Basic Science, and the research period is January 1, 2018 to December 31, 2018.
  • the present invention relates to a technique for preventing or treating viral infections and infectious diseases by inducing mixed tailing to viral RNA.
  • Hepatitis B is a viral disease transmitted from their children sexually and vertically from extraintestinal, infected or carrier mothers by contaminated materials such as blood and blood products, contaminated needles. According to the World Health Organization, more than 2 billion people are infected worldwide, about 4 million acute cases each year, 1 million deaths annually, and an estimated 350-400 million chronic vectors (World Health Health Organization). Organization: Geographic Prevalence of Hepatitis B Prevalence, 2004.http://www.who.int/vaccines-surveillance/graphics/htmls/hepbprev.htm).
  • HBV This virus, HBV, is a double-stranded hepatotropic virus that infects only humans and non-human primates. Viral replication occurs primarily in the liver, and less than that, in the kidneys, pancreas, bone marrow and spleen (Hepatitis B virus biology. Microbiol Mol Biol Rev. 64: 2000; 51-68.). Viral and immunological markers are detectable in the blood, and characteristic antigen-antibody patterns evolve over time. The first detectable viral label is HBsAg, followed by hepatitis B e antigen (HBeAg) and HBV DNA.
  • HBsAg hepatitis B e antigen
  • HBeAg is a detectable viral marker in the blood, and is associated with active viral replication, and is therefore highly viral load and infectious (Hepatitis B virus e antigenthe dangerous end game of hepatitis B virus.N Engl J Med. 347: 2002; 208-210).
  • the presence of anti-HBsAb and anti-HBcAb (IgG) indicates recovery and immunity in already infected individuals.
  • the currently recommended treatments for chronic HBV infection are interferon alpha (INF ⁇ ), pegylated interferon alpha-2a (Peg-IFN2a). ), entecavir, and tenofovir.
  • Nucleoside and nucleotide therapies, entecavir and tenofovir are successful in reducing viral load, but HBeAg seroconversion and HBsAg loss rates are much lower than those obtained with IFN ⁇ treatment. Similar other therapies are also used, including lamivudine (3TC), belbivudine (LdT), and adefovir, but overall for nucleoside/nucleotide therapies the development of resistance limits the therapeutic effect.
  • HCMV human cytomegalovirus
  • DNA linear double-stranded deoxyribonucleic acid
  • capsid surrounded by a tegument and wrapped in a lipid bilayer carrying glycoprotein spikes on its surface.
  • HCMV retains the properties of incubation and reactivation.
  • HCMV has the ability to infect and hide in many cells.
  • HCMV infections are asymptomatic or very mild with some nonspecific symptoms such as fatigue, malaise, moderate fever, lymphadenopathy, hepatomegaly, or a slight increase in liver enzymes.
  • heterotrophic-negative mononucleosis was previously observed in approximately 10% of healthy individuals.
  • New strategies are also required for HCMV treatment.
  • TENT4A/B is involved in the mixed tailing of viral RNA, more specifically mRNA, and helps to inhibit the degradation of viral mRNA in host cells.
  • the present invention was completed by finding that it is possible to promote diadenylation of viral RNA by inhibiting mixed tailing, thereby promoting rapid degradation of viral RNA. Was done.
  • an object of the present invention is to provide a pharmaceutical composition for preventing viral infection or treating viral infection.
  • Another object of the present invention is to provide a method for screening a pharmaceutical composition for preventing viral infection or treating viral infection.
  • Another object of the present invention is to provide a method for producing virus resistant cells.
  • Another object of the present invention is to provide a method for stabilizing RNA sequences.
  • the present invention relates to a pharmaceutical composition for preventing viral infection or treating viral infection, comprising any one or more inhibitors of TENT4A and TENT4B involved in mixed tailing of viral RNA, the The inhibitor is an siRNA or shRNA that inhibits the expression of any one or more of TENT4A and TENT4B, or an antibody or antigen-binding fragment thereof that inhibits the activity of any one or more of TENT4A and TENT4B.
  • TENT4A/B is involved in the mixed tailing of viral RNA, more specifically mRNA, and helps to inhibit the degradation of viral mRNA in host cells.
  • TENT4A/B expression and activity of (subject) it was found that by inhibiting mixed tailing, diadenylation of viral RNA can be promoted, and rapid degradation of viral RNA can be promoted.
  • RNA tailing (adding non-templated nucleotides at the 3'end) is the most extensive and conserved type of RNA modification.
  • Noncanonical poly(A) polymerases also known as terminal nucleotidyltransferases (TENT), regulate maturation, stability, and activity by incorporating nucleotides at the 3'end of RNA after transcription.
  • TENT terminal nucleotidyltransferases
  • TAIL-seq for searching the RNA 3'end and measuring the poly(A) tail length.
  • noncanonical tailing events such as uridylation and guanylation on vertebrate mRNAs.
  • Terminal freedylyltransferases (TUT4 and TUT7) freedylated didenylated poly(A) tails (shorter than -25 nucleotides) after PABPC removal.
  • U tails in particular oligo-U tails, promote mRNA disruption.
  • guanylation occurs for long poly(A) tails, protecting mRNAs from rapid diadenylation.
  • the two related enzymes TENT4A (also known as PAPD7 or TUT5) and TENT4B (also known as PAPD5 or TUT3) are intermittent non-adenosine residues (most commonly guanosine) that extend the mRNA poly(A) tail to a'mixed tail. tails)'. This impure poly(A) tail interferes with the diadenylation by the CCR4-NOT(CNOT) complex and improves the stability of the mRNA.
  • Mixed tailing has been proposed to act as a new type of post-transcriptional regulation.
  • the term “mixed tailing” refers to viral RNA, more specifically, in which one or more sequences of the poly(A) tail sequence portion of viral mRNA are guanylated or freedylated, and thus other nucleic acids such as guanine or uridine. It means the action of being substituted by sequence.
  • the above-described “mixed tailing” may be simply described as “mixed tailing”, “tailing”, and the like.
  • TENT4A and TENT4B of the present invention are noncanonical poly(A) polymerases belonging to terminal nucleotidyltransferases, the inventors of the present invention that TENT4A and TENT4B are involved in the mixed tailing of the poly(A) tail of viral mRNA. It was first identified.
  • TENT4A and TENT4B of the present invention are derived from a subject at risk of viral infection or in a virus-infected state.
  • the present inventors have found that viral mRNA infected into a subject can be induced by mixed tailing by TENT4A and TENT4B derived from the subject.
  • the virus of the present invention is a virus in which RNA tailing is caused by at least one of TENT4A and TENT4B. More specifically, the present inventors have found that a post-transcriptional regulatory element (PRE), more specifically a CNGGN-type pentaloop, plays an important role for TENT4A and TENT4B dependent regulation. In addition, the present inventors have found that both HBV and HCMV act in a similar manner using pentaloop to recruit TENT4A/B and cause mixed tailing.
  • PRE post-transcriptional regulatory element
  • the HBV and HCMV of the present invention have very different life cycles and tissue specificities, and these two distinct viruses (a virus belonging to the Hepadnaviridae and a virus belonging to the Herpesviridae) use the same strategy for the benefit of gene expression.
  • this convergent evolution and the simplicity of this cis- acting element show that this mechanism can be used in other viruses.
  • the virus of the present invention is a virus belonging to the family Hepadnavirus or the family Herpesvirus.
  • the virus belonging to the Hepadnavirus family of the present invention is Hepatitis B virus, Ground Squirrel Hepatitis B, Woodchuck Hepatitis B virus (Woodchuck Hepatitis B), duck hepatitis B virus (Duck hepatitis B), and Heron hepatitis B virus (Heron Hepatitis B) any one selected from the group.
  • the viruses belonging to the herpesvirus family of the present invention are Iltovirus, Mardivirus, Scutavirus, Simplexvirus, and Varicellovirus. , Cytomegalovirus, Muromegalovirus, Proboscivirus, Roseolovirus, Lymphocryptovirus, Macavirus, Percavirus, and Radino It is any one selected from the group consisting of viruses (Rhadinovirus).
  • siRNA used in the present invention refers to a short double-stranded RNA capable of inducing RNAi (RNA interference) phenomenon through cleavage of a specific mRNA. It consists of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto. Since siRNA can inhibit the expression of a target gene, it can be provided as an efficient gene knockdown method or as a method of gene therapy.
  • RNAi RNA interference
  • siRNA is not limited to a complete pair of double-stranded RNA portions that pair with each other, and is not paired by mismatch (the corresponding base is not complementary), bulge (there is no base corresponding to one chain), etc. May contain parts that do not.
  • the total length is 10 to 100 bases, preferably 15 to 80 bases, more preferably 20 to 70 bases.
  • the siRNA terminal structure can be either a blunt end or a cohesive end as long as the expression of the target gene can be suppressed by the RNAi effect.
  • the adhesive end structure can be a structure that protrudes at the 3'end and a structure protrudes at the 5'end. The number of protruding bases is not limited.
  • siRNA is a low-molecular RNA (e.g., a natural RNA molecule such as tRNA, rRNA, viral RNA, or an artificial RNA molecule) in the protruding portion of one end in the range that can maintain the effect of suppressing the expression of the target gene. It may include.
  • the siRNA terminal structure need not have a cleavage structure on both sides, and may be a step loop type structure in which the general terminal portion of the double-stranded RNA is connected by a linker RNA.
  • the siRNA used in the present invention is itself a complete form having polynucleotide pairing, that is, a form that is introduced into cells through two transformation processes by directly synthesizing siRNA in a test tube, or a form to have such a form after being administered in vivo.
  • Single-stranded oligonucleotide fragments and their reverse complements can be derived from single-stranded polynucleotides separated by spacers, for example siRNA expression vectors or PCR-induced siRNAs prepared so that siRNA is expressed in cells
  • the expression cassette may be introduced into cells through a transformation or infection process. The determination of how siRNA is prepared and introduced into cells or animals can vary depending on the purpose and the cellular biological function of the target gene product.
  • shRNA used in the present invention is to overcome the shortcomings such as the high cost of siRNA biosynthesis and short-term maintenance of the RNA interference effect due to low cell transfection efficiency.
  • Adenovirus and lenti from the promoter of RNA polymerase III Virus and plasmid expression vector systems can be used to introduce and express these shRNAs, and these shRNAs are converted into siRNAs having an accurate structure by siRNA processing enzymes (Dicer or Rnase III) present in the cells to silence target genes. It is widely known to induce.
  • the siRNA of the present invention is exemplarily shown in Table 1, but is not limited thereto.
  • Antibodies that inhibit the activity of any one or more of TENT4A and TENT4B of the present invention include monoclonal antibodies and chimeric antibodies, humanized antibodies, and human antibodies. In addition to novel antibodies, antibodies already known in the art are also Can be included.
  • the antibody includes a complete form having a full length of two heavy chains and two light chains as long as it specifically binds to TENT4A and/or TENT4B, as well as functional fragments of antibody molecules.
  • the functional fragment of an antibody molecule refers to a fragment that has at least an antigen-binding function, and includes Fab, F(ab'), F(ab')2, and Fv.
  • Anti-TENT4A antibody invitrogen, PA5-61302
  • anti-TENT4A antibody Align Antibodies, HPA045487
  • anti-TENT4B antibody invitrogen, PA5-60177
  • anti-TENT4B antibody Atlas Antibodies, HPA042968
  • anti-TENT4B mouse antibody las Antibodies, HPA042968
  • the content of the active ingredient in the composition can be appropriately adjusted according to the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9 based on the total weight of the composition. It may be included in% by weight, but is not limited thereto.
  • the content ratio is a value based on the amount of dry solvent removed.
  • the pharmaceutical composition may further include suitable carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions, and powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. It can be formulated and used in the form of an oral dosage form, external preparation, suppository, or sterile injectable solution.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations may contain at least one or more excipients and/or lubricants.
  • Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, syrups, etc.In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweetening agents, fragrances, and preservatives may be included. have.
  • Formulations for parenteral administration may include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories, and the like.
  • the preferred dosage of the pharmaceutical composition varies depending on the condition and weight of the patient, the degree of disease, the form of the drug, the route and duration of administration, but may be appropriately selected by those skilled in the art.
  • the dosage of the composition of the present invention is preferably 0.1 mg/kg to 100 mg/kg per day based on the active ingredient, but is not limited thereto. Administration may be administered once a day, or may be divided several times.
  • the composition of the present invention can be administered to animals, preferably mammals, including humans, by various routes. All modes of administration can be expected, for example, it can be administered orally, intravenously, intramuscularly, or by subcutaneous injection.
  • the pharmaceutical dosage form of the composition of the present invention may be used in the form of a pharmaceutically acceptable salt of the active ingredient, and may be used alone or in combination with other pharmaceutically active compounds as well as in an appropriate set.
  • the present invention provides a method for screening a pharmaceutical composition for preventing viral infection or treating viral infection, comprising the following steps:
  • RNA tailing is determined by the number of times the adenine contained in the poly(A) tail is replaced with another nucleic acid such as guanine or uridine by guanylation or uridylation.
  • Steps (a) and (b) in the present invention can be reversed in any order of execution.
  • the sample When a sample is treated with a virus-infected host cell to inhibit mixed tailing, the sample can be selected as an effective drug candidate.
  • the drug screening method of the present invention has characteristics in common with the pharmaceutical composition, which is another aspect of the present invention, in that it uses the mixed tailing operation principle by TENT4A/B, the detailed description of the pharmaceutical composition is used. And, in order to avoid excessive complexity of the description of the present specification, duplicate descriptions are omitted.
  • the present invention provides a method for producing virus-resistant cells comprising knock-out the expression of any one or more of TENT4A and TENT4B in cells isolated from a living body.
  • the knockout of the present invention can be introduced by variously utilizing various conventionally known gene editing techniques, and although the CRISPR-Cas genome editing method was used in the examples herein (see Example 6), it is not limited thereto.
  • the present invention provides a method for stabilizing an RNA sequence comprising inserting a stem-loop sequence comprising a pentaloop structure consisting of an amino acid sequence represented by the following general formula into a target RNA sequence:
  • Each of N is independently any one selected from adenosine (A) and uracil (U).
  • stem-loop structure refers to a linkage between base pairs that occurs in single-stranded DNA or RNA. This structure is also referred to as a hairpin or hairpin structure. Occurs when the base pairs are complementary to each other when two regions of a strand read in opposite directions.
  • FIG. 12B An example of a stem-loop structure is illustrated in FIG. 12B, but is not limited thereto.
  • penta-loop refers to a single-stranded sequence site in which 5 bases exist at a linking site that does not form a bond between base pairs in a stem-loop structure.
  • the stem-loop structure of the present invention includes a penta-loop structure, and an exemplary diagram is shown in FIG. 13.
  • the stem-loop structure of the present invention includes a bond between 2-15 base pairs. More specifically, for example, 2-14 base pair bond, 2-13 base pair bond, 2-12 base pair bond, 2-11 base pair bond, 2-10 base pair bond, 3-10 base pair bond, 3-9 base pair bond. However, it is not limited thereto.
  • the bond between base pairs may be an adenine-uracil bond or a cytosine-guanine bond, and the type of bond is not limited.
  • the frequency of inducing mixed tailing of the target RNA sequence using TENT4A/B can be increased, and the corresponding RNA sequence can be stabilized.
  • FIG. 13 A specific embodiment of the present invention is shown in FIG. 13.
  • the present invention provides a pharmaceutical composition for preventing viral infection or treating viral infection.
  • the present invention provides a method for screening a pharmaceutical composition for preventing viral infection or treating viral infection.
  • the present invention provides a method for producing virus resistant cells.
  • This eradication provides a method of stabilizing the RNA sequence by introduction of a predetermined stem-loop structure sequence.
  • RNA 1 shows a broad mixed tail of viral RNA.
  • c Total poly(A) tail length distribution of cellular (grey) and HBV (yellow) mRNA. The median value is indicated by a vertical dotted line, and the median length is indicated in parentheses.
  • d Total poly(A) tail length distribution of cellular (grey), HCMV (yellow) and VRNA2.7 (orange) RNA. The median value is indicated by a vertical dotted line, and the median length is indicated in parentheses.
  • HBV RNA is a major mRNA substrate of TENT4 through PRE of HBV.
  • a Normalized reading range of the fCLIP-seq library across the HBV genome (NCBI U95551.1). The HBV's PRE area is highlighted in yellow. HBV transcripts and their respective coding sequence regions are shown below for reference. Input and NMG libraries were used as negative controls.
  • b Scatter plot of the abundance (abundance, x axis) and enrichment score (y axis) of the fCLIP-seq peak cluster. HBV PRE is indicated by a red dot. In this analysis, a size-matched input library was used as a negative control.
  • FIG. 3 is a diagram showing that the stem-loop structure of PRE is essential, but may not be sufficient for TENT4-dependent RNA tailing of HBV mRNA.
  • a Schematic diagram of the Firefly luciferase reporter construct carrying mutations and subregions of PRE in 3'UTR. Blue, La-binding motif; Green, stem-loop alpha; And red asterisk, the area of the point mutation.
  • Luciferase activity of both Renilla and control vectors were used for normalization. *P ⁇ 0.01, **P ⁇ 0.001; Bilateral t - test (two-sided t -test).
  • c Distribution of the poly(A) tail length of the reporter RNA measured by Hire-PAT analysis. Reporter constructs containing the PRE ⁇ and PRE ⁇ sequences were transfected with HEK293T cells after TENT4 depletion.
  • g Stem-loop structure of HBV PRE, mutant HBV PRE and WPRE.
  • Figure 4 is the stem of the HCMV RNA2.7-loop structure TENT4- cis causing the dependent control - are diagrams showing that the action (cis -acting) RNA element.
  • b Schematic diagram of the Firefly luciferase reporter construct carrying subregions and mutations of HCMV RNA2.7 in the 3'UTR .
  • the stem-loop structure and mutations of HCMV RNA2.7 are shown on the left.
  • FRG short. ce, the reporter's Firefly luciferase activity in parental and TENT4 KO cells. Data are expressed as mean ⁇ sem.
  • RNA2.7 3 independent experiments
  • c partial deletion mutation of the fragments of RNA2.7 1 (1-513)
  • n 3 independent experiments
  • d partial deletion mutation of the fragments of RNA2.7 1 (1-513)
  • n 3 independent experiments
  • Luciferase activity of both Renilla and control vectors were used for normalization. *P ⁇ 0.05, **P ⁇ 0.01; Two-sided student's t -test.
  • FIG. 5 is a diagram showing that the SAM domain-containing protein, including ZCCHC14, binds to the stem-loop structure and regulates HBV mRNA.
  • LFQ label-free quantification
  • Saccharomyces cerevisiae Sc
  • Schizosaccharomyces pombe Sp
  • Candida albicans Ca
  • C. elegans C. elegans
  • Dm Drosophila melanogaster
  • Danio rerio Dr
  • Xenopus laevis Xl
  • Mus musculus Mm
  • Homo sapiens Hs
  • the asterisk indicates manual gene name assignment based on the phylogenetic tree. UniProt IDs are listed in the Methods section. Bottom, domain structure of three human proteins with SAM domains. Orange, SAM domain; Purple, CCHC zinc finger (ZnF) domain.
  • c Pull-down of biotinylated SL2.7 from HEK293T cells after Western blot using the indicated antibodies. Asterisks indicate cross-reaction bands.
  • FIG. 6 is a diagram showing that cytoplasmic ZCCHC14 recruits TENT4 to protect RNA with a stem-loop structure.
  • a The fraction of guanylated tails of HBV mRNA was calculated for mRNAs with poly(A) tail lengths of 25 nt or more in ZBHC14-depleted HepG2.2.15 cells.
  • b Total poly(A) tail length distribution of HBV mRNA in control (gray) and ZCCHC14-depleted HepG2.2.15 cells (red). The median value is indicated by a vertical dotted line, and the median value is indicated in parentheses.
  • HBV mRNA is a highly mixed tail (G: guanylation U: uridylation, C: cytidylation) in HepG2.2.15 cells.
  • the fraction of each variant includes its corresponding terminal and internal variants.
  • HCMV RNA is also a highly mixed tail in HCMV-infected HFF cells.
  • HCMV RNA 2.7 VRNA2.7
  • c Gene-level analysis of guanylated tails of cellular (grey) and viral (yellow) mRNA in HCMV-infected HFF cells.
  • d siRNA knockdown confirmation by RT-qPCR.
  • e Reduction in the fraction of mixed tails of HBV mRNA in TENT4-depleted HepG2.2.15 cells.
  • g reduction in the fraction of mixed tails of HCMV RNA2.7 in TENT4-depleted HCMV-infected HFF cells.
  • HBV mRNA shows shorter poly(A) tail lengths in TENT4-depleted HepG2.2.15 cells. The median value is indicated by a vertical dotted line and is shown in parentheses.
  • i Total poly(A) tail length distribution of viral mRNA after TENT4 depletion in HCMV-infected HFF cells.
  • j Poly(A) tail length distribution of HCMV RNA2.7 after TENT4 depletion.
  • k HBV transcript and its corresponding CDS region are shown. Bars indicate the location of the RT-qPCR amplicon (#1-3).
  • l Tail modification of HBV mRNA over poly(A) tail length in TENT4-depleted HepG2.2.15 cells.
  • FIG. 8 is a diagram showing the results of analysis and confirmation of TENT4A/B and HBV mRNA interaction.
  • a The TENT4B-binding RNA fragment is again enriched in the PRE region of HBV (highlighted in yellow). Standardized read coverage of the fCLIP-seq library across the HBV genome (NCBI: U95551.1). The X-axis scale is the same as in Fig. 2A.
  • FIG. 9 is a diagram showing the results of confirming the TENT4-dependent control of the PRE reporter.
  • a Knockout confirmation by Western blotting. GAPDH was used as a loading control.
  • c siRNA knockdown confirmation by western blotting in HEK293T cells. GAPDH was used as a loading control.
  • the mRNA levels of both Renilla and control vectors were used for normalization. Means were calculated and error bars represent SEM. *P ⁇ 0.05, **P ⁇ 0.01; Two-sided t test.
  • the data for the uncropped blots for panels a, c and e and the graphs in b, d, and f are available as source data.
  • RNA2.7 reporter 10 shows the results of confirming the TENT4-dependent regulation of the RNA2.7 reporter.
  • a Immunoprecipitation with anti-TENT4A was confirmed by Western blotting in RNA2.7 -transfected HEK293T cells. Normal mouse IgG (NMG) was used as a negative control. The RNA2.7 transcript is shown with a bar indicating the location of the RT-qPCR amplicon.
  • FIG. 12 is a diagram showing the results of confirming ZCCHC14 knockdown, stem-loop-dependent tail regulation, and immunoprecipitation.
  • a siRNA knockdown confirmation by western blotting in ZCCHC14-depleted HEK293T cells. GAPDH was used as a loading control. Dotted lines represent discontinuous lanes in the same gel.
  • b Stem-loop structure of WPRE ⁇ and its respective mutations.
  • c Distribution of the poly(A) tail length of the reporter RNA measured by Hire-PAT analysis. Reporter constructs were transfected into HEK293T cells after ZCCHC14 depletion.
  • d Immunoprecipitation using anti-ZCCHC14 was confirmed by Western blotting in HepG2.2.15 cells.
  • Normal rabbit IgG (NRG) was used as a negative control.
  • Western blotting after immunoprecipitation with anti-TENT4A and anti-TENT4B was used to measure the physical interaction between TENT4A/B and ZCCHC14 in HepG2.2.15 and primary HFF cells.
  • Cell extracts were treated with RNase A.
  • Normal mouse IgG (NMG) was used as a negative control.
  • An asterisk indicates a cross-reacting band. The uncropped blots for panels a and d-e are available as source data.
  • FIG. 13 shows a stem-loop structure including a pentaloop.
  • the method of inserting the stem-loop structure of the present invention into the target RNA sequence may be performed by various conventionally known methods, and is not particularly limited.
  • TAIL-seq was performed as previously known [3].
  • DNaseI Takara, 2270A treated total RNA (>200 nt)
  • Ribo-Zero kit Epicentre, MRZH11124 (discontinued) for primary HFF library or Illumina
  • the rRNA-depleted RNA was ligated to a 3'adapter and partially fragmented by RNase T1 (Ambion).
  • RNA was pulled down with streptavidin beads (Invitrogen), 5'phosphorylated, and purified by 6% urea-PAGE gel (500-1,000 nt). The purified RNA was ligated to a 5'adapter, reverse transcribed, and amplified by PCR.
  • the library was sequenced by paired-end run (51 ⁇ 251 cycles) on the Illumina platform (MiSeq) with PhiX control library v.3 (Illumina) and Spike-In mixture.
  • TAIL-seq sequencing data was deposited in the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database using accession number GSE146600. TAIL-seq analysis was performed using Tailseeker v.3.1.5[9].
  • Read 1 was used for gene identification, and Read 2 was used to detect the 3'end modification and measure the length of the poly (A) tail.
  • Read 2 was used to detect the 3'end modification and measure the length of the poly (A) tail.
  • Read 1 was mapped to the human genome GRCh38 with STAR 2.5.2b [50] and the HBV genome NCBI U95551.1 or HCMV genome NCBI GU937742.2 with bowtie2.2.6 [51].
  • TAIL-seq fragments with a poly(A) tail length of 25 nt or more were used as before [6].
  • fCLIP-seq was performed as previously described with minor adjustments [16, 52]. Briefly, HepG2.2.15 cells on two 150 mm dishes were crosslinked with 0.1% paraformaldehyde (Pierce, 28906), collected and lysed. 15 ⁇ g of each antibody (NMG, Santa Cruz, sc-2025; TENT4A, laboratory manufactured; TENT4B, laboratory manufactured) was added to Protein A and G Sepharose beads (1:1 mixture, total 20 ⁇ l, GE Healthcare, 17-5138). -01 and 17-0618-01 respectively). The lysate was incubated with antibody-conjugated beads, RNA was purified from the eluent, and then DNaseI treatment and washing were performed.
  • RNA was depleted twice by the Ribo-Zero kit (Illumina, TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat, 20020596). rRNA-depleted RNA was ligated to a 3'adapter and purified by 6% urea-PAGE gel (80-500 nt, corresponding to 50-470 nt RNA fragmented by sonication), followed by 5'phosphorylation , 5'adapter ligation, reverse transcription and PCR amplification were performed.
  • fCLIP-seq sequencing data was stored in the NCBI GEO database under accession number GSE146597.
  • the enrichment score of the peak cluster was calculated by the log 2 ratio of the readings of the TENT4 fCLIP-seq library and the NMG library.
  • the input library was used as a negative control for this assay [55].
  • the Hodges-Lehmann estimate for the HBV genome was used. Specifically, given an HBV genome of length n, the median of the next set is calculated.
  • X i and X j are raw read coverage at positions i and j, respectively.
  • the raw read coverage was then normalized with this Hodges-Lehmann estimate and visualized using the ggplot2 R package.
  • Example 3 Cell culture, transfection and actinomycin D treatment
  • HeLaT was derived from HeLa (provided by Seoul National University C.-H. Chung) with a null mutation in the TUT4 gene.
  • HeLaT and HEK293T (provided from Seoul National University S. Kim) cells were certified by ATCC (STR profiling).
  • HepG2.2.15, HeLaT and HEK293T cells were grown in DMEM (Welgene, LM 001-05) containing 10% FBS (Welgene, S001-01).
  • Primary HFF (ATCC SCRC-1041) cells were grown in DMEM (HyClone) containing 10% FBS (HyClone), GlutaMAX-1 (Gibco) and penicillin-streptomycin (Gibco). Prior to transfection, primary HFF was grown in antibiotic-free medium.
  • HEK293T cells were transfected with the RNA2.7-expressing pCK vector for RNA immunoprecipitation by Lipofectamine 3000 on day 0 and collected on day 2.
  • Primary HFF cells were transfected with 20 nM siRNA by DharmaFECT 1 (Dharmacon) on days 0 and 2, and collected on day 5.
  • the sequence information of siRNA is presented in Table 1.
  • siRNAs (sense strand) siCont only for primary HFF CCUACGCCACCAAUUUCGU siCont AccuTargetTM Negative Control siRNA from Bioneer Inc (Seoul, South Korea) siTENT4A-1 CUACGGUACCAAUAAUAAA siTENT4A-2 GGAAGAAUCAUCAAAGUAA siTENT4A-3 CCAAACAGAGACGCCGAAA siTENT4A-4 GCGAAUAGCCACAUGCAAU siTENT4A only for HepG2.2.15 ON-TARGETplus SMART pool (Dharmacon) siTENT4B-1 GGACGACACUUCAAUUAUU siTENT4B-2 GGCCUUUGAUUAUGCCUAC siTENT4B-3 GCGCUGACGUCCAGAUAUU siTENT4B-4 CCUAUUGCAGAGGGACCUU siZCCHC14-1 GCAUUUUAUGUGGAGCGAA siZCCHC14-2 CCUUCUCACGUGUUGAAAA siZCCHC14
  • Infectious HCMV particles were prepared by transfecting HCMV Toledo BAC DNA (provided from Princeton University T. Shenk) into primary HFF cells by electroporation (Invitrogen, Neon). When 100% cytopathic effect was observed, the cell culture supernatant was collected, centrifuged to remove cell debris and stored as 1 ml aliquots at -80°C. To titrate the virus stock, the diluted virus stock was inoculated for 1 hour into the primary HFF grown on a cover glass and fixed with 3.7% formaldehyde 24 hours after the inoculation.
  • HCMV IE1 antibody MAB810R; Millipore
  • FITC- Mounted with conjugated anti-mouse antibody 115-095-146; Jackson Laboratories
  • H1200 Vector Laboratory
  • the Multiplicity of infection was determined by counting the number of HCMV IE1 positive cells and calculating the ratio of IE1-positive cells to total cells.
  • primary HFF cells were incubated with HCMV (MOI, 2) diluted in serum-free DMEM for 1 hour, washed with PBS, and cultured in DMEM for further culture.
  • the wild-type TENT4A and TENT4B isoforms described above (792 and 666 aa, respectively) [6] were used. Point mutations for the catalytic killing mutants were introduced (D352A for TENT4A and D326A for TENT4B, respectively).
  • PRE(1,154-1,687 bp), PRE ⁇ (1,154-1,351 bp), PRE ⁇ (1,352-1,687 bp), ⁇ 1 (1,276-1,351 bp) and ⁇ 2 (1,154-1,275 bp) are HepG2.
  • WPRE (1,095-1,670 bp), W ⁇ +W ⁇ (1,095-1,507 bp), W ⁇ +W ⁇ (1,300-1,670 bp), W ⁇ (1,093-1,299 bp), W ⁇ (1,300-1,507 bp), W ⁇ (1,508-1,670 bp) was amplified from the pLenti-CMV vector (Addgene, 17492) and introduced into the 3'UTR of firefly luciferase in the pmirGLO-3Xmir-1 vector.
  • the point mutation of WPRE ⁇ to CNGGN pentaloop was designed in a similar manner to the PRE mutant.
  • FRG1 (1-513 bp), FRG2 (414-913 bp), FRG3 (814-1,313 bp), FRG4 (1,214-1,713 bp), FRG5 (1,614-2,113 bp), FRG6 (2,014- 2,513 bp), 1 ⁇ A(1-513 bp, ⁇ 1-100 bp), 1 ⁇ B(1-513 bp, ⁇ 101-200 bp), 1 ⁇ C(1-513 bp, ⁇ 201-300 bp), 1 ⁇ D(1- 513 bp, ⁇ 301-400 bp), 1 ⁇ E (1-513 bp, ⁇ 401-513 bp), 1D (301-400 bp), 1E (401-513 bp) and SL2.7 (414-463 bp) are HCMV infected Amplified from the primary HFF cDNA and introduced into the 3'UTR region in the pmirGLO-3Xmir-1 vector
  • RNA2.7 (1-2,513 bp) was amplified from pmirGLO-3Xmir-1 vector and subcloned into pCK vector.
  • T7 endonuclease I (NEB, M0302) was used instead of Surveyor nuclease.
  • 6E4 HeLaT cells on a 24-well plate were first prepared for TENT4A, with a single-guide RNA (agccacgttgtgcttccgcg, PAM sequence is GGG) with 300 ng pSpCas9(BB)-2A-GFP-px458 plasmid (Addgene no. 48138) with Metafectene (Metafectene). Biontex, T020) was used for transfection.
  • HeLaT parental cells are derived from HeLa and contain a null mutation in the TUT4 gene. After single cell screening and Sanger sequencing to confirm knockout, the maternal and altered genomic sequences are listed in Table 2, and the inserted sequences are indicated in bold and underlined.
  • TENT4A knockout cell for the in TENT4B TENT4B sgRNA was removed in addition to the (gacatcgacctagtggtgtt, PAM sequence TGG). Altered genomic sequences are also listed in Table 2, and inserted and deleted sequences are indicated by red and dotted lines, respectively.
  • mice were immunized with TENT4A antigen (126-571aa from 792aa isoform, NCBI NP_008930.2) or TENT4B antigen (106-533 aa from 666aa isoform, NCBI XP_006721308.1) and killed.
  • TENT4A antigen 126-571aa from 792aa isoform, NCBI NP_008930.2
  • TENT4B antigen 106-533 aa from 666aa isoform, NCBI XP_006721308.1
  • the collected splenocytes were fused with Sp2/O myeloma, and hybridoma cells producing high affinity antibodies were selected. After intraperitoneal injection of hybridoma cells into mice, ascites were obtained (Youngin Frontier Inc.) and used for immunoprecipitation experiments.
  • HepG2.2.15 cells in RIPA buffer (20mM Tris-HCl (pH 7.5), 150mM NaCl, 1mM EDTA, 10% NP-40 (Sigma, 74385), 1% sodium deoxycholate (Sigma, D6750), 1% SDS ( Ambion, AM9823)).
  • Other cells were lysed in buffer D (200mM KCl, 10mM Tris-HCl (pH 8.0), 0.2mM EDTA, 0.1% Triton X-100 (Promega, H5142). Approximately 60 ⁇ g of lysate was lysed in a ladder (Thermo, 26616 and 26619).
  • Chemiluminescence was performed with West Pico or Femto Luminol reagent (Thermo) and signals were detected by ChemiDoc XRS+ System (BioRad) Anti-TENT4A(1:500, Invitrogen, PA5-61302;1:250-500, Atlas Antibodies, HPA045487), anti-TENT4B (1:500, Invitrogen, PA5-60177; 1:500, Atlas Antibodies, HPA042968; 1:500, laboratory made), anti-ZCCHC14 (1:1,000-2,000, Bethyl Laboratories, A303 -096A), anti-GAPDH (1:1,000-2,000, Santa Cruz, sc32233), anti-SAMD4B (1:500, Invitrogen, PA5-53490), anti-GM130 (1:500, BD Bioscience, 610822) and anti -Histone H3 (1:2,000, Cell signaling, 4499) was used as the primary antibody.
  • TENT4A and TENT4B immunoprecipitation using HepG2.2.15 cells cells from one 150 mm dish were collected and lysis buffer (20 mM HEPES (pH 7.0-7.6) (Sigma, H0887), 4% NP-40, 100 Dissolved on ice with mM KCl, 0.1 mM EDTA, 10% glycerol, 1 mM DTT, 20 Uml -1 RNase inhibitor (Ambion, AM2696), 1x protease inhibitor (Calbiochem, 535140) and centrifuged, 0.375 ⁇ g each of Antibodies (NMG, Santa Cruz, sc-2025; anti-TENT4A, laboratory manufactured; anti-TENT4B, laboratory manufactured) were conjugated to Protein A and G Sepharose beads (1:1 mixture, total 10 ⁇ l).
  • lysis buffer 20 mM HEPES (pH 7.0-7.6) (Sigma, H0887), 4% NP-40, 100 Dissolved on ice with mM
  • wash buffer the same lysis buffer other than 2% NP-40
  • 10 ng of firefly luciferase mRNA as spike-in used for normalization was added to the sample, followed by RNA.
  • RNase A was added to the lysate to have a final concentration of 0.2-0.3 ⁇ g/ ⁇ l.
  • cytoplasmic extracts from 1 and 1/3 150 mm dishes of HeLaT cells were obtained by extracellular fractionation as described below, followed by 18 ⁇ g of each antibody (NMG, anti- TENT4A, anti-TENT4B) was used for immunoprecipitation.
  • 1E5 HeLaT cells on 24-well plates were transfected with 200 ng pmirGLO plasmid for luciferase reporter analysis with Lipofectamine 3000 on day 0 and collected on day 2.
  • 1.5E5 HeLaT blasts and TENT4 KO cells on 24-well plates were 0 with Lipofectamine 3000 with 20 ng of null vector or TENT4A/B (1:1 mix) plasmid with 50 ng of pmirGLO plasmid. Transfection was done on day and collected on day 2.
  • HEK293T cells were transfected with 100 nM siRNA on day 0, and 1.5E5 cells on 24-well plates were further transfected with 100 nM siRNA on day 2 with 100 or 200 ng of pmirGLO plasmid with Lipofectamine 3000. . HEK293T cells were collected on day 4. For luciferase assay, cells were lysed and analyzed with a dual-luciferase reporter assay system (Promega) according to the manufacturer's instructions.
  • 2E6 HeLaT cells were collected and washed with cold PBS.
  • cytoplasmic lysis buffer 0.2 ⁇ g/ ⁇ l digitonin (Sigma, D141), 150 mM NaCl, 50 mM HEPES (pH 7.0-7.6), 0.1 mM EDTA, 1 mM DTT, 20 U ml-1 RNase inhibitor, 1x protease inhibitor, 1x phosphatase inhibitor).
  • cytoplasmic lysis buffer 0.2 ⁇ g/ ⁇ l digitonin (Sigma, D141), 150 mM NaCl, 50 mM HEPES (pH 7.0-7.6), 0.1 mM EDTA, 1 mM DTT, 20 U ml-1 RNase inhibitor, 1x protease inhibitor, 1x phosphatase inhibitor.
  • the supernatant was collected and used as a cytoplasmic fraction at 4° C. for 5 minutes.
  • an intracellular protein fractionation kit (Thermo Scientific, 78
  • RNA-binding SAM domains of Drosophila Smaug (UniProtKB Q23972) and human SAMD4A/B (UniProtKB Q9UPU9 and Q5PRF9) used UniProt BLAST with an E value threshold of 10. It was searched and not gapped [58].
  • Protein sequences used for analysis UniProtKB Q08831 (S. cerevisiae), UniProtKB Q9P6R7 (S. pombe), UniProtKB Q5AI80 (C. albicans), UniProtKB O76699 (C. elegans), UniProtKB Q23972 (D.
  • Phylogenetic trees were reconstructed using PhyML v.3.1/3.0 aLRT[60] and visualized using TreeDyn v.198.3[61] on the Phylogeny.fr platform [62]. The edges and leaves of the reconstructed phylogenetic tree were readjusted and manually rooted for visualization.
  • RNA2.7 stem-loop (SL2.7) and stem-loop mutant (SL2.7 mutation) of 3'TEG (tetraethylene glycol spacer)-biotinylated RNA were synthesized (Bioneer Inc.), and the sequence is shown in Table 5 Described in.
  • RNA oligos for pull-down mass SL-2.7 CACCGCGUUAUCCAUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCGG[Biotin-TEG] SL-2.7 mutant CACCGCGUUAUCCAUUCCUCGUAGGAUUUUCCUGGGGAACGGGUCGGCGG[Biotin-TEG]
  • Streptavidin M-270 beads for set 1 (Thermo Scientific, 65305) and streptavidin magnetic beads for set 2 (NEB, S1420S) were added to the pull-down buffer (50 mM Tris (pH 8.0), 150 mM NaCl, 5% glycerol, Washed twice with 1 mM DTT, 100 U ml-1 RNase inhibitor, 1x protease inhibitor). Subsequently, 10 ⁇ g of the oligonucleotide of SL2.7 or a mutant thereof was conjugated to streptavidin beads in pull-down buffer overnight at 4° C., followed by washing with pull-down buffer.
  • the pull-down buffer 50 mM Tris (pH 8.0), 150 mM NaCl, 5% glycerol, Washed twice with 1 mM DTT, 100 U ml-1 RNase inhibitor, 1x protease inhibitor.
  • HEK293T cells from four 150 mm dishes were collected, lysed with 1.5 ml pull-down buffer, and sonicated. After centrifugation, the supernatant was incubated with beads and washed buffer No. 1 (50mM Tris (pH 8.0), 300mM NaCl, 5% glycerol), wash buffer number. Washed with 2 (50 mM Tris (pH 8.0), 150 mM NaCl, 5% glycerol, 0.1% Triton X-100) and pulldown buffer. For elution, the beads were incubated in a heat mixer at 65° C.
  • Example 17 Liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis
  • Immunoprecipitated protein samples containing SDS were subjected to filtration aid sample preparation digestion. Briefly, protein samples were first reduced and alkylated with denaturing ABC buffer (8 M urea in 50 mM ammonium bicarbonate (ABC)). The alkylated samples were placed on a pre-conditioned 30 kDa MWCO amicon filter (Millipore, UFC5030) and centrifuged at 14,000 g for 30 min. SDS was removed from the filter unit by performing continuous washing with 200 ⁇ l of 8M urea or 50mM ABC buffer and centrifuging at 14,000g for 15 minutes. The protein samples were then digested overnight at 37° C. with 2% (w/w) trypsin.
  • ABC buffer 8 M urea in 50 mM ammonium bicarbonate
  • the resulting peptide samples were subjected to C18 zipper tip cleaning (Millipore, Z720070) and LC-MS/MS analysis.
  • a self-packed long capillary column (internal diameter 100 cm ⁇ 75 ⁇ m) and trap column (internal diameter 3 cm ⁇ 150 ⁇ m) embedded with 3 ⁇ m Jupiter C18 particles (Phenomenex) were used for peptide separation.
  • Linear gradients ranging from 95% Solvent A (water with 0.1% formic acid) to 40% Solvent B (acetonitrile with 0.1% formic acid) for 100 min with a flow rate of 300 nl/min were analyzed by Orbitrap Fusion Lumos Mass Spectrometer (Thermo Scientific).
  • the mass spectrometry raw data file is in the human Uniprot database [58] (v.12/5/) in the default settings (20 or 6 ppm of precursor ion mass tolerance for each initial or main search, and 0.5 Da for intercept ion masses). 2018) was processed with MaxQuant (v.1.5.3.30) using MaxQuant's built-in Andromeda search engine [65]. The enzyme specificity was set to trypsin/P and a maximum of two missed cleavage was allowed. Cysteine carbamido methylation and methionine oxidation were chosen as fixed and variable modifications, respectively. 1% FDR was required at both protein and peptide levels.
  • Mass spectrometric proteomics data was stored in the ProteomeXchange consortium via PRIDE[66] partner repository with data set identifiers PXD018061 and 10.6019/PXD018061.
  • the results obtained from'bead only' and mutant constructs were considered as the technical background and customized statistical tests were designed to increase the number of protein spectra. .
  • the number of spectra identified for protein p from the SL2.7 construct is Np
  • the number from the background construct is Mp.
  • the statistical significance (or P value) of the enrichment was calculated:
  • N P is the total number of spectra
  • B (k; n, p) is n attempts with the probability of success of P. Is a binomial distribution with k successes at.
  • the P value was adjusted through the Benjamini-Hochberg method. Proteins with an adjusted P ⁇ 0.01 were considered statistically significant when using the technical background ('bead only' or mutant). Statistically significant proteins in either the Set 1 or Set 2 data sets were considered for subsequent protein strength analysis. The minimum non-zero intensity values in the data set were substituted to handle the missing values. The protein enrichment score was then calculated as the log 2 fold change in protein intensity of SL2.7 against the mutation data.
  • HBV and HCMV reverse the use of mixed tailing tools.
  • HepG2.2.15 cells integrated with HBV DNA and primary human foreskin fibroblasts infected with HCMV (HFF).
  • HFF HCMV
  • HepG2.2.15 cells are derived from the hepatoblastoma cell line HepG2 and were used to study the life cycle of HBV when supporting the production and assembly of HBV particles.
  • TAIL-seq data for HepG2.2.15 cells showed a very high guanylation frequency for viral RNA (FIGS. 1A, 7A).
  • the mixed tailing frequencies (G, U and C coefficients) were also substantially higher in viral RNA than in cellular RNA (FIG. 7A ).
  • RNA2.7 a modification of RNA that influences the length of HCMV.
  • HBV and HCMV RNAs had significantly longer tails than cellular mRNAs (Figs. 1c, d), indicating that these viral RNAs can undergo slower net denylation than cellular mRNAs.
  • TENT4A and TENT4B Guanylation and mixed tailing frequencies of HBV mRNA and HCMV RNA2.7 were reduced in TENT4A- and TENT4B-depleted cells (FIGS. 1E, F and 7D-G). Knockdown of TENT4A and TENT4B also shortened the poly(A) tail of the viral RNA (Fig. 7h-j), showing that the TENT4 enzyme contributes to the extension of the viral RNA tail. Consistently, HBV mRNA was downregulated and destabilized after TENT4 depletion (Fig. 1G, H and Fig.
  • HBV RNA is the main substrate of TENT4 in HepG2.2.15 cells.
  • HBV RNA is generated from a 3.2 kilobase of circular DNA genome. Five overlapping viral transcripts share a consensus 3'end sequence ( ⁇ 700 base pairs) and a single polyadenylation site (Figure 2A). TENT4 binding readings are enriched in the 3'end region ranging from 1,154-1,687 ( Figure 2A). This region corresponds to the post-transcriptional regulatory element (PRE) and is well known to enhance RNA nuclear release and stabilization. PRE from woodchuck hepatitis virus (WPRE) has been widely used to increase ectopic gene expression and lentiviral gene delivery.
  • PRE post-transcriptional regulatory element
  • RNA-binding proteins such as La, PTB, GAPDH and ZC3H18 have been reported to interact with PRE, but the functional importance of these interactions is unclear.
  • PRE of HBV showed the highest enrichment score compared to other estimated peak clusters of human transcripts (FIG. 2B ).
  • the interaction between TENT4A, TENT4B and HBV mRNA was confirmed by immunoprecipitation and subsequent quantitative PCR using reverse transcription (RT-qPCR) (Fig. 8b).
  • RT-qPCR reverse transcription
  • RNA element recognized by TENT4 we generated a reporter with different subregions of PRE in the 3'untranslated region (UTR) (Fig. 3a).
  • PRE consists of two sub-elements: PRE ⁇ (1154-1351) and PRE ⁇ (1352-1687) (Fig. 3A).
  • TENT4A and TENT4B knockout (KO) cells were generated to test TENT4A and TENT4B dependence (Fig. 9A).
  • Luciferase protein and RNA levels were significantly upregulated in a TENT4 dependent manner only when the reporter was equipped with complete PRE or PRE ⁇ (FIGS. 3B and 9B ). Similar results were obtained in human embryonic kidney 293T (HEK293T) cells depleted of TENT4 (Fig. 9c, d), and it was confirmed that PRE ⁇ is required for TENT4-dependent stabilization. As a result of measuring the poly(A) tail length by Hier-PAT analysis, TENT4 depletion shortened the poly(A) tail in the PRE ⁇ structure, but not in the PRE ⁇ structure (FIG. 3C ).
  • TENT4 acts directly through tail modification in a PRE ⁇ -dependent manner.
  • PRE and PRE ⁇ reporter expression at both protein and RNA levels were rescued by ectopically expressed TENT4 (Figs. 3d and 9e, f).
  • the catalytically inactive mutant did not restore activity. Therefore, the catalytic activity of TENT4 is required for upregulation of PRE ⁇ -containing mRNA.
  • WPRE woodchuck hepatitis virus segment
  • PRE ⁇ contains a La-binding motif and stem-loop alpha (SL ⁇ ), both reported to be required for RNA release and stability.
  • SL ⁇ La-binding motif and stem-loop alpha
  • Recent mutagenesis studies have shown that the La-binding site and apical loop sequence of SL ⁇ are essential for DHQ-1-mediated HBV gene expression.
  • SL ⁇ contains a CAGGU pentaloop that essentially adopts the CNGG(N) family loop structure as a single overhanging G residue flanked by the A-helix region (Fig. 3G, left).
  • the structure of SL ⁇ is also preserved evolutionarily in WHV (Fig. 3G, right).
  • a PRE ⁇ mutant reporter (Fig. 3A) that interferes with the apical sequence and shape of SL ⁇ (Fig. 3G, arrows).
  • Mutagenesis of the La-binding motif ( ⁇ mut1) did not affect TENT4 dependence, and SL ⁇ mutation ( ⁇ mut2) and double mutation ( ⁇ mut3) stopped PRE ⁇ function (Fig. 3H).
  • the stem-loop (SL ⁇ ) of PRE ⁇ is an essential element for post-transcriptional regulation by TENT4.
  • HCMV RNA2.7 has a similar stem-loop for TENT4-dependent regulation.
  • HCMV RNA2.7 ( VRNA2.7 ) also undergoes mixed tailing ( Figures 1B, D and 7B).
  • RT-qPCR showed that TENT4A interacts with RNA2.7 ectopically expressed in HEK293T cells (Figs. 4A and 10A), and the interaction between TENT4A and RNA2.7 It suggests that no viral factor is required for action.
  • a reporter containing partially overlapping fragments of RNA2.7 was generated (FIG. 4B, FRG1-6).
  • Protein and RNA levels of the first two reporters were significantly higher in parental cells compared to TENT4 KO cells (FIGS. 4C and 10B ).
  • the partial deletion of FRG1 was found to confer a TENT4-dependent strengthening effect on only the 1E fragment (414-513) (Figs. 4d, e and 10c, d).
  • the 1E domain has a stem-loop structure similar to the CNGG (N) family loop morphology of SL ⁇ of PRE ⁇ and WPRE ⁇ (Fig. 4B, lower right) (Fig. 3G).
  • a point mutation to the stem-loop of 1E (1E mut) stopped the regulation of TENT4 (FIGS.
  • SL2.7 The smaller 50-nt truncated fragment comprising the stem-loop (414-463 hereinafter referred to as SL2.7) has similar activity to FRG1 and 1E (FIG. 10E ).
  • FRG1 and 1E FRG1 and 1E
  • the present invention demonstrates the functional importance of SL ⁇ -like structures in TENT4-dependent regulation.
  • Cytoplasmic ZCCHC14 binds to the stem-loop structure and interacts with TENT4.
  • the CNGGN pentaloop was initially characterized as a Smaug recognition element that binds to the sterile alpha motif (SAM) domain of yeast Vts1p, and Drosophila Smaug mediates post-transcriptional inhibition [32-36].
  • SAM sterile alpha motif
  • Drosophila Smaug mediates post-transcriptional inhibition [32-36].
  • Schwalbe and colleagues suggested that the HBV SL ⁇ pentaloop could serve as a binding site for the SAM domain and protein based on structural similarity.
  • TENT4 does not contain the SAM domain [31], and our tailing analysis with recombinant TENT4 did not detect a remarkable affinity for PRE-in vitro, which represents an RNA-interacting cofactor.
  • RNA pulldown was performed with biotinylated synthetic SL2.7 and HEK293T cell extracts (Fig. 5A). Loop mutants were used as negative controls. Mass spectrometry revealed significantly enriched six proteins, namely TENT4A, TENT4B, K0355, SAMD4A, SAMD4B and ZCCHC14 (Fig. 5A). In particular, three human proteins with Smaug-like SAM domains are included in this list: two homologues of Smaug (SAMD4A and SAMD4B) and ZCCHC14 ( Figure 5B). The specific enrichment of ZCCHC14 was further confirmed by RNA pulldown and western blotting (Fig. 5c).
  • K0355 (or KIAA0355) does not have a SAM domain and is reported to interact with SAMD4B37, indicating that K0355 may not interact directly with the penta loop.
  • SAM domain protein is responsible for TENT4-dependent regulation.
  • Knockdown of ZCCHC14 did not reduce HBV RNA levels in knockdown of SAMD4 protein (FIGS. 5D and 11). Consistently, recent genome-wide CRISPR screens reported ZCCHC14 as an essential host factor for the production of surface antigens of HBV.
  • ZCCHC14 To understand the mechanism of action of ZCCHC14, we performed TAIL-seq experiments in ZCCHC14-depleted HepG2.2.15 cells. The frequency of guanylation of HBV mRNA was reduced (FIG. 6A ), and the poly(A) tail was substantially shortened in ZCCHC14 knockdown (FIG. 6B ), demonstrating the important role of ZCCHC14 in the HBV RNA mixed tail. Consistently, ZCCHC14 depletion reduced luciferase expression from reporters carrying CNGGN stem-loops (RNA2.7 1E, PRE ⁇ , W ⁇ + W ⁇ ) (FIG. 6C ).
  • each of the pentaloop mutants (1E mut, ⁇ mut2, W ⁇ + W ⁇ mut) did not show any significant change after ZCCHC14 knockdown (P>0.05; two-sided student's t-test) (Fig. 6c), which It shows that the function of ZCCHC14 is dependent on the CNGGN motif.
  • the present inventors also performed Hire-PAT analysis to confirm that the poly(A) tail length of reporter mRNAs was reduced in ZCCHC14 depleted cells in a CNGGN motif-dependent manner (FIGS. 12a-c).
  • RNA immunoprecipitation using the ZCCHC14 antibody confirmed the interaction between ZCCHC14 and HBV transcript in HepG2.2.15 cells (Figs. 6D and 12D). Moreover, in both HepG2.2.15 and primary HFF cells, ZCCHC14 co-immunoprecipitated with TENT4A and TENT4B irrespective of RNase treatment ( Figure 12e), indicating an RNA-non-dependent interaction between ZCCHC14 and TENT4. Finally, the inventors found that ZCCHC14 was mainly confined to the cytoplasm (Fig. 6e), and that ZCCHC14 co-immunoprecipitates with TENT4A and TENT4B using the cytoplasmic fraction of HeLaT cells (Fig. 6f). Taken together, the present invention shows that ZCCHC14 inadvertently protects viral transcripts containing SL ⁇ -like elements from didenylation by interacting with TENT4 primarily in the cytoplasm.
  • HBV mRNA and HCMV RNA2.7 contain a cis -acting element with a CNGGN penta loop important for recruiting ZCCHC14 and TENT4.
  • the mixed tail by TENT4 protects the viral RNA against the CNOT diadenylase complex.
  • TENT4B acts as a component of the nuclear TRAMP complex (Trf4-Air1/2-Mtr4 in yeast and TENT4B-ZCCHC7-hMTR4 in humans) and is involved in the degradation or cleavage and maturation of abnormal transcriptomes, or It is involved in the trimming and maturation of small noncoding RNAs in [5, 39-43].
  • mixed tailing contributes to mRNA stability as a module distinct from the TRAMP complex. Considering that the knockdown of hMTR4 and ZCCHC7 does not affect HBV protein and mRNA levels, TENT4 appears to act independently of the TRAMP complex in HBV regulation.
  • HBV gene expression appears to be particularly important for HBV gene expression.
  • mRNA species pgRNA except X, Precore, PreS1 and PreS2/S
  • pgRNA mRNA species
  • X mRNA species
  • Precore mRNA species
  • PreS1 mRNA species
  • PreS2/S mRNA species
  • Current treatment options include nucleos(t)ide analogues and interferon alpha, but due to the less effective and often ineffective treatment, HBV infection remains a major medical burden, killing about 80 million people worldwide each year.
  • Functional therapy can be achieved by blocking the production of viral proteins, especially viral S antigens (HBsAg) that induce immune evasion.
  • HBV protein especially viral S antigens (HBsAg) that induce immune evasion.
  • TENT4 and ZCCHC14 may provide mechanistic insights into the development of a new class of anti-HBV drugs. To avoid potential side effects targeting how TENT4 works, it is important to understand the endogenous functions and mechanisms of action of the TENT4 protein and its partners.
  • the physical interaction between the CNGGN penta loop and the RNA-binding SAM protein has been found to be a highly conserved and widely used functional module.
  • Smaug induces timely mRNA degradation by recognizing hairpins with the CUGGC loop of nanos mRNA. This is essential for the establishment of the anterior-posterior axis.
  • Vts1p binds to mRNA with CNGG (N) penta loops for targeted mRNA degradation.
  • Vertebrate animals have three RNA-binding SAM proteins and appear to extend the use of this interaction module.
  • SAMD4B one of Smaug's vertebrate orthologs, targets nanos1 mRNA and is essential in mammalian neurodevelopment.
  • SAMD4A Smaug's other vertebrate ortholog, inhibits the translation of penta loop-containing reporters and is associated with the formation of cytoplasmic lesions.
  • SAMD4A Smaug's other vertebrate ortholog, inhibits the translation of penta loop-containing reporters and is associated with the formation of cytoplasmic lesions.
  • the same mechanism can be used for the opposite purpose, particularly through the vertebrate-specific protein ZCCHC14 for the benefit of viral RNA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Epidemiology (AREA)
  • Analytical Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Mycology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

본 발명은 바이러스 RNA에 대한 혼합된 테일링을 유도함으로서, 바이러스 감염 및 감염증을 예방 또는 치료하는 기술에 관한 것이다.

Description

바이러스 감염 및 활성 억제 방법
본 발명은 대한민국 과학기술정보통신부의 지원 하에서 과제번호 1711079098에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 기초과학연구원, 연구사업명은 "기초과학연구원연구운영비지원", 연구과제명은 “RNA에 의한 세포 운명 조절 연구", 주관기관은 기초과학연구원, 연구기간은 2018.01.01.~2018.12.31.이다.
본 특허출원은 2019년 5월 30일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2019-0064129호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
본 발명은 바이러스 RNA에 대한 혼합된 테일링을 유도함으로서, 바이러스 감염 및 감염증을 예방 또는 치료하는 기술에 관한 것이다.
B형 간염은 혈액 및 혈액 생성물들, 오염된 바늘과 같은 오염된 재료에 의해 장관외로, 감염된 또는 매개체(carrier) 모체들로부터 성적으로 그리고 수직적으로 이들의 자녀로부터 전염된 바이러스성 질환이다. 세계 보건 기구(World Health Organization)에 의하면 20억 이상의 사람들이 전세계적으로 감염되었으며, 매년 약 4 백만명은 급성 경우이며, 매년 백만명이 사망하고, 그리고 350-400백만이 만성 매개체로 추정된다(World Health Organization: Geographic Prevalence of Hepatitis B Prevalence, 2004. http://www.who.int/vaccines-surveillance/graphics/htmls/hepbprev.htm).
이 바이러스, HBV는 이중-가닥으로 된 간 친화성(hepatotropic) 바이러스로 사람 및 사람이 아닌 영장류 만을 감염시킨다. 바이러스 복제는 주로 간에서 발생되며, 그리고 그 보다는 덜하지만 신장, 췌장, 골수 및 비장에서 일어난다(Hepatitis B virus biology. Microbiol Mol Biol Rev. 64: 2000; 51-68.). 바이러스 및 면역 표지들은 혈액에서 탐지가능하고, 그리고 특징적인 항원-항체 패턴들은 시간이 경과함에 따라 진화된다. 첫 탐지가능한 바이러스성 표지는 HBsAg이며, 이어서 B형 간염 e 항원 (HBeAg) 및 HBV DNA이다. 잠복기(incubation period) 동안 역가는 높을 수 있지만, 그러나 HBV DNA 및 HBeAg 수준들은 질병의 개시 시기에 떨어지기 시작하고, 임상적으로 질병의 절정 시기에는 탐지불가능할 수 있다(Hepatitis B virus infectionnatural history and clinical consequences. N Engl J Med.. 350: 2004; 1118-1129). HBeAg는 혈액내 탐지가능한 바이러스성 표지이고, 그리고 활성 바이러스성 복제와 연관되며, 그리고 따라서 바이러스 로드(load) 및 감염성이 높다(Hepatitis B virus e antigenthe dangerous end game of hepatitis B virus. N Engl J Med. 347: 2002; 208-210). 항-HBsAb 및 항-HBcAb (IgG)의 존재는 이미 감염된 개체에서 회복 및 면역성을 나타낸다.
American Association for the Study of Liver Diseases (AASLD) 및 European Association for the Study of the Liver (EASL)에 의하면 HBV 만성 감염의 현재 권장 치료법은 인터페론 알파 (INFα), 페길화된 인터페론 알파-2a (Peg-IFN2a), 엔테카비르(entecavir), 및 테노포비르(tenofovir)를 포함한다. 뉴클레오시드 및 뉴클레오티드 치료제(therapies), 엔테카비르 및 테노포비르는 바이러스 로드를 감소시키는데는 성공적이나, HBeAg 혈청변환(seroconversion) 및 HBsAg 손실율은 IFNα 치료제를 이용하여 수득된 것보다는 훨씬 더 낮다. 라미부딘 (3TC), 벨비부딘 (LdT), 및 아데포비르(adefovir)를 포함하는 유사한 기타 치료제가 또한 이용되지만, 전반적으로 뉴클레오시드/뉴클레오티드 치료제의 경우 저항 발생이 치료 효과를 제한한다.
따라서, 새로운 항-바이러스성 치료제를 발견하고 개발하는 것이 이 분야에서 필요하다.
한편, 인간 시토메갈로바이러스 (HCMV)는 헤르페스 바이러스 패밀리에 속하는 편재하는 바이러스이다. 상기 바이러스는 외피(tegument)에 의해 둘러싸인 캡시드에 함유되고 그의 표면 상에 당단백질 스파이크를 수반하는 지질 이중층에 감싸진 선형 이중-가닥 데옥시리보핵산 (DNA)으로 구성된다. 이 패밀리의 다른 구성원과 마찬가지로, HCMV는 잠복기 및 재활성화의 특성을 보유한다. HCMV는 많은 세포에서 감염되고 잠복하는 능력을 갖는다.
면역적격 숙주에서, 대부분의 HCMV 감염은 조금의 비특이적 증상 예컨대 피로, 권태감, 중등도의 열, 림프절병증, 간비대 또는 간 효소의 약간의 증가로 무증상이거나 매우 경증이다. 그러나 이종친화성-음성 단핵구증은 이전에 건강한 개인의 대략 10%에서 관찰된다.
HCMV 치료에 대해서도 새로운 전략이 요구되고 있다.
본 발명자들은 TENT4A/B가 바이러스 RNA, 보다 구체적으로 mRNA의 혼합된 테일링(mixed tailing)에 관여하여, 숙주 세포 내에서의 바이러스 mRNA의 분해를 억제하는데 도움을 준다는 사실을 밝혔으며, 숙주 세포로서의 대상(subject)의 TENT4A/B 발현 및 활성을 억제하는 경우, 혼합된 테일링을 억제함으로써, 바이러스 RNA의 디아데닐화를 촉진하여, 바이러스 RNA의 빠른 분해를 촉진할 수 있음을 규명함으로써, 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 바이러스 감염 예방 또는 바이러스 감염증 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 바이러스 감염 예방 또는 바이러스 감염증 치료용 약제학적 조성물의 스크리닝 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 바이러스 내성 세포 제조방법을 제공하는 것이다.
본 발명의 또 다른 목적은 RNA 서열 안정화 방법을 제공하는 것이다.
본 발명의 일 양태에 따르면, 본 발명은 바이러스 RNA의 혼합된 테일링(Mixed tailing)에 관여하는 TENT4A 및 TENT4B 중 어느 하나 이상의 억제제를 포함하는 바이러스 감염 예방 또는 바이러스 감염증 치료용 약제학적 조성물에 있어서, 상기 억제제는 TENT4A 및 TENT4B 중 어느 하나 이상의 발현을 억제하는 siRNA 또는 shRNA, 또는 TENT4A 및 TENT4B 중 어느 하나 이상의 활성을 억제하는 항체 또는 그의 항원결합 단편인, 약제학적 조성물을 제공한다.
본 발명자들은 TENT4A/B가 바이러스 RNA, 보다 구체적으로 mRNA의 혼합된 테일링(mixed tailing)에 관여하여, 숙주 세포 내에서의 바이러스 mRNA의 분해를 억제하는데 도움을 준다는 사실을 밝혔으며, 숙주 세포로서의 대상(subject)의 TENT4A/B 발현 및 활성을 억제하는 경우, 혼합된 테일링을 억제함으로써, 바이러스 RNA의 디아데닐화를 촉진하여, 바이러스 RNA의 빠른 분해를 촉진할 수 있음을 규명하였다.
RNA 테일링(3 '말단에 비 템플레이트화 된 뉴클레오티드 첨가)은 가장 광범위하고 보존 된 유형의 RNA 변형이다. 말단 뉴클레오티딜 트랜스퍼라제 (terminal nucleotidyltransferases; TENT)로도 알려진 Noncanonical 폴리(A) 폴리머라아제는 전사 후 RNA의 3 '말단에 뉴클레오티드를 통합하여 성숙, 안정성 및 활성을 조절합니다. 이전에, 본 발명자들은 RNA 3 '말단을 탐색하 고 폴리(A) 테일 길이를 측정하기 위한 TAIL-seq라는 방법을 개발하였다. TAIL-seq 실험에서 척추 동물 mRNAs에 대한 유리딜화(uridylation) 및 구아닐화(guanylation)와 같은 Noncanonical한 테일링 이벤트를 발견했다. 말단 유리딜릴트랜스퍼라아제(TUT4 및 TUT7)는 PABPC 제거 후 디아데닐화된 폴리(A) 테일들(~25 뉴클레오티드보다 짧은)을 유리딜화시켰다. U 테일들, 특히, 올리고-U 테일들은 mRNA 붕괴를 촉진한다. 반대로, 구아닐화는 긴 폴리(A) 테일들에 대해서 발생하고, mRNA들을 빠른 디아데닐화로부터 보호한다. 두 가지 관련 효소 TENT4A (PAPD7 또는 TUT5라고도 함) 및 TENT4B (PAPD5 또는 TUT3이라고도 함)는 간헐적인 비 아데노신 잔기(가장 일반적으로 구아노 신)로 mRNA 폴리(A) 테일을 확장하여 '혼합된 테일(Mixed tails)'을 생성한다. 이 순수하지 않은 폴리(A) 테일은 CCR4-NOT(CNOT) 복합체에 의한 디아데닐화를 방해하고 mRNA의 안정성을 향상시킨다. 혼합된 테일링(Mixed tailing)은 새로운 유형의 전사 후 조절(post-transcriptional regulation)로 작용하도록 제안되었다.
본 명세서 상의 용어, “혼합된 테일링”은 바이러스성 RNA, 보다 구체적으로 바이러스성 mRNA의 폴리(A) 테일 서열 부분의 하나 이상의 서열이 구아닐화 또는 유리딜화 되어, 구아닌 또는 유리딘과 같은 다른 핵산 서열로 치환되는 작용을 의미한다. 본 명세서 상에서, 상술한 “혼합된 테일링”은 “혼합 테일링”, “테일링” 등으로 간단히 기재될 수 있다. 바이러스성 RNA의 폴리(A) 테일 서열에 구아닐화 또는 유리딜화가 일어나면, 해당 폴리(A) 테일의 디아데닐화가 억제되고, mRNA의 분해는 지연된다.
본 발명의 TENT4A 및 TENT4B는 말단 뉴클레오티딜트랜스퍼라제(terminal nucleotidyltransferases)에 속하는 noncanonical poly(A) 폴리머라제로서, 본 발명자들은 TENT4A 및 TENT4B가 바이러스 mRNA의 폴리(A) 테일의 혼합된 테일링에 관여한다는 것은 최초로 규명하였다.
본 발명의 일 구현예에 있어서, 본 발명의 TENT4A 및 TENT4B는 바이러스 감염 위험이 있거나, 바이러스에 감염된 상태인 대상(subject)으로부터 유래된 것이다. 본 발명자들은, 대상 내로 감염된 바이러스 mRNA는 대상으로부터 유래된 TENT4A 및 TENT4B에 의해 혼합된 테일링이 유도될 수 있다는 것을 규명하였다.
본 발명의 일 구현예에 있어서, 본 발명의 바이러스는 TENT4A 및 TENT4B 중 어느 하나 이상에 의해 RNA 테일링이 유발되는 바이러스이다. 보다 구체적으로, 본 발명자들은 TENT4A 및 TENT4B 의존적 조절을 위해서 전사후 조절 요소(post-transcriptional regulatory element, PRE), 보다 더 구체적으로 CNGGN-타입의 펜타루프(pentaloop)가 중요한 역할을 함을 규명하였다. 또한, 본 발명자들은 HBV 및 HCMV가 모두 pentaloop를 이용하는 유사한 방식으로 작용하여 TENT4A/B를 모집하고, 혼합된 테일링을 유발한다는 것을 규명하였다. 본 발명의 HBV 및 HCMV는 매우 다른 수명주기와 조직 특이성을 가진 이 두 가지 별개의 바이러스(헤파드나비리대에 속하는 바이러스와 헤르페스비리대에 속하는 바이러스)는 유전자 발현의 이점을 위한 동일한 전략을 사용하며, 이러한 수렴 진화와 이 cis-acting 요소의 단순성은 이 메커니즘이 다른 바이러스에서도 사용될 수 있음을 보여준다.
본 발명의 일 구체예에 있어서, 본 발명의 바이러스는 헤파드나바이러스과 또는 헤르페스바이러스과에 속하는 바이러스이다.
본 발명의 일 구현예에 있어서, 본 발명의 헤파드나바이러스과에 속하는 바이러스는 B형 간염 바이러스(Hepatitis B virus), 그라운드 다람쥐 B 형 간염 바이러스(Ground Squirrel Hepatitis B), 우드척 B형 간염 바이러스(Woodchuck Hepatitis B), 오리 B형 간염 바이러스(Duck hepatitis B) 및 헤론 B형 간염 바이러스(Heron Hepatitis B)으로 구성된 군으로부터 선택되는 어느 하나이다.
본 발명의 일 구현예에 있어서, 본 발명의 헤르페스바이러스과에 속하는 바이러스는 일토 바이러스(Iltovirus), 마디 바이러스(Mardivirus), 스쿠타 바이러스(Scutavirus), 단순 바이러스(Simplexvirus), 바리셀로 바이러스(Varicellovirus), 거대세포 바이러스(Cytomegalovirus), 무로메갈로 바이러스(Muromegalovirus), 프로보 바이러스(Proboscivirus), 로졸로 바이러스(Roseolovirus), 림포크립토 바이러스(Lymphocryptovirus), 마카 바이러스(Macavirus), 페르카 바이러스(Percavirus) 및 라디노 바이러스(Rhadinovirus)로 구성된 군으로부터 선택되는 어느 하나이다.
본 발명에서 사용되는 용어, "siRNA"는 특정 mRNA의 절단(cleavage)을 통하여 RNAi(RNA interference) 현상을 유도할 수 있는 짧은 이중사슬 RNA를 의미한다. 표적 유전자의 mRNA와 상동인 서열을 가지는 센스 RNA 가닥과 이와 상보적인 서열을 가지는 안티센스 RNA 가닥으로 구성된다.　 siRNA는 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운 방법으로서 또는 유전자 치료의 방법으로 제공될 수 있다.
siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고 미스매치(대응하는 염기가 상보적이지 않음), 벌지(일방의 사슬에 대응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분이 포함될 수 있다. 전체 길이는 10 내지 100 염기, 바람직하게는 15 내지 80 염기, 더욱 바람직하게는 20 내지 70염기이다.　 siRNA 말단 구조는 표적 유전자의 발현을 RNAi 효과에 의해 억제할 수 있는 것이면 평활(blunt) 말단 또는 점착(cohesive) 말단 모두 가능하다. 점착 말단 구조는 3' 말단 돌출한 구조와 5' 말단 쪽이 돌출한 구조 모두 가능하다. 돌출하는 염기 수는 한정되지 않는다. 또한 siRNA는 표적 유전자의 발현 억제 효과를 유지할 수 있는 범위에서 예를 들어, 한쪽 말단의 돌출 부분에 저분자 RNA(예를 들어, tRNA, rRNA, 바이러스 RNA와 같은 천연의 RNA 분자 또는 인공의 RNA 분자)를 포함할 수 있다. siRNA 말단 구조는 양측 모두 절단 구조를 가질 필요는 없고, 이중 사슬 RNA 일반의 말단 부위가 링커 RNA에 의하여 접속된 스텝 루프형 구조일 수도 있다.
본 발명에서 사용되는 siRNA는 그 자체로 폴리뉴클레오타이드 페어링을 갖는 완전한 형태, 즉 시험관에서 siRNA를 직접 합성한 두 형질전환 과정을 거쳐 세포 안으로 도입되는 형태이거나, 생체 내에 투여된 후 이러한 형태를 갖도록 하나의 단일쇄 올리고뉴클레오타이드 단편과 이의 역방향(reverse) 상보물이 스페이서에 의해 분리된 단일쇄 폴리뉴클레오타이드로부터 유도될 수 있는 형태, 예를 들어 siRNA가 세포 안에서 발현되도록 제조된 siRNA 발현 벡터 또는 PCR-유도된 siRNA 발현 카세트를 형질전환 또는 감염(infection) 과정을 거쳐 세포 안으로 도입되는 형태일 수 있다.　 siRNA를 제조하고 세포 또는 동물로 도입하는 방법의 결정은 목적 및 표적 유전자 산물의 세포 생물학적 기능에 따라 달라질 수 있다.　
본 발명에서 사용되는 용어, "shRNA" 는 siRNA의 고가의 생합성 비용, 낮은 세포 형질감염 효율로 인한 RNA 간섭 효과의 단시간 유지 등의 단점을 극복하기 위한 것으로 RNA 중합효소 Ⅲ의 프로모터로부터 아데노바이러스, 렌티바이러스 및 플라스미드 발현 벡터 시스템을 이용하여 이를 세포 내로 도입하여 발현시킬 수 있으며, 이러한 shRNA는 세포 내에 존재하는 siRNA 프로세싱 효소(Dicer or Rnase Ⅲ)에 의해 정확한 구조를 갖는 siRNA로 전환되어 목적 유전자의 사일런싱을 유도함이 널리 알려져 있다.
본 발명의 일 구현예에 있어서, 본 발명의 siRNA는 표 1에 예시적으로 나타내었으나 이에 제한되는 것은 아니다.
본 발명의 TENT4A 및 TENT4B 중 어느 하나 이상의 활성을 억제하는 항체는 단일클론항체 및 이에 대한 키메라 항체, 인간화 항체 및 인간 항체를 모두 포함하는 것이고, 신규한 항체 외에 이미 당해 기술분야에서 공지된 항체들도 포함될 수 있다. 상기 항체는 TENT4A 및/또는 TENT4B에 특이적으로 결합하는 한, 2개의 중쇄와 2개의 경쇄의 전체 길이를 가지는 완전한 형태뿐만 아니라, 항체 분자의 기능적인 단편을 포함한다. 항체의 분자의 기능적인 단편이란, 적어도 항원 결합 기능을 보유하고 있는 단편을 뜻하며, Fab, F(ab'), F(ab')2 및 Fv 등이 있다.
본 발명의 실시예에서는 다음의 항체들을 사용하였으나, 이에 제한되는 것은 아니다:
항-TENT4A 항체 (invitrogen, PA5-61302), 항-TENT4A 항체 (Atlas Antibodies, HPA045487), 항-TENT4A 마우스 항체 (labmade), 항-TENT4B 항체 (invitrogen, PA5-60177), 항-TENT4B 항체 (Atlas Antibodies, HPA042968), 항-TENT4B 마우스 항체 (labmade).
본 발명의 조성물이 약제학적 조성물로 사용될 경우, 상기 조성물 내의 유효성분의 함량은 질환의 증상, 증상의 진행 정도, 환자의 상태 등에 따라서 적절히 조절 가능하며, 예컨대, 전체 조성물 중량을 기준으로 0.0001 내지 99.9중량% 포함될 수 있으나, 이에 한정되는 것은 아니다. 상기 함량비는 용매를 제거한 건조량을 기준으로 한 값이다.
상기 약제학적 조성물은 약학 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있으며, 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 또는 멸균 주사용액 등의 형태로 제형화하여 사용될 수 있다.
상기 약제학적 조성물을 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.　경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형 제제는 적어도 한 가지 이상의 부형제 및/또는 윤활제 등을 포함할 수 있다.　경구투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조제제, 좌제 등이 포함될 수 있다.
상기 약학 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 보다 바람직한 효과를 위해서, 본 발명의 조성물의 투여량은 유효성분을 기준으로 1일 0.1 mg/kg 내지 100 mg/kg으로 하는 것이 좋으나 이에 제한되는 것은 아니다.　투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수 있다. 본 발명의 조성물은 동물, 바람직하게는 인간을 포함하는 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 정맥, 근육, 피하주사 등에 의해 투여될 수 있다. 본 발명의 조성물의 약학적 투여 형태는 유효성분의 약학적 허용 가능한 염의 형태로도 사용될 수 있고, 또한 단독으로 또는 타 약학적 활성 화합물과 결합뿐만 아니라 적당한 집합으로 사용될 수 있다.
본 발명의 다른 일 양태에 따르면, 본 발명은 다음 단계를 포함하는 바이러스 감염 예방 또는 바이러스 감염증 치료용 약제학적 조성물의 스크리닝 방법을 제공한다:
(a) 숙주 세포(host cell)에 바이러스를 형질감염 시키는 단계;
(b) 약물 후보 물질을 숙주 세포에 처리하는 단계; 및
(c) 약물 후보 물질을 처리한 실험군으로부터의 RNA tailing 수준을 분석하고, 약물 후보 물질 무-처리 대조군으로부터의 RNA tailing 수준과 비교하는 단계; 실험군으로부터의 RNA tailing 수준이 무-처리 대조군에 비해 상대적으로 감소되어 있는 경우, 유효한 약물 후보 물질로 선정한다.
RNA 테일링 수준은 구아닐화 또는 유리딜화에 의해 폴리(A) 테일에 포함된 아데닌이 구아닌 또는 유리딘과 같은 다른 핵산으로 치환된 횟수에 의해 결정된다.
본 발명에서의 단계 (a) 및 (b)는 실행 순서가 얼마든지 뒤바뀔 수 있다.
시료를 바이러스가 감염된 숙주 세포에 처리하여 혼합된 테일링이 억제되는 경우, 해당 시료는 유효한 약물 후보 물질로 선정할 수 있다.
본 발명의 약물 스크리닝 방법은 TENT4A/B에 의한 혼합된 테일링 작동원리를 이용한다는 점에서 본 발명의 다른 일 양태인 약제학적 조성물과 공통되는 특성을 가지므로, 약제학적 조성물의 상세한 설명 기재 내용을 원용하며, 본 명세서 기재의 과도한 복잡성을 피하기 위해 중복되는 기재를 생략하도록 한다.
본 발명의 다른 일 양태에 따르면, 본 발명은 생체로부터 분리된 세포의 TENT4A 및 TENT4B 중 어느 하나 이상의 발현을 녹아웃(Kock-out) 시키는 단계를 포함하는 바이러스 내성 세포 제조방법을 제공한다.
본 발명의 녹아웃은 종래 알려진 다양한 유전자 편집 기술을 다양하게 활용하여 도입할 수 있으며, 본 명세서 상의 실시예에서는 CRISPR-Cas 게놈 편집 방법을 이용하였으나(참조: 실시예 6), 이에 제한되는 것은 아니다.
본 발명의 다른 일 양태에 따르면, 본 발명은 다음 일반식으로 나타낸 아미노산 서열로 구성된 펜타루프구조를 포함하는 스템-루프 서열을 타겟 RNA 서열에 삽입하는 단계를 포함하는 RNA 서열 안정화 방법을 제공한다:
[일반식]
5’-CNGGN-3’,
상기 N은 각각 독립적으로 아데노신(A) 및 유라실(U)로부터 선택되는 어느 하나이다.
본 명세서 상의 용어 “스템-루프”구조는 스템-루프 구조(Stem-Loop Structure)는 단일 가닥 DNA 또는 RNA에서 일어나는 염기쌍 간의 결합이다. 이 구조를 헤어핀(Hairpin) 또는 헤어핀 구조(Hairpin Structure)라고도 한다. 한 가닥의 두 영역이 서로 반대 방향으로 읽을 때 염기쌍이 서로 상보적이면 발생한다. 스템-루프 구조의 예는 도 12b에 나타내었으나 이에 제한되는 것은 아니다.
본 발명의 용어 “펜타-루프”는 스템-루프 구조 상 염기쌍 간의 결합을 형성하지 않은 연결 부위에 5개의 염기가 존재하는 단일 가닥 서열 부위를 의미한다. 본 발명의 스템-루프 구조는 펜타-루프 구조를 포함하며, 예시도는 도 13에 나타내었다.
본 발명의 일 구현예에 있어서, 본 발명의 스템-루프 구조는 2-15 염기쌍 간의 결합을 포함한다. 더욱 구체적으로 예를 들면, 2-14 염기쌍 결합, 2-13 염기쌍 결합, 2-12 염기쌍 결합, 2-11 염기쌍 결합, 2-10 염기쌍 결합, 3-10 염기쌍 결합, 3-9 염기쌍 결합을 포함하지만, 이에 제한되는 것은 아니다. 염기쌍 간의 결합은 아데닌-유라실 결합 또는 시토신-구아닌 결합일 수 있고, 결합의 종류가 제한되지는 않는다.
본 발명의 스템-루프 구조를 타겟 RNA 서열에 삽입함으로써, 타겟 RNA 서열이 TENT4A/B를 활용하여 혼합된 테일링을 유발하는 빈도를 높여주고, 해당 RNA 서열의 안정화를 기할 수 있다.
본 발명의 구체적인 구현예는 도 13에 나타내었다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 바이러스 감염 예방 또는 바이러스 감염증 치료용 약제학적 조성물을 제공한다.
(b) 본 발명은 바이러스 감염 예방 또는 바이러스 감염증 치료용 약제학적 조성물의 스크리닝 방법을 제공한다.
(c) 본 발명은 바이러스 내성 세포 제조방법을 제공한다.
(d) 본 발멸은 소정의 스템-루프 구조 서열의 도입에 의해 RNA 서열을 안정화 시키는 방법을 제공한다.
(e) 본 발명의 약제학적 조성물을 이용하는 경우, 바이러스 감염을 효과적으로 예방 및 치료할 수 있다.
(f) 본 발명의 RNA 서열 안정화 방법을 이용하는 경우, 원하는 RNA 서열에 대해 혼합된 테일링을 유도하여 서열 안정화를 유도할 수 있다.
도 1은 바이러스 RNA의 광범위한 혼합된 테일을 나타낸다. a, 세포 및 바이러스 mRNA의 구아닐화 테일의 분율은 폴리(A) 테일 길이가 25nt 이상인 mRNA에 대하여 계산되었다(n=2 TAIL-seq 실험). b, 세포 RNA, HCMV RNA 및 RNA2.7(VRNA2.7)의 구아닐화 테일의 분율은 폴리(A) 테일 길이가 25nt 이상인 RNA에 대하여 계산되었다(n=1 TAIL-seq 실험). c, 세포(회색) 및 HBV(노란색) mRNA의 전체 폴리(A) 테일 길이 분포. 중앙값은 수직의 점선으로 표시되며 중앙값 길이는 괄호 안에 나타나 있다. d, 세포(회색), HCMV(노란색) 및 VRNA2.7(주황색) RNA의 전체 폴리(A) 테일 길이 분포. 중앙값은 수직의 점선으로 표시되며 중앙값 길이는 괄호 안에 나타나 있다. e, TENT4-고갈된 HepG2.2.15 세포에서 25nt 이상의 폴리(A) 테일 길이를 갖는 HBV mRNA의 구아닐화된 테일의 분율(n=1 TAIL-seq 실험). f, TENT4-고갈된, HCMV-감염된 HFF 세포에서 폴리(A) 테일 길이가 25nt 이상인 HCMV RNA의 구아닐화된 테일의 분율(n=1 TAIL-seq 실험). g, TENT4-고갈된 HepG2.2.15 세포에서 HBV mRNA 수준은 2개의 개별 프라이머 세트를 사용한 RT-qPCR에 의해 측정되었다. 데이터는 평균±s.e.m.으로 표시된다(n=3 독립 실험). **P<0.01; 양측 학생의 t-검정(Student’s t-test). h, HBV mRNA의 반감기는 2개의 개별 프라이머 세트를 사용한 RT-qPCR에 의해 측정되었다. 데이터는 평균±s.e.m.으로 표시된다(n=3 독립 실험). GAPDH mRNA는 정규화에 사용된다.
도 2는 HBV RNA는 HBV의 PRE를 통한 TENT4의 주요 mRNA 기질임을 뒷받침하는 실험 결과들을 나타낸다. a, HBV 지놈(NCBI U95551.1)에 걸친 fCLIP-seq 라이브러리의 표준화된 판독 범위. HBV의 PRE 영역은 노란색으로 강조 표시되어 있다. HBV 전사체 및 이의 각각의 코딩 서열 영역은 아래에 참고로 나타나 있다. 입력(input) 및 NMG 라이브러리는 음성 대조군으로서 사용되었다. b, fCLIP-seq 피크 클러스터의 풍부도(abundance, x 축) 및 농축 점수(enrichment score, y 축)의 스캐터 플롯(scatter plot). HBV PRE는 빨간색 점으로 나타나 있다. 이 분석에서는 크기-일치된 입력 라이브러리(size-matched input library)가 음성 대조군으로 사용되었다.
도 3은 PRE의 스템-루프 구조는 필수적이지만 HBV mRNA의 TENT4-의존성 RNA 테일링(tailing)에는 충분하지 않을 수 있음을 보여주는 도면이다. a, 3' UTR에서 PRE의 돌연변이 및 하위영역을 보유하는 파이어플라이 루시퍼레이즈 리포터 컨스트럭트의 개략도. 파란색, La-결합 모티프(motif); 초록색, 스템-루프 알파; 및 빨간색 별표, 점 돌연변이(point mutation)의 영역. b, 모(parental) HeLaT(회색) 및 TENT4 KO(적색) 세포에서 PRE의 하위영역을 함유하는 리포터의 파이어플라이 루시퍼레이즈 활성. 데이터는 평균±s.e.m.으로 표시된다(n=7 PRE, PREα 및 PREβ에 대한 독립 실험, n=6 다른 모든 것에 대한 독립 실험). 레닐라 및 대조군 벡터 모두의 루시퍼레이즈 활성이 정규화에 사용되었다. *P<0.01, **P<0.001; 양측 t-검정(two-sided t-test). c, Hire-PAT 분석에 의해 측정된 리포터 RNA의 폴리(A) 테일 길이의 분포. PREα 및 PREβ 서열을 함유하는 리포터 컨스트럭트는 TENT4 고갈 후 HEK293T 세포로 형질감염되었다. d, 이소적으로(ectopically) 발현된 야생형 TENT4 또는 촉매적으로 불활성인 돌연변이를 갖는 모세포(parental) 또는 TENT4 KO 세포에서 PRE 리포터 컨스트럭트의 파이어플라이 루시퍼레이즈 활성. 데이터는 평균±s.e.m.으로 표시된다(n=3 독립실험). 레닐라 및 대조군 벡터 모두 정규화에 사용되었다. *P<0.05, **P<0.01, ***P<0.001; 양측 학생의 t-검정( two-sided Student’s t-test). e, 3' UTR에서 WPRE의 하위영역을 보유하는 파이어플라이 루시퍼레이즈 리포터 컨스트럭트의 개략도. f, TENT4 KO 세포에서 WPRE 리포터 컨스트럭트의 파이어플라이 루시퍼레이즈 활성. 데이터는 평균±s.e.m.으로 표시된다(n=3 Wβ에 대한독립 실험, n=7 다른 모든 것에 대한 독립 실험). 레닐라 및 대조군 벡터 모두의 루시퍼레이즈 활성은 정규화에 사용되었다. *P<0.05, **P<0.01; 양측 학생의 t-검정. g, HBV PRE, 돌연변이 HBV PRE 및 WPRE의 스템-루프 구조. h, TENT4 KO 세포에서 a에 나타낸 돌연변이 PRE 리포터 컨스트럭트의 파이어플라이 루시퍼레이즈 활성. 데이터는 평균±s.e.m.으로 표시된다(n=4 독립 실험). 레닐라 및 대조군 벡터 모두의 루시퍼레이즈 활성은 정규화에 사용되었다. *P<0.05, **P<0.01; 양측 학생의 t-검정.
도 4는 HCMV RNA2.7의 스템-루프 구조는 TENT4-의존적 조절의 원인이 되는 cis-작용(cis-acting) RNA 요소임을 보여주는 도면들이다. a, RNA2.7-형질감염된 HEK293T 세포에서 포름 알데히드 가교결합(crosslinking) 및 항-TENT4A 항체에 의한 면역침전 후 표시된 RNA의 RT-qPCR. 데이터는 평균±s.e.m.으로 표시된다(n=3 독립 실험). NMG에 의한 면역침전은 표준화에 사용되었다. **P<0.01, ***P<0.001; 양측 학생의 t-검정. b, 3' UTR에서 HCMV RNA2.7의 하위영역 및 돌연변이를 보유하는 파이어플라이 루시퍼레이즈 리포터 컨스트럭트의 개략도. 초록색, 스템-루프 및 빨간색 별표, 점 돌연변이(point mutation). HCMV RNA2.7의 스템-루프 구조 및 돌연변이는 좌측에 나타나 있다. 1E mut(1E 돌연변이) 컨스트럭트에서, 루프에서는 빨간색 뉴클레오타이드 및 루프 기저의 C는 표시된 바와 같이 돌연변이 된다. FRG, 단편. c-e, 모세포(parental) 및 TENT4 KO 세포에서 리포터의 파이어플라이 루시퍼레이즈 활성. 데이터는 평균±s.e.m.으로 표시된다. RNA2.7의 하위영역을 갖는 리포터(n=3 독립 실험)(c), RNA2.7의 단편 1(1-513)의 부분 결실 돌연변이(n=3 독립 실험)(d) 및 컨스트럭트 1D, 1E 및 1E의 스템-루프 돌연변이(n=3 독립 실험)(e). 레닐라 및 대조군 벡터 모두의 루시퍼레이즈 활성은 정규화에 사용되었다. *P<0.05, **P<0.01; 양측 학생의 t-검정.
도 5는 ZCCHC14를 포함한, SAM 도메인-함유 단백질은 스템-루프 구조에 결합하고 HBV mRNA를 조절한다는 것을 나타내는 도면들이다. a, HEK293T 세포 용해물(cell lysate)로부터 SL2.7 RNA 풀다운(pulldown)의 질량분석(mass spectrometry analysis)(n=2 질량 분석 실험). SL2.7 돌연변이 및 '오직 비드(bead only)' 샘플이 음성 대조군으로 사용되었다. 단백질 농축 점수(enrichment score)는 돌연변이 데이터에 대한 SL2.7 샘플로부터의 LFQ(label-free quantification, 비-표지 정량) 강도의 log2 배 변화로서 계산되었다. 스펙트럼 계수는 농축(enrichment) 후보를 여과하기 위하여 사용되었다. b, 상단(top), 추정상의 RNA-결합 SAM 도메인을 갖는 단백질의 계통수(phylogenetic tree). Saccharomyces cerevisiae(Sc), Schizosaccharomyces pombe(Sp), Candida albicans(Ca), C. elegans(Ce), Drosophila melanogaster(Dm), Danio rerio(Dr), Xenopus laevis(Xl), Mus musculus(Mm) 및 Homo sapiens(Hs). 별표는 계통수에 기초한 수동의 유전자 이름 할당을 나타낸다. UniProt ID는 방법 섹션에 나열되어 있다. 하단(bottom), SAM 도메인을 가진 3개의 인간 단백질의 도메인 구조. 주황색, SAM 도메인; 자주색, CCHC 징크 핑거(zinc finger, ZnF) 도메인. c, 표시된 항체를 사용한 웨스턴 블롯 후, HEK293T 세포로부터 비오티닐화된 SL2.7의 풀다운. 별표는 교차-반응 밴드를 나타낸다. d, ZCCHC14-고갈된 및 SAMD4A/B-고갈된 HepG2.2.15 세포에서 HBV mRNA 수준은 2세트의 프라이머를 사용한 RT-qPCR에 의해 측정되었다. 데이터는 평균±s.e.m.으로 표시된다(n=4 독립 실험). *P<0.05, **P<0.01, ***P<0.001; 양측 t-검정. c에 대한 자르지 않은 블롯 및 d의 그래프에 대한 소스 데이터는 온라인에서 이용 가능하다.
도 6은 세포질 ZCCHC14는 스템-루프 구조로 RNA를 보호하기 위해 TENT4를 모집한다(recruit)는 것을 나타내는 도면들이다. a, HBV mRNA의 구아닐화된 테일의 분율은 ZBHC14-고갈된 HepG2.2.15 세포에서 25nt 이상의 폴리(A) 테일 길이를 갖는 mRNA에 대하여 계산되었다. b, 대조군(회색) 및 ZCCHC14-고갈된 HepG2.2.15 세포(빨간색)에서 HBV mRNA의 전체 폴리(A) 테일 길이 분포. 중앙값은 수직의 점선으로 표시되며 중앙값은 괄호 안에 나타나 있다. c, ZCCHC14-고갈된 HEK293T 세포에서 HCMV RNA2.7 1E, HBV PREα, WHV WPRE(Wγ+Wα) 및 이의 각각의 돌연변이(1E mut, α mut2 및 Wγ+Wα mut)를 보유하는 리포터의 파이어플라이 루시퍼레이즈 활성. 데이터는 평균±s.e.m.으로 표시된다(n=4 PREα 및 α mut2에 대한 독립 실험, n=3 다른 모든 것에 대한 독립 실험). 중요하게, WPRE 돌연변이 리포터(Wγ+Wα mut)는 WPREα 스템-루프 구조 모두에서 점 돌연변이로 구성된다(보조 도 6b). 레닐라 및 대조군 벡터 모두의 루시퍼레이즈 활성은 정규화에 사용되었다. *P<0.05; 양측 학생의 t-검정. d, HepG2.2.15 세포에서 항-ZCCHC14 항체로 면역침전 후 지시된 RNA의 RT-qPCR. 데이터는 평균±s.e.m.로 표시된다(n=3 독립 실험). 정상 토끼 IgG를 사용한 면역침전은 표준화에 사용 되었다. *P<0.05; 양측 학생의 t-검정. e, ZCCHC14 단백질의 국소화(localization)는 초원심세포분획법(subcellular fractionation) 및 웨스턴 블롯팅에 의해 HeLaT 세포에서 검사되었다: 세포질(Cyto), 막(Memb) 및 핵(Nuc). GAPDH(세포질), GM130(골지) 및 히스톤 H3(핵)은 분획 마커로 사용되었다. f, 항-TENT4A 및 항-TENT4B에 의한 면역침전 후 웨스턴 블롯은 HeLaT 세포질 추출물에서 TENT4A/B와 ZCCHC14 사이의 물리적 상호 작용을 측정하기 위해 사용되었다. 세포 추출물은 RNase A로 처리되었다. GAPDH는 로딩 대조군으로 사용되었다. g, 제안된 모델. HBV mRNA 및 HCMV RNA2.7은 표적 혼합 테일링(targeted mixed tailing)을 유도하기 위하여 CNGGN pentaloop를 통해 TENT4-ZCCHC14 복합체를 모집하며(recruit), 이는 이후 바이러스 RNA를 세포 붕괴 인자로부터 보호한다.
도 7은 바이러스 RNA의 광범위한 3' 말단 테일(3' end tail) 변형을 나타내는 도면들이다. a, HBV mRNA는 HepG2.2.15 세포에서 고도로 혼합된 테일(G: 구아닐화(guanylation) U: 우리딘화(uridylation), C: 시티딜화(cytidylation))이다. 각 변형의 분율은 이의 해당 말단(terminal) 및 내부(internal) 변형이 포함된다. 시티딜화 및 우리딘화 테일과 바이러스 mRNA의 분율은 폴리(A) 테일 길이가 25nt 이상인 것에 대하여 계산되었다(n=2 TAIL-seq 실험). b, HCMV RNA는 또한 HCMV-감염된 HFF 세포에서 고도로 혼합된 테일이다. HCMV RNA2.7(VRNA2.7)은 특히 실질적으로 혼합된 테일이다(n=1 TAIL-seq 실험). c, HCMV-감염된 HFF 세포에서 세포(회색) 및 바이러스(노란색) mRNA의 구아닐화 테일의 유전자-수준 분석. d, RT-qPCR에 의한 siRNA 녹다운(knockdown) 확인. e, TENT4-고갈된(depleted) HepG2.2.15 세포에서 HBV mRNA의 혼합된 테일의 분율 감소. f, TENT4A/B 발현은 HCMV-감염된 HFF 세포에서 유도된다. HCMV-감염된 HFF 세포에서 TENT4A 및 TENT4B RNA 수준은 RT-qPCR(n=1)에 의해 측정되었다. g, TENT4-고갈된 HCMV-감염된 HFF 세포에서 HCMV RNA2.7의 혼합된 테일의 분율에서의 감소. h, HBV mRNA는 TENT4-고갈된 HepG2.2.15 세포에서 더 짧은 폴리(A) 테일 길이를 나타낸다. 중앙값은 수직의 점선으로 표시되고 괄호 안에 나타나 있다. i, HCMV-감염된 HFF 세포에서 TENT4 고갈 후 바이러스 mRNA의 전체 폴리(A) 테일 길이 분포. j, TENT4 고갈 후 HCMV RNA2.7의 폴리(A) 테일 길이 분포. k, HBV 전사체 및 이의 해당 CDS 영역이 나타나 있다. 막대는 RT-qPCR 앰플리콘(#1-3)의 위치를 나타낸다. l, TENT4-고갈된 HepG2.2.15 세포에서 폴리(A) 테일 길이에 걸친 HBV mRNA의 테일 변형. m, HCMV RNA2.7의 반감기는 TENT4 고갈 후 HCMV-감염된 HFF 세포에서 RT-qPCR(n=3 독립 실험)에 의해 측정되었다. GAPDH mRNA는 정규화(normalization)에 사용되었다. 평균이 계산되었다. a-b, d-g, m의 그래프 데이터는 소스 데이터로 이용 가능하다.
도 8은 TENT4A/B 및 HBV mRNA 상호 작용의 분석 및 확인 결과를 나타낸 도면들이다. a, TENT4B-결합 RNA 단편이 HBV의 PRE 영역 내(노란색으로 강조 표시됨)에서 다시 농축된다(enriched). HBV 지놈(NCBI: U95551.1)에 걸친 fCLIP-seq 라이브러리의 표준화된 판독 범위(standardized read coverage). X-축 스케일은 도 2a와 동일하다. b, 항-TENT4A 및 항-TENT4B에 의한 면역침전(immunoprecipitation) 후 RT-qPCR은 HepG2.2.15 세포에서 TENT4-결합 RNA의 농축(enrichment)을 측정하기위해 사용되었다(n=3 독립 실험). 정상 마우스 IgG를 사용한 면역침전은 정규화에 사용되었다. 평균은 계산되었고 오차 막대는 SEM을 나타낸다. **P <0.01, ****P <0.0001; 양측 t 검정(two-sided t test). b의 그래프 데이터는 소스 데이터로 이용 가능하다.
도 9는 PRE 리포터의 TENT4-의존적 조절을 확인한 결과를 나타내는 도면들이다. a, 웨스턴 블롯팅에 의한 녹아웃(Knockout) 확인. GAPDH는 로딩 대조군으로 사용되었다. b, PRE의 하위영역을 보유하는 파이어플라이(firefly) 리포터의 RNA 수준은 RT-qPCR에 의해 측정되었다(PRE:PREα:PREβ, n=4; αΔ1, n=2; αΔ2, n=1 독립 실험). 레닐라(renilla) 및 대조군 벡터 모두의 mRNA 수준은 정규화에 사용되었다. 평균은 계산되었고 오차 막대는 SEM을 나타낸다. *P<0.05; 양측 t 검정(two-sided t test). c, HEK293T 세포에서 웨스턴 블롯팅에 의한 siRNA 녹다운 확인. GAPDH는 로딩 대조군으로 사용되었다. d, TENT4-고갈된 HEK293T 세포에서 PRE 리포터 컨스트럭트의 파이어플라이 루시퍼레이즈(firefly luciferase) 활성(PRE:PREα:PREβ, n=7; αΔ1, n=6; αΔ2, n=5 독립적 실험). 레닐라 및 대조군 벡터 모두의 루시퍼레이즈 활성은 정규화에 사용되었다. 평균은 계산되었고 오차 막대는 SEM을 나타낸다. *P<0.05, **P<0.01, ***P <0.001; 양측 t 검정. e, KO 세포에서 웨스턴 블롯팅에 의한 과발현 확인. GAPDH는 로딩 대조군으로 사용되었다. f, 이소성으로(ectopically) 발현된 TENT4 야생형 또는 돌연변이형을 갖는 TENT4 KO 세포에서 구제 실험(rescue experiment)에 사용된 파이어플라이 리포터의 RNA 수준(n=3 독립 실험)은 RT-qPCR(n=3 독립 실험)에 의해 측정되었다. 레닐라 및 대조군 벡터 모두의 mRNA 수준은 정규화에 사용되었다. 평균은 계산되었고 오차 막대는 SEM을 나타낸다. *P<0.05, **P<0.01; 양측 t 검정. 패널 a, c, e에 대한 자르지 않은 블롯 및 b, d, f에 있는 그래프에 대한 데이터는 소스 데이터로 이용 가능하다.
도 10은 RNA2.7 리포터의 TENT4-의존적 조절의 확인 결과를 나타낸다. a, 항-TENT4A를 이용한 면역침전은 RNA2.7-형질감염된 HEK293T 세포에서 웨스턴 블롯팅에 의해 확인되었다. 정상 마우스 IgG(Normal mouse IgG, NMG)는 음성 대조군으로 사용되었다. RNA2.7 전사체는 RT-qPCR 앰플리콘의 위치를 나타내는 막대와 함께 나타나 있다. b-e, 다음을 보유하는 파이어플라이 리포터의 RNA 수준 b, RNA2.7의 하위영역(n=3 독립 실험), c, RNA2.7의 단편 1(1-513)의 결실 컨스트럭트(n=3 독립 실험), d, 컨스트럭트 1D(314-413), 1E(414-513) 및 스템-루프(stem-loop) 돌연변이 1E(n=3 독립 실험) 및 e, 모세포 및 TENT4 KO 세포에서 컨스트럭트 SL2.7(414-463) 및 대조군 (n = 3 독립 실험). 레닐라 및 대조군 벡터 모두의 mRNA 수준이 정규화에 사용되었다. 평균은 계산되었고 오차 막대는 SEM을 나타낸다. *P<0.05, **P<0.00.0; 양측 t 검정. 패널 a에 대한 자르지 않은 블롯 및 b-e에 있는 그래프에 대한 데이터는 소스 데이터로 이용 가능하다.
도 11은 ZCCHC14 및 SAMD4A/B 녹다운을 확인한 도면이다. RT-qPCR(n=4 독립 실험) 및 HepG2.2.15 세포에서의 웨스턴 블롯팅에 의한 siRNA 녹다운 확인. 평균은 계산되었고 오차 막대는 SEM을 나타낸다. ****P<0.0001; 양측 t 검정. GAPDH는 로딩 대조군으로 사용된다.
도 12는 ZCCHC14 녹다운, 스템-루프-의존적 테일 조절, 및 면역침전의 확인 결과를 나타낸 도면이다. a, ZCCHC14-고갈된 HEK293T 세포에서 웨스턴 블롯팅에 의한 siRNA 녹다운 확인. GAPDH는 로딩 대조군으로 사용되었다. 점선은 같은 겔(gel)에서 불연속적인 레인(lane)을 나타낸다. b, WPREα의 스템-루프 구조 및 이의 각각의 돌연변이. c, Hire-PAT 분석에 의해 측정된 리포터 RNA의 폴리(A) 테일 길이의 분포. 리포터 컨스트럭트는 ZCCHC14 고갈 후 HEK293T 세포 내로 형질감염되었다. d, 항-ZCCHC14을 이용한 면역침전은 HepG2.2.15 세포에서 웨스턴 블롯팅에 의해 확인되었다. 정상 토끼 IgG(Normal rabbit IgG, NRG)는 음성 대조군으로 사용되었다. e, 항-TENT4A 및 항-TENT4B을 이용한 면역침전 후의 웨스턴 블롯팅은 HepG2.2.15 및 일차(primary) HFF 세포에서 TENT4A/B와 ZCCHC14 사이의 물리적 상호 작용을 측정하기 위해 사용되었다. 세포 추출물은 RNase A로 처리되었다. 정상 마우스 IgG(NMG)는 음성 대조군으로 사용되었다. 별표는 교차-반응 밴드(cross-reacting band)를 나타낸다. 패널 a, d-e에 대한 자르지 않은 블롯은 소스 데이터로 이용 가능하다.
도 13은 pentaloop를 포함하는 stem-loop 구조를 나타낸다.
본 발명의 stem-loop 구조를 타겟 RNA 서열에 삽입하는 방법은 종래 공지된 다양한 방법에 의해 수행할 수 있으며, 특별히 제한되는 것은 아니다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
실험방법
실시예 1: TAIL-seq 라이브러리 준비 및 데이터 처리
TAIL-seq는 종래 알려진 바와 같이 수행되었다[3]. 요약하면, ~50μg의 DNaseI(Takara, 2270A) 처리 된 총 RNA (>200 nt)를 사용하여 Ribo-Zero 키트(Epicentre, MRZH11124 (discontinued) for primary HFF library or Illumina, TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat, 20020596 for HepG2.2.15 library)에 의해 ribosomal RNA를 2회 고갈시켰다. rRNA-고갈된 RNA를 3'어댑터에 연결시키고 RNase T1(Ambion)에 의해 부분적으로 단편화시켰다. 단편화 된 RNA를 스트렙타비 딘 비드(Invitrogen)로 풀다운하고, 5' 인산화시키고, 6% 우레아-PAGE 겔(500-1,000 nt)로 정제하였다. 정제된 RNA를 5' 어댑터에 연결시키고 역전사시켜 PCR로 증폭시켰다. 라이브러리를 PhiX control library v.3 (Illumina) 및 스파이크-인 혼합물과 함께 Illumina 플랫폼 (MiSeq)에서 페어드-엔드 런(paired-end run)(51 × 251 사이클)에 의해 시퀀싱했다. TAIL-seq 시퀀싱 데이터는 수탁번호 GSE146600을 사용하여 국립 생명 공학 정보 센터 (NCBI) 유전자 발현 옴니버스 (GEO) 데이터베이스에 기탁되었다. TAIL-seq 분석은 Tailseeker v.3.1.5[9]를 사용하여 수행되었다. 간략하게, Read 1을 유전자 식별에 사용하였고, Read 2를 사용하여 3' 말단 변형을 검출하고 폴리 (A) 테일의 길이를 측정하였다. 각각의 TAIL-seq 라이브러리에 대해, Read 1은 STAR 2.5.2b [50]를 갖는 인간 게놈 GRCh38 및 bowtie2.2.6 [51]을 갖는 HBV 게놈 NCBI U95551.1 또는 HCMV 게놈 NCBI GU937742.2에 맵핑되었다. 폴리(A) 테일 길이가 25 nt 이상인 TAIL-seq 단편만 이전과 같이[6] 사용되었다. Read 2 중, 말단 또는 내부 모노-구아닐화(또는 -사이티딜화, -유리딜화)를 갖는 3' 말단 10-mer 서열을 조사하여 폴리(A) 테일의 비-아데노신 혼입의 분율(fraction)을 추정하였다.
실시예 2: fCLIP-seq 라이브러리 준비 및 데이터 처리
fCLIP-seq는 약간의 조정으로 이전에 설명한대로 수행되었다[16, 52]. 간단히 말하면, 2개의 150 mm 디쉬 상의 HepG2.2.15 세포를 0.1% 파라포름알데히드(Pierce, 28906)로 가교시키고, 수집하고 용해시켰다. 각각의 15 μg의 항체 (NMG, Santa Cruz, sc-2025; TENT4A, 실험실 제작; TENT4B, 실험실 제작)를 단백질 A 및 G 세파로스 비드(1:1 혼합, 총 20 μl, GE Healthcare, 17-5138-01 및 17-0618-01 각각)에 컨쥬게이트시켰다. 용 해물을 항체-접합 된 비드와 함께 배양하고, 용리액으로부터 RNA를 정제한 후 DNaseI 처리 및 세척을 수행하였다. 그 다음, 1 ㎍의 input RNA 또는 각 샘플로부터의 RNA를 라이브러리에 대해 제조하였다. rRNA는 Ribo-Zero 키트(Illumina, TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat, 20020596)에 의해 2회 고갈시켰다. rRNA-고갈된 RNA를 3 '어댑터에 연결시키고, 6% 우레아-PAGE 겔(80-500 nt, 초음파 처리에 의해 단편화된 50-470 nt RNA에 상응함)에 의해 정제시켰으며, 이어서 5' 인산화, 5' 어댑터 연결, 역 전사 및 PCR 증폭을 수행하였다. fCLIP-seq 라이브러리는 PhiX control library v.3(Illumina)을 이용하여 Illumina 플랫폼(MiSeq) 상에서 페어드-엔드 런(151×151 사이클)으로 시퀀싱하였다. fCLIP-seq 시퀀싱 데이터는 수탁번호 GSE146597로 NCBI GEO 데이터베이스에 저장되었다.
각 fCLIP-seq 라이브러리에 대해 페어-엔드 판독 값을 pear v.0.9.10 [53]으로 조립하였고 STAR 2.5.2b[50]에 의해 인간 게놈 GRCh38을, bowtie2.2.6[51]에 의해 HBV 게놈 NCBI U95551.1을 얼라인하였다. fCLIP-seq 라이브러리의 Raw read coverage를 bedtools v.2.26.0으로 계산하였다. 세포 mRNA의 fCLIP-seq 피크 클러스터는, 공변량으로서, 200 nt(-z 200)의 클러스터 크기, 내부 정규화 (-n), 로그 변환 (-l) 및 NMG 라이브러리를 갖는 Piranha v1.2.1[54]을 사용하여 추정하였다. 참고로, HBV PRE는 약 400nt에 걸쳐있다. 피크 클러스터의 농축 스코어는 TENT4 fCLIP-seq 라이브러리 및 NMG 라이브러리의 판독 값의 log2 비에 의해 계산되었다. 입력 라이브러리는 이 분석의 음성 대조군(negative control)으로 사용되었다[55]. 판독 범위의 기술적 배경을 설명하기 위해, HBV 게놈에 대한 Hodges-Lehmann 추정이 사용되었다. 구체적으로, 길이 n의 HBV 게놈이 주어지면, 다음 세트의 중앙값(median)을 계산한다.
{(Xi + Xj)/2 : 1≤i≤j≤n}
여기서, Xi와 Xj는 각각 위치 i와 j에서의 원시 판독 커버리지(raw read coverage)이다. 그런 다음 이 Hodges-Lehmann 추정으로 원시 판독 커버리지를 정규화(normalized)하고 ggplot2 R 패키지를 사용하여 시각화했다.
실시예 3: 세포 배양, 형질 감염 및 악티노마이신 D 처리
이 연구에 사용 된 모든 세포주는 마이코플라스마-음성을 시험했다. HeLaT는 TUT4 유전자에서 null 돌연변이를 갖는 HeLa(서울 대학교 C.-H. Chung으로부터 제공받음)로부터 유래되었다. HeLaT 및 HEK293T (서울대학교 S. Kim으로부터 제공받음) 세포는 ATCC (STR 프로파일링)에 의해 인증되었다. HepG2.2.15, HeLaT 및 HEK293T 세포를 10% FBS(Welgene, S001-01)를 함유하는 DMEM(Welgene, LM 001-05)에서 성장시켰다. 프라이머리 HFF (ATCC SCRC-1041) 세포를 10% FBS(HyClone), GlutaMAX-1 (Gibco) 및 페니실린-스트렙토마이신(Gibco)을 함유하는 DMEM(HyClone)에서 성장시켰다. 형질 감염 전에, 프라이머리 HFF를 항생제가 없는 배지에서 성장시켰다.
조합 넉다운(combinatorial knockdown)의 경우, 표적 유전자에 대해 동일량의 small-interfering RNA 또는 GAPmer를 혼합하여 최종 농도가 다음에 설명 된 바와 같이 되도록 하였다. TENT4A 및 TENT4B 녹다운의 경우, 0, 2 및 4 일에 리포펙타민 RNAiMAX (Invitrogen)에 의해 HepG2.2.15 세포를 100 nM siRNA로 형질감염시키고 6일에 수집하였다. ZCCHC14, SAMD4A 및 SAMD4B 녹다운에 대해서는, HepG2.2.15 세포를 0일 및 2일에 리포펙타민 RNAiMAX (Invitrogen)에 의한 100 nM siRNA 또는 GAPmer에 의해 형질감염시키고, 4 일에 수집하였다. HEK293T 세포는 0일에 리포펙타민 3000에 의해 RNA 면역 침전을 위한 RNA2.7-발현하는 pCK 벡터로 형질 감염시켰고 2일에 수집하였다. 프라이머리 HFF 세포는 0 일 및 2 일에 DharmaFECT 1(Dharmacon)에 의해 20 nM siRNA로 형질 감염시켰고, 5일에 수집하였다. siRNA의 서열 정보는 표 1에 제시되어있다.
siRNAs (sense strand)
siCont only for primary HFF CCUACGCCACCAAUUUCGU
siCont AccuTarget™ Negative Control siRNA from Bioneer Inc (Seoul, South Korea)
siTENT4A-1 CUACGGUACCAAUAAUAAA
siTENT4A-2 GGAAGAAUCAUCAAAGUAA
siTENT4A-3 CCAAACAGAGACGCCGAAA
siTENT4A-4 GCGAAUAGCCACAUGCAAU
siTENT4A only for HepG2.2.15 ON-TARGETplus SMART pool (Dharmacon)
siTENT4B-1 GGACGACACUUCAAUUAUU
siTENT4B-2 GGCCUUUGAUUAUGCCUAC
siTENT4B-3 GCGCUGACGUCCAGAUAUU
siTENT4B-4 CCUAUUGCAGAGGGACCUU
siZCCHC14-1 GCAUUUUAUGUGGAGCGAA
siZCCHC14-2 CCUUCUCACGUGUUGAAAA
siZCCHC14-3 GAAUAAAUUUGAGUCUCUU
siSAMD4A-1 GGAUAUCGACAGCAAAGAA
siSAMD4A-2 CAUCAUGAAACAAGGAAGA
siSAMD4B-1 CACUAGAGAUGCAGAACUA
siSAMD4B-2 CCUACUCAAUCGAGAGCAA
siSAMD4B-3 AGGAGAACAUCACCAGUUA
본 발명자들은 HepG2.2.15에서의 더 나은 녹다운 효율을 위해 ON-TARGETplus SMARTpool(Dharmacon)로부터 TENT4A에 대한 siRNA와 Antisense LNA GapmeR Standard (Qiagen, 339511 LG00236046-DDA)로부터의 SAMD4A에 대한 GAPmer를 구입했다. 액티노마이신 D (Sigma, A9415, 4 μg ml-1)를 HepG2.2.15 세포에 첨가하여 전사를 차단하고 표시된 시간에 세포를 수집 하였다.실시예 4: HCMV 감염
감염성 HCMV 입자는 전기천공법(electroporation)(Invitrogen, Neon)에 의해 HCMV Toledo BAC DNA(프린스턴 대학 T. Shenk로부터 제공 받음)를 프라이머리 HFF 세포 내로 형질 감염시킴으로써 제조하였다. 100% 세포 변성 효과(cytopathic effect)가 관찰될 때, 세포 배양 상청액을 수집하였고, 원심 분리하여 세포 잔해물을 제거하고 -80℃에서 1 ml 분취량( aliquots)으로 저장하였다. 바이러스 스톡을 적정하기 위해, 커버 유리에서 성장한 프라이머리 HFF에, 희석된 바이러스 스톡을 1 시간 동안 접종하고 접종 24시간 후에 3.7% 포름알데히드로 고정시켰다. 세포를 0.1% 트리톤 X-100을 사용하여 투과화시키고(permeabilized), 블록킹 버퍼(인산 완충 식염수 중 2% 소 혈청 알부민)와 함께 배양하였고, HCMV IE1 항체(MAB810R; Millipore)로 염색한 후 FITC-접합된 항-마우스 항체(115-095-146; Jackson Laboratories) 및 DAPI-함유 용액 (H1200; Vector Laboratory)으로 마운팅하였다. HCMV IE1 양성 세포의 수를 세고, 총 세포에 대한 IE1-양성 세포의 비를 계산함으로써 MOI(the Multiplicity of infection)를 결정하였다. HCMV 감염의 경우, 프라이머리 HFF 세포를 1시간 동안 무 혈청 DMEM에 희석된 HCMV(MOI, 2)와 함께 배양하고, PBS로 세척하고 추가 배양을 위해 DMEM에서 배양하였다.
실시예 5: 플라스미드 구축
FLAG 태그를 제외하고는 전술한 야생형 TENT4A 및 TENT4B 이형체들(각각 792 및 666 aa)[6]을 사용하였다. 촉매 사멸 돌연변이체에 대한 점 돌연변이가 도입되었다(각각, TENT4A의 경우 D352A, TENT4B의 경우 D326A). PRE 리포터 컨스트럭트의 경우, PRE(1,154-1,687 bp), PREα(1,154-1,351 bp), PREβ(1,352-1,687 bp), αΔ1(1,276-1,351 bp) 및 αΔ2(1,154-1,275 bp)가 HepG2.2.15 상보적 DNA에서 증폭되었고, pmirGLO-3XmiR-1 vector[6]에서 반딧불이 루시퍼라제 mRNA 서열의 3' UTR 영역으로 도입되었다. La-결합 모티프 및 스템-루프 α에 대한 점 돌연변이는 이전에 기재된 돌연변이체[30]와 동일하였다. α-mut1, α-mut2 및 α-mut3은 PCR-지정 돌연변이 유발에 의해 생성되었다. WPRE 리포터 구성의 경우, WPRE(1,095-1,670 bp), Wγ+Wα(1,095-1,507 bp), Wα+Wβ(1,300-1,670 bp), Wγ(1,093-1,299 bp), Wα(1,300-1,507 bp), Wβ(1,508-1,670 bp)는 pLenti-CMV 벡터 (Addgene, 17492)로부터 증폭되었고, pmirGLO-3Xmir-1 벡터에서 반딧불이 루시퍼라제의 3' UTR로 도입되었다. WPREα의 CNGGN 펜타루프에 대한 점 돌연변이는 PRE 돌연변이체와 유사한 방식으로 디자인되었다. RNA2.7 컨스트럭트의 경우, FRG1(1-513 bp), FRG2(414-913 bp), FRG3(814-1,313 bp), FRG4(1,214-1,713 bp), FRG5(1,614-2,113 bp), FRG6(2,014- 2,513 bp), 1ΔA(1-513 bp, Δ1-100 bp), 1ΔB(1-513 bp, Δ101-200 bp), 1ΔC(1-513 bp, Δ201-300 bp), 1ΔD(1-513 bp, Δ301-400 bp), 1ΔE(1-513 bp, Δ401-513 bp), 1D(301-400 bp), 1E(401-513 bp) 및 SL2.7(414-463 bp)은 HCMV 감염된 프라이머리 HFF cDNA로부터 증폭되었고, pmirGLO-3Xmir-1 벡터에서 3' UTR 영역으로 도입되었다. 1E 및 SL2.7 돌연변이 컨스트럭트는 PRE 돌연변이체와 동일한 방식으로 생성되었다. RNA 면역 침전을 위해, RNA2.7 (1-2,513 bp)을 pmirGLO-3Xmir-1 벡터로부터 증폭시켰고, pCK 벡터로 서브클로닝 하였다.
실시예 6: TENT4A 및 TENT4B 녹아웃 세포 제조
TENT4A 및 TENT4B의 제거를 위해, CRISPR-Cas 게놈 편집은 T7 엔도뉴클레아제I (NEB, M0302)이 Surveyor 뉴클레아제 대신 사용된 마이너 적용으로 이전에 기술된 바와 같이[56] 수행되었다. 24-웰 플레이트상의 6E4 HeLaT 세포를 먼저 TENT4A에 대해, single-guide RNA (agccacgttgtgcttccgcg, PAM 서열은 GGG)를 갖는 300ng pSpCas9(BB)-2A-GFP-px458 플라스미드 (Addgene no. 48138)와 함께 Metafectene(Biontex, T020)을 사용하여 형질 감염시켰다. 이 HeLaT 모 세포는 HeLa로부터 유래되었고 TUT4 유전자에 null 돌연변이를 함유한다. 녹아웃을 확인하기위한 단일 세포 스크리닝 및 생거 시퀀싱(Sanger sequencing) 후, 모체 및 변경된 게놈 서열이 표 2에 열거되었고, 삽입 된 서열은 진한글씨 및 밑줄로 표시하였다.
Genomic sequences of TENT4A and TENT4B KO HeLaT cells
Parental GAGCAAGCCCTGCGGAAGCACAACGTGGCT
TENT4A KO GAGCAAGCCCTGCGG G AAGCACAACGTGGCT
GAGCAAGCCCTGCG CAAGATGGACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGATCCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGAA GAAGCACAACGTGGCT
GAGCAAGCCCTGCG CCGGTTCTTCCGTCTGGTGTATCTTCTTCTGGCGGTTCTCTTCAGCCGGGTGGCCTCGGCTGTTTCGCCGCTGTCGAACAGCAGGGCTCCGATCAGGTTCTTCTTGATGCTGTGCCGGTCGGTGTTGCCCAGCACCTTGAATTTCTTGCTGGGCACCTTGTACTCGTCG GAAGCACAACGTGGCT
Parental TAGTGACATCGACCTAGTGGTGTTTGGGAA
TENT4B KO TAGTGACATCGACCTAGT--TGTTTGGGAA
TAGTGACATCGACCTAGT- A -AGTTTGGGAA
TAGTGACATCGACCTAGTGGT T GTTTGGGAA
TENT4A 녹아웃 세포를 사용하여, TENT4B를 TENT4B에 대해 sgRNA (gacatcgacctagtggtgtt, PAM 서열은 TGG)로 추가로 제거하였다. 변경된 게놈 서열은 표 2에 또한 열거되어 있으며, 삽입 및 결실된 서열은 각각 적색 및 점선으로 표시하였다.
실시예 7: TENT4A 및 TENT4B 항체 준비
마우스를 TENT4A 항원(792aa 이형체로부터의 126-571aa, NCBI NP_008930.2) 또는 TENT4B 항원(666aa 이형체로부터의 106-533 aa, NCBI XP_006721308.1)으로 면역시키고 사멸시켰다. 수집된 비장 세포를 Sp2/O 골수종과 융합시키고, 고친화도 항체를 생성하는 하이브리도마 세포를 선택하였다. 마우스에 하이브리도마 세포를 복강 내 주사한 후 복수를 수득하고 (Youngin Frontier Inc.), 면역 침전 실험에 사용하였다.
실시예 8: 웨스턴 블랏
HepG2.2.15 세포를 RIPA 완충액 (20mM Tris-HCl (pH 7.5), 150mM NaCl, 1mM EDTA, 10% NP-40 (Sigma, 74385), 1% 나트륨 데옥시콜레이트 (Sigma, D6750), 1% SDS (Ambion, AM9823))에 용해시켰다. 다른 세포를 완충액 D (200mM KCl, 10mM Tris-HCl (pH 8.0), 0.2mM EDTA, 0.1% 트리톤 X-100(Promega, H5142)에 용해시켰다. 대략 60μg의 용해물을 ladder(Thermo, 26616 및 26619)와 함께 10% 또는 8-16%(Novex) SDS-PAGE 겔에 로딩하였다. 메탄올-활성화 폴리비닐리덴 디플루오라이드 막 (Millipore)으로 옮긴 후, 막을 5% 탈지유(skim milk)를 함유하는 PBS-T에서 블록킹하고, 일차 항체로 표지하고 PBS-T로 3 회 세척 하였다. 항-마우스 또는 항-토끼 HRP- 접합 된 이차 항체 (Jackson ImmunoResearch Laboratories)를 배양하고 PBS-T로 3회 세척하였다. 화학 발광은 West Pico 또는 Femto Luminol 시약 (Thermo)으로 수행되었으며, 신호는 ChemiDoc XRS+ System (BioRad)에 의해 검출되었습니다. 항-TENT4A(1:500, Invitrogen, PA5-61302;1:250-500, Atlas Antibodies, HPA045487), 항 -TENT4B (1:500, Invitrogen, PA5-60177;1:500, Atlas Antibodies, HPA042968;1:500, 실험실 제작), 항-ZCCHC14(1:1,000-2,000, Bethyl Laboratories, A303-096A), 항-GAPDH (1:1,000-2,000, Santa Cruz, sc32233), anti-SAMD4B (1:500, Invitrogen, PA5-53490), 항-GM130 (1:500, BD Bioscience, 610822) 및 항-히스톤 H3(1:2,000, Cell signaling, 4499)을 1차 항체로 사용하였다.
실시예 9: RT-qPCR
총 RNA는 Trizol 시약 (Invitrogen, 15596018) 또는 Maxwell 16 LEV simplyRNA Tissue 키트 (Promega, AS1280)를 사용하여 추출하였고 DNaseI로 처리하였으며, RNeasy MinElute Cleanup Kit (Qiagen)로 정제하고, RevertAid 역전사 효소 (Thermo) 및 루시페라제 검정 샘플에 대한 oligo dT, 또는 다른 샘플들에 대한 랜덤 헥사머 (Invitrogen)로 역전사했다. mRNA 수준은 SYBR Green 분석 (Thermo) 및 StepOnePlus Real-Time PCR System (Applied Biosystems) 또는 QuantStudio 3 (Applied Biosystems)으로 측정하였다. RT-qPCR 프라이머의 목록은 표 3에 제시되어있다.
qPCR primers
qPCR-ZCCHC14-F ACCCCGTCTTTAAGCAGCTC
qPCR-ZCCHC14-R GGCACCGTCTCTCTGACTTC
qPCR-TENT4A-F CCCACCACTTCCAGAACACT
qPCR-TENT4A-R GCTTTCAAAGACGCAGTTCC
qPCR-TENT4B-F TCGCAGATGAGGATTCG
qPCR-TENT4B-R CTGCTCTCACGCCATTCT
qPCR-GAPDH-F CTCTCTGCTCCTCCTGTTCGAC
qPCR-GAPDH-R TGAGCGATGTGGCTCGGCT
qPCR-FireflyLuc-F CCCATCTTCGGCAACCAGAT
qPCR-FireflyLuc-R GTACATGAGCACGACCCGAA
qPCR-RenillaLuc-F CTGGACGAAGAGCATCAGG
qPCR-RenillaLuc-R TGATATTCGGCAAGCAGGCA
qPCR-SAMD4A-F CTGAGCAGCTGCGATGGG
qPCR-SAMD4A-R GGTCTGGAGACCAAGAGCTG
qPCR-SAMD4B-F TGCAATGACATCCACCTGCT
qPCR-SAMD4B-R GTACTCCGACTTGGCCTCTG
qPCR-HBV#1-F AACGGCCAGGTCTGTGCCAA
qPCR-HBV#1-R CCGCAGTATGGATCGGCAGAG
qPCR-HBV#2-F TACATAAGAGGACTCTTGG
qPCR-HBV#2-R GCAGACCAATTTATGCCTAC
qPCR-HBV#3-F TACTGCGGAACTCCTAGCCG
qPCR-HBV#3-R TTGCGGGAGAGGACAACAGAG
qPCR-RNA2.7-F CAGCTTTTCTCCCAAACCTCG
qPCR-RNA2.7-R AGGAATAATCCGTGCGACCG
qPCR-HSPA8-F ACCTACTCTTGTGTGGGTGTT
qPCR-HSPA8-R GACATAGCTTGGAGTGGTTCG
qPCR-ACTB-F CCTGTACGCCAACACAGTGC
qPCR-ACTB-R ATACTCCTGCTTGCTGATCC
qPCR-FireflyLuc-F used for RIP-qPCR spike-in AAGGTTGTGGATCTGGATAC
qPCR-FireflyLuc-R used for RIP-qPCR spike-in GATTGTTTACATAACCGGAC
실시예 10: RNA 면역 침전
HepG2.2.15 세포를 사용한 TENT4A 및 TENT4B 면역 침전의 경우, 하나의 150mm 접시로부터의 세포를 수집하고, 용해 완충액 (20 mM HEPES (pH 7.0-7.6) (Sigma, H0887), 4% NP-40, 100 mM KCl, 0.1mM EDTA, 10% 글리세롤, 1 mM DTT, 20 Uml-1 RNase 억제제 (Ambion, AM2696), 1x 프로테아제 억제제 (Calbiochem, 535140)로 얼음 상에서 용해시키고, 원심 분리하였다. 각각의 0.375 μg의 항체 (NMG, Santa Cruz, sc-2025; 항-TENT4A, 실험실 제작; 항-TENT4B, 실험실 제작)를 단백질 A 및 G 세파로스 비드에 접합시켰다 (1:1 혼합, 총 10 μl). 용해물을 항체-접합 된 비드와 함께 인큐베이션 한 다음 세척 완충제 (2% NP-40 외에 동일한 용해 완충제)로 세척하였다. 정규화에 사용되는 스파이크-인으로서 10 ng의 반딧불이 루시퍼 라제 mRNA를 샘플에 첨가한 후, RNA를 TRIzol 시약으로 정제하고 DNaseI로 처리하고 RT-qPCR에 사용하였다. 유사한 방법이 HepG2.2.15 세포를 사용한 ZCCHC14 면역 침전을 위해 사용되었고, 또한 용해 동안 Turbo DNaseI (Ambion, AM2239)으로 처리하였고, 각각 10 μg의 항체 (일반 토끼 IgG (Cell signaling, 2729S) 및 항-ZCCHC14 (Bethyl Laboratories, A303-096A))를 사용하였다. HEK293T 세포 (하나의 100 mm 접시)를 사용한 TENT4A 면역 침전의 경우, 유사한 방법이 각각의 6 μg의 항체 (NMG 및 항 -TENT4A)와 함께 사용되었고, 세포는 또한 수집 전에 가교 결합되었다 (0.1% 파라포름알데히드).
실시예 11: 공동 면역 침강
유사한 단계가 RNA 면역 침전에서와 같이 사용되었지만 Turbo DNaseI 및 RNase A (Thermo, EN0531)가 첨가되었다. 간단히 말하면, 5 개의 150 mm 접시로부터의 HepG2.2.15 세포를 용해시켰고, 각각의 17.5 μg의 항체 (NMG, 항-TENT4A, 항-TENT4B)로 면역 침전에 사용하였으며, 이는 단백질 A 및 G 세파로스 비드(1:1 혼합, 총 25 μl)에 컨쥬게이션되었다. 2개의 150 mm 디쉬로부터의 프라이머리 HFF 세포를 용해시켰고, 각각 6 μg의 항체 (NMG, 항-TENT4A, 항-TENT4B)로 면역 침전에 사용하였으며, 이는 단백질 A 및 G 세파로스 비드 (1:1 혼합, 총 20 개)에 접합되었다. RNase A를 용 해물에 첨가하여 0.2-0.3 μg/μl 최종 농도를 갖도록 하였다. 공면역침강 실험을 위해, HeLaT 세포의 1 및 1/3 150 mm 디쉬로부터의 세포질 추출물들을 다음에 설명 된 바와 같이 세포 외 분별법에 의해 수득 한 다음, 각각의 18 μg의 항체 (NMG, 항-TENT4A, 항-TENT4B)와 함께 면역 침전에 사용하였다.
실시예 12: 루시퍼라제 분석 및 형질 감염
24-웰 플레이트상의 1E5 HeLaT 세포를 0일에 리포펙타민 3000에 의해 루시페라제 리포터 분석을 위해 200 ng pmirGLO 플라스미드로 형질 감염시키고 2일에 수집하였다. 회복 실험을 위해, 24-웰 플레이트상의 1.5E5 HeLaT 모세포 및 TENT4 KO 세포를 50 ng의 pmirGLO 플라스미드와 함께 20 ng의 null 벡터 또는 TENT4A/B(1:1 혼합) 플라스미드로 리포펙타민 3000에 의해 0일에 형질 감염시켰고, 2일에 수집하였다. HEK293T 세포는 0 일에 100 nM siRNA로 형질 감염시켰고, 24-웰 플레이트상의 1.5E5 세포를 리포펙타민 3000에 의해 100 또는 200 ng의 pmirGLO 플라스미드와 함께 2 일에 100 nM siRNA로 추가로 형질 감염시켰다. 4 일에 HEK293T 세포를 수집하였다. 루시퍼라제 분석을 위해, 세포를 용해시키고 제조사의 지시에 따라 듀얼-루시퍼라제 리포터 분석 시스템 (Promega)으로 분석하였다.
실시예 13: 세포 내 분획
2E6 HeLaT 세포를 수집하고 차가운 PBS로 세척하였다. 세포질 분획을 수득하기 위해, 세포를 200 μl의 세포질 용해 완충제 (0.2 μg/μl digitonin (Sigma, D141), 150 mM NaCl, 50 mM HEPES (pH 7.0-7.6), 0.1 mM EDTA, 1 mM DTT, 20 U ml-1 RNase 억제제, 1x 프로테아제 억제제, 1x 포스파타제 억제제)로 용해시켰다. 2,000 상대 원심력(relative centifugal force)에서 원심 분리 후, 4℃에서 5분 동안, 상청액을 수집하여 세포질 분획으로 사용하였다. 막 및 핵 분획의 경우, 세포 내 단백질 분별 키트 (Thermo Scientific, 78840)를 제조업체의 지침에 따라 사용하였다.
실시예 14: Hire-PAT 분석
모세관 전기 영동 데이터의 Hire-PAT 분석 및 신호 처리는 이전에 기재된 바와 같이[3, 57], 총 RNA가 효모 폴리(A) 폴리머라제(Thermo Scientific, 74225Z25KU)에 의해 G/I 테일이 되도록 마이너 어댑테이션으로 수행되었다. 반딧불이 루시퍼라제 유전자의 폴리(A) 부위는 생거 시퀀싱에 의해 확인되었고, 포워드 PCR 프라이머는 표 4에 나타내었다.
Hire-PAT PCR primer
Hire-PAT-FireflyLuc-F GGACAAACCACAACTAGAATG
실시예 15: 계통 발생 학적 분석
추정 스템-루프 결합 단백질을 확인하기 위해, Drosophila Smaug (UniProtKB Q23972) 및 인간 SAMD4A/B (UniProtKB Q9UPU9 및 Q5PRF9)의 RNA-결합 SAM 도메인의 상동체는 10의 E 값 임계 값과 함께 UniProt BLAST를 사용하여 서치하였고, 갭핑되지 않았다[58]. 분석에 사용 된 단백질 서열: UniProtKB Q08831 (S. cerevisiae), UniProtKB Q9P6R7 (S. pombe), UniProtKB Q5AI80 (C. albicans), UniProtKB O76699 (C. elegans), UniProtKB Q23972 (D. melanogaster), UniProtKB E7F85 E7FBA1, A0A0R4IUM4 (D. rerio), UniProtKB Q6GLT9, Q5FWP2, A0A1L8GL36 (X. laevis), UniProtKB Q8CBY1, Q80XS6, Q8VIG0 (M. musculus) 및 UniProtKB Q9UPU9, Q5PRF9, Q8WYQ9 (H. sapiens). 기본 파라미터를 갖는 MUSCLE v.3.8.31[59]을 생성 된 17개의 단백질 서열의 다중 서열 정렬에 사용하였다. 계통발생 수(phylogenetic tree)는 PhyML v.3.1/3.0 aLRT[60]을 사용하여 재구성하였고, Phylogeny.fr 플랫폼[62]에서 TreeDyn v.198.3[61]을 사용하여 시각화했다. 재구성된 계통발생 수의 가장자리와 잎은 재조정되고 시각화를 위해 수동으로 루팅되었다(rooted).
실시예 16: RNA 풀다운 분석
RNA2.7 스템-루프 (SL2.7) 및 스템-루프 돌연변이체 (SL2.7 돌연변이)의 3' TEG (tetraethylene glycol spacer)-비오티닐화 RNA를 합성하고 (Bioneer Inc.), 서열은 표 5에 기재하였다.
RNA oligos for pull-down mass
SL-2.7 CACCGCGUUAUCCAUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCGG[Biotin-TEG]
SL-2.7 mutant CACCGCGUUAUCCAUUCCUCGUAGGAUUUUCCUGGGGAACGGGUCGGCGG[Biotin-TEG]
세트 1에 대한 스트렙타비딘 M-270 비드 (Thermo Scientific, 65305) 및 세트 2에 대한 스트렙타비딘 자성 비드(NEB, S1420S)를 풀다운 버퍼(50mM Tris (pH 8.0), 150mM NaCl, 5% 글리세롤, 1 mM DTT, 100 U ml-1 RNase 억제제, 1x 프로테아제 억제제)로 2회 세척하였다. 이어서, SL2.7의 10㎍의 올리고뉴클레오티드 또는 이의 돌연변이체를 4℃에서 밤새 풀다운 완충제 중의 스트렙타비딘 비드에 컨쥬게이션시킨 후, 풀다운 완충제로 세척 하였다. 4개의 150 mm 접시로부터의 HEK293T 세포를 수집한 다음 1.5 ml 풀다운 완충액으로 용해시킨 후 초음파처리 하였다. 원심 분리 후, 상청액을 비드와 함께 인큐베이션하고 세척 버퍼 No. 1 (50mM 트리스 (pH 8.0), 300mM NaCl, 5% 글리세롤), 세척 완충액 번호. 2 (50 mM 트리스 (pH 8.0), 150 mM NaCl, 5 % 글리세롤, 0.1 % 트리톤 X-100) 및 풀다운 완충제로 세척하였다. 용리를 위해, 비드를 1,600 r.p.m에서 60 μl의 용리 완충제 (100 mM (pH 7.5), 4% SDS, 100 mM DTT)와 함께 65℃에서 10분 동안 열 혼합기에서 배양하였다. 이어서, 10 및 50 μl의 용출액을 각각 웨스턴 블롯팅 및 질량 분석에 사용하였다.
실시예 17: 액체 크로마토그래피-탠덤 질량 분석기(LC-MS/MS) 분석
SDS를 함유하는 면역 침전된 단백질 샘플은 여과 보조 샘플 제조 소화에 적용되었다. 간략하게, 단백질 샘플을 먼저 환원시키고 변성 ABC 완충제 (50 mM 중탄산 암모늄 (ABC) 중 8 M 우레아)로 알킬화시켰다. 알킬화 된 샘플을 미리 조정 된 30 kDa MWCO 아미콘 필터 (밀리 포어, UFC5030)에 놓고 14,000g에서 30분 동안 원심 분리 하였다. 200㎕의 8M 우레아 또는 50mM ABC 완충액으로 연속 세척을 수행하고 14,000g에서 15 분 동안 원심 분리하여 필터 유닛에서 SDS를 제거 하였다. 이어서, 단백질 샘플을 37℃에서 2% (w/w) 트립신으로 밤새 소화시켰다. 생성된 펩티드 샘플을 C18 지퍼 팁 세정 (Millipore, Z720070) 및 LC-MS/MS 분석에 적용하였다. 3 μm Jupiter C18 입자 (Phenomenex)가 내장 된 자체 포장 된 긴 모세관 컬럼 (내부 직경 100cm × 75μm) 및 트랩 컬럼 (내부 직경 3cm × 150μm)을 펩타이드 분리에 사용했다. 300 nl/min의 유속 및 100분 동안 95% 용매 A (0.1% 포름산 함유 물) 내지 40%의 용매 B (0.1% 포름산 함유 아세토 니트릴) 범위의 선형 구배를, Orbitrap Fusion Lumos 질량 분석기 (Thermo Scientific)와 결합된 nanoACQUITY UPLC(Waters) 상에 적용하였고, 이는 다음 파라미터를 사용하여 작용되었다: 전구체 스캔 범위의 m/z 300-1,800, 전구체 격리 윈도우 1.4 Th, 고 에너지 충돌 해리 (HCD)에 대한 정규화된 충돌 에너지의 30%, 동적 배제 기간 30초 및 full MS 또는 MS/MS 스캔dp 대한 m/z 200에서의 60,000 또는 75,000 해상도, 각각.
질량 분석 원시 데이터 파일은 기본 설정(초기 또는 메인 서치 각각에 대한 전구체 이온 질량 공차의 20 또는 6 ppm, 및 절편 이온 질량들에 대한 0.5 Da)에서 인간 Uniprot 데이터베이스[58](v.12/5/2018)에 대해 MaxQuant의 내장 Andromeda 검색 엔진[65]을 사용하여 MaxQuant (v.1.5.3.30)로 처리하였다. 효소 특이성은 트립신/P로 설정되었고, 최대 2 개의 누락 된 분열이 허용되었다. 시스테인 카바미도 메틸화 및 메티오닌 산화는 각각 고정 및 가변 변형으로서 선택되었다. 단백질 및 펩티드 수준 모두에서 1% FDR이 요구되었다. 질량 분석 프로테오믹스 데이터는 데이터 세트 식별자 PXD018061 및 10.6019/PXD018061과 함께 PRIDE[66] 파트너 저장소를 통해 ProteomeXchange 컨소시엄에 저장되었다. SL2.7 컨스트럭트에 대한 스퓨리어스 또는 비특이적 결합을 설명하기 위해 '비드 만(only)' 및 돌연변이 컨스트럭트로부터 얻은 결과를 기술적 배경으로 간주하고 단백질 스펙트럼 수 증가를 위한 커스터마이즈된 통계 테스트를 디자인했다. SL2.7 컨스트럭트로부터 단백질 p에 대해 확인된 스펙트럼 개수의 수를 Np로하고, 배경 구축물로부터의 개수를 Mp로 한다. Np≥1인 각 단백질 p에 대해, 농축의 통계적 유의성(또는 P 값)이 계산되었다 :
Figure PCTKR2020007100-appb-I000001
여기서 N=∑PNP 는 총 스펙트럼 수, ρ=(Mp+1)/∑P(MP+1)은 배경 확률이고 B (k; n, p)는 P의 성공 확률로 n 번의 시도에서 k 개의 성공을 얻는 이항 분포이다. 마지막으로, P 값은 Benjamini-Hochberg 방법을 통해 조정되었다. 기술적 배경('비드 만' 또는 돌연변이 체)을 사용할 때 조정 된 P <0.01 인 단백질은 통계적으로 유의한 것으로 간주되었다. 세트 1 또는 세트 2 데이터 세트에서 통계적으로 유의한 단백질이 후속 단백질 강도 분석을 위해 고려되었다. 결측값을 처리하기 위해 데이터 세트의 최소 0이 아닌 강도 값이 대치되었다. 이어서, 단백질 농축 점수를 돌연변이 데이터에 대한 SL2.7의 단백질 강도의 log2 배 변화로서 계산하였다.
결과
1. HBV와 HCMV는 혼합된 테일링 도구를 역이용한다.
바이러스 RNA 테일링을 조사하고 특성화하기 위해, 먼저 TAIL-seq를 두 가지 바이러스 감염 모델에 적용했다: HBV DNA와 통합된 HepG2.2.15 세포 및 HCMV에 감염된 프라이머리 인간 포피 섬유 아세포 (primary human foreskin fibroblast; HFF). HepG2.2.15 세포는 간 모세포종 세포주 HepG2에서 유래하며, HBV 입자의 생산 및 조립을 지원할 때 HBV의 수명주기를 연구하는 데 사용하였다. HepG2.2.15 세포에 대한 TAIL-seq 데이터는 바이러스 RNA에 대해 매우 높은 구아닐화 빈도를 나타냈다(도 1a, 도 7a). 혼합 테일링 빈도(G, U 및 C 계수)는 또한 세포 RNA보다 바이러스 RNA에서 실질적으로 더 높았다 (도 7a). 또한, HCMV- 감염된 HFF 세포에 대한 TAIL-seq 데이터는 HCMV RNA에 대해 높은 구아닐화 및 혼합 테일링 빈도를 나타냈다(도 1b 및 도 7b). 변형은 주로 HCMV의 4개의 풍부하고 보존 된 긴 비코딩 RNA 중 하나인 RNA2.7(도 7c, VRNA2.7)에 기인하였다. HBV 및 HCMV RNA는 모두 세포 mRNA보다 테일이 상당히 길었고(도 1c, d), 이는 이러한 바이러스 RNA는 세포 mRNA보다 느린 전체(net) 디아데닐화를 겪을 수 있음을 나타낸다.
바이러스 혼합 테일링이 숙주 대응물과 동일한 효소에 의해 매개되는지를 조사하기 위해, 우리는 TENT4A 및 TENT4B를 고갈시켰다. HBV mRNA 및 HCMV RNA2.7의 구아닐화 및 혼합된 테일링 빈도는 TENT4A- 및 TENT4B- 고갈된 세포에서 감소되었다(도 1e, f 및 도 7d-g). TENT4A 및 TENT4B의 녹다운은 또한 바이러스 RNA의 폴리(A) 테일이 짧아져 (도 7h-j), TENT4 효소가 바이러스 RNA 테일의 연장에 기여한다는 것을 보여주었다. 일관되게, HBV mRNA는 TENT4 고갈 후 하향 조절 및 불안정화되었고(도 1g, h 및 도 7k), 이는 HBV가 TENT4를 사용하여 mRNA를 안정화시킴을 나타낸다. 주목할만한 점은, TENT4가 없을 때 보상 메커니즘의 가능성을 제외하고, 올리고-유리딜화(도 7l)와 같은 테일 변형이 증가하지 않는다는 점이다. 고도로 안정한 HCMV RNA2.7은 실험 시간 윈도우(experimental time window) 범위 내에서 RNA 반감기에서 유의한 변화를 나타내지 않았고(도 7m, P>0.05; 양면 Student 's t-test), 이는 디아데닐화에 이어지는 추가적인 다운스트림 메카니즘을 시사하며, 이는 RNA2.7 붕괴를 차단한다.
2. HBV RNA는 HepG2.2.15 세포에서 TENT4의 주요 기질이다.
TENT4 모집의 메커니즘을 설명하기 위해, HepG2.2.15 세포에서 포름 알데히드-매개 가교 결합 및 면역 침전 시퀀싱 (fCLIP-seq)을 수행하였다 (도 2). 포름 알데히드 기반의 가교는 RNA-단백질 상호 작용이 일시적이고 구조 의존적일 때에도 RNA-단백질 상호 작용을 효과적이고 강력하게 캡처한다. 정상 마우스 IgG (NMG), TENT4A 항체 또는 TENT4B 항체를 사용하여 입력(input) 용해물 및 면역 침전물로 4개의 라이브러리를 제조하였다. 입력 및 NMG 라이브러리는 배경을 추정하기위한 사이즈 매칭된 대조군으로 사용되었다. HBV 게놈에 걸쳐 표준화된 판독 범위는 TENT4A 및 TENT4B 항체 둘 다를 사용하여 HBV 게놈으로부터 실질적으로 풍부한 피크를 확인하였으며 (도 2a), 이는 HBV RNA상의 TENT4의 상호 작용 부위를 나타낸다. TENT4B 항체에 대한 독립적인 실험은 유사한 결과를 보여 주었다 (도 8a).
HBV RNA는 3.2 킬로베이스의 원형(circular) DNA 게놈으로부터 생성된다. 5 개의 중복 바이러스 전사체는 공통 3' 말단 서열(~700 염기쌍)과 단일 폴리아데닐화 부위를 공유한다(도 2a). TENT4 결합 판독 값은 1,154-1,687에 이르는 3' 말단 영역이 풍부합니다(도 2a). 이 영역은 전사 후 조절 요소(PRE)에 해당하며, RNA 핵 방출 및 안정화를 향상시키는 것으로 잘 알려져있다. WPRE(woodchuck hepatitis virus)의 PRE는 이소성 유전자 발현 및 렌티 바이러스 유전자 전달을 증가시키는데 널리 사용되어왔다. La, PTB, GAPDH 및 ZC3H18과 같은 몇몇 RNA-결합 단백질이 PRE와 상호 작용하는 것으로 보고되었지만, 이들 상호 작용의 기능적 중요성은 불분명하다. 본 발명의 fCLIP-seq 실험에서 HBV의 PRE는 인간 전사체의 다른 추정된 피크 클러스터와 비교하여 가장 높은 농축 점수를 나타냈다(도 2b). 면역 침전 및 그 이후의 역 전사(RT-qPCR)를 이용한 정량적 PCR에 의해 TENT4A, TENT4B 및 HBV mRNA 사이의 상호 작용을 확인하였다 (도 8b). 종합하면, 이러한 결과들은 HBV mRNA가 HepG2.2.15 세포에서 TENT4의 주요 기질이고 TENT4가 HBV mRNA와 PRE 영역을 통해 상호 작용한다는 것을 입증한다.
3. HBV RNA의 스템-루프 α는 TENT4-의존적 테일 조절에 필요하다.
TENT4에 의해 인식되는 cis-acting RNA 요소를 확인하기 위해, 우리는 3' 비 번역 영역(UTR)에서 PRE의 상이한 하위 영역을 갖는 리포터를 생성 하였다(도 3a). PRE는 PREα(1154-1351)와 PREβ (1352-1687)의 두 가지 하위 요소로 구성된다(도 3a). 또한 TENT4A 및 TENT4B 의존성을 테스트하기 위해 TENT4A 및 TENT4B 녹아웃(KO) 세포를 생성했다(도 9a).
루시퍼라제 단백질 및 RNA 수준은 리포터에 완전한 PRE 또는 PREα가 장착된 경우에만 TENT4 의존적 방식으로 유의미하게 상향 조절되었다 (도 3b 및 도 9b). TENT4가 고갈된 인간 배아 신장 293T (HEK293T) 세포에서 유사한 결과가 얻어졌으며 (도 9c, d), PREα가 TENT4 의존적 안정화에 필요하다는 것을 확인하였다. Hier-PAT 분석에 의한 폴리(A) 테일 길이 측정 결과, TENT4 고갈이 PREα 구조물에서 폴리(A) 테일을 단축시켰지만 PREβ 구조물에서는 그렇지 않았다(도 3c).
TENT4가 PREα- 의존적 방식으로 테일 변형을 통해 직접 작용한다는 것을 나타낸다. 또한, 녹아웃 세포에서, 단백질 및 RNA 수준 둘 다에서 PRE 및 PREα 리포터 발현은 이소적으로(ectopically) 발현 된 TENT4에 의해 구제되었다(도 3d 및 도 9e, f). 촉매적으로 비활성인 돌연변이체가 활성을 복원하지 못했다. 따라서, PREα를 함유하는 mRNA의 상향 조절에는 TENT4의 촉매 활성이 필요하다.
PRE의 기계적인 보존을 조사하기 위해, HBV의 PRE와 동종인 WHV(woodchuck hepatitis virus) 세그먼트 (WPRE)를 사용하였다(도 3e). HBV의 PRE와 달리 WPRE는 다음 세 가지 하위 요소로 구성된다: WPREγ, WPREα 및 WPREβ. WPREα 및 WPREβ는 WHV와 HBV 사이에 보존되는 반면, WPREγ는 독특하고 HBV의 PRE에 비해 WPRE의 더 큰 활성을 담당하는 것으로 생각된다. WPREα (Wα)를 갖는 모든 컨스트럭트는 TENT4-의존적 상향 조절을 보여 주었고(도 3f), 이는 TENT4 매개 메카니즘은 WHV에서 보존됨을 제안한다.
WPREγ (Wγ)와 WPREα (Wα)의 조합은 시너지 효과(도 3f)를 도출하고, 이는 WPREγ가 WHV의 TENT4-매개 조절에 대한 인핸서로서 작용할 수 있음을 시사한다.
PREα에서 핵심 모티프를 특정하기 위해 추가의 점 돌연변이가 도입되었다(도 3a). PREα는 La-결합 모티프 및 스템-루프 알파 (SLα)를 함유하며, 둘 다 RNA 방출 및 안정성에 필요한 것으로 보고 되었다. 최근의 돌연변이 유발 연구는 SLα의 La-결합 부위 및 정단(apical) 루프 서열이 DHQ-1-매개 HBV 유전자 발현에 필수적임을 보여주었다. 주목할 점은, SLα는 A-나선 영역이 측면에 있는 단일 돌출 G 잔기로 CNGG(N) 패밀리 루프 구조를 본질적으로 채택하는 CAGGU pentaloop을 포함하고 있다는 점이다(도 3g, 좌측). SLα의 구조는 WHV에서도 진화적으로 보존되어있다(도 3g, 우측). 이러한 요소가 TENT4 의존적 조절에 필요한지 여부를 테스트하기 위해 SLα의 정점 시퀀스와 모양을 방해하는 PREα 돌연변이체 리포터(도 3a)를 생성했다(도 3g, 화살표). La-결합 모티프(α mut1)의 돌연변이 유발은 TENT4 의존성에 영향을 미치지 않았고 SLα 돌연변이 (α mut2)와 이중 돌연변이 (α mut3)는 PREα 기능을 중단시켰다(도 3h). 따라서, PREα의 스템-루프 (SLα)는 TENT4에 의한 전사 후 조절에 필수적인 요소이다.
4. HCMV RNA2.7은 TENT4-의존적 조절을 위한 유사한 스템-루프를 보유한다.
HBV mRNA에 더하여, HCMV RNA2.7(VRNA2.7)은 또한 혼합된 테일링을 진행한다(도 1b, d 및 도 7b). TENT4A 항체를 사용한 RNA-면역 침전 실험에 이어 RT-qPCR은 TENT4A가 HEK293T 세포에서 이소성으로 발현되는 RNA2.7과 상호 작용하는 것을 보여주며 (도 4a 및 도 10a), TENT4A와 RNA2.7 사이의 상호 작용에 바이러스 인자가 필요하지 않음을 시사한다. TENT4 상호 작용을 담당하는 RNA2.7의 기능적 도메인을 확인하기 위해, RNA2.7의 부분적으로 중첩되는 단편을 포함하는 리포터를 생성하였다 (도 4b, FRG1-6). 처음 두 리포터 (FRG1 및 FRG2)의 단백질 및 RNA 수준은 TENT4 KO 세포와 비교하여 모 세포에서 유의하게 더 높았다 (도 4c 및 도 10b). 따라서, cis-요소는 5' 말단 근처에 존재한다. FRG1의 부분적 결실은 1E 단편 (414-513)만이 TENT4 의존적 강화 효과를 부여하는 것으로 밝혀졌다(도 4d, e 및 도 10c, d). 1E 도메인은 PREα 및 WPREα의 SLα의 CNGG (N) 패밀리 루프 형태와 유사한 스템-루프 구조 (도 4b, 우측 하단)를 보유한다 (도 3g). 1E의 스템-루프에 대한 점 돌연변이 (1E mut)는 TENT4의 조절을 중단시켰다 (도 4e 및 도 10d). 스템-루프 (이후 SL2.7로 지칭되는 414-463)를 포함하는 더 작은 50-nt 절단 단편은 FRG1 및 1E와 유사한 활성을 갖는다 (도 10e). HBV PRE 및 WPRE의 SLα는 RNA의 3 '말단 근처에 있지만, HCMV RNA2.7의 SL2.7은 5'말단 근처에 있으며, 이는 펜타 루프가 위치 독립적 방식으로 기능 할 수 있음을 시사한다.
종합하면, 본 발명은 TENT4-의존적 조절에서의 SLα-유사 구조의 기능적 중요성을 입증한다.
5. 세포질 ZCCHC14는 스템-루프 구조에 결합하고 TENT4와 상호 작용한다.
CNGGN pentaloop는 처음에 효모 Vts1p의 멸균 알파 모티프 (SAM) 도메인에 결합하는 Smaug 인식 요소로 특성화되었으며 Drosophila Smaug는 전사 후 억제를 중재한다[32-36]. Schwalbe와 동료들은 구조적 유사성을 바탕으로 HBV SLα pentaloop가 SAM 도메인과 단백질의 결합 부위 역할을 할 수 있다고 제안했다. 그러나, TENT4는 SAM 도메인[31]을 함유하지 않으며, 재조합 TENT4를 사용한 우리의 테일링 분석은 PRE-인비트로에 대한 주목할만한 친화력을 검출하지 못하였고, 이는 RNA-상호 작용 보조 인자를 나타낸다.
SLα 및 SL2.7을 인식하는 잠재적인 보조 인자를 찾기 위해, 비오틴화 된 합성 SL2.7 및 HEK293T 세포 추출물로 RNA 풀다운을 수행하였다 (도 5a). 루프 돌연변이체를 음성 대조군으로 사용하였다. 질량 분석법은 현저하게 농축 된 6 개의 단백질, 즉 TENT4A, TENT4B, K0355, SAMD4A, SAMD4B 및 ZCCHC14를 나타냈다(도 5a). 특히, Smaug-유사 SAM 도메인을 갖는 3 가지 인간 단백질이 이 목록에 포함되어있다: Smaug의 2개의 상동체 (SAMD4A 및 SAMD4B) 및 ZCCHC14(도 5b). ZCCHC14의 특이적 농축은 RNA 풀다운 및 웨스턴 블롯팅에 의해 추가로 확인되었다(도 5c). K0355 (또는 KIAA0355)에는 SAM 도메인이 없으며 SAMD4B37과 상호 작용하는 것으로보고되어 K0355가 펜타 루프와 직접 상호 작용하지 않을 수 있음을 나타낸다. 어떤 SAM 도메인 단백질이 TENT4-의존적 조절을 담당하는지 확인하기 위해, 우리는 HBV-생성 HepG2.2.15 세포를 재검토하였다. ZCCHC14의 녹다운은 SAMD4 단백질의 녹다운에서 HBV RNA 수준을 감소시키지 않았다(도 5d 및 도 11). 일관되게, 최근 게놈-와이드 CRISPR 스크린은 ZCCHC14를 HBV의 표면 항원 생산을 위한 필수 숙주 인자로 보고했다.
ZCCHC14의 작용 메커니즘을 이해하기 위해, 우리는 ZCCHC14-고갈 된 HepG2.2.15 세포에서 TAIL-seq 실험을 수행하였다. HBV mRNA의 구아닐화 빈도가 감소되었고(도 6a), 폴리(A) 테일은 ZCCHC14 녹다운에서 실질적으로 단축되었으며(도 6b), HBV RNA 혼합된 테일에서 ZCCHC14의 중요한 역할을 입증하였다. 일관되게, ZCCHC14 고갈은 CNGGN 줄기-루프(RNA2.7 1E, PREα, Wγ + Wα)를 보유한 리포터로부터 루시퍼라제 발현을 감소시켰다(도 6c). 대조적으로, 각각의 펜타루프 돌연변이체 (1E mut, α mut2, Wγ + Wα mut)는 ZCCHC14 녹다운 후 유의한 변화를 나타내지 않았고 (P> 0.05; two-sided student’s t-test) (도 6c), 이는 ZCCHC14의 기능이 CNGGN 모티프에 의존한다는 것을 보여준다. 본 발명자들은 또한 Hire-PAT 분석을 수행하여 리포터 mRNAs의 poly(A) 테일 길이가 CNGGN 모티프-의존적인 방식으로 ZCCHC14 고갈 세포에서 감소 됨을 확인하였다 (도 12a-c).
ZCCHC14 항체를 사용한 RNA 면역 침전은 HepG2.2.15 세포에서 ZCCHC14와 HBV 전사체 사이의 상호 작용을 확인시켰다 (도 6d 및 도 12d). 더욱이, HepG2.2.15 및 프라이머리 HFF 세포 둘 다에서, ZCCHC14는 RNase 처리에 관계없이 TENT4A 및 TENT4B와 공동 면역 침전되었고 (도 12e), 이는 ZCCHC14와 TENT4 사이의 RNA-비 의존적 상호 작용을 나타낸다. 마지막으로, 본 발명자들은 ZCCHC14가 주로 세포질에 국한되었고(도 6e), ZCCHC14가 HeLaT 세포의 세포질 분획을 사용하여 TENT4A 및 TENT4B와 공동 면역 침전한다는 것을 발견했다(도 6f). 종합하면, 본 발명은 ZCCHC14가 주로 세포질에서 TENT4와 상호 작용하여 디아데닐화로부터 SLα-유사 요소를 포함하는 바이러스 전사체를 부주의하게 보호 함을 나타낸다.
본 발명자들은 바이러스 성 유전자 발현에서 타겟팅되고 혼합된 테일링의 메커니즘을 밝혔다(도 6g). HBV mRNA 및 HCMV RNA2.7은 ZCCHC14 및 TENT4를 모집하는 데 중요한 CNGGN 펜타 루프와 함께 cis-작용 요소를 포함한다. TENT4에 의한 혼합 테일은 CNOT 디아데닐라제 복합체에 대항하여 바이러스 RNA를 보호한다. 매우 다른 수명주기와 조직 특이성을 가진 이 두 가지 별개의 바이러스(헤파드나비리대에 속하는 바이러스와 헤르페스비리대에 속하는 바이러스)는 유전자 발현의 이점을 위한 동일한 전략을 제시한 것이 흥미롭다. 이러한 수렴 진화와 이 cis-acting 요소의 단순성은 이 메커니즘이 다른 바이러스에서도 사용될 수 있음을 시사한다.
혼합된 테일링 작동방식 이외에, TENT4B는 핵 TRAMP 복합체 (효모에서 Trf4-Air1/2-Mtr4 및 인간에서 TENT4B-ZCCHC7-hMTR4)의 성분으로서 작용하며 비정상적인 전사체의 분해 또는 절단 및 성숙에 관여하거나, 핵에 있는 small noncoding RNAs의 트리밍 및 성숙에 관여한다[5, 39-43]. 본 발명자들은 혼합 테일링이 TRAMP complex와 구별되는 모듈로서 mRNA 안정성에 기여한다는 것을 이전에 보여 주었다. hMTR4 및 ZCCHC7의 녹다운이 HBV 단백질 및 mRNA 수준에 영향을 미치지 않는다는 것을 고려하면, TENT4는 HBV 조절에서 TRAMP 복합체와 독립적으로 작용하는 것으로 보인다. ZCCHC14의 세포질 국재화(cytoplasmic localization)는 또한 TENT4-ZCCHC14 복합체가 핵 TRAMP 복합체와 별개의 서브 셀룰러 구획에서 작동한다는 것을 시사하지만, 비록 TENT4-ZCCHC14 복합체의 마이너 프랙션이 핵에서 작동할 가능성을 배제하지는 않는다.
혼합된 테일링은 HBV 유전자 발현에 특히 중요한 것으로 보인다. 5 가지 mRNA 종 중 4 가지 (X를 제외한 pgRNA, Precore, PreS1 및 PreS2/S)는 SLα 스템루프를 포함하며, TENT4 효소가 고갈되면 반감기가 실질적으로 감소한다. 현재의 치료 옵션에는 nucleos(t)ide 유사체와 인터페론 알파가 포함되지만 치료 효과가 적고 종종 비효율적이므로 HBV 감염은 매년 전 세계적으로 약 8 천만 명이 사망하는 주요 의료 부담으로 남아 있다. 바이러스성 단백질, 특히 면역 회피를 유도하는 바이러스 성 S 항원 (HBsAg)의 생산을 차단함으로써 기능적 치료를 달성 할 수 있다. 바이러스 성 혼합 꼬리의 발견 및 바이러스 유전자 발현에 TENT4 및 ZCCHC14의 관여는 새로운 부류의 항-HBV 약물의 발달에 대한 메카니즘적인 통찰력을 제공할 수 있다. TENT4 작동 방식을 타겟팅하는 잠재적 부작용을 피하기 위해, TENT4 단백질과 그 파트너의 내인성 기능과 작용 메커니즘을 이해하는 것이 중요하다.
CNGGN 펜타 루프와 RNA-결합 SAM 단백질 사이의 물리적 상호 작용은 고도로 보존되고 널리 사용되는 기능적 모듈인 것으로 확인되었다. 과일 파리(fruit fly)에서 Smaug는 nanos mRNA의 CUGGC 루프로 헤어핀을 인식하여 적시의 mRNA 분해를 유도한다. 이는 전-후 축(anterior-posterior axis)의 설정에 필수적이다. 효모에서, Vts1p는 표적화 된 mRNA 분해를 위해 CNGG (N) 펜타 루프를 갖는 mRNA에 결합한다. 척추 동물은 3개의 RNA-결합 SAM 단백질을 가지며 이 상호 작용 모듈의 사용을 확장한 것으로 보인다. Smaug의 척추 동물 오르톨로그(ortholog) 중 하나 인 SAMD4B는 nanos1 mRNA를 표적으로하며 포유류 신경 발달 과정에서 필수적이다. Smaug의 다른 척추 동물 오르톨로그인 SAMD4A는 펜타 루프-함유 리포터의 번역을 억제하고 세포질 병소의 형성과 관련이 있다. 여기서 본 발명자들은 동일한 메커니즘을 특히 바이러스성 RNA의 이익을 위해 척추 동물-특이적 단백질 ZCCHC14를 통해 반대 목적으로 사용될 수 있음을 보여주었다.

Claims (9)

  1. 바이러스 RNA의 혼합 테일링에 관여하는 TENT4A 및 TENT4B 중 어느 하나 이상의 억제제를 포함하는 바이러스 감염 예방 또는 바이러스 감염증 치료용 약제학적 조성물에 있어서, 상기 억제제는 TENT4A 및 TENT4B 중 어느 하나 이상의 발현을 억제하는 siRNA 또는 shRNA, 또는 TENT4A 및 TENT4B 중 어느 하나 이상의 활성을 억제하는 항체 또는 그의 항원결합 단편인, 약제학적 조성물.
  2. 제 1 항에 있어서, 상기 TENT4A 및 TENT4B는 바이러스 감염 위험이 있거나, 바이러스에 감염된 상태인 대상(subject)으로부터 유래된 것인, 약제학적 조성물.
  3. 제 1 항에 있어서, 상기 바이러스는 TENT4A 및 TENT4B 중 어느 하나 이상에 의해 RNA 테일링이 유발되는 바이러스인, 약제학적 조성물.
  4. 제 3 항에 있어서, 상기 바이러스는 헤파드나바이러스과 또는 헤르페스바이러스과에 속하는 바이러스인, 약제학적조성물.
  5. 제 4 항에 있어서, 상기 헤파드나바이러스과에 속하는 바이러스는 B형 간염 바이러스(Hepatitis B virus), 그라운드 다람쥐 B 형 간염 바이러스(Ground Squirrel Hepatitis B virus), 우드척 B형 간염 바이러스(Woodchuck Hepatitis B virus), 오리 B형 간염 바이러스(Duck hepatitis B virus) 및 헤론 B형 간염 바이러스(Heron Hepatitis B virus)으로 구성된 군으로부터 선택되는 어느 하나인, 약제학적 조성물.
  6. 제 4 항에 있어서, 상기 헤르페스바이러스과에 속하는 바이러스는 일토 바이러스(Iltovirus), 마디 바이러스(Mardivirus), 스쿠타 바이러스(Scutavirus), 단순 바이러스(Simplexvirus), 바리셀로 바이러스(Varicellovirus), 거대세포 바이러스(Cytomegalovirus), 무로메갈로 바이러스(Muromegalovirus), 프로보 바이러스(Proboscivirus), 로졸로 바이러스(Roseolovirus), 림포크립토 바이러스(Lymphocryptovirus), 마카 바이러스(Macavirus), 페르카 바이러스(Percavirus) 및 라디노 바이러스(Rhadinovirus)로 구성된 군으로부터 선택되는 어느 하나인, 약제학적 조성물.
  7. 다음 단계를 포함하는 바이러스 감염 예방 또는 바이러스 감염증 치료용 약제학적 조성물의 스크리닝 방법:
    (a) 숙주 세포(host cell)에 바이러스를 형질감염 시키는 단계;
    (b) 약물 후보 물질을 숙주 세포에 처리하는 단계; 및
    (c) 약물 후보 물질을 처리한 실험군으로부터의 RNA tailing 수준을 분석하고, 약물 후보 물질 무-처리 대조군으로부터의 RNA tailing 수준과 비교하는 단계; 실험군으로부터의 RNA tailing 수준이 무-처리 대조군에 비해 상대적으로 감소되어 있는 경우, 유효한 약물 후보 물질로 선정한다.
  8. 생체로부터 분리된 세포의 TENT4A 및 TENT4B 중 어느 하나 이상의 발현을 녹아웃(Kock-out) 시키는 단계를 포함하는 바이러스 내성 세포 제조방법.
  9. 다음 일반식으로 나타낸 아미노산 서열로 구성된 펜타루프구조를 포함하는 스템-루프 서열을 타겟 RNA 서열에 삽입하는 단계를 포함하는 RNA 서열 안정화 방법:
    [일반식]
    5’-CNGGN-3’,
    상기 N은 각각 독립적으로 아데노신(A) 및 유라실(U)로부터 선택되는 어느 하나이다.
PCT/KR2020/007100 2019-05-30 2020-06-01 바이러스 감염 및 활성 억제 방법 WO2020242278A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US17/614,795 US20220220483A1 (en) 2019-05-30 2020-06-01 Method for inhibiting infection and activation of virus
EP20813525.1A EP3984558A4 (en) 2019-05-30 2020-06-01 METHOD OF VIRUS INFECTION AND ACTIVATION INHIBITION
CN202080039725.5A CN113874042A (zh) 2019-05-30 2020-06-01 病毒感染及活性抑制方法
JP2021571026A JP7403777B2 (ja) 2019-05-30 2020-06-01 ウイルス感染及び活性抑制方法
JP2023021944A JP2023058675A (ja) 2019-05-30 2023-02-15 ウイルス感染及び活性抑制方法
JP2023021943A JP2023058674A (ja) 2019-05-30 2023-02-15 ウイルス感染及び活性抑制方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0064129 2019-05-30
KR20190064129 2019-05-30

Publications (1)

Publication Number Publication Date
WO2020242278A1 true WO2020242278A1 (ko) 2020-12-03

Family

ID=73552603

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/007100 WO2020242278A1 (ko) 2019-05-30 2020-06-01 바이러스 감염 및 활성 억제 방법

Country Status (6)

Country Link
US (1) US20220220483A1 (ko)
EP (1) EP3984558A4 (ko)
JP (3) JP7403777B2 (ko)
KR (1) KR20200138094A (ko)
CN (1) CN113874042A (ko)
WO (1) WO2020242278A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240003760A (ko) * 2022-06-29 2024-01-09 서울대학교산학협력단 RNA 안정성 또는 mRNA 번역 증가용 신규 조절 엘리먼트,이와 상호작용하는 ZCCHC2, 및 이들의 용도

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190019164A (ko) * 2016-06-17 2019-02-26 에프. 호프만-라 로슈 아게 B형 간염 감염을 치료하기 위한 papd5 및 papd7 억제제
WO2019076842A1 (en) * 2017-10-16 2019-04-25 F. Hoffmann-La Roche Ag NUCLEIC ACID MOLECULE FOR THE REDUCTION OF PAPD5 AND PAPD7 MRNA FOR THE TREATMENT OF HEPATITIS B INFECTION
KR20190064129A (ko) 2017-11-30 2019-06-10 삼성전자주식회사 컴퓨팅 장치의 정보 입력 방법 및 그 컴퓨팅 장치

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9771590B2 (en) 2015-09-17 2017-09-26 University Of Massachusetts Targeting hepatitis B virus (HBV) host factors

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190019164A (ko) * 2016-06-17 2019-02-26 에프. 호프만-라 로슈 아게 B형 간염 감염을 치료하기 위한 papd5 및 papd7 억제제
WO2019076842A1 (en) * 2017-10-16 2019-04-25 F. Hoffmann-La Roche Ag NUCLEIC ACID MOLECULE FOR THE REDUCTION OF PAPD5 AND PAPD7 MRNA FOR THE TREATMENT OF HEPATITIS B INFECTION
KR20190064129A (ko) 2017-11-30 2019-06-10 삼성전자주식회사 컴퓨팅 장치의 정보 입력 방법 및 그 컴퓨팅 장치

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
"Hepatitis B virus biology", MICROBIOL MOL BIOL REV, vol. 64, 2000, pages 51 - 68
"Hepatitis B virus e antigen the dangerous end game of hepatitis B virus", N ENGL J MED, vol. 347, 2002, pages 208 - 210
"Hepatitis B virus infection natural history and clinical consequences", N ENGL J MED., vol. 350, 2004, pages 1118 - 1129
"NCBI", Database accession no. NP _008930.2
"UniProtKB", Database accession no. AOA1L8GL36
CHEN, LINAN ET AL.: "Global regulation of mRNA translation and stability in the early Drosophila embryo by the Smaug RNA-binding protein", GENOME BIOLOGY, vol. 15, no. R4, 2014, pages 1 - 21, XP021173994, DOI: 10.1186/gb-2014-15-1-r4 *
EMORY, S. A.: "A 5'-terminal stem-loop structure can stabilize mRNA in Escherichia coli", GENES & DEVELOPMENT, vol. 6, 1992, pages 135 - 148, XP008075014 *
INSTITUTE FOR BASIC SCIENCE: "Regulatory RNAs in Cell Fate Decision", 1 January 2018, MINISTRY OF SCIENCE AND ICT, article "Support for research and operation expenses of the Institute of Basic Science"
LIM, J.: "Mixed tailing by TENT4A and TENT4B shields mRNA from rapid deadenylation", SCIENCE, vol. 36, 2018, pages 701 - 704, XP055526201, DOI: 10.1126/science.aam5794 *
See also references of EP3984558A4
WORLD HEALTH ORGANIZATION, GEOGRAPHIC PREVALENCE OF HEPATITIS B PREVALENCE, 2004, Retrieved from the Internet <URL:http://www.who.int/vaccines-surveillance/graphics/htmls/hepbprev.htm>

Also Published As

Publication number Publication date
KR20200138094A (ko) 2020-12-09
US20220220483A1 (en) 2022-07-14
CN113874042A (zh) 2021-12-31
EP3984558A1 (en) 2022-04-20
JP2022534526A (ja) 2022-08-01
JP2023058675A (ja) 2023-04-25
JP2023058674A (ja) 2023-04-25
JP7403777B2 (ja) 2023-12-25
EP3984558A4 (en) 2023-08-30

Similar Documents

Publication Publication Date Title
Feng et al. MDA5 detects the double-stranded RNA replicative form in picornavirus-infected cells
Frankiw et al. BUD13 promotes a type I interferon response by countering intron retention in Irf7
US11499157B2 (en) Immunomodulatory small hairpin RNA molecules
Széles et al. TLR3-mediated CD8+ dendritic cell activation is coupled with establishment of a cell-intrinsic antiviral state
JP7332585B2 (ja) Ｂ型肝炎ウイルス感染症を予防し且つ／又は処置するのに使用するための阻害剤
Lee et al. Suppression of hepatitis B virus through therapeutic activation of RIG-I and IRF3 signaling in hepatocytes
Linder et al. Defective interfering genomes and the full-length viral genome trigger RIG-I after infection with vesicular stomatitis virus in a replication dependent manner
WO2020242278A1 (ko) 바이러스 감염 및 활성 억제 방법
WO2021247367A1 (en) Compounds and compositions for treating, ameliorating, and/or preventing sars-cov-2 infection and/or complications thereof
Kang et al. ISG20 inhibits bluetongue virus replication
Xu et al. Type-III interferon stimulated gene TRIM31 mutation in an HBV patient blocks its ability in promoting HBx degradation
JP6986263B2 (ja) 抗ウイルス薬
Sun et al. Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors
Zhang et al. Potential drug targets against hepatitis B virus based on both virus and host factors
Malfatti et al. AUF1 Recognizes 8-Oxo-Guanosine Embedded in DNA and Stimulates APE1 Endoribonuclease Activity
WO2017023001A1 (ko) 비알콜성 지방간 조절인자 14-3-3 단백질
WO2017023002A1 (ko) 비알콜성 지방간 조절인자 14-3-3 단백질
WO2012036507A2 (ko) Ｈｃｖ 감염 세포에서 특이적으로 마이크로 ｒｎａ에 대한 안티센스를 방출하는 엡타자임 및 이의 이용
US11512357B2 (en) Gamma herpesvirus circular RNA
WO2020237909A1 (zh) 一种可用于埃博拉病毒病治疗的靶点
Tu et al. Ubiquitin E3 ligase β‐TrCP negatively regulates surface protein of hepatitis B virus
KR101928564B1 (ko) 인터페론 및 dna 메틸화 억제제를 유효성분으로 포함하는, b형 간염 바이러스 감염증 예방 및 치료용 약학적 조성물
He et al. The SARS‐CoV‐2 nucleocapsid protein suppresses innate immunity by remodeling stress granules to atypical foci
Cai et al. Plerixafor and resatorvid inhibit hepatitis B virus in vitro by upregulating elongation factor Tu GTP-binding domain containing 2
Zhang et al. PQBP1 regulates the cellular inflammation induced by avian reovirus and interacts with the viral p17 protein

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20813525

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021571026

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020813525

Country of ref document: EP

Effective date: 20220103