WO2022250503A1 - Composition pharmaceutique pour la prévention ou le traitement du coronavirus-19, comprenant une protéine cas13 et un arncr - Google Patents

Composition pharmaceutique pour la prévention ou le traitement du coronavirus-19, comprenant une protéine cas13 et un arncr Download PDF

Info

Publication number
WO2022250503A1
WO2022250503A1 PCT/KR2022/007599 KR2022007599W WO2022250503A1 WO 2022250503 A1 WO2022250503 A1 WO 2022250503A1 KR 2022007599 W KR2022007599 W KR 2022007599W WO 2022250503 A1 WO2022250503 A1 WO 2022250503A1
Authority
WO
WIPO (PCT)
Prior art keywords
crrna
cov
sars
covid
rna
Prior art date
Application number
PCT/KR2022/007599
Other languages
English (en)
Korean (ko)
Inventor
허원도
유다슬이
유정혜
Original Assignee
한국과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술원 filed Critical 한국과학기술원
Publication of WO2022250503A1 publication Critical patent/WO2022250503A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating COVID-19 comprising Cas13 protein and crRNA.
  • Coronaviruses which cause severe respiratory illness and cause death, are classified as RNA viruses belonging to Coronaviridae, and are defined as respiratory syndrome caused by coronavirus infection.
  • viruses belonging to Coronaviridae there are a total of 7 viruses known to infect humans: 4 types that cause colds (229E, OC43, NL63, HKU1), 2 types that cause severe pneumonia (SARS-CoV, MERS-CoV), and this time There is SARS-CoV-2, the virus responsible for the pandemic.
  • SARS-CoV The three viruses (SARS-CoV, MERS-CoV, and SARS-CoV-2) that cause severe pneumonia, starting with SARS-CoV in 2002 and followed by MERS-CoV in 2012, are highly homologous in gene sequence with SARS-CoV. Until the current SARS-CoV-2, a global pandemic is underway.
  • SARS-CoV-2 was first reported in late 2019. Compared to SARS-CoV that occurred in 2002, the severity of SARS-CoV is high, but the transmission power of SARS-CoV-2 is much higher. . This has resulted in a worldwide pandemic. Common signs of infection include respiratory symptoms, fever, cough, shortness of breath and shortness of breath. In more severe cases, infection can cause pneumonia, severe acute respiratory syndrome, kidney failure and even death.
  • SARS-CoV-2's spike protein binds to the host cell's angiotensin-converting enzyme 2 (ACE2) receptor
  • ACE2 angiotensin-converting enzyme 2
  • ACE2 is an enzyme that acts on heart function and blood pressure control, and is present in large quantities in the heart, kidneys, gastrointestinal mucosa, and lungs. Among them, it is more likely to be infected through the respiratory tract than through the internal organs that have to travel through the bloodstream.
  • SARS-CoV-2 genome is replicated and proteins are synthesized by viral polymerase, and viral particles are formed and released to the outside of the cell, resulting in symptoms of viral infection.
  • CRISPR/Cas system Bacterial response to viral infection includes the CRISPR/Cas system.
  • the CRISPR-Cas system has specificity for a target through CRISPR RNA (crRNA), and when used experimentally, guide RNA (gRNA) It is used slightly modified.
  • crRNA CRISPR RNA
  • gRNA guide RNA
  • a part called a spacer of crRNA recognizes and binds to a target sequence, and at this time, the target sequence must exist adjacent to a sequence called Protospacer Adjacent Motif (PAM). After the crRNA binds to the target, the Cas protein cuts the target genome.
  • PAM Protospacer Adjacent Motif
  • CRISPR-Cas13 has the potential to be used as a therapeutic agent for RNA viruses by targeting single-stranded RNA.
  • the CRISPR/Cas13 system has been used as a treatment method for plant virus infections (Plant J. 2018 Jun;94(5):767-775.) and can be an effective antiviral agent against single-stranded RNA (ssRNA) viruses (Molecuar Cell, Volume 76, Issue 5, 5 December 2019, Pages 826-837.e11) has been disclosed.
  • ssRNA single-stranded RNA
  • the present inventors completed the present invention by confirming that the crRNA and Cas13 enzyme capable of recognizing the target RNA of SARS-CoV-2 can treat COVID-19 by degrading the genome of SARS-CoV-2.
  • An object of the present invention is to provide a pharmaceutical composition for preventing or treating coronavirus infection-19 (COVID-19).
  • the present invention provides a Cas13 protein or a polynucleotide encoding the same; And it provides a pharmaceutical composition for preventing or treating coronavirus infection-19 (COVID-19) containing crRNA (CRISPR RNA).
  • COVID-19 coronavirus infection-19
  • CRISPR RNA crRNA
  • the present invention relates to a pharmaceutical composition for preventing or treating COVID-19 comprising a Cas13 protein and crRNA, and specifically, a crRNA targeting the Cas13b of the present invention and the RdRp gene portion of ORF1b of SARS-CoV-2 or
  • the crRNA targeting the pseudoknot region located upstream of RdRp has an excellent ability to degrade RNA of SARS-CoV-2, so it can be usefully used as a treatment for COVID-19.
  • RNA-dependent RNA polymerase RNA-dependent RNA polymerase (2.7 kb)
  • 2 fragment Helicase (1.8 kb)
  • 3 fragment exonuclease + endoRNase + 2'O-ribose methyltransferase (3.5 kb) is a schematic diagram.
  • Figure 2 is a schematic diagram showing the results of sequence homology analysis of coronavirus and the crRNA target site in the SARS-CoV-2 ORF1b gene.
  • Figure 3a is a schematic diagram of the dual-luciferase assay.
  • Figure 3b is a schematic diagram of the dual-luciferase assay for the crRNA of the present invention.
  • 3c is a diagram confirming that crRNAs 2, 5, 9, and 11 show relatively low levels of light emission, indicating that SARS-CoV-2 has excellent RNA degradation ability.
  • Figure 3d is a diagram showing the results of selection as potential crRNA candidates showing excellent RNA degradation ability of SARS-CoV-2 in the order of 2, 5, 11, and 9.
  • 5 is a schematic diagram showing synthesized PspCas13b mRNA and crRNA modified with 2'-O-methyl 3'phosphorothioate.
  • Figure 6a is a diagram showing that the expression of PspCas13b protein steadily increased from 2 hours after transfection.
  • 6B is a diagram confirming that uniform expression of PspCas13b is induced in most cells through HA tag staining.
  • FIG. 7 is a diagram confirming that cells expressing PspCas13b mRNA gradually divide after 24 and 48 hours, and the number of cells visible on one image screen increases, thereby confirming that there is no cytotoxicity.
  • Figure 8a is a schematic diagram showing the location where the crRNA target site in the SARS-CoV-2 ORF1b gene can be amplified with RT-qPCR primers.
  • each crRNA spacer 1, 2, 3, and 4 can degrade the targeting portion of RdRp mRNA together with PspCas13b.
  • each crRNA spacer 5, 6, 7, and 8 8) can degrade the targeting portion of RdRp mRNA together with PspCas13b.
  • each crRNA spacer 9, 10, 11, and 12
  • PspCas13b PspCas13b
  • 9a is a diagram confirming that all four crRNAs (Nos. 2, 5, 9, and 11) showed a significant decrease in the level of RdRp mRNA by PspCas13b, compared to the non-target (NT) experimental group.
  • Figure 9b is a diagram confirming the mRNA degradation activity according to the ratio of PspCas13b and crRNA No. 2 or No. 5.
  • 10A is a diagram showing the results of immunostaining to confirm whether each crRNA expresses spike protein.
  • 10B is a diagram illustrating the effect of each crRNA on the SARS-CoV-2 RNA gene level in cell culture medium (supernant) or cell lysate (cell) of SARS-CoV-2 infected Vero E6 cells.
  • 10c is a diagram analyzing the effect of each crRNA on the number of SARS-CoV-2 genomes in Vero E6 cells infected with SARS-CoV-2.
  • 10D is a diagram illustrating the effect of each crRNA on the level of SARS-CoV-2 RNA gene in Vero E6 cells infected with SARS-CoV-2.
  • Figure 10e is a diagram analyzing the effect of each crRNA on the level of SARS-CoV-2 RdRp, nucleotide gene in Calu-3 cells infected with SARS-CoV-2.
  • 11a is a diagram showing the structure of crRNA targeting a pseudoknot region.
  • 11b is a diagram confirming through immunostaining whether pseudoknot-targeting crRNA inhibits spike protein expression.
  • 11c is a diagram confirming through western blot whether pseudoknot-targeting crRNA inhibits spike protein expression.
  • 11d is a diagram illustrating the effect of each crRNA on the level of RdRp and nucleocapsid genes in cell culture medium (supernant) or cell lysate (cell) of SARS-CoV-2-infected Vero E6 cells.
  • 12a is a diagram confirming whether spike protein expression is inhibited using dead PspsCas13b.
  • Figure 12b is a diagram confirming whether the RdRp, nucleocapsid gene levels of SARS-CoV-2 are reduced in the treatment group using dead PspsCas13b.
  • Figure 12c is a plaque assay measuring the change in the level of live SARS-CoV-2 replication according to the treatment for each concentration of Cas13b mRNA and crRNA.
  • Figure 12d is a diagram showing the results of analyzing plaque assay measuring the change in the level of live SARS-CoV-2 replication according to the treatment for each concentration of Cas13b mRNA and crRNA.
  • 13a is a SARS-CoV-2 variant It is a diagram showing the results of analyzing sequence variation between (alpha, beta, gamma and delta).
  • Figure 13b is a diagram confirming whether crRNA targeting the pseudoknot region reduces the expression of spike protein in cells infected with SARS-CoV-2 mutants.
  • 13c is a diagram confirming whether crRNA targeting the pseudoknot region reduces subgenomic RNA levels of N and nsp2 genes in SARS-CoV-2 mutant virus-infected cells.
  • 14 is a diagram confirming whether crRNA targeting the pseudoknot region inhibits viral infection in mice infected with SARS-CoV-2 mutant virus.
  • the present invention relates to a Cas13 protein or a polynucleotide encoding the same; And it provides a pharmaceutical composition for preventing or treating coronavirus infection-19 (COVID-19) containing crRNA (CRISPR RNA).
  • COVID-19 coronavirus infection-19
  • CRISPR RNA crRNA
  • the Cas13 protein is a type of Cas protein.
  • Cas protein is a CRISPR-associated protein, and is an enzyme capable of recognizing and cleaving double-stranded or single-stranded nucleic acids such as DNA or RNA (dsDNA/RNA and ssDNA/RNA). Specifically, they can recognize double-stranded or single-stranded nucleic acids bound to crRNA or guide RNA and cleave them. That is, the endonuclease function is activated by recognizing that the crRNA is bound to the target site. In addition, as the endonuclease function is activated, it may have exonuclease activity capable of non-specifically cutting double-stranded and/or single-stranded DNA and/or RNA.
  • the Cas13 protein can be any one protein selected from the group consisting of Cas13a, Cas13b, Cas13c and Cas13d, can naturally recognize and cut 'RNA', and is known as "C2c2" in bacteria.
  • Cas13 is a class 2, type VI CRISPR protein that is activated by recognizing ssRNA targets.
  • Cas13a found in Leptotrichia wadei and Prevotella sp.
  • Cas13b (PspCas13b) found at P5-125 is representative, and both do not require a specific motif like PAM.
  • the Cas13b protein is associated with one or more functional domains, and the effector protein contains one or more mutations in the HEPN domain, so that the complex can deliver epigenetic modifiers or transcriptional or translational activation or inhibition signals.
  • Complexes can be formed in vitro or ex vivo, introduced into cells or contacted with RNA; or in vivo.
  • the polynucleotide encoding the Cas13 protein may be DNA or mRNA, and according to a specific embodiment of the present invention, it is mRNA.
  • the crRNA is CRISPR RNA and may be single strand RNA.
  • crRNA may be used in the form of guide RNA combined with tracrRNA (trans-activating CRISPR RNA).
  • the crRNA may have a sequence complementary to a gene sequence specifically present in the target.
  • the crRNA may be RNA composed of 15 to 40 nucleic acids.
  • the polynucleotide may be composed of 18 to 30 nucleic acids.
  • crRNA may consist of 30 nucleic acids.
  • the crRNA may include an additional sequence 3' to make the CRISPR-associated protein active.
  • the crRNA can be chemically modified.
  • chemical transformations include, but are not limited to, 2'-O-methyl 3'phosphorothioate (MS), 2'-O-methyl ( M), or incorporation of 2'-O-methyl 3'thio PACE (MSP).
  • Such chemically modified crRNAs have unpredictable on-target (on-target, on-target) specificity versus off-target (off-target, off-target) specificity, but unmodified It may include increased stability and increased activity compared to crRNA.
  • Chemically modified crRNAs include without limitation RNAs with locked nucleic acid (LNA) nucleotides comprising phosphorothioate linkages and methylene bridges between the 2' and 4' carbons of the ribose ring.
  • LNA locked nucleic acid
  • the target RNA sequence of the SARS-CoV-2 gene is RNA-dependent RNA polymerase (RdRp) in ORF1b, a ribosomal frameshift site located upstream of RdRp, Helicase, 3' to 5' exonuclease, endoRNase or It may be a 2'O-ribose methyltransferase, preferably a ribosome reading frame displacement site located upstream of RdRp or RdRp.
  • RdRp RNA-dependent RNA polymerase
  • the crRNA can hybridize to a target site including a nucleic acid sequence selected from SEQ ID NOs: 1 to 12.
  • the guide RNA may include nucleic acid sequences represented by SEQ ID NOs: 13 to 24.
  • a vector may be used to synthesize the polynucleotide and crRNA encoding the Cas13b protein included in the composition of the present invention.
  • a "vector” is a tool that permits or facilitates the transfer of an entity from one environment to another. It is a replicon, such as a plasmid, phage, or cosmid, into which another segment of DNA can be inserted, causing replication of the inserted segment.
  • vectors are capable of replication when associated with appropriate control elements.
  • vector refers to a nucleic acid molecule capable of delivering another nucleic acid to which it has been linked.
  • Vectors include, without limitation, nucleic acid molecules that are single-stranded, double-stranded or partially double-stranded; nucleic acid molecules that do not contain free ends (eg, circular), including one or more free ends; nucleic acid molecules including DNA, RNA or both; and other types of polynucleotides known in the art.
  • plasmid refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, eg, by standard molecular cloning techniques.
  • viral vector which exists in vectors in which virus-derived DNA or RNA sequences are enclosed in viruses (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno- Associated virus (AAV) viral vectors also include polynucleotides carried by viruses for transfection into host cells.
  • viruses e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno- Associated virus (AAV) viral vectors also include polynucleotides carried by viruses for transfection into host cells.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
  • vectors e.g., non-episomal mammalian vectors
  • Other vectors are capable of autonomous replication in a host cell into which they are introduced. Upon introduction into the host cell, it integrates into the host cell's genome and is thereby replicated along with the host genome.
  • certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors".
  • Common expression vectors useful in recombinant DNA technology often exist in the form of plasmids.
  • a recombinant expression vector may contain a nucleic acid of the present invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vector contains one or more regulatory elements, wherein the one or more regulatory elements are used in the host cell to be used for expression. and is operably linked to the nucleic acid sequence to be expressed.
  • "operably linked" means that the nucleotide sequence of interest allows expression of the nucleotide sequence (e.g., within an in vitro transcription/translation system, or within a host cell when the vector is introduced into a host cell). It is intended to mean connected to the controlling element in such a way as to make it possible.
  • the vector may be any one selected from the group consisting of plasmids and viruses.
  • plasmid DNA examples include commercial plasmids such as pCMV3, pET28a, pUC57 and pET.
  • Other examples of plasmids that can be used in the present invention include Escherichia coli-derived plasmids (pUC57, pCMV3, pET28a, pET, pGEX, pQE, pDEST and pCOLD), Bacillus subtilis -derived plasmids (pUB110 and pTP5) and yeast -Derived plasmids (YEp13, YEp24 and YCp50). Since these plasmids show different amounts of protein expression and modification depending on the host cell, a host cell most suitable for the purpose may be selected and used.
  • suitable vectors include, but are not limited to, microinjection, electroporation, sonoporation, biolistics, calcium phosphate-mediated transfection, cation transfection , liposome transfection, dendrimer transfection, heat shock transfection, nucleofection transfection, magnetofection, lipofection, impalefection, optical transfection, dedicated formulation-enhanced uptake of nucleic acids, and liposomes, It can be introduced into cells through one or more methods known in the art, including delivery via immunoliposomes, virosomes or artificial virions.
  • vectors are introduced into cells by microinjection.
  • the vector or vectors can be microinjected into the nucleus or cytoplasm.
  • the vector or vectors can be introduced into cells by nucleofection.
  • Vectors can be designed for expression of CRISPR transcripts (eg, nucleic acid transcripts, proteins or enzymes) in prokaryotic or eukaryotic cells.
  • CRISPR transcripts eg, nucleic acid transcripts, proteins or enzymes
  • CRISPR transcripts can be expressed in bacterial cells such as Escherichia coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells.
  • Recombinant expression vectors can be transcribed and translated in vitro using, for example, T7 promoter regulatory sequences and T7 polymerase.
  • the present invention provides a method for treating COVID-19 by administering the pharmaceutical composition to a subject.
  • “individual” means all animals, including humans, that can be infected with coronavirus.
  • the vaccine of the present invention By administering the vaccine of the present invention to a subject, the above diseases can be effectively treated.
  • COVID-19 can be treated with the pharmaceutical composition of the present invention.
  • the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is dependent on the type and severity of the subject, age, sex, infected virus type, drug activity, drug sensitivity, administration time, route of administration, excretion rate, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical field.
  • the pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And it can be single or multiple administrations. It is important to administer the amount that can obtain the maximum effect with the minimum amount without side effects in consideration of all the above factors, and can be easily determined by those skilled in the art.
  • the term "effective amount" refers to a dose sufficient to provide the desired therapeutic effect in the subject being treated, eg sufficient to generate or induce an immune response against a pathogen or antigen in its receptor.
  • the effective amount may vary for various reasons, such as the route and frequency of administration, the body weight and species of the individual receiving the drug, and the purpose of administration. A person skilled in the art can determine the dosage in each case based on the disclosure herein, established methods and their own experience.
  • the dosage form of the pharmaceutical composition of the present invention may be for parenteral use.
  • preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • composition of the present invention can be administered parenterally, intratumorally, intravenously, intramuscularly, intracutaneously, subcutaneously, intraperitoneally, intraarterially, intraventricularly, intralesionally, intrathecally, topically, and combinations thereof. It may be administered by any one route selected from the group consisting of
  • the dosage of the pharmaceutical composition of the present invention varies in its range depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate and severity of the disease, and can be appropriately selected by those skilled in the art.
  • the pharmaceutical composition of the present invention may be administered at 0.01 ug/kg to 100 mg/kg per day, specifically at 1 ug/kg to 1 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. Accordingly, the dosage is not intended to limit the scope of the present invention in any way.
  • ORF1b mRNA of SARS-CoV-2 which is a target of crRNA, was synthesized to be used as a template (see FIG. 1).
  • sequence variation between SARS-CoV2, MERS-CoV and SARS-CoV-2 was analyzed, focusing on genes of non-structural proteins with little sequence variation (see Figure 2).
  • the front gene of ORF1b ranging from the ribosomal frameshift site to the RNA-dependent RNA polymerase (RdRp), was selected as the target site (see Table 2), and 12 crRNAs capable of hybridizing to the target site were selected. design (see Table 3).
  • Nos. 1 to 3 target the peudoknot region
  • Nos. 4 to 12 target RdRp.
  • crRNAs 2, 5, 11, and 9 were found to have relatively excellent RNA degradation ability of SARS-CoV-2 (see FIGS. 3A to 3D), and in particular, crRNA No. 2 had the highest RNA degradation activity. It was shown (see Fig. 4).
  • mRNA encoding the Cas13b protein was synthesized (see FIG. 5), and the synthesized PspCas13b mRNA was transfected into cells to confirm high transfection efficiency (see FIGS. 6a and 6b), and PspCas13b mRNA was cytotoxic. It was confirmed that there was no (see FIG. 7).
  • the SARS-CoV-2 mRNA degrading efficacy of the Cas13b mRNA and crRNA was confirmed.
  • crRNA could degrade the target region of RdRp mRNA together with PspCas13b by using primers that amplify the region targeted by crRNA (see FIGS. 8A and 8D ).
  • crRNAs 2, 5, 9, and 11 induced degradation of RdRp mRNA by PspCas13b, resulting in a decrease in the level of RdRp mRNA (see FIG. 9a).
  • it showed the highest mRNA degradation activity
  • crRNA No. 5 was treated at a ratio of 1:36, it was confirmed that the highest mRNA degradation activity was shown (see FIG. 9b).
  • the pharmaceutical composition of the present invention can be usefully used as a therapeutic agent for COVID-19.
  • the SARS-CoV-2 ORF1b portion which is the target of the crRNA, was cloned so that it could be used as a template.
  • the entire (about 8 kb, 8,135 bp) cDNA library of ORF1b was divided into three fragments (1 fragment: RNA-dependent RNA polymerase (2.7 kb), 2 fragment: Helicase (1.8 kb), 3 fragment: exonuclease + endoRNase + 2'O). -ribose methyltransferase (3.5 kb)) and PCR cloning was performed (Fig. 1).
  • each fragment was extracted from the cDNA library through a PCR process using the primers in Table 1 below capable of PCR of 1, 2, and 3 fragments.
  • ORF1b in the form of DNA was synthesized by conducting PCR under conditions where all fragments were mixed using 1 the forward primer of the fragment and 3 the reverse primer of the fragment.
  • Sequence (5' ⁇ 3') sequence number 1 Fragment forward primer GCTACCGGACTCAGATCTCGAGaccatgCGGGTTTGCGGTGTAAGTGCAGCC SEQ ID NO: 25 1 Reverse fragmentation primer CCCAACAGCCTGTAAGACTGTATGCGGTGTGTACATAGCC SEQ ID NO: 26 2 Fragment forward primer CTTACAGGCTGTTGGGGCTTGTGTTCTTTGCA SEQ ID NO: 27 2 Reverse fragmentation primer TTTCAGCTTGTAAAGTTGCCACATTCCTACGTGGAATTTCAAGAC SEQ ID NO: 28 3 Fragment forward primer GCAACTTTACAAGCTGAAAATGTAACAGGACTCTTTAAAGATTGTAGTAAGGTAATCAC SEQ ID NO: 29 3 Reverse fragmentation primer GGGCCCGCGGTACCGTCGACccGTTGTTAACAAGAACATCACTAGAAATAACAACTCTGTTGTTTTCTCTAATT SEQ ID NO: 30
  • the entire genome of a coronavirus patient sample was obtained using open source data (GISAID) and sequence alignment was performed using the MAFFT method for association between genome sequences.
  • the structural protein of the coronavirus had a relatively large amount of sequence variation compared to the non-structural protein. Therefore, the present inventors focused on genes of non-structural proteins involved in the viral replication system in order to completely block viral genome replication.
  • Example 2-1 Based on the sequence homology analysis of Example 2-1, the front gene of ORF1b ranging from the ribosomal frameshift site to the RNA-dependent RNA polymerase (RdRp) was selected as the crRNA target site (FIG. 2). After deriving a target sequence using a program (CHOPCHOP, Benchling) to predict Cas13a and Cas13d crRNA, it was arbitrarily matched to a length of 30 bp to be suitable for Cas13b crRNA.
  • a program (CHOPCHOP, Benchling)
  • a crRNA targeting the target site of Example 2-2 was prepared.
  • crRNAs numbered 1 to 12 were prepared.
  • crRNAs 1 to 3 were designed to target the peudoknot region of the ribosome reading frame displacement site located upstream of RdRp, and crRNAs 4 to 12 were designed to target RdRp (FIG. 2).
  • 2'-0-methyl 3'phophorothioate modification was introduced to 3 nucleotides at each of the 5' and 3' ends of crRNA.
  • HEK293T cells were transfected with DNA capable of expressing PspCas13b and crRNA together with DNA encoding the firefly-conjugated RdRp fragment. After 48 hours, the luminescence was measured using a dual-luciferase reporter assay system (FIGS. 3a and 3b).
  • RNA degradation ability of SARS-CoV-2 was excellent in the order of 2, 5, 11, and 9.
  • RdRp DNA, Cas13b DNA, and crRNA DNA were injected into HEK293T cells, 24 hours later, total RNA from the cells was extracted and RdRp mRNA values were measured by qRT-PCR.
  • qRT-PCR primers that can detect the RdRp part targeted by each crRNA were used, and based on the RdRp mRNA value of the crRNA (NT) treatment group that does not target RdRp, crRNA #2, #5, # The values of the 9 and #11 treatment groups were normalized.
  • RNA having a T7 promoter was synthesized by PCR, and RNA was synthesized using the Hiscribe T7 ARCA mRNA synthesis kit (with tailing). T7 RNA polymerase mix and ARCA/NTP mix were mixed with PspCas13b DNA with T7 promoter and reacted at 37°C. DNase was treated to remove PspCas13b DNA, followed by poly(A) tailing. The synthesized RNA was purified using an RNA purification kit.
  • PspCas13b mRNA was synthesized as shown in FIG. 5 .
  • the Cas13b protein encoded by the mRNA can induce rapid and transient expression of the Cas13b protein in cells.
  • PspCas13b mRNA was introduced into HEK293T cells, and the cells were collected and protein extracted at 2, 4, 8, and 12 hours. The same amount for each time period was Western blotted through protein quantification.
  • the PspCas13b protein was targeted using rabbit anti-HA tag antibody, and the GAPDH protein was targeted using mouse anti-GAPDH antibody.
  • each protein was imaged as a secondary target using goat anti-rabbit IgG H&L (IRDye 680RD) and goat anti-mouse IgG H&L (IRDye 800CW).
  • HEK293T cells transfected with PspCas13b mRNA were confirmed to express PspCas13b by HA tag staining 48 hours after transfection.
  • HEK293T into which PspCas13b mRNA was introduced was fixed with 4% formaldehyde and then permeabilized with 0.2% Triton X-100.
  • Rabbit anti-HA tag antibody was used to target the PspCas13b protein for 24 hours, and goat anti-rabbit IgG (H+L) and alexa fluor 488 were used as secondary targets and imaged using ImagExfluorer.
  • PspCas13 mRNA was expressed in HEK293T cells and observed under a microscope for 48 hours.
  • HEK293T cells were transfected with DNA expressing PspCas13b and crRNA, and cells were harvested 48 hours later. RNA was extracted from harvested cells, and cDNA was synthesized using random hexamer and oligo dT as primers. As shown in FIG. 8a, primers capable of amplifying the RT-qPCR detection region were prepared and RT-qPCR was performed using cDNA as a template. In the case of the experimental group that was recognized by the corresponding crRNA and degraded by PspCas13b, it was confirmed whether each crRNA and PspCas13b could degrade the RNA of SARS-CoV-2 because it was not detected by the RT-qPCR primer.
  • the gray bar is the non-targeted experimental group (using Non-target crRNA)
  • the blue bar is the targeted experimental group
  • the red bar is the amplification of the part targeted by the crRNA.
  • the groups in which the primers were used were indicated, and in most cases, it was confirmed that the lowest RdRp mRNA expression level was shown in the RT-qPCR result group.
  • HEK29T cells were transfected with PspCas13b mRNA, crRNA, and RdRp mRNA, and 24 hours later, the cells were harvested and RNA was extracted. After synthesizing cDNA from RNA, RT-qPCR was performed using primers that detect the site targeted by the corresponding crRNA.
  • crRNA No. 2 showed the highest mRNA degradation activity when PspCas13b and crRNA were treated at a ratio of 1:20, but when treated at a ratio of 1:36 and 1:50, There was no statistically significant difference, and crRNA 5 showed the highest mRNA degradation activity when treated at a ratio of 1:36, but there was a statistically significant difference between treatment at a ratio of 1:20 and 1:50. there was no
  • Cells were fixed with 4% formaldehyde and then permeabilized with 2% Triton X-100.
  • the spike protein was first targeted using rabbit anti-2019-nCoV spike protein, and the second target was goat anti-rabbit IgG (H+L) and alexa fluor 488. After staining the cells with DAPI, DAPI and GFP imaging were performed, and the number of cells stained with DAPI and GFP was measured relative to the number of cells stained with DAPI, and expressed as a percentage.
  • the number of cells expressing spike protein was significantly reduced in the crRNA #2 and #9 treated groups compared to the non-treated control group (Non).
  • the number was 99.9 It was confirmed that % spike protein was not expressed.
  • crRNA #2 targeting the pseudoknot region has an excellent effect of inhibiting viral replication.
  • SARS-CoV-2 gene was analyzed through qPCR.
  • RNA from SARS-CoV-2 infected Vero E6 cells After extracting total RNA from SARS-CoV-2 infected Vero E6 cells, it was fragmented, and a library was created by attaching the sequences necessary for sequencing to both ends of the fragment.
  • the data generated after sequencing was mapped using STAR and HTSeq tools, using the sample-derived species Vero cell (GCF_015252025.1_Vero_WHO_p1.0) and SARS-CoV-2 (MW466791.1) as a reference. To check the number of read coverages, BAM files were used and adjusted to cover each location within the genome of SARS-CoV-2.
  • the SARS-CoV-2 genome was significantly reduced in the crRNA #2, 9, and 11 treated groups compared to the non-RdRp non-targeted crRNA (NT) treated group.
  • the crRNA #2 treatment group targeting the pseudoknot part showed complete SARS-CoV-2 genome reduction.
  • Calu-3 cells transfected with Cas13b mRNA and crRNA #2 were infected with SARS-CoV-2, and 24 hours later, total RNA was extracted from the infected cells and the SARS-CoV-2 gene was analyzed by qRT-PCR.
  • crRNA #2 which showed a strong virus inhibitory effect in Experimental Example 2, targets the pseudoknot region of the ribosomal reading frame displacement site of ORF1b.
  • the ribosome reading frame displacement site has a highly conserved 3-stemmed pseudoknot structure in SARS-CoV-2, and crRNA #1 and #3 also target the pseudoknot region and cover the entire 3-stemmed structure (Fig. 11a).
  • crRNA #1 targeted sequences forming stem 1 and 3
  • crRNA #2 and #3 targeted sequences from stem 1-3 and stem 2, respectively. Accordingly, we spiked cells transfected with crRNAs (#1, #2, #3) and Cas13b mRNA targeting the peudoknot region to confirm that targeting the pseudoknot region is important for blocking viral replication. Protein expression and subgenomic RNA levels were confirmed.
  • the culture medium and cell lysates of cells transfected with crRNA #1, #2, and #3 compared to the control group treated with crRNA not treated or non-targeted crRNA (Non-target). It was confirmed that the spike protein did not appear in .
  • crRNA #1, #2 and #3 and PspCas13b inhibit viral replication of SARS-CoV-2.
  • each time period was Western blotted through protein quantification.
  • rabbit anti-2019-nCoV spike protein and rabbit anti-2019-nCoV nucleotide were used to target spike protein and nucleocapsid protein, respectively, and mouse anti-GAPDH was used to target GAPDH protein.
  • each protein was imaged as a secondary target using goat anti-rabbit IgG H&L (IRDye 680RD) and goat anti-mouse IgG H&L (IRDye 800CW).
  • crRNA #1, #2 and #3 and PspCas13b effectively inhibit viral replication of SARS-CoV-2.
  • RNA levels were confirmed by qPCR.
  • translation start sites such as the pseudoknot region
  • the pseudoknot region in SARS-CoV-2 has a 3-stemmed RNA structure and is located at a frameshifting site, playing an important role in viral protein expression.
  • SARS-CoV-2 proliferation is inhibited by cleavage of the SARS-CoV-2 genome, rather than inhibition of SARS-CoV-2 proliferation by inhibiting the frameshifting site function by binding to the pseudoknot region of the PspCas13b protein, the cleavage effect A dead PspsCas13b was produced and tested for suppression of SARS-CoV-2.
  • crRNA #5 was used as a control.
  • PspCas13b mRNA and crRNA #2 and dead PspCas13b mRNA and crRNA #2 were introduced into Vero E6 cells, respectively, and Spike protein was stained 24 hours after infection with SARS-CoV-2.
  • Triton X-100 Cells were fixed with 4% formaldehyde and then permeabilized with 2% Triton X-100.
  • the spike protein was first targeted using rabbit anti-2019-nCoV spike protein, and the second target was goat anti-rabbit IgG (H+L) and alexa fluor 488. After DAPI staining of the cells, DAPI and GFP imaging were performed.
  • spike protein was increased in both crRNA #2 and #5 treatment groups in the dead PspCas13b mRNA treatment group.
  • the number of stained cells was not reduced at all.
  • qRT-PCR was performed using primers that amplify RdRp and nucleotide genes of SARS-CoV-2 by extracting total RNA from infected Vero E6 cells.
  • a plaque assay was performed to measure the change in the level of live SARS-CoV-2 replication according to the concentrations of Cas13b mRNA and crRNA.
  • Vero E6 cells were treated with 0 ng: 0 ng, 50 ng: 25 ng, 100 ng: 50 ng, 200 ng: 100 ng, and 400 ng: 200 ng Cas13b mRNA and crRNA, respectively, followed by SARS-CoV-2 infection. induced. After 24 hours, SARS-CoV-2 was isolated from the infected cells and infected with it into new Vero E6 cells. These cells were subjected to plaque assay.
  • SARS-CoV-2 variants Sequence variation between (alpha, beta, gamma and delta) was analyzed.
  • the entire SARS-CoV-2 genome corresponding to the variant was obtained from each of 10 patient samples using open source data (GISAID), and sequence alignment was performed using the MAFFT method to confirm the association between genome sequences. .
  • ORF1a and structural proteins of SARS-CoV-2 mutants had a relatively large amount of mutations compared to ORF1b.
  • ORF1b is the most conserved region in the SARS-CoV-2 genome, and the sequence and structure of the pseudoknot region of ORF1b are known to be highly conserved in coronaviruses.
  • SARS-CoV-2 viral genome-based antiviral agents are faced with the challenge of overcoming mutations.
  • Drugs designed to recognize the gene of a structural protein have a high mutation rate, which risks reducing targeting efficiency. Therefore, it suggests that the crRNA targeting the RdRp or pseudoknot region in ORF1b of the present invention can effectively inhibit viral replication even in SARS-CoV-2 mutants.
  • PspCas13b mRNA and crRNA #2 were introduced into Vero E6 cells and SARS-CoV-2, SARS-CoV-2 alpha, SARS-CoV-2 beta, SARS-CoV-2 gamma, SARS-CoV-2 delta mutants 24 hours after each infection, the spike protein was stained.
  • Cells were fixed with 4% formaldehyde and then permeabilized with 2% Triton X-100.
  • the spike protein was first targeted using rabbit anti-2019-nCoV spike protein, and the second target was goat anti-rabbit IgG (H+L) and alexa fluor 488. After DAPI staining of the cells, DAPI and GFP imaging were performed.
  • qRT-PCR was performed to confirm the subgenomic RNA levels of nucleocapsid (N) and non-structural protein 2 (nsp2) genes.
  • Vero E6 cells were infected with each SARS-CoV-2 mutant virus, and 24 hours later, total RNA was extracted from the infected cells and nucleocapsid (N) or non-structural protein 2 (nsp2) of SARS-CoV-2 was extracted. qRT-PCR was performed using primers for amplification.
  • the subgenomic amount of the N and nsp2 genes was higher in the pseudoknot region than in the non-treated or non-targeted crRNA-treated control group. It was confirmed that all types of SARS-CoV-2 viruses were reduced by Cas13-mediated degradation of crRNA #2.
  • SARS-CoV-2 As an animal model for SARS-CoV, human ACE2 transgenic mice were introduced with PspCas13b mRNA and crRNA #2 via tracheal intubation, and SARS-CoV-2 infection was induced. After 24 hours, SARS-CoV-2 was isolated from lung tissues of infected mice and the virus was quantified through TCID 50 analysis.
  • virus detection was very insignificant in mice targeting the pseudoknot region (#2), unlike mice not treated with mRNA (Non) and mice not targeting RdRp (NT).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne une composition pharmaceutique pour la prévention ou le traitement du coronavirus-19, comprenant des protéines Cas13 et de l'ARNcr. En particulier, Cas13b et ARNsc, qui cible la région du gène RdRp d'ORF1b du SARS-CoV-2, de la présente invention, ne sont pas cytotoxiques et ont une excellente capacité à dégrader l'ARN du SARS-CoV-2, et peuvent ainsi être utilisés efficacement en tant qu'agents thérapeutiques pour la maladie du coronavirus 19.
PCT/KR2022/007599 2021-05-27 2022-05-27 Composition pharmaceutique pour la prévention ou le traitement du coronavirus-19, comprenant une protéine cas13 et un arncr WO2022250503A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0068113 2021-05-27
KR20210068113 2021-05-27

Publications (1)

Publication Number Publication Date
WO2022250503A1 true WO2022250503A1 (fr) 2022-12-01

Family

ID=84228915

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/007599 WO2022250503A1 (fr) 2021-05-27 2022-05-27 Composition pharmaceutique pour la prévention ou le traitement du coronavirus-19, comprenant une protéine cas13 et un arncr

Country Status (2)

Country Link
KR (1) KR20220160510A (fr)
WO (1) WO2022250503A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111363847A (zh) * 2020-02-12 2020-07-03 广州微远基因科技有限公司 基于CRISPR技术的2019-nCoV快速检测引物组及其用途
CN112159817A (zh) * 2020-10-09 2021-01-01 天津医科大学总医院 靶向新型冠状病毒棘突的基因、试剂盒、筛选方法及应用
WO2021016453A1 (fr) * 2019-07-23 2021-01-28 University Of Rochester Clivage d'arn ciblé avec crispr-cas

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021016453A1 (fr) * 2019-07-23 2021-01-28 University Of Rochester Clivage d'arn ciblé avec crispr-cas
CN111363847A (zh) * 2020-02-12 2020-07-03 广州微远基因科技有限公司 基于CRISPR技术的2019-nCoV快速检测引物组及其用途
CN112159817A (zh) * 2020-10-09 2021-01-01 天津医科大学总医院 靶向新型冠状病毒棘突的基因、试剂盒、筛选方法及应用

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ABBOTT TIMOTHY R., DHAMDHERE GIRIJA, LIU YANXIA, LIN XUEQIU, GOUDY LAINE, ZENG LEIPING, CHEMPARATHY AUGUSTINE, CHMURA STEPHEN, HEA: "Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and Influenza", CELL, vol. 181, no. 4, 14 May 2020 (2020-05-14), Amsterdam NL , pages 865 - 876+12, XP055854857, ISSN: 0092-8674, DOI: 10.1016/j.cell.2020.04.020 *
FAREH MOHAMED, ZHAO WEI, HU WENXIN, CASAN JOSHUA M. L., KUMAR AMIT, SYMONS JORI, ZERBATO JENNIFER M., FONG DANIELLE, VOSKOBOINIK I: "Reprogrammed CRISPR-Cas13b suppresses SARS-CoV-2 replication and circumvents its mutational escape through mismatch tolerance", NATURE COMMUNICATIONS, vol. 12, no. 1, 1 January 2021 (2021-01-01), pages 1 - 16, XP093008405, DOI: 10.1038/s41467-021-24577-9 *
KELLY JAMIE A., OLSON ALEXANDRA N., NEUPANE KRISHNA, MUNSHI SNEHA, EMETERIO JOSUE SAN, POLLACK LOIS, WOODSIDE MICHAEL T., DINMAN J: "Structural and functional conservation of the programmed −1 ribosomal frameshift signal of SARS-CoV-2", BIORXIV, 15 June 2020 (2020-06-15), pages 1 - 13, XP093008404, DOI: 10.1101/2020.03.13.991083 *

Also Published As

Publication number Publication date
KR20220160510A (ko) 2022-12-06

Similar Documents

Publication Publication Date Title
JP7522088B2 (ja) 単純ヘルペス１型および他の関連するヘルペスウイルスのｒｎａガイド除去
US11970710B2 (en) Genome engineering with Type I CRISPR systems in eukaryotic cells
US8163292B2 (en) Herpes simplex viruses and methods of viral replication
WO2010041913A9 (fr) Nouvelles utilisations des protéines grs ou de leurs fragments
US20050226847A1 (en) Adeno-associated virus producer system
WO2023282688A1 (fr) Cellule souche mésenchymateuse ayant une résistance au stress oxydatif, son procédé de préparation et son utilisation
Tian et al. Assessment of the IFN-β response to four feline caliciviruses: Infection in CRFK cells
Gao et al. Kaempferol inhibits SARS-CoV-2 invasion by impairing heptad repeats-mediated viral fusion
WO2022250503A1 (fr) Composition pharmaceutique pour la prévention ou le traitement du coronavirus-19, comprenant une protéine cas13 et un arncr
Chen et al. Optimization of 5′ UTR to evade SARS-CoV-2 Nonstructural protein 1-directed inhibition of protein synthesis in cells
Qu et al. C/EBPα Epigenetically Modulates TFF1 Expression via mC-6 Methylation in the Jejunum Inflammation Induced by a Porcine Coronavirus
JP7075653B2 (ja) αヘルペスウイルス感染を処置する方法及び医薬組成物
WO2011087343A2 (fr) Composition destinée à traiter un cancer lié à une infection par un papillomavirus humain
WO2020139031A1 (fr) Composition à base de crispr-cas pour correction génique
WO2020242278A1 (fr) Méthode d'inhibition d'infection et d'activation de virus
US20220235348A1 (en) Crispr methods for treating cancers
WO2023244048A1 (fr) Vecteur recombiné du sars coronavirus 2 exprimant le gène rapporteur issu du sars coronavirus 2 clade gh des isolats coréens, et son procédé de production
WO2023179781A1 (fr) Procédé et composition pharmaceutique de traitement d'infections virales
WO2023244044A1 (fr) Protéine d'antigène de spicule du coronavirus modifiée et ses utilisations
WO2023234661A1 (fr) Nouvelle séquence de polyadénine modifiée et son utilisation
WO2022060155A1 (fr) Vecteur de thérapie génique ayant une occurrence de recombinaison minimisée, rétrovirus recombinant comprenant un vecteur et composition pharmaceutique pour la prévention ou le traitement du cancer, comprenant un rétrovirus recombinant
WO2024014770A1 (fr) Arn modifié pour la préparation d'un vaccin à arnm et d'un agent thérapeutique
WO2023063695A1 (fr) Composition anti-coronavirus comprenant du xanthorrhizol ou un sel de celui-ci
WO2022220380A1 (fr) Préparation du virus kilham du rat recombiné, et son utilisation
US20240271128A1 (en) Rna guided eradication of herpes simplex type i and other related human herpesviruses

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22811694

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22811694

Country of ref document: EP

Kind code of ref document: A1