WO2022250491A1 - Novel dual helper plasmid - Google Patents

Novel dual helper plasmid Download PDF

Info

Publication number
WO2022250491A1
WO2022250491A1 PCT/KR2022/007553 KR2022007553W WO2022250491A1 WO 2022250491 A1 WO2022250491 A1 WO 2022250491A1 KR 2022007553 W KR2022007553 W KR 2022007553W WO 2022250491 A1 WO2022250491 A1 WO 2022250491A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
seq
plasmid
rep
cap
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2022/007553
Other languages
English (en)
French (fr)
Inventor
Joo Seok HAN
Hoon Young Kong
Yoon Hyung HWANG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Neuracle Genetics Inc
Original Assignee
Neuracle Genetics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US17/750,241 external-priority patent/US12305188B2/en
Application filed by Neuracle Genetics Inc filed Critical Neuracle Genetics Inc
Priority to EP22811682.8A priority Critical patent/EP4347850A4/en
Priority to KR1020237035539A priority patent/KR102685652B1/ko
Priority to JP2023573241A priority patent/JP7854125B2/ja
Priority to CN202280037488.8A priority patent/CN117500932A/zh
Priority to AU2022282057A priority patent/AU2022282057B2/en
Priority to CA3219287A priority patent/CA3219287C/en
Publication of WO2022250491A1 publication Critical patent/WO2022250491A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151Methods of production or purification of viral material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151Methods of production or purification of viral material
    • C12N2750/14152Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/106Plasmid DNA for vertebrates
    • C12N2800/107Plasmid DNA for vertebrates for mammalian
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/50Vectors for producing vectors

Definitions

  • the present disclosure relates to a novel dual helper plasmid for producing a recombinant AAV for gene delivery.
  • Adeno-associated virus is a single-stranded DNA virus which belongs to helper-dependent parvoviruses requiring help from adenovirus, etc. for proliferation. It is a non-pathogenic virus having a genome size of about 4.7 kbp and does not induce cell-mediated immune response.
  • the target of infection varies widely depending on serotypes and the virus can deliver genes to non-dividing and dividing cells. In particular, the expression of the genes delivered by the AAV is continued for a long time in vivo [1-3].
  • recombinant adeno-associated virus is produced by triple transfection of host cells (e.g. , HEK293 cells) [4]. It requires 1) an AAV construct plasmid having a gene expression cassette flanked by ITRs (inverted terminal repeats), 2) a "Rep-Cap plasmid” which provides Rep proteins necessary for the replication of the adeno-associated virus genome and capsid proteins that constitute virus particles and, finally, 3) a "helper plasmid” which provides the proteins (E2a, E4) and RNAs (VA RNAs) of adenovirus that help the life cycle of adeno-associated virus.
  • Adeno-associated virus is produced when these three types of plasmids are transfected into HEK293 cells, etc. that provide the E1 and E3 genes of adenovirus [5].
  • the recombinant adeno-associated virus vector is produced only in the cells transfected with all of the above-mentioned three plasmids. If two plasmids are combined as one for double transfection, the chance of co-transfection will increase and, consequently, the production yield of the recombinant adeno-associated virus will be increased [6, 7]. In addition, since the number of the plasmids required to produce the recombinant adeno-associated virus is decreased from three to two, the time and cost required for producing and purifying the plasmids will be saved, too [8].
  • the recombinant adeno-associated virus vector cannot be replicated in vivo because it does not retain the rep and cap genes and does not have adenovirus-derived genes [9].
  • an engineered dual helper plasmid designed to increase the chance of transfection of a recombinant adeno-associated virus vector and the productivity of a recombinant adeno-associated virus therethrough and, at the same time, reduce the time and cost of the production and purification of a plasmid, and a method for preparing the same are keenly needed.
  • Adeno-Associated Virus as a Vector for Gene Therapy. M. F. Naso, B. Tomkowicz, W. L. Perry 3rd, W. R. Strohl.
  • a dual helper plasmid comprising an E2a gene, E4 gene, VA RNA gene, and rep-cap gene, wherein the E2a , E4 , and the VA RNA genes are linked sequentially, and wherein the rep - cap gene is located between the 5'-terminal of the E2a gene and the 3'-terminal of the VA RNA gene in a clockwise direction (from 5' to 3').
  • a dual helper plasmid comprising an E2a gene, E4 gene, VA RNA gene, and rep-cap gene, wherein the E2a , E4 , and the VA RNA genes are linked sequentially, and wherein the rep - cap gene is located between the 5'-terminal of the E2a gene and the 3'-terminal of the VA RNA gene in a counterclockwise direction (from 3' to 5').
  • a dual helper plasmid comprising a regulatory component, wherein the regulatory component comprises (from 5' to 3'):
  • VA RNA gene which comprises the sequence set forth in SEQ ID NO: 36;
  • a cap gene which comprises the sequence set forth in SEQ ID NO: 30;
  • a dual helper plasmid comprising a regulatory component, wherein the regulatory component comprises (from 5' to 3'):
  • VA RNA gene which comprises the sequence set forth in SEQ ID NO: 36;
  • a cap gene which comprises the sequence set forth in SEQ ID NO: 31;
  • a dual helper plasmid comprising a regulatory component, wherein the regulatory component comprises (from 5' to 3'):
  • VA RNA gene which comprises the sequence set forth in SEQ ID NO: 36;
  • a cap gene which comprises the sequence set forth in SEQ ID NO: 32;
  • a dual helper plasmid comprising a regulatory component, wherein the regulatory component comprises (from 5' to 3'):
  • VA RNA gene which comprises the sequence set forth in SEQ ID NO: 36;
  • a cap gene which comprises the sequence set forth in SEQ ID NO: 33;
  • composition comprising any of the dual helper plasmid of the present disclosure.
  • a cell comprising any of the dual helper plasmid or the composition of the present disclosure.
  • a method of producing a recombinant AAV comprising modifying a cell to comprise a first plasmid and a second plasmid, wherein the first plasmid is any of the dual helper plasmid of the present disclosure, and wherein the second plasmid comprises a transgene.
  • a method of increasing the yield of recombinant AAV during production comprising modifying a cell to comprise a first plasmid and a second plasmid, wherein the first plasmid is any of the dual helper plasmid of the present disclosure and the second plasmid comprises a transgene, and wherein the amount of recombinant AAV produced after the modifying is increased compared to the corresponding amount produced with a reference method.
  • a recombinant AAV produced by any of the method of the present disclosure.
  • a pharmaceutical formulation comprising any of the recombinant AAV of the present disclosure, and a pharmaceutically acceptable excipient.
  • a method of treating a disease or disorder in a subject in need thereof comprising administering to the subject any of the recombinant AAV or the pharmaceutical formulation of the present disclosure.
  • any of the recombinant AAV or the pharmaceutical formulation of the present disclosure in the manufacture of a medicament for treating a disease or disorder in a subject in need thereof.
  • FIGS. 1A-1F show the cleavage maps of pHelper-NG and Helper-In-One constructs (pHION8 series) for producing adeno-associated virus vector serotype 8 (AAV8) prepared by the inventors of the present disclosure.
  • FIG. 1A schematically shows a pHelper-NG construct for triple transfection, which includes the E2a , E4 gene and VA RNA genes of adenovirus serotype 5.
  • FIGS. 1B-1F schematically show five Helper-In-One-NG plasmid (pHION8) constructs, which are dual helper plasmids prepared by inserting rep2-cap8 gene fragments into different regions of the pHelper-NG construct.
  • FIGS. 1B and 1C schematically show a pHION8-BF construct prepared by cloning a rep2-cap8 construct in a forward direction (clockwise direction, 5' -> 3') using the BamHI site present between the beginning portion of the E2a gene and the ending portion of the VA RNA gene (FIG. 1B) and a pHION8-BR construct prepared by cloning in a reverse direction (counterclockwise direction, 3' -> 5') (FIG. 1C).
  • FIGS. 1D and 1E schematically show a pHION8-NF construct prepared by cloning a rep2-cap8 construct in a forward direction using the NotI site present at the beginning portion of the E4 gene (FIG.
  • FIG. 1D schematically shows a pHION8-AF construct prepared by cloning a rep2-cap8 construct in a forward direction using the AsiSI site present between the beginning portion of the VA RNA gene and the ending portion of the E4 gene.
  • FIG. 2 shows the cleavage map of a pHNG2 construct, which is a dual helper plasmid for producing adeno-associated virus vector serotype 2 (AAV2).
  • the pHNG2 construct was prepared by inserting a rep2-cap2 gene fragment in a forward direction using the BamHI site present between the beginning portion of the E2a gene and the ending portion of the VA RNA gene in a pHelper-NG plasmid.
  • FIG. 3 shows the cleavage map of a pHNG9 construct, which is a dual helper plasmid for producing adeno-associated virus vector serotype 9 (AAV9).
  • the pHNG9 construct was prepared by cloning a rep2-cap9 gene fragment in a forward direction using the BamHI site present between the beginning portion of the E2a gene and the ending portion of the VA RNA gene for double transfection.
  • FIG. 4 shows the cleavage map of a pHNG5K construct, which is a dual helper plasmid for producing adeno-associated virus vector serotype 5 (AAV5).
  • the pHNG5K construct was prepared by cloning a rep2-cap5 gene fragment in a forward direction using the BamHI site present between the beginning portion of the E2a gene and the ending portion of the VA RNA gene for double transfection.
  • FIGS. 5A and 5B show the cleavage maps of pHNG and pHNGR constructs.
  • FIG. 5A shows a rep-cap gene fragment inserted in a forward direction between the beginning portion of the E2a gene and the ending portion of the VA RNA gene
  • FIG. 5B shows the rep-cap gene fragment inserted in a reverse direction.
  • FIG. 6 shows a result of observing the effect of double transfection (Double) using pHION8 series on the increase or decrease of AAV8 production in adhesion cells (HEK293) as compared to triple transfection (Triple).
  • FIG. 7 shows a result of observing the effect of double transfection (Double) using pHION8 series on the increase or decrease of AAV8 production in suspension cells (Expi293) as compared to triple transfection (Triple).
  • FIG. 8 shows a result of observing the effect of double transfection (Double) using pHNG2 on the increase of AAV2 production in adhesion cells (HEK293) as compared to triple transfection (Triple).
  • FIG. 9 shows a result of observing the effect of double transfection (Double) using pHNG9 on the increase of AAV9 production in adhesion cells (HEK293) as compared to triple transfection (Triple).
  • FIG. 10 shows a result of observing the effect of double transfection (Double) using pHNG5K on the increase of AAV5 production in adhesion cells (HEK293) as compared to triple transfection (Triple).
  • FIG. 11 shows that AAV8s produced by triple transfection (Triple) or by double transfection (Double) using Helper-In-One constructs show comparable cell transduction efficiency.
  • FIG. 12 shows that AAV2s produced by triple transfection (Triple) or by double transfection (Double) using a pHNG2 construct show comparable cell transduction efficiency.
  • FIG. 13 shows that AAV9s produced by triple transfection (Triple) or by double transfection (Double) using a pHNG9 construct show comparable cell transduction efficiency.
  • the present disclosure is generally directed to compositions and methods for producing recombinant AAVs, and the use of such rAAVs to treat a disease or disorder.
  • the dual helper plasmids of the present disclosure comprise multiple genes (e.g. , E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene). Applicant has identified that by arranging the multiple genes in certain configurations, the yield or productivity can be increased or decreased during recombinant AAV production . Additional aspects of the present disclosure are provided throughout the present application.
  • a or “an” entity refers to one or more of that entity; for example, “a polypeptide,” is understood to represent one or more polypeptides.
  • the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein.
  • the term "at least" prior to a number or series of numbers is understood to include the number adjacent to the term “at least,” and all subsequent numbers or integers that could logically be included, as clear from context.
  • the number of nucleotides in a nucleic acid molecule must be an integer.
  • "at least 18 nucleotides of a 21-nucleotide nucleic acid molecule” means that 18, 19, 20, or 21 nucleotides have the indicated property.
  • At least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.
  • “At least” is also not limited to integers (e.g., "at least 5%” includes 5.0%, 5.1%, 5.18% without consideration of the number of significant figures.
  • AAV adeno-associated virus
  • AAV includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, those AAV serotypes and clades disclosed by Gao et al. ( J. Virol. 78 :6381 (2004)) and Moris et al. ( Virol.
  • an "AAV” includes a derivative of a known AAV. In some aspects, an "AAV” includes a modified or an artificial AAV.
  • administration refers to introducing a composition (e.g. , a recombinant AAV delivery vector produced using the dual helper plasmids of the present disclosure) into a subject via a pharmaceutically acceptable route.
  • a composition e.g. , a recombinant AAV delivery vector produced using the dual helper plasmids of the present disclosure
  • the introduction of a composition into a subject is by any suitable route, including intratumorally, orally, pulmonarily, intranasally, parenterally (intravenously, intra-arterially, intramuscularly, intraperitoneally, or subcutaneously), rectally, intralymphatically, intrathecally, periocularly or topically.
  • Administration includes self-administration and the administration by another.
  • a suitable route of administration allows the composition or the agent to perform its intended function. For example, if a suitable route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject.
  • antibiotic resistance gene refers to a gene inserted to a plasmid in order to confer drug resistance so that a microorganism can survive even after exposure to an antibiotic.
  • an antibiotic resistance gene can be introduced into a plasmid (e.g. , dual helper plasmid) to screen cells having the desired plasmid through cloning.
  • plasmid e.g. , dual helper plasmid
  • Non-limiting examples of antibiotic resistance genes that are useful for the present disclosure include ampicillin, kanamycin, chloramphenicol, gentamycin, streptomycin, tetracycline, erythromycin, vancomycin, penicillin, spectinomycin, chloramphenicol, sulfadiazine, and trimethoprim resistance genes
  • the dual helper plasmids of the present disclosure comprise rep gene and cap gene which are present with the dual helper plasmids in certain orientation/configuration.
  • the rep and cap genes are in a " clockwise direction ,” “ forward direction ,” or “ 5' -> 3' “ (e.g., as shown in FIG. 5A), which means that the rep - cap gene is inserted or included in a clockwise direction or in a direction from the site where replication begins (5') to the site where replication ends (3').
  • the rep and cap genes are in a " counterclockwise direction ", " reverse direction " or " 3' -> 5' " (e.g., as shown in FIG. 5B) means that the rep - cap gene is inserted or included in a counterclockwise direction or in a direction from the site where replication ends (3') to the site where replication begins (5').
  • rep gene refers to a gene which encodes one or more open reading frame (ORF), wherein the ORF encodes AAV Rep protein or a mutant or derivative thereof.
  • the AAV Rep protein (or a mutant or derivative thereof) is involved in AAV genome replication and/or AAV genome packaging, and a wild-type rep gene encodes the four Rep proteins Rep78, Rep68, Rep52 and Rep40.
  • rep gene includes a wild-type rep gene, a derivative thereof, and an artificial rep gene having an equivalent function.
  • the rep gene may be a rep2 gene derived from adeno-associated virus serotype 2 (AAV2).
  • the rep2 gene comprises the nucleic acid sequence set forth in SEQ ID NO 29.
  • cap gene refers to a gene which encodes one or more open reading frame (ORF), wherein the ORF encodes AAV Cap structural protein, or a mutant or derivative thereof.
  • ORF open reading frame
  • VP1, VP2 and VP3 proteins are structural proteins constituting AAV particles
  • AAP assembly-activating protein
  • cap gene includes a wild-type cap gene, a derivative thereof and an artificial cap gene having an equivalent function.
  • the cap gene is a cap gene derived from adeno-associated virus serotype 2 (AAV2; cap2 ), serotype 5 (AAV5; cap5 ), serotype 8 (AAV8; cap8 ) or serotype 9 (AAV9; cap9 ).
  • the cap gene comprises the nucleic acid sequence set forth in SEQ ID NO 30 ( cap2 ), SEQ ID NO 31 ( cap5 ), SEQ ID NO 32 ( cap8 ) or SEQ ID NO 33 ( cap9 ).
  • E2a gene refers to a gene encoding the protein E2a of adenovirus, which regulates the promoter of AAV, helps AAV genome replication and is involved in increased capsid protein production through splicing of Rep mRNA and enhanced stability of capsid mRNA.
  • E2a gene includes a wild-type E2a gene, a derivative thereof and an artificial E2a gene having an equivalent function.
  • the E2a gene is an E2a gene derived from adenovirus serotype 5 (Ad5).
  • the E2a gene comprises the nucleic acid sequence set forth in SEQ ID NO 34.
  • E4 gene refers to a gene encoding the protein E4 of adenovirus, which is involved in the second-strand synthesis of the AAV genome in the life cycle of AAV and helps AAV genome replication by inhibiting the formation of the MRN (Mre11-Rad50-Nbs1) complex, which is responsible for the intracellular mechanism that inhibits AAV genome replication.
  • E4 gene includes a wild-type E4 gene, a derivative thereof and an artificial E4 gene having an equivalent function.
  • the E4 gene is an E4 gene derived from adenovirus serotype 5 (Ad5).
  • the E4 gene comprises the nucleic acid sequence set forth in SEQ ID NO 35.
  • VA RNA(s) gene or " VA RNA(s) region” refers to a VA region that produces VA RNA, which increases the stability of AAV capsid mRNA, improves the efficiency of translation and helps preventing the degradation of the Rep52 protein.
  • VA RNA gene includes a wild-type VA RNA gene, a derivative thereof and an artificial VA RNA gene having an equivalent function.
  • the VA RNA gene is a VA RNA gene derived from adenovirus serotype 5 (Ad5).
  • the VA RNA gene comprises the nucleic acid sequence set forth in SEQ ID NO 36.
  • Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences.
  • control element refers to a nucleic acid sequence that regulate (e.g. , increase or decrease) the expression of an operably linked nucleic acid (e.g. , transgene).
  • operably linked nucleic acid e.g. , transgene
  • two or more sequences are said to be "completely conserved” or “identical” if they are 100% identical to one another. In some aspects, two or more sequences are said to be “highly conserved” if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some aspects, two or more sequences are said to be “highly conserved” if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another.
  • two or more sequences are said to be "conserved” if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some aspects, two or more sequences are said to be “conserved” if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Conservation of sequence can apply to the entire length of a polynucleotide or polypeptide or can apply to a portion, region or feature thereof.
  • enhancer refers to a segment of DNA which contains sequences capable of providing enhanced transcription and in some instances can function independent of their orientation relative to another control sequence.
  • An enhancer can function cooperatively or additively with promoters and/or other enhancer elements.
  • excipient and “carrier” are used interchangeably and refer to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound, e.g., a recombinant AAV delivery vector comprising a transgene and produced using the dual helper plasmids provided herein.
  • RNA messenger RNA
  • rRNA rRNA or tRNA
  • RNA messenger RNA
  • expression produces a "gene product” or "encoded protein.”
  • a gene product can be, e.g., a nucleic acid, such as an RNA produced by transcription of a gene.
  • a gene product can be either a nucleic acid or a polypeptide which is translated from a transcript.
  • Gene products described herein further include nucleic acids with post transcriptional modifications, e.g., polyadenylation or splicing, or polypeptides with post translational modifications, e.g., phosphorylation, methylation, glycosylation, the addition of lipids, association with other protein subunits, or proteolytic cleavage.
  • post transcriptional modifications e.g., polyadenylation or splicing
  • polypeptides with post translational modifications e.g., phosphorylation, methylation, glycosylation, the addition of lipids, association with other protein subunits, or proteolytic cleavage.
  • identity refers to the overall monomer conservation between polymeric molecules, e.g., between polynucleotide molecules.
  • Calculation of the percent identity of two polypeptide or polynucleotide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second polypeptide or polynucleotide sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence.
  • the amino acids at corresponding amino acid positions, or bases in the case of polynucleotides, are then compared.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • Suitable software programs that can be used to align different sequences are available from various sources.
  • One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov).
  • Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm.
  • BLASTN is used to compare nucleic acid sequences
  • BLASTP is used to compare amino acid sequences.
  • Sequence alignments can be conducted using methods known in the art such as MAFFT, Clustal (ClustalW, Clustal X or Clustal Omega), MUSCLE, etc.
  • Different regions within a single polynucleotide or polypeptide target sequence that aligns with a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.
  • sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., location of mutations), or phylogenetic data.
  • a suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at www.tcoffee.org, and alternatively available, e.g., from the EBI.
  • T-Coffee available at www.tcoffee.org, and alternatively available, e.g., from the EBI.
  • the final alignment used to calculate percent sequence identity can be curated either automatically or manually.
  • isolating or purifying as used herein is the process of removing, partially removing (e.g., a fraction) a composition of the present disclosure, e.g., a polynucleotide described herein from a sample containing contaminants.
  • linked refers to a first amino acid sequence or polynucleotide sequence covalently or non-covalently joined to a second amino acid sequence or polynucleotide sequence, respectively.
  • the first amino acid or polynucleotide sequence can be directly joined or juxtaposed to the second amino acid or polynucleotide sequence or alternatively an intervening sequence can covalently join the first sequence to the second sequence.
  • the term "linked” means not only a fusion of a first polynucleotide sequence to a second polynucleotide sequence at the 5'-end or the 3'-end, but also includes insertion of the whole first polynucleotide sequence (or the second polynucleotide sequence) into any two nucleotides in the second polynucleotide sequence (or the first polynucleotide sequence, respectively).
  • the first polynucleotide sequence can be linked to a second polynucleotide sequence by a phosphodiester bond or a linker.
  • the linker can be, e.g., a polynucleotide.
  • miRNA refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. The term will be used to refer to the single-stranded RNA molecule processed from a precursor.
  • antisense oligomers can also be used to describe the microRNA molecules of the present disclosure. Names of miRNAs and their sequences related to the present disclosure are provided herein.
  • MicroRNAs recognize and bind to target mRNAs through imperfect base pairing leading to destabilization or translational inhibition of the target mRNA and thereby downregulate target gene expression.
  • targeting miRNAs via molecules comprising a miRNA binding site can reduce or inhibit the miRNA-induced translational inhibition leading to an upregulation of the target gene.
  • Nucleic acid “nucleic acid molecule,” “nucleotide sequence,” “polynucleotide,” and grammatical variants thereof are used interchangeably and refer to a sequence of nucleotides connected by phosphodiester linkages. Polynucleotides are presented herein in the direction from the 5 ′ to the 3′ direction. A polynucleotide of the present disclosure can be a deoxyribonucleic acid (DNA) molecule or acid (RNA) molecule. Nucleotide bases are indicated herein by a single letter code: adenine (A), guanine (G), thymine (T), cytosine (C), inosine (I) and uracil (U).
  • A adenine
  • G guanine
  • T thymine
  • C cytosine
  • I inosine
  • U uracil
  • operatively linked means that DNA sequences to be linked are located adjacent to each other to perform a desired function.
  • a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence (e.g., transgene). As long as this functional relationship is maintained, the promoter needs not be contiguous with the coding region.
  • pharmaceutically acceptable carrier encompass any of the agents approved by a regulatory agency of the U.S. Federal government or listed in the U.S. Pharmacopeia for use in animals, including humans, as well as any carrier or diluent that does not cause the production of undesirable physiological effects to a degree that prohibits administration of the composition to a subject and does not abrogate the biological activity and properties of the administered compound. Included are excipients and carriers that are useful in preparing a pharmaceutical composition and are generally safe, non-toxic, and desirable.
  • composition refers to one or more of the compositions described herein (e.g., polynucleotides, vectors, cells, and/or recombinant viruses) mixed or intermingled with, or suspended in one or more other chemical components, such as pharmaceutically acceptable carriers and excipients.
  • promoter and “promoter sequence” are interchangeable and refer to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
  • a coding sequence is located 3' to a promoter sequence. Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions.
  • Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters.” Promoters that cause a gene to be expressed in a specific cell type are commonly referred to as “cell-specific promoters” or “tissue-specific promoters.” Promoters that cause a gene to be expressed at a specific stage of development or cell differentiation are commonly referred to as “developmentally-specific promoters” or “cell differentiation-specific promoters.” Promoters that are induced and cause a gene to be expressed following exposure or treatment of the cell with an agent, biological molecule, chemical, ligand, light, or the like that induces the promoter are commonly referred to as “inducible promoters” or “regulatable promoters.” It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths can have identical promoter activity.
  • the promoter sequence is typically bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • a promoter that can be used with the present disclosure includes a tissue specific promoter.
  • the term "gene regulatory region” or “regulatory region” refers to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding region, and which influence the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, or stem-loop structures. If a coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
  • a nucleic acid composition provided herein can include a promoter and/or other expression (e.g., transcription) control elements operably associated with one or more coding regions.
  • a coding region for a gene product is associated with one or more regulatory regions in such a way as to place expression of the gene product under the influence or control of the regulatory region(s).
  • a coding region and a promoter are "operably associated" if induction of promoter function results in the transcription of mRNA encoding the gene product encoded by the coding region, and if the nature of the linkage between the promoter and the coding region does not interfere with the ability of the promoter to direct the expression of the gene product or interfere with the ability of the DNA template to be transcribed.
  • Other expression control elements besides a promoter, for example enhancers, operators, repressors, and transcription termination signals, can also be operably associated with a coding region to direct gene product expression.
  • transgene refers to one or more polynucleotide or polynucleotide region encoded into a recombinant expression construct, an expression product of the polynucleotide or polynucleotide region, or a polynucleotide or modulatory (or regulatory) nucleic acid encoding a polypeptide or polypeptides.
  • the transgene can be a nucleotide sequence encoding a therapeutic peptide for a particular disease, which is desired to be expressed continuously in the body of a subject or a patient.
  • operatively linked or " operably linked” means that the DNA sequences to be linked are contiguous so as to perform their desired functions. For example, if a specific promoter helps the initiation of the transcription of a coding sequence (e.g., a transgene), the promoter may be operatively linked to the coding region. The promoter and the coding region do not need to be contiguous as long as this functional relationship is maintained.
  • the term "vector” or “construct” refers to a construct that can insert a nucleic acid or a gene and, specifically, includes a vector that can insert a nucleic acid sequence for introduction into a cell capable of replicating the nucleic acid sequence.
  • the nucleic acid sequence may be exogenous or heterologous.
  • the nucleic acid sequence may be a transgene.
  • the construct may be a plasmid, a cosmid or a virus (e.g., AAV), although not being limited thereto.
  • expression vector refers to a vector or a construct including a nucleotide sequence which encodes at least a portion of a transcribed gene product.
  • the transcribed RNA molecule is translated into a protein, a polypeptide or a peptide.
  • the expression construct may include various control elements.
  • the vector or expression vector may further include a nucleotide sequence that provides another function.
  • the term "subject” refers to an individual to which the AAV (produced using the methods provided herein) or a composition comprising such an AAV is administered.
  • Non-limiting examples include humans, domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like), and laboratory animals (e.g., monkey, rats, mice, rabbits, guinea pigs and the like) for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • the methods described herein are applicable to both human therapy and veterinary applications.
  • the phrase "subject in need thereof” includes subjects, such as mammalian subjects, that would benefit from administration of composition described herein.
  • the term "therapeutically effective amount” is the amount of reagent or pharmaceutical compound comprising a composition of the present disclosure (e.g., polynucleotide comprising a transgene and an untranslated nucleic acid sequence) that is sufficient to a produce a desired therapeutic effect, pharmacologic and/or physiologic effect on a subject in need thereof.
  • a therapeutically effective amount can be a “prophylactically effective amount” as prophylaxis can be considered therapy.
  • the term "transgene” refers to at least one polynucleotide or polynucleotide region encoded in a recombinant expression construct or an expression product of the polynucleotide or polynucleotide region, a polynucleotide encoding a polypeptide or multi-polypeptide or a modulatory or regulatory nucleic acid.
  • the transgene can be heterologous to the cell (i.e., not naturally expressed in the cell) in which it is inserted (or transduced).
  • treat refers to, e.g., the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration or elimination of one or more symptoms associated with a disease or condition; the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition.
  • treatment refers to, e.g., the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration or elimination of one or more symptoms associated with a disease or condition; the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition.
  • the term also includes prophylaxis or prevention of a disease or condition or its symptoms thereof.
  • upstream refers to a nucleotide sequence that is located 5' to a reference nucleotide sequence.
  • vector refers to any vehicle into which a nucleic acid or a gene can be inserted, such as delivery vehicles into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated.
  • the nucleic acid sequence which can be inserted into a vector can be exogenous or heterologous.
  • the nucleic acid sequence can be a transgene. Examples of constructs include, but are not limited to, plasmids, cosmids, and viruses (e.g., AAVs).
  • expression vector refers to a vector or construct including a nucleotide sequence coding for at least a portion of a gene product to be transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide or peptide. Expression constructs can include various control elements. In addition to regulatory sequences that govern transcription and translation, vectors and expression vectors can include nucleotide sequence that serve other functions as well.
  • Vectors can be engineered to encode selectable markers or reporters that provide for the selection or identification of cells that have incorporated the vector. Expression of selectable markers or reporters allows identification and/or selection of host cells that incorporate and express other coding regions contained on the vector.
  • selectable marker genes known and used in the art include: genes providing resistance to ampicillin, streptomycin, gentamycin, kanamycin, hygromycin, bialaphos herbicide, sulfonamide, and the like; and genes that are used as phenotypic markers, i.e., anthocyanin regulatory genes, isopentanyl transferase gene, and the like.
  • reporters known and used in the art include: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), ⁇ -galactosidase (LacZ), ⁇ -glucuronidase (Gus), and the like. Selectable markers can also be considered to be reporters.
  • E2a gene E4 gene
  • VA RNA gene RNA gene
  • rep gene rep gene
  • cap gene cap gene
  • AAV adeno-associated virus
  • Adeno-associated virus is a single-stranded DNA virus and a helper-dependent human parvovirus. It has a genome size of about 4.7 kbp.
  • the N-terminal of the genome encodes the rep gene which is involved in viral replication and viral gene expression, and the C-terminal encodes the cap gene which encodes the capsid protein of the virus.
  • Inverted terminal repeats ITRs of about 145 bases are inserted at both terminals.
  • the 145-bp ITRs (inverted terminal repeats) having a T-shaped structure function as a replication origin during the replication of the viral genome and serve as a primary packaging signal.
  • the ITRs are the only cis -active base sequences required for making a recombinant AAV construct.
  • an expression construct is prepared with appropriate enhancer, promoter, pA, etc. when cloning a transgene into the recombinant AAV construct (RJ Samulski and N Muzyczka, Annu. Rev. Virolo. 2014. 1:427-451).
  • rep 78, rep 68, rep 52 and rep 40 Four proteins are translated from the rep gene. Their names depict their molecular weights: rep 78, rep 68, rep 52 and rep 40. They play an important role in AAV DNA replication.
  • Four proteins are translated from the cap gene.
  • VP1, VP2 and VP3 proteins are structural proteins constituting AAV particles, and assembly-activating protein (AAP) promotes the formation (assembly) of AAV particles by the structural proteins.
  • AAP assembly-activating protein
  • proteins and RNAs derived from a helper virus such as adenovirus or herpes simplex virus are necessary (Muzyczka N. Curr Top Microbiol Immunol 158, 97-129, 1992).
  • dual helper plasmid refers to a plasmid that is capable of providing two or more of the requirements for producing AAV in a cell.
  • AAV vector comprising a transgene
  • the following components must be provided to the host cells: (1) transgene, (2) rep and cap proteins, and (3) E2a, E4, and VA RNA proteins.
  • the different requirements are provided to the cells using three different plasmids (i.e., 1 AAV construct plasmid comprising the transgene flanked by ITRs, 2 Rep-Cap plasmid, and 3 helper plasmid).
  • a dual helper plasmid described herein provides requirements (2) and (3) described above.
  • the dual helper plasmid comprises a rep gene, cap gene, E2a gene, E4 gene, and VA RNA gene.
  • dual helper plasmids described herein not only comprise the above-described genes but the genes are also arranged in certain configurations within the plasmid.
  • the E2a gene, E4 gene, and the VA RNA gene are linked sequentially within the dual helper plasmid, and the rep gene and the cap gene (referred to herein collectively as " rep - cap gene ”) are between the 5'-terminal of the E2a gene and the 3'-terminal of the VA RNA gene sequentially in a clockwise direction (from 5' to 3').
  • the 5'-terminal of the rep-cap gene is linked to the 5'-terminal of the E2a gene, and wherein the 3'-terminal of the rep-cap gene is linked to the 3'-terminal of the VA RNA gene.
  • a non-limiting example of such a dual helper plasmid is illustrated in FIG. 5A.
  • the E2a gene, E4 gene, and the VA RNA gene are linked sequentially, and the rep - cap gene is between the 5'-terminal of the E2a gene and the 3'-terminal of the VA RNA gene in a counterclockwise direction (from 3' to 5'). More specifically, in some aspects, the 3'-terminal of the rep-cap gene is linked to the 5'-terminal of the E2a gene, and wherein the 5'-terminal of the rep-cap gene is linked to the 3'-terminal of the VA RNA gene.
  • a non-limiting example of such a dual helper plasmid is illustrated in FIG. 5B.
  • each of the E2a gene, E4 gene, and VA RNA gene described above are derived from Adenovirus.
  • the cap gene and the rep gene are derived from the same AAV serotype.
  • both the cap gene and the rep gene are derived from AAV2 ( see, e.g. , pUC-R2C2 construct described in Example 1-4).
  • the cap gene and the rep gene are derived from AAVs having different serotype.
  • the cap gene is derived from AAV8 ( cap8 or a fragment thereof) and the rep gene is derived from AAV2 ( rep2 or a fragment thereof) ( see, e.g. , pUC-R2C8 construct described in Example 1-2).
  • the cap gene is derived from AAV9 ( cap9 or a fragment thereof) and the rep gene is derived from AAV2 ( rep2 or a fragment thereof) ( see, e.g. , pUC-R2C9 construct described in Example 1-6).
  • the cap gene is derived from AAV5 ( cap5 or a fragment thereof) and the rep gene is derived from AAV2 ( rep2 or a fragment thereof) ( see, e.g. , pUC-R2C5 construct described in Example 1-7).
  • Non-limiting examples of types or serotypes of the AAV that can be used in the present disclosure include AAVrh.lO (AAVrhlO), AAV-DJ (AAVDJ), AAV-DJ8 (AAVDJ8), AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV 12, AAV16.3, AAV24.1, AAV27.3,AAV42.12, AAV42-lb, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV
  • the serotype of the adeno-associated virus useful for the present disclosure comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10, or a combination thereof.
  • one or more of the multiple genes of a dual helper plasmid are derived from AAV1.
  • the rep gene is derived from AAV1.
  • the cap gene is derived from AAV1.
  • both the rep gene and the cap gene are derived from AAV1.
  • one or more of the multiple genes of a dual helper plasmid are derived from AAV2.
  • the rep gene is derived from AAV2.
  • the cap gene is derived from AAV2. In some aspects, both the rep gene and the cap gene are derived from AAV2. In some aspects, one or more of the multiple genes of a dual helper plasmid are derived from AAV3. For instance, in some aspects, the rep gene is derived from AAV3. In some aspects, the cap gene is derived from AAV3. In some aspects, both the rep gene and the cap gene are derived from AAV3. In some aspects, one or more of the multiple genes of a dual helper plasmid are derived from AAV4. For instance, in some aspects, the rep gene is derived from AAV4. In some aspects, the cap gene is derived from AAV4. In some aspects, both the rep gene and the cap gene are derived from AAV4.
  • one or more of the multiple genes of a dual helper plasmid are derived from AAV5.
  • the rep gene is derived from AAV5.
  • the cap gene is derived from AAV5.
  • both the rep gene and the cap gene are derived from AAV5.
  • one or more of the multiple genes of a dual helper plasmid are derived from AAV6.
  • the rep gene is derived from AAV6.
  • the cap gene is derived from AAV6.
  • both the rep gene and the cap gene are derived from AAV6.
  • one or more of the multiple genes of a dual helper plasmid are derived from AAV7.
  • the rep gene is derived from AAV7.
  • the cap gene is derived from AAV7.
  • both the rep gene and the cap gene are derived from AAV7.
  • one or more of the multiple genes of a dual helper plasmid are derived from AAV8.
  • the rep gene is derived from AAV8.
  • the cap gene is derived from AAV8.
  • both the rep gene and the cap gene are derived from AAV8.
  • one or more of the multiple genes of a dual helper plasmid are derived from AAV9.
  • the rep gene is derived from AAV9.
  • the cap gene is derived from AAV9. In some aspects, both the rep gene and the cap gene are derived from AAV9. In some aspects, one or more of the multiple genes of a dual helper plasmid are derived from AAVrh10. For instance, in some aspects, the rep gene is derived from AAVrh10. In some aspects, the cap gene is derived from AAVrh10. In some aspects, both the rep gene and the cap gene are derived from AAVrh10.
  • a dual helper plasmid of the present disclosure comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the rep gene is derived from AAV2.
  • the nucleic acid sequence for the AAV2 rep gene is set forth in SEQ ID NO: 29.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the rep gene comprises a nucleic acid sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the sequence set forth in SEQ ID NO: 29.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the rep gene comprises the nucleic acid sequence set forth in SEQ ID NO: 29.
  • a dual helper plasmid described herein comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the cap gene is derived from AAV2, AAV5, AAV8, or AAV9.
  • the cap gene is derived from AAV2. Accordingly, in some aspects, a dual helper plasmid described herein comprises a rep gene derived from AAV2 ( rep2 ) and a cap gene derived from AAV2 ( cap2 ).
  • the nucleic acid sequence for the AAV2 cap gene is set forth in SEQ ID NO: 30.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the cap gene comprises a nucleic acid sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity the sequence set forth in SEQ ID NO: 30.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the cap gene comprises the nucleic acid sequence set forth in SEQ ID NO: 30.
  • the cap gene is derived from AAV5.
  • a dual helper plasmid described herein comprises a rep gene derived from AAV2 ( rep2 ) and a cap gene derived from AAV5 ( cap5 ).
  • the nucleic acid sequence for the AAV5 cap gene is set forth in SEQ ID NO: 31.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the cap gene comprises a nucleic acid sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity the sequence set forth in SEQ ID NO: 31.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the cap gene comprises the nucleic acid sequence set forth in SEQ ID NO: 31.
  • the cap gene is derived from AAV8.
  • a dual helper plasmid described herein comprises a rep gene derived from AAV2 ( rep2 ) and a cap gene derived from AAV8 ( cap8 ).
  • the nucleic acid sequence for the AAV8 cap gene is set forth in SEQ ID NO: 32.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the cap gene comprises a nucleic acid sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity the sequence set forth in SEQ ID NO: 32.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the cap gene comprises the nucleic acid sequence set forth in SEQ ID NO: 32.
  • the cap gene is derived from AAV9.
  • a dual helper plasmid described herein comprises a rep gene derived from AAV2 ( rep2 ) and a cap gene derived from AAV9 ( cap9 ).
  • the nucleic acid sequence for the AAV9 cap gene is set forth in SEQ ID NO: 33.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the cap gene comprises a nucleic acid sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity the sequence set forth in SEQ ID NO: 33.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the cap gene comprises the nucleic acid sequence set forth in SEQ ID NO: 33.
  • a dual helper plasmid provided herein comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the E2a gene is derived from adenovirus serotype 5 (Ad5).
  • the nucleic acid sequence for the Ad5 E2a gene is set forth in SEQ ID NO: 34.
  • a dual helper plasmid useful for the present disclosure comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the E2a gene comprises a nucleic acid sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity the sequence set forth in SEQ ID NO: 34.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the E2a gene comprises the nucleic acid sequence set forth in SEQ ID NO: 34.
  • a dual helper plasmid provided herein comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the E4 gene is derived from adenovirus serotype 5 (Ad5).
  • Ad5 E4 gene The nucleic acid sequence for the Ad5 E4 gene is set forth in SEQ ID NO: 35.
  • a dual helper plasmid useful for the present disclosure comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the E4 gene comprises a nucleic acid sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity the sequence set forth in SEQ ID NO: 35.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the E4 gene comprises the nucleic acid sequence set forth in SEQ ID NO: 35.
  • a dual helper plasmid provided herein comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the VA RNA gene is derived from adenovirus serotype 5 (Ad5).
  • Ad5 VA RNA gene The nucleic acid sequence for the Ad5 VA RNA gene is set forth in SEQ ID NO: 36.
  • a dual helper plasmid useful for the present disclosure comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the VA RNA gene comprises a nucleic acid sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity the sequence set forth in SEQ ID NO: 36.
  • a dual helper plasmid comprises E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene, wherein the VA RNA gene comprises the nucleic acid sequence set forth in SEQ ID NO: 36.
  • the dual helper plasmids described herein comprise genes derived from the same viral source or from multiple viral sources.
  • a dual helper plasmid described comprises: (i) an E2a gene derived from Ad5 ( e.g. , SEQ ID NO: 34); (ii) an E4 gene derived from Ad5 ( e.g. , SEQ ID NO: 35); (iii) a VA RNA gene derived from Ad5 ( e.g. , SEQ ID NO: 36), (iv) a cap gene derived from AAV2 ( e.g. , SEQ ID NO: 30); and (v) a rep gene derived from AAV2 ( e.g.
  • a dual helper plasmid described comprises: (i) an E2a gene derived from Ad5 ( e.g. , SEQ ID NO: 34); (ii) an E4 gene derived from Ad5 ( e.g. , SEQ ID NO: 35); (iii) a VA RNA gene derived from Ad5 ( e.g. , SEQ ID NO: 36), (iv) a cap gene derived from AAV5 ( e.g. , SEQ ID NO: 31); and (v) a rep gene derived from AAV2 (SEQ ID NO: 29).
  • a dual helper plasmid described comprises: (i) an E2a gene derived from Ad5 ( e.g. , SEQ ID NO: 34); (ii) an E4 gene derived from Ad5 ( e.g. , SEQ ID NO: 35); (iii) a VA RNA gene derived from Ad5 ( e.g. , SEQ ID NO: 36), (iv) a cap gene derived from AAV8 ( e.g. , SEQ ID NO: 32); and (v) a rep gene derived from AAV2 ( e.g. , SEQ ID NO: 29).
  • a dual helper plasmid described comprises: (i) an E2a gene derived from Ad5 ( e.g. , SEQ ID NO: 34); (ii) an E4 gene derived from Ad5 ( e.g. , SEQ ID NO: 35); (iii) a VA RNA gene derived from Ad5 ( e.g. , SEQ ID NO: 36), (iv) a cap gene derived from AAV9 ( e.g. , SEQ ID NO: 33); and (v) a rep gene derived from AAV2 ( e.g. , SEQ ID NO: 29).
  • a dual helper plasmid described comprises: (i) an E2a gene derived from Ad5 ( e.g. , SEQ ID NO: 34); (ii) an E4 gene derived from Ad5 ( e.g. , SEQ ID NO: 35); (iii) a VA RNA gene derived from Ad5 ( e.g.
  • SEQ ID NO: 36 (iv) a cap gene derived from AAV2, AAV5, AAV8, or AAV9 ( e.g. , SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, or SEQ ID NO: 33, respectively); and (v) a rep gene derived from AAV2 ( e.g. , SEQ ID NO: 29), wherein the rep gene and the cap gene are in a clockwise direction.
  • a dual helper plasmid described comprises: (i) an E2a gene derived from Ad5 ( e.g. , SEQ ID NO: 34); (ii) an E4 gene derived from Ad5 ( e.g.
  • a VA RNA gene derived from Ad5 e.g. , SEQ ID NO: 36
  • a cap gene derived from AAV2, AAV5, AAV8, or AAV9 e.g. , SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, or SEQ ID NO: 33, respectively
  • a rep gene derived from AAV2 e.g. , SEQ ID NO: 29
  • the rep gene and the cap gene are in a counterclockwise direction.
  • the 5'-terminal of the rep gene is linked to the 3'-terminal of the VA RNA gene, wherein the 3'-terminal of the rep gene is linked to the 5'-terminal of the cap gene, and wherein the 3'-terminal of the cap gene is linked to the 5'-terminal of the E2a gene. See, e.g. , FIG. 5B.
  • the dual helper plasmid of the present disclosure exhibit one or more of the following improved properties:, 1) increased chance of cotransfection such that host cell has all the necessary components to produce a recombinant AAV, 2) increased productivity of recombinant adeno-associated virus, and 3) reduction in cost and time of plasmid production and purification. Additional disclosure relating to such properties are provided elsewhere in the present disclosure.
  • the dual helper plasmids described herein comprise one or more additional features that are useful in a recombinant AAV production.
  • the dual helper plasmid described herein further includes an antibiotic resistance gene.
  • the dual helper plasmids further comprises a selection marker.
  • selection marker refers to any gene that can be used to identify cells that express a nucleic acid sequence. Accordingly, such selection marker can be used to identify and enrich for the transformed cells after transfection with the dual helper plasmids described herein.
  • the selection markers that can be used with the present disclosure include any suitable selection markers known in the art.
  • Non-limiting examples of suitable selection markers include (i) enzymes encoding resistance to an antibiotic (i.e. , "antibiotic resistance gene"), e.g., kanamycin, neomycin, puromycin, hygromycin, blasticidin, or zeocin; or (ii) fluorescent proteins, for example green fluorescent protein (GFP), red fluorescent protein (RFP) or blue fluorescent protein (BFP).
  • an antibiotic i.e. , "antibiotic resistance gene”
  • fluorescent proteins for example green fluorescent protein (GFP), red fluorescent protein (RFP) or blue fluorescent protein (BFP).
  • the selection marker comprises an antibiotic resistance gene.
  • the antibiotic resistance gene comprises an ampicillin resistance gene, kanamycin resistance gene, or both.
  • the nucleic acid sequence for the ampicillin resistance gene is set forth in SEQ ID NO 37.
  • the nucleic acid sequence for the kanamycin resistance gene is set forth in SEQ ID NO 38.
  • the dual helper plasmids provided herein can be used in combination with one or more additional plasmids, e.g. , in producing a recombinant AAV.
  • the additional plasmid comprises a recombinant expression construct, e.g. , an AAV construct plasmid (referred to herein as " expression construct "). Exemplary aspects of such expression constructs are described below.
  • a dual helper plasmid comprises a E2a gene, E4 gene , VA RNA gene, rep gene, and cap gene.
  • the transgene e.g. , which is to be introduced into the recombinant AAV that is produced
  • the expression construct comprises a transgene.
  • the transgene is flanked by inverted terminal repeats (ITRs).
  • ITRs inverted terminal repeats
  • transgenes of interest can be used with present disclosure.
  • a transgene encodes a polypeptide (or any variant thereof), fusion protein, antibody or an antigen-binding fragment thereof, a RNA-based molecule (e.g. , miRNA, shRNA, ribozyme, siRNA), or any combination thereof.
  • a RNA-based molecule e.g. , miRNA, shRNA, ribozyme, siRNA
  • a transgene encodes a protein that is useful for the treatment of a disease or disorder, such as those described herein.
  • the transgene encodes a therapeutic peptide for a specific disease for the purpose of sustained expression in the body of a subject or patient.
  • the expression construct that can be used with the dual helper plasmids of the present disclosure further comprises a control element.
  • the control element is operably linked to the transgene.
  • an expression construct described herein (e.g. , AAV construct plasmid) comprises:
  • Control elements useful for the present disclosure comprises an enhancer (e.g., CMV enhancer), a promoter (e.g., CMV promoter, EF-1 ⁇ promoter, ⁇ -actin promoter), an exon (e.g., exon 1, exon 2), an intron (e.g., intron A), a splicing donor or acceptor sequence, or combinations thereof.
  • the control element can include a sequence for transcription termination (e.g., poly A), a sequence for stable transgene expression (e.g., WPRE sequence), a sequence for reducing transgene-specific immunity (e.g., miRNA target sequence), or combinations thereof.
  • transgene and the control element can be found in US 2022/0010332 A1, which is incorporated herein by reference in its entirety.
  • an expression construct useful for the present disclosure comprises (i) a transgene and (ii) a control element operably linked to the transgene, wherein the control element includes the following components:
  • vectors comprising any of the plasmids provided herein (e.g. , dual helper plasmid and/or expression construct comprising a transgene).
  • recombinant AAVs produced using the plasmids provided herein. As described herein, such vectors are useful for recombinant expression in host cells and cells targeted for therapeutic intervention.
  • vectors useful for the present disclosure are derived from AAV.
  • AAV possesses unique features that make it attractive as a vector system for delivering foreign DNA into cells.
  • AAV infection of cells in culture has generally been noncytopathic, and natural infection of humans and other animals is silent and asymptomatic.
  • AAV infects many different types of mammalian cells allowing the possibility of targeting many different tissues in vivo.
  • AAV also possesses additional advantages that make it a particularly attractive viral system for gene delivery, including the promotion of an immune response that is relatively mild compared to other forms of gene delivery, and persistent expression in both dividing and quiescent cells based on non-integrating, episomal vector DNA.
  • AAV withstands the conditions used to inactivate adenovirus (56° to 65° C for several hours), making cold preservation of rAAV-based vaccines less critical.
  • Non-limiting examples of the types or serotypes of adeno-associated viruses that can be used with the present disclosure are provided elsewhere in the present disclosure.
  • the present disclosure provides cells comprising the plasmids described herein (e.g. , dual helper plasmid and expression construct comprising a transgene) (also referred to herein as " modified cells ").
  • the cells e.g. , a host cell
  • the modified cells of the present disclosure are capable of improving one or more aspects of recombinant AAV production.
  • the modified cells provided herein allow for greater yield when producing a recombinant AAV, as compared to a reference cell.
  • the reference cell comprises a corresponding cell that was modified to comprise the following three separate plasmids: (1) first plasmid comprising a rep gene and a cap gene (" rep-cap plasmid "); (2) second plasmid comprising an E2a gene, E4 gene, and VA RNA gene (" helper plasmid "); and (3) third plasmid comprising a transgene.
  • cells of the present disclosure are capable of increasing the amount of recombinant AAV produced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100% or more.
  • cells of the present disclosure are capable of increasing the amount of recombinant AAV produced by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 75-fold, or at least about 100-fold or more.
  • cells provided herein e.g.
  • the production and/or purification time is decreased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% or more.
  • cells provided herein have been modified (e.g. , transfected) to comprise the recombinant AAV produced using the plasmids described herein.
  • Such cells can be particularly useful for producing a protein, e.g. , encoded by a transgene described herein.
  • the resulting recombinant AAV produced comprises one of more features of the individual plasmids.
  • the resulting recombinant AAV comprises the transgene operably linked to the control element.
  • the one or more control elements described herein can enhance the expression of the protein encoded by the transgene ("encoded protein") in a cell.
  • a cell described herein e.g. , transfected with a recombinant AAV delivery vector comprising a transgene operably linked to one or more control elements described herein
  • the reference cell is transfected with a corresponding delivery vector but lacking one or more of the control elements described herein.
  • the cells described herein are modified (e.g. , transfected) in vitro to produce a composition of interest.
  • the cells are transfected in vitro with a dual helper plasmid and an expression construct ( e.g. , such as those described herein) to produce a recombinant AAV.
  • the cells are transfected in vitro with the recombinant gene delivery vector to produce the protein encoded by the transgene.
  • the cells described herein can produce the encoded protein in vivo ( e.g. , in a subject that received an administration of the recombinant AAV comprising the transgene).
  • the cells described herein can produce the composition of interest (e.g. , encoded protein) both in vitro and in vivo .
  • the present disclosure provides a host cell transformed, transduced or transfected with, e.g. , the recombinant expression construct for transgene expression.
  • the term "host cell" includes eukaryotic cells and prokaryotic cells, and refers to a cell of an organism that can be transduced, e.g. , so that a gene encoded by a plasmid or an expression construct (e.g., AAV construct plasmid, Rep-Cap plasmid, helper plasmid, dual helper plasmid, etc.) can be expressed or replicated. In some aspects, it refers to an isolated (eukaryotic) host cell.
  • transfection is intended to include transduction and transformation.
  • the host cell can be transfected, transduced, or transformed with any of the plasmids, constructs, and/or vectors described herein.
  • the term means a process whereby an exogenous nucleic acid molecule is delivered or introduced into the host cell.
  • the host cell is a eukaryotic cell. In some aspects, the host cell is selected from the group consisting of a mammalian cell, an insect cell, a yeast cell, a transgenic mammalian cell, and a plant cell. In some aspects, the host cell is a prokaryotic cell. In some aspects, the prokaryotic cell is a bacterial cell.
  • cells useful for the present disclosure comprise an insect cell, a mammalian cell, or both.
  • the insect cell can be Sf9 cell.
  • the mammalian cell comprises HEK293 cell, HeLa cell, ARPE-19 cell, RPE-1 cell, HepG2 cell, Hep3B cell, Huh-7 cell, C8D1a cell, Neuro2A cell, CHO cell, MES13 cell, BHK-21 cell, COS7 cell, COP5 cell, A549 cell, MCF-7 cell, HC70 cell, HCC1428 cell, BT-549 cell, PC3 cell, LNCaP cell, Capan-1 cell, Panc-1 cell, MIA PaCa-2 cell, SW480 cell, HCT166 cell, LoVo cell, A172 cell, MKN-45 cell, MKN-74 cell, Kato-III cell, NCI-N87 cell, HT-144 cell, SK-MEL-2 cell, SH-SY5
  • a cell useful for the present disclosure comprises a human cell.
  • the human cell is a cell of a subject that is to receive an administration of a recombinant gene delivery vector described herein.
  • the human cell is from a donor ( e.g. , healthy human subject).
  • compositions comprising the dual helper plasmids described herein.
  • such compositions further comprise an additional plasmid, such as the expression constructs described herein (e.g. , an AAV construct plasmid for transgene expression).
  • additional plasmid such as the expression constructs described herein (e.g. , an AAV construct plasmid for transgene expression).
  • such compositions can be useful in producing a recombinant AAV.
  • the various plasmids e.g. , dual helper plasmid
  • constructs e.g. , expression construct
  • vectors e.g. , recombinant AAV delivery vector
  • cells disclosed herein also referred to herein as " active compounds ”
  • the present disclosure is directed to such pharmaceutical compositions.
  • the present disclosure provides a pharmaceutical composition comprising a recombinant AAV produced using the plasmids described herein ( e.g. , dual helper plasmids).
  • compositions described herein further comprises a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carriers that can be used with the present disclosure include those that are commonly used for formulation.
  • Non-limiting examples of such pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, and combinations thereof.
  • compositions of the present disclosure can further comprise one or more additives, such as a lubricant, a wetting agent, sweetener, a flavorant, an emulsifier, a suspending agent, a preservative, and combinations thereof. Additional details of suitable pharmaceutically acceptable carriers and formulations are described in Remington's Pharmaceutical Sciences (19th ed., 1995).
  • a pharmaceutical composition of the disclosure is formulated to be compatible with an intended route of administration.
  • Non-limiting examples of such administration routes are provided elsewhere in the present disclosure.
  • compositions described herein can be provided as a single-dosage or in multiple-dosage forms.
  • a pharmaceutical composition provided herein is formulated in the form of a solution (e.g. , in an oily or aqueous medium), a suspension, an emulsion, an extract, a powder, a granule, a tablet or a capsule.
  • a formulation comprising a pharmaceutical composition described herein can further contain a dispersant, a stabilizer, or both.
  • kits comprising one or more of the various plasmids (e.g. , dual helper plasmid), constructs (e.g. , expression construct), vectors ( e.g. , recombinant AAV delivery vector), cells, and compositions (e.g. , pharmaceutical compositions) disclosed herein.
  • the kit also comprises instructions for use (e.g. , for administering any of the aforesaid, or a combination thereof, to a subject in need thereof).
  • kit and " system ,” as used herein, are intended to refer to at least one or more of the various plasmids (e.g. , dual helper plasmid), constructs (e.g. , expression construct), vectors ( e.g. , recombinant AAV delivery vector), cells, and compositions ( e.g. , pharmaceutical compositions), or any combination thereof, which, in some aspects, are in combination with one or more other types of elements or components (e.g., other types of biochemical reagents, containers, packages, such as packaging intended for commercial sale, instructions of use, and the like).
  • constructs e.g. , expression construct
  • vectors e.g. , recombinant AAV delivery vector
  • cells e.g. , recombinant AAV delivery vector
  • compositions e.g. , pharmaceutical compositions
  • Certain aspects of the present disclosure relate to methods of producing an AAV. More specifically, in some aspects, provided herein are methods of producing a recombinant AAV comprising a transgene. In some aspects, such methods comprise transfecting a cell (e.g. , host cell) with a dual helper plasmid (such as those described herein) and an expression construct (e.g. , AAV construct plasmid) comprising a transgene. In some aspects, the cell is transfected with the dual helper plasmid and the expression construct concurrently. In some aspects, the cell is transfected with the dual helper plasmid and the expression construct sequentially. Unless indicated otherwise, any suitable transfection methods known in the art can be used with the present disclosure.
  • the method of producing a recombinant AAV further comprises culturing the transfected cells under suitable conditions such that the recombinant AAVs are produced. In some aspects, the method further comprises recovering the produced recombinant AAV.
  • the methods of producing recombinant AAVs described herein provide certain distinct benefits.
  • the more traditional methods of producing an AAV require triple transfection, in which a host cell is transfected with the following three separate plasmids: i) a Rep-Cap plasmid including a gene encoding Rep protein and Cap protein; ii) a helper plasmid including a gene encoding the proteins (E2a, E4) and VA RNAs of adenovirus; and iii) an AAV construct plasmid for transgene expression.
  • the recombinant AAV is only produced where the cells are successfully transfected with all of the above-mentioned three plasmids ( i.e.
  • each of the genes are taken up and delivered to the nucleus of the cells, and subsequently transcribed, replicated, and/or translated within the cells). Because of the complexity involved, such methods requiring triple transfection can result in low yield and/or be more labor intensive and costly.
  • the methods of producing a recombinant AAV provided herein can result in greater yield of the recombinant AAVs.
  • the amount of recombinant AAV produced is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100% or more.
  • cells of the present disclosure are capable of increasing the amount of recombinant AAV produced by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 75-fold, or at least about 100-fold or more.
  • the methods of producing a recombinant AAV provided herein can result in reduced production and/or purification time. Additional benefits are described elsewhere in the present disclosure.
  • a method of producing a protein (or polypeptide) encoded by a transgene comprises culturing a cell described herein (e.g. , transfected with a recombinant AAV delivery vector comprising a transgene) under suitable conditions and recovering the encoded protein.
  • a method of producing a protein encoded by a transgene comprises administering a recombinant AAV to a subject in need thereof, such that the encoded polypeptide is produced in the subject. Additional disclosure relating to such in vivo method of producing a protein is provided elsewhere in the present disclosure.
  • the present disclosure further provides a use of a recombinant AAV produced using the dual helper plasmids of the present disclosure for various therapeutic applications.
  • the present disclosure provides a method for treating a disease in a subject in need thereof, comprising administering to the subject a recombinant AAV comprising a transgene and produced as described herein.
  • a method of treating a disease provided herein comprises administering to a subject in need thereof any of the modified cells described herein ( e.g. , transfected with the recombinant AAV gene delivery vector comprising a transgene).
  • a method of treating a disease provided herein comprises administering to a subject in need thereof any of the pharmaceutical compositions described herein ( e.g. , comprising the recombinant AAV provided herein).
  • the above methods can be used to treat and/or prevent any disease of interest, e.g. , by modifying the transgene.
  • the disease to be prevented, alleviated, or treated by the present disclosure is not limited but includes all diseases that require reduced number of a drug administration.
  • diseases include ophthalmic diseases and neurological diseases.
  • ophthalmic diseases comprise diabetic retinopathy, choroidal neovascularization, macular degeneration, retinal degeneration, macular edema, retinal edema, macular tumentia, or a combination thereof.
  • neurological diseases comprise those that affect the central nervous system, the peripheral nervous system, or both.
  • Non-limiting examples of neurological diseases include: anxiety, depression, post-traumatic stress disorder (PTSD), bipolar disorder, attention deficit hyperactivity disorder (ADHD), autism, schizophrenia, neuropathic pain, glaucoma, toxicosis, arachnoid cyst, catatonia, encephalitis, epilepsy/seizure, locked-in syndrome, meningitis, migraine, multiple sclerosis, myelopathy, Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), Batten disease, Tourette's syndrome, traumatic brain injury, cerebrospinal injury, stroke, tremor (essential or Parkinsonian), dystonia, intellectual disability, brain tumor or a combination thereof.
  • PTSD post-traumatic stress disorder
  • ADHD attention deficit hyperactivity disorder
  • autism schizophrenia, neuropathic pain, glaucoma, toxicosis, arachnoid cyst, catatonia, encephalitis, epilepsy/seizure, locked-in syndrome, mening
  • Some aspects of the present disclosure relate to gene therapy agent that can achieve continuous expression of a transgene or a method using such agents for treating a disease.
  • the therapeutic agent e.g. , recombinant AAVs comprising the transgene
  • the therapeutic agent can be administered at intervals of about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, or about 1 year or more.
  • the interval is about 2 to about 3 months. In some aspects, the interval is about 6 months.
  • the interval is about 1 year. In some aspects, the interval is at least about 1 year. In some aspects, depending on the symptoms of a patient, the administration can be made about 2 or 3 times with an interval of about 1-2 weeks in the early stage, followed by administration with an interval of about 2-3 months, about 6 months, or about 1 year or longer, if necessary.
  • the therapeutic agent can be administered to the subject orally or parenterally.
  • the therapeutic agent e.g. , any of the AAVs, cells, and/or pharmaceutical compositions described herein
  • parenteral administration include: intravenous injection, transdermal administration, subcutaneous injection, intramuscular injection, intravitreal injection, subretinal injection, suprachoroidal injection, eye drop administration, intracerebroventricular injection, intrathecal injection, intraamniotic injection, intraarterial injection, intraarticular injection, intracardiac injection, intracavernous injection, intracerebral injection, intracisternal injection, intracoronary injection, intracranial injection, intradural injection, epidural injection, intrahippocampal injection, intranasal injection, intraosseous injection, intraperitoneal injection, intrapleural injection, intraspinal injection, intrathoracic injection, intrathymic injection, intrauterine injection, intravaginal injection, intraventricular injection, intravesical injection, subconjunctival injection, intratumoral injection, topical injection, intraperitoneal injection, and combinations thereof.
  • appropriate administration dosage of a therapeutic agent can vary depending on factors, such as, formulation method, mode of administration, the age, body weight, sex, pathological condition and diet of a patient, administration time, administration route, excretion rate and response sensitivity.
  • a daily administration dosage of a therapeutic agent is about 0.00001-100 mg/kg.
  • a cap8 gene fragment was obtained by conducting polymerase chain reaction (hereinafter, PCR) using pIDT-Cap8-Kan (Integrated DNA Technologies, USA) as a template and using a combination of oligo #001/002, and a plasmid backbone DNA fragment including the rep2 gene was obtained by conducting PCR using pRC6 (Takara Bio, Japan) as a template and using a combination of oligo #003/004.
  • pRC8 construct was prepared by joining the two DNA fragments through Gibson Assembly ® (NEB, USA, Cat. No. E2611).
  • a plasmid backbone was obtained by conducting PCR using pUC57-WPRE (GenScript, USA) as a template and using a combination of oligo #005/006, and a cap8 gene fragment and a rep2 gene fragment were obtained by conducting PCR using the pRC8 construct of Example 1-1 as a template and using oligo #007/008 and oligo #009/004, respectively.
  • a pUC-R2C8 construct was prepared by joining the three DNA fragments through Gibson Assembly ® .
  • a cap2 gene fragment was obtained by conducting PCR using pRC2-mi342 (Takara Bio, Japan) as a template and using a combination of oligo #007/010, and a plasmid backbone fragment including the rep2 gene was obtained by conducting PCR using pRC6 (Takara Bio, Japan) as a template and using a combination of oligo #003/004.
  • a pRC2 construct was prepared by joining the two DNA fragments through Gibson Assembly ® .
  • a plasmid backbone fragment including the rep2 gene was obtained by conducting PCR using the pUC-R2C8 construct of Example 1-2 as a template and using a combination of oligo #011/012, and a cap2 gene fragment was obtained by conducting PCR using the pRC2 construct of Example 1-3 as a template and using a combination of oligo #013/014.
  • a pUC-R2C2 construct was prepared by joining the two DNA fragments through Gibson Assembly ® .
  • a cap9 gene fragment was obtained by conducting PCR using pIDT-Cap9-Kan (Integrated DNA Technologies, USA) as a template and using a combination of oligo #001/015, and a plasmid backbone fragment including the rep2 gene was obtained by conducting PCR using pRC6 (Takara Bio, Japan) as a template and using a combination of oligo #003/004.
  • a pRC9 construct was prepared by joining the two DNA fragments through Gibson Assembly ® (NEB, USA, Cat. No. E2611).
  • a plasmid backbone was obtained by conducting PCR using pUC57-WPRE (GenScript, USA) as a template and using a combination of oligo #005/006 combination, and a cap9 gene fragment and a rep2 gene fragment were obtained by conducting PCR using the pRC9 construct of Example 1-5 as a template and using oligo #007/008, and using the pRC8 construct of Example 1-1 as a template and using oligo #009/004, respectively.
  • a pUC-R2C9 construct was prepared by joining the three DNA fragments through Gibson Assembly ® .
  • a plasmid backbone was obtained by conducting PCR using pUC57-WPRE (GenScript, USA) as a template and using a combination of oligo #005/006, and a rep2-cap5 gene fragment was obtained by conducting PCR using a pRC5 construct (Takara Bio, Japan) as a template and using oligo #008/009.
  • a pUC-R2C5 construct was prepared by joining the two DNA fragments through Gibson Assembly ® .
  • a pHelper-NG was prepared through cloning by joining VA-E4-pUC (GeneScript, USA) and E2a-pUC57 (GeneScript, USA) using the SalI/BamHI site shared by the two constructs (FIG. 1A).
  • the pHelper-NG includes the E2a , E4 and VA RNA genes of adenovirus serotype 5.
  • Example 2-2-1 Cloning of pHION8-BamHI-Forward or Reverse (pHION8-BF or -BR)
  • FIG. 1B schematically shows a pHION8-BF construct, which was prepared by inserting the rep2-cap8 gene fragment in a forward direction (clockwise direction, 5' -> 3') using the BamHI site present between the beginning portion of the E2a gene and the ending portion of the VA RNA gene.
  • FIG. 1B schematically shows a pHION8-BF construct, which was prepared by inserting the rep2-cap8 gene fragment in a forward direction (clockwise direction, 5' -> 3') using the BamHI site present between the beginning portion of the E2a gene and the ending portion of the VA RNA gene.
  • pHION8-BR construct which was prepared by inserting the rep2-cap8 construct in a reverse direction (counterclockwise direction, 3'-> 5') using the BamHI site present between the beginning portion of the E2a gene and the ending portion of the VA RNA gene.
  • the pHION8-BF was named as pHNG8, and pHION8-BR as pHNGR8.
  • Example 2-2-2 Cloning of pHION8-NotI-Forward or -Reverse (pHION8-NF or -NR)
  • FIG. 1D schematically shows a pHION8-NF construct, which was prepared by inserting the rep2-cap8 gene fragment in a forward direction (clockwise direction) using the NotI site present between the beginning portion of the E4 gene and the beginning portion of the AmpR gene.
  • FIG. 1D schematically shows a pHION8-NF construct, which was prepared by inserting the rep2-cap8 gene fragment in a forward direction (clockwise direction) using the NotI site present between the beginning portion of the E4 gene and the beginning portion of the AmpR gene.
  • 1E schematically shows a pHION8-NR construct, which was prepared by inserting the rep2-cap8 gene fragment in a reverse direction (counterclockwise direction) using the NotI site present between the beginning portion of the E4 gene and the beginning portion of the AmpR gene.
  • a pHION8-AF construct was prepared by obtaining a rep2-cap8 gene fragment by conducting PCR using the pUC-R2C8 construct of Example 1-2 as a template and using a combination of oligo #020/021 and inserting in a forward direction (clockwise direction) at the AsiSI site of the pHelper-NG prepared in Example 2-1 between the VA RNA gene and the E4 gene (FIG. 1F).
  • a construct prepared by obtaining a rep2-cap2 gene fragment by conducting PCR using the pUC-R2C2 construct of Example 1-4 as a template and using oligo #016/017 and inserting the same at the BamHI site of the pHelper-NG prepared in Example 2-1 was named pHNG2.
  • FIG. 2 schematically shows the pHNG2 construct, which was prepared by inserting the rep2-cap2 gene fragment in a forward direction (clockwise direction) using the BamHI site present between the E2a gene and the VA RNA gene.
  • FIG. 3 schematically shows the pHNG9 construct, which was prepared by inserting the rep2-cap9 gene fragment in a forward direction (clockwise direction) using the BamHI site present between the E2a gene and the VA RNA gene.
  • a kanamycin resistance gene fragment was obtained by conducting PCR using a pMK-RQ-1-PM construct (Geneart, Thermo Fisher Scientific, USA) as a template and using a combination of oligo #018/019, and an E4 gene fragment, a fragment from VA RNAs gene to an N-term of the E2a gene and a fragment from a C-term of the E2a gene to Origin were obtained by conducting PCR using the pHelper-NG construct of Example 2-1 as a template and using oligo #020/021, oligo #022/023 and oligo #024/025, respectively.
  • a pHelper-NG-Kan construct was prepared by joining the four DNA fragments through Gibson Assembly ® .
  • pHNG5K A construct prepared by obtaining a rep2-cap5 gene fragment by conducting PCR using the pUC-R2C5 construct of Example 1-7 as a template and using oligo #016/#017 and inserting the same at the BamHI site of the pHelper-NG-Kan prepared in Example 3-3-1 was named pHNG5K (K denotes that a kanamycin resistance gene was used as an antibiotic resistance gene).
  • FIG. 4 schematically shows the pHNG5K construct, which was prepared by inserting the rep2-cap5 gene fragment in a forward direction (clockwise direction) using the BamHI site present between the E2a gene and the VA RNA gene.
  • Oligo ID SEQ ID (#) Sequence (5' -> 3') 001 1 TGAACAATAAATGATTTAAATCAGGTATGGCTGCCGATGGTTATCTTCCAG 002 2 TAACAAGCAATTACAGATTACGGGTGAGGTAACGGG 003 3 TAATCTGTAATTGCTTGTTAATCAATAAACCGTTTAATTCGTTTCAG 004 4 TTTAAATCATTTATTGTTCAAAGATGCAGTCATCCAAATCCAC 005 5 ATTAACTACAAGCTGTTTCCTGTGTGAAATTGTTATCC 006 6 GCGGCTGCGCTTAAGCCAGCCCCGACACC 007 7 TGAACAATAAATGATTTAAATCAGGTATGGCTGCCG 008 8 GGAAACAGCTTGTAGTTAATGATTAACCCGCCATGC 009 9 GCTGGCTTAAGCAGCCGCCATG 010 10 TAACAAGCAATTACAGATTACGAGTCAGGTATCTGG 011 11 GGTCGCTGGGGACC
  • constructs prepared by inserting the rep - cap gene fragment between the E2a gene and the VA RNA gene in a forward direction were collectively named pHNG (pHNG2, pHNG5 (including pHNG5K), pHNG8, pHNG9, etc.) and constructs prepared by inserting in a reverse direction (counterclockwise direction, 3'-> 5') were collectively named pHNGR (pHNGR8, etc.).
  • pHNG pHNG2
  • pHNG5 including pHNG5K
  • pHNG8 pHNG9
  • An AAV construct plasmid including a transgene was prepared according to the method described in Korean Patent Application No. 10-2020-0084038. Specifically, the plasmid was prepared from a pUC57 plasmid, with AAV2 ITR (inverted terminal repeat) base sequences necessary for AAV capsid packaging on both sides and a CMV enhancer, a chicken ⁇ -actin promoter, a hybrid intron, an eGFP gene as a transgene, a WPRE sequence, four repeating miR142-3p target sequences and the pA sequence of bovine growth hormone included therebetween.
  • AAV2 ITR inverted terminal repeat
  • HEK293 cells were wet-cultured using an MEM medium (Gibco, USA, Cat. No. 42360-032) containing 10% FBS (fetal bovine serum, Gibco, USA, Cat. No. 16000-044) and 1% penicillin-streptomycin (Gibco, USA, Cat. No. 15140-163) under the condition of 5% CO 2 and 37 oC.
  • Expi293 cells were wet-cultured using an Expi293 medium (Gibco, USA, Cat. No. A14351-01) supplemented with 1% penicillin-streptomycin under the condition of 8% CO 2 and 37 oC while shaking at 250 rpm.
  • Example 7-1 Transfection of adhesion cells for production of AAV
  • HEK293 cells were washed twice using DPBS (Gibco, USA, Cat. No. 14190-250), detached from the culture dish by treating with trypsin-EDTA (Gibco, USA, Cat. No. 25200-114), and then inoculated onto a 150-mm culture dish at 2x10 7 cell/dish. After culturing for 24 hours, a pHelper-NG plasmid, a pUC-R2C2, pUC-R2C8 or pUC-R2C9 plasmid and an AAV construct plasmid including the transgene, 3.73 pmol each, were dissolved in 500 ⁇ L of Opti-MEM (Gibco, USA, Cat.
  • Example 7-2 Transfection of suspension cells for production of AAV
  • a pHelper-NG plasmid for production of AAV, 6x10 8 cells were inoculated to 220 mL of an Expi293 medium in a 1-L Erlenmeyer culture flask. After culturing for about 3-4 hours for stabilization, a pHelper-NG plasmid, a pUC-R2C2, pUC-R2C5, pUC-R2C8 or pUC-R2C9 plasmid and an AAV construct plasmid including the transgene, 3.73 pmol each, were dissolved in 10 mL of Opti-MEM (Gibco, USA, Cat. No. 51985-034) for triple transfection.
  • Opti-MEM Gabco, USA, Cat. No. 51985-034
  • a pHION8 plasmid, a pHNG2 plasmid or a pHNG9 plasmid and an AAV construct plasmid including the transgene, 3.73 pmol each, were dissolved in 10 mL of Opti-MEM (Gibco, USA, Cat. No. 51985-034). Then, after diluting polyethylenimine (PEI, Polyscience, USA, Cat. No. 23966-1) corresponding to 2-fold of the total DNAs in 10 mL of Opti-MEM, the two solutions were mixed immediately to prepare a transfection solution. After incubating at room temperature for 30 minutes, 20 mL of the transfection solution was added to the culture flask.
  • PEI polyethylenimine
  • Example 7-1 or 7-2 After conducting transfection for 72 hours in Example 7-1 or 7-2, the cells were incubated for 3 hours after adding NaCl to the culture dish and the culture flask to a concentration of 500 mM (salt shock). Then, after recovering all the culture and removing debris through centrifugation, centrifugation was performed using Centricon (Vivaspin 20, 100,000 MWCO PES, Sartorius, Germany) having a molecular weight cut-off pore size of 100 kDa at 4 oC and 4000 rpm until about 200 ⁇ L of a supernatant remained. Then, the supernatant containing a recombinant adeno-associated virus vector was recovered and used for experiment or stored at -80 oC.
  • Centricon Vivaspin 20, 100,000 MWCO PES, Sartorius, Germany
  • qPCR Bio-Rad, USA, CFX96 was conducted to determine the titer of the AAV purified in Example 8.
  • the AAV was treated with DNaseI at 37 oC for 1 hour using a DNaseI reaction buffer (New England Biolab, USA, M0303S).
  • DNaseI-treated sample with proteinase K (Invitrogen, USA, Cat. No. AM2548) at 55 oC for 30 minutes, the proteinase K was inactivated by incubating at 95 oC for 15 minutes.
  • proteinase K Invitrogen, USA, Cat. No. AM2548
  • the prepared sample was used as a template for qPCR, the AAV construct plasmid (7.4x10 8 to 7.4x10 4 , 10-fold dilution) was used to obtain a standard curve, and a recombinant adeno-associated virus 2 reference standard stock (rAAV2-RSS, ATCC, USA, Cat. No. VR-1616) or a recombinant adeno-associated virus 8 reference standard stock (rAAV8-RSS, ATCC, USA, Cat. No. VR-1816) was used as a positive control group.
  • rAAV2-RSS recombinant adeno-associated virus 2 reference standard stock
  • rAAV8-RSS recombinant adeno-associated virus 8 reference standard stock
  • HEK293 cells were inoculated on a 24-well culture plate with 4x10 5 cells per well. 24 hours later, each well was treated with 5 ⁇ M MG132 (Sigma-Aldrich, USA, Cat. No. M7449) for 8 hours. The cells were treated with 2,500 MOI (multiplicity of infection) of AAV2, or with 10,000 MOI of AAV8 or AAV9, and then cultured for 72 hours.
  • MOI multiplicity of infection
  • Example 11 Measurement of expression level of eGFP gene through flow cytometry
  • eGFP The expression of eGFP was measured by flow cytometry (Beckman Coulter, USA, CytoFlex). After transfection for 72 hours, the cells were treated with DPBS and detached using trypsin. After centrifuging the cells at 1500 rpm for 5 minutes, the cells were resuspended by adding 500 ⁇ L of DPBS supplemented with 2% FBS. The single cell region was distinguished from the FSC vs SSC plot and the expression level of FL1-A (green) was measured. The result of flow cytometry was analyzed using the FlowJo software 10.5.3 (Becton Dickinson & Company, USA).
  • the AAV production may vary depending on the relative location and direction of the rep2-cap8 gene in the dual helper plasmid.
  • the construct wherein the rep2-cap gene is present in a forward direction (BF) at the BamHI site in the pHION plasmid for double transfection is named pHNG, and the construct wherein it is present in a reverse direction (BR) is named pHNGR.
  • BF forward direction
  • BR reverse direction
  • a pHNG2 construct was prepared by inserting the rep2-cap2 gene fragment in a forward direction using the BamHI site present between the beginning portion of the E2a gene and the ending portion of the VA RNA gene in a pHelper-NG plasmid, and it was used for double transfection (FIG. 2).
  • pHNG9 construct was prepared by cloning the rep2-cap9 gene fragment in a forward direction using the BamHI site present between the beginning portion of the E2a gene and the ending portion of the VA RNA gene (FIG. 3).
  • AAV9 production was significantly increased to 214.0% ( p ⁇ 0.001) by the double transfection as compared to the triple transfection (FIG. 9).
  • This result was consistent to the increased AAV8 or AAV2 production by double transfection using pHNG8 and pHNG2.
  • AAV9 adeno-associated virus serotype 9
  • pHNG5K construct was prepared by cloning the rep2-cap5 gene fragment in a forward direction using the BamHI site present between the beginning portion of the E2a gene and the ending portion of the VA RNA gene (FIG. 4).
  • adeno-associated virus serotype 5 (AAV5) by double transfection can also be increased by locating the rep2-cap gene between the beginning portion of the E2a gene and the ending portion of the VA RNA gene.
  • AAV8 produced by triple transfection and AAV8 produced by double transfection using pHNG8 and pHNGR8 were compared.
  • the AAV8s were designed to express the eGFP protein. After infecting HEK293 cells with 10,000 MOI of AAV8, the expression level of eGFP in the cells was measured by flow cytometry 72 hours later.
  • AAV2 In gene delivery (transduction) using AAV2, the cellular infectivity and gene expression ability of AAV2 produced by triple transfection and AAV2 produced by double transfection using pHNG2 were compared.
  • the AAV2s were designed to express the eGFP protein. After infecting HEK293 cells with 2,500 MOI of AAV2, the proportion of cells expressing eGFP and the expression level of eGFP in the cells were measured by flow cytometry 72 hours later.
  • This result suggests that the AAV2 produced by double transfection using pHNG2 exhibits cellular infectivity and gene expression ability after infection at least comparable to those of the AAV2 produced by triple transfection (FIG. 12).
  • AAV9 In gene delivery (transduction) using AAV9, the cellular infectivity and gene expression ability of AAV9 produced by triple transfection and AAV9 produced by double transfection using pHNG9 were compared.
  • the AAV9s were designed to express the eGFP protein. After infecting HEK293 cells with 10,000 MOI of AAV9, the expression level of eGFP in the cells was measured by flow cytometry 72 hours later.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
PCT/KR2022/007553 2021-05-27 2022-05-27 Novel dual helper plasmid Ceased WO2022250491A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP22811682.8A EP4347850A4 (en) 2021-05-27 2022-05-27 Novel dual helper plasmid
KR1020237035539A KR102685652B1 (ko) 2021-05-27 2022-05-27 신규한 듀얼 헬퍼 플라스미드
JP2023573241A JP7854125B2 (ja) 2021-05-27 2022-05-27 新規なデュアルヘルパープラスミド
CN202280037488.8A CN117500932A (zh) 2021-05-27 2022-05-27 新型双重辅助质粒
AU2022282057A AU2022282057B2 (en) 2021-05-27 2022-05-27 Novel dual helper plasmid
CA3219287A CA3219287C (en) 2021-05-27 2022-05-27 Dual helper plasmid

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210068364 2021-05-27
KR10-2021-0068364 2021-05-27
US17/750,241 US12305188B2 (en) 2021-05-27 2022-05-20 Dual helper plasmid
US17/750,241 2022-05-20

Publications (1)

Publication Number Publication Date
WO2022250491A1 true WO2022250491A1 (en) 2022-12-01

Family

ID=84228978

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/007553 Ceased WO2022250491A1 (en) 2021-05-27 2022-05-27 Novel dual helper plasmid

Country Status (6)

Country Link
US (1) US20260092291A1 (enExample)
EP (1) EP4347850A4 (enExample)
JP (1) JP7854125B2 (enExample)
KR (1) KR102685652B1 (enExample)
AU (1) AU2022282057B2 (enExample)
WO (1) WO2022250491A1 (enExample)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024211780A1 (en) * 2023-04-07 2024-10-10 Regenxbio Inc. Compositions and methods for recombinant aav production
WO2025083617A1 (en) * 2023-10-18 2025-04-24 Nanocell Therapeutics Holdings B.V. Methods and compositions for nucleic construct delivery

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040033751A (ko) * 2002-10-15 2004-04-28 주식회사 삼양제넥스 재조합 아데노부속바이러스 유전자 전달체 생산용 벡터시스템
US20130089523A1 (en) * 2010-03-26 2013-04-11 Deutsches Krebsforschungszentrum Adenovirus derived helper virus for enhancing recombinant parvovirus production
WO2020086881A1 (en) * 2018-10-25 2020-04-30 Baxalta Incorporated Aav triple-plasmid system
EP3722434A1 (en) * 2019-04-12 2020-10-14 Freeline Therapeutics Limited Plasmid system

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5872005A (en) 1994-11-03 1999-02-16 Cell Genesys Inc. Packaging cell lines for adeno-associated viral vectors
JP2003501042A (ja) 1999-05-27 2003-01-14 ジェノボ, インコーポレイテッド 非哺乳動物ウイルス由来のキャリアベクターを使用する、組換えウイルスの産生のための組成物および方法
US10550405B2 (en) 2017-03-15 2020-02-04 The University Of North Carolina At Chapel Hill Rational polyploid adeno-associated virus vectors and methods of making and using the same
EP3612635A2 (en) 2017-04-18 2020-02-26 GlaxoSmithKline Intellectual Property Development Limited Methods for adeno-associated viral vector production
GB201706090D0 (en) * 2017-04-18 2017-05-31 Glaxosmithkline Ip Dev Ltd Methods for adeno-associated viral vector production
GB201800903D0 (en) 2018-01-19 2018-03-07 Oxford Genetics Ltd Vectors
WO2022097647A1 (ja) 2020-11-04 2022-05-12 株式会社シンプロジェン 統合型プラスミド

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040033751A (ko) * 2002-10-15 2004-04-28 주식회사 삼양제넥스 재조합 아데노부속바이러스 유전자 전달체 생산용 벡터시스템
US20130089523A1 (en) * 2010-03-26 2013-04-11 Deutsches Krebsforschungszentrum Adenovirus derived helper virus for enhancing recombinant parvovirus production
WO2020086881A1 (en) * 2018-10-25 2020-04-30 Baxalta Incorporated Aav triple-plasmid system
EP3722434A1 (en) * 2019-04-12 2020-10-14 Freeline Therapeutics Limited Plasmid system

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
See also references of EP4347850A1 *
TANG QIUSHI, KEELER ALLISON M., ZHANG SONGBO, SU QIN, LYU ZHUOYAO, CHENG YANGFAN, GAO GUANGPING, FLOTTE TERENCE R.: "Two-Plasmid Packaging System for Recombinant Adeno-Associated Virus", BIORESEARCH OPEN ACCESS, vol. 9, no. 1, 1 October 2020 (2020-10-01), pages 219 - 228, XP055852381, DOI: 10.1089/biores.2020.0031 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024211780A1 (en) * 2023-04-07 2024-10-10 Regenxbio Inc. Compositions and methods for recombinant aav production
WO2025083617A1 (en) * 2023-10-18 2025-04-24 Nanocell Therapeutics Holdings B.V. Methods and compositions for nucleic construct delivery

Also Published As

Publication number Publication date
EP4347850A1 (en) 2024-04-10
JP7854125B2 (ja) 2026-05-01
US20260092291A1 (en) 2026-04-02
AU2022282057A1 (en) 2023-12-21
JP2024519175A (ja) 2024-05-08
KR102685652B1 (ko) 2024-07-19
AU2022282057A9 (en) 2024-01-25
KR20230152768A (ko) 2023-11-03
AU2022282057B2 (en) 2025-01-23
EP4347850A4 (en) 2025-04-02

Similar Documents

Publication Publication Date Title
WO2022250491A1 (en) Novel dual helper plasmid
WO2022010277A1 (en) Novel intron fragments
JP2023538666A (ja) 閉端DNA(ceDNA)の改善された製造のための改変バキュロウイルス系
EP4200428B1 (en) Method of making recombinant aavs
WO2025143742A1 (ko) 혈액응고인자 IX를 암호화하는 코돈-최적화된 폴리뉴클레오티드 및 이를 포함하는 rAAV 생산용 플라스미드
WO2023172115A1 (ko) Nhej 복구 경로 조절을 통해 핵산 세그먼트의 결실 효율을 증가시키기 위한 조성물 및 방법
WO2012134215A2 (ko) 동물세포 발현벡터
WO2024204883A1 (en) Nucleic acid molecule comprising asymmetrically modified itr for improving expression rate of inserted gene, and use thereof
WO2024204882A1 (en) Modified complex platform of adeno-associated virus with improved rate of expression of loaded genes and reduced genotoxicity
WO2025063664A1 (ko) 재조합 aav 생산을 위한 단일 벡터 시스템
WO2022019706A1 (ko) 로돕신 전사체에 특이적인 트랜스-스플라이싱 라이보자임 및 이의 용도
WO2026019230A1 (ko) 스터퍼를 포함하는 재조합 aav 생산을 위한 벡터 시스템
WO2023191570A1 (ko) 어셔 증후군 치료를 위한 유전자 편집 시스템
WO2023121377A1 (ko) 신규한 프로모터 및 이의 이용
WO2026063691A1 (ko) 아르기니노숙시네이트 합성효소를 암호화하는 코돈-최적화된 폴리뉴클레오티드 및 이를 포함하는 rAAV 생산용 플라스미드
WO2023234701A1 (ko) 망막 또는 황반 질환 치료용 조성물
WO2015152609A1 (ko) GM-CSF 유전자; 데코린 유전자; TGF-β2 발현을 억제하는 shRNA; 및 FoxP3 발현을 억제하는 shRNA를 포함하는 항종양 조성물
US12305188B2 (en) Dual helper plasmid
WO2026084101A1 (ko) 아데노연관바이러스 변이체
WO2026024045A1 (ko) 변이체 캡시드를 포함하는 아데노-연관 바이러스 및 이의 용도
KR102704771B1 (ko) 망막 또는 황반 질환 치료용 조성물
WO2025105906A1 (en) Novel rna construct and a method of preparing circular rna using the same
WO2026010243A1 (ko) Crispr/cas 시스템을 사용하는 best1 유전자 편집 방법
WO2026038929A1 (ko) Rna 안정성 또는 mrna 번역 증가용 신규 조절 엘리먼트 및 이의 용도
WO2025116606A1 (ko) 신규한 케모카인-유사 단백질 단편

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22811682

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 20237035539

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020237035539

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 3219287

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 202280037488.8

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 2023573241

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2022282057

Country of ref document: AU

Ref document number: AU2022282057

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2022282057

Country of ref document: AU

Date of ref document: 20220527

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2022811682

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2022811682

Country of ref document: EP

Effective date: 20240102