WO2022248879A1 - Composition et procédé d'édition d'arn médiée par adar - Google Patents

Composition et procédé d'édition d'arn médiée par adar Download PDF

Info

Publication number
WO2022248879A1
WO2022248879A1 PCT/GB2022/051359 GB2022051359W WO2022248879A1 WO 2022248879 A1 WO2022248879 A1 WO 2022248879A1 GB 2022051359 W GB2022051359 W GB 2022051359W WO 2022248879 A1 WO2022248879 A1 WO 2022248879A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
adar
uorf
rna
target
Prior art date
Application number
PCT/GB2022/051359
Other languages
English (en)
Inventor
Thomas Charles ROBERTS
Nenad Svrzikapa
Matthew Wood
Britt HANSON
Original Assignee
Oxford University Innovation Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oxford University Innovation Limited filed Critical Oxford University Innovation Limited
Publication of WO2022248879A1 publication Critical patent/WO2022248879A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/344—Position-specific modifications, e.g. on every purine, at the 3'-end
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications

Definitions

  • the invention relates to compounds for site-directed editing of a RNA transcript, and methods and uses thereof.
  • the primary open reading frame In eukaryotic mRNAs, the primary open reading frame (pORF) is often preceded by one or more regulatory elements in the 5' untranslated region (UTR) which modulate the expression of the downstream pORF.
  • UTR 5' untranslated region
  • uORFs upstream open reading frames
  • uORFs are regulatory sequences which occur in 5' UTRs and consist of a start codon and an in-frame stop codon.
  • the presence of one or more uORFs in a RNA transcript is associated with translation repression of the corresponding pORF.
  • uORFs can also influence gene expression via other mechanisms, such as transcript stability via nonsense- mediated decay.
  • RNA editing approaches are known in the art, e.g. reviewed in references 1 and 2.
  • adenosine deaminase acting on RNA (ADAR) proteins can be recruited to specific target site, and ADAR catalyses the conversion of adenosine to inosine.
  • Inosine is typically read as guanosine for the purposes of transcription and translation, so the ADAR-catalysed base change can be considered an A-to-I (or A-to-‘G’) transition.
  • the application of these site-directed RNA editing approaches typically focuses on editing the coding regions of disease-related proteins, e.g. by reversing non-sense mutations or substitution mutations, leading to restoration of the wild-type protein.
  • One of the drawbacks of the ADAR-mediated site-directed RNA editing approach is that relatively long oligonucleotides (e.g. over 60 nucleotides in length) are used to recruit ADAR to the target site (e.g. references 3, 4 and 5).
  • the synthesis of good quality long oligonucleotides e.g. over 60 nucleotides in length), in particular those with a diverse combination of nucleic acid chemistries, is challenging.
  • failure sequences tend to build up with increasing oligonucleotide length, and since the failure sequences are similar in properties to the desired sequence, they are difficult to remove by purification steps. This results in a significant impurity which is a mixture of failure sequences, and this is undesirable.
  • modulation of a single upstream open reading frame (uORF) by RNA editing can lead to de-repression of the downstream protein at a therapeutically relevant level.
  • the inventors also found that, surprisingly, the disruption of a start codon of an uORF (i.e. an upstream start codon) has a significant effect on the expression of the downstream pORF.
  • targeted editing of the uORF start codon by ADAR e.g. converting the AUG to an IUG
  • ADAR e.g. converting the AUG to an IUG
  • site-directed editing can be used to disrupt a uORF start codon, with the aim of increasing the expression of the downstream pORF.
  • Site-directed editing can also be used to disrupt a stop codon in an uORF (i.e. an upstream stop codon). This would lead to the extension of the uORF, thereby enhancing its repressive activity on the downstream pORF.
  • Site-directed editing can also be used to introduce regulatory elements in the 5' UTR of a transcript.
  • an upstream start codon can be introduced.
  • the presence of an upstream start codon may interfere with translation of the downstream pORF, resulting in the repression of the downstream pORF.
  • an upstream stop codon can be introduced, e.g. to shorten an uORF, thereby reducing its repressive activity on the downstream pORF.
  • oligonucleotides that are particularly effective for site-directed editing of a RNA transcript by recruiting endogenous ADAR.
  • These oligonucleotides are shorter (e.g. about 60 nucleotides in length or less) than the oligonucleotides used in the art. This is in part due to the surprising discovery that ADAR can be efficiently recruited by oligonucleotides that do not contain the conserved GluR2 pentaloop structure (i.e. GCUMA sequence, wherein M is A or C).
  • GCUMA sequence conserved GluR2 pentaloop structure
  • the shorter oligonucleotides are advantageous because they are relatively easy to synthesise with high purity, capable of recruiting ADAR to a specific target site in a RNA transcript with high efficiency and useful for therapeutic applications.
  • the invention provides a compound comprising a target recognition module and an RNA editing enzyme-recruiting module, wherein the target recognition module targets the compound to a target site in the 5' untranslated region (5' UTR) of a RNA transcript, such that one or more nucleosides in the 5' UTR are edited by the RNA editing enzyme, optionally wherein the RNA editing enzyme is an adenosine deaminase acting on RNA (ADAR) and an adenosine in the target site is converted to an inosine by ADAR.
  • ADAR adenosine deaminase acting on RNA
  • the invention also provides a compound comprising a target recognition module and an adenosine deaminase acting on RNA (ADAR)-recruiting module, comprising two strands of single-stranded oligonucleotides annealed to form a single-stranded target recognition module and a double-stranded ADAR-recruiting module, wherein each strand is 60 nucleotides or less in length, wherein the target recognition module is capable of targeting the compound to a target site comprising an adenosine nucleotide such that the adenosine nucleotide is converted to an inosine nucleotide by ADAR.
  • ADAR adenosine deaminase acting on RNA
  • the invention also provides a compound comprising a target recognition module and an adenosine deaminase acting on RNA (ADAR)-recruiting module, wherein the ADAR-recruiting module does not comprise a Glur2 hairpin loop sequence consisting of GCUMA (SEQ ID NO: 5), where M is A or C, wherein the target recognition module is capable of targeting the compound to a target site comprising an adenosine such that the adenosine is converted to an inosine by ADAR.
  • ADAR adenosine deaminase acting on RNA
  • the invention also provides a polynucleotide or a vector encoding the compound of the invention, optionally wherein the vector is AAV or lentivirus.
  • the invention also provides a delivery vehicle comprising the compound or conjugated compound of the invention.
  • the invention also provides a modified RNA transcript comprising: (a) the absence of an upstream start codon, (b) the absence of an upstream stop codon, or (c) the presence of an upstream start codon in the 5' UTR compared to the unmodified mRNA transcript.
  • the invention also provides a composition comprising two or more compounds of the invention, optionally wherein the compounds are conjugated.
  • the invention also provides a pharmaceutical composition
  • a pharmaceutical composition comprising the compound, the polynucleotide, the delivery vehicle or the composition of the invention, and a pharmaceutically acceptable carrier.
  • the invention also provides a method of site-directed editing of the 5' UTR in a RNA transcript, comprising delivering to a cell at least one compound comprising a target recognition module and an RNA editing enzyme-recruiting module, wherein the target recognition module targets the compound to a target site in the 5' UTR, such that one or more nucleosides in the 5' UTR is edited by the RNA editing enzyme.
  • the invention also provides a method of treating or preventing a disease or condition in a subject by modulating the expression of a protein, comprising administering to the subject a therapeutically effective amount of the compound, the polynucleotide, the delivery vehicle, the composition or the pharmaceutical composition of the invention.
  • the invention also provides the use of the compound, polynucleotide, the delivery vehicle, the composition or the pharmaceutical composition of the invention in the manufacture of a medicament for the treatment or prevention of a disease or condition in a subject by modulating the expression of a protein.
  • the invention also provides the use of the compound, polynucleotide, the delivery vehicle, the composition or the pharmaceutical composition of the invention for the treatment or prevention of a disease or condition in a subject by modulating the expression of a protein.
  • Figure 1A shows the proportion of human and mouse transcripts containing predicted uORFs.
  • Figure IB shows the number of uORFs per transcript.
  • Figure 1C shows the distribution of uORF lengths.
  • Figure ID shows the proportion of uORFs which overlap with the pORF.
  • Figure IE shows the distribution of distances between the transcription start site and uORF.
  • Figure IF shows the distribution of distances between the uORF and the pORF.
  • Figure 1G shows the distribution of pORF and uORF stop codon usage.
  • Figure 1H shows the proportion of uORFs and pORFs with weak or strong Kozak contexts.
  • Figure II shows logo plots for the Kozak context at uORFs and pORFs.
  • Figure 1 J shows the distribution of phastCons scores in uORFs relative to other genomic features.
  • Figure IK shows a predicted uORF at the HTT gene mapped on to the genome browser with additional riboseq and RNA-seq tracks.
  • Figure 2 A shows luciferase validation data for predicted uORFs for FOXL2 , HOXA11, JUN, KDR, RNASEH1, SMO and SRY. Each 5' UTR was cloned upstream of a Renilla reporter gene and a mutant construct generated in which the uORF ATG was changed to TTG, thereby inactivating the uORF. Activation of luciferase expression is indicative of de-repression uORF-mediated translational repression.
  • Figure 2B shows transcript level data for the constructs in Figure 2A.
  • Figure 2C shows an independent verification of Figure 2 A that also includes MAP2K2.
  • Figure 2D shows luciferase reporter data for BDNF (2 isoforms), C9orf72 , GATA2 (3 isoforms), GDNF, HTT and SCN1A. Together these plots validate the existence of multiple uORFs.
  • Figure 2E shows a cumulative distribution function plot for proteomics data (ubiquitously-expressed proteins only) taken from 29 healthy human tissues (6) whereby transcripts were classified as uORF-containing or non-uORF-containing. The distribution of protein expression values is significantly lower for uORF-containing transcripts.
  • Figure 2F shows a cumulative distribution function plot for proteomics data (all proteins) aggregated from 29 healthy human tissues (6) whereby transcripts were classified as uORF-containing or non-uORF- containing. The distribution of protein expression values is significantly lower for uORF- containing transcripts.
  • Figure 3 A shows analyses of uORF properties.
  • Various functional mutants were generated to the HOXA11 uORF to change the strength of the Kozak context sequence, increase the length of the uORF, progressively truncate the uORF, and to add FLAG and HiBiT tags to the uORF (Nucleotide sequences from top to bottom are set out in SEQ ID NOs: 23-35, respectively, and the corresponding peptide sequences from top to bottom are set out in SEQ ID NOs: 52-64, respectively).
  • Figure 3B,C and D show cumulative distribution function plots for proteomics data taken from 29 healthy human tissues (6) whereby transcripts were classified as: (B) strong or weak Kozak contexts, (C) minimal uORF (ATG-STOP) or other uORFs, and (D) translation initiation site (TIS) spanning or not.
  • Figure 4 shows luciferase reporter data for various mutants of the SCN1A 5'UTR, which contains 12 mutants. All uORFs were inactivated by ATG to TTG mutation as appropriate. All 12 uORFs were inactivated, each uORF was inactivated one at a time, each uORF was tested in the context where all other uORFs were inactivated, and uORFs were sequentially inactivated from either the 5' or 3' ends of the 5' UTR.
  • Figure 4 is luciferase data performed in HEK293T cells transfected with various plasmid constructs in which the SCN1A 5' UTR was cloned upstream of a Renilla luciferase reporter gene.
  • the SCN1A 5' UTR contains 12 predicted uORFS which are represented by open circles. Inactivating ATG to TTG mutation at a uORF is indicated by closed circles.
  • FIG. 5 is a schematic diagram showing a compound of the invention.
  • A, B Two strands of oligonucleotides (“Guide” and “Passenger”) anneal to form an asymmetric duplex having a single-stranded target recognition module at one end and a double- stranded ADAR-recruiting module at the other end.
  • the target recognition module targets the start codon of an uORF.
  • the Passenger strand may comprise various chemistries, e.g. Chemistry 1, Chemistry 2 and Chemistry 3.
  • C An example of a compound of the invention targeted to the uORF of HOXA11.
  • Figure 6 shows the results of luciferase expression assays for HOXA11 5' UTR constructs sequentially treated with ADAR expressing plasmids and editing oligonucleotides targeting the HOXA11 uORF.
  • A ADAR PI 10 (25 and 50nM).
  • B ADAR PI 50 (25 and 50nM).
  • MM indicates mismatches between strands
  • PS indicates phosphorothioate
  • PO indicates phosphodiester.
  • Figure 7 shows the results of luciferase expression assays for HOXA11 5' UTR constructs cotransfected with ADAR expressing plasmids and editing oligonucleotides targeting the HOXA11 uORF at the same time.
  • A) and B) show 48hrs post-transfection.
  • C) and (D) show 72hrs post-transfection.
  • MM indicates mismatches between strands
  • PS indicates phosphorothioate
  • PO indicates phosphodiester.
  • FIG 8 is a schematic diagram showing the positioning of the target recognition module and the ADAR recruiting module in a compound of the invention.
  • ADAR- recruiting module is positioned at the 5' end of the target recognition module.
  • ADAR- recruiting module is positioned at the 3' end of the target recognition module.
  • C Two ADAR-recruiting modules are included - one at each terminus of the target recognition module.
  • Figure 9 shows design and screening of a panel of crRNAs for RNA editing of the HOXA11 uORF start codon (A)
  • a panel of 15 crRNAs were designed for targeting the HOXA11 5' UTR with a mismatched cytosine (C) to facilitate adenine to guanine (A to G) editing in the mRNA transcript using a CRISPR/ADAR system derived from Prevotella sp. Cas13b (PspCas13b).
  • the mismatch distance (MD) was optimised in the crRNA design, and the spacer length (SL) kept at ⁇ 50 nt.
  • the crRNA hairpin structure required for recognition by the Psp Cas13b-ADAR fusion protein is shown.
  • HEK 293T cells were transiently transfected with the CRISPR/ADAR and crRNA plasmids alongside the HOXA11 WT pDLR vector to assess the effect on uORF activity using a dual-luciferase assay measuring RLuc expression, normalised to FLuc.
  • a compound of the invention is a bifunctional molecule comprising a target recognition module and an RNA editing enzyme recruiting module.
  • the RNA editing enzyme recruiting module selectively binds with sufficient affinity to the RNA editing enzyme that is naturally present in the cell, and recruits it to the target site as determined by the target recognition module. This promotes site-directed editing of the target site in the RNA transcript.
  • the compounds described herein are not designed to elicit cleavage of the target RNA transcript.
  • the compound of the invention hybridises to the target sequence and recruits endogenous RNA editing enzyme to the target site, in such a way that it does not induce target cleavage via RNase H recruitment.
  • the compound does not induce or has a reduced ability to induce RNase H cleavage of the target nucleic acid.
  • the compound of the invention is targeted to an upstream start codon (e.g. a start codon of an uORF)
  • the compound of the invention is not designed to sterically interfere with ribosome assembly at the uORF, e.g. by physically masking the uATG.
  • the compound does not or has a reduced ability to interfere with ribosome assembly at the uORF.
  • RNA editing enzyme recruiting module is typically an adenosine deaminase acting on RNA (ADAR)-recruiting module.
  • ADAR adenosine deaminase acting on RNA
  • the compound is typically an oligonucleotide that acts as a bifunctional molecule with a target recognition module and a ADAR-recruiting module.
  • a target recognition module and the ADAR-recruiting module which are independently a small molecule (e.g. having a molecular weight of less than 900 Da), a peptide (e.g. an antibody) or an RNA aptamer, may also be useful with the invention.
  • the invention provides a compound comprising a target recognition module and an ADAR-recruiting module, comprising two strands of single-stranded oligonucleotides annealed to form a single-stranded target recognition module and a double-stranded ADAR-recruiting module, wherein each strand is 60 nucleotides or less in length.
  • the invention also provides a compound comprising a target recognition module and an ADAR-recruiting module, wherein the ADAR-recruiting module does not comprise a Glur2 hairpin loop sequence consisting of GCUMA (SEQ ID NO: 5), where M is A or C.
  • the target recognition module and the ADAR-recruiting module may be conjugated by any means, such as an internucleoside linkage or peptide linkage.
  • the target recognition module and the ADAR-recruiting module may be covalently linked together utilising click chemistry, e.g. via azide and alkyne residues (e.g. see reference 7).
  • the target recognition module and the ADAR-recruiting module may be linked by a linker.
  • the linker may comprise one or more nucleotides, an oligopeptide or another chemical linker such a polyethylene glycol (PEG).
  • the two strands of single-stranded oligonucleotides may be referred to as a guide strand and a passenger strand, respectively.
  • the guide strand comprises the target recognition module and the first half of the ADAR-recruiting module
  • the passenger strand comprises the second half of the ADAR-recruiting module.
  • the ADAR-recruiting module is functional (i.e. has ADAR- recruiting activity) only after annealing of the guide and passenger stands to form a double- stranded portion (see Figure 5).
  • the passenger strand acts as a universal passenger stand which can be used to anneal with a guide strand comprising a target recognition module specific for any target site (see Figure 5C).
  • This has the advantages of reducing the cost of materials, employing modularity (universal component can be used across multiple targets), more flexible chemistry composition, and ease of use.
  • the guide strand and the passenger strand anneal to form an asymmetric duplex, e.g. with a single-stranded target recognition module at one end and a double- stranded ADAR-recruiting module at the other end.
  • a guide strand may comprise: (i) a sequence as set out in any of SEQ IDs: 1 to 5 and 22, and (ii) a sequence having >70%, >80%, >90% , >95% or 100% identity of a sequence set out in SEQ ID NO: 6.
  • a guide strand may comprise or consist of a sequence set out in any of SEQ ID NO NOs: 10 to 12.
  • a passenger strand may comprise a sequence having >70%, >80%, >90% , >95% or 100% identity of SEQ ID NO 7, e.g. SEQ ID NO: 8.
  • the guide strand and passenger strand are annealed before use.
  • the first half of the ADAR-recruiting module may be positioned at the 5' or 3' end of the target recognition module (see Figure 8).
  • the guide strand may comprise a sequence as set out in any of SEQ ID NOs: 1 to 5 and 22 positioned at the 5' end of a sequence having >70%, >80%, >90% , >95% or 100% identity of a sequence set out in SEQ ID NO: 6.
  • the guide strand may comprise a sequence as set out in any of SEQ ID NOs: 1 to 5 and 22 positioned at the 3' end of a sequence having >70%, >80%, >90% , >95% or 100% identity of a sequence set out in SEQ ID NO: 6.
  • the compound may comprise multiple (e.g. 2, 3 or 4) ADAR-recruiting modules.
  • the first half of each of the multiple ADAR- recruiting modules may be positioned at the 5' and/or 3' ends of the target recognition module in the guide strand.
  • the first half of a first ADAR-recruiting module may be positioned on the 5' end of the target recognition module in the guide strand and the first half of a second ADAR-recruiting module may be positioned on the 3' end of the target recognition module in the guide strand (see Figure 8).
  • the compound comprises multiple passenger strands, wherein each passenger strand comprises the second half of each of the ADAR-recruiting modules.
  • the guide strand is 60 nucleotides or less (i.e. ⁇ 60 nucleotides) in length, e.g. ⁇ 55, ⁇ 50 ⁇ 45, ⁇ 40, ⁇ 35, or ⁇ 30 nucleotides.
  • the guide strand may be >15, >20, >25 or >30 nucleotides in length.
  • the passenger strand is 60 nucleotides or less in length, e.g. ⁇ 45, ⁇ 40, ⁇ 35, ⁇ 30, ⁇ 25 , ⁇ 20, or ⁇ 15 nucleotides in length. Typically, the passenger strands is 40 nucleotides or less. The passenger strand may be >20, >25 or >30 nucleotides in length.
  • the guide strand may consist of about 45 nucleotides and the passenger strand may consist of about 25 nucleotides.
  • Each of the guide and passenger strands typically comprises a phosphodiester (PO) linkage at each intemucleoside linkage.
  • PO phosphodiester
  • the termini of either strand may be protected from exonucleolytic degradation by inclusion of intemucleoside linkages, such as phosphorothioate (PS) linkages.
  • PS phosphorothioate
  • the intemucleoside linkages at the 5' and/or 3' termini of the guide strand may be phosphorothioate (PS) linkages, and the remaining intemucleoside linkages may be phosphodiester (PO) linkages, and/or the intemucleoside linkages at the 5' and/or 3' termini of the passenger strand may be phosphorothioate (PS) linkages, and the remaining intemucleoside linkages may be phosphodiester (PO) linkages.
  • PS phosphorothioate
  • PO phosphodiester
  • the guide strand may comprise >2, >3 or >4 modified internucleotide linkages (e.g. PS linkages) at the 5' terminus and/or comprise >2, >3 or >4 modified intemucleotide linkages (e.g. PS linkages) at the 3' terminus, and the remaining intemucleoside linkages may be PO linkages.
  • the passenger strand may comprise >2, >3 or >4 modified intemucleotide linkages (e.g. PS linkages) at the 5' terminus and/or comprise >2, >3 or >4 modified intemucleotide linkages (e.g. PS linkages) at the 3' terminus, and the remaining intemucleoside linkages may be PO linkages.
  • Each of the guide and passenger strand may comprise >2, >3 or >4 modified intemucleotide linkages (e.g. PS linkages) at the 5' terminus and/or comprise >2, >3 or >4 modified intemucleotide linkages (e.g. PS linkages) at the 3' terminus, and the remaining intemucleoside linkages may be PO linkages.
  • modified intemucleotide linkages e.g. PS linkages
  • the guide and/or passenger strands may comprise one or more modified intemucleotide linkages (e.g. PS linkages) internally improve stability.
  • the one or more modified intemucleotide linkages e.g. PS linkages
  • the guide and/or passenger strands may comprise a modified intemucleotide linkage (e.g. PS linkage) at each intemucleoside linkage.
  • a modified intemucleotide linkage e.g. PS linkage
  • target recognition module and the ADAR-recruiting module are provided below.
  • the target recognition module targets the compound of the invention to a specific target site.
  • the target recognition module is typically an oligonucleotide, although a small molecule (e.g. having a molecular weight of less than 900 Da), or a peptide (e.g. an antibody) may be useful with the invention.
  • a small molecule e.g. having a molecular weight of less than 900 Da
  • a peptide e.g. an antibody
  • the oligonucleotide may be a modified oligonucleotide, such as an antisense oligonucleotide.
  • the target recognition module comprises a region that is sufficiently complementary to the target nucleic acid to allow hybridisation under physiological conditions.
  • the target recognition module may be the single-stranded portion of a complex, such as a portion of the guide strand in an asymmetric duplex formed by annealing two single- stranded oligonucleotides (i.e. a guide strand and a passenger strand).
  • the target recognition module begins where the first nucleobase (in the direction from 5' to 3' end) hybridises to the target nucleic acid, and ends where the last nucleobase (in the direction from 5' to 3' end) hybridises to the target nucleic acid.
  • the target recognition module is typically single-stranded. In some instances, the target recognition module may comprise partial double-stranded regions or may be fully double-stranded.
  • the target recognition module may be up to 50, 40, 30, 20, 10 or 5 nucleotides in length.
  • the target recognition module may be at least 15, 20, 25, 30 or 35 nucleotides in length.
  • the target recognition module may be between 15 to 30 nucleotides, or between 18 to 30 nucleotides in length.
  • the target recognition module is 18 to 30 nucleotides in length.
  • the length may vary from target to target but may be routinely determined by a person having ordinary skill in the art. In general, longer sequences provide more specificity, and consequently fewer off-target effects, and stronger binding to the target site.
  • the target recognition module is partially complementary to the target site.
  • the target recognition module comprises a mismatch or a wobble nucleobase opposite the nucleoside to be edited (e.g. adenosine if the RNA editing enzyme is ADAR), when the target recognition module is aligned with the target nucleic acid.
  • a mismatch base pair is A-C, and hence the nucleobase in the target recognition module opposite the adenosine targeted for RNA editing is a C.
  • the mismatch base pair is A-A or A-G, and hence the nucleobase in the target recognition module opposite the adenosine to be edited is an A or G.
  • the target recognition module is typically fully complementary to the target nucleic acid over the entire length of the target recognition module except for the mismatch nucleobase opposite the adenosine to be edited.
  • the target recognition module may comprise one or more (e.g. ⁇ 5, ⁇ 4, ⁇ 3, ⁇ 2 or 1) further mismatch nucleobases when aligned with the target nucleic acid, except at the first and last nucleobase (direction from 5' to 3' end) of the target recognition module.
  • the target recognition module may comprise >2, >3, >4, >5, >6, >7, >8, >9, >10, >11, >12, >13, >14, >15, >16, >17, >18, >19, and/or >20 contiguous nucleobases that are complementary to their opposing nucleobases in the target nucleic acid.
  • the target recognition module may comprise ⁇ 5, ⁇ 4, ⁇ 3, ⁇ 2 or 1 nucleobases that form wobble base pairs with the opposing nucleobases in the target nucleic acid.
  • the target recognition module may comprise at least one modified nucleoside (e.g. at least one modified sugar moiety and/or at least one modified nucleobase moiety) and/or at least one modified internucleoside linkage, as described further below.
  • modified nucleoside e.g. at least one modified sugar moiety and/or at least one modified nucleobase moiety
  • modified internucleoside linkage as described further below.
  • the target recognition module comprises ribonucleotides at the positions opposite the adenosine to be edited and the two nucleoside on either side (i.e. 5' and 3' side) of it, and the remaining of the target recognition module may comprise at least one modified nucleoside (e.g. at least one modified sugar moiety and/or at least one modified nucleobase moiety) and/or at least one modified internucleoside linkage.
  • the target recognition module comprises ribonucleotides at the positions opposite the adenosine to be edited and the two nucleoside on either side (i.e. 5' and 3' side) of it, and the remaining of the target recognition module may comprise at least one modified nucleoside (e.g. at least one modified sugar moiety and/or at least one modified nucleobase moiety) and/or at least one modified internucleoside linkage.
  • the target recognition module may comprise: (a) 2'-OH in the sugar moiety at the nucleoside opposite to the adenosine to be edited and at the two adjacent nucleosides (i.e. one on 5' and one on 3' of said nucleoside), and (b) a modified sugar moiety, e.g. 2'OMe, at each of the remaining nucleosides in the target recognition module.
  • the target recognition module may be over 50 nucleotides in length, also referred to herein as a long RNA (e.g. between 50 and 200 nucleotides in length).
  • the long RNA may be expressed from plasmid or viral vectors, or provided as a synthetic oligonucleotide.
  • the long RNA may comprise a mismatched base at the site of desired RNA editing (e.g. an A:C mismatch if the RNA editing enzyme is ADAR). Typically, the site of the mismatch will be approximately positioned within the middle of the long RNA.
  • the long RNA may comprise further mismatched bases throughout the sequence of the long RNA when the target recognition module is aligned with the target nucleic acid.
  • the long RNA may comprise A:G mismatches between the target: long RNA at adenosines for which editing may be undesirable, to minimise off-target editing. Synthetic long RNAs may be subject to the chemical modifications described herein.
  • the target recognition module is capable of binding (e.g. hybridising) to a target site comprising a nucleoside to be edited, e.g. an adenosine if the RNA editing enzyme is ADAR.
  • the target site is in a RNA transcript.
  • the RNA transcript is typically a mature messenger RNA (mRNA), but may also be a precursor mRNA (pre-mRNA).
  • the pre- mRNA may have undergone partial splicing, i.e. a partially processed mRNA transcript.
  • the target site is typically in the 5' UTR of a RNA transcript, although targeting anywhere along the RNA transcript is also useful with the invention.
  • the compound of the invention may target an upstream open reading frame (uORF).
  • uORF upstream open reading frame
  • the invention may comprise a step of identifying an uORF, such as a potent uORF, comprising one or more of the features described below.
  • the uORF may be anywhere in the 5' UTR.
  • the uORF to be targeted may be within 500 nucleotides upstream of the pORF.
  • the uORF may be ⁇ 400, ⁇ 300, ⁇ 200, ⁇ 100, ⁇ 90, ⁇ 80, ⁇ 70, ⁇ 60, ⁇ 50, ⁇ 30, ⁇ 20, ⁇ 10, ⁇ 5 nucleotides upstream of the pORF start codon.
  • the uORF is within 100 nucleotides upstream of the pORF.
  • the uORF may be the most proximal uORF to the pORF, when multiple uORFs are present in the 5' UTR of the RNA transcript.
  • the uORF may overlap with the pORF.
  • the uORF may comprise a Kozak sequence.
  • the Kozak sequence may be a strong Kozak sequence comprising guanine at the +4 position and a purine at the -3 position (relative to the first nucleoside of the start codon, e.g. A of the AUG start codon).
  • the Kozak sequence may be a weak Kozak sequence comprising a purine at the -3 position but not a guanine at the +4 position (relative to the first nucleoside of the start codon, e.g. A of the AUG start codon), and vice versa.
  • the Kozak sequence may be a weak Kozak sequence which lacks both a purine at the -3 position and a guanine at the +4 position (relative to the first nucleoside of the start codon, e.g. A of the AUG start codon)
  • the uORF may be of any length.
  • the uORF to be targeted may comprise
  • the uORF comprises ⁇ 5, ⁇ 4, ⁇ 3, ⁇ 2, 1, or 0 codons between the start codon and the stop codon.
  • the uORF may comprise a higher percentage composition of acidic and basic amino acids as compared to aromatic hydrophobic amino acids.
  • the uORF to be targeted may be present naturally in the RNA transcript.
  • the uORF may be introduced by non-canonical and/or ectopic splicing events, or by mutations.
  • SNP single nucleotide polymorphism
  • a new upstream start codon e.g. the genes listed in Table 5.
  • upstream start and stop codons are particularly effective targets for modulating protein expression of the downstream pORF.
  • uORF start codons e.g. in an uORF of a RNA transcript
  • the target site may comprise an upstream start codon (i.e. a start codon upstream of the start codon of the pORF), e.g. a start codon of an uORF of a RNA transcript.
  • the upstream start codon may be edited by any RNA editing enzyme, e.g. ADAR. Examples of start codons and the consequently ADAR-edited codons are illustrated in Table 1.
  • Editing of one or more nucleosides in the start codon leads to abrogation of the translation initiation potential of the uORF start codon and hence the silencing of the uORF.
  • the loss of uORF translation leads to de-repression of the downstream primary open reading frame (pORF), as shown in the Examples.
  • the invention provides a method of disrupting the start codon of an uORF in a RNA transcript, comprising delivering to a cell at least one compound comprising a target recognition module and an RNA editing enzyme-recruiting module, wherein the target recognition module is capable of targeting the compound to the uORF start codon, such that editing of the target sequence by the RNA editing enzyme results in the disruption of the start codon.
  • the method may be a method of increasing the expression of a target protein. The method may comprise any of the steps described herein.
  • the invention also provides a compound for site-directed RNA editing of a start codon in an uORF of a RNA transcript, comprising a target recognition module and an RNA editing enzyme-recruiting module, wherein the target recognition module is capable of targeting the compound to the uORF start codon, and editing of the target nucleic acid by the RNA editing enzyme results in the disruption of the start codon.
  • the disruption of an upstream start codon is expected to induce translational de-repression of the downstream pORF.
  • the compound may comprise any of the features described herein.
  • the RNA editing enzyme may be ADAR.
  • the target recognition module targeting the start codon of the uORF may comprise or consist of the sequence:
  • N is any nucleoside, or modified nucleoside thereof
  • M is cytidine (C), guanosine (G) or adenosine (A); or modified nucleoside thereof
  • X is cytidine (C), adenosine (A) or guanosine (G); or modified nucleoside thereof
  • a is 0 to 25
  • b is 0 to 25.
  • M is opposite to the adenosine to be edited.
  • M in SEQ ID NO: 1 and the two adjacent nucleosides i.e. the nucleoside on the 5' of M and the nucleoside on the 3' of M
  • the target recognition module targeting the start codon of the uORF may comprise or consist of the sequence: 5'-[N] a N 1 XAMN 2 N 3 N 4 [N] b -3' (SEQ ID NO: 1) where:
  • N is any nucleoside, or modified nucleoside thereof
  • M is cytidine (C), guanosine (G) or adenosine (A); or modified nucleoside thereof;
  • X is cytidine (C), adenosine (A) or guanosine (G); or modified nucleoside thereof; a is 0 to 25; and b is 0 to 25.
  • M is opposite to the adenosine to be edited.
  • the uORF may comprise a Kozak sequence.
  • the Kozak sequence may be a strong Kozak sequence comprising guanine at the +4 position and a purine at the -3 position (relative to A of the AUG start codon).
  • N 1 is cytidine (C) and N 4 is Y, where Y is cytidine (C) or uridine (U).
  • the Kozak sequence may be a weak Kozak sequence comprising guanine at the +4 position (relative to A of the AUG start codon).
  • N 1 is cytidine (C).
  • the Kozak sequence may be a weak Kozak sequence comprising a purine at the -3 position (relative to A of the AUG start codon).
  • N 4 is Y, where Y is cytidine (C) or uridine (U).
  • N 1 and N 4 may be independently any nucleoside, or modified nucleoside thereof.
  • X in SEQ ID NO: 1 is cytosine (C).
  • X in SEQ ID NO: 1 is adenosine (A).
  • X in SEQ ID NO: 1 is guanosine (G).
  • M in SEQ ID NO: 1 and the two adjacent nucleosides may comprise 2'-OH in the sugar moiety and each of the remaining nucleosides in SEQ ID NO: 1 may comprise 2'-OMe in the sugar moiety.
  • Each of the intemucleoside linkages in SEQ ID NO: 1 may be a phosphodi ester (PO) linkage.
  • Each of the intemucleoside linkages in SEQ ID NO: 1 may be phosphorothioate (PS) linkage.
  • At least two (e.g. >2, >3 or >4) intemucleotide linkages at the 5' terminus may be phosphorothioate (PS) linkages and/or at least two (e.g. >2, >3 or >4) intemucleotide linkages at the 3' terminus may be phosphorothioate (PS) linkages, and the remaining intemucleoside linkages may be phosphodiester (PO) linkages.
  • the invention also provides a modified RNA transcript comprising the absence of an upstream start codon in the 5' UTR compared to the unmodified RNA transcript. uORF stop codon
  • the target site may comprise a stop codon in an uORF of a RNA transcript.
  • Examples of stop codons and the consequently ADAR-edited codons are illustrated in Table 2.
  • N is any nucleoside
  • M is cytidine (C), guanosine (G) or adenosine (A); or modified nucleoside thereof; a is 0 to 25; b is 0 to 25. M is opposite to the adenosine to be edited. Editing of one or more nucleosides in the stop codon (e.g. by ADAR) leads to abrogation of the translation termination potential of the uORF stop codon, hence the extension of the uORF and enhancement of the repression of the downstream pORF.
  • C cytidine
  • G guanosine
  • A adenosine
  • the invention provides a method of disrupting the stop codon of an uORF in a RNA transcript, comprising delivering to a cell at least one compound comprising a target recognition module and an RNA editing enzyme-recruiting module, wherein the target recognition module is capable of targeting the compound to the uORF stop codon, such that editing of the target sequence by the RNA editing enzyme results in the disruption of the stop codon.
  • the method may be a method of decreasing the expression of a target protein. The method may comprise any of the steps described herein.
  • the invention also provides a compound for site-directed RNA editing of a stop codon in an uORF of a RNA transcript, comprising a target recognition module and an RNA editing enzyme-recruiting module, wherein the target recognition module is capable of targeting the compound to the uORF stop codon, and editing of the target sequence by the RNA editing enzyme results in the disruption of the stop codon.
  • the disruption of an upstream stop codon is expected to enhance translational repression of the downstream pORF.
  • the compound may comprise any of the features described herein.
  • the RNA editing enzyme may be ADAR.
  • the invention also provides a modified RNA transcript comprising the absence of an upstream stop codon in the 5' UTR compared to the unmodified RNA transcript.
  • the target site may comprise a ATA trinucleotide in the 5' UTR of a RNA transcript.
  • the ATA trinucleotide is converted to ATI by ADAR. This is read as ATG for translational purposes, and hence an additional start codon is introduced in the 5' UTR.
  • an upstream AUG may interfere with translation of the downstream primary ORF, and hence resulting in translational repression of the downstream primary ORF.
  • the invention provides a method of introducing an upstream start codon in the 5' UTR of a RNA transcript, comprising delivering to a cell at least one compound comprising a target recognition module and an RNA editing enzyme-recruiting module, wherein the target recognition module is capable of targeting the compound to the 5' UTR, such that editing of the target sequence by the RNA editing enzyme results in the creation of an upstream start codon in the 5' UTR.
  • the method may be a method of reducing the expression of a target protein.
  • the method may comprise any of the steps described herein.
  • the invention also provides a compound comprising a target recognition module and an RNA editing enzyme-recruiting module, wherein the target recognition module is capable of targeting the compound to the 5' UTR of a RNA transcript, such that the editing of the target sequence by the RNA editing enzyme results in the creation of an upstream start codon in the 5' UTR.
  • the introduction of a novel uORF is expected to induce translational repression of the downstream pORF.
  • the compound may comprise any of the features described herein.
  • the RNA editing enzyme may be ADAR.
  • the RNA editing enzyme may be ADAR, and the target site comprises a ATA trinucleotide in the 5' UTR.
  • the RNA transcript may comprise no uORF.
  • the RNA transcript may comprise one or more uORFs.
  • the target recognition module targeting an ATA trinucleotide in the 5' UTR of a RNA transcript may comprise or consist of the sequence:
  • N is any nucleoside or modified nucleoside thereof; M is cytidine (C) or adenosine (A); or modified nucleoside thereof; a is 0 to 25; b is 0 to 25. M is opposite to the adenosine to be edited.
  • the invention also provides a modified RNA transcript comprising the presence of an upstream start codon in the 5' UTR compared to the unmodified RNA transcript. Any adenosine-containing codon
  • the invention is also useful for editing any adenosine in a RNA transcript, e.g. by ADAR.
  • the adenosine may be part of codon, i.e. an adenosine-containing codon, e.g. see Table 3.
  • RNA-editing enzyme is typically ADAR, although other RNA-editing enzymes, such as ribozymes, are also useful with the invention.
  • the compound of the invention typically comprises an ADAR-recruiting module.
  • the ADAR-recruiting module selectively binds with sufficient affinity to ADAR that is naturally present in the cell.
  • the ADAR may be hADAR1, hADAR2, and any isoforms thereof such as hADARl pi 10 and pl50.
  • the ADAR may be hADAR1, and the ADAR-recruiting module may specifically and selectively recruit hADAR1.
  • the ADAR-recruiting module is typically an oligonucleotide (e.g. a double- stranded oligonucleotide or an aptamer (e.g. an ADAR-binding aptamer)), although it may be a small molecule (e.g. having a molecular weight of less than 900 Da) or a peptide (e.g. an antibody, such as a nanobody or a Fab fragment).
  • the ADAR-recruiting module may be a modified oligonucleotide.
  • the ADAR-recruiting module may be a double-stranded oligonucleotide.
  • the double-stranded oligonucleotide is typically formed by two single-stranded oligonucleotides, which are referred to herein as a guide strand and a passenger strand.
  • double-stranded ADAR-recruiting module that resembles the Glu2 double- stranded binding domain substrate are also useful with the invention.
  • the double-stranded ADAR-recruiting modules described in references 3, 4 and 5, are useful with the invention.
  • the guide strand may comprise a sequence having >70%, >80%, >90%, >95% or 100% identity with any one of SEQ ID NOs: 13 to 21.
  • An ADAR-recruiting module begins where the first nucleobase (in the direction from 5' to 3' end) in the guide strand hybridises with the passenger strand, and ends where the last nucleobase (in the direction from 5' to 3' end) guide strand hybridises with the passenger strand.
  • the ADAR-recruiting module may comprise a guide strand comprising a sequence having >70%, >80%, >90%, >95% or 100% identity with SEQ ID NO: 6 (5'- AUGUUGUUCUCGUCUCCUCGAC ACC-3').
  • the ADAR-recruiting module may comprise a passenger stand comprising a sequence having >70%, >80%, >90%, >95% or 100% identity with SEQ ID NO: 7 (5 '-GGUGUCGAGGAGACGAGAAC AAC AU-3 ').
  • the ADAR-recruiting module may comprise a guide strand comprising a sequence having >70%, >80%, >90%, >95% or 100% identity with SEQ ID NO: 6 and a passenger stand comprising a sequence having >70%, >80%, >90%, >95% or 100% identity with SEQ ID NO: 7.
  • the ADAR-recruiting module may comprise a guide strand comprising or consisting of SEQ ID NO: 6 and a passenger strand comprising or consisting of SEQ ID NO: 7.
  • the guide strand and the passenger stand when aligned, may comprise mismatch and/or wobble base pairs, provided that the two strands are capable of forming a double- stranded oligonucleotide.
  • the guide strand and the passenger stand when aligned, may comprise ⁇ 5, ⁇ 4, ⁇ 3, ⁇ 4, or 1 mismatch base pairs.
  • the guide strand and the passenger stand, when aligned, may comprise ⁇ 5, ⁇ 4, ⁇ 3, ⁇ 4, or 1 wobble base pairs.
  • the guide strand and the passenger stand, when aligned, may comprise a mismatch and/or wobble base pairs at one or more of positions 10, 14 and 23 relative to the 5' terminus of the passenger strand.
  • the guide strand may comprise a sequence having SEQ ID NO: 6 and the passenger strand may comprise a sequence having SEQ ID NO: 8 (5'- GGU GU C GAGA AGAG GAGA AC A AU AU -3 ') .
  • the ADAR-recruiting module may comprise up to 50, 45, 40, 35 or 30 base pairs.
  • the ADAR-recruiting module may comprise at least 20, 25 or 30 base pairs.
  • the ADAR-recruiting module may comprise between 20 to 30 base pairs.
  • the ADAR- recruiting module may comprise or consist of 25 base pairs in length.
  • the ADAR-recruiting module does not comprise a stem loop.
  • the ADAR-recruiting module does not comprise a sequence that is capable of folding back upon itself over at least part of its length.
  • the ADAR-recruiting module does not comprise the Glur2 hairpin loop sequence consisting of GCUMA (SEQ ID NO: 5), where M is A or C.
  • GCUMA GCUMA
  • M A or C.
  • RNA editing by ADAR was surprisingly successful using oligonucleotides that do not contain the pentaloop structure in the ADAR-recruiting module, and so they concluded that this pentaloop structure is not essential for ADAR recruitment.
  • the ADAR-recruiting module comprises a stem loop.
  • the double-stranded oligonucleotide may be formed by a palindromic sequence that is capable of folding back upon itself over at least part of its length.
  • the ADAR- recruiting module may comprise the Glur2 hairpin loop sequence consisting of GCUMA (SEQ ID NO: 9), where M is A or C.
  • the ADAR-recruiting module may comprise at least one modified nucleoside (e.g. at least one modified sugar moiety and/or at least one modified nucleobase moiety) and/or at least one modified internucleoside linkage, as described further below.
  • the ADAR-recruiting module typically comprises RNA (2'-OH in the sugar moiety).
  • the passenger and/or guide strand may comprise a modified sugar moiety, e.g. 2'-H, 2'-MOE, LNA, 2'-Fluoro or 2'-OMethyl in the sugar moiety.
  • each nucleotide in the guide strand may comprise 2 ⁇ H in the sugar moiety and each nucleotide in the passenger strand may comprises a modified sugar moiety, e.g. 2'-H, 2'-MOE, LNA, 2'-Fluoro or 2'-OMethyl in the sugar moiety.
  • a modified sugar moiety e.g. 2'-H, 2'-MOE, LNA, 2'-Fluoro or 2'-OMethyl in the sugar moiety.
  • oligonucleotides discussed herein may be modified oligonucleotides. Modifications to the oligonucleotide are well known to the skilled person to impart useful properties, e.g. increase the biological stability of the molecules (e.g. nuclease resistance), enhance target binding, increase tissue uptake and/or increase the physical stability of the duplex formed between the oligonucleotide and target nucleic acids (e.g. see reference 8).
  • useful properties e.g. increase the biological stability of the molecules (e.g. nuclease resistance), enhance target binding, increase tissue uptake and/or increase the physical stability of the duplex formed between the oligonucleotide and target nucleic acids (e.g. see reference 8).
  • the oligonucleotide may comprise DNA, RNA, and/or nucleotide analogues.
  • the nucleotide analogues may be peptide nucleic acid (PNA), FANA, DANA, LNA and other branched nucleic acids (ENA, cEt), phosphorodiamidate morpholino oligomer (PMO), and/or tricyclo DNA.
  • the oligonucleotide may comprise an abasic site, i.e. the absence of a purine (adenine and guanine) or a pyrimidine (thymine, uracil and cytosine) nucleobase.
  • the oligonucleotide may comprise a 3' to 5' phosphodiester (PO) linkage as naturally found in DNA or RNA.
  • the oligonucleotide may comprise a modified intemucleoside linkage, e.g. a phosphotriester linkage, a phosphorothioate (PS) linkage, a boranophosphate linkage, a phosphorodiamidate linkage, a phosphoamidate linkage, and/or a thiophosphoramidate linkage.
  • the modified intemucleoside linkage may be other modifications known in the art.
  • the oligonucleotide may comprise one or more asymmetric centers and thus give rise to enantiomers, diasteromers, and other stereoisomeric configurations, e.g. R, S.
  • stereochemistry may be constrained at one or more modified intemucleoside linkages.
  • the oligonucleotide may comprise repeated left-left-right (or SSR) chiral PS centers.
  • the oligonucleotide may comprise a sugar moiety as found in naturally occurring RNA (i.e. a ribofuranosyl) or a sugar moiety as found in naturally occurring DNA (i.e. a deoxyribofuranosyl).
  • the oligonucleotide may comprise a modified sugar moiety, i.e. a substituted sugar moiety or a sugar surrogate.
  • Substituted sugar moiety moieties include furanosyls comprising substituents at the 2'-position, the 3'-position, the 5'-position and/or the 4'-position.
  • a substituted sugar moiety may be a bicyclic sugar moiety (BNA).
  • Sugar surrogates include morpholino, cyclohexeynl and cyclohexitol.
  • the modified sugar moiety may comprise a 2'-O-methyl, 2'-O-methoxyethyl (2'-O- MOE), 2'-O-aminopropyl, 2'-deoxy, 2'-O- propyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O- dimethylaminoethyloxyethyl (2'O-DMAEOE), or 2'O-N-methylacetoamido ( 2'O-NMA) modification or a locked or bridged ribose conformation (e.g. LNA or ENA).
  • the modified sugar moiety may comprise other modifications known in the art.
  • the oligonucleotide may comprise a terminal modification at its 5' and/or 3' end, such as a vinyl phosphonate, and/or inverted terminal bases.
  • the oligonucleotide may comprise a nucleobase as found in naturally occurring RNA and DNA (i.e. adenine (A), thymine (T), uracil (U), guanine (G), cytosine (C), inosine (I), and 5-methyl C).
  • the oligonucleotide may comprise a modified nucleobase, e.g. 5-hyrdoxymethylcytosine, 5-formylcytosine, and 5-carboxycytosine. The inclusion of 5 'methyl cytosine may enhance base pairing by modifying the hydrophobic nature of the oligonucleotide.
  • the oligonucleotide may comprise a single type of nucleic acid chemistry (e.g. full PS-MOE, or full PMO) or combinations of different nucleic acid chemistries.
  • each of the sugar moieties in the oligonucleotide may comprise a 2'- O-methoxyethyl (2'-MOE) modification and each of the internucleoside linkages may be a phosphorothioate (i.e. a fully PS-MOE oligonucleotide).
  • PS modifications are known to result in resistance to a broad spectrum of nucleases and increase protein binding, which also improves tissue uptake (8,9).
  • 2'-MOE modifications are known to enable enhanced binding affinity to the target mRNA with minimal toxicity and reduce plasma protein binding.
  • the oligonucleotide may be a fully phosphorodiamidate morpholino oligomer (PMO). Morpholinos are known to provide greater target affinity and facilitate nuclease avoidance (10).
  • the oligonucleotide may comprise a combination of PO and PS intemucleoside linkages. This may facilitate the fining tuning of the pharmacokinetics of the oligonucleotide.
  • the oligonucleotide may be constructed using chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. Exemplary methods can include those described in reference 11,12,13,14,15,16,17 or 18.
  • the oligonucleotide may be produced biologically using an expression vector into which the oligonucleotide is subcloned in an antisense orientation (i.e., RNA transcribed from the inserted oligonucleotide will be of an antisense orientation to the target nucleic acid of interest).
  • an antisense orientation i.e., RNA transcribed from the inserted oligonucleotide will be of an antisense orientation to the target nucleic acid of interest.
  • a compound described herein may be conjugated to one or more further compounds, such as a nucleic acid molecule, a peptide, or other chemicals for the purpose of improving targeting (e.g. to a specific tissue, cell type, or cell developmental stage), improving cell penetration (e.g. delivery), improving endosomal escape, improving sub- cellular localisation, improving activity and/or promoting recruitment of a cellular protein.
  • the compounds may be conjugated by any means known in the art, e.g. they may be chemically attached to the further compound via cleavable or non-cleavable linkers.
  • the compound may be conjugated to the guide strand and/or the passenger strand.
  • a conjugated compound of the invention may comprise a compound described herein conjugated to a further compound described herein.
  • Each of the compounds in the conjugated compound may target a different site on the same RNA transcript.
  • the further compound may be a peptide, such as a cell penetrating peptide, a protein transduction domain, a targeting peptide, a endosomolytic peptide.
  • the further compound may be a small molecule ligand (e.g. having a molecular weight of less than 900 Da).
  • the further compound may be an antibody, e.g. nanobody, Fab fragment.
  • the further compound may be a sugar-based ligand, e.g. GalNAc, or its derivatives).
  • the further compound may be a lipid-based ligand, e.g. cholesterol, lipidoid, lipidlike conjugate, lipophilic molecule.
  • the further compound may be a polymer (e.g. PEI, dendrimer).
  • the further compound may be a polyethylene glycol, a click-reactive group or an endosomolytic group (e.g. chloroquine or its derivatives).
  • the further compound may be a RNA molecule.
  • the compound of the invention may be combined as part of a platform molecule, e.g. a dynamic polyconjugate.
  • the compound of the invention may be conjugated to a delivery vehicle.
  • the invention also provides a delivery vehicle comprising the compound of the invention.
  • the delivery vehicle may be capable of site-specific, tissue-specific, cell-specific or developmental stage-specific delivery.
  • the delivery vehicle may comprise a lipid-based nanoparticle, a cationic cell penetrating peptide (CPP), a linear or branched cationic polymer, or a bioconjugate, such as cholesterol, bile acid, lipid, peptide, polymer, protein, or an aptamer.
  • CPP cationic cell penetrating peptide
  • bioconjugate such as cholesterol, bile acid, lipid, peptide, polymer, protein, or an aptamer.
  • the delivery vehicle may comprise an antibody, or part thereof.
  • the antibody may be specific for a cell surface marker on the cells of interest for delivery of the compound of the invention to the specific cells.
  • the specific cells may be beta cells in the pancreas, thymic cells, malignant cells, and/or pre-malignant cells (e.g. pre-leukaemias and myelodysplastic syndromes or histopathologically defined precancerous lesions or conditions).
  • the delivery vehicle may comprise a cell penetrating peptide (CPP).
  • CPP cell penetrating peptide
  • Suitable CPPs are known in the art, e.g. as described in reference 19.
  • the CPP may be an arginine and/or lysine rich peptide.
  • the CPP may comprise a poly-L-lysine (PLL) and/or a poly-arginine.
  • the CPP may comprise a Pip peptide.
  • the delivery vehicle may comprise a peptide-based nanoparticle (PBN), wherein a plurality of CPPs form a complex with the polynucleic acid polymer through charge interactions.
  • PBN peptide-based nanoparticle
  • the compound of the invention may be complexed with (e.g. by ionic bonding) or covalently bound to a delivery vehicle.
  • Suitable conjugation methods are known in art, e.g. as described in reference 20.
  • a conjugation method may comprise introducing a suitable tether containing a reactive group (e.g. -ME or -SH2) to the compound of the invention and to the delivery vehicle (e.g. a peptide) post-synthetically as an active intermediate, followed by carrying out the coupling reaction in aqueous medium.
  • An alternative method may comprise carrying out the conjugation in a linear mode on a single solid-phase support.
  • the invention also provides one or more polynucleotides (DNA) encoding compounds or conjugated compounds described herein.
  • the polynucleotide sequence is collectively present on more than one polynucleotide, but collectively together they are able to encode a compound of the invention.
  • the polynucleotides may encode the guide strand and/or passenger strand of a compound of the invention.
  • one polynucleotide molecule would encode each of the guide and passenger strands.
  • polynucleotides can be obtained by methods well known to those skilled in the art.
  • General methods by which the vectors may be constructed, transfection methods and culture methods are well known to those skilled in the art, e.g. see 21.
  • a polynucleotide of the invention may be provided in the form of an expression cassette, which includes control sequences operably linked to the inserted sequence, thus allowing for expression of the oligonucleotide or conjugated oligonucleotide of the invention in vivo.
  • the invention also provides one or more expression cassettes encoding the one or more polynucleotides that encoding a compound or conjugated compound described herein. These expression cassettes, in turn, are typically provided within vectors.
  • the invention provides one or more vectors encoding a compound or conjugated compound described herein.
  • the vector may be cloning vector (e.g. a plasmid) or expression vector.
  • the vector may be a viral vector, such as an adeno-associated viral vector (AAV) or lentiviral vector.
  • AAV adeno-associated viral vector
  • the vector may comprise any virus that targets the oligonucleotide or conjugated oligonucleotide according to the invention to a specific cell type.
  • the polynucleotide, expression cassette or vector of the invention is introduced into a host cell.
  • the invention also provides a host cell comprising one or more polynucleotides, expression cassettes or vectors of the invention.
  • the polynucleotides, expression cassettes or vectors of the invention may be introduced transiently or permanently into the host cell, allowing expression of an oligonucleotide or conjugated oligonucleotide from the expression cassette or vector.
  • the invention provides a composition
  • a composition comprising a compound (e.g. an antisense oligonucleotide), a conjugated compound (e.g. a conjugated antisense oligonucleotide), a polynucleotide or a vector of the invention.
  • the composition may comprise a combination (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) of the compounds of the invention.
  • composition may be a pharmaceutical composition.
  • a pharmaceutical composition of the invention may comprise a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials are typically non-toxic and does not interfere with the efficacy of the active ingredient.
  • the precise nature of the carrier or other material may be determined by the skilled person according to the route of administration.
  • the pharmaceutical composition comprises a sterile saline solution (e.g. PBS) and one or more antisense compounds of the invention.
  • a sterile saline solution e.g. PBS
  • PBS sterile saline solution
  • composition of the invention may include one or more pharmaceutically acceptable salts, esters or salts of such esters.
  • a pharmaceutically acceptable salt refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects. Examples of such salts include sodium or potassium salts.
  • the compound of the invention may be in the form of a prodrug.
  • the prodrug may include the incorporation of additional nucleosides at one or both ends of an oligonucleotide which are cleaved by endogenous nucleases when administered, to form the active compound.
  • the pharmaceutical composition may comprise lipid moieties.
  • the oligonucleotide of the invention is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • the lipid moiety may be selected to increase distribution of the oligonucleotide to a particular cell or tissue, e.g. fat tissue or muscle tissue.
  • the pharmaceutical composition may comprise a compound and one or more excipients.
  • the excipient may be water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and/or polyvinylpyrrolidone.
  • the pharmaceutical composition may comprise a delivery system, such as liposomes and emulsions.
  • a delivery system such as liposomes and emulsions.
  • organic solvents such as dimethylsulfoxide are used.
  • the pharmaceutical composition may comprise one or more tissue-specific delivery molecules designed to deliver the one or more compounds of the invention to specific tissues or cell types.
  • the delivery molecule may comprise liposomes coated with a tissue-specific antibody.
  • a vector may be included in a pharmaceutical composition which is formulated for slow release, such as in microcapsules formed from biocompatible polymers or in liposomal carrier systems according to methods known in the art.
  • compositions of the invention may comprise additional active agents, for example a drug or a pro-drug.
  • the pharmaceutical composition may be formulated to be administered by any administration route, e.g. as described herein.
  • the pharmaceutical composition is typically administered by injection.
  • the pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • aqueous solution such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • the invention also relates to the methods and uses of the compound, conjugated compound, polynucleotide or vector encoding the compound, or the composition described herein.
  • the methods and uses of the invention may be non-therapeutic or therapeutic, as explained further below.
  • the invention further relates to the use of the compound, conjugated compound, polynucleotide or vector encoding the compound, or the composition described herein, e.g. in a method of therapy practiced on the human or animal body.
  • the invention relates to a method of treating or preventing a disease or condition in a subject by modulating the expression of a protein, comprising administering to the subject a therapeutically effective amount of the compound or the composition of the invention.
  • the invention also relates to the use of the compound or the composition of the invention in the manufacture of a medicament for the treatment or prevention of a disease or condition in a subject by modulating the expression of a protein.
  • the invention also relates to the compound or the composition of the invention for use in a method of treating or preventing a disease or condition in a subject by modulating the expression of a protein.
  • the methods and uses of the invention may comprise inhibiting the disease state, e.g. arresting its development; and/or relieving the disease state, e.g. causing regression of the disease state until a desired endpoint is reached.
  • the methods and uses of the invention may comprise the amelioration or the reduction of the severity, duration or frequency of a symptom of the disease state (e.g. lessen the pain or discomfort), and such amelioration may or may not be directly affecting the disease.
  • the invention relates to a method of treating or preventing a disease listed in Table 4 or 5.
  • the methods and uses of the invention comprise administering to the subject a therapeutically effective amount of the compound or the composition of the invention a compound of the invention, wherein the compound is targeted to the RNA transcript of the respective gene listed in Table 4 or 5.
  • RNA transcript may be encoded by a uORF-containing gene, such as: ABCA1, ABCB11, ABCC2, ABCG5, ADAM10, ALB, ANK1, APOE, ATP2A2, ATP7B, ATRX, ATXN1, ATXNIL, BAX, BCL2L11, BDNF, BLM, BRCA1, C/EBPa, CA2, CASP8, CCBE1, CD36, CD3D, CDKN1B, CDKN2A, CEP290, CFH, CFTR, CHRNA4, CHRNA5, CNTF, CNTFR, COL1A1, CR1, CSPP1, CTNND2, CTNS, CYP1B1, DBT, DCAF17, DNASE 1, DDIT3, DICERl, DRD3, EED, EFNB1, EPO, ESR1, ETHE1, EZH2, F8 (andF2, 3, 5, 7, 11, 13), FAP, FMR1, FNDC5, FXN, GALNS, GATA3, GBA, G
  • RNA transcript may be encoded by a gene with mutations or SNPs that create uORFs, such as: ATP7B, ATRX, BLM, BRCA1,CA2, CCBE1, CD3D, CD4, CDKN2A, CFL2, CFTR, CSPP1, CTNS, DBT, DCAF17, DCLREIC, DFNB31, DLG4, DMD, DNASE1, ETHE1, GALNS, GCH1, HAMP, HBB, HMBS, HR, IGHMBP2, IRF6, ITGAZ, ITGB2, KCNJ11, KCNQ3, LDLR, LRP5, LRP5L, MECP2, MLH1, MSH6, MUTYH, NR5A1, PALB2, PANK2, PEX7, PHYH, PIK3R5, POMC, POMT1, ROR2, SCN2A, SGCA, SGCD, SLC16A1, SLC19A3, SLC2A2, SLC7A9, SPINK1, SRY, STIL,
  • RNA transcript may be encoded by HOXA11, RNASEH1, SCNIA, BRD3, FOXL2, JUN, KDR, SMO, SRY.
  • MAP2K2, BDNF, C9orf72, GATA2, GDNF or HTT may be encoded by HOXA11, RNASEH1, SCNIA, BRD3, FOXL2, JUN, KDR, SMO, SRY.
  • the methods and uses of the invention may comprise a step of annealing the guide strand and passenger strand prior to use.
  • the guide and passenger strands are mixed in equimolar amounts and heated to 90 °C (e.g. for 5 minutes) and then allowed to cool to room temperature to allow annealing.
  • Annealed oligonucleotides are typically stored at -20 degrees until ready for use, or -80 degrees for long-term storage. Storing the annealed oligonucleotides at room temperature is to be avoided.
  • the methods and uses of the invention may be in vitro , ex vivo or in vivo.
  • the invention also provides an in vitro method of site-directed editing of the 5' UTR in a RNA transcript, comprising delivering to a cell at least one compound comprising a target recognition module and an RNA editing enzyme-recruiting module, wherein the target recognition module targets the compound to a target site in the 5' UTR, such that one or more nucleosides in the 5' UTR are edited by the RNA editing enzyme.
  • the method or use of the invention is not a treatment of the human or animal body by surgery or therapy and is not a diagnostic method practised on the human or animal body.
  • the methods and uses of the invention may comprise increasing, decreasing, or restoring the expression of a protein of interest by the site-directed editing method described herein.
  • the invention also provides a method of increasing, decreasing, or restoring the amount or activity of a target protein, comprising a method of site-directed editing of a RNA transcript as described herein.
  • the protein expression may be increased by >50% ⁇ i.e. 50 % or more), >60%, >70%, >80%, >90%, >100% or >200% compared to the protein expression in subjects where splicing has not been modulated.
  • the protein expression may be reduced by >50% (i.e. 50% or more), >60%, >70%, >80%, >90% or 100% compared to the protein expression in subjects where splicing has not been modulated.
  • the methods and uses of the invention may include a step of determining the expression and/or activity level of the RNA transcript which is modulated by splicing (e.g. mature mRNA) and/or the protein in a sample from the patient.
  • Methods of determining the expression and/or activity levels of RNAs and proteins are known in the art.
  • RNA from a sample may be isolated and tested by hybridisation or PCR techniques as known in the art.
  • protein expression assays can be performed in vivo, in situ , i.e. directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary. Immunoassays may also be used.
  • the RNA transcript may be encoded by a gene listed in Table 4 or 5.
  • the diseases associated with each gene in Table 4 is treated by the methods of the invention using a compound of the invention targeting the RNA transcript of the respective gene.
  • the invention relates to methods and uses for a human subject in need thereof.
  • non-human animals such as mice, rats, rabbits, sheep, pigs, cows, cats, or dogs is also contemplated.
  • the invention relates to analysing samples from subjects.
  • the sample may be tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject.
  • the sample may be blood and a fraction or component of blood including blood serum, blood plasma, or lymph.
  • the protein detection assays may be performed in situ , in which case the sample is a tissue section (fixed and/or frozen) of the tissue obtained from biopsies or resections from a subject.
  • the compound or composition of the invention may be administered subcutaneously, intravenously, intradermally, orally, intranasally, intramuscularly, intracranially, intrathecally, intracerebroventricularly, intravitreally, or topically (e.g. in the form of a cream for skin).
  • Dosages and dosage regimes appropriate for use with the invention can be determined within the normal skill of the medical practitioner responsible for administration of the composition.
  • a therapeutically effective amount of the compound or composition of the invention would be administered to such a subject.
  • a therapeutically effective amount is an amount which is effective to ameliorate one or more symptoms of the disorder.
  • the dosage may be determined according to various parameters, especially according to the age, weight and condition of the patient to be treated; the nature of the active ingredient, the route of administration; and the required regimen. A physician will be able to determine the required route of administration and dosage for any particular patient.
  • the dose may be provided as a single dose, but may be repeated (e.g. for cases where vector may not have targeted the correct region and/or tissue (such as surgical complication)).
  • the compound or composition of the invention may be administered in a multiple dosage regimen.
  • the initial dose may be followed by administration of a second or plurality of subsequent doses.
  • the second and subsequent doses may be separated by an appropriate time.
  • the compound or composition of the invention are typically used in a single pharmaceutical composition/combination (co-formulated). However, the invention also generally includes the combined use of the compound or composition of the invention in separate preparations/compositions. The invention also includes combined use of the compound or composition of the invention with additional therapeutic agents, as described herein.
  • Combined administration of the two or more agents may be achieved in a number of different ways.
  • all the components may be administered together in a single composition.
  • each component may be administered separately as part of a combined therapy.
  • the compound or composition of the invention may be administered before, after or concurrently with another compound or composition of the invention.
  • the invention also provides kits and articles of manufacture for use with the invention.
  • the kit may comprise a compound (e.g. an antisense oligonucleotide), a conjugated compound (e.g. a conjugated antisense oligonucleotide), a polynucleotide, a vector, a delivery vehicle, a composition or a pharmaceutical composition of the invention and instructions for use.
  • the kit may further comprise one or more additional reagents, such as buffers necessary for the makeup and delivery of the compound of the invention.
  • the kit may further comprise package inserts with instructions for use.
  • a compound comprising a target recognition module and an adenosine deaminase acting on RNA (ADAR)-recruiting module, wherein the target recognition module targets the compound to a target site in the 5' untranslated region (5' UTR) of a RNA transcript, such that an adenosine in the target site is converted to an inosine by ADAR.
  • ADAR adenosine deaminase acting on RNA
  • a compound comprising a target recognition module and an adenosine deaminase acting on RNA (ADAR)-recruiting module, comprising a first single-stranded oligonucleotide (guide strand) and a second single-stranded oligonucleotide (passenger strand) annealed to form a single-stranded target recognition module and a double-stranded ADAR-recruiting module, wherein each strand is 60 nucleotides or less in length, wherein the target recognition module is capable of targeting the compound to a target site comprising an adenosine such that the adenosine is converted to an inosine by ADAR.
  • ADAR adenosine deaminase acting on RNA
  • the compound of embodiment 1, comprising a first single-stranded oligonucleotide (guide strand) and a second single-stranded oligonucleotide (passenger strand) annealed to form an asymmetric duplex having a single-stranded target recognition module at one end and a double-stranded ADAR-recruiting module at the other end, wherein each strand is 60 nucleotides or less in length.
  • ADAR- recruiting module does not comprise the Glur2 hairpin loop sequence consisting of GCUMA (SEQ ID NO: 9), where M is A or C.
  • (c) comprises C or A opposite the adenosine targeted for RNA editing in the target nucleic acid.
  • N is any nucleoside or modified nucleoside thereof
  • M is the nucleoside opposite the adenosine to be targeted; M is cytidine (C), guanosine (G) or adenosine (A); or modified nucleoside thereof;
  • X is cytidine (C), adenosine (A) or guanosine (G); or modified nucleoside thereof a is 0 to 25; and; b is 0 to 25; optionally wherein N 1 is C; and/or N 4 is Y, where Y is C or T.
  • M in SEQ ID NO: 1 and the two nucleosides adjacent to it comprises 2'-OH in the sugar moiety, optionally wherein each of the remaining nucleosides in SEQ ID NO: 1 comprises 2'-OMe in the sugar moiety.
  • the ADAR-recruiting module comprises a double-stranded oligonucleotide formed by annealing together a first single-stranded oligonucleotide (guide strand) and a second single-stranded oligonucleotide (passenger strand), wherein each nucleotide in the guide strand comprises 2'-OH in the sugar moiety and optionally wherein each nucleotide in the passenger strand comprises 2'-MOE in the sugar moiety.
  • the ADAR-recruiting module comprises a double-stranded oligonucleotide formed by annealing together a first single-stranded oligonucleotide (guide strand) and a second single-stranded oligonucleotide (passenger strand), wherein each nucleotide in the guide strand comprises 2'-OH in the sugar moiety and optionally wherein each nucleotide in the passenger strand comprises 2'-MOE in the
  • ADAR-recruiting module comprises a double-stranded oligonucleotide comprising:
  • oligonucleotide (a) a single-stranded oligonucleotide (guide strand) having >70%, >80%, >90%,
  • (a) is within 100 nucleotides upstream of the primary open reading frame (pORF);
  • (c) comprises ⁇ 5, ⁇ 4, ⁇ 3, ⁇ 2, 1, or 0 codons between the start codon and the stop codon;
  • (d) comprises higher percentage composition of acidic and basic amino acids as compared to aromatic hydrophobic amino acids.
  • a single-stranded oligonucleotide (guide strand) comprising: (i) a sequence as set out in any of SEQ IDs: 1 to 5 and 22, and (ii) a sequence having >70% identity of a sequence set out in SEQ ID NO: 6; and
  • oligonucleotide (b) a single-stranded oligonucleotide (passenger strand) comprising a sequence having >70% identity of SEQ ID NO 7, e.g. SEQ ID NO: 8.
  • composition comprising two or more compounds of any one of embodiments 1 to 16, optionally wherein the compounds are conjugated.
  • a pharmaceutical composition comprising the compound of any one of embodiments 1 to 16, or the composition of embodiment 17, and a pharmaceutically acceptable carrier.
  • a method of site-directed editing of the 5' UTR in a RNA transcript comprising delivering to a cell at least one compound comprising a target recognition module and an RNA editing enzyme-recruiting module, wherein the target recognition module targets the compound to a target site in the 5' UTR, such that one or more nucleosides in the 5' UTR are edited by the RNA editing enzyme.
  • RNA editing enzyme is an adenosine deaminase acting on RNA (ADAR).
  • ADAR adenosine deaminase acting on RNA
  • ADAR-recruiting module includes two or more ADAR-recruiting modules.
  • composition “comprising” encompasses “including” as well as “consisting” e.g. a composition “comprising” X may consist exclusively of X or may include something additional e.g. X + Y.
  • the sequences are aligned for optimal comparison purposes (e.g. gaps can be introduced in a first sequence for optimal alignment with a second sequence).
  • the nucleotides at each position are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the nucleotides are identical at that position.
  • sequence comparison is carried out over the length of the reference sequence. For example, if the user wished to determine whether a given (“test”) sequence is 95% identical to SEQ ID NO: 3, SEQ ID NO: 3 would be the reference sequence. To assess whether a sequence is at least 95% identical to SEQ ID NO: 3 (an example of a reference sequence), the skilled person would carry out an alignment over the length of SEQ ID NO: 3, and identify how many positions in the test sequence were identical to those of SEQ ID NO: 3. If at least 95% of the positions are identical, the test sequence is at least 95% identical to SEQ ID NO: 3. If the sequence is shorter than SEQ ID NO: 3, the gaps or missing positions should be considered to be non-identical positions.
  • the skilled person is aware of different computer programs that are available to determine the homology or identity between two sequences. For instance, a comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • the percent identity between two amino acid or nucleic acid sequences is determined using the Needleman and Wunsch (1970) algorithm which has been incorporated into the GAP program in the Accelrys GCG software package (available at http://www.accelrys.com/products/gcg/), using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10,
  • complementary in reference to oligomeric compounds means the capacity of such oligomeric compounds or regions thereof to hybridize to another oligomeric compound or region thereof through nucleobase complementarity under stringent conditions.
  • Complementary nucleobases form a pair by forming hydrogen bonds with their partner based upon canonical Watson-Crick base pairing.
  • adenine (A) is complementary to thymine (T).
  • adenine (A) is complementary to uracil (U).
  • Nucleobases comprising modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.
  • Complementary nucleobases may also form a pair using non-Watson and Crick base pairing, for example, wobble base pairs.
  • a wobble base pair may be a G-U, I-U, I-A or I-C base pair. If no hydrogen bonds can form between the nucleobases, the nucleobases are not complementary.
  • the non-complementary base pairs are also referred to herein as mismatch base pairs.
  • a mismatch base pair may be a G-A, C-A, T-C, U-C, A-A, G-G, C-C, T-T, U-U, I- A or I-I base pair.
  • a nucleobase in a first oligonucleotide forms a mismatch base pair with a nucleobase in a second oligonucleotide
  • each of the nucleobases in the first and second oligonucleotides may be referred to herein as a mismatch nucleobase.
  • the nucleic acid sequences in the sequence listing accompanying this application identifies each sequence as either “RNA” or “DNA” as required.
  • an oligonucleotide having the sequence “GAATGGAC” encompasses any oligonucleotides having such nucleotide sequences, whether modified or unmodified, such as oligonucleotides having RNA bases, e.g. “GAAUGGAC”, and/or oligonucleotides having other modified or naturally occurring bases, such as “GAAUGGA m C” where m C is 5-methyl cytosine.
  • uORF upstream open reading frames
  • pORF primary open reading frame
  • uORFs upstream open reading frames
  • These uORFs are highly diverse in terms of sequence length, number of uORFs per transcript, distance from the 5' m7G-cap, distance from the pORF, strength of uORF Kozak sequence, evolutionary conservation, and whether the uORF overlaps with the pORF.
  • uORFs can be predicted either computationally or empirically observed. The aim of this experiment is to identify uORFs in human and mouse protein coding genes, and the results are explained below.
  • Predicted uORFs were identified in the 5' UTRs of all human and mouse proteincoding genes using a custom script. 59.3% of human transcripts and 48.5% of mouse transcripts were found to have at least one predicted uORF (Figure 1A), which was comparable to previous estimates using similar approaches with earlier genome builds (22,23,24,25). For those transcripts with predicted uORFs, the majority contained only a single uORF, although ⁇ 6% of human and ⁇ 4% of mouse transcripts contained 10 or more uORFs ( Figure 1B). The majority of uORFs were between 6 and ⁇ 30 amino acids in length (Figure 1C), and -85% of uORFs did not overlap with the pORF ( Figure 1D).
  • uORF predictions were visualized using the GWIPS-viz genome browser (26) together with aggregated ribosome profiling and RNA-seq data, which allows for the identification of uORFs for which there is experimental evidence.
  • the HTT gene is shown as an example ( Figure 1K) whereby a prominent initiating ribosome peak and ribosome footprint are observed at the predicted uORF.
  • Predicted human uORF -containing genes were tested by cloning the corresponding 5' UTR upstream of Renilla luciferase in a dual luciferase reporter system. For each candidate gene, control constructs were generated in which the uORF was disrupted by mutagenesis of the uATG to TTG. The relative levels of Renilla and Firefly luciferase where analyzed for each 5' UTR and mutant controls by RT-qPCR.
  • the HOXA11 uORF was selected for further study, as this uORF conferred a strong repressive translational repressive effect ( ⁇ 4 fold) in reporter studies, and the length of both the 5' UTR and uORF were of convenient lengths for facile experimental manipulation.
  • a plasmid was constructed in which the HOXA11 uORF was replaced with a cloning site, and a variety of mutants of the wild-type HOXA11 uORF were subsequently generated. Altering the Kozak consensus at the HOXA11 uORF uATG resulted in an enhancement of downstream gene repression by 22% which did not reach statistical significance at the P ⁇ 0.05 level (Figure 3A).
  • the SCN1A gene (which contains 12 predicted uORFs) was selected for further study. A variety of mutants were generated in which each uORF was knocked-out in turn, or tested for activity in isolation with all other uORFs knocked-out. uORFs were also progressively knocked-out starting at either the 5' or 3' ends of the SCN1A 5' UTR ( Figure 4). The data show that the effects of uORFs are additive, and that no one uORF is responsible for the overall SCN1A repressive effect observed in the wild-type case. Notably, the uORFs closest to the pORF (i.e. uORF- 10, uORF-11 and uORF-12) exert the greatest repressive effect in isolation.
  • the editing oligonucleotide consists of an asymmetric duplex of two annealed oligonucleotides (the guide and passenger strands).
  • the guide strand interacts with a target transcript at the site of a uORF sequence via complementary base pairing, with a mismatch at the site of RNA editing.
  • the guide and passenger strands contain sufficient complementarity to anneal with each other under appropriate conditions. Together the double-stranded guide-passenger duplex constitutes an ADAR-recruiting domain.
  • ADAR catalyses the conversion of the upstream ATG to ITG (where inosine (I) is reads as guanosine (G) by the translation machinery). In this manner, the uORF is disrupted, leading to release of pORF repression and activation of protein expression.
  • Bold nucleotides indicate the ADAR-recruiting portion of the guide strand.
  • the underlined nucleotide is the mismatch with the target adenosine for editing.
  • HEK293T cells were transfected with plasmids expressing both isoforms of ADAR (pi 10 and pl50). Subsequently, a dual luciferase plasmid expressing any 5' UTR of interest was introduced.
  • the dual luciferase plasmid contains one or more uORFs together with ADAR recruiting oligonucleotides that target the uORF ( Figure 6). Alternatively, both plasmids can be introduced at the same time ( Figure 7). In this way it was possible to measure the level of signal in comparison to wild type or mock transfected wells at different time points (48 or 72 hours post-transfection), and evaluate signal accumulation.
  • the optimal configuration was SEQ ID NO: 10 paired with SEQ ID NO: 8 where the chemistry was phosphodiester backbone with fully 2'MOE chemistry ( Figures 6 and 7). Significant signal was found to be 2' chemistry-dependent, with some chemistries showing superior upregulation to others.
  • ADAR-recruiting module is sensitive to chemical modification on either the passenger or guide strand.
  • the levels of translated protein are expected to increase as a consequence of efficient uORF editing.
  • crRNAs CRISPR RNAs
  • Figure 9A CRISPR RNAs
  • MD mismatch distance
  • the shortest MD tested was 21 nt as it has been reported that the functional range is typically longer, rather than shorter.
  • a mismatched C was introduced into the crRNA sequence at the target A, facilitating conversion of A to I, which is read as G by the translation machinery.
  • crRNA lengths were ⁇ 50 nt, but altered slightly in order to optimise the sequence motif at the 5' and 3' ends.
  • Bold nucleotides indicate the ADAR-recruiting portion of the guide strand.
  • the underlined nucleotide is the mismatch with the target adenosine for editing.
  • Each of the guide strands is first hybridized with a universal passenger strand prior to use.
  • the annealed oligonucleotides can be stored.
  • the guide and passenger strands are mixed in equimolar amounts and heated to 90 °C for 5 minutes and then allowed to slowly cool to room temperature to allow annealing.
  • Annealed oligonucleotides are stored at - 20 °C until ready for use, or -80 °C for long-term storage. Storing at room temperature is avoided.
  • the annealed oligonucleotide is to be administered to mammalian cells in culture, or injected into human patients or animal models.
  • the annealed compound may be injected by intramuscular injection.
  • the compound is injected in a sterile buffer (e.g. saline). Typical doses might range between 1 mg/kg and 300 mg/kg, with 50 mg/kg.
  • the amount or activity of the protein to be targeted is determined prior to and after contacting the annealed oligonucleotide with the cell.
  • RNA transcript HOXA11 , RNASEH1 or BRD3
  • pORF primary open reading frame
  • N is any nucleoside or modified nucleoside thereof;
  • M is cytosine (C), guanosine (G), or adenosine (A); or modified nucleoside thereof;
  • X is cytidine (C), adenosine (A) or guanosine (G); or modified nucleoside thereof;
  • a is 0 to 25; and
  • b is 0 to 25.
  • M is opposite to the adenosine to be edited.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne l'édition dirigée sur un site de la région non traduite 5ʹ (5ʹ UTR) d'un transcrit d'ARN par le recrutement d'une enzyme d'édition d'ARN, ainsi qu'un procédé et ses utilisations. L'invention concerne également de nouveaux composés pour l'édition dirigée sur un site en recrutant l'enzyme adénosine désaminase agissant sur l'ARN (ADAR) sur un site cible, ainsi que des procédés et des utilisations de ceux-ci.
PCT/GB2022/051359 2021-05-27 2022-05-27 Composition et procédé d'édition d'arn médiée par adar WO2022248879A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB2107553.6 2021-05-27
GBGB2107553.6A GB202107553D0 (en) 2021-05-27 2021-05-27 Method

Publications (1)

Publication Number Publication Date
WO2022248879A1 true WO2022248879A1 (fr) 2022-12-01

Family

ID=76741419

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2022/051359 WO2022248879A1 (fr) 2021-05-27 2022-05-27 Composition et procédé d'édition d'arn médiée par adar

Country Status (2)

Country Link
GB (1) GB202107553D0 (fr)
WO (1) WO2022248879A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024084048A1 (fr) * 2022-10-21 2024-04-25 Proqr Therapeutics Ii B.V. Complexes oligonucléotidiques hétéroduplex d'édition d'arn

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5142047A (en) 1985-03-15 1992-08-25 Anti-Gene Development Group Uncharged polynucleotide-binding polymers
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
EP1579015A2 (fr) 2002-07-23 2005-09-28 Applera Corporation Procede de nettoyage de la pcr et d'evacuation d'oligonucleotides
WO2009099942A2 (fr) 2008-01-31 2009-08-13 Alnylam Pharmaceuticals, Inc. Oligonucléotides modifiés chimiquement et leurs utilisations
WO2016077837A1 (fr) * 2014-11-14 2016-05-19 Ionis Pharmaceuticals, Inc. Composés et procédés de modulation des protéines
WO2016097212A1 (fr) 2014-12-17 2016-06-23 Proqr Therapeutics Ii B.V. Édition ciblée d'arn
EP3323890A1 (fr) * 2015-07-14 2018-05-23 Fukuoka University Procédé pour induire des mutations d'arn spécifiques d'un site, arn-guide d'édition cible utilisés dans le procédé, et complexe arn cible-arn guide d'édition cible
US20190093098A1 (en) * 2015-09-26 2019-03-28 Eberhard Karls Universität Tübingen Methods and substances for directed rna editing
WO2019076355A1 (fr) * 2017-10-19 2019-04-25 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Procédé de régulation de l'expression génique
WO2019111957A1 (fr) * 2017-12-06 2019-06-13 学校法人福岡大学 Oligonucléotides, leur procédé de fabrication et procédé d'édition spécifique d'un site arn cible
WO2020001793A1 (fr) * 2018-06-29 2020-01-02 Eberhard-Karls-Universität Tübingen Acides nucléiques artificiels pour édition d'arn
WO2022026928A1 (fr) * 2020-07-30 2022-02-03 Adarx Pharmaceuticals, Inc. Compositions d'édition dépendant d'adar et leurs procédés d'utilisation

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5142047A (en) 1985-03-15 1992-08-25 Anti-Gene Development Group Uncharged polynucleotide-binding polymers
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
EP1579015A2 (fr) 2002-07-23 2005-09-28 Applera Corporation Procede de nettoyage de la pcr et d'evacuation d'oligonucleotides
WO2009099942A2 (fr) 2008-01-31 2009-08-13 Alnylam Pharmaceuticals, Inc. Oligonucléotides modifiés chimiquement et leurs utilisations
WO2016077837A1 (fr) * 2014-11-14 2016-05-19 Ionis Pharmaceuticals, Inc. Composés et procédés de modulation des protéines
WO2016097212A1 (fr) 2014-12-17 2016-06-23 Proqr Therapeutics Ii B.V. Édition ciblée d'arn
EP3323890A1 (fr) * 2015-07-14 2018-05-23 Fukuoka University Procédé pour induire des mutations d'arn spécifiques d'un site, arn-guide d'édition cible utilisés dans le procédé, et complexe arn cible-arn guide d'édition cible
US20190093098A1 (en) * 2015-09-26 2019-03-28 Eberhard Karls Universität Tübingen Methods and substances for directed rna editing
WO2019076355A1 (fr) * 2017-10-19 2019-04-25 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Procédé de régulation de l'expression génique
WO2019111957A1 (fr) * 2017-12-06 2019-06-13 学校法人福岡大学 Oligonucléotides, leur procédé de fabrication et procédé d'édition spécifique d'un site arn cible
WO2020001793A1 (fr) * 2018-06-29 2020-01-02 Eberhard-Karls-Universität Tübingen Acides nucléiques artificiels pour édition d'arn
WO2022026928A1 (fr) * 2020-07-30 2022-02-03 Adarx Pharmaceuticals, Inc. Compositions d'édition dépendant d'adar et leurs procédés d'utilisation

Non-Patent Citations (23)

* Cited by examiner, † Cited by third party
Title
ABRAMOVA ET AL., INDIAN JOURNAL OF CHEMISTRY 48B, 2009, pages 1721 - 1726
AQUINO-JARQUIN, MOLECULAR THERAPY: NUCLEIC ACIDS, 19 March 2020 (2020-03-19), pages 1065 - 1072
BOISGUERIN ET AL., ADVANCED DRUG DELIVERY REVIEWS, 2015
CALVO ET AL., PNAS, vol. 106, 2009, pages 7507 - 7512
CROOKE ET AL., NAT BIOTECHNOL., vol. 35, no. 3, 2017, pages 230 - 237
GEARY ET AL., ADV DRUG DELIV REV., vol. 87, 2015, pages 46 - 51
GRIFFEY ET AL., J. MED. CHEM., vol. 39, no. 26, 1997, pages 5100 - 5109
IACONO ET AL., GENE, vol. 349, 2005, pages 97 - 105
KOCALKA ET AL., CHEMBIOCHEM, vol. 9, no. 8, 2008, pages 1280 - 5
KOIZUMI, CURRENT OPINION IN MOLECULAR THERAPEUTICS, vol. 8, no. 2, 2006, pages 144 - 149
LEE ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 109, 2012, pages E2424 - 2432
LOCHMANN ET AL., EU. J. PHARMACEUTICS AND BIOPHARMACEUTICS, vol. 58, 2004, pages 237 - 251
MERKLE ET AL., NATURE BIOTECHNOLOGY, vol. 37, 2019, pages 1059 - 1069
MERKLE TOBIAS ET AL: "Precise RNA editing by recruiting endogenous ADARs with antisense oligonucleotides", NATURE BIOTECHNOLOGY, NATURE PUBLISHING GROUP US, NEW YORK, vol. 37, no. 2, 28 January 2019 (2019-01-28), pages 133 - 138, XP036688633, ISSN: 1087-0156, [retrieved on 20190128], DOI: 10.1038/S41587-019-0013-6 *
MICHEL ET AL., NUCLEIC ACIDS RES., vol. 42, 2014, pages D859 - 864
MONTIEL-GONZALEZ ET AL., METHODS, vol. 156, 2019, pages 16 - 24
NOSE KANAKO ET AL: "Short-Chain Guide RNA for Site-Directed A-to-I RNA Editing", NUCLEIC ACID THERAPEUTICS, vol. 31, no. 1, 11 February 2021 (2021-02-11), US, pages 58 - 67, XP055801188, ISSN: 2159-3337, DOI: 10.1089/nat.2020.0866 *
OBIKA ET AL., TETRAHEDRON LETTERS, vol. 38, no. 50, 1997, pages 8735
SARAH E CALVO ET AL: "Upstream Open Reading Frames Cause Widespread Reduction Of Protein Expression And Are Polymorphic Among Humans", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, vol. 106, no. 18, 5 May 2009 (2009-05-05), pages 7507 - 7512, XP003031323, ISSN: 0027-8424, [retrieved on 20090416], DOI: 10.1073/PNAS.0810916106 *
SCHULLERGREEN, NAT REV MOL CELL BIOL., vol. 19, 2018, pages 526 - 541
SUMMERTON, BIOCHIM BIOPHYS ACTA, vol. 1489, no. 1, 1999, pages 141 - 58
WANG ET AL., MOLECULAR SYSTEMS BIOLOGY, vol. 15, 2019, pages e8503
YAMASHITA ET AL., COMPTES RENDUS BIOLOGIES, vol. 326, 2003, pages 987 - 991

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024084048A1 (fr) * 2022-10-21 2024-04-25 Proqr Therapeutics Ii B.V. Complexes oligonucléotidiques hétéroduplex d'édition d'arn

Also Published As

Publication number Publication date
GB202107553D0 (en) 2021-07-14

Similar Documents

Publication Publication Date Title
EP4261284A1 (fr) Arn guide stable d'édition cible dans lequel un acide nucléique chimiquement modifié a été introduit
EP3234134B1 (fr) Édition ciblée d'arn
CN106434665B (zh) 用于抑制乙型肝炎病毒的基因表达的组合物和方法
WO2018134301A1 (fr) Complexes oligonucléotidiques destinés à être utilisés dans l'édition d'arn
KR20190042660A (ko) 화학적으로 변형된 단일 가닥 rna-편집 올리고뉴클레오타이드
CA3129660A1 (fr) Oligonucleotides antisens d'edition d'acide nucleique
CN108350454A (zh) 等位基因选择性基因编辑及其用途
US11866702B2 (en) Nucleic acid molecules for pseudouridylation
JP2023529316A (ja) ゲノム編集のための組成物及び方法
JP2021527437A (ja) Ｓｃｎ９ａ発現を調節するためのオリゴヌクレオチド
KR20110086815A (ko) 텔로머라제 억제제 및 그의 사용 방법
EP4381065A2 (fr) Procédé
JP2021511029A (ja) Ｓｒｅｂｐ１を標的とするアンチセンスオリゴヌクレオチド
TWI791868B (zh) 調節rtel1表現之寡核苷酸
JP7453921B2 (ja) Ｇｙｓ２発現を阻害するための組成物及び方法
CN117295819A (zh) 用于抑制补体组分3表达的组合物和方法
WO2022248879A1 (fr) Composition et procédé d'édition d'arn médiée par adar
CN117858949A (zh) 用于抑制粘蛋白5AC(MUC5AC)的表达的RNAi试剂、其组合物及其使用方法
JP2023506546A (ja) Ｂ型肝炎ウイルス感染症を処置するためのｓｅｐｔ９阻害剤の使用
TW202435897A (zh) 用於治療遺傳性ｈｆｅ血色沉著病之反義寡核苷酸
TW202302848A (zh) 以crispr/sacas9治療第1型肌強直性營養不良之組合物及方法
WO2024197139A2 (fr) Administration d'agents thérapeutiques à base d'arn à l'aide d'acides nucléiques promédicaments circulaires
JP2023554579A (ja) 核内受容体サブファミリー１グループｈメンバー３（ｎｒ１ｈ３）発現を阻害するための組成物および方法
JP2023506547A (ja) Ｂ型肝炎ウイルス感染を処置するためのｃｏｐｓ３阻害剤の使用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22731768

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22731768

Country of ref document: EP

Kind code of ref document: A1