WO2022245739A1 - Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders - Google Patents
Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders Download PDFInfo
- Publication number
- WO2022245739A1 WO2022245739A1 PCT/US2022/029462 US2022029462W WO2022245739A1 WO 2022245739 A1 WO2022245739 A1 WO 2022245739A1 US 2022029462 W US2022029462 W US 2022029462W WO 2022245739 A1 WO2022245739 A1 WO 2022245739A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- week
- dose
- patients
- weeks
- vegf
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
- A61K38/179—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/16—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
- A61K47/18—Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
- A61K47/183—Amino acids, e.g. glycine, EDTA or aspartame
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/22—Heterocyclic compounds, e.g. ascorbic acid, tocopherol or pyrrolidones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0048—Eye, e.g. artificial tears
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
Definitions
- sequence listing of the present application is submitted electronically as an ASCII formatted sequence listing with a file name “10861 WO01 -Sequence”, creation date of May 16, 2022, and a size of 6,006 bytes. This sequence listing submitted is part of the specification and is herein incorporated by reference in its entirety.
- the field of the present invention relates to methods for treating or preventing angiogenic eye disorders by administering a VEGF antagonist.
- Neovascular (wet) AMD is a major health issue in aging populations globally. Vision loss in nAMD results from the abnormal growth and leakage of blood vessels in the macula. In elderly patients affected by nAMD, vision loss frequently has an even greater impact, as it substantially reduces the visual compensation of functional impairment by other age-related comorbidities, such as arthritis and osteoporosis.
- IVT Intravitreally administered anti-vascular endothelial growth factor (VEGF) therapies like EYLEA® inhibit neovascular vessel growth and leakage in the retina, and they are currently the standard-of-care for patients with nAMD. They not only maintain visual function but also provide clinically meaningful visual gains. Treatment of nAMD is chronic and life-long in most patients to suppress retinal edema and recurrences of choroidal neovascularization (CNV). Although the currently approved IVT anti-VEGF therapies are efficacious and well-tolerated, the need for IVT injections every 4 to 8 weeks, specifically in the initial phase and during maintenance of treatment, represents a significant burden to physicians, patients, and caregivers.
- IVT anti-VEGF anti-vascular endothelial growth factor
- EYLEA (2 mg dose, administered at a concentration of 40 mg/mL, also called intravitreal aflibercept injection [IAI]) is currently approved in the United States (US) for the treatment of nAMD, and is also approved for the treatment of macular edema following retinal vein occlusion (RVO), diabetic macular edema (DME), and diabetic retinopathy (DR).
- US United States
- IAI intravitreal aflibercept injection
- the present invention provides a method for treating or preventing an angiogenic eye disorder (e.g., neovascular age-related macular edema (nAMD), diabetic macular edema (DME), diabetic retinopathy (DR), macular edema (ME) secondary to retinal vein occlusion (RVO) (ME-RVO), in a subject in need thereof, comprising administering to an eye of the subject (e.g., by intravitreal injection), e.g., in about 70 mI, a single initial dose of about 8 mg or more of a VEGF antagonist (e.g., aflibercept) to an eye of the subject, followed by one or more secondary doses of the VEGF antagonist, followed by one or more tertiary doses of the VEGF antagonist; wherein each secondary dose is administered about 2 to 4 or 3 to 5 weeks after the immediately preceding dose; and wherein each tertiary dose is administered about 4, 8 or 12 weeks after the immediately
- the subject achieves: a reduction in total choroidal neovascularization (CNV) lesion size by at least about 3.2 or 3.3 mhp by about week 4, 8, 9, 12, 16, 20, 24, 28, 32, 36, 40 or 44 following the initial dose; no significant increase in intraocular pressure from baseline by about week 4, 8, 9, 12, 16, 20, 24, 28, 32, 36, 40 or 44 or later following the initial dose; and/or no significant increase in systolic (S) and/or diastolic (D) blood pressure from baseline by
- CNV total choroidal neovascularization
- the method for treating or preventing an angiogenic eye disorder includes administering a single initial dose of VEGF antagonist (e.g., aflibercept), followed by one or more secondary doses of the VEGF antagonist, followed by one or more tertiary doses of the VEGF antagonist; wherein each secondary dose is administered about 4 weeks after the immediately preceding dose; and wherein each tertiary dose is administered about 4, 8 or 12 weeks after the immediately preceding dose.
- VEGF antagonist e.g., aflibercept
- the subject receiving 8 mg of VEGF antagonist exhibits a greater decrease in central retinal thickness after 4, 8, 12, 16 or more weeks; a greater improvement in best corrected visual acuity after 4, 8, 12, 16 or more weeks; and/or a greater likelihood of having a dry retina (e.g., lacks intraretinal fluid and/or subretinal fluid) after 4, 8, 12, 16 or more weeks.
- 2-4 weeks is 2, 3 or 4 weeks.
- the present invention further provides a method for improving best corrected visual acuity, decreasing central retinal thickness and/or achieving a dry retina, in the eye of a subject (e.g., suffering from neovascular age-related macular edema, diabetic retinopathy, diabetic macular edema or macular edema following retinal vein occlusion (RVO)) in need thereof, comprising administering to the eye of the subject, a single initial dose of about 8 mg or more of a VEGF antagonist (e.g., aflibercept) to an eye of the subject, followed by one or more secondary doses of the VEGF antagonist, followed by one or more tertiary doses of the VEGF antagonist; wherein each secondary dose is administered about 2 to 4 weeks after the immediately preceding dose; and wherein each tertiary dose is administered about 4, 8 or 12 weeks after the immediately preceding dose.
- a VEGF antagonist e.g., aflibercept
- Also provided by the present invention is a method for promoting retinal drying, in the eye of a subject suffering from an angiogenic eye disorder (e.g., neovascular age-related macular edema, diabetic retinopathy, diabetic macular edema or macular edema following retinal vein occlusion (RVO)), comprising administering to the eye of the subject, a single initial dose of about 8 mg or more of a VEGF antagonist, followed by one or more secondary doses of about 8 mg or more of the VEGF antagonist, followed by one or more tertiary doses of about 8 mg or more of the VEGF antagonist; wherein each secondary dose is administered about 2 to 4 weeks after the immediately preceding dose; and wherein each tertiary dose is administered about 4, 8 or 12 weeks after the immediately preceding dose; for example, wherein retinal drying is characterized by no intraretinal fluid (IRF) and/or no subretinal fluid (SRF) in the eye of the subject, e.
- a VEGF receptor fusion protein for example, comprising two polypeptides that comprise (1) a VEGFR1 component comprising amino acids 27 to 129 of SEQ ID NO: 2; (2) a VEGFR2 component comprising amino acids 130-231 of SEQ ID NO: 2; and (3) a multimerization component comprising amino acids 232-457 of SEQ ID NO: 2;
- VEGF receptor fusion protein comprising two polypeptides that comprise immunoglobin-like (Ig) domain 2 of a VEGFR1 and Ig domain 3 of VEGFR2, and a multimerizing component;
- a VEGF receptor fusion protein comprising two polypeptides that comprise an immunoglobin-like (Ig) domain 2 of VEGFR1, an Ig domain 3 of VEGFR2, an Ig domain 4 of said VEGFR2; and a multimerizing component;
- VEGF receptor fusion protein comprising two VEGFR1R2-FcAC1(a) polypeptides encoded by the nucleic acid sequence of SEQ ID NO: 1 ;
- VEGF antagonist selected from the group consisting of: aflibercept, conbercept, bevacizumab, ranibizumab, pegaptanib, brolucizumab, an anti-VEGF DARPin, abicipar pegol, faricimab, an anti-VEGF antibody or antigen-binding fragment thereof or biopolymer conjugate thereof (e.g., KSI-301), bevacizumab, ranibizumab and a bispecific anti-VEGF/ANG2 antibody.
- the VEGF antagonist is administered to the eye of the subject in a pharmaceutical formulation, for example, which is selected from the group consisting of A-KKKK as so designated herein.
- the VEGF antagonist is administered to the eye from a syringe, e.g., a pre-filled syringe, (e.g., which is glass, plastic and/or sterile).
- a syringe e.g., a pre-filled syringe, (e.g., which is glass, plastic and/or sterile).
- the syringe is characterized by the ornamental design as set forth in International Design Registration No. DM/212 509; which is herein incorporated by reference.
- a dosage of about 8 mg or more is a dose of about 9, 9.3, 9.33, 9.7, 9.8, 9.9, 9.7-9.9 mg or more and such a dosage amount may vary within a given range, e.g., + about 0.5, or + about 0.51 mg.
- the volume in which a dose is delivered can be, for example, about 70, 81 , 82, 81.7, 85, 86, 87, 85-87 microliters and the volume may vary within a given range, e.g., + about 4, 4.45, 4.5, or 5 microliters.
- Doses may be delivered with a dose delivery device (DDD) which is a syringe.
- DDD dose delivery device
- VEGF antagonist e.g., aflibercept
- a dose is delivered with a syringe by a method that includes the steps: (a) withdrawing a plunger rod of the syringe to fill the syringe with the formulation; (b) priming the syringe, thereby removing air from the syringe and, thus avoiding injection of air into the eye, by advancing the plunger rod by a predetermined distance into the syringe body until advancement of the plunger rod is resisted by a stop; (c) rotating the plunger rod about a longitudinal axis; and (d) actuating the plunger rod to dispense a predetermined (device-determined) volume (e.g., about 70, 81 , 82, 81.7, 85, 86, 87, 85-87 microliters, + about 4, 4.45,
- a predetermined (device-determined) volume e.g., about 70, 81 , 82, 81.7
- Figure 1 Summary of CANDELA Clinical Trial Plan and Dosing Schedule.
- CTR Central Retinal Thickness
- BCVA Best Corrected Visual Acuity
- Figure 7 Proportion of HD and IAI patients in CANDELA Completing to Week 16 with a Dry Retina (no intraretinal or subretinal fluid) at Baseline and Weeks 4, 8, 12 and 16.
- Figure 8 Proportion of HD and IAI patients in CANDELA Completing to week 16 with a Retina that is Not Dry (intraretinal and/or subretinal fluid) at Baseline and Weeks 4, 8, 12 and 16.
- Figure 9 Proportion of HD and IAI Patients in CANDELA Completing to Week 16 with Intraretinal Fluid (IRF) at Baseline and Weeks 4, 8, 12 and 16.
- IRF Intraretinal Fluid
- Figure 10 Proportion of HD and IAI Patients in CANDELA Completing to Week 16 with Subretinal fluid (SRF) at Baseline and Weeks 4, 8, 12 and 16.
- SRF Subretinal fluid
- TEAE Treatment Emergent Adverse Events
- TEAE T reatment Emergent Adverse Events
- IOP Intraocular Pressure
- TEAE Non-Ocular T reatment Emergent Adverse Events
- TEAE Non-Ocular Treatment Emergent Adverse Events
- SAES Non-Ocular Serious Adverse Events
- Figure 21 Mean Systolic Blood Pressure of IAI and HD Patients in CANDELA trial.
- Figure 22 Mean Diastolic Blood Pressure of IAI and HD Patients in CANDELA Trial.
- Figure 23 Mean Intraocular Pressure of IAI and HD Patients in CANDELA Trial.
- Figure 24 Change in Intraocular Pressure from Baseline of IAI and HD Patients in CANDELA Trial.
- FIGS 25A, 25B and 25C Precision Dose Delivery Device Analyses.
- Fig. 25A Delivered dose summary for REGN3-PFS-0.5mL
- Fig. 25B Delivered dose summary for 1mL BD Luer Lok syringe
- Fig. 25C Individual value plot of doses delivered with REGN3- PFS-0.5mL and 1mL BD Luer Lok syringe.
- Figure 28 Baseline Characteristics in Patients treated with HD, IAI or All Patients (analysis of additional patients reaching week 16).
- Figure 30 Primary Efficacy Endpoint - Proportion of Patients Treated with HD or IAI Regimen with Dry Retina at Week 16 (analysis of additional patients reaching week 16; number of patients analyzed is shown).
- Figure 31 Proportion of Patients Treated with HD or IAI Regimen without Intraretinal Fluid (IRF) and without Subretinal Fluid (SRF) at Week 16 (analysis of additional patients reaching week 16; number of patients analyzed is shown).
- IRF Intraretinal Fluid
- SRF Subretinal Fluid
- Figure 32 Median Change from Baseline in Central Retinal Thickness of Patients Treated with HD or IAI Regimen through Week 16 (analysis of additional patients reaching week 16; number of patients analyzed is shown).
- Figure 33 Mean Change from Baseline in Central Retinal Thickness of Patients Treated with HD or IAI Regimen through Week 16 (analysis of additional patients reaching week 16; number of patients analyzed is shown).
- Figure 35 Mean Change from Baseline in Best Corrected Visual Acuity (BCVA) through Week 16 in Patients Treated with HD or IAI Regimen (analysis of additional patients reaching week 16; number of patients analyzed is shown).
- BCVA Best Corrected Visual Acuity
- Figure 36 Changes in Vision at Week 16 in Patients Treated with HD or IAI Regimen (analysis of additional patients reaching week 16; number of patients analyzed is shown).
- Figures 38A, 38B and 38C Summary of Treatment Emergent Adverse Events (TEAEs) in Patients Treated with HD or IAI Regimen,
- Fig. 38A Ocular TEAEs in Study Eye Occurring in >2% of Patients through Week 16,
- Fig. 38B Ocular Serious TEAEs in the Study Eye through Week 16,
- Figure 39 Mean Intraocular Pressure Change from Baseline in Patients Treated with HD or IAI Regimen through Week 16 (analysis of additional patients reaching week 16; number of patients analyzed is shown).
- APTC Anti-Platelet Trialists' Collaboration
- Fig. 44A Systolic
- Fig. 44B Diastolic
- PK Dense Pharmacokinetic
- Figure 45 Patient Disposition as of study start, week 16 and week 44 of HD and IAI patient study groups and combined groups (All).
- Figure 46 Baseline Demographics (sex, ethnicity, race, age) of HD and IAI patient study groups and combined groups (All).
- Figure 48 T reatment Exposure summary through Week 44 of HD and IAI patient study groups.
- IRF intraretinal fluid
- SRF subretinal fluid
- Figure 50 Proportion of Eyes without Fluid in the Macula (no IRF and no SRF in the macula on SD-OCT) at week 16 (difference of 17 (95% confidence interval: -0.9, 34.8)) and week 44 (difference of 17 (95% confidence interval: 1.1 , 32.8)). Percentages and number of patients out of 53 (n/53) are shown.
- Figure 51 Proportion of Eyes without Fluid in the Center Subfield (without fluid in the center subfield refers to no intraretinal fluid and no subretinal fluid in the center subfield on SD-OCT (Spectral Domain Optical Coherence Tomography)) at weeks 16, 20, 2428, 32, 36, 40 and 44. Percentages and number of patients out of 53 (n/53) are shown. Syringes on the X-axis indicate scheduled dose visits.
- Figure 52 Proportion of Eyes without Intraretinal Fluid (without intraretinal fluid is dry or with subretinal fluid only) in the Center Subfield at Weeks 16 and 44. Percentages and number of patients out of 53 (n/53) are shown.
- Figure 53 Proportion of Eyes without Subretinal Fluid (without subretinal fluid is dry or with intraretinal fluid only) in the Center Subfield at Weeks 16 and 44. The week 16 and 44 treatment effect was 18.9%. Percentages and number of patients out of 53 (n/53) are shown.
- Figure 54 Mean Change from Baseline (BL) in Central Retinal Thickness (CRT; micrometers) over time through Week 44. Syringes on the X-axis indicate scheduled dose visits. Week 16 data for patients receiving treatment at week 16 are carried forward.
- BL Baseline
- CRT Central Retinal Thickness
- LOCF Patients receiving treatment at week 16 were considered not dry from week 16 onward.
- Inset box shows changes in CRT between weeks 12 and 20; 24 and 32; or 36 and 44 in the HD and IAI groups.
- Figure 55 Median Change from Baseline (BL) in Central Retinal Thickness (CRT; micrometers) over time through Week 44. Syringes on the X-axis indicate scheduled dose visit.
- LOCF Patients receiving treatment at week 16 were considered not dry from week 16 onward.
- Figure 56 Mean Change from Baseline (BL) in Best Corrected Visual Acuity (BCVA; ETDRS letters) over time through Week 44. Syringes on the X-axis indicate scheduled dose visit.
- LOCF Patients receiving treatment at week 16 were considered not dry from week 16 onward.
- Figure 57 Proportion of Patients Losing and Gaining Vision (ETDRS letters) from Baseline (BL) at Week 44. Percentages and number of patients out of 53 (n/53) are shown.
- Figure 58 Ocular Treatment Emergent Adverse Events (TEAEs) in the Study Eye Occurring in > 2% of Patients (Pts). Percentages and number of patients out of 53 (n/53) in HD and IAI groups are shown.
- TEAEs Ocular Treatment Emergent Adverse Events
- FIG. 59 Ocular Serious T reatment Emergent Adverse Events (TEAEs) in the Study Eye. Percentages and number of patients out of 53 (n/53) in HD and IAI groups are shown.
- TEAEs Ocular Serious T reatment Emergent Adverse Events
- Figure 60 Intraocular Inflammation T reatment Emergent Adverse Events (TEAEs) in the Study Eye. Percentages and number of patients out of 53 (n/53) in HD and IAI groups are shown.
- TEAEs Intraocular Inflammation T reatment Emergent Adverse Events
- Figure 61 Summary of Intraocular Pressure Events in the HD and IAI Study Groups. Safety analysis set. Percentages are calculated based on N. Percentages and number of patients out of 53 (n/53) in HD and IAI groups are shown.
- Figure 62 Mean Pre-Dose Intraocular Pressure, Change from Baseline in the HD and IAI study groups over time (mmHg). Safety analysis set.
- Figure 63 Non-Ocular Treatment Emergent Adverse Events (TEAEs) Occurring in > 2% of Patients. Percentages and number of patients out of 53 (n/53) in HD and IAI groups are shown.
- TEAEs Non-Ocular Treatment Emergent Adverse Events
- Figure 64 Non-Ocular Serious T reatment Emergent Adverse Events (TEAEs) in the HD and IAI study groups. Percentages and number of patients out of 53 (n/53) are shown.
- TEAEs Non-Ocular Serious T reatment Emergent Adverse Events
- FIG 65 Hypertension Treatment Emergent Adverse Events (TEAEs) in the HD and IAI study groups. Percentages and number of patients out of 53 (n/53) in HD and IAI groups are shown.
- TEAEs Hypertension Treatment Emergent Adverse Events
- Figure 66 Adjudicated Anti-Platelet Trialists' Collaboration (APTC) Events and Deaths in the HD and IAI study groups.
- APTC Anti-Platelet Trialists' Collaboration
- VEGF antagonist therapeutic protein in the dosing formulation is a potential way to bring further benefits to patients with chorioretinal vascular diseases, including nAMD.
- a higher dose of aflibercept administered IVT has the potential to prolong the drug’s therapeutic effects and for improvement in pharmacodynamics such as better drying.
- the resulting extension of treatment intervals early after the initiation of treatment to every 12 weeks would reduce the number of injections in the first treatment year.
- a potential decrease in injection-related treatment burden and safety events with fewer injections could be a significant contribution to patient care and healthcare services.
- the present invention provides, in part, a safe and effective method for treating angiogenic eye disorders with an 8 mg dose of aflibercept in a regimen calling for monthly loading doses before quarterly maintenance doses.
- 8 mg dose which is four times the dose approved for Eylea, (2 mg)
- Figure 65 Systemic exposure to VEGF inhibitor is known to be associated with the risk of systemic blood pressure (BP) increases.
- BP systemic blood pressure
- intravitreal injection of VEGF inhibitors has been associated with blood pressure effects.
- CRT central retinal thickness
- VEGF antagonists and VEGF receptor fusion proteins are at least partially free of other biological molecules from the cells or cell culture from which they are produced.
- biological molecules include nucleic acids, proteins, other VEGF antagonists and VEGF receptor fusion proteins, lipids, carbohydrates, or other material such as cellular debris and growth medium.
- An isolated VEGF antagonist or VEGF receptor fusion protein may further be at least partially free of expression system components such as biological molecules from a host cell or of the growth medium thereof.
- isolated is not intended to refer to a complete absence of such biological molecules (e.g., minor or insignificant amounts of impurity may remain) or to an absence of water, buffers, or salts or to components of a pharmaceutical formulation that includes the VEGF antagonists or VEGF receptor fusion proteins.
- a “subject” or “patient” is a mammal, for example a human, mouse, rabbit, monkey or non-human primate.
- a subject or patient may be said to be “suffering from” an angiogenic eye disorder such as nAMD, DR or DME.
- a subject has the disorder in one or both eyes.
- a subject or patient has one or more of the following characteristics (at or before the start of treatment):
- Subfoveal CNV secondary to nAMD e.g., including juxtafoveal lesions that affect the fovea in an eye.
- BCVA Best Corrected Visual Acuity
- EDRS Early Treatment Diabetic Retinopathy Study
- a central retinal thickness in an eye greater than normal e.g., greater than approximately 130, 140, 150, 160, 170 or 180 micrometers, e.g., as determined manually or by optical coherence tomography (OCT) mapping software, for example with a central retinal thickness of about 300, 400, 500 or 600 micrometers or more; or about 488.1+204.9, 516.2+175.64 or 502.1 + 190.6 micrometers.
- OCT optical coherence tomography
- Intraocular pressure of about 14.8+3.4 or 14.9+3.4 mmHg.
- nAMD lesion size of about 7.9+6.21, 7.7+6.84 or 7.8+6.50 mm 2 .
- Choroidal neovascularization lesion size of about 7.9+6.20, 7.5+6.86 or 7.7+6.51 mm 2 .
- FFA fluorescein angiography
- CNV choroidal neovascularization
- BP blood-pressure
- the present invention includes methods for using a VEGF antagonist for treating or preventing angiogenic eye disorders.
- VEGF antagonists include molecules which interfere with the interaction between VEGF and a natural VEGF receptor, e.g., molecules which bind to VEGF or a VEGF receptor and prevent or otherwise hinder the interaction between VEGF and a VEGF receptor.
- exemplary VEGF antagonists include anti-VEGF antibodies, anti-VEGF receptor antibodies, and VEGF receptor fusion proteins.
- VEGF receptor fusion protein refers to a molecule that comprises one or more VEGF receptors or domains thereof, fused to another polypeptide, which interferes with the interaction between VEGF and a natural VEGF receptor, e.g., wherein two of such fusion polypeptides are associated thereby forming a homodimer or other multimer.
- VEGF receptor fusion proteins may be referred to as a "VEGF-Trap" or “VEGF T rap”.
- VEGF receptor fusion proteins within the context of the present disclosure that fall within this definition include chimeric polypeptides which comprise two or more immunoglobulin (Ig)-like domains of a VEGF receptor such as VEGFR1 (also known as Flt1) and/or VEGFR2 (also known as Flk1 or KDR), and may also contain a multimerizing domain (for example, an Fc domain).
- VEGFR1 also known as Flt1
- VEGFR2 also known as Flk1 or KDR
- Fc domain multimerizing domain
- An exemplary VEGF receptor fusion protein is a molecule referred to as VEGF1 R2-FcAC1(a) which is encoded by the nucleic acid sequence of SEQ ID NO:1 or nucleotides 79-1374 or 79-1371 thereof.
- VEGF1 R2-FCAC1 (a) comprises three components:
- VEGFR1 component comprising amino acids 27 to 129 of SEQ ID NO:2;
- VEGFR2 component comprising amino acids 130 to 231 of SEQ ID NO:2;
- a multimerization component comprising amino acids 232 to 457 of SEQ ID NO:2 (the C-terminal amino acids of SEQ ID NO:2, i.e., K458, may or may not be included in the VEGF receptor fusion proteins, see U.S. Patent No. 7,396,664 or 7,354,579, incorporated herein for all purposes). Note that amino acids 1 to 26 of SEQ ID NO:2 are the signal sequence.
- the multimerizing component (MC) of a VEGF receptor fusion protein is derived from an IgG (e.g., lgG1) Fc domain, then the MC has no fewer amino acids than are in amino acids 232 to 457 of SEQ ID NO:2. Thus, the IgG of the MC cannot be truncated to be shorter than 226 amino acids.
- the VEGF receptor fusion protein comprises amino acids 27-458 or 27-457 of SEQ ID NO: 2. atggtcagctactgggacaccggggtcctgctgtgcgcgctgctcagctgtctgcttctcacaggatctagttccgg aagtgataccggtagacctttcgtagagatgtacagtgaaatccccgaaattatacacatgactgaaggaagggagc tcgtcattccctgccgggttacgtcacctaacatcactgttactttaaaaaagtttccacttgacactttgatccct gatggaaaacgcataatctgggacagtagaaagggcttcatcatatcaaatgcaacaacaaaaggcttcatcatatcaaatgcaaca
- aflibercept is N-glycosylated at any one or more of Asparagines 62, 94, 149, 222 and 308.
- the VEGF receptor fusion protein comprises
- an immunoglobin-like (Ig) domain 2 of a first VEGF receptor e.g., VEGFR1
- a first VEGF receptor e.g., VEGFR1
- VEGF receptor e.g., VEGFR2
- a multimerizing component e.g., Fc domain of IgG including the hinge, CH2 and CH3 domains.
- the VEGF receptor fusion protein has the following arrangement of said domains:
- the present disclosure also includes, within its scope, high concentration formulations including, instead of a VEGF receptor fusion protein, a VEGF binding molecule or anti-VEGF antibody or antigen-binding fragments thereof or biopolymer conjugate thereof (e.g., KSI-301) and uses thereof as discussed, e.g.,
- bevacizumab e.g., at a concentration of about 80-90 or 88 mg/ml
- ranibizumab e.g., at a concentration of about 20-40 mg/ml, e.g., 21-35, 21 or 35 mg/ml
- an anti-VEGF aptamer such as pegaptanib (e.g., pegaptanib sodium),
- V L -V H anti-VEGF antibody
- brolucizumab e.g., at a concentration of about 200-400 or 200, 210, 400 or 420 mg/ml
- an anti-VEGF DARPin such as the Abicipar Pegol DARPin (e.g., at a concentration of about 70-140, 70 or 140 mg/ml), or
- a bispecific anti-VEGF antibody e.g., which also binds to ANG2, such as RG7716 (faricimab) (e.g., at a concentration of about 100-400, 100, 105, 400 or 420 mg/ml).
- any of the formulations discussed herein include, in place of a VEGF receptor fusion protein, an anti-VEGF antibody or antibody fragment or other VEGF binding molecule as discussed herein (e.g., substituted with an anti-VEGF DARPin) at any of the concentrations discussed herein.
- the present invention includes a formulation having 35 or 80 mg/ml ranibizumab, a buffer, a thermal stabilizer, a viscosity reducing agent and a surfactant.
- DARPins are Designed Ankyrin Repeat Proteins.
- DARPins generally contain three to four tightly packed repeats of approximately 33 amino acid residues, with each repeat containing a b-turn and two anti-parallel a-helices. This rigid framework provides protein stability whilst enabling the presentation of variable regions, normally comprising six amino acid residues per repeat, for target recognition.
- an “anti-VEGF” antibody or antigen-binding fragment of an antibody refers to an antibody or fragment that specifically binds to VEGF.
- Illustrative VEGF receptor fusion proteins include aflibercept (EYLEA®, Regeneron Pharmaceuticals, Inc.) or conbercept (sold commercially by Chengdu Kanghong Biotechnology Co., Ltd.). See International patent application publication no.
- Aflibercept and “conbercept” include biosimilar versions thereof.
- a biosimilar version of a reference product e.g., aflibercept
- aflibercept generally refers to a product comprising the identical amino acid sequence but includes products which are biosimilar under the U.S. Biologies Price Competition and Innovation Act.
- the present invention includes methods in which the VEGF antagonist (e.g., aflibercept) that is administered to the patient’s eye is contained within a pharmaceutical formulation.
- the pharmaceutical formulation includes a VEGF antagonist along with a pharmaceutically acceptable carrier.
- Other agents may be incorporated into the pharmaceutical formulation to provide improved transfer, delivery, tolerance, and the like.
- pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly, in humans.
- carrier refers to a diluent, adjuvant, excipient, or vehicle with which the VEGF antagonist is administered.
- compositions for use in a method of the present invention can be “high concentration”.
- High concentration pharmaceutical formulations of the present invention include VEGF antagonist, e.g., VEGF receptor fusion protein (e.g., aflibercept), at a concentration of greater than 40 mg/ml, at least 41 mg/ml, of at least 80 mg/ml, of at least 100 mg/ml, of at least 125 mg/ml, of at least 140 mg/ml, of at least 150 mg/ml, of at least 175 mg/ml, of at least 200 mg/ml, of at least 225 mg/ml, of at least 250 mg/ml, or of at least 275 mg/ml.
- VEGF antagonist e.g., VEGF receptor fusion protein (e.g., aflibercept)
- concentration of greater than 40 mg/ml at least 41 mg/ml, of at least 80 mg/ml, of at least 100 mg/ml, of at least 125 mg/ml, of at least 140 mg/ml, of at least 150 mg/ml, of at
- High concentration can refer to formulations that include a concentration of VEGF antagonist of from about 140 mg/ml to about 160 mg/ml, at least about 140 mg/ml but less than 160 mg/ml, from about 41 mg/ml to about 275 mg/ml, from about 70 mg/ml to about 75 mg/ml or from about 80 mg/ml to about 250 mg/ml.
- the VEGF antagonist concentration in the formulation is about any of the following concentrations: 41 mg/ml; 42 mg/ml; 43 mg/ml; 44 mg/ml; 45 mg/ml; 46 mg/ml; 47 mg/ml; 48 mg/ml; 49 mg/ml; 50mg/ml; 51 mg/ml; 52 mg/ml; 53 mg/ml; 54 mg/ml; 55 mg/ml; 56 mg/ml; 57 mg/ml; 58 mg/ml; 59 mg/ml; 60 mg/ml; 61 mg/ml; 62 mg/ml; 63 mg/ml; 64 mg/ml; 65 mg/ml; 66 mg/ml; 67 mg/ml; 68 mg/ml; 69 mg/ml; 70 mg/ml; 71 mg/ml; 72 mg/ml; 73 mg/ml; 74 mg/ml; 75 mg/ml; 76 mg/ml; 77
- a pharmaceutical formulation for use in a method of the present invention is of such a concentration as to contain about 4, 6, 8, 10, 12, 14, 16, 18 or 20 mg VEGF receptor fusion protein (e.g., aflibercept), or the amount of such protein in any of the acceptable doses thereof which are discussed herein, in about 100 mI or less, about 75 mI or less or about 70 mI or less, e.g., about 50 mI; 51 mI; 52 mI; 53 mI;
- the present invention includes methods of using (as discussed herein) any of the formulations set forth under “Illustrative Formulations” herein, but wherein the concentration of the VEGF receptor fusion protein (e.g., aflibercept) is substituted with a concentration which is set forth in this section (“VEGF Receptor Fusion Proteins and Other VEGF inhibitors”).
- concentration of the VEGF receptor fusion protein e.g., aflibercept
- Buffers for use in pharmaceutical formulations herein that may be used in a method of the present invention refer to solutions that resist pH change by use of acid-base conjugates. Buffers are capable of maintaining pH in the range of from about 5.0 to about
- the pH of the formulation of the present invention is about 5.0, about 5.1 , about 5.2, about 5.3, about 5.4, about 5.5, about 5.6, about 5.7, about 5.8, about
- Example buffers for inclusion in formulations herein include histidine-based buffers, for example, histidine, histidine hydrochloride, and histidine acetate.
- Buffers for inclusion in formulations herein can alternatively be phosphate-based buffers, for example, sodium phosphate, acetate-based buffers, for example, sodium acetate or acetic acid, or can be citrate-based, for example, sodium citrate or citric acid. It is also recognized that buffers can be a mix of the above, as long as the buffer functions to buffer the formulations in the above-described pH ranges.
- the buffer is from about 5 mM to about 25 mM, or more typically, about 5 mM to about 15 mM.
- Buffers can be about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, about 20 mM, about 21 mM, about 22 mM, about 23 mM, about 24 mM, or about 25 mM.
- a histidine-based buffer is prepared using histidine and histidine monohydrochloride.
- Surfactant for use herein refers to ingredients that protect the higher concentration of VEGF antagonist, e.g., VEGF receptor fusion protein (e.g., aflibercept), from various surface and interfacial induced stresses. As such, surfactants can be used to limit or minimize VEGF receptor fusion protein aggregation and promote protein solubility. Suitable surfactants herein have been shown to be non-ionic, and can include surfactants that have a polyoxyethylene moiety. Illustrative surfactants in this category include: polysorbate 20, polysorbate 80, poloxamer 188, polyethylene glycol 3350, and mixtures thereof.
- Surfactants in the formulations can be present at from about 0.02% to about 0.1 % weight per volume (w/v), and more typically, about 0.02% to about 0.04% (w/v). In some cases, the surfactant is about 0.02% (w/v), about 0.03% (w/v), about 0.04% (w/v), about 0.05% (w/v), about 0.06% (w/v), about 0.07% (w/v), about 0.08% (w/v), about 0.09% (w/v), or about 0.1% (w/v).
- Thermal stabilizers for use in pharmaceutical formulations refers to ingredients that provide thermal stability against thermal denaturation of the VEGF antagonist, e.g., VEGF receptor fusion protein (e.g., aflibercept), as well as protect against loss of VEGF receptor fusion protein potency or activity.
- VEGF antagonist e.g., VEGF receptor fusion protein (e.g., aflibercept)
- Suitable thermal stabilizers include sugars, and can be sucrose, trehalose, sorbitol or mannitol, or can be amino acids, for example L-proline, L-arginine (e.g., L-arginine monohydrochloride), or taurine.
- thermal stabilizers may also include substituted acrylamides or propane sulfonic acid, or may be compounds like glycerol.
- the pharmaceutical formulations for use in a method herein include both a sugar and taurine, a sugar and an amino acid, a sugar and propane sulfonic acid, a sugar and taurine, glycerol and taurine, glycerol and propane sulfonic acid, an amino acid and taurine, or an amino acid and propane sulfonic acid.
- formulations can include a sugar, taurine and propane sulfonic acid, glycerol, taurine and propane sulfonic acid, as well as L-proline, taurine and propane sulfonic acid.
- Embodiments herein may have thermal stabilizers present alone, each independently present at a concentration of, or present in combination at a total concentration of, from about 2% (w/v) to about 10% (w/v) or 4% (w/v) to about 10% (w/v), or about 4% (w/v) to about 9% (w/v), or about 5% (w/v) to about 8% (w/v).
- Thermal stabilizers in the formulation can be at a concentration of about 2% (w/v), about 2.5% (w/v), about 3% (w/v), about 4% (w/v), about 5% (w/v), about 6% (w/v), about 7% (w/v), about 8% (w/v), about 9% (w/v), about 10% (w/v) or about 20% (w/v).
- these thermal stabilizers can be present in the formulations at about from 25 mM to about 100 mM, and more typically from about 50 mM to about 75 mM (as compared to the other thermal stabilizers).
- Viscosity reducing agents typically are used to reduce or prevent protein aggregation.
- Viscosity reducing agents for inclusion herein include: sodium chloride, magnesium chloride, D- or L-arginine (e.g., L-arginine monohydrochloride), lysine, or mixtures thereof.
- viscosity reducing agents can be present at from about 10 mM to about 100 mM, and more typically from about 30 mM to about 75 mM, and even more typically from about 40 mM to about 70 mM.
- the viscosity reducing agent is present at about 10 mM, about 15 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM, about 55 mM, about 60 mM, about 65 mM, about 70 mM, about 75 mM, about 80 mM, about 85 mM, about 90 mM, about 95 mM or about 100 mM.
- compositions for use in a method as set forth herein can also have a pharmaceutically acceptable viscosity for ocular administration, for example, intravitreal injection.
- Viscosity generally refers to the measure of resistance of a fluid which is being deformed by either shear stress or tensile stress (typically measured by techniques known in the art, viscometer or rheometer, for example).
- Typical viscosities of formulations for use in a method set forth herein are from about 5.0 cP (centipoise) to about 15 cP, from about 11 cP to about 14 cP, from about 12 cP to about 15 cP or from about 11 cP to about 12 cP.
- formulation viscosity herein can be about 5.0 cP, about 6.0, about 7.1 cP, about 7.2 cP, about 7.3 cP, about 7.4 cP, about 7.5 cP, about 7.6 cP, about 10 cP, about 10.5 cP, about 11.0 cP, about 11.5 cP, about 12.0 cP, about 12.5 cP, about 13.0 cP, about 13.5 cP, about 14.0 cP, about 14.5 cP, or about 15.0 cP (e.g., when measured at 20°C).
- embodiments herein do not require inclusion of an inorganic salt, or other viscosity reducing agent, to maintain these highly useful viscosities.
- high concentration protein solutions require viscosity reducing agents to avoid protein aggregation and higher viscosity, making the formulations difficult for intravitreal injection and reducing the potency of the VEGF receptor fusion protein.
- embodiments herein include methods of using formulations that have had substantially no, or no added, sodium chloride (NaCI), magnesium chloride (MgCI 2 ), D- or L-arginine hydrochloride, lysine or other viscosity reducing agent.
- Osmolality is a critical attribute for injectable pharmaceutical formulations for use in a method of the present invention. It is desirable to have products match physiological osmotic conditions. Furthermore, osmolality provides confirmation of soluble content in solution.
- the osmolality of a formulation for use in a method of the present invention is less than or equal to about 506 mmol/Kg or from about 250 to about 506 mmol/Kg., e.g., about 250, 260, 270, 280, 290, 299, 300, 310, 314, 315, 316, 324, 343, 346, 349, 369, 384, 403, 426, 430 or 506 mmol/Kg.
- the osmolality is lower than about 250 mmol/Kg.
- Illustrative pharmaceutical formulations for use in the methods of the present invention include the following:
- Formulation A 80 mg/ml aflibercept, 10 mM histidine-based buffer, 5 % (w/v) sucrose, 0.03% (w/v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation B 80 mg/ml aflibercept, 10 mM phosphate-based buffer, 5 % (w/v) sucrose, 0.03% (w/v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation C 80 mg/ml aflibercept, 10 mM citrate-based buffer, 5 % (w/v) sucrose,
- Formulation D 80 mg/ml aflibercept, 10 mM histidine-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 6.2.
- Formulation E 80 mg/ml aflibercept, 10 mM phosphate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation F 80 mg/ml aflibercept, 10 mM citrate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation G 80 mg/ml aflibercept, 10 mM histidine-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation H 80 mg/ml aflibercept, 10 mM phosphate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation I 80 mg/ml aflibercept, 10 mM citrate-based buffer, 8 % (w/v) sucrose, and 0.0 3% (w/v) polysorbate 20, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation J 80 mg/ml aflibercept, 10 mM histidine-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation K 80 mg/ml aflibercept, 10 mM phosphate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation L 80 mg/ml aflibercept, 10 mM citrate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation M 150 mg/ml aflibercept, 10 mM histidine-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation N 150 mg/ml aflibercept, 10 mM phosphate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation O 150 mg/ml aflibercept, 10 mM citrate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation P 150 mg/ml aflibercept, 10 mM histidine-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 6.2.
- Formulation Q 150 mg/ml aflibercept, 10 mM phosphate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation R 150 mg/ml aflibercept, 10 mM citrate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation S 150 mg/ml aflibercept, 10 mM histidine-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation T 150 mg/ml aflibercept, 10 mM phosphate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20, with a pH of 5.8 to 6.2 (e.g., 6.2), and, optionally, specifically excluding a viscosity reducing agent.
- Formulation U 150 mg/ml aflibercept, 10 mM citrate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation V 150 mg/ml aflibercept, 10 mM histidine-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation W 150 mg/ml aflibercept, 10 mM phosphate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation X 150 mg/ml aflibercept, 10 mM citrate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation Y 80 mg/ml conbercept, 10 mM histidine-based buffer, 5 % (w/v) sucrose,
- Formulation Z 80 mg/ml conbercept, 10 mM phosphate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation AA 80 mg/ml conbercept, 10 mM citrate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation BB 80 mg/ml conbercept, 10 mM histidine-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 6.2.
- Formulation CC 80 mg/ml conbercept, 10 mM phosphate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation DD 80 mg/ml conbercept, 10 mM citrate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation EE 80 mg/ml conbercept, 10 mM histidine-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation FF 80 mg/ml conbercept, 10 mM phosphate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation GG 80 mg/ml conbercept, 10 mM citrate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation HH 80 mg/ml conbercept, 10 mM histidine-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation II 80 mg/ml conbercept, 10 mM phosphate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation JJ 80 mg/ml conbercept, 10 mM citrate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation KK 150 mg/ml conbercept, 10 mM histidine-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation LL 150 mg/ml conbercept, 10 mM phosphate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation MM 150 mg/ml conbercept, 10 mM citrate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation NN 150 mg/ml conbercept, 10 mM histidine-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 6.2.
- Formulation OO 150 mg/ml conbercept, 10 mM phosphate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation PP 150 mg/ml conbercept, 10 mM citrate-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8 to 6.2.
- Formulation QQ 150 mg/ml conbercept, 10 mM histidine-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation RR 150 mg/ml conbercept, 10 mM phosphate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation SS 150 mg/ml conbercept, 10 mM citrate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation TT 150 mg/ml conbercept, 10 mM histidine-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation UU 150 mg/ml conbercept, 10 mM phosphate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation VV 150 mg/ml conbercept, 10 mM citrate-based buffer, 8 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 80, with a pH of 5.8 to 6.2, and, optionally, specifically excluding a viscosity reducing agent.
- Formulation VWV 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 10 mM histidine-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20, and 50 mM taurine, with a pH of 5.8.
- VEGF receptor fusion protein e.g., aflibercept
- Formulation XX 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 4 % (w/v) proline, 0.03 % (w/v) polysorbate 20, and 50 mM arginine hydrochloride, with a pH of 5.8.
- VEGF receptor fusion protein e.g., aflibercept
- 20 mM histidine-based buffer 4 % (w/v) proline, 0.03 % (w/v) polysorbate 20
- 50 mM arginine hydrochloride 50 mM arginine hydrochloride, with a pH of 5.8.
- Formulation YY 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 2.5 % (w/v) sucrose, 2.0 % (w/v) proline, 0.03 % (w/v) polysorbate 20, and 50 mM taurine, with a pH of 5.8.
- VEGF receptor fusion protein e.g., aflibercept
- Formulation ZZ 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 10 mM histidine-based buffer, 2.5 % (w/v) sucrose, 2.0 % (w/v) proline, 0.03 % (w/v) polysorbate 20, and 50 mM arginine hydrochloride, with a pH of 5.8.
- VEGF receptor fusion protein e.g., aflibercept
- 10 mM histidine-based buffer 2.5 % (w/v) sucrose, 2.0 % (w/v) proline, 0.03 % (w/v) polysorbate 20
- 50 mM arginine hydrochloride with a pH of 5.8.
- Formulation AAA 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5 % (w/v) sucrose, 0.03% (w/v) polysorbate 20, and 50 mM PSA, with a pH of 5.8.
- VEGF receptor fusion protein e.g., aflibercept
- 20 mM histidine-based buffer 5 % (w/v) sucrose, 0.03% (w/v) polysorbate 20
- 50 mM PSA 50 mM PSA, with a pH of 5.8.
- Formulation BBB 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 2.5 % (w/v) sucrose, 2.0 % (w/v) proline, 0.03 % (w/v) polysorbate 20, and 50 mM PSA, with a pH of 5.8.
- VEGF receptor fusion protein e.g., aflibercept
- Formulation CCC 80, 100, 120 or 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20, and 50 mM arginine hydrochloride, with a pH of 5.8.
- VEGF receptor fusion protein e.g., aflibercept
- 20 mM histidine-based buffer 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20
- 50 mM arginine hydrochloride with a pH of 5.8.
- Formulation DDD 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 10 mM histidine-based buffer, 4 % (w/v) proline, 0.03 % (w/v) polysorbate 20, and 50 mM PSA, with a pH of 5.8.
- VEGF receptor fusion protein e.g., aflibercept
- 10 mM histidine-based buffer 4 % (w/v) proline
- 0.03 % (w/v) polysorbate 20 0.03 % (w/v) polysorbate 20
- 50 mM PSA 50 mM PSA
- Formulation EEE 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20 and, optionally, no thermal stabilizer, with a pH of 5.8.
- VEGF receptor fusion protein e.g., aflibercept
- 20 mM histidine-based buffer 5 % (w/v) sucrose, and 0.03 % (w/v) polysorbate 20 and, optionally, no thermal stabilizer, with a pH of 5.8.
- Formulation FFF 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 10mM sodium phosphate, 5 % (w/v) sucrose and 0.03 % polysorbate 20 with a pH of 6.2.
- VEGF receptor fusion protein e.g., aflibercept
- 10mM sodium phosphate 10mM sodium phosphate
- 5 % (w/v) sucrose 5 % (w/v) sucrose
- 0.03 % polysorbate 20 with a pH of 6.2.
- Formulation GGG 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept); 20 mM histidine, pH 5.8; 5% sucrose; 0.03 % polysorbate 20; 50 mM sodium sulfate
- Formulation HHH 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept); 20 mM histidine, pH 5.8; 5% sucrose; 0.03 % polysorbate 20; 50 mM sodium thiocyanate
- Formulation III 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept); 20 mM histidine, pH 5.8; 5 % sucrose, 0.03 % polysorbate 20; 40 mM sodium citrate
- Formulation JJJ 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept); 20 mM histidine, pH 5.8; 5% Sucrose, 0.03 % polysorbate 20; 50 m
- Formulation PPP 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept); 20 mM histidine, pH 5.8; 5 % sucrose; 0.03% polysorbate 20; 50 mM glycine; 50 mM arginine hydrochloride
- Formulation QQQ 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept); 20 mM histidine, pH 5.8; 5 % sucrose; 0.03% polysorbate 20; 50 mM sodium aspartate; 50 mM arginine hydrochloride
- Formulation RRR 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept); 20 mM histidine, pH 5.8; 5 % sucrose; 0.03% polysorbate 20; 50 mM sodium glutamate; 50 mM arginine hydrochloride
- Formulation SSS 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept); 20 mM His, pH 5.8; 5 % sucrose; 0.03 % polysorbate 20; 10 mM L-arginine hydrochloride Formulation TTT: 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept); 20 mM His, pH 5.8; 5 % sucrose; 0.03 % polysorbate 20; 100 mM L-arginine hydrochloride Formulation UUU: 30 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 10 % sucrose, 10 mM phosphate, 0.03 % polysorbate 20, pH 6.2
- Formulation VVV 30 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 20 % sucrose, 10 mM phosphate, 0.03 % polysorbate 20, pH 6.2
- Formulation WWW 60 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 10 % sucrose, 10 mM phosphate, 0.03 % polysorbate 20, pH 6.2
- Formulation XXX 60 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 20 % sucrose, 10 mM phosphate, 0.03 % polysorbate 20, pH 6.2
- VEGF receptor fusion protein e.g., aflibercept
- Formulation YYY 120 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 10 % sucrose, 10 mM phosphate, 0.03 % polysorbate 20, pH 6.2
- VEGF receptor fusion protein e.g., aflibercept
- 10 % sucrose 10 mM phosphate
- 0.03 % polysorbate 20 pH 6.2
- Formulation ZZZ 120 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 20 % sucrose, 10 mM phosphate, 0.03 % polysorbate 20, pH 6.2
- VEGF receptor fusion protein e.g., aflibercept
- Formulation AAAA 120 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 10 % sucrose, 10 mM phosphate, 0.03 % polysorbate 20, 50 mM NaCI, pH 6.2
- Formulation BBBB 120 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 20 % sucrose, 10 mM phosphate, 0.03 % polysorbate 20, 50 mM NaCI, pH 6.2
- Formulation CCCC 140 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 10 mM sodium phosphate, 5 % sucrose, 40 mM sodium chloride, 0.03 % PS20, pH 6.2 Formulation DDDD: 80 mg/ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5 % (w/v) sucrose, 0.03 % (w/v) polysorbate 20, and 50
- Formulation EEEE 120.0 mg/ml VEGF receptor fusion protein (e.g., aflibercept) (e.g., + 12 mg/ml), 20 mM histidine-based buffer (e.g., + 2 mM), 5 % (w/v) sucrose (e.g., + 0.5%), 0.03 % (w/v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g.,
- Formulation FFFF 113.3 mg/ml VEGF receptor fusion protein (e.g., aflibercept) (e.g., 102-
- Formulation GGGG 114.3 mg/ml VEGF receptor fusion protein (e.g., aflibercept) (e.g., 10S-
- Formulation HHHH 100.0 mg/ml VEGF receptor fusion protein (e.g., aflibercept) (e.g., + 10 mg/ml), 20 mM histidine-based buffer (e.g., + 2 mM), 5 % (w/v) sucrose (e.g., + 0.5%), 0.03 % (w/v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g.,
- VEGF receptor fusion protein e.g., aflibercept
- 20 mM histidine-based buffer e.g., + 2 mM
- 5 % (w/v) sucrose e.g., + 0.5%)
- 0.03 % (w/v) polysorbate 20 e.g., 0.02-0.04%)
- 50 mM L-arginine monohydrochloride e.g.,
- Formulation JJJJ 150 mg/ml aflibercept (e.g., aflibercept) (e.g., + 15 mg/ml), 10 mM sodium phosphate, 8% (w/v) sucrose (e.g., + 0.8%), 0.03% (w/v) polysorbate 20 (e.g., 0.02- 0.04%) and 50 mM L-arginine hydrochloride, pH 6.2 (e.g., 6.0-6.4 or 5.9-6.5).
- aflibercept e.g., + 15 mg/ml
- sucrose e.g., + 0.88%
- polysorbate 20 e.g., 0.02- 0.04%
- 50 mM L-arginine hydrochloride pH 6.2 (e.g., 6.0-6.4 or 5.9-6.5).
- Formulation KKKK 114.3 mg/ml VEGF receptor fusion protein (e.g., aflibercept) (e.g., + 14 mg/ml), 20 mM histidine-based buffer (e.g., + 2 mM), 5% (w/v) sucrose (e.g., + 0.5%),
- VEGF receptor fusion protein e.g., aflibercept
- 20 mM histidine-based buffer e.g., + 2 mM
- 5% (w/v) sucrose e.g., + 0.5%)
- polysorbate 20 e.g., 0.02-0.04%)
- 50 mM L-arginine monohydrochloride e.g., ⁇ 5 mM
- pH 5.8 (e.g., 5.6-6.0 or 5.5-6.1).
- the formulation that can be administered, e.g., intravitreally, to a subject is an aqueous pharmaceutical formulation comprising: at least about 100 mg/ml of a VEGF receptor fusion protein comprising two polypeptides that each comprises an immunoglobin-like (Ig) domain 2 of VEGFR1, an Ig domain 3 of
- VEGFR2 VEGFR2
- a multimerizing component e.g., aflibercept
- L-arginine e.g., at a concentration of about 10-100 mM
- sucrose e.g., glycerol
- histidine-based buffer e.g., glycerol
- surfactant e.g., sodium bicarbonate
- the formulation has a pH of about 5.0 to about 6.8
- the VEGF receptor fusion protein has less than about 3.5% high molecular weight species immediately after manufacture and purification and/or less than or equal to about 6% high molecular weight species after storage for about 24 months at about 2-8°C.
- the present invention provides methods for treating angiogenic eye disorders by sequentially administering initial loading doses of greater than or equal to (>) about 8 mg (e.g., about every 2-4 or 3-5 weeks) of VEGF antagonist (e.g., aflibercept) followed by additional doses of > about 8 mg every 12 weeks of VEGF antagonist (e.g., aflibercept).
- initial loading doses of greater than or equal to (>) about 8 mg (e.g., about every 2-4 or 3-5 weeks) of VEGF antagonist (e.g., aflibercept) followed by additional doses of > about 8 mg every 12 weeks of VEGF antagonist (e.g., aflibercept).
- the methods of the present invention include treating or preventing angiogenic eye disorders, such as diabetic retinopathy, diabetic macular edema or neovascular AMD, by administering, sequentially, one or more (e.g., 3, 4 or 5) doses (e.g., > about 8 mg) about every month (or about every 28 days, 28 + 5 days or about every 4 weeks), followed by one or more doses (e.g., > about 8 mg) about every 12 weeks.
- doses e.g., > about 8 mg
- about 8 mg is 7.2 mg
- the terms "initial dose,” “secondary doses,” and “tertiary doses,” refer to the temporal sequence of administration of the VEGF antagonist (e.g., aflibercept).
- the “initial dose” is the dose which is administered at the beginning of the treatment regimen (also referred to as the “baseline dose”);
- the “secondary doses” are the doses which are administered after the initial dose;
- the “tertiary doses” are the doses which are administered after the secondary doses.
- the initial dose occurs on day 1 for the purposes of counting or numbering days thereafter (see e.g., Tables 1-1 and 1-2 herein).
- the initial, secondary, and tertiary doses may all contain the same amount of VEGF antagonist, but will generally differ from one another in terms of frequency of administration. In certain embodiments, however, the amount of VEGF antagonist contained in the initial, secondary and/or tertiary doses will vary from one another (e.g., adjusted up or down as appropriate) during the course of treatment.
- a dosing regimen of the present invention may be expressed as follows: a single initial dose (e.g., > about 8 mg) of a VEGF antagonist (e.g., aflibercept), followed by one or more (e.g., 2, or 3 or 4) secondary doses of the VEGF antagonist, followed by one or more tertiary doses of the VEGF antagonist; wherein each secondary dose is administered 2 to 4 weeks after the immediately preceding dose; and wherein each tertiary dose is administered about 12 weeks after the immediately preceding dose.
- the initial and secondary doses administered before the tertiary doses may be referred to, generally, as “loading” doses.
- the tertiary doses may be referred to as “maintenance” doses.
- the present invention includes methods wherein one or more additional, non- scheduled, pro re nata (PRN) doses, in addition to any of the scheduled initial, secondary and/or tertiary doses of VEGF antagonist (e.g., aflibercept) are administered to a subject.
- PRN pro re nata
- Such PRN doses are typically administered at the discretion of the treating physician depending on the particular needs of the subject.
- the method comprises administering the secondary doses to a subject who has received the initial dose
- the method comprises administering the remaining secondary doses to a subject who has already received one or more secondary doses;
- the method comprises administering one or more tertiary doses to a subject who has already received the secondary doses
- the method comprises administering one or more tertiary doses to a subject who has already received one or more tertiary doses; optionally wherein the subject receives doses, earlier in the regimen, in one pharmaceutical formulation and additional doses, later in the regimen, in a different pharmaceutical formulation, for example, comprising a different buffer (e.g., wherein one or more of the secondary doses are in one pharmaceutical formulation and the tertiary doses are in a different pharmaceutical formulation).
- Dosing every “month” refers to dosing about every 28 days, about every 4 weeks, or about every 28 + 5 days and may encompass up to every 5 weeks.
- Dosing every “4 weeks” refers to dosing about every 28 days, about every month or about every 28 + 5 days, and may encompass up to every 5 weeks.
- Dosing every “2-4 weeks” refers to dosing about every 2 weeks, 3 weeks or 4 weeks.
- Dosing every “8 weeks” refers to dosing about every 2 months, about every 56 days, 56 + 5 days.
- Dosing every “12 weeks” refers to dosing about every 3 months, about every quarter year, about every 84, 90 days, 84 + 5 days, or 90 + 5 days.
- a dose of greater than or equal to about 8 mg or > about 8 mg VEGF antagonist includes 7.2 mg; 7.2-8.8 mg; 8.0 mg; 8.01 mg; 8.1 mg; 8.2 mg; 8.3 mg;
- a dosage of > 8 mg VEGF antagonist is administered in a dose having a volume of about 100 mI or less, about 75 mI or less or about 70 mI or less, e.g., about 50 mI; 51 mI; 52 mI; 53 mI; 54 mI; 55 mI; 56 mI;
- Any dosing frequency specified herein may, in an embodiment of the invention, be expressed as the specific frequency “+ 5 days” (e.g., where “4 weeks” is stated, the present invention also includes embodiments such as 4 weeks + 5 days).
- VEGF antagonist e.g., aflibercept
- a predetermined interval e.g., hours, days, weeks or months.
- the present invention includes methods which comprise sequentially administering, to the eye of a patient, a single initial dose of a VEGF antagonist, followed by one or more secondary doses of the VEGF antagonist, followed by one or more tertiary doses of the VEGF antagonist.
- An effective or therapeutically effective dose of VEGF antagonist for treating or preventing an angiogenic eye disorder refers to the amount of VEGF antagonist sufficient to alleviate one or more signs and/or symptoms of the disease or condition in the treated subject, whether by inducing the regression or elimination of such signs and/or symptoms or by inhibiting the progression of such signs and/or symptoms.
- an effective or therapeutically effective dose of VEGF antagonist is > about 8 mg every month followed by once every 12 weeks.
- angiogenic eye disorder means any disease of the eye which is caused by or associated with the growth or proliferation of blood vessels or by blood vessel leakage.
- angiogenic eye disorders that are treatable or preventable using the methods of the present invention include: • age-related macular degeneration (neovascular (nAMD)),
- DME diabetic macular edema
- CNV choroidal neovascularization
- DR diabetic retinopathies
- non-proliferative diabetic retinopathy e.g., characterized by a Diabetic Retinopathy Severity Scale (DRSS) level of about 47 or 53
- proliferative diabetic retinopathy e.g., in a subject that does not suffer from DME
- DRSS Diabetic Retinopathy Severity Scale
- DME diabetic macular edema
- a subject receiving a treatment for an angiogenic eye disorder as set forth herein achieves one or more of the following:
- CTR central retinal thickness
- o a decrease in central retinal thickness
- o a decrease in central retinal thickness by at least about 123, 125, 131 , 142, 147, 149, 150, 151 , 156, 157, 158, 159, 161 , 162, 166, 167, 168, 172, 173, 175, 177, 178 or 183 micrometers (or more), for example, by about week 4, 8, 9, 12, 16,
- the baseline (prior to treatment) CRT is about 488, 492, 497 or 516 micrometers; o a decrease in CRT of about 47 micrometers (or more) from about week 12 to about week 20 following the initial dose, e.g., wherein the baseline CRT is about 516 micrometers; o a decrease in CRT of about 17 micrometers (or more) from about week 24 to about week 32 following the initial dose, e.g., wherein the baseline CRT is about 516 micrometers; o a decrease in CRT of about 18 micrometers (or more) from about week 36 to about week 44 following the initial dose, e.g., wherein the baseline CRT is about 516 micrometers; o a decrease in central retinal thickness by at least about 4 or 24.3 micrometers (or more) from about week 12 to about week 16, for example, wherein the baseline CRT, prior to treatment, is about 516 micrometers;
- a dry retina e.g., no IRF and no SRF; or no IRF; or no SRF, e.g., in the center subfield or in the macula, e.g., on SD-OCT
- o no fluid in the center subfield e.g., no IRF and no SRF; or no IRF; or no SRF
- o no sub-retinal pigment epithelium (RPE) fluid e.g., by about week 16, e.g., until at least about week 44 following the initial dose (e.g., as measured by SD-OCT);
- o no SRF and IRF in the macula e.g., by SD-OCT, e.g., by week 16 or week 44 following the initial dose, and/or o maintenance of a dry retina
- RPE sub-retinal pigment epithelium
- S
- the center subfield of the retina is a 1 mm diameter area around the macula.
- the macula itself is about 6 mm in diameter.
- the present invention also includes methods for achieving any one or more of the foregoing in a subject (e.g., increase in VA or BCVA, or decrease in CRT) suffering from an angiogenic eye disorder, e.g., nAMD, DR or DME, comprising administering to an eye of the subject, a single initial dose of about 8 mg or more of a VEGF antagonist (e.g., aflibercept), followed by one or more (e.g., 3, 4 or 5) secondary doses of about 8 mg or more of the VEGF antagonist, followed by one or more tertiary doses of about 8 mg or more of the VEGF antagonist; wherein each secondary dose is administered about 2 to 4 weeks after the immediately preceding dose; and wherein each tertiary dose is administered about 12 weeks after the immediately preceding dose.
- a VEGF antagonist e.g., aflibercept
- the present invention includes methods for treating or an angiogenic eye disorder (e.g., nAMD, DR, DME or ME-RVO), in a subject in need thereof, comprising administering to an eye of the subject, a single initial dose of about 8 mg or more of a VEGF antagonist (e.g., aflibercept), followed by one or more secondary doses of about 8 mg or more of the VEGF antagonist, followed by one or more tertiary doses of about 8 mg or more of the VEGF antagonist; wherein each secondary dose is administered about 2 to 4 weeks after the immediately preceding dose; and wherein each tertiary dose is administered about 12 weeks after the immediately preceding dose; wherein the subject achieves a change in central retinal thickness, from baseline at the initiation of treatment, as depicted in Figure 54 or Figure 55 (or a greater reduction), e.g., by the timepoint shown for such a change; and/or wherein the subject achieves a change in central retinal thickness, during the
- BCVA Best Corrected Visual Acuity
- Best corrected visual acuity can be measured in various methods known in the art. First, determining the proper level of lens refraction needed to best correct the visual acuity (VA) of a subject is determined before testing best corrected visual acuity (BCVA) with a visual acuity chart.
- Two separate VA charts used for testing the right and left eye e.g., Sloan Letter ETDRS Chart 1 and Sloan Letter ETDRS Chart 2, respectively
- a third refraction chart is used for testing appropriate refraction (e.g., Sloan Letter ETDRS Chart R).
- the features of the Sloan charts are high-contrast Sloan letters of equal difficulty, 5 letters in each of 14 rows, and a geometric progression of letter size (and, thus, an arithmetic progression of the logarithm of minimum angle of resolution [LogMAR]) from row to row.
- the charts have different letter sequences.
- BCVA can be measured first in one eye with a visual acuity chart, and then in the other eye with another visual acuity chart (e.g., Charts 1 and 2 as discussed herein), wherein each chart remains hidden from view until the eye in question is ready for testing.
- the distance from the subject's eyes to the visual acuity chart is typically 4 meters (13 feet and 1.5 inches, or 157.5 inches).
- the subject should be asked to read slowly (e.g., at a rate not faster than about one letter per second). Eyes reading 19 or fewer letters correctly at 4 meters can be tested at 1 meter.
- VA visual acuity
- BCVA BCVA
- EDRS Early Treatment Diabetic Retinopathy Study
- EDRS chart The “ETDRS chart” and the protocol to test vision with the chart is commonly used in clinical trials.
- the ETDRS chart is typically tested from a shorter distance (13 feet (or 4 meters) rather than 20 feet) than Snellen, but does not allow the use of mirrors to simulate the correct distance, has the same amount of letters in every row (five letters each), and has an equal spacing of both the letters and the rows on a logarithmic scale.
- the Snellen Chart uses a geometric scale to measure visual acuity, with normal vision at a distance being set at 20/20.
- VA or BCVA can be expressed in terms of ETDRS or Snellen.
- ETDRS VA values can be converted to a corresponding Snellen equivalent using methods known in the art.
- VA or BCVA is measured with an ETDRS chart or with a Snellen chart.
- a VEGF antagonist e.g., aflibercept
- a drug delivery device e.g., with a 0.5 ml_ volume
- the DDD is a syringe, e.g., with a 30 gauge, 1 ⁇ 2 inch needle.
- One means for ensuring precision of a dose to be delivered with a device is by employing a syringe wherein the dose volume is device-determined. If the dose volume is device-determined, the device is designed only to deliver a single volume (e.g., 87 microliters) or a single volume with a limited amount of acceptable error (+ 4-5 microliters). Thus, if used properly, the user cannot deliver the wrong dose (e.g., cannot deliver more than the intended volume from the device).
- the present invention includes embodiments wherein, a precise dosage of about 8 mg or more is a dose of about 9, 9.3, 9.33, 9.7, 9.8, 9.9, 9.7-9.9 mg or more + about 0.5, or + about 0.51 mg is delivered to a subject’s eye.
- the volume in which a dose is delivered can be, for example, about 70, 81 , 82, 81.7, 85, 86, 87, 85-87 microliters + about 4, 4.45, 4.5, or 5 microliters.
- Doses may be delivered with a dose delivery device (DDD) which is a syringe.
- DDD dose delivery device
- VEGF antagonist e.g., aflibercept
- a method that includes the steps: (a) priming the syringe (e.g., a pre-filled syringe), thereby removing air from the syringe and, thus avoiding injection of air into the eye, by advancing the plunger rod by a predetermined distance into the syringe body until advancement of the plunger rod is resisted by a stop; (b) rotating the plunger rod about a longitudinal axis; and (c) actuating the plunger rod to dispense a predetermined (device-determined) volume (e.g., about 70, 81, 82, 81.7, 85, 86, 87, 85-87 microliters, + about 4, 4.45, 4.5, or 5 microliters) of the formulation.
- a predetermined (device-determined) volume e.g., about 70, 81, 82, 81.7, 85, 86, 87, 85-87 microliters,
- the drug delivery device comprises:
- a barrel including a longitudinal axis, a proximal end region, and a distal end region, the proximal end region including an opening, wherein the barrel is configured to receive a drug therein;
- a plunger rod disposed at least partially inside the barrel and protruding from the opening, wherein the plunger rod includes a rack having a plurality of teeth;
- the DDD further includes a magnifier disposed on the distal end region of the barrel.
- the DDD further includes a stopper inside the barrel, wherein the stopper is affixed to a distal end of the plunger rod.
- the DDD further includes a circular ratchet disposed coaxially with the pinion, wherein the circular ratchet has a diameter smaller than a diameter of the pinion; a spring-loaded pawl disposed on an internal circumference of the pinion, wherein the pawl is configured to engage the ratchet; and a shaft affixed to the ratchet, wherein rotation of the shaft in one direction causes rotation of the pinion, and rotation of the shaft in a second direction does not cause rotation of the pinion for example wherein the ratchet is disposed inside the pinion.
- the pinion includes a plurality of teeth having a first height, and a stopper tooth having a second height greater than the first height, for example, wherein the second height of the stopper tooth prevents the pinion from engaging the plurality of teeth of the rack, and/or wherein the second height of the stopper tooth is configured to contact one of the plunger rod and the rack to stop rotation of the pinion.
- the plunger rod includes an inner column and an outer lumen, and wherein the rack is disposed on the inner column, e.g., wherein rotation of the pinion against the rack moves the inner column of the plunger rod independently of the outer lumen, and/or further including a shaft removably affixed to the pinion, wherein the shaft prevents movement of the outer lumen of the plunger rod relative to the barrel, and wherein removal of the shaft allows for movement of the outer lumen of the plunger rod relative to the barrel.
- the plunger rod further includes a body and a flange, the flange extending partially along a longitudinal length of the body and having a width greater than a width of the body; wherein the barrel further comprises a plunger lock, the plunger lock including a through hole configured to allow the flange to pass through the second plunger lock in a specific orientation.
- the drug delivery device comprises:
- a barrel including a longitudinal axis, a proximal end region, a distal end region, and an interior, the proximal end region including an opening and the interior including a threaded region;
- a plunger rod disposed at least partially inside the barrel and protruding from the opening, the plunger rod including a threaded region configured to engage the threaded region of the barrel interior, wherein rotation of the plunger rod about the longitudinal axis of the drug delivery device moves the plunger rod along the longitudinal axis.
- the plunger rod further includes a tab protruding from the plunger rod in a first direction and located proximally from the threaded region of the plunger rod, and wherein the threaded region in the interior of the barrel further includes a slot sized and configured to allow for the tab to pass through the threaded region in the interior of the barrel, e.g., wherein the slot includes a first segment parallel to the longitudinal axis of the drug delivery device and a second segment perpendicular to the longitudinal axis of the drug delivery device — the slot may include a third segment parallel to the longitudinal axis of the drug delivery device, wherein the second segment is in between the first segment and the third segment.
- the tab is a first tab
- the plunger rod further includes a second tab protruding from the plunger rod in a second direction opposite to the first direction
- the threaded region in the interior of the barrel further includes a second slot sized and configured to allow for the second tab to pass through the threaded region in the interior of the barrel.
- the drug delivery device includes:
- a barrel having a proximal end region, a distal end region, an opening in the proximal end region, an interior, and a threaded region in the interior;
- a sleeve disposed partly inside the barrel and protruding from the opening in the proximal end region of the barrel, the sleeve including a threaded region engaged with the threaded region of the barrel interior;
- rotation of the sleeve in the first direction moves the stopper towards the distal end region of the barrel.
- the sleeve includes an inner passage, and the stopper has a diameter larger than a diameter of the inner passage; and/or the sleeve includes a tab disposed on an exterior of the sleeve, the tab located proximally from the threaded region of the barrel interior, and wherein the tab stops movement of the sleeve towards the distal end region of the barrel, e.g., wherein the tab is configured to stop movement of the sleeve towards the distal end region of the barrel after the drug delivery device has been primed or wherein the tab is a first tab, and wherein the sleeve further includes a second tab disposed on an exterior of the sleeve, the second tab located distally from the threaded region of the barrel interior, wherein the second tab stops movement of the sleeve towards the proximal end region of the barrel.
- the drug delivery device comprises:
- a barrel including a proximal end region and a distal end region, the proximal end region including an opening
- a plunger rod including a body and a flange, the flange extending partially along a longitudinal length of the body and having a width greater than a width of the body, the plunger rod disposed at least partially inside the barrel and protruding from the opening;
- a second plunger lock disposed in the barrel, the second plunger lock including a through hole configured to allow the flange to pass through the second plunger lock in a specific orientation.
- the first plunger lock is removable and/or frangible.
- a distance between the first plunger lock and the second plunger lock is equivalent to the distance that the stopper must travel to prime the drug delivery device; and/or the plunger rod is rotatable around a longitudinal axis of the drug delivery device.
- Substances from such a DDD e.g., a formulation including aflibercept as described herein, having a plunger rod and a barrel, may be dispensed as follows:
- Advancing the plunger rod may include the step of rotating a pinion against a rack disposed on the plunger rod, e.g., wherein the stop comprises a shaft removably affixed to the pinion, and wherein deactivating the stop comprises removing the shaft from the pinion.
- Deactivating the stop may include the step of rotating the plunger rod.
- deactivating the stop includes the step of removing the lock and/or breaking the lock.
- the drug delivery device includes:
- a barrel including a longitudinal axis, a proximal end region, and a distal end region, the proximal end region including an opening and a rack disposed on the interior of the barrel, the rack having a plurality of teeth, wherein the barrel is configured to receive a drug therein;
- a plunger rod disposed at least partially inside the barrel and protruding from the opening, wherein the plunger rod includes a rack having a plurality of teeth; a pinion having a plurality of teeth configured to engage with the plurality of teeth of the plunger rod rack; and
- the pinion is a first pinion, and further includes: a second pinion disposed coaxially with the first pinion, the second pinion having a diameter smaller than a diameter of the first pinion and a plurality of teeth configured to engage with the plurality of the teeth of the rack disposed on the barrel, wherein rotation of the first pinion results in rotation of the second pinion against the rack disposed on the barrel and in movement of the inner plunger along the longitudinal axis of the barrel.
- the drug delivery device includes:
- a blocking component coupled to a proximal end portion of the body, wherein the blocking component is a flange piece, wherein, when the protrusion is in a first position relative to the blocking component, the blocking component restricts distal movement of the plunger rod to a first stopping point, and when the protrusion is in a second position relative to the blocking component, the blocking component restricts distal movement of the plunger rod to a second stopping point.
- the DDD further includes: a stopper disposed in the body, wherein distal movement of the plunger rod distally moves the stopper; and a drug substance disposed in the body in between the stopper and a distal end of the body, wherein distal movement of the plunger rod to the first stopping point primes the drug delivery device, and distal movement of the plunger rod to the second stopping point dispenses a predetermined volume of the drug substance from a distal end of the device.
- moving the protrusion from the first position to the second position includes twisting the plunger rod relative to the blocking component.
- the DDD further includes: a cavity in a proximal side of the blocking component, the cavity sized and configured to receive a portion of the protrusion, wherein when the protrusion is in the second position relative to the blocking component, the protrusion is positioned proximally from the cavity, such that distal movement of the plunger rod moves the protrusion into the cavity; e.g., wherein the cavity is a first cavity, and further includes: a second cavity in a proximal side of the blocking component, the second cavity sized and configured to receive a portion of the protrusion, wherein the first and second cavity are located on opposite sides of a central longitudinal axis of the drug delivery device.
- the plunger rod passes through an opening in the blocking component.
- the DDD further includes an actuation portion at a proximal end portion of the plunger rod, wherein the protrusion extends from the actuation portion, e.g., wherein the actuation portion includes a generally cylindrical shape having a diameter greater than a width of the remainder of the plunger rod, wherein the protrusion extends from a side of the generally cylindrical shape, and wherein the actuation portion further comprises: a thumb pad on a proximal end of the actuation portion; and a ring on an exterior surface on the side of the generally cylindrical shape; e.g., further including a proximal collar on the blocking component, wherein the actuation portion partially fits inside the proximal collar; e.g., wherein the plunger rod further includes a pair of extensions protruding distally from the actuation portion and the blocking component (e.g., which includes one or more indents
- the protrusion is a first protrusion, and further includes a second protrusion extending from the plunger rod in a direction opposite to the first protrusion.
- the blocking component is slidably coupled to the body and includes a third cavity and a pair of ribs that extend into the third cavity, wherein the body includes a top flange and the pair of ribs are configured to engage the top flange received in the third cavity; wherein the pair of internal ribs are configured to apply a distally-directed force onto the top flange.
- the blocking component is slidably coupled to the body and includes a pair of movable tabs that are configured to engage the body; and the pair of movable tabs are laterally deflectable upon receiving the body in the blocking component and are configured to apply a radially-inward directed force onto the body.
- the blocking component further includes a pair of finger flanges, and each of the finger flanges includes a textured surface having a predefined pattern that increases a grip of the blocking component.
- the drug delivery device includes:
- a plunger rod having a distal end contacting a stopper inside the body, and a proximal end including an actuation portion with a thumb pad;
- a blocking component disposed on the body, the blocking component including a proximal collar having a plurality of slots, wherein, when the protrusions and the slots are in a first configuration relative to one another, the blocking component restricts distal movement of the plunger rod to a first stopping point, and when the protrusions and the slots are in a second configuration, the blocking component restricts distal movement of the plunger rod to a second stopping point, wherein, in the second configuration, the slots are configured to receive the protrusions upon distal movement of the plunger rod.
- the protrusions and the slots are movable from the first configuration to the second configuration by rotation of the actuation portion about a longitudinal axis in relation to the blocking component, and wherein when the protrusions and the slots are in the second configuration, the protrusions and the slots are not movable to the first configuration; and/or a difference between the first stopping point and the second stopping point is equivalent to a distance that the stopper must travel to expel a predetermined volume of a drug product from a distal end of the body, and wherein the plunger rod is prevented from moving from the second stopping point to the first stopping point; and/or the plurality of protrusions includes two protrusions disposed symmetrically about the actuation portion; and/or the blocking component further comprises a pair of finger flanges; and/or the drug delivery device is a pre-filled syringe; and/or the drug delivery device is changeable: (a) from a pre use state to a primed state, by longitudinally moving
- a drug delivery device includes:
- a plunger rod including:
- a blocking component coupled to the body, the blocking component including: a collar configured to accept a distal part of the actuation portion; and two cavities in the collar having proximally-facing openings, wherein each cavity is configured to accept a distal portion of one of the two protrusions; wherein the plunger rod is longitudinally movable and rotatable about a longitudinal axis relative to the blocking component, and wherein, when the drug delivery device is in a pre-use state, the protrusions and the cavity openings are not longitudinally aligned, and when the drug delivery device is in a delivery state, the protrusions and the cavity openings are longitudinally aligned.
- the blocking component further includes a finger flange, and further includes a ribbed surface on a side of the actuation portion.
- the plunger rod further includes: two extensions protruding distally from the actuation portion; and a plurality of openings in the collar of the blocking component, wherein a portion of each extension is configured to be received by one of the plurality of openings upon distal movement of the plunger rod relative to the blocking component.
- a drug delivery device includes:
- a sleeve having a proximal end and a distal end, the distal end being disposed inside the body, proximally from the stopper;
- a plunger rod disposed at least partially inside the sleeve; wherein, when the stopper is in a ready position, distal advancement of one of (a) only the sleeve, (b) only the plunger rod, or (c) both the sleeve and the plunger rod together, relative to the body advances the stopper to a primed position, and wherein, when the stopper is in the primed position, distal advancement of another of (a) only the sleeve, (b) only the plunger rod, or (c) both the sleeve and the plunger rod together, relative to the body advances the stopper to a dose completion position.
- a DDD further includes a removable blocking component (e.g., wherein the blocking component is a clip removably secured around at least a portion of the sleeve) disposed between a proximal portion of the sleeve and a proximal end of the body, the blocking component obstructing distal advancement of the sleeve relative to the body, wherein distal advancement of the sleeve relative to the body after removal of the blocking component advances the stopper to the primed position.
- a removable blocking component e.g., wherein the blocking component is a clip removably secured around at least a portion of the sleeve
- the DDD further includes a removable locking component (e.g., a pin, a tab, or a bar) that couples the plunger rod to the sleeve, wherein distal advancement of both the sleeve and the plunger rod together relative to the body advances the stopper to the primed position, wherein distal advancement of only the plunger rod relative to the body after removal of the locking component advances the stopper to the dose completion position.
- a proximal end of the plunger rod abuts against a distal end of the sleeve, such that the plunger rod is prevented from advancing distally any further relative to the body.
- the DDD further includes a protrusion disposed on the plunger rod; and an inner protrusion disposed on an interior wall of the sleeve distally to the protrusion of the plunger rod, wherein distal advancement of only the plunger rod relative to the body advances the stopper to the primed position and causes the protrusion of the plunger rod to contact the inner protrusion of the sleeve, and wherein distal advancement of both the plunger rod and the sleeve relative to the body, after the protrusion of the plunger rod has contacted the inner protrusion of the sleeve, advances the stopper to the dose completion position.
- the sleeve includes a finger flange.
- the DDD further includes a stop disposed at a proximal end of the body, the stop sized to block distal advancement of the sleeve or the plunger rod once the stopper is in the completion position.
- a drug delivery device includes:
- a plunger rod having a distal portion disposed inside the body and a proximal portion disposed outside a proximal end of the body, the proximal portion having a width greater than a width of the distal portion;
- an obstruction that, in an obstructing position relative to the plunger rod, prevents distal advancement of the plunger rod from a primed position to a dose completion position, wherein displacement of the obstruction from the obstructing position permits distal advancement of the plunger rod to the dose completion position, for example, further including a collar affixed to a proximal end portion of the body, the collar surrounding the proximal portion of the plunger rod; and a collar projection extending radially inward from the collar, wherein the proximal portion of the plunger rod includes a channel into which the collar projection protrudes, the channel including a circumferential path and an axial dose completion path, wherein the obstruction comprises the collar projection, which, when disposed in the circumferential path of the channel, prevents distal advancement of the plunger rod to the dose completion position, and wherein displacement of the obstruction from the obstructing position comprises twisting the plunger rod about a longitudinal axis to align the collar projection with the axial dose completion path.
- the channel further includes an axial priming path offset from the axial dose completion path, and connected to the axial dose completion path by the circumferential path, and distal movement of the plunger rod such that the collar projection travels on the axial priming path advances the plunger rod to the primed position.
- the DDD further includes a finger flange.
- the proximal portion of the plunger rod includes a projection extending radially outward
- the drug delivery device further includes: a rotatable alignment component disposed in between the proximal portion of the plunger rod and the body, the alignment component including a channel, the channel sized and configured to accommodate the plunger rod projection, wherein the obstruction comprises a wall of the channel that blocks a distal axial path of the plunger rod projection when the plunger rod is in the primed position, and wherein displacement of the obstruction from the obstructing position comprises rotating the alignment component to remove the wall of the channel from the distal axial path of the plunger rod projection, e.g., further including a finger flange coupled to a proximal end portion of the body, wherein the rotatable alignment component is disposed between the finger flange and the proximal portion of the plunger rod.
- the DDD further includes a flange piece disposed at the proximal end of the body, wherein the obstruction includes a removable cap that, when in the obstructing position relative to the plunger rod, is disposed partially in between the proximal portion of the plunger rod and the flange piece.
- removal of the cap allows the proximal portion of the plunger rod to advance to a dose completion position, wherein, in the dose completion position, the proximal portion of the plunger rod contacts the flange piece.
- the removable cap covers the proximal portion of the plunger rod when in the obstructing position.
- the DDD further includes a collar disposed between the proximal end of the body and the proximal portion of the plunger rod, the collar defining an opening sized to accommodate the proximal portion of the plunger rod upon distal advancement of the plunger rod beyond a primed position; wherein the obstruction comprises a tab protruding radially outward from the proximal portion of the plunger rod, the tab preventing the proximal portion of the plunger rod from fitting into the opening of the collar, and wherein a depth of the collar opening coincides with a distance the plunger rod must travel to advance distally to the dose completion position, e.g., wherein displacement of the obstruction from the obstructing position comprises either removing the tab or compressing the tab into a side of the proximal portion of the plunger rod; and/or wherein the tab is a first tab, and wherein the obstruction further comprises a second tab protruding radially outward from the proximal portion of the plunger rod
- displacement of the obstruction may include removing the tab from the drug delivery device by pulling the tab.
- the DDD further includes a flange piece, wherein a portion of the tab is disposed inside a cavity of the flange piece.
- displacement of the obstruction comprises removing the tab from the drug delivery device by breaking the tab.
- the obstruction includes a flange piece that, in the obstructing position, is disposed proximally from the proximal end of the body, between the proximal portion of the plunger rod and the body, and is spaced from the proximal end of the body by a removable blocking component, and wherein displacement of the obstruction from the obstructing position comprises: removing the blocking component; and shifting the flange piece distally towards the proximal end of the body.
- the plunger rod includes a projection extending radially outward
- the obstruction includes a lever having an end that, in the obstructing position, is located distally from the projection and blocks distal movement of the projection and thereby distal movement of the plunger rod, and wherein displacement of the obstruction from the obstructing position comprises actuating the lever to remove the end of the lever from its location distal from the projection.
- distal advancement of the plunger rod beyond the dose completion position is prevented by contact between the proximal portion of the plunger rod and a portion of a flange piece coupled to the body.
- the drug delivery device includes:
- a sleeve affixed to the body, the sleeve including a proximal end, a distal end, and an opening disposed in a circumferential wall of the sleeve;
- a plunger rod passing through the sleeve the plunger rod including a distal end portion disposed inside the body, and a radially-extending protrusion; wherein the plunger rod may be distally advanced into the body from a ready position to a primed position, wherein, in the primed position, the protrusion of the plunger rod is disposed inside the opening, and further distal advancement of the plunger rod is resisted by contact between the protrusion and a wall of the opening, and wherein pressure may be exerted on the protrusion to overcome the resistance to further distal advancement of the plunger rod.
- the opening in the sleeve is a second opening
- the sleeve further includes a first opening disposed in the circumferential wall of the sleeve proximally from the second opening, and a third opening disposed in the circumferential wall of the sleeve distally from the second opening, wherein, in the ready position, the protrusion of the plunger rod is disposed in the first opening, and further distal advancement of the plunger rod is resisted by contact between the protrusion and a wall of the first opening, and wherein, after further distal advancement of the plunger rod past the primed position, the protrusion of the plunger rod is disposed in the third opening, and further distal advancement of the plunger rod is prevented.
- the radially-extending protrusion is a first protrusion
- the plunger rod further includes a second radially-extending protrusion opposite the first protrusion, and wherein squeezing the first and second protrusions towards one another while applying axial pressure in the distal direction on the plunger rod overcomes the resistance to further distal advancement of the plunger rod.
- the protrusion includes a distally-tapering profile to aid in distal advancement of the plunger rod.
- a drug delivery device includes:
- a sleeve affixed to the body, the sleeve including a proximal opening into which the plunger rod may be advanced, wherein rotating the rotatable element causes distal advancement of the plunger rod to a primed position, and wherein once the plunger rod is in the primed position, further rotation of the rotatable element is resisted.
- the DDD further includes a collar disposed at a proximal end of the body, an interior of the collar including a proximal threaded portion forming a proximal helical path, wherein the rotatable element comprises a proximal portion of the plunger rod including a protrusion, wherein the proximal portion of the plunger rod may be rotated about a longitudinal axis to cause the protrusion to travel distally along the proximal helical path, and wherein once the protrusion reaches the end of the proximal threaded portion of the collar, the plunger rod is in the primed position, e.g., wherein once the plunger rod is in the primed position, the plunger rod may be depressed axially into the body to distally advance the plunger rod to a dose completion position; and/or wherein the interior of the collar further includes a distal threaded portion, wherein threads of the distal threaded portion form a
- the DDD further includes a flange piece having a collar, and advancing the plunger rod and actuating the plunger rod comprise pressing an actuation portion of the plunger rod into the collar of the flange piece; for example, wherein the plunger rod comprises a protrusion, and wherein the collar of the flange piece abuts against the protrusion to resist advancement of the plunger rod.
- rotating the plunger rod comprises twisting an actuation portion of the plunger rod relative to the flange piece, until a protrusion on the plunger rod becomes longitudinally aligned with a cavity in the collar of the flange piece, which may further include advancing the protrusion into the cavity until the protrusion abuts a distal side of the cavity, wherein the predetermined volume of the substance is dispensed when the protrusion abuts the distal side of the cavity.
- Example 1 A Randomized, Single-Masked, Active-Controlled Phase 2 Study of the Safety, Tolerability, and Efficacy of Repeated Doses of High-Dose Aflibercept in Patients with Neovascular Age-Related Macular Degeneration (CANDELA trial).
- This phase 2 multi-center, randomized, single-masked study in patients with nAMD investigated the efficacy, safety, and tolerability of HD (8 mg doses) versus IAI (2mg doses).
- the Study dosing regimen is summarized in Figure 1. The Study consisted of a screening/baseline period, a treatment period, and an end of study (EOS) visit at week 44. Patients were seen monthly through week 44.
- Anatomical findings that are considered vision threatening such as worsening or persistent retinal fluid, new or worsening PED (pigment epithelial detachment), new or persistent hemorrhage, etc.
- the study also includes a pharmacokinetic (PK) sub-study, with dense blood sampling (dense PK sub-study) for systemic drug concentrations and PK assessments for approximately 15 patients from each group from selected sites. Additional patients (up to approximately 50% more in each treatment group) may be enrolled in the dense PK sub study to ensure adequate data is are captured.
- PK pharmacokinetic
- Week 16 Additional treatment allowed after discussion with sponsor [0163] See also Table 1-2 herein. As discussed in this Example, IAI dosing regimens call for 2 mg doses given as defined in Table 1-1 ; and HD dosing regimens call for 8 mg doses given as defined in Table 1-1.
- Exploratory Endpoints [0166] The exploratory endpoints are:
- BCVA Best Corrected Visual Acuity
- CNV choroidal neovascularization
- the efficacy variable relevant to the primary efficacy endpoint is the assessment of retinal fluid.
- the efficacy variables relevant to the exploratory endpoints are:
- the safety variable relevant to the primary safety endpoint is the proportion of patients with TEAEs and SAEs.
- the PK variables are the concentrations of free and bound aflibercept in plasma at each time point using both sparse sampling and dense sampling.
- the study will enroll approximately 100 patients to be randomized in a 1:1 ratio. Study Population
- the study population consists of treatment-naive patients with nAMD.
- a patient must meet the following criteria at both the screening and/or the randomization visits to be eligible for inclusion in the study:
- BCVA Best Corrected Visual Acuity
- EDRS Early Treatment Diabetic Retinopathy Study
- IVT anti-VEGF agents aflibercept, ranibizumab, bevacizumab, brolucizumab, pegaptanib sodium
- Prior IVT investigational agents in either eye e.g., anti-ang-2/anti-VEGF bispecific monoclonal antibodies, gene therapy).
- fluorescein angiography FA
- OCT e.g., due to media opacity, allergy to fluorescein dye or lack of venous access
- Uncontrolled BP defined as systolic >140 mm Hg or diastolic >90 mm Hg.
- Patients may be treated with up to 3 agents known to have anti-hypertensive effects for arterial hypertension to achieve adequate BP control. This limit applies to drugs that could be used to treat hypertension even if their primary indication in the patient was not for BP control. Any recent changes in medications known to affect BP need to be stable for 90 days prior to the screening visit.
- Highly effective contraceptive measures include: a. stable use of combined (estrogen and progestogen containing) hormonal contraception (oral, intravaginal, transdermal) or progestogen-only hormonal contraception (oral, injectable, implantable) associated with inhibition of ovulation initiated 2 or more menstrual cycles prior to screening.
- IUD intrauterine device
- IUS intrauterine hormone-releasing system
- bilateral tubal ligation d. vasectomized partner e. and or sexual abstinence ⁇ , ⁇
- ⁇ Sexual abstinence is considered a highly effective method only if defined as refraining from heterosexual intercourse during the entire period of risk associated with the study treatments.
- ⁇ Periodic abstinence (calendar, symptothermal, post-ovulation methods), withdrawal (coitus interruptus), spermicides only, and lactational amenorrhea method (LAM) are not acceptable methods of contraception.
- Female condom and male condom should not be used together.
- the HD will be provided as a liquid formulation in a vial.
- the target concentration of aflibercept is 114.3 mg/mL.
- the dose will be delivered in an injection volume of 70 microliters.
- the IAI will be provided as a liquid formulation in a vial.
- the target concentration of aflibercept is 40 mg/mL.
- the dose will be delivered in an injection volume of 50 microliters.
- Deviation from the treatment schedule defined in the protocol is discouraged. Efforts should be made to ensure adherence to the protocol-specified dosing intervals. If, however, in the investigator’s judgement, a patient cannot adhere to the protocol-specified dosing interval due to persistent or worsening disease and requires an interim injection, the patient may receive additional treatment at week 16. The investigator must make reasonable efforts to consult with the study director or sponsor designee prior to additional treatment being allowed.
- Patients will receive their randomized dose of aflibercept if it is determined that additional treatment will be administered. Patients who receive additional treatment will continue to receive their randomized treatment at future visits and will remain masked to treatment assignment. Data from patients receiving additional treatment will be censored from the time additional treatment is administered.
- Any treatment administered from the time of informed consent to the final study visit will be considered concomitant medication. This includes medications that were started before the study and are ongoing during the study.
- a pretreatment concomitant medication is administered in the study eye before injection (e.g., antibiotic or anesthetic), it must be administered for fellow eye treatment as well.
- Patients are not allowed to receive any standard or investigational treatment for nAMD in the study eye other than their assigned study treatment with HD or IAI, as specified in the protocol.
- IAI (2 mg) will be allowed and supplied through the IWRS (Interactive web response system). Patients are not allowed to receive any other anti-VEGF agent in the fellow eye. Patients enrolled in the dense PK sub-study cannot receive IAI (2 mg) in the fellow eye before week 12.
- Non-ocular (systemic) standard or investigational treatments for nAMD of the study or fellow eye are not permitted.
- Systemic anti-angiogenic agents and anti-Ang2 inhibitors are not permitted during the study.
- BCVA Best Corrected Visual Acuity
- ECG electrocardiogram
- EOS end of study
- ETDRS Early Treatment Diabetic Retinopathy Study
- FA fluorescein angiography
- FBR future biomedical research
- FP fundus photography
- IOP lntraocular pressure
- PK pharmacokinetics
- PRN pro re nata (as needed)
- SDOCT spectral domain optical coherence tomography
- UPCR urine protein:creatinine ratio.
- the visit window is ⁇ 0 days.
- the visit window is ⁇ 2 days.
- genomic and FBR sub-study ICF informed consent form
- the genomic DNA sample should be collected on day 1/baseline (pre-dose) or at any study visit from patients who have signed the sub-study ICF.
- Intraocular pressure will be measured bilaterally at all study visits. On days when study drug is administered, IOP should also be measured approximately 30 minutes after administration of study drug, in the study eye only. Intraocular pressure will be measured using Goldman applanation tonometry or Tono-penTM and the same method of measurement must be used in each patient throughout the study.
- Indirect ophthalmoscopy should be performed bilaterally at all visits. On days when study drug is administered, it should also be performed immediately after administration of study drug (study eye only).
- Timing of BP assessment at all visits must be within 2 hours of planned time of dosing on day 1 for patients in the dense PK sub-study. For all other patients, this window should be adhered to as closely as possible.
- urinalysis/UPCR will also be collected according to the schedule in Table 1-2.
- Dense PK sampling will be performed in approximately 30 patients (15 in each group) drawn according to the schedule in Table 1-2. On dosing days, BP (blood pressure) and PK samples must be collected prior to study drug administration. Additional patients (up to approximately 50% more in each treatment group) may be enrolled in the dense PK sub study to ensure adequate data is are captured.
- Timing of all BP assessments must be within ⁇ 2 hours of the time of dosing on day 1.
- Blood pressure assessments will be taken using automated office blood pressure (AOBP) with the Omron Model HEM 907XL (or comparable). Measures will be taken in triplicate and a mean measure as displayed by the device will be recorded in the EDC. Detailed instructions can be found in the study procedure manual.
- AOBP automated office blood pressure
- Intraocular pressure will be measured at approximately 4 hours post-dose only if the IOP measurement from approximately 30 minutes to 60 minutes post-dose remains clinically significantly higher than the pre-injection reading.
- Intraocular pressure will be measured at approximately 8 hours post-dose only if the IOP measurements from approximately 30 minutes to 60 minutes and approximately 4 hours post-dose remain clinically significantly higher than the pre-injection reading.
- PK draw for all assessment days are to be performed within ⁇ 2 hours of the time of dosing on day 1.
- Intraocular Pressure Intraocular Pressure will be measured in both eyes at every visit using Goldmann applanation tonometry or Tono penTM, as specified in Table 1-2. The same method of IOP measurement must be used throughout the study for each individual patient. On dosing visits, IOP will also be measured approximately 30 minutes post-dose (study eye).
- IOP will also be measured 4 hours post dose if the reading from approximately 30 minutes to 60 minutes post-dose remains clinically significantly higher than the pre-dose reading, and again at approximately 8 hours post-dose if the reading from approximately 4 hours post-dose remains clinically significantly higher than the pre-dose reading.
- Spectral Domain Optical Coherence Tomography Retinal characteristics will be evaluated at every visit using SD-OCT. Images will be captured and transmitted for both eyes. Images will be sent to an independent reading center where they will be read by masked readers. All OCTs will be electronically archived at the study site as part of the source documentation. Optical coherence tomography technicians must be certified by the reading center to ensure consistency and quality in image acquisition. A detailed protocol for acceptable OCT machines and OCT image acquisition/transmission can be found in the study procedure manual. Imaging technicians should remain masked to treatment assignment.
- Adverse Event An AE is any untoward medical occurrence in a patient administered a study drug which may or may not have a causal relationship with the study drug. Therefore, an AE is any unfavorable an unintended sign (including abnormal laboratory finding), symptom, or disease which is temporally associated with the use of a study drug, whether or not considered related to the study drug (ICH E2A Guideline. Clinical Safety Data Management: Definitions and Standards for Expedited Reporting, Oct 1994).
- Serious Adverse Event An SAE is any untoward medical occurrence that at any dose:
- Results in death - includes all deaths, even those that appear to be completely unrelated to study drug (e.g., a car accident in which a patient is a passenger). Is life-threatening - in the view of the investigator, the patient is at immediate risk of death at the time of the event. This does not include an AE that had it occurred in a more severe form, might have caused death.
- Inpatient hospitalization is defined as a hospital admission (any duration) or an emergency room visit for longer than 24 hours.
- Prolongation of existing hospitalization is defined as a hospital stay that is longer than was originally anticipated for the event or is prolonged due to the development of a new AE as determined by the investigator or treating physician
- Is an important medical event - Important medical events may not be immediately life-threatening or result in death or hospitalization, but may jeopardize the patient or may require intervention to prevent one of the other serious outcomes listed above (e.g., intensive treatment in an emergency room or at home for allergic bronchospasm; blood dyscrasias or convulsions that do not result in hospitalization; or development of drug dependency or drug abuse).
- Ocular important medical event may include the following:
- Treatment for symptom may be needed.
- Severe Produces significant impairment of functioning or incapacitation and is a definite hazard to the patient’s health. Treatment for symptom may be given and/or patient hospitalized. If a laboratory value is considered an AE, its severity should be based on the degree of physiological impairment the value indicates.
- the AE follows a reasonable temporal sequence from study drug administration, and cannot be reasonably explained by the nature of the reaction, patient’s clinical (e.g., disease under study, concurrent diseases, concomitant medications), or other external factors; or the AE follows a reasonable temporal sequence from study drug administration, and is a known reaction to the drug under study or its class of drugs, or is predicted by known pharmacology.
- the PK parameters to be determined after the first dose for free and bound aflibercept may include, but are not limited to:
- PK parameters to be determined may include, but are not limited to, C trough , time to reach steady-state, and accumulation ratio.
- concentrations of free and bound aflibercept over time and selected PK parameters will be summarized by descriptive statistics by treatment group. This descriptive statistical assessment will include the geometric means and ratios of the geometric means for selected PK parameters, as deemed appropriate. No formal statistical hypothesis testing will be performed.
- the HD and IAI dosing regimens were generally well tolerated.
- the ocular treatment-emergent adverse events (TEAEs) ( Figure 14-15), intraocular pressure (IOP) (Figure 16), non-ocular TEAEs ( Figures 17-18), non-ocular SAEs (Figure 19), hypertension AEs (Figure 20), mean systolic blood pressure (Figure 21), mean diastolic blood pressure (Figure 22), mean IOP ( Figure 23), mean change of IOP ( Figure 24) were comparable in each treatment group.
- SAEs Serious ocular AEs occurred in two patients overall, one in the aflibercept 8 mg group (retinal tear) and one in the EYLEA 2 mg group (visual acuity reduced). No intraocular inflammation, occlusive vasculitis, arterial thromboembolic events (adjudicated according to the Anti- Platelet Trialists' Collaboration definitions) or death in either patient group were identified through week 16.
- HD patients achieved a mean change, from baseline through week 16, of 8.4 (ETDRS letters) whereas IAI patients achieved 6.5 (Figure 35) (LOCF).
- EDRS letters 8.4
- IAI patients achieved 6.5
- LOCF 6.5
- Retinal drying (lack of fluid in the center subfield-no intraretinal fluid (IRF) and no subretinal fluid (SRF)) at weeks 16 to 44 was higher in the HD group relative to that of the IAI group ( Figure 49, Figure 51). Moreover, at weeks 16 and 44, there was a greater proportion of eyes, in the HD group than in the IAI group, without fluid in the macula (no IRF and no SRF in the macula by SD-OCT) ( Figure 50). The proportion of patients in each group without IRF (dry or SRF only) at weeks 16 and 44 is set forth in Figure 52.
- This Example documents the procedure and execution results of deliverable volume characterization testing conducted to compare different presentations of a formulation including aflibercept (REGN3) at a concentration of 114.3 mg/ml.
- REGN3 aflibercept
- Deliverable volume was calculated by collecting the dose delivered through manual injection after the syringe was manually primed and weighing the collected dose on a balance. The collected mass was then divided by the density of the FDS (1.059 g/ml) to calculate the volume delivered.
- V (mdose/p) * 1000, where V ⁇ s the delivered volume (mI_), m d 0Se is the dose mass (g), and p is the solution density (g/mL). Preconditioning of samples at 5°C was conducted for the testing in order to maintain drug product integrity.
- the deliverable volume data of both devices showed the difference in variability and accuracy.
- the 1mL BD (Becton Dickinson) Luer Lok syringe has a lower average delivered volume at 74.7 microliters than the 0.5mL PFS with 81.6 microliters. However, it has a larger spread of volumes delivered with a range of 53.5 microliters compared to 24.8 microliters for the 0.5 mL PFS.
- the increased variability depicted in the 1mL BD (Becton Dickinson) Luer Lok syringe may be attributed to user variability in setting the dose to 70 microliters as well as the variability in graduation printing on the syringe. Individual delivered volumes for each device are set forth in Figure 25 (C).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Ophthalmology & Optometry (AREA)
- Gastroenterology & Hepatology (AREA)
- Organic Chemistry (AREA)
- Cell Biology (AREA)
- Zoology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Immunology (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Dermatology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicinal Preparation (AREA)
Priority Applications (22)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3190663A CA3190663A1 (en) | 2021-05-17 | 2022-05-16 | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| FIEP22728724.0T FI4185318T3 (fi) | 2021-05-17 | 2022-05-16 | Pitkäaikaisia, suuren annoksen VEGF-antagonistihoitoja angiogeenisten silmäsairauksien hoitoon |
| PL22728724.0T PL4185318T3 (pl) | 2021-05-17 | 2022-05-16 | Rozszerzone schematy leczenia dużymi dawkami antagonistów vegf w leczeniu angiogennych zaburzeń oka |
| SI202230175T SI4185318T1 (sl) | 2021-05-17 | 2022-05-16 | Razširjeni režimi antagonistov VEGF z visokimi odmerki za zdravljenje angiogenih očesnih bolezni |
| KR1020237013896A KR20240008821A (ko) | 2021-05-17 | 2022-05-16 | 혈관신생성 눈 장애 치료를 위한 연장된 고용량 vegf 길항제 요법 |
| DK22728724.0T DK4185318T3 (da) | 2021-05-17 | 2022-05-16 | Forlængede, højdosis-VEGF-antagonistregimer til behandling af angiogene øjensygdomme |
| JP2023513604A JP2024519629A (ja) | 2021-05-17 | 2022-05-16 | 血管新生性眼疾患の治療のための長期の高用量vegfアンタゴニストレジメン |
| PE2023003023A PE20240922A1 (es) | 2021-05-17 | 2022-05-16 | Regimenes de antagonistas del vegf en dosis alta extendidos para el tratamiento de trastornos oculares angiogenicos |
| IL308505A IL308505A (en) | 2021-05-17 | 2022-05-16 | Continuous high-dose VEGF antagonist regimens for the treatment of angiogenic ocular disorders |
| HRP20251282TT HRP20251282T8 (hr) | 2021-05-17 | 2022-05-16 | Produženi režimi antagonista vegf u visokim dozama za liječenje angiogenih očnih poremećaja |
| CN202280032529.4A CN117642175A (zh) | 2021-05-17 | 2022-05-16 | 用于治疗血管生成性眼病的延长的高剂量vegf拮抗剂方案 |
| LTEPPCT/US2022/029462T LT4185318T (lt) | 2021-05-17 | 2022-05-16 | Prailginto atpalaidavimo, didelės dozės vegf antagonisto režimai, skirti akių angiogeninių sutrikimų gydymui |
| RS20251029A RS67369B1 (sr) | 2021-05-17 | 2022-05-16 | Produženi režimi antagonista vegf u visokim dozama za lečenje angiogenih očnih poremećaja |
| EP22728724.0A EP4185318B1 (en) | 2021-05-17 | 2022-05-16 | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| US18/021,802 US20230302085A1 (en) | 2021-05-17 | 2022-05-16 | Extended, High Dose VEGF Antagonist Regimens for Treatment of Angiogenic Eye Disorders |
| EP25189523.1A EP4647125A3 (en) | 2021-05-17 | 2022-05-16 | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| ES22728724T ES3041647T3 (en) | 2021-05-17 | 2022-05-16 | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| BR112023023002A BR112023023002A2 (pt) | 2021-05-17 | 2022-05-16 | Regimes estendidos de antagonistas de vegf em altas doses para tratamento de doenças oculares angiogênicas |
| MX2023013554A MX2023013554A (es) | 2021-05-17 | 2022-05-16 | Regimenes de antagonistas del vegf en dosis alta extendidos para el tratamiento de trastornos oculares angiogenicos. |
| AU2022275786A AU2022275786C1 (en) | 2021-05-17 | 2022-05-16 | Extended, high dose VEGF antagonist regimens for treatment of angiogenic eye disorders |
| JOJO/P/2023/0283A JOP20230283A1 (ar) | 2021-05-17 | 2023-11-06 | أنظمة مضادة لـ vegf ممتدة عالية الجرعة لعلاج الاضطرابات وعائية المنشأ بالعين |
| AU2025226774A AU2025226774A1 (en) | 2021-05-17 | 2025-09-04 | Extended, high dose VEGF antagonist regimens for treatment of angiogenic eye disorders |
Applications Claiming Priority (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163189541P | 2021-05-17 | 2021-05-17 | |
| US63/189,541 | 2021-05-17 | ||
| US202163235398P | 2021-08-20 | 2021-08-20 | |
| US63/235,398 | 2021-08-20 | ||
| US202263297420P | 2022-01-07 | 2022-01-07 | |
| US63/297,420 | 2022-01-07 | ||
| US202263306315P | 2022-02-03 | 2022-02-03 | |
| US63/306,315 | 2022-02-03 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022245739A1 true WO2022245739A1 (en) | 2022-11-24 |
Family
ID=81975181
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2022/029462 Ceased WO2022245739A1 (en) | 2021-05-17 | 2022-05-16 | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
Country Status (23)
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4245313A1 (en) * | 2022-03-15 | 2023-09-20 | Regeneron Pharmaceuticals, Inc. | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| EP4245312A1 (en) * | 2022-03-15 | 2023-09-20 | Regeneron Pharmaceuticals, Inc. | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| US12168036B2 (en) | 2018-05-10 | 2024-12-17 | Regeneron Pharmaceuticals, Inc. | Methods for treating angiogenic eye disorders with high doses of VEGF receptor fusion proteins |
| EP4480491A1 (en) * | 2023-06-23 | 2024-12-25 | Regeneron Pharmaceuticals, Inc. | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| WO2025259718A2 (en) | 2024-06-11 | 2025-12-18 | Regeneron Pharmaceuticals, Inc. | Vegf antagonists and methods of use thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3886946A1 (en) | 2019-06-05 | 2021-10-06 | Regeneron Pharmaceuticals, Inc. | Devices and methods for precision dose delivery |
| USD1120314S1 (en) | 2022-11-30 | 2026-03-24 | Regeneron Pharmaceuticals, Inc. | Dose delivery device |
Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005121176A1 (en) | 2004-06-08 | 2005-12-22 | Chengdu Kanghong Biotechnologies Co. Ltd | Angiogenesis-inhibiting chimeric protein and the use |
| WO2007112675A1 (fr) | 2006-03-31 | 2007-10-11 | Chengdu Kanghong Biotechnologies Co., Ltd. | Protéine de fusion du récepteur du vegf et son utilisation |
| US7354579B2 (en) | 2003-07-25 | 2008-04-08 | Regeneron Pharmaceuticals, Inc. | Method of treating cancer with a VEGF antagonist and an anti-proliferative agent |
| US7396664B2 (en) | 1999-06-08 | 2008-07-08 | Regeneron Pharmaceuticals, Inc. | VEGF-binding fusion proteins and nucleic acids encoding the same |
| WO2012097019A1 (en) * | 2011-01-13 | 2012-07-19 | Regeneron Pharmaceuticals, Inc. | Use of a vegf antagonist to treat angiogenic eye disorders |
| WO2017120601A1 (en) * | 2016-01-08 | 2017-07-13 | Clearside Biomedical, Inc. | Methods and devices for treating posterior ocular disorderswith aflibercept and other biologics |
| US20180298092A1 (en) * | 2014-11-07 | 2018-10-18 | Novartis Ag | Methods for treating ocular diseases |
| WO2019108770A1 (en) * | 2017-11-30 | 2019-06-06 | Regeneron Pharmaceuticals, Inc. | Use of a vegf antagonist to treat angiogenic eye disorders |
| WO2019118588A1 (en) | 2017-12-13 | 2019-06-20 | Regeneron Pharmaceuticals, Inc. | Devices and methods for precision dose delivery |
| WO2019217927A1 (en) | 2018-05-10 | 2019-11-14 | Regeneron Pharmaceuticals, Inc. | High concentration vegf receptor fusion protein containing formulations |
| WO2020247686A1 (en) | 2019-06-05 | 2020-12-10 | Regeneron Pharmaceuticals, Inc. | Devices and methods for precision dose delivery |
| WO2021048779A2 (en) * | 2019-09-12 | 2021-03-18 | Lupin Limited | Modified dosing of vegf inhibitors for ophthalmic use |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5288931A (en) * | 1991-12-06 | 1994-02-22 | Genentech, Inc. | Method for refolding insoluble, misfolded insulin-like growth factor-I into an active conformation |
| GB9912350D0 (en) * | 1999-05-26 | 1999-07-28 | European Molecular Biology Lab Embl | Modified cytokine |
| FI117667B (fi) * | 2001-07-05 | 2007-01-15 | Univ Zuerich | Farmaseuttinen koostumus, joka soveltuu käytettäväksi ortopediassa ja hammaslääketieteessä |
| AU2012212047A1 (en) * | 2011-02-03 | 2013-08-22 | Xoma Technology Ltd. | Methods and materials for enhancing functional protein expression in bacteria |
-
2022
- 2022-05-16 KR KR1020237013896A patent/KR20240008821A/ko active Pending
- 2022-05-16 IL IL308505A patent/IL308505A/en unknown
- 2022-05-16 US US18/021,802 patent/US20230302085A1/en active Pending
- 2022-05-16 JP JP2023513604A patent/JP2024519629A/ja active Pending
- 2022-05-16 TW TW111118217A patent/TW202313095A/zh unknown
- 2022-05-16 MX MX2023013554A patent/MX2023013554A/es unknown
- 2022-05-16 BR BR112023023002A patent/BR112023023002A2/pt unknown
- 2022-05-16 EP EP25189523.1A patent/EP4647125A3/en active Pending
- 2022-05-16 PE PE2023003023A patent/PE20240922A1/es unknown
- 2022-05-16 PT PT227287240T patent/PT4185318T/pt unknown
- 2022-05-16 ES ES22728724T patent/ES3041647T3/es active Active
- 2022-05-16 EP EP22728724.0A patent/EP4185318B1/en active Active
- 2022-05-16 SI SI202230175T patent/SI4185318T1/sl unknown
- 2022-05-16 WO PCT/US2022/029462 patent/WO2022245739A1/en not_active Ceased
- 2022-05-16 RS RS20251029A patent/RS67369B1/sr unknown
- 2022-05-16 DK DK22728724.0T patent/DK4185318T3/da active
- 2022-05-16 CA CA3190663A patent/CA3190663A1/en active Pending
- 2022-05-16 AU AU2022275786A patent/AU2022275786C1/en active Active
- 2022-05-16 LT LTEPPCT/US2022/029462T patent/LT4185318T/lt unknown
- 2022-05-16 HR HRP20251282TT patent/HRP20251282T8/hr unknown
- 2022-05-16 PL PL22728724.0T patent/PL4185318T3/pl unknown
- 2022-05-16 FI FIEP22728724.0T patent/FI4185318T3/fi active
-
2023
- 2023-11-06 JO JOJO/P/2023/0283A patent/JOP20230283A1/ar unknown
- 2023-11-14 CL CL2023003396A patent/CL2023003396A1/es unknown
-
2024
- 2024-10-02 CL CL2024002972A patent/CL2024002972A1/es unknown
-
2025
- 2025-04-29 CL CL2025001269A patent/CL2025001269A1/es unknown
- 2025-09-04 AU AU2025226774A patent/AU2025226774A1/en active Pending
Patent Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7396664B2 (en) | 1999-06-08 | 2008-07-08 | Regeneron Pharmaceuticals, Inc. | VEGF-binding fusion proteins and nucleic acids encoding the same |
| US7354579B2 (en) | 2003-07-25 | 2008-04-08 | Regeneron Pharmaceuticals, Inc. | Method of treating cancer with a VEGF antagonist and an anti-proliferative agent |
| WO2005121176A1 (en) | 2004-06-08 | 2005-12-22 | Chengdu Kanghong Biotechnologies Co. Ltd | Angiogenesis-inhibiting chimeric protein and the use |
| WO2007112675A1 (fr) | 2006-03-31 | 2007-10-11 | Chengdu Kanghong Biotechnologies Co., Ltd. | Protéine de fusion du récepteur du vegf et son utilisation |
| WO2012097019A1 (en) * | 2011-01-13 | 2012-07-19 | Regeneron Pharmaceuticals, Inc. | Use of a vegf antagonist to treat angiogenic eye disorders |
| US20180298092A1 (en) * | 2014-11-07 | 2018-10-18 | Novartis Ag | Methods for treating ocular diseases |
| WO2017120601A1 (en) * | 2016-01-08 | 2017-07-13 | Clearside Biomedical, Inc. | Methods and devices for treating posterior ocular disorderswith aflibercept and other biologics |
| WO2019108770A1 (en) * | 2017-11-30 | 2019-06-06 | Regeneron Pharmaceuticals, Inc. | Use of a vegf antagonist to treat angiogenic eye disorders |
| WO2019118588A1 (en) | 2017-12-13 | 2019-06-20 | Regeneron Pharmaceuticals, Inc. | Devices and methods for precision dose delivery |
| WO2019217927A1 (en) | 2018-05-10 | 2019-11-14 | Regeneron Pharmaceuticals, Inc. | High concentration vegf receptor fusion protein containing formulations |
| US11103552B2 (en) | 2018-05-10 | 2021-08-31 | Regeneron Pharmaceuticals, Inc. | High concentration VEGF receptor fusion protein containing formulations |
| WO2020247686A1 (en) | 2019-06-05 | 2020-12-10 | Regeneron Pharmaceuticals, Inc. | Devices and methods for precision dose delivery |
| WO2021048779A2 (en) * | 2019-09-12 | 2021-03-18 | Lupin Limited | Modified dosing of vegf inhibitors for ophthalmic use |
Non-Patent Citations (11)
| Title |
|---|
| "Remington's Pharmaceutical Sciences", 1975, MACK PUBLISHING COMPANY |
| ARCH OPHTHALMOL, vol. 103, no. 12, December 1985 (1985-12-01), pages 1796 - 806 |
| BAILEYLOVIE, NEW DESIGN PRINCIPLES FOR VISUAL ACUITY LETTER CHARTS, vol. 53, no. 11, 1976, pages 740 - 745 |
| BAILEYLOVIE: "New design principles for visual acuity letter charts", AM J OPTOMETRY PHYSIOL OPT, vol. 53, 1976, pages 740 - 745, XP055331689, DOI: 10.1097/00006324-197611000-00006 |
| CHEN ET AL., COMPARISON OF VISUAL ACUITY ESTIMATES USING THREE DIFFERENT LETTER CHARTS UNDER TWO AMBIENT ROOM ILLUMINATIONS, vol. 60, no. 2, 2012, pages 101 - 104 |
| HANNA ET AL.: "Three patients with injection of intravitreal vascular endothelial growth factor inhibitors and subsequent exacerbation of chronic proteinuria and hypertension", CLINICAL KIDNEY JOURNAL, vol. 12, no. 1, 2019, pages 92 - 100 |
| HEIER ET AL.: "Intravitreal Aflibercept (VEGF Trap-Eye) in Wet Age-related Macular Degeneration", OPHTHALMOLOGY, vol. 119, 2012, pages 2537 - 2548, XP055138976, DOI: 10.1016/j.ophtha.2012.09.006 |
| KAISER: "Prospective Evaluation of Visual Acuity Assessment: A Comparison of Snellen Versus ETDRS Charts in Clinical Practice (An AOS Thesis", TRANS AM OPHTHALMOL SOC, vol. 107, 2009, pages 311 - 324 |
| RAISER ET AL.: "The effect of intravitreal bevacizumab (Avastin) administration on systemic hypertension", EYE, vol. 23, 2009, pages 1714 - 1718 |
| REGENERON PHARMACEUTICALS: "Safety, Tolerability, and Efficacy of Aflibercept in Patients With Neovascular Age-Related Macular Degeneration. NCT04126317", 15 October 2019 (2019-10-15), pages 1 - 8, XP055952673, Retrieved from the Internet <URL:https://clinicaltrials.gov/ct2/show/record/NCT04126317> [retrieved on 20220818] * |
| SHAMIR: "Comparison of Snellen and Early Treatment Diabetic Retinopathy Study charts using a computer simulation", INT. J. OPTHAMOLOGY, vol. 9, no. 1, 2016, pages 119 - 123 |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12168036B2 (en) | 2018-05-10 | 2024-12-17 | Regeneron Pharmaceuticals, Inc. | Methods for treating angiogenic eye disorders with high doses of VEGF receptor fusion proteins |
| EP4245313A1 (en) * | 2022-03-15 | 2023-09-20 | Regeneron Pharmaceuticals, Inc. | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| EP4245312A1 (en) * | 2022-03-15 | 2023-09-20 | Regeneron Pharmaceuticals, Inc. | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| WO2023177689A1 (en) * | 2022-03-15 | 2023-09-21 | Regeneron Pharmaceuticals, Inc. | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| WO2023177691A1 (en) * | 2022-03-15 | 2023-09-21 | Regeneron Pharmaceuticals, Inc. | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| EP4480491A1 (en) * | 2023-06-23 | 2024-12-25 | Regeneron Pharmaceuticals, Inc. | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| WO2024263995A1 (en) * | 2023-06-23 | 2024-12-26 | Regeneron Pharmaceuticals, Inc. | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
| WO2025259718A2 (en) | 2024-06-11 | 2025-12-18 | Regeneron Pharmaceuticals, Inc. | Vegf antagonists and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20240008821A (ko) | 2024-01-19 |
| BR112023023002A2 (pt) | 2024-01-23 |
| FI4185318T3 (fi) | 2025-10-13 |
| AU2022275786A8 (en) | 2023-04-20 |
| AU2022275786B2 (en) | 2025-06-05 |
| EP4185318B1 (en) | 2025-09-03 |
| JOP20230283A1 (ar) | 2023-11-06 |
| HRP20251282T8 (hr) | 2025-12-19 |
| MX2023013554A (es) | 2023-11-29 |
| PT4185318T (pt) | 2025-09-29 |
| CL2025001269A1 (es) | 2025-08-22 |
| EP4647125A3 (en) | 2026-01-28 |
| EP4185318A1 (en) | 2023-05-31 |
| PE20240922A1 (es) | 2024-04-30 |
| PL4185318T3 (pl) | 2026-01-12 |
| LT4185318T (lt) | 2025-11-10 |
| DK4185318T3 (da) | 2025-09-29 |
| SI4185318T1 (sl) | 2025-10-30 |
| HRP20251282T1 (hr) | 2025-12-05 |
| CA3190663A1 (en) | 2022-11-24 |
| IL308505A (en) | 2024-01-01 |
| EP4647125A2 (en) | 2025-11-12 |
| JP2024519629A (ja) | 2024-05-21 |
| RS67369B1 (sr) | 2025-11-28 |
| AU2022275786C1 (en) | 2025-12-11 |
| CL2023003396A1 (es) | 2024-06-07 |
| ES3041647T3 (en) | 2025-11-13 |
| AU2025226774A1 (en) | 2025-09-25 |
| TW202313095A (zh) | 2023-04-01 |
| CL2024002972A1 (es) | 2025-01-24 |
| US20230302085A1 (en) | 2023-09-28 |
| AU2022275786A1 (en) | 2023-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2022275786B2 (en) | Extended, high dose VEGF antagonist regimens for treatment of angiogenic eye disorders | |
| US20190290725A1 (en) | Use of a vegf antagonist to treat angiogenic eye disorders | |
| US20230295266A1 (en) | Extended, High Dose VEGF Antagonist Regimens for Treatment of Angiogenic Eye Disorders | |
| US20240024420A1 (en) | Extended, High Dose VEGF Antagonist Regimens for Treatment of Angiogenic Eye Disorders | |
| KR20220062279A (ko) | 안질환의 치료 방법 | |
| HK40094129A (en) | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders | |
| HK40094129B (en) | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders | |
| EA051980B1 (ru) | Расширенные схемы применения высоких доз антагониста vegf для лечения ангиогенных нарушений со стороны глаза | |
| US20250025531A1 (en) | Extended, High Dose VEGF Antagonist Regimens for Treatment of Angiogenic Eye Disorders | |
| HK40099476A (en) | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders | |
| HK40099475A (en) | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders | |
| CA3190733A1 (en) | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders | |
| CA3190726A1 (en) | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders | |
| HK40119109A (en) | Extended, high dose vegf antagonist regimens for treatment of angiogenic eye disorders |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22728724 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3190663 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022728724 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023513604 Country of ref document: JP |
|
| ENP | Entry into the national phase |
Ref document number: 2022728724 Country of ref document: EP Effective date: 20230224 |
|
| ENP | Entry into the national phase |
Ref document number: 2022275786 Country of ref document: AU Date of ref document: 20220516 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202280032529.4 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: DZP2023001741 Country of ref document: DZ Ref document number: 003023-2023 Country of ref document: PE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 308505 Country of ref document: IL Ref document number: 805485 Country of ref document: NZ |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112023023002 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2301007435 Country of ref document: TH |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2023/013554 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202393098 Country of ref document: EA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202308521P Country of ref document: SG |
|
| ENP | Entry into the national phase |
Ref document number: 112023023002 Country of ref document: BR Kind code of ref document: A2 Effective date: 20231103 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451513 Country of ref document: SA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451513 Country of ref document: SA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451513 Country of ref document: SA |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2022728724 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 525472489 Country of ref document: SA |