WO2022245067A1 - RORα의 활성자 JC1-40을 포함하는 근감소증 예방, 개선, 또는 치료를 위한 약학적 조성물 - Google Patents

RORα의 활성자 JC1-40을 포함하는 근감소증 예방, 개선, 또는 치료를 위한 약학적 조성물 Download PDF

Info

Publication number
WO2022245067A1
WO2022245067A1 PCT/KR2022/006925 KR2022006925W WO2022245067A1 WO 2022245067 A1 WO2022245067 A1 WO 2022245067A1 KR 2022006925 W KR2022006925 W KR 2022006925W WO 2022245067 A1 WO2022245067 A1 WO 2022245067A1
Authority
WO
WIPO (PCT)
Prior art keywords
acceptable salt
sarcopenia
acid
present
preventing
Prior art date
Application number
PCT/KR2022/006925
Other languages
English (en)
French (fr)
Inventor
이미옥
박형근
김현지
Original Assignee
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220058534A external-priority patent/KR20220155910A/ko
Application filed by 서울대학교 산학협력단 filed Critical 서울대학교 산학협력단
Publication of WO2022245067A1 publication Critical patent/WO2022245067A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/17—Amides, e.g. hydroxamic acids having the group >N—C(O)—N< or >N—C(S)—N<, e.g. urea, thiourea, carmustine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system

Definitions

  • the present invention relates to a pharmaceutical composition for the prevention, improvement, or treatment of sarcopenia containing JC1-40, an activator of ROR ⁇ .
  • Korean society is entering an era of super-aging society due to an increase in the average life expectancy and a decrease in the birth rate.
  • obesity a major factor threatening health in modern society, is continuously increasing in Korean society, which causes various chronic diseases and causes an increase in premature death.
  • sarcopenia and sarcopenic obesity which are caused by a decrease in muscle mass and strength, not only loses the ability to exercise in daily life, but also causes chronic liver disease, cardiovascular disease, lung disease, brain disease and degenerative disease. It is a disease that must be overcome for human health in modern society in that it can lead to disease.
  • Mitochondria are organelles that play a central role in energy metabolism, and the quantitative and qualitative maintenance of mitochondria is an essential factor for maintaining intracellular homeostasis. Mitochondrial function is largely controlled through biosynthesis, fission/fusion, and mitochondria-specific autophagy. Impaired mitochondrial function is a major factor contributing to the complex pathogenesis of sarcopenia, including oxidative stress, apoptosis, and inflammation.
  • ROR ⁇ (also known as NR1F1, RORA or RZR) is a member of the steroid hormone receptor superfamily and is a transcription factor that regulates gene expression.
  • the activity of ROR ⁇ is regulated through specific binding of ligands such as CGP52608, which is one of cholesterol and cholesterol derivatives, melatonin, and thiazolidinedione. Adjust.
  • CGP52608 which is one of cholesterol and cholesterol derivatives, melatonin, and thiazolidinedione. Adjust.
  • CGP52608 is one of cholesterol and cholesterol derivatives, melatonin, and thiazolidinedione. Adjust.
  • ROR ⁇ promotes muscle differentiation through direct binding to p300 and MyoD.
  • ROR ⁇ deficient mice (sg/sg, sg/+) showed improved glucose intolerance and increased insulin sensitivity, suggesting that muscle ROR ⁇ may be involved in glucose metabolism.
  • ROR ⁇ may be involved in lipid homeostasis through the regulation of the Akt2-AMPK pathway.
  • FGF21 fibroblast growth factor 21
  • mitochondrial complex II activation mitochondrial complex II activation
  • super complex formation were increased, indicating that ROR ⁇ activity is effective in treating obesity-related diseases and sarcopenia. means that it can be applied.
  • the present inventors confirmed that the JC1-40 compound increases mitochondrial biosynthesis and increases the expression of mitochondria-related regulatory factors, thereby completing the present invention.
  • the present inventors confirmed that the JC1-40 compound increases mitochondrial biosynthesis and increases the expression of mitochondria-related regulatory factors, thereby completing the present invention.
  • an object of the present invention is to provide a pharmaceutical composition for preventing or treating sarcopenia, comprising JC1-40 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • Another object of the present invention is to provide a food composition for preventing or improving sarcopenia, comprising JC1-40 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • Another object of the present invention is to provide a cosmetic composition for muscle function improvement comprising JC1-40 or a cosmetically acceptable salt thereof as an active ingredient.
  • Another object of the present invention is to provide a composition for increasing mitochondrial biosynthesis, comprising JC1-40 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating sarcopenia, comprising JC1-40 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a food composition for preventing or improving sarcopenia, comprising JC1-40 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a cosmetic composition for improving muscle function, comprising JC1-40 or a cosmetically acceptable salt thereof as an active ingredient.
  • the present invention provides a composition for increasing mitochondrial biosynthesis, comprising JC1-40 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the JC1-40 may be an activator of ROR ⁇ protein, but is not limited thereto.
  • the JC1-40 may be included in a concentration of 1 to 100 ⁇ M relative to the total composition, but is not limited thereto.
  • the JC1-40 may be characterized as satisfying one or more of the following characteristics, but is not limited thereto: a) increasing mitochondrial membrane potential; b) increasing the amount of mitochondria; and c) increasing mitochondrial biogenesis.
  • the JC1-40 may increase the expression or activity of a gene or protein selected from the group consisting of SDHA, COX5A, MCAD, PGC-1 ⁇ , NRF1, NRF2 ⁇ , and TFAM, but , but not limited thereto.
  • the expression or activity of the TFAM gene or protein may be dependent on ROR ⁇ , but is not limited thereto.
  • the sarcopenia may be characterized by obese sarcopenia or geriatric sarcopenia, but is not limited thereto.
  • the present invention provides a method for preventing or treating sarcopenia, comprising administering JC1-40 or a pharmaceutically acceptable salt thereof to a subject in need thereof.
  • the present invention provides a use of JC1-40 or a pharmaceutically acceptable salt thereof for preventing or treating sarcopenia.
  • the present invention provides a use of JC1-40 or a pharmaceutically acceptable salt thereof for producing a drug used for preventing or treating sarcopenia.
  • the present invention provides a method for increasing mitochondrial biosynthesis, comprising administering JC1-40 or a pharmaceutically acceptable salt thereof to a subject in need thereof.
  • the present invention provides a use of JC1-40 or a pharmaceutically acceptable salt thereof to increase mitochondrial biosynthesis.
  • the present invention provides a use of JC1-40 or a pharmaceutically acceptable salt thereof for producing a drug for increasing mitochondrial biosynthesis.
  • the present invention provides a method for improving muscle function, comprising administering JC1-40 or a salt thereof to a subject in need thereof.
  • the present invention provides a use of JC1-40 or a salt thereof for improving muscle function.
  • the present invention provides the use of JC1-40 or a cosmetically acceptable salt thereof for producing cosmetics used for muscle function improvement.
  • composition according to the present invention increases the mitochondrial membrane potential, increases the amount of mitochondria, and increases the expression or activity of genes or proteins related to mitochondria, thereby increasing mitochondrial biosynthesis and is effective in preventing, improving, and treating sarcopenia. It is expected that there will be
  • Figure 1 shows the effect of JC1-40 on mitochondrial membrane potential in C2C12 cells.
  • Figure 2 shows the effect of JC1-40 on the amount of mitochondria in HeLa cells.
  • Figure 3 shows the effect of JC1-40 on the mRNA expression of SDHA, COX5A, and MCAD in C2C12 cells.
  • Figure 4a shows the effect of JC1-40 on mRNA expression of PGC-1 ⁇ , NRF1, NRF2 ⁇ , and TFAM in C2C12 cells.
  • Figure 4b shows the effect of JC1-40 on the activities of NRF1 and TFAM proteins in C2C12 cells.
  • Figure 4c shows the effect of JC1-40 on the transcriptional activity of the TFAM promoter in C2C12 cells.
  • 6a and 6b show experimental methods and results confirming the effect of JC1-40 on mitochondrial biosynthetic effects in an animal model induced by a high-fat diet.
  • the inventors of the present invention found that the JC1-40 compound increases mitochondrial membrane potential, increases the amount of mitochondria, and inhibits the expression or activity of mitochondria-related genes or proteins.
  • the present invention was completed by confirming that sarcopenia can be efficiently prevented, improved, or treated by increasing mitochondrial biosynthesis.
  • the present invention provides a pharmaceutical composition for preventing or treating sarcopenia, comprising JC1-40 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • JC1-40 may be represented by Formula 1 as an activator of ROR ⁇ protein, and may have an IUPAC name of 1-methyl-3-[(4-phenylmethoxyphenyl)methyl]thiourea, and the formula is C It may be 16 H 18 N 2 OS, and the molecular weight may be 286.39, but is not limited thereto.
  • the method for obtaining the compound may be chemically synthesized by a method known in the field to which the present invention pertains, or a commercially available material may be used.
  • the JC1-40 is 1 to 100 ⁇ M, 1 to 90 ⁇ M, 1 to 80 ⁇ M, 1 to 70 ⁇ M, 1 to 60 ⁇ M, 1 to 50 ⁇ M, 2 to 100 ⁇ M, 2 to 90 ⁇ M, 2 to 80 ⁇ M, 2 to 70 ⁇ M, 2 to 60 ⁇ M, 2 to 50 ⁇ M, 3 to 100 ⁇ M, 3 to 90 ⁇ M, 3 to 80 ⁇ M, 3 to 70 ⁇ M, 3 to 60 ⁇ M, 3 to 50 ⁇ M, 4 to 100 ⁇ M, 4 to 90 ⁇ M, 4 to 80 ⁇ M, 4 to 70 ⁇ M , at a concentration of 4 to 60 ⁇ M, 4 to 50 ⁇ M, 5 to 100 ⁇ M, 5 to 90 ⁇ M, 5 to 80 ⁇ M, 5 to 70 ⁇ M, 5 to 60 ⁇ M, 5 to 50 ⁇ M, 10 to 50 ⁇ M, 10 to 40 ⁇ M, 10 to 30 ⁇ M, or 20 ⁇ M It may
  • the JC1-40 may satisfy one or more of the following characteristics, but is not limited thereto: a) increases mitochondrial membrane potential; b) increasing the amount of mitochondria; and c) increasing mitochondrial biogenesis. In addition, the JC1-40 may satisfy one or more of the above characteristics, particularly in muscle cells, but is not limited thereto.
  • the JC1-40 may increase the expression or activity of a gene or protein selected from the group consisting of SDHA, COX5A, MCAD, PGC-1 ⁇ , NRF1, NRF2 ⁇ , and TFAM, but is not limited thereto.
  • Expression or activity of the TFAM gene or protein may be dependent on ROR ⁇ , but is not limited thereto.
  • RORa RAR-related orphan receptor alpha
  • ROR ⁇ is one of the steroid hormone receptor superfamily and is a transcription factor that regulates gene expression.
  • ROR ⁇ promotes muscle differentiation through direct binding to p300 and MyoD.
  • mitochondrial complex II activation and super complex formation may increase, but are not limited thereto.
  • sarcopenia refers to a degenerative disease in which muscle mass and muscle strength decrease, and refers to a disease in which muscle mass is abnormally and rapidly decreased, unlike muscle loss that occurs in a normal aging process.
  • This sarcopenia is divided into primary sarcopenia caused by aging and secondary sarcopenia caused by various causes.
  • the causes of secondary sarcopenia include nutritional deficiency, decreased activity, obesity, organ failure, These include drugs, inflammation, malignant diseases, or endocrine and metabolic diseases.
  • the sarcopenia may be due to mitochondrial dysfunction, but is not limited thereto. According to one embodiment of the present invention, it may be obese sarcopenia or geriatric sarcopenia, preferably obese sarcopenia, but is not limited thereto.
  • the mitochondrial biosynthetic activity can improve oxidative metabolism and tissue bioenergetic generation, and improve muscle function in sarcopenia, but is not limited thereto.
  • the present invention may include a pharmaceutically acceptable salt of the JC1-40 compound as an active ingredient.
  • pharmaceutically acceptable salt includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases.
  • acids examples include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid , benzoic acid, malonic acid, gluconic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid and the like.
  • Acid addition salts can be prepared by conventional methods, for example, by dissolving a compound in an aqueous solution of excess acid and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It can also be prepared by heating equimolar amounts of the compound and an acid or alcohol in water and then evaporating the mixture to dryness, or suction filtering the precipitated salt.
  • a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile.
  • Salts derived from suitable bases may include, but are not limited to, alkali metals such as sodium and potassium, alkaline earth metals such as magnesium, and ammonium.
  • An alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving a compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate.
  • the metal salt it is particularly suitable for pharmaceutical purposes to prepare a sodium, potassium or calcium salt, and the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).
  • a suitable silver salt eg, silver nitrate
  • the present inventors confirmed that the JC1-40 compound was excellent in the effect of increasing the mitochondrial membrane potential and the amount of mitochondria (see Examples 1 and 2),
  • JC1-40 or a pharmaceutically acceptable salt thereof of the present invention is a pharmaceutical composition for preventing or treating sarcopenia; Alternatively, it may be provided as a composition for increasing mitochondrial biosynthesis.
  • the present invention provides a method for preventing or treating sarcopenia, comprising administering JC1-40 or a pharmaceutically acceptable salt thereof to a subject in need thereof.
  • the present invention provides a use of JC1-40 or a pharmaceutically acceptable salt thereof for preventing or treating sarcopenia.
  • the present invention provides a use of JC1-40 or a pharmaceutically acceptable salt thereof for producing a drug used for preventing or treating sarcopenia.
  • the present invention provides a method for increasing mitochondrial biosynthesis, comprising administering JC1-40 or a pharmaceutically acceptable salt thereof to a subject in need thereof.
  • the present invention provides a use of JC1-40 or a pharmaceutically acceptable salt thereof to increase mitochondrial biosynthesis.
  • the present invention provides a use of JC1-40 or a pharmaceutically acceptable salt thereof for producing a drug for increasing mitochondrial biosynthesis.
  • the content of the JC1-40 compound or a pharmaceutically acceptable salt thereof in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the progress of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9 based on the weight of the total composition. % by weight, or 0.001 to 50% by weight, but is not limited thereto.
  • the content ratio is a value based on the dry amount after removing the solvent.
  • the pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions.
  • the excipient may be, for example, one or more selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a moisturizer, a film-coating material, and a controlled release additive.
  • compositions according to the present invention are powders, granules, sustained-release granules, enteric granules, solutions, eye drops, elsilic agents, emulsions, suspensions, spirits, troches, perfumes, and limonadese, respectively, according to conventional methods.
  • tablets, sustained-release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusate It can be formulated and used in the form of external preparations such as warning agents, lotions, pasta agents, sprays, inhalants, patches, sterile injection solutions, or aerosols, and the external agents are creams, gels, patches, sprays, ointments, and warning agents.
  • lotion, liniment, pasta, or cataplasma may have formulations such as the like.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • Additives for the liquid formulation according to the present invention include water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, sucrose monostearate, polyoxyethylene sorbitol fatty acid esters (tween esters), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, and the like may be used.
  • a solution of white sugar, other sugars, or a sweetener may be used, and aromatics, coloring agents, preservatives, stabilizers, suspending agents, emulsifiers, thickeners, etc. may be used as necessary.
  • Purified water may be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. may be used as needed.
  • Suspension agents according to the present invention include acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, HPMC 2910, etc. Agents may be used, and surfactants, preservatives, stabilizers, colorants, and fragrances may be used as needed.
  • Injections according to the present invention include distilled water for injection, 0.9% sodium chloride injection, IV injection, dextrose injection, dextrose + sodium chloride injection, PEG, lactated IV injection, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; solubilizing agents such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, twins, nijuntinamide, hexamine, and dimethylacetamide; buffers such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, and gums; tonicity agents such as sodium chlor
  • the suppository according to the present invention includes cacao butter, lanolin, witapsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lannet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolen (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Buytyrum Tego-G -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxycote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hyde Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Masupol, Masupol-15, Neos
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient, for example, starch, calcium carbonate, sucrose, etc. ) or by mixing lactose and gelatin.
  • excipients for example, starch, calcium carbonate, sucrose, etc.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc.
  • various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included.
  • Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • composition according to the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, activity of the drug, It may be determined according to factors including sensitivity to the drug, administration time, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention belongs.
  • the pharmaceutical composition of the present invention can be administered to a subject by various routes. All modes of administration can be envisaged, eg oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, intrarectal insertion, vaginal It can be administered by intraoral insertion, ocular administration, otic administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, and the like.
  • the pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient together with various related factors such as the disease to be treated, the route of administration, the age, sex, weight and severity of the disease of the patient.
  • “individual” means a subject in need of treatment of a disease, and more specifically, a human or non-human primate, mouse, rat, dog, cat, horse, cow, etc. It may be a mammal of, but is not limited thereto.
  • administration means providing a given composition of the present invention to a subject by any suitable method.
  • prevention refers to any action that suppresses or delays the onset of a desired disease
  • treatment means that the desired disease and its resulting metabolic abnormality are improved or improved by administration of the pharmaceutical composition according to the present invention. All actions that are advantageously altered are meant, and “improvement” means any action that reduces a parameter related to a target disease, for example, the severity of a symptom, by administration of the composition according to the present invention.
  • the present invention provides a food composition for preventing or improving sarcopenia, comprising JC1-40 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the food composition includes a health functional food composition.
  • JC1-40 or a food chemically acceptable salt thereof of the present invention When JC1-40 or a food chemically acceptable salt thereof of the present invention is used as a food additive, the JC1-40 or a food chemically acceptable salt thereof may be added as it is or used together with other foods or food ingredients. Depending on the method, it can be used appropriately.
  • the mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment). In general, when preparing food or beverage, JC1-40 or a food chemically acceptable salt thereof of the present invention may be added in an amount of 15% by weight or less, or 10% by weight or less based on the raw material. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount greater than the above range.
  • Examples of foods to which the above substances can be added include meat, sausages, bread, chocolates, candies, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice creams, various soups, beverages, tea, drinks, There are alcoholic beverages and vitamin complexes, and includes all health functional foods in a conventional sense.
  • the health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as additional components, like conventional beverages.
  • the aforementioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrins and cyclodextrins, and sugar alcohols such as xylitol, sorbitol and erythritol.
  • natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used.
  • the proportion of the natural carbohydrate is generally about 0.01-0.20 g, or about 0.04-0.10 g per 100 mL of the composition of the present invention.
  • the composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, A carbonation agent used in carbonated beverages and the like may be contained.
  • the composition of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The ratio of these additives is not critical, but is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention.
  • the present invention provides a cosmetic composition for improving muscle function, comprising JC1-40 or a cosmetically acceptable salt thereof as an active ingredient.
  • the present invention provides a method for improving muscle function, comprising administering JC1-40 or a salt thereof to a subject in need thereof.
  • the present invention provides a use of JC1-40 or a salt thereof for improving muscle function.
  • the present invention provides the use of JC1-40 or a cosmetically acceptable salt thereof for producing cosmetics used for muscle function improvement.
  • improved of muscle function means to improve the decrease in muscle mass caused by aging, obesity, and the like.
  • the muscle function may be proportional to muscle mass, but is not limited thereto.
  • the formulation of the cosmetic composition according to the present invention is skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrient lotion, massage cream, nutrient cream, mist, moisture cream, hand cream, hand lotion, foundation, It may be in the form of essence, nutritional essence, pack, soap, cleansing foam, cleansing lotion, cleansing cream, cleansing oil, cleansing balm, body lotion, or body cleanser.
  • the cosmetic composition of the present invention may further include a composition selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high-molecular peptides, high-molecular polysaccharides, and sphingolipids.
  • Any water-soluble vitamin can be used as long as it can be incorporated into cosmetics, but examples include vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine hydrochloride, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, and vitamin H. salts (thiamine hydrochloride, sodium ascorbate, etc.) or derivatives (sodium ascorbic acid-2-phosphate, magnesium salt of ascorbic acid-2-phosphate, etc.) included Water-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a microbial culture, an enzymatic method, or a chemical synthesis method.
  • any useful vitamin can be used as long as it can be formulated into cosmetics, but examples thereof include vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol), and their derivatives (palmitic acid).
  • the useful vitamins can be obtained by conventional methods such as microbial transformation, purification from microbial culture, enzymatic or chemical synthesis.
  • Any polymer peptide may be used as long as it can be incorporated into cosmetics, and examples thereof include collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, and keratin.
  • Polymer peptides can be purified and obtained by conventional methods such as a purification method from a culture medium of microorganisms, an enzyme method, or a chemical synthesis method, or can be used after being purified from natural products such as pig or cow dermis or silkworm silk fibers.
  • the polymeric polysaccharide may be any material as long as it can be incorporated into cosmetics, and examples thereof include hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate or salts thereof (sodium salt, etc.).
  • chondroitin sulfate or a salt thereof can be used after being purified from mammals or fish.
  • sphingolipid can be used as long as it can be incorporated into cosmetics, and examples thereof include ceramide, phytosphingosine, and sphingoglycolipid. Sphingolipids can be purified by conventional methods or obtained by chemical synthesis from mammals, fish, shellfish, yeast, or plants.
  • composition of the present invention in addition to the above essential ingredients, other ingredients normally formulated in cosmetics may be blended as necessary.
  • ingredients that may be added include fats and oils, humectants, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, bactericides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, fragrances, A blood circulation accelerator, a cooling agent, an antiperspirant, purified water, etc. are mentioned.
  • oil and fat component examples include ester oils, hydrocarbon oils, silicone oils, fluorine oils, animal fats and vegetable oils.
  • ester oils include glyceryl tri-2-ethylhexanoate, cetyl 2-ethylhexanoate, isopropyl myristate, butyl myristate, isopropyl palmitate, ethyl stearate, octyl palmitate, isocetyl isostearate, and stearic acid.
  • hydrocarbon-based fats and oils examples include hydrocarbon-based fats and oils such as squalene, liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, liquid isoparaffin, polybuden, microcrystalline wax, and vaseline.
  • silicone oils include polymethylsilicone, methylphenylsilicone, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane/methylcetyloxysiloxane copolymer, dimethylsiloxane/methylstealoxysiloxane copolymer, alkyl Modified silicone oil, amino modified silicone oil, etc. are mentioned.
  • fluorine-based fats and oils examples include perfluoropolyether and the like.
  • Animal or vegetable oils include avocado oil, almond oil, olive oil, sesame oil, rice bran oil, birdflower oil, soybean oil, corn oil, rapeseed oil, algae oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil , cottonseed oil, palm oil, kukui nut oil, wheat germ oil, rice germ oil, shea butter, moonshine colostrum, marker damian nut oil, meadowsweet oil, egg yolk oil, beef tallow, horse oil, mink oil, orange raffia oil, jojoba oil , animal or plant fats and oils such as candelilla wax, carnaba wax, liquid lanolin, and hydrogenated castor oil.
  • avocado oil almond oil, olive oil, sesame oil, rice bran oil, birdflower oil, soybean oil, corn oil, rapeseed oil, algae oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil , cottonseed oil, palm oil, kukui nut oil, wheat germ
  • moisturizer examples include water-soluble low-molecular moisturizers, fat-soluble molecular moisturizers, water-soluble polymers, and oil-soluble polymers.
  • Cholesterol, cholesterol ester, etc. are mentioned as a fat-soluble low-molecular moisturizer.
  • water-soluble polymers include carboxyvinyl polymer, polyaspartate, tragacanth, xanthan gum, methyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, water-soluble chitin, chitosan, dextrin, and the like.
  • the fat-soluble polymer examples include polyvinylpyrrolidone/eicosene copolymer, polyvinylpyrrolidone/hexadecene copolymer, nitrocellulose, dextrin fatty acid ester, and high molecular silicone.
  • emollient agent examples include long-chain acyl glutamic acid cholesteryl ester, hydroxystearic acid cholesteryl, 12-hydroxystearic acid, stearic acid, rosin acid, lanolin fatty acid cholesteryl ester, and the like.
  • surfactant examples include nonionic surfactants, anionic surfactants, cationic surfactants, and amphoteric surfactants.
  • Nonionic surfactants include self-emulsifying glycerin monostearate, propylene glycol fatty acid esters, glycerin fatty acid esters, polyglycerin fatty acid esters, sorbitan fatty acid esters, POE (polyoxyethylene) sorbitan fatty acid esters, POE sorbitan fatty acid esters, POE Glycerin fatty acid ester, POE alkyl ether, POE fatty acid ester, POE hydrogenated castor oil, POE castor oil, POE ⁇ POP (polyoxyethylene ⁇ polyoxypropylene) copolymer, POE ⁇ POP alkyl ether, polyether modified silicone, lauric acid alkanolamides, alkylamine oxides, hydrogenated soybean phospholipids, and the like.
  • Anionic surfactants include fatty acid soaps, alpha-acyl sulfonates, alkyl sulfonates, alkyl allyl sulfonates, alkyl naphthalene sulfonates, alkyl sulfates, POE alkyl ether sulfates, alkyl amide sulfates, alkyl phosphates, POE alkyl phosphates, and alkyl amide phosphates.
  • alkyloylalkyl taurine salts alkyloylalkyl taurine salts, N-acylamino acid salts, POE alkyl ether carboxylate salts, alkyl sulfosuccinic acid salts, sodium alkyl sulfoacetate, acylated hydrolyzed collagen peptide salts, perfluoroalkyl phosphate esters, and the like.
  • Amphoteric surfactants include carboxybetaine type, amidebetaine type, sulfobetaine type, hydroxysulfobetaine type, amide sulfobetaine type, phosphobetaine type, aminocarboxylate type, imidazoline derivative type, amideamine type, etc. An amphoteric surfactant etc. are mentioned.
  • organic and inorganic pigments silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium-coated mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide inorganic pigments such as calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine blue, chromium oxide, chromium hydroxide, calamine and complexes thereof; Polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenolic resin, fluororesin, silicon resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, divinylbenzene/styrene copolymer, organic pigments such as silk powder, cellulose, CI pigment yellow and CI pigment orange, and composite pigments of these in
  • organic powder examples include metal soaps such as calcium stearate; Alkyl phosphate metal salts, such as zinc sodium cetylrate, zinc laurylrate, and calcium laurylrate; polyvalent metal salts of acyl amino acids such as N-lauroyl-beta-alanine calcium, N-lauroyl-beta-alanine zinc, and N-lauroyl glycine calcium; polyvalent metal salts of amide sulfonic acids such as N-lauroyl-taurine calcium and N-palmitoyl-taurine calcium; N-epsilon-lauroyl-L-lysine, N-epsilon-palmitoylizine, N-alpha-paritoylolnithine, N-alpha-lauroylarginine, N-alpha-hardened beef fatty acid acylarginine, etc.
  • metal soaps such as calcium stearate
  • Alkyl phosphate metal salts such
  • N-acyl basic amino acids such as N-lauroylglycylglycine
  • alpha-amino fatty acids such as alpha-aminocaprylic acid and alpha-aminolauric acid
  • polyethylene polypropylene, nylon, polymethyl methacrylate, polystyrene, divinylbenzene/styrene copolymer, tetrafluoroethylene, and the like.
  • UV absorbers examples include para-aminobenzoic acid, ethyl para-aminobenzoate, amyl para-aminobenzoate, octyl para-aminobenzoate, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicylate, butylphenyl salicylate, homomenthyl salicylate, and benzyl cinnamate.
  • Bactericides include hinokitiol, triclosan, trichlorohydroxydiphenyl ether, chlorhexidine gluconate, phenoxyethanol, resorcin, isopropylmethylphenol, azulene, salicylic acid, zincophylthione, benzalkonium chloride, photosensitizer So No. 301, mononitroguacol sodium, undecyrenic acid, etc. are mentioned.
  • antioxidants examples include butylhydroxyanisole, propyl gallic acid, and elisorbic acid.
  • pH adjuster examples include citric acid, sodium citrate, malic acid, sodium malate, fumaric acid, sodium fumalate, succinic acid, sodium succinate, sodium hydroxide, and sodium monohydrogenphosphate.
  • alcohol examples include higher alcohols such as cetyl alcohol.
  • blending components that may be added are not limited to these, and any of the above ingredients can be blended within a range not impairing the objects and effects of the present invention, but 0.01 to 5% by weight percent or 0.01 to 3% based on the total weight. Can be formulated in % weight percentage.
  • the formulation of the present invention is a lotion, paste, cream or gel, animal fiber, vegetable fiber, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide as a carrier component can be used
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, additional chlorofluorohydrocarbon, propane / May contain a propellant such as butane or dimethyl ether.
  • a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butyl glycol oil, fatty acid esters of glycerol, polyethylene glycol or sorbitan.
  • the formulation of the present invention is a suspension
  • a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar or tracanth and the like may be used.
  • the formulation of the present invention is surfactant-containing cleansing
  • carrier components aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linolin derivatives, or ethoxylated glycerol fatty acid esters may be used.
  • C2C12 cells (2 x 10 5 cells/well) were seeded in a 12-well culture plate and cultured in Dulbecco's modified Eagle's medium (DMEM) medium containing 10% fetal bovine serum (FBS). C2C12 cells were maintained at 37° C. in a humidified thermostat with 5% CO 2 and 95% air. After 48 hours of culture, the differentiation medium was changed to DMEM (Dulbecco's modified Eagle's medium) containing 2% horse serum, and treated with JC1-40 (20 ⁇ M) and a solvent (control group). 48 hours after changing the differentiation medium, mitochondria of C2C12 cells were stained with 600 nM of tetramethylrhodamine, methyl ester, and perchlorate (TMRM). After 20 minutes, the medium containing 150 nM of TMRM was replaced, and red fluorescence was confirmed after 10 minutes. The results are shown in Figure 1.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine
  • HeLa cells (4 x 10 4 cells/well) were seeded in a 12-well culture plate and cultured overnight in Dulbecco's modified Eagle's medium (DMEM) medium containing 10% fetal bovine serum (FBS). HeLa cells were maintained at 37° C. in a humidified thermostat with 5% CO 2 and 95% air. After 24 hours of culture, the medium was replaced and treated with JC1-40 (5 ⁇ M, 50 ⁇ M) and a solvent (control) for 24 hours. Thereafter, the cells were stained with 200 nM of MitoTracker Green at 37° C. for 30 minutes, and after fixation with 4% formaldehyde, green fluorescence was confirmed using a confocal microscope. The results are shown in Figure 2.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • C2C12 cells (8 x 10 5 cells/dish) were seeded on a 60 mm dish and cultured in Dulbecco's modified Eagle's medium (DMEM) medium containing 10% fetal bovine serum (FBS). C2C12 cells were maintained at 37° C. in a humidified thermostat with 5% CO 2 and 95% air. After 48 hours of culture, the differentiation medium was changed to DMEM (Dulbecco's modified Eagle's medium) containing 2% horse serum, and treated with JC1-40 (20 ⁇ M) and solvent (control). 48 hours after changing the differentiation medium, RNA extraction was performed.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • RNA-M-MLV mixture was prepared using M-MLV reverse transcriptase (Invitrogen) and a reverse transcriptase polymerase chain reaction was developed using a thermal cylinder. Then, real-time polymerase chain reaction was performed using an ABI StepOnePlus Real-Time PCR system (Applied Biosystems). The results are shown in Figure 3. In addition, the primer sequences used in the experiment are shown in Table 1 below.
  • SDHA F GAAAGGCGGGCAGGCTCATC One R: CACCACGGCACTCCCCATTTT 2 COX5A F: TTGATGCCTGGGAATTGCGTAAAG 3 R: AACAACCTCCAAGATGCGAACAG 4 MCAD F: GATCGCAATGGGTGCTTTTGATAGAA 5 R: AGCTGATTGGCAATGTCTCCAGCAAA 6
  • C2C12 cells (8 x 10 5 cells/dish) were seeded on a 60 mm dish and cultured in Dulbecco's modified Eagle's medium (DMEM) medium containing 10% fetal bovine serum (FBS). C2C12 cells were maintained at 37° C. in a humidified thermostat with 5% CO 2 and 95% air. After 48 hours of culture, the differentiation medium was changed to DMEM (Dulbecco's modified Eagle's medium) containing 2% horse serum, and treated with JC1-40 (20 ⁇ M) and solvent (control). The differentiation medium was replaced and 48 hours later, RNA extraction was performed. The RNA extraction method was as described in Example 3.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • NRF1 and TFAM proteins which are regulators of mitochondrial biogenesis, were analyzed by Western blotting analysis.
  • specific antibodies against NRF1 Santa Cruz Biotechnology
  • TFAM Santa Cruz Biotechnology
  • ⁇ -tubulin Millipore
  • C2C12 cells (1 ⁇ 10 5 cells/well) were seeded in a 12-well culture plate and cultured overnight in Dulbecco's modified Eagle's medium (DMEM) medium containing 10% fetal bovine serum (FBS). C2C12 cells were maintained at 37° C. in a humidified thermostat with 5% CO 2 and 95% air. After 24 hours of culture, human TFAM-Luc reporter (100 ng) was transfected into C2C12 cells using PolyFect (QIAGEN). After 24 hours of transformation, the medium was changed to DMEM (Dulbecco's modified Eagle's medium) containing 2% horse serum, and treated with JC1-40 (20 ⁇ M) and solvent (control).
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • C2C12 cells (8 x 10 5 cells/dish) were seeded on a 60 mm dish and cultured overnight in Dulbecco's modified Eagle's medium (DMEM) medium containing 10% fetal bovine serum (FBS). C2C12 cells were maintained at 37° C. in a humidified thermostat with 5% CO 2 and 95% air. After 24 hours of culture, C2C12 cells were transfected with si-RORa (250 pmoles) and si-GL3 (control) using Lipofectamine 2000 (Thermo Fisher Scientific). After 24 hours of transformation, the cells were replaced with DMEM (Dulbecco's modified Eagle's medium) differentiation medium containing 2% horse serum, and treated with JC1-40 (20 ⁇ M) for 48 hours. RNA and protein extraction methods are as described above. 5 shows the RORa-dependent results of the increase in TFAM expression by JC1-40.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • TFAM a mitochondrial biogenesis regulator
  • mice were acclimated to a room temperature and humidity-controlled environment for 1 week, and fed with a high-fat diet (lard-derived fat and soybean oil-derived fat containing 60 kcal%, Research diets ) was provided for 12 weeks. From the 8th week of the diet, JC1-40 was orally administered at a concentration of 5 mg/kg once a day for 5 weeks (FIG. 6a).
  • JC1-40 in an amount corresponding to the final concentration was weighed and added to sterile water containing 0.5% carboxymethylcellulose, and then evenly suspended using a mortar and pestle to prepare a drug. Doses of individual mouse subjects were taken and administered orally using a Sonde. Sterile water containing 0.5% carboxymethylcellulose was administered to the control group in the same manner. After 12 weeks of diet, mice were anesthetized, gastrocnemius tissue was excised, and fixed using a 4% paraformaldehyde solution. The fixed tissue was finally prepared as a paraffin block using paraffin after washing, decalcification, and dehydration.
  • composition containing JC1-40 of the present invention as an active ingredient increases mitochondrial membrane potential, increases the amount of mitochondria, and increases the expression or activity of genes or proteins related to mitochondria, thereby increasing mitochondrial biosynthesis to prevent sarcopenia. , improvement, and treatment, so it has industrial applicability.

Landscapes

  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 RORα의 활성자 JC1-40을 포함하는 근감소증 예방, 개선, 또는 치료를 위한 약학적 조성물 등에 관한 것이다. 본 발명에 따른 조성물은 미토콘드리아 막전위를 증가시키고 미토콘드리아 양을 증가시키며, 미토콘드리아와 관련한 유전자 또는 단백질의 발현 또는 활성을 증가시키는 바, 미토콘드리아의 생합성을 증가시켜 근감소증의 예방, 개선, 및 치료에 효과가 있을 것으로 기대된다.

Description

RORα의 활성자 JC1-40을 포함하는 근감소증 예방, 개선, 또는 치료를 위한 약학적 조성물
본 발명은 RORα의 활성자 JC1-40을 포함하는 근감소증 예방, 개선, 또는 치료를 위한 약학적 조성물 등에 관한 것이다.
본 출원은 2021년 5월 17일에 출원된 한국특허출원 제10-2021-0063110호 및 2022년 5월 12일에 출원된 한국특허출원 제10-2022-0058534호에 기초한 우선권을 주장하며, 해당 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
한국 사회는 평균수명의 연장과 출산율의 감소로 초고령화 사회 시대를 맞이하고 있다. 또한 현대 사회의 건강을 위협하는 주된 요인인 비만은 한국 사회에서 지속적으로 증가하고 있고, 이는 다양한 만성질환의 병인이 되며 조기 사망의 증가를 유발시킨다. 노화와 비만에 따른 신체적 변화 중의 하나로서, 근육량 및 근력의 감소로 나타나는 근감소증 및 근감소성 비만은 일상생활의 운동력을 상실시킬 뿐 아니라 만성 간질환, 심혈관계 질환, 폐질환, 뇌질환 및 퇴행성 질환으로 이어질 수 있다는 점에서 현대 사회의 인류 건강을 위해 반드시 극복해야 할 질환이다. 현재로서는 절식, 단백질 보충, 운동 요법이 일차적 치료 요법이 되고 있으며 테스토스테론, myostatin 저해제, ghrelin analogue, 비타민 K 등이 미래의 치료요법으로 제시되고 있지만 근감소증을 특이적으로 치료하는 약물은 여전히 부재한 상황이다.
미토콘드리아는 에너지 대사에 있어 주축이 되는 세포소기관이며 미토콘드리아의 양적, 질적 유지는 세포 내 항상성 유지에 필수적인 요인이다. 미토콘드리아 기능 조절은 크게 생합성, fission/fusion, 미토콘드리아 특이적 자가포식 작용을 통해 이루어진다. 미토콘드리아의 기능 손상은 산화 스트레스, 세포 사멸, 염증 등 근감소증의 복합적인 병인에 기여하는 주요 요인이다.
RORα(또는 NR1F1, RORA or RZR로 알려짐)는 스테로이드 호르몬 수용체 슈퍼패밀리의 하나로, 유전자 발현을 조절하는 전사 인자이다. RORα는 콜레스테롤과 콜레스테롤 유도체, 멜라토닌 및 thiazolidinedione의 하나인 CGP52608 등의 리간드의 특이적 결합을 통해 활성이 조절되며, 타겟 유전자의 프로모터에 있는 ROR-결합 반응 엘리먼트(RORE)에 결합하여 타겟 유전자의 발현을 조절한다. 근육에서 RORα는 p300과 MyoD와의 직접적인 결합을 통해 근육의 분화를 촉진한다. RORα 결손 마우스 (sg/sg, sg/+)는 당 불내성의 개선과 인슐린 감수성의 증가를 보였으며 이는 근육의 RORα가 당 대사에 관여할 수 있음을 시사한다. 뿐만 아니라 근육 내 RORα 의 발현이 감소되었을 때 지질 항상성과 관련된 유전자들(caveolin-3, CPT-1)의 발현이 감소하였으며, 잘린 (우성 음성) RORa1의 근육 특이적인 발현을 나타내는 형질 전환 마우스를 이용하여 RORα가 Akt2-AMPK 경로 조절을 통해 지질 항상성에 관여할 수 있다. 또한 근육세포에서 합성 활성제 및 천연물질을 통해 RORα를 활성화시켰을 때 fibroblast growth factor 21(FGF21)의 발현, 미토콘드리아 Complex II 활성화, 및 슈퍼 컴플렉스 형성이 증가하였으며 이는 비만 관련 질환 치료 및 근감소증에 RORα 활성이 적용될 수 있음을 의미한다.
이에, 본 발명자들은 JC1-40 화합물이 미토콘드리아 생합성을 증가시키고 미토콘드리아 관련 조절 인자의 발현을 증가시키는 것을 확인하여, 본 발명을 완성하였다.
이에 본 발명자들은 JC1-40 화합물이 미토콘드리아 생합성을 증가시키고 미토콘드리아 관련 조절 인자의 발현을 증가시키는 것을 확인하여, 본 발명을 완성하였다.
이에 본 발명의 목적은 JC1-40 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 근감소증 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 JC1-40 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는, 근감소증 예방 또는 개선용 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 JC1-40 또는 이의 화장품학적으로 허용 가능한 염을 유효성분으로 포함하는, 근기능 개선용 화장료 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 JC1-40 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 미토콘드리아 생합성 증가용 조성물을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기 본 발명의 목적을 달성하기 위하여, 본 발명은 JC1-40 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 근감소증 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 JC1-40 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는, 근감소증 예방 또는 개선용 식품 조성물을 제공한다.
또한, 본 발명은 JC1-40 또는 이의 화장품학적으로 허용 가능한 염을 유효성분으로 포함하는, 근기능 개선용 화장료 조성물을 제공한다.
또한, 본 발명은 JC1-40 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 미토콘드리아 생합성 증가용 조성물을 제공한다.
본 발명의 일 구현예에서 상기 JC1-40은 RORα 단백질의 활성화제인 것을 특징으로 할 수 있으나, 이에 제한되지 않는다.
본 발명의 다른 구현예에서 상기 JC1-40은 전체 조성물 대비 1 내지 100μM의 농도로 포함되는 것을 특징으로 할 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예에서 상기 JC1-40은 하기 특징 중 하나 이상을 만족시키는 것을 특징으로 할 수 있으나, 이에 제한되지 않는다: a) 미토콘드리아 막전위를 증가시킴; b) 미토콘드리아 양을 증가시킴; 및 c) 미토콘드리아 생합성을 증가시킴.
본 발명의 또 다른 구현예에서 상기 JC1-40은 SDHA, COX5A, MCAD, PGC-1α, NRF1, NRF2α, 및 TFAM으로 이루어진 군에서 선택된 유전자 또는 단백질의 발현 또는 활성을 증가시키는 것을 특징으로 할 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예에서 상기 TFAM 유전자 또는 단백질의 발현 또는 활성은 RORα에 의존적인 것을 특징으로 할 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예에서 상기 근감소증은 비만성 근감소증 또는 노인성 근감소증인 것을 특징으로 할 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 JC1-40 또는 이의 약학적으로 허용 가능한 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 근감소증 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 JC1-40 또는 이의 약학적으로 허용 가능한 염의 근감소증 예방 또는 치료 용도를 제공한다.
또한, 본 발명은 근감소증 예방 또는 치료에 이용되는 약제를 생산하기 위한 JC1-40 또는 이의 약학적으로 허용 가능한 염의 용도를 제공한다.
또한, 본 발명은 JC1-40 또는 이의 약학적으로 허용 가능한 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 미토콘드리아 생합성 증가 방법을 제공한다.
또한, 본 발명은 JC1-40 또는 이의 약학적으로 허용 가능한 염의 미토콘드리아 생합성 증가 용도를 제공한다.
또한, 본 발명은 미토콘드리아 생합성 증가용 약제를 생산하기 위한 JC1-40 또는 이의 약학적으로 허용 가능한 염의 용도를 제공한다.
또한, 본 발명은 JC1-40 또는 이의 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 근기능 개선 방법을 제공한다.
또한, 본 발명은 JC1-40 또는 이의 염의 근기능 개선 용도를 제공한다.
또한, 본 발명은 근기능 개선에 이용되는 화장품을 생산하기 위한 JC1-40 또는 이의 화장품학적으로 허용 가능한 염의 용도를 제공한다.
본 발명에 따른 조성물은 미토콘드리아 막전위를 증가시키고 미토콘드리아 양을 증가시키며, 미토콘드리아와 관련한 유전자 또는 단백질의 발현 또는 활성을 증가시키는 바, 미토콘드리아의 생합성을 증가시켜 근감소증의 예방, 개선, 및 치료에 효과가 있을 것으로 기대된다.
도 1은 C2C12 세포에서 JC1-40이 미토콘드리아 막전위에 미치는 효과를 나타낸 것이다.
도 2는 HeLa 세포에서 JC1-40이 미토콘드리아 양에 미치는 효과를 나타낸 것이다.
도 3은 C2C12 세포에서 JC1-40이 SDHA, COX5A, 및 MCAD의 mRNA 발현에 미치는 효과를 나타낸 것이다.
도 4a는 C2C12 세포에서 JC1-40이 PGC-1α, NRF1, NRF2α, 및 TFAM의 mRNA 발현에 미치는 효과를 나타낸 것이다.
도 4b는 C2C12 세포에서 JC1-40이 NRF1 및 TFAM 단백질의 활성에 미치는 효과를 나타낸 것이다.
도 4c는 C2C12 세포에서 JC1-40이 TFAM 프로모터의 전사 활성에 미치는 효과를 나타낸 것이다.
도 5는 C2C12 세포에서 JC1-40에 의한 TFAM 발현 증가가 RORα 의존적인지를 확인한 결과를 나타낸 것이다.
도 6a 및 6b는 고지질 식이 유도 동물 모델에서 JC1-40이 미토콘드리아 생합성 효과에 미치는 영향을 확인한 실험 방법 및 결과를 나타낸 것이다.
본 발명자들은 근감소증을 효과적으로 치료하거나, 진행을 둔화시키는 제제를 개발하기 위해 예의 노력한 결과, JC1-40 화합물이 미토콘드리아 막전위를 증가시키고 미토콘드리아 양을 증가시키며, 미토콘드리아와 관련한 유전자 또는 단백질의 발현 또는 활성을 증가시키는 바, 미토콘드리아의 생합성을 증가시켜 근감소증을 효율적으로 예방, 개선, 또는 치료할 수 있음을 확인함으로써 본 발명을 완성하였다.
이하, 본 발명에 대해 상세히 설명한다.
본 발명은 JC1-40 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 근감소증 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에 있어서, JC1-40은 RORα 단백질의 활성화제로서 하기 화학식 1로 표시될 수 있으며, 1-methyl-3-[(4-phenylmethoxyphenyl)methyl]thiourea의 IUPAC 네임을 가질 수 있으며, 화학식은 C16H18N2OS일 수 있고, 분자량은 286.39일 수 있으나, 이에 제한되지 않는다. 또한, 상기 화합물의 획득 방법은 본 발명이 속한 분야에서 공지된 방법으로 화학적으로 합성하거나, 시판되는 물질을 사용할 수 있다.
[화학식 1]
Figure PCTKR2022006925-appb-img-000001
본 발명에 있어서, 상기 JC1-40은 전체 조성물 대비 1 내지 100μM, 1 내지 90μM, 1 내지 80μM, 1 내지 70μM, 1 내지 60μM, 1 내지 50μM, 2 내지 100μM, 2 내지 90μM, 2 내지 80μM, 2 내지 70μM, 2 내지 60μM, 2 내지 50μM, 3 내지 100μM, 3 내지 90μM, 3 내지 80μM, 3 내지 70μM, 3 내지 60μM, 3 내지 50μM, 4 내지 100μM, 4 내지 90μM, 4 내지 80μM, 4 내지 70μM, 4 내지 60μM, 4 내지 50μM, 5 내지 100μM, 5 내지 90μM, 5 내지 80μM, 5 내지 70μM, 5 내지 60μM, 5 내지 50μM, 10 내지 50μM, 10 내지 40μM, 10 내지 30μM, 또는 20μM의 농도로 포함될 수 있으나, 이에 제한되지 않는다. 또한, 상기 JC1-40은 하기 특징 중 하나 이상을 만족시킬 수 있으나, 이에 제한되지 않는다: a) 미토콘드리아 막전위를 증가시킴; b) 미토콘드리아 양을 증가시킴; 및 c) 미토콘드리아 생합성을 증가시킴. 또한, 상기 JC1-40은 특히 근육세포에서 상기 특징 중 하나 이상을 만족시킬 수 있으나, 이에 제한되지 않는다
본 발명에 있어서, 상기 JC1-40은 SDHA, COX5A, MCAD, PGC-1α, NRF1, NRF2α, 및 TFAM으로 이루어진 군에서 선택된 유전자 또는 단백질의 발현 또는 활성을 증가시킬 수 있으나, 이에 제한되지 않는다. 상기 TFAM 유전자 또는 단백질의 발현 또는 활성은 RORα에 의존적일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, “RORα(RAR-related orphan receptor alpha)”는 스테로이드 호르몬 수용체 슈퍼패밀리의 하나로, 유전자 발현을 조절하는 전사 인자이다. 근육에서 RORα는 p300과 MyoD와의 직접적인 결합을 통해 근육의 분화를 촉진한다. RORα가 활성화되면 미토콘드리아 콤플렉스(Complex) II 활성화 및 슈퍼 컴플렉스 형성이 증가할 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, “근감소증(sarcopenia)”은 근육량 및 근력이 감소하는 퇴행성 질환으로, 정상적인 노화 과정에서 나타나는 근육 소실과 달리, 비정상적으로 급격히 근육량이 감소하는 질환을 말한다. 이러한 근감소증은 노화에 의한 일차성 근감소증(Primary sarcopenia)과 다양한 원인들에 의한 이차성 근감소증(Secondary sarcopenia)으로 나누어 지는데, 이차성 근감소증의 원인으로는 영양결핍, 활동 저하, 비만, 장기 부전, 약물, 염증, 악성 질환, 또는 내분비 대사질환 등이 있다. 상기 근감소증은 미토콘드리아 기능 장애에 의한 것일 수 있으나, 이에 제한되지 않는다. 본 발명의 일 실시예에 따르면, 비만성 근감소증 또는 노인성 근감소증일 수 있으며, 바람직하게는 비만성 근감소증일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 미토콘드리아 생합성 활성은 산화 대사 및 조직 생물 에너지 발생을 향상시키고, 근감소증 질환에서 근기능을 향상시킬 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 JC1-40 화합물의 약학적으로 허용 가능한 염을 유효성분으로 포함할 수 있다. 본 발명에서 용어, "약학적으로 허용 가능한 염"이란 약학적으로 허용되는 무기산, 유기산, 또는 염기로부터 유도된 염을 포함한다.
적합한 산의 예로는 염산, 브롬산, 황산, 질산, 과염소산, 푸마르산, 말레산, 인산, 글리콜산, 락트산, 살리실산, 숙신산, 톨루엔-p-설폰산, 타르타르산, 아세트산, 시트르산, 메탄설폰산, 포름산, 벤조산, 말론산, 글루콘산, 나프탈렌-2-설폰산, 벤젠설폰산 등을 들 수 있다. 산부가염은 통상의 방법, 예를 들면 화합물을 과량의 산 수용액에 용해시키고, 이 염을 메탄올, 에탄올, 아세톤 또는 아세토니트릴과 같은 수혼화성 유기 용매를 사용하여 침전시켜서 제조할 수 있다. 또한, 동몰량의 화합물 및 물 중의 산 또는 알코올을 가열하고 이어서 상기 혼합물을 증발시켜서 건조시키거나, 또는 석출된 염을 흡인 여과시켜 제조할 수 있다.
적합한 염기로부터 유도된 염은 나트륨, 칼륨 등의 알칼리 금속, 마그네슘 등의 알칼리 토금속, 및 암모늄 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 알칼리 금속 또는 알칼리 토금속염은, 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리토 금속 수산화물 용액 중에 용해하고, 비용해 화합물염을 여과한 후 여액을 증발, 건조시켜 얻을 수 있다. 이 때, 금속염으로서는 특히 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하며, 또한 이에 대응하는 은염은 알칼리 금속 또는 알칼리토 금속염을 적당한 은염(예, 질산은)과 반응시켜 얻을 수 있다.
본 발명자들은 JC1-40 화합물이 미토콘드리아 막전위 증가 효과 및 미토콘드리아 양 증가 효과가 우수한 것을 확인하였으며(실시예 1 및 2 참조),
미토콘드리아 관련 유전자 및 단백질의 발현 및 활성 증가 효과가 우수함을 확인하였으며(실시예 3 및 4 참조),
미토콘드리아 생합성 조절인자 TFAM의 발현이 RORα 의존적으로 증가하는 것을 확인하였으며, 고지질 식이 유도 동물 모델에서 JC1-40의 미토콘드리아 생합성 증가 효과가 현저함을 확인하였다(실시예 5 및 6 참조).
따라서, 본 발명의 JC1-40 또는 이의 약학적으로 허용 가능한 염은 근감소증 예방 또는 치료용 약학적 조성물; 또는 미토콘드리아 생합성 증가용 조성물로서 제공될 수 있다.
또한, 본 발명은 JC1-40 또는 이의 약학적으로 허용 가능한 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 근감소증 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 JC1-40 또는 이의 약학적으로 허용 가능한 염의 근감소증 예방 또는 치료 용도를 제공한다.
또한, 본 발명은 근감소증 예방 또는 치료에 이용되는 약제를 생산하기 위한 JC1-40 또는 이의 약학적으로 허용 가능한 염의 용도를 제공한다.
또한, 본 발명은 JC1-40 또는 이의 약학적으로 허용 가능한 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 미토콘드리아 생합성 증가 방법을 제공한다.
또한, 본 발명은 JC1-40 또는 이의 약학적으로 허용 가능한 염의 미토콘드리아 생합성 증가 용도를 제공한다.
또한, 본 발명은 미토콘드리아 생합성 증가용 약제를 생산하기 위한 JC1-40 또는 이의 약학적으로 허용 가능한 염의 용도를 제공한다.
본 발명의 조성물 내의 상기 JC1-40 화합물 또는 이의 약학적으로 허용 가능한 염의 함량은 질환의 증상, 증상의 진행 정도, 환자의 상태 등에 따라서 적절히 조절 가능하며, 예컨대, 전체 조성물 중량을 기준으로 0.0001 내지 99.9중량%, 또는 0.001 내지 50중량%일 수 있으나, 이에 한정되는 것은 아니다. 상기 함량비는 용매를 제거한 건조량을 기준으로 한 값이다.
본 발명에 따른 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 부형제는 예를 들어, 희석제, 결합제, 붕해제, 활택제, 흡착제, 보습제, 필름-코팅 물질, 및 제어방출첨가제로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 서방형 과립제, 장용과립제, 액제, 점안제, 엘실릭제, 유제, 현탁액제, 주정제, 트로키제, 방향수제, 리모나아데제, 정제, 서방형정제, 장용정제, 설하정, 경질캅셀제, 연질캅셀제, 서방캅셀제, 장용캅셀제, 환제, 틴크제, 연조엑스제, 건조엑스제, 유동엑스제, 주사제, 캡슐제, 관류액, 경고제, 로션제, 파스타제, 분무제, 흡입제, 패취제, 멸균주사용액, 또는에어로졸 등의 외용제 등의 형태로 제형화하여 사용될 수 있으며, 상기 외용제는 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 등의 제형을 가질 수 있다.
본 발명에 따른 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
본 발명에 따른 정제, 산제, 과립제, 캡슐제, 환제, 트로키제의 첨가제로 옥수수전분, 감자전분, 밀전분, 유당, 백당, 포도당, 과당, 디-만니톨, 침강탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 미결정셀룰로오스, 덱스트린, 알긴산나트륨, 메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 카올린, 요소, 콜로이드성실리카겔, 히드록시프로필스타치, 히드록시프로필메칠셀룰로오스(HPMC), HPMC 1928, HPMC 2208, HPMC 2906, HPMC 2910, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤 등 부형제; 젤라틴, 아라비아고무, 에탄올, 한천가루, 초산프탈산셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스칼슘, 포도당, 정제수, 카제인나트륨, 글리세린, 스테아린산, 카르복시메칠셀룰로오스나트륨, 메칠셀룰로오스나트륨, 메칠셀룰로오스, 미결정셀룰로오스, 덱스트린, 히드록시셀룰로오스, 히드록시프로필스타치, 히드록시메칠셀룰로오스, 정제쉘락, 전분호, 히드록시프로필셀룰로오스, 히드록시프로필메칠셀룰로오스, 폴리비닐알코올, 폴리비닐피롤리돈 등의 결합제가 사용될 수 있으며, 히드록시프로필메칠셀룰로오스, 옥수수전분, 한천가루, 메칠셀룰로오스, 벤토나이트, 히드록시프로필스타치, 카르복시메칠셀룰로오스나트륨, 알긴산나트륨, 카르복시메칠셀룰로오스칼슘, 구연산칼슘, 라우릴황산나트륨, 무수규산, 1-히드록시프로필셀룰로오스, 덱스트란, 이온교환수지, 초산폴리비닐, 포름알데히드처리 카제인 및 젤라틴, 알긴산, 아밀로오스, 구아르고무(Guar gum), 중조, 폴리비닐피롤리돈, 인산칼슘, 겔화전분, 아라비아고무, 아밀로펙틴, 펙틴, 폴리인산나트륨, 에칠셀룰로오스, 백당, 규산마그네슘알루미늄, 디-소르비톨액, 경질무수규산 등 붕해제; 스테아린산칼슘, 스테아린산마그네슘, 스테아린산, 수소화식물유(Hydrogenated vegetable oil), 탈크, 석송자, 카올린, 바셀린, 스테아린산나트륨, 카카오지, 살리실산나트륨, 살리실산마그네슘, 폴리에칠렌글리콜(PEG) 4000, PEG 6000, 유동파라핀, 수소첨가대두유(Lubri wax), 스테아린산알루미늄, 스테아린산아연, 라우릴황산나트륨, 산화마그네슘, 마크로골(Macrogol), 합성규산알루미늄, 무수규산, 고급지방산, 고급알코올, 실리콘유, 파라핀유, 폴리에칠렌글리콜지방산에테르, 전분, 염화나트륨, 초산나트륨, 올레인산나트륨, dl-로이신, 경질무수규산 등의 활택제;가 사용될 수 있다.
본 발명에 따른 액제의 첨가제로는 물, 묽은 염산, 묽은 황산, 구연산나트륨, 모노스테아린산슈크로스류, 폴리옥시에칠렌소르비톨지방산에스텔류(트윈에스텔), 폴리옥시에칠렌모노알킬에텔류, 라놀린에텔류, 라놀린에스텔류, 초산, 염산, 암모니아수, 탄산암모늄, 수산화칼륨, 수산화나트륨, 프롤아민, 폴리비닐피롤리돈, 에칠셀룰로오스, 카르복시메칠셀룰로오스나트륨 등이 사용될 수 있다.
본 발명에 따른 시럽제에는 백당의 용액, 다른 당류 혹은 감미제 등이 사용될 수 있으며, 필요에 따라 방향제, 착색제, 보존제, 안정제, 현탁화제, 유화제, 점조제 등이 사용될 수 있다.
본 발명에 따른 유제에는 정제수가 사용될 수 있으며, 필요에 따라 유화제, 보존제, 안정제, 방향제 등이 사용될 수 있다.
본 발명에 따른 현탁제에는 아카시아, 트라가칸타, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 미결정셀룰로오스, 알긴산나트륨, 히드록시프로필메칠셀룰로오스(HPMC), HPMC 1828, HPMC 2906, HPMC 2910 등 현탁화제가 사용될 수 있으며, 필요에 따라 계면활성제, 보존제, 안정제, 착색제, 방향제가 사용될 수 있다.
본 발명에 따른 주사제에는 주사용 증류수, 0.9%염화나트륨주사액, 링겔주사액, 덱스트로스주사액, 덱스트로스+염화나트륨주사액, 피이지(PEG), 락테이티드 링겔주사액, 에탄올, 프로필렌글리콜, 비휘발성유-참기름, 면실유, 낙화생유, 콩기름, 옥수수기름, 올레인산에칠, 미리스트산 이소프로필, 안식향산벤젠과 같은 용제; 안식향산나트륨, 살리실산나트륨, 초산나트륨, 요소, 우레탄, 모노에칠아세트아마이드, 부타졸리딘, 프로필렌글리콜, 트윈류, 니정틴산아미드, 헥사민, 디메칠아세트아마이드와 같은 용해보조제; 약산 및 그 염(초산과 초산나트륨), 약염기 및 그 염(암모니아 및 초산암모니움), 유기화합물, 단백질, 알부민, 펩톤, 검류와 같은 완충제; 염화나트륨과 같은 등장화제; 중아황산나트륨(NaHSO3)이산화탄소가스, 메타중아황산나트륨(Na2S2O5), 아황산나트륨(Na2SO3), 질소가스(N2), 에칠렌디아민테트라초산과 같은 안정제; 소디움비설파이드 0.1%, 소디움포름알데히드 설폭실레이트, 치오우레아, 에칠렌디아민테트라초산디나트륨, 아세톤소디움비설파이트와 같은 황산화제; 벤질알코올, 클로로부탄올, 염산프로카인, 포도당, 글루콘산칼슘과 같은 무통화제; 시엠시나트륨, 알긴산나트륨, 트윈 80, 모노스테아린산알루미늄과 같은 현탁화제를 포함할 수 있다.
본 발명에 따른 좌제에는 카카오지, 라놀린, 위텝솔, 폴리에틸렌글리콜, 글리세로젤라틴, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 스테아린산과 올레인산의 혼합물, 수바날(Subanal), 면실유, 낙화생유, 야자유, 카카오버터+콜레스테롤, 레시틴, 라네트왁스, 모노스테아린산글리세롤, 트윈 또는 스판, 임하우젠(Imhausen), 모놀렌(모노스테아린산프로필렌글리콜), 글리세린, 아뎁스솔리두스(Adeps solidus), 부티룸 태고-G(Buytyrum Tego-G), 세베스파마 16 (Cebes Pharma 16), 헥사라이드베이스 95, 코토마(Cotomar), 히드록코테 SP, S-70-XXA, S-70-XX75(S-70-XX95), 히드록코테(Hydrokote) 25, 히드록코테 711, 이드로포스탈 (Idropostal), 마사에스트라리움(Massa estrarium, A, AS, B, C, D, E, I, T), 마사-MF, 마수폴, 마수폴-15, 네오수포스탈-엔, 파라마운드-B, 수포시로(OSI, OSIX, A, B, C, D, H, L), 좌제기제 IV 타입 (AB, B, A, BC, BBG, E, BGF, C, D, 299), 수포스탈 (N, Es), 웨코비 (W, R, S, M ,Fs), 테제스터 트리글리세라이드 기제 (TG-95, MA, 57)와 같은 기제가 사용될 수 있다.
경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다.
경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 본 발명이 속하는 기술분야에 통상의 기술자에 의해 용이하게 결정될 수 있다.
본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구 복용, 피하 주사, 복강 투여, 정맥 주사, 근육 주사, 척수 주위 공간(경막내) 주사, 설하 투여, 볼점막 투여, 직장 내 삽입, 질 내 삽입, 안구 투여, 귀 투여, 비강 투여, 흡입, 입 또는 코를 통한 분무, 피부 투여, 경피 투여 등에 따라 투여될 수 있다.
본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별, 체중 및 질환의 중등도 등의 여러 관련 인자와 함께 활성성분인 약물의 종류에 따라 결정된다.
본 발명에서 “개체”란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말, 및 소 등의 포유류일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 “투여”란 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.
본 발명에서 “예방”이란 목적하는 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미하고, “치료”란 본 발명에 따른 약학적 조성물의 투여에 의해 목적하는 질환과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, “개선”이란 본 발명에 따른 조성물의 투여에 의해 목적하는 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.
또한, 본 발명은 JC1-40 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는, 근감소증 예방 또는 개선용 식품 조성물을 제공한다. 상기 식품 조성물은 건강기능식품 조성물을 포함한다.
본 발명의 JC1-40 또는 이의 식품학적으로 허용 가능한 염을 식품 첨가물로 사용할 경우, 상기 JC1-40 또는 이의 식품학적으로 허용 가능한 염을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시 본 발명의 JC1-40 또는 이의 식품학적으로 허용 가능한 염은 원료에 대하여 15 중량% 이하, 또는 10 중량% 이하의 양으로 첨가될 수 있다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.
상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다.
본 발명에 따른 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당 및 과당과 같은 모노사카라이드, 말토오스 및 수크로오스와 같은 디사카라이드, 덱스트린 및 시클로덱스트린과 같은 폴리사카라이드, 및 자일리톨, 소르비톨 및 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 mL당 일반적으로 약 0.01-0.20g, 또는 약 0.04-0.10g 이다.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01-0.20 중량부의 범위에서 선택되는 것이 일반적이다.
또한, 본 발명은 JC1-40 또는 이의 화장품학적으로 허용 가능한 염을 유효성분으로 포함하는, 근기능 개선용 화장료 조성물을 제공한다.
또한, 본 발명은 JC1-40 또는 이의 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 근기능 개선 방법을 제공한다.
또한, 본 발명은 JC1-40 또는 이의 염의 근기능 개선 용도를 제공한다.
또한, 본 발명은 근기능 개선에 이용되는 화장품을 생산하기 위한 JC1-40 또는 이의 화장품학적으로 허용 가능한 염의 용도를 제공한다.
본 발명에 있어서, “근기능 개선”은 노화, 비만 등으로 인해 발생하는 근육량 감소를 개선시키는 것을 의미한다. 상기 근기능은 근육량에 비례할 수 있으나, 이에 제한되지 않는다.
본 발명에 따른 화장료 조성물의 제형은 스킨로션, 스킨소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스쳐 로션, 영양로션, 맛사지크림, 영양크림, 미스트, 모이스쳐 크림, 핸드크림, 핸드로션, 파운데이션, 에센스, 영양에센스, 팩, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 클렌징오일, 클렌징밤, 바디로션 또는 바디클렌저의 형태일 수 있다.
본 발명의 화장료 조성물은 수용성 비타민, 유용성 비타민, 고분자 펩티드, 고분자 다당, 및 스핑고 지질로 이루어진 군에서 선택된 조성물을 더 포함할 수 있다.
수용성 비타민으로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 예를 들어 비타민 B1, 비타민 B2, 비타민 B6, 피리독신, 염산피리독신, 비타민 B12, 판토텐산, 니코틴산, 니코틴산아미드, 엽산, 비타민 C, 비타민 H 등을 들 수 있으며, 그들의 염(티아민염산염, 아스코르빈산나트륨염 등)이나 유도체(아스코르빈산-2-인산나트륨염, 아스코르빈산-2-인산마그네슘염 등)도 본 발명에서 사용할 수 있는 수용성 비타민에 포함된다. 수용성 비타민은 미생물 변환법, 미생물의 배양물로부터의 정제법, 효소법 또는 화학 합성법 등의 통상의 방법에 의해 수득할 수 있다.
유용성 비타민으로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 예를 들어 비타민 A, 카로틴, 비타민 D2, 비타민 D3, 비타민 E(d1-알파 토코페롤, d-알파 토코페롤) 등을 들 수 있으며, 그들의 유도체(팔미틴산아스코르빈, 스테아르산아스코르빈, 디팔미틴산아스코르빈, 아세트산 dl-알파 토코페롤, 니코틴산 dl-알파 토코페롤 비타민 E, DL-판토테닐알코올, D-판토테닐알코올, 판토테닐에틸에테르 등) 등도 본 발명에서 사용되는 유용성 비타민에 포함된다. 유용성 비타민은 미생물 변환법, 미생물의 배양물로부터의 정제법, 효소 또는 화학 합성법 등의 통상의 방법에 의해 취득할 수 있다.
고분자 펩티드로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 예를 들어 콜라겐, 가수 분해 콜라겐, 젤라틴, 엘라스틴, 가수 분해 엘라스틴, 케라틴 등을 들 수 있다. 고분자 펩티드는 미생물의 배양액으로부터의 정제법, 효소법 또는 화학 합성법 등의 통상의 방법에 의해 정제 취득할 수 있으며, 또는 통상 돼지나 소 등의 진피, 누에의 견섬유 등의 천연물로부터 정제하여 사용할 수 있다.
고분자 다당으로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 예를 들어 히드록시에틸셀룰로오스, 크산탄검, 히알루론산나트륨, 콘드로이틴 황산 또는 그 염(나트륨염 등) 등을 들 수 있다. 예를 들어, 콘드로이틴 황산 또는 그 염 등은 통상 포유 동물이나 어류로부터 정제하여 사용할 수 있다.
스핑고 지질로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 예를 들어 세라미드, 피토스핑고신, 스핑고당지질 등을 들 수 있다. 스핑고 지질은 통상 포유류, 어류, 패류, 효모 또는 식물 등으로부터 통상의 방법에 의해 정제하거나 화학 합성법에 의해 취득할 수 있다.
본 발명의 화장료 조성물에는 상기 필수 성분과 더불어 필요에 따라 통상 화장품에 배합되는 다른 성분을 배합해도 된다.
이외에 첨가해도 되는 배합 성분으로서는 유지 성분, 보습제, 에몰리엔트제, 계면 활성제, 유기 및 무기 안료, 유기 분체, 자외선 흡수제, 방부제, 살균제, 산화 방지제, 식물 추출물, pH 조정제, 알콜, 색소, 향료, 혈행 촉진제, 냉감제, 제한(制汗)제, 정제수 등을 들 수 있다.
유지 성분으로서는 에스테르계 유지, 탄화수소계 유지, 실리콘계 유지, 불소계 유지, 동물 유지, 식물 유지 등을 들 수 있다.
에스테르계 유지로서는 트리2-에틸헥산산글리세릴, 2-에틸헥산산세틸, 미리스틴산이소프로필, 미리스틴산부틸, 팔미틴산이소프로필, 스테아르산에틸, 팔미틴산옥틸, 이소스테아르산이소세틸, 스테아르산부틸, 리놀레산에틸, 리놀레산이소프로필, 올레인산에틸, 미리스틴산이소세틸, 미리스틴산이소스테아릴, 팔미틴산이소스테아릴, 미리스틴산옥틸도데실, 이소스테아르산이소세틸, 세바신산디에틸, 아디핀산디이소프로필, 네오펜탄산이소알킬, 트리(카프릴, 카프린산)글리세릴, 트리2-에틸헥산산트리메틸롤프로판, 트리이소스테아르산트리메틸롤프로판, 테트라2-에틸헥산산펜타엘리슬리톨, 카프릴산세틸, 라우린산데실, 라우린산헥실, 미리스틴산데실, 미리스틴산미리스틸, 미리스틴산세틸, 스테아르산스테아릴, 올레인산데실, 리시노올레인산세틸, 라우린산이소스테아릴, 미리스틴산이소트리데실, 팔미틴산이소세틸, 스테아르산옥틸, 스테아르산이소세틸, 올레인산이소데실, 올레인산옥틸도데실, 리놀레산옥틸도데실, 이소스테아르산이소프로필, 2-에틸헥산산세토스테아릴, 2-에틸헥산산스테아릴, 이소스테아르산헥실, 디옥탄산에틸렌글리콜, 디올레인산에틸렌글리콜, 디카프린산프로필렌글리콜, 디(카프릴,카프린산)프로필렌글리콜, 디카프릴산프로필렌글리콜, 디카프린산네오펜틸글리콜, 디옥탄산네오펜틸글리콜, 트리카프릴산글리세릴, 트리운데실산글리세릴, 트리이소팔미틴산글리세릴, 트리이소스테아르산글리세릴, 네오펜탄산옥틸도데실, 옥탄산이소스테아릴, 이소노난산옥틸, 네오데칸산헥실데실, 네오데칸산옥틸도데실, 이소스테아르산이소세틸, 이소스테아르산이소스테아릴, 이소스테아르산옥틸데실, 폴리글리세린올레인산에스테르, 폴리글리세린이소스테아르산에스테르, 시트르산트리이소세틸, 시트르산트리이소알킬, 시트르산트리이소옥틸, 락트산라우릴, 락트산미리스틸, 락트산세틸, 락트산옥틸데실, 시트르산트리에틸, 시트르산아세틸트리에틸, 시트르산아세틸트리부틸, 시트르산트리옥틸, 말산디이소스테아릴, 히드록시스테아르산 2-에틸헥실, 숙신산디2-에틸헥실, 아디핀산디이소부틸, 세바신산디이소프로필, 세바신산디옥틸, 스테아르산콜레스테릴, 이소스테아르산콜레스테릴, 히드록시스테아르산콜레스테릴, 올레인산콜레스테릴, 올레인산디히드로콜레스테릴, 이소스테아르산피트스테릴, 올레인산피트스테릴, 12-스테알로일히드록시스테아르산이소세틸, 12-스테알로일히드록시스테아르산스테아릴, 12-스테알로일히드록시스테아르산이소스테아릴 등의 에스테르계 등을 들 수 있다.
탄화 수소계 유지로서는 스쿠알렌, 유동 파라핀, 알파-올레핀올리고머, 이소파라핀, 세레신, 파라핀, 유동 이소파라핀, 폴리부덴, 마이크로크리스탈린왁스, 와셀린 등의 탄화 수소계 유지 등을 들 수 있다.
실리콘계 유지로서는 폴리메틸실리콘, 메틸페닐실리콘, 메틸시클로폴리실록산, 옥타메틸폴리실록산, 데카메틸폴리실록산, 도데카메틸시클로실록산, 디메틸실록산ㆍ메틸세틸옥시실록산 공중합체, 디메틸실록산ㆍ메틸스테알록시실록산 공중합체, 알킬 변성 실리콘유, 아미노 변성 실리콘유 등을 들 수 있다.
불소계 유지로서는 퍼플루오로폴리에테르 등을 들 수 있다.
동물 또는 식물 유지로서는 아보카도유, 아르몬드유, 올리브유, 참깨유, 쌀겨유, 새플라워유, 대두유, 옥수수유, 유채유, 행인(杏仁)유, 팜핵유, 팜유, 피마자유, 해바라기유, 포도종자유, 면실유, 야자유, 쿠쿠이너트유, 소맥배아유, 쌀 배아유, 시아버터, 월견초유, 마커데이미아너트유, 메도홈유, 난황유, 우지(牛脂), 마유, 밍크유, 오렌지라피유, 호호바유, 캔데리러왁스, 카르나바왁스, 액상 라놀린, 경화피마자유 등의 동물 또는 식물 유지를 들 수 있다.
보습제로서는 수용성 저분자 보습제, 지용성 분자 보습제, 수용성 고분자, 지용성 고분자 등을 들 수 있다.
수용성 저분자 보습제로서는 세린, 글루타민, 솔비톨, 만니톨, 피롤리돈-카르복실산나트륨, 글리세린, 프로필렌글리콜, 1,3-부틸렌글리콜, 에틸렌글리콜, 폴리에틸렌글리콜B(중합도 n=2 이상), 폴리프로필렌글리콜(중합도 n=2 이상), 폴리글리세린B(중합도 n=2 이상), 락트산, 락트산염 등을 들 수 있다.
지용성 저분자 보습제로서는 콜레스테롤, 콜레스테롤에스테르 등을 들 수 있다.
수용성 고분자로서는 카르복시비닐폴리머, 폴리아스파라긴산염, 트라가칸트, 크산탄검, 메틸셀룰로오스, 히드록시메틸셀룰로오스, 히드록시에틸셀룰로오스, 히드록시프로필셀룰로오스, 카르복시메틸셀룰로오스, 수용성 키틴, 키토산, 덱스트린 등을 들 수 있다.
지용성 고분자로서는 폴리비닐피롤리돈ㆍ에이코센 공중합체, 폴리비닐피롤리돈ㆍ헥사데센 공중합체, 니트로셀룰로오스, 덱스트린지방산에스테르, 고분자 실리콘 등을 들 수 있다.
에몰리엔트제로서는 장쇄아실글루타민산콜레스테릴에스테르, 히드록시스테아르산콜레스테릴, 12-히드록시스테아르산, 스테아르산, 로진산, 라놀린지방산콜레스테릴에스테르 등을 들 수 있다.
계면 활성제로서는 비이온성 계면 활성제, 음이온성 계면 활성제, 양이온성 계면 활성제, 양성 계면 활성제 등을 들 수 있다.
비이온성 계면 활성제로서는 자기 유화형 모노스테아르산글리세린, 프로필렌글리콜지방산에스테르, 글리세린지방산에스테르, 폴리글리세린지방산에스테르, 솔비탄지방산에스테르, POE(폴리옥시에틸렌)솔비탄지방산에스테르, POE 솔비트지방산에스테르, POE 글리세린지방산에스테르, POE 알킬에테르, POE 지방산에스테르, POE 경화피마자유, POE 피마자유, POEㆍPOP(폴리옥시에틸렌ㆍ폴리옥시프로필렌) 공중합체, POEㆍPOP 알킬에테르, 폴리에테르변성실리콘, 라우린산알카놀아미드, 알킬아민옥시드, 수소첨가대두인지질 등을 들 수 있다.
음이온성 계면 활성제로서는 지방산비누, 알파-아실술폰산염, 알킬술폰산염, 알킬알릴술폰산염, 알킬나프탈렌술폰산염, 알킬황산염, POE 알킬에테르황산염, 알킬아미드황산염, 알킬인산염, POE 알킬인산염, 알킬아미드인산염, 알킬로일알킬타우린염, N-아실아미노산염, POE 알킬에테르카르복실산염, 알킬술포숙신산염, 알킬술포아세트산나트륨, 아실화 가수분해 콜라겐펩티드염, 퍼플루오로알킬인산에스테르 등을 들 수 있다.
양이온성 계면 활성제로서는 염화알킬트리메틸암모늄, 염화스테아릴트리메틸암모늄, 브롬화스테아릴트리메틸암모늄, 염화세토스테아릴트리메틸암모늄, 염화디스테아릴디메틸암모늄, 염화스테아릴디메틸벤질암모늄, 브롬화베헤닐트리메틸암모늄, 염화벤잘코늄, 스테아르산디에틸아미노에틸아미드, 스테아르산디메틸아미노프로필아미드, 라놀린 유도체 제 4급 암모늄염 등을 들 수 있다.
양성 계면 활성제로서는 카르복시베타인형, 아미드베타인형, 술포베타인형, 히드록시술포베타인형, 아미드술포베타인형, 포스포베타인형, 아미노카르복실산염형, 이미다졸린 유도체형, 아미드아민형 등의 양성 계면 활성제 등을 들 수 있다.
유기 및 무기 안료로서는 규산, 무수규산, 규산마그네슘, 탤크, 세리사이트, 마이카, 카올린, 벵갈라, 클레이, 벤토나이트, 티탄피막운모, 옥시염화비스무트, 산화지르코늄, 산화마그네슘, 산화아연, 산화티탄, 산화알루미늄, 황산칼슘, 황산바륨, 황산마그네슘, 탄산칼슘, 탄산마그네슘, 산화철, 군청, 산화크롬, 수산화크롬, 칼라민 및 이들의 복합체등의 무기 안료; 폴리아미드, 폴리에스테르, 폴리프로필렌, 폴리스티렌, 폴리우레탄, 비닐수지, 요소수지, 페놀수지, 불소수지, 규소수지, 아크릴수지, 멜라민수지, 에폭시수지, 폴리카보네이트수지, 디비닐벤젠ㆍ스티렌 공중합체, 실크파우더, 셀룰로오스, CI 피그먼트옐로우, CI 피그먼트오렌지 등의 유기 안료 및 이들의 무기 안료와 유기 안료의 복합 안료 등을 들 수 있다.
유기 분체로서는 스테아르산칼슘 등의 금속비누; 세틸린산아연나트륨, 라우릴린산아연, 라우릴린산칼슘 등의 알킬인산금속염; N-라우로일-베타-알라닌칼슘, N-라우로일-베타-알라닌아연, N-라우로일글리신칼슘 등의 아실아미노산 다가금속염; N-라우로일-타우린칼슘, N-팔미토일-타우린칼슘 등의 아미드술폰산 다가금속염; N-엡실론-라우로일-L-리진, N-엡실론-팔미토일리진, N-알파-파리토일올니틴, N-알파-라우로일아르기닌, N-알파-경화우지지방산아실아르기닌 등의 N-아실염기성아미노산; N-라우로일글리실글리신 등의 N-아실폴리펩티드; 알파-아미노카프릴산, 알파-아미노라우린산 등의 알파-아미노지방산; 폴리에틸렌, 폴리프로필렌, 나일론, 폴리메틸메타크릴레이트, 폴리스티렌, 디비닐벤젠ㆍ스티렌 공중합체, 사불화에틸렌 등을 들 수 있다.
자외선 흡수제로서는 파라아미노벤조산, 파라아미노벤조산에틸, 파라아미노벤조산아밀, 파라아미노벤조산옥틸, 살리실산에틸렌글리콜, 살리신산페닐, 살리신산옥틸, 살리신산벤질, 살리신산부틸페닐, 살리신산호모멘틸, 계피산벤질, 파라메톡시계피산-2-에톡시에틸, 파라메톡시계피산옥틸, 디파라메톡시계피산모노-2-에틸헥산글리세릴, 파라메톡시계피산이소프로필, 디이소프로필ㆍ디이소프로필계피산에스테르 혼합물, 우로카닌산, 우로카닌산에틸, 히드록시메톡시벤조페논, 히드록시메톡시벤조페논술폰산 및 그 염, 디히드록시메톡시벤조페논, 디히드록시메톡시벤조페논디술폰산나트륨, 디히드록시벤조페논, 테트라히드록시벤조페논, 4-tert-부틸-4'-메톡시디벤조일메탄, 2,4,6-트리아닐리노-p-(카르보-2'-에틸헥실-1'-옥시)-1,3,5-트리아진, 2-(2-히드록시-5-메틸페닐)벤조트리아졸 등을 들 수 있다.
살균제로서는 히노키티올, 트리클로산, 트리클로로히드록시디페닐에테르, 크로르헥시딘글루콘산염, 페녹시에탄올, 레조르신, 이소프로필메틸페놀, 아줄렌, 살리칠산, 진크필리티온, 염화벤잘코늄, 감광소 301 호, 모노니트로과이어콜나트륨, 운데시렌산 등을 들 수 있다.
산화 방지제로서는 부틸히드록시아니솔, 갈릭산프로필, 엘리소르빈산 등을 들 수 있다.
pH 조정제로서는 시트르산, 시트르산나트륨, 말산, 말산나트륨, 프말산, 프말산나트륨, 숙신산, 숙신산나트륨, 수산화나트륨, 인산일수소나트륨 등을 들 수 있다.
알코올로서는 세틸알코올 등의 고급 알코올을 들 수 있다.
또한, 이외에 첨가해도 되는 배합 성분은 이에 한정되는 것은 아니며, 또, 상기 어느 성분도 본 발명의 목적 및 효과를 손상시키지 않는 범위 내에서 배합 가능하지만, 총중량에 대하여 0.01-5% 중량 백분율 또는 0.01-3% 중량 백분율로 배합될 수 있다.
본 발명의 제형이 로션, 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물섬유, 식물섬유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
본 발명의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.
본 발명의 제형이 용액 또는 유탁액의 경우에는 담체 성분으로서 용매, 용매화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.
본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.
본 발명의 제형이 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 리놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 근육세포에서 JC1-40의 미토콘드리아 막전위의 증가 효과 확인
C2C12 세포(2 x 105 세포/웰)를 12-웰 배양 플레이트에 씨딩하고, 10% FBS(fetal bovine serum)를 함유하는 DMEM(Dulbecco's modified Eagle's medium) 배지에서 배양하였다. C2C12 세포를 5% CO2 및 95% 공기를 갖는 함습 항온기에서 37℃로 유지시켰다. 배양 48 시간 후, 2% horse serum을 함유하는 DMEM(Dulbecco's modified Eagle's medium) 분화 배지로 교체하고 JC1-40(20 μM), 및 용매(대조군)를 처리하였다. 분화 배지 교체 48 시간 후, 테트라메틸로다민(Tetramethylrhodamine), 메틸에스터(Methyl Ester), 및 과염소산염(Perchlorate, TMRM) 600 nM로 C2C12 세포의 미토콘드리아를 염색하였다. 20분 후, TMRM 150 nM이 담긴 배지로 교체하였고, 10분 후 red 형광을 확인하였다. 그 결과는 도 1에 나타내었다.
도 1에 나타난 바와 같이, JC1-40을 처리한 C2C12 myotube에서 red 형광이 증가한 것을 확인하였다. 이는 JC1-40에 의해서 미토콘드리아 막전위가 증가한 것을 의미한다.
실시예 2. JC1-40의 미토콘드리아 양의 증가 효과 확인
HeLa 세포(4 x 104 세포/웰)를 12-웰 배양 플레이트에 씨딩하고, 10% FBS(fetal bovine serum)를 함유하는 DMEM(Dulbecco's modified Eagle's medium) 배지에서 하룻밤 동안 배양하였다. HeLa 세포를 5% CO2 및 95% 공기를 갖는 함습 항온기에서 37℃로 유지시켰다. 배양 24 시간 후, 배지를 교체하며 JC1-40(5 μM, 50 μM), 및 용매(대조군)를 24시간 처리하였다. 이후 MitoTracker Green 200 nM로 30분간 37℃에서 염색하였고, 4% 포름알데하이드(formaldehyde)로 고정(fixation)한 후 공초점 현미경으로 green 형광을 확인하였다. 그 결과는 도 2에 나타내었다.
도 2에 나타난 바와 같이, HeLa 세포에서 JC1-40에 농도 의존적으로 green 형광이 증가한 것을 확인하였다. 이는 JC1-40에 의해서 미토콘드리아의 양이 증가된 것을 의미한다.
실시예 3. 근육세포에서 JC1-40의 미토콘드리아 구성 유전자의 mRNA 발현 증가 효과 확인
C2C12 세포(8 x 105 세포/dish)를 60 mm dish에 씨딩하고, 10% FBS(fetal bovine serum)를 함유하는 DMEM(Dulbecco's modified Eagle's medium) 배지에서 배양하였다. C2C12 세포는 5% CO2 및 95% 공기를 갖는 함습 항온기에서 37℃로 유지하였다. 배양 48 시간 후, 2% horse serum을 함유하는 DMEM(Dulbecco's modified Eagle's medium) 분화 배지로 교체하고 JC1-40 (20 μM) 및 용매(대조군)를 처리하였다. 분화 배지 교체 48 시간 후, RNA 추출을 하였다. 추출을 위해서 EASY BLUE(Intron, Korea)로 용해하고, 이소프로판올(iso-propanol) 분획과 에탄올(ethanol) 침전을 이용하였다. 각 RNA 샘플을 가지고 cDNA를 합성하였고 특정 유전자의 cDNA를 증폭시키는 올리고머를 사용하였으며, β-actin의 발현을 대조군으로 모니터링하였다. 보다 자세하게는, M-MLV 역전사 효소(reverse transcriptase, Invitrogen)를 이용하여 mRNA-M-MLV 혼합물을 제조하고 thermal cylcer를 이용하여 역전사 중합효소 연쇄반응을 전개하였다. 그 후, ABI StepOnePlus Real-Time PCR system(Applied Biosystems)을 이용하여 실시간 중합효소 연쇄반응을 수행하였다. 그 결과는 도 3에 나타내었다. 또한, 실험에 사용한 프라이머 서열은 하기 표 1에 타내었다.
Marker Sequence 서열번호
SDHA F: GAAAGGCGGGCAGGCTCATC 1
R: CACCACGGCACTCCCCATTTT 2
COX5A F: TTGATGCCTGGGAATTGCGTAAAG 3
R: AACAACCTCCAAGATGCGAACAG 4
MCAD F: GATCGCAATGGGTGCTTTTGATAGAA 5
R: AGCTGATTGGCAATGTCTCCAGCAAA 6
도 3에 나타난 바와 같이, JC1-40을 처리하였을 때 미토콘드리아 구성 요소인 SDHA(Succinate dehydrogenase complex, subunit a), 및 COX5A(Cytochrome c oxidase subunit 5a)의 mRNA 발현과 미토콘드리아 지방산 β 산화에 연관된 효소인 MCAD(Medium-chain acyl-coenzyme A dehydrogenase)의 mRNA 발현이 증가하였다.
실시예 4. JC1-40의 미토콘드리아 생합성 조절 인자 mRNA 및 단백질 발현 증가 효과, 및 프로모터 활성 증가 효과 확인
C2C12 세포(8 x 105 세포/dish)를 60 mm dish에 씨딩하고, 10% FBS(fetal bovine serum)를 함유하는 DMEM(Dulbecco's modified Eagle's medium) 배지에서 배양하였다. C2C12 세포는 5% CO2 및 95% 공기를 갖는 함습 항온기에서 37℃로 유지하였다. 배양 48 시간 후, 2% horse serum을 함유하는 DMEM(Dulbecco's modified Eagle's medium) 분화 배지로 교체하고, JC1-40(20 μM), 및 용매(대조군)를 처리하였다. 분화 배지로 교체하고 48 시간 후, RNA 추출을 하였다. RNA 추출 방법은 실시예 3에 기재한 바와 같다. JC1-40에 의한 미토콘드리아 생합성 조절인자인 PGC-1α(Peroxisome proliferator-activated receptor gamma coactivator 1-alpha), NRF-1(Nuclear Respiratory Factor 1), NRF-2α(Nuclear Respiratory Factor 1 alpha), 및 TFAM(Mitochondrial transcription factor A)의 mRNA 발현 결과를 도 4a에 나타내었다. 또한, 실험에 사용한 프라이머 서열은 하기 표 2에 나타내었다.
Marker Sequence 서열번호
PGC-1α F: CCCTGCCATTGTTAAGACC 7
R: TGCTGCTGTTCCTGTTTTC 8
NRF-1 F: CCCCCGAGGACACTTCTTATGATG 9
R: GGCCGTTTCCGTTTCTTCCCTGTT 10
NRF-2α F: CAAGAGCAACAGATGAATGAG 11
R: ACTTTAATCGTAGTCGGTGTAG 12
TFAM F: GGAATGTGGAGCGTGCTAAAA 13
R: ACAAGACTGATAGACGAGGGG 14
상기 방법과 동일하게 JC1-40 화합물을 C2C12 세포에 처리한 후 웨스턴 블롯팅 분석법으로 미토콘드리아 생합성 조절인자인 NRF1 및 TFAM 단백질의 발현을 분석하였다. 또한, NRF1(Santa Cruz Biotechnology), TFAM(Santa Cruz Biotechnology), α-tubulin(Millipore)에 대한 특정 항체를 사용하였다. JC1-40에 의한 미토콘드리아 생합성 조절인자들의 단백질 발현 결과를 도 4b에 나타내었다.
C2C12 세포(1 x 105 세포/웰)를 12-웰 배양 플레이트에 씨딩하고, 10% FBS(fetal bovine serum)를 함유하는 DMEM(Dulbecco's modified Eagle's medium) 배지에서 하룻밤 동안 배양하였다. C2C12 세포는 5% CO2 및 95% 공기를 갖는 함습 항온기에서 37℃로 유지하였다. 배양 24 시간 후, PolyFect(QIAGEN)를 이용하여 human TFAM-Luc 리포터(100 ng)를 C2C12 세포에 형질전환시켰다. 형질전환 24시간 후, 2% horse serum을 함유하는 DMEM(Dulbecco's modified Eagle's medium) 분화 배지로 교체하고, JC1-40(20 μM), 및 용매(대조군)를 처리하였다. 24 시간 후, 세포 용해물을 수득하고 Analytical luminescence luminometer를 이용하여 루시퍼라아제 활성을 분석하고 결정하였다. β-gal 활성으로 형질전환 효율에 대한 루시퍼라아제 활성을 표준화하였고, 그 결과를 도 4c에 나타내었다.
도 4a에 나타난 바와 같이, JC1-40을 처리하였을 때 미토콘드리아 생합성 조절 인자인 PGC-1α, NRF-1, NRF-2, 및 TFAM의 mRNA 발현이 증가하였다. 또한, 도 4b에 나타난 바와 같이 JC1-40에 의해 NRF-1, 및 TFAM의 단백질 발현이 증가하였다. 또한, 도 4c에 나타난 바와 같이, JC1-40에 의한 TFAM의 mRNA 및 단백질 발현의 증가는 TFAM 프로모터의 전사 활성에 의한 것임을 확인하였다.
실시예 5. JC1-40의 미토콘드리아 생합성 조절인자 TFAM 발현의 RORα 의존적 증가 효과 확인
C2C12 세포(8 x 105 세포/dish)를 60 mm dish에 씨딩하고, 10% FBS(fetal bovine serum)를 함유하는 DMEM(Dulbecco's modified Eagle's medium) 배지에서 하룻밤 동안 배양하였다. C2C12 세포는 5% CO2 및 95% 공기를 갖는 함습 항온기에서 37℃로 유지하였다. 배양 24 시간 후, Lipofectamine 2000(Thermo Fisher Scientific)을 이용하여 si-RORα(250 pmoles) 및 si-GL3(대조군)을 C2C12 세포에 형질전환시켰다. 형질전환 24시간 후, 2% horse serum을 함유하는 DMEM(Dulbecco's modified Eagle's medium) 분화 배지로 교체하고, JC1-40(20μM)으로 48 시간 동안 처리하였다. RNA 및 단백질 추출 방법은 상기에 제시한 바와 같다. JC1-40에 의한 TFAM 발현 증가의 RORα 의존성 결과를 도 5에 나타내었다.
도 5에 나타난 바와 같이, JC1-40을 처리하였을 때 미토콘드리아 생합성 조절 인자인 TFAM의 단백질 발현이 증가하였지만, si-RORα에 의해서는 TFAM 발현 증가 현상이 일어나지 않았다. 이를 통해 JC1-40에 의한 TFAM 발현 증가는 RORα 의존적임을 확인하였다.
실시예 6. 고지질 식이 유도 동물 모델의 근육 조직에서 JC1-40의 미토콘드리아 생합성 효과 확인
JC1-40의 투여와 미토콘드리아 생합성의 증가 및 근감소증 억제와의 연관관계를 확인하기 위하여, 식이 유도 동물 모델을 이용하여 실험을 진행하였다. 구체적으로, 5주령 C57BL/6 마우스 수컷을 실온 및 습도가 조절되는 환경에 1주일 간 적응시키고, 고지질 식이(돈유(lard) 유래 지방 및 콩기름(soybean oil) 유래 지방 60 kcal% 함유, Research diets)를 12주간 제공하였다. 식이 시작 8주째부터 JC1-40을 5 mg/kg 농도로 5주간 1일 1회 경구 투여하였다(도 6a). 자세하게는, 0.5% 카복시메틸셀룰로스를 포함하는 멸균수에 최종 농도에 부합하는 양의 JC1-40을 칭량하여 첨가한 후, 막자사발을 이용하여 고르게 현탁하여 약물을 제조하였다. 개별 마우스 개체의 투여량을 취하여 존데(Sonde)를 사용하여 경구 투여하였다. 대조군에는 0.5% 카복시메틸셀룰로스를 포함하는 멸균수를 동일한 방법으로 투여하였다. 12 주간의 식이가 종료된 후, 마우스들을 마취하여 비복근(gastrocnemius) 조직을 적출하였고 4% 파라포름알데하이드 용액을 이용하여 고정하였다. 고정화한 조직은 세척, 탈석회(decalcification), 및 탈수화를 거쳐 최종적으로 파라핀을 이용한 파라핀 블록으로 제작되었다. 제작된 파라핀 블록을 3 ㎛ 두께로 절단하여 절편을 제작한 후, COX4(Cytochrome c oxidase subunit 4, Santa Cruz Biotechnology), TFAM(Mitochondrial transcription factor A, Santa Cruz Biotechnology)에 대한 특정 항체를 이용하여 단백질 발현을 형광으로 확인하였다. 그 결과는 도 6b에 나타내었다.
도 6b에 나타난 바와 같이, 고지질 식이로 유도된 근감소증이 유도되었다. 또한, JC1-40을 경구 투여한 경우, 미토콘드리아 구성 요소인 COX4와 미토콘드리아 생합성 조절 인자인 TFAM의 단백질 발현이 현저히 증가하였는바, 근감소증이 현저하게 개선된 것을 확인하였다. 이는, JC1-40의 근감소증 억제 효과가 우수하다는 것을 의미한다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명의 JC1-40을 유효성분으로 포함하는 조성물은 미토콘드리아 막전위를 증가시키고 미토콘드리아 양을 증가시키며, 미토콘드리아와 관련한 유전자 또는 단백질의 발현 또는 활성을 증가시키는 바, 미토콘드리아의 생합성을 증가시켜 근감소증의 예방, 개선, 및 치료에 사용할 수 있으므로 산업상 이용가능성이 있다.

Claims (19)

  1. JC1-40 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 근감소증 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 JC1-40은 RORα 단백질의 활성화제인 것을 특징으로 하는, 근감소증 예방 또는 치료용 약학적 조성물.
  3. 제1항에 있어서,
    상기 JC1-40은 전체 조성물 대비 1 내지 100μM의 농도로 포함되는 것을 특징으로 하는, 근감소증 예방 또는 치료용 약학적 조성물.
  4. 제1항에 있어서,
    상기 JC1-40은 하기 특징 중 하나 이상을 만족시키는 것을 특징으로 하는, 근감소증 예방 또는 치료용 약학적 조성물:
    a) 미토콘드리아 막전위를 증가시킴;
    b) 미토콘드리아 양을 증가시킴; 및
    c) 미토콘드리아 생합성을 증가시킴.
  5. 제1항에 있어서,
    상기 JC1-40은 SDHA, COX5A, MCAD, PGC-1α, NRF1, NRF2α, 및 TFAM으로 이루어진 군에서 선택된 유전자 또는 단백질의 발현 또는 활성을 증가시키는 것을 특징으로 하는, 근감소증 예방 또는 치료용 약학적 조성물.
  6. 제5항에 있어서,
    상기 TFAM 유전자 또는 단백질의 발현 또는 활성은 RORα에 의존적인 것을 특징으로 하는, 근감소증 예방 또는 치료용 약학적 조성물.
  7. 제1항에 있어서,
    상기 근감소증은 비만성 근감소증 또는 노인성 근감소증인 것을 특징으로 하는, 근감소증 예방 또는 치료용 약학적 조성물.
  8. JC1-40 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는, 근감소증 예방 또는 개선용 식품 조성물.
  9. JC1-40 또는 이의 화장품학적으로 허용 가능한 염을 유효성분으로 포함하는, 근기능 개선용 화장료 조성물.
  10. JC1-40 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 미토콘드리아 생합성 증가용 조성물.
  11. JC1-40 또는 이의 약학적으로 허용 가능한 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 근감소증 예방 또는 치료 방법.
  12. JC1-40 또는 이의 약학적으로 허용 가능한 염의 근감소증 예방 또는 치료 용도.
  13. 근감소증의 예방 또는 치료 약제를 생산하기 위한 JC1-40 또는 이의 약학적으로 허용 가능한 염의 용도.
  14. JC1-40 또는 이의 약학적으로 허용 가능한 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 미토콘드리아 생합성 증가 방법.
  15. JC1-40 또는 이의 약학적으로 허용 가능한 염의 미토콘드리아 생합성 증가 용도.
  16. 미토콘드리아 생합성 증가용 약제를 생산하기 위한 JC1-40 또는 이의 약학적으로 허용 가능한 염의 용도.
  17. JC1-40 또는 이의 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 근기능 개선 방법.
  18. JC1-40 또는 이의 염의 근기능 개선 용도.
  19. 근기능 개선에 이용되는 화장품을 생산하기 위한 JC1-40 또는 이의 화장품학적으로 허용 가능한 염의 용도.
PCT/KR2022/006925 2021-05-17 2022-05-13 RORα의 활성자 JC1-40을 포함하는 근감소증 예방, 개선, 또는 치료를 위한 약학적 조성물 WO2022245067A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210063110 2021-05-17
KR10-2021-0063110 2021-05-17
KR1020220058534A KR20220155910A (ko) 2021-05-17 2022-05-12 RORα의 활성자 JC1-40을 포함하는 근감소증 예방, 개선, 또는 치료를 위한 약학적 조성물
KR10-2022-0058534 2022-05-12

Publications (1)

Publication Number Publication Date
WO2022245067A1 true WO2022245067A1 (ko) 2022-11-24

Family

ID=84141808

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/006925 WO2022245067A1 (ko) 2021-05-17 2022-05-13 RORα의 활성자 JC1-40을 포함하는 근감소증 예방, 개선, 또는 치료를 위한 약학적 조성물

Country Status (1)

Country Link
WO (1) WO2022245067A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180265462A1 (en) * 2011-05-23 2018-09-20 Seoul National University R & Db Foundation NOVEL THIOUREA DERIVATIVES AS ACTIVATORS OF RORalpha AND PHARMACEUTICAL COMPOSITION CONTAINING SAME
KR20210005880A (ko) * 2018-05-03 2021-01-15 지앙수 헨그루이 메디슨 컴퍼니 리미티드 레티노이드-관련 희귀 수용체 감마(ＲＯＲγ)의 조절제로서 벤즈이미다졸 유도체 및 이의 약학적 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180265462A1 (en) * 2011-05-23 2018-09-20 Seoul National University R & Db Foundation NOVEL THIOUREA DERIVATIVES AS ACTIVATORS OF RORalpha AND PHARMACEUTICAL COMPOSITION CONTAINING SAME
KR20210005880A (ko) * 2018-05-03 2021-01-15 지앙수 헨그루이 메디슨 컴퍼니 리미티드 레티노이드-관련 희귀 수용체 감마(ＲＯＲγ)의 조절제로서 벤즈이미다졸 유도체 및 이의 약학적 용도

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ANTON M. JETTEN, HONG SOON KANG, YUKIMASA TAKEDA: "Retinoic acid-related orphan receptors α and γ: key regulators of lipid/glucose metabolism, inflammation, and insulin sensitivity", FRONTIERS IN ENDOCRINOLOGY, vol. 4, pages 1 - 8, XP055159436, DOI: 10.3389/fendo.2013.00001 *
AZUMA KOTARO, IKEDA KAZUHIRO, INOUE SATOSHI: "Functional Mechanisms of Mitochondrial Respiratory Chain Supercomplex Assembly Factors and Their Involvement in Muscle Quality", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 21, no. 3182, pages 1 - 17, XP093007574, DOI: 10.3390/ijms21093182 *
KIM HYEON-JI, HAN YONG-HYUN, NA HYELIN, KIM JU-YEON, KIM TAEWOOK, KIM HYE-JIN, SHIN CHANSEOK, LEE JUNG WEON, LEE MI-OCK: "Liver-specific deletion of RORα aggravates diet-induced nonalcoholic steatohepatitis by inducing mitochondrial dysfunction", SCIENTIFIC REPORTS, vol. 7, no. 16041, 1 December 2017 (2017-12-01), pages 1 - 11, XP093007559, DOI: 10.1038/s41598-017-16077-y *

Similar Documents

Publication Publication Date Title
WO2018194309A1 (ko) 인디루빈 유도체를 유효성분으로 포함하는 약학 조성물
WO2021149880A1 (ko) 오이, 가지 및 달팽이의 혼합 추출물을 유효성분으로 포함하는 탈모 방지 또는 발모 촉진용 조성물
WO2020040432A1 (ko) 인삼열매 추출물을 유효성분으로 함유하는 근육 질환의 예방 또는 치료용 약학적 조성물
WO2022255744A1 (ko) 락토바실러스 플란타룸 유래 소포 및 이의 용도
WO2022245067A1 (ko) RORα의 활성자 JC1-40을 포함하는 근감소증 예방, 개선, 또는 치료를 위한 약학적 조성물
WO2021230677A1 (ko) 신규 폴리페놀 화합물 및 이를 유효성분으로 함유하는 항진균용 조성물
WO2017142368A2 (ko) 알레르기성 또는 염증성 피부질환의 예방 또는 치료용 조성물
WO2021080298A1 (ko) 엔테로코커스 패칼리스를 유효성분으로 함유하는 비만 또는 비만으로부터 유도된 대사증후군의 예방 또는 치료용 조성물
WO2020166868A1 (ko) 로치아 속 세균 유래 나노소포 및 이의 용도
WO2023101440A1 (ko) 금나노-땅콩새싹 추출물을 유효성분으로 포함하는 항염증용 조성물
WO2020256381A1 (ko) 옥타데센 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물
WO2019031655A1 (ko) 티몰을 유효성분으로 함유하는 피부 주름 또는 아토피성 피부염의 예방 또는 치료용 조성물
KR20220155910A (ko) RORα의 활성자 JC1-40을 포함하는 근감소증 예방, 개선, 또는 치료를 위한 약학적 조성물
WO2022231294A1 (ko) 피부 색소침착의 예방, 개선, 또는 치료용 조성물
WO2010077093A2 (ko) 에리스로포이에틴을 함유하는 발모 촉진 또는 탈모 방지용 조성물
WO2019245245A1 (ko) 강황 추출물을 포함하는 간손상 예방 및 치료용 약학 조성물
WO2022255746A1 (ko) 락토바실러스 아시도필러스 유래 소포 및 이의 용도
KR20210142362A (ko) 후베리아 페루비아나 추출물을 유효성분으로 포함하는 염증성 질환의 예방 또는 치료용 약학적 조성물
WO2014185610A1 (ko) 밀기울 추출물을 유효성분으로 포함하는 탈모 방지 또는 육모 촉진 조성물
WO2018155933A1 (ko) 아쿠아포린-3의 발현을 증가시키는 6,7-디메톡시-2,2-디메틸-2h-크로멘 및 이의 용도
WO2023096345A1 (ko) 톱니모자반 추출물을 포함하는 근육 질환 예방 또는 치료용 조성물
WO2022265281A1 (ko) 증숙생강 추출물 또는 이로부터 분리된 1-데하이드로-6-진저다이온을 유효성분으로 포함하는 퇴행성 관절염 예방, 개선, 또는 치료용 조성물
WO2023027540A1 (ko) 진세노사이드 rc를 포함하는 근육 질환의 예방, 개선 또는 치료용 조성물
WO2022255784A1 (ko) 락토바실러스 람노수스 유래 소포 및 이의 용도
WO2023128255A1 (ko) 폴리갈라테노사이드를 유효성분으로 포함하는 암 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22804922

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22804922

Country of ref document: EP

Kind code of ref document: A1