WO2022240143A1 - 발암성 돌연변이 유전자 검출용 가이드 rna 내지 이의 용도 - Google Patents

발암성 돌연변이 유전자 검출용 가이드 rna 내지 이의 용도 Download PDF

Info

Publication number
WO2022240143A1
WO2022240143A1 PCT/KR2022/006665 KR2022006665W WO2022240143A1 WO 2022240143 A1 WO2022240143 A1 WO 2022240143A1 KR 2022006665 W KR2022006665 W KR 2022006665W WO 2022240143 A1 WO2022240143 A1 WO 2022240143A1
Authority
WO
WIPO (PCT)
Prior art keywords
guide rna
seq
wild
mutation
cancer
Prior art date
Application number
PCT/KR2022/006665
Other languages
English (en)
French (fr)
Inventor
김형범
김상우
김혜련
손현주
라무고파라빠
Original Assignee
주식회사 애이마
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 애이마 filed Critical 주식회사 애이마
Priority to JP2023571114A priority Critical patent/JP2024517984A/ja
Priority to CA3218653A priority patent/CA3218653A1/en
Priority to EP22807791.3A priority patent/EP4339285A1/en
Priority to AU2022273481A priority patent/AU2022273481A1/en
Priority to CN202280034885.XA priority patent/CN117597445A/zh
Publication of WO2022240143A1 publication Critical patent/WO2022240143A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to a guide RNA used for detecting an oncogenic mutant gene by cleaving a wild-type cancer cell gene using a CRISPR/Cas9 system or a use thereof.
  • COSMIC Catalogue of Somatic Mutations in Cancer
  • liquid biopsy has recently emerged as a useful alternative to conventional tissue biopsy, providing a non-invasive approach to detect and monitor tumor-derived elements circulating in the bloodstream, directly or indirectly as a source of cancer biomarkers.
  • Blood contains two types of cancer-derived components that are susceptible to detailed molecular analysis.
  • One is intact circulating tumor cells (CTCs) and cell-free circulating tumor DNA (cfDNA or circulating tumor DNA; ctDNA).
  • CTCs circulating tumor cells
  • cfDNA or circulating tumor DNA circulating tumor DNA
  • This liquid biopsy helps analyze the DNA that the tumor normally releases into the bloodstream.
  • the amount of cfDNA released into the bloodstream varies from 0.01% to 90% of all DNA present in plasma.
  • liquid biopsy provides a large-scale, non-invasive approach to tumor molecular profiling without obtaining tumor tissue.
  • CRISPR Clustered regular interspaced short palindromic repeats
  • Cas CRISPR-associated protein systems
  • CRISPR endonucleases e.g., type II Cas9 or type V Cpf1 recognize a protospacer-adjacent motif (PAM) downstream or upstream, respectively, of the target DNA sequence corresponding to the guide RNA (gRNA), resulting in duplication in the target DNA. induces strand breakage.
  • PAM protospacer-adjacent motif
  • gRNA guide RNA
  • gRNA guide RNA
  • Tumor-specific versus wild-type alleles can be enriched by specifically cleaving the wild-type DNA.
  • RNA To cleave the wild-type target DNA using Cas9-sgRNA, a single guide RNA must be designed to target the sequence of the PAM site. However, since the DNA PAM site targeted in cfDNA is destroyed by oncogenic mutation, it is difficult to detect because it is not recognized by CRISPR endonuclease.
  • CRISPR/Cas9 CRISPR endonuclease and Cas9
  • the present invention was completed by preparing a guide RNA capable of specifically cleaving only wild-type DNA, not DNA.
  • an object of the present invention is to provide a guide RNA of the CRISPR/Cas9 system or a composition or kit for diagnosing cancer or predicting prognosis containing the guide RNA.
  • Another object of the present invention is to provide a method for providing information for cancer diagnosis or prognosis prediction, which includes the step of processing a patient's sample with guide RNA of the CRISPR/Cas9 system.
  • the present invention is a guide RNA used in the CRISPR / Cas9 system,
  • the guide RNA is characterized by cleaving wild-type cell-free DNA.
  • the guide RNA may include one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 1 to 17.
  • the guide RNA is a conversion mutation in any one or more regions selected from the group consisting of a trunk region, a semi-seed region, and a seed region of the guide RNA (transversion mutation) may have occurred.
  • the guide RNA may include one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 9, and SEQ ID NO: 13.
  • the guide RNA may detect one or more cancer-related mutations selected from the group consisting of EGFR, MET, KRAS, PIK3CA, and BRAF.
  • the guide RNA when detecting the EGFR mutation, should include any one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 1 to 4, 8, 9, and 11 to 13 can
  • the guide RNA when detecting the MET mutation, may include one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 5 to 7.
  • the guide RNA when detecting the KRAS mutation, may include the nucleotide sequence of SEQ ID NO: 10.
  • the guide RNA when detecting the PIK3CA mutation, may include one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 14 to 16.
  • the guide RNA when detecting the BRAF mutation, may include the nucleotide sequence of SEQ ID NO: 17.
  • the present invention provides a composition for diagnosing cancer or predicting prognosis, comprising a CRISPR/Cas9 guide RNA comprising any one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 1 to 17.
  • the guide RNA is a conversion mutation in any one or more regions selected from the group consisting of a trunk region, a semi-seed region, and a seed region of the guide RNA (transversion mutation) may have occurred.
  • the guide RNA may detect one or more cancer-related mutations selected from the group consisting of EGFR, MET, KRAS, PIK3CA, and BRAF.
  • the guide RNA may cleave wild-type cell-free DNA.
  • the cancer is any one or more selected from the group consisting of lung cancer, pancreatic cancer, colon cancer, stomach cancer, breast cancer, kidney cancer, liver cancer, blood cancer, bladder cancer, and uterine cancer. It could be cancer.
  • the present invention also provides a kit for diagnosing cancer or predicting prognosis comprising the composition.
  • the present invention also provides a method for providing information for diagnosing cancer or predicting prognosis, comprising the step of treating a sample of a patient with the composition.
  • the detection of oncogenic mutant genes using cell-free DNA with the existing CRISPR/Cas9 system targets mutations in three PAM sequence (NGG) nucleotides and has a low probability of detecting them with guide RNA.
  • NGS PAM sequence
  • the guide RNA of the present invention targets and cleave wild-type cell-free DNA, not the oncogenic mutant gene, through the CRISPR/Cas 9 system, and in particular, conversion mutations in the trunk region of the guide RNA It is possible to selectively target and amplify only oncogenic mutant genes by using a guide RNA that causes transversion mutation.
  • the present invention is a guide RNA used in the CRISPR/Cas9 system, and the guide RNA may cleave wild-type cell-free DNA.
  • the 'CRISPR/Cas 9 system' means that an enzyme capable of recognizing a specific nucleotide sequence called Cas9 and cutting a gene recognizes a single-stranded guide RNA (sgRNA) containing the nucleotide sequence and cuts a specific DNA.
  • sgRNA single-stranded guide RNA
  • the CRISPR/Cas9 system consists of sgRNA designed to accurately recognize target DNA and Cas9 that can cut target DNA based on it. Cas9 that recognizes the sgRNA cuts the DNA double helix.
  • the guide RNA may include one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 1 to 17.
  • Guide RNA containing the nucleotide sequence of SEQ ID NO: 1 is a wild-type guide RNA (wild sgRNA) capable of detecting EGFR (p.T790M) mutation, and SEQ ID NO: 18 can be used as a target sequence when used for in vitro cleavage analysis have.
  • wild sgRNA wild-type guide RNA
  • p.T790M EGFR
  • Guide RNA containing the nucleotide sequence of SEQ ID NO: 2 is a transversion guide RNA (transversion sgRNA) capable of detecting EGFR (p.T790M) mutation, and when used for in vitro cleavage analysis, SEQ ID NO: 19 can be used as a target sequence.
  • transversion sgRNA transversion guide RNA
  • SEQ ID NO: 19 can be used as a target sequence.
  • the mutant sequence can be amplified by 1% to 32%.
  • Guide RNA containing the nucleotide sequence of SEQ ID NO: 3 is a wild-type guide RNA (wild sgRNA) capable of detecting EGFR (p.C797S) mutation, and SEQ ID NO: 20 can be used as a target sequence when used for in vitro cleavage analysis have.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 20 can be used as a target sequence when used for in vitro cleavage analysis have.
  • the guide RNA containing the nucleotide sequence of SEQ ID NO: 4 is a transversion guide RNA (transversion sgRNA) capable of detecting EGFR (p.C797S) mutation, and SEQ ID NO: 21 is the target sequence when used for in vitro cleavage analysis.
  • transversion sgRNA transversion guide RNA
  • SEQ ID NO: 21 is the target sequence when used for in vitro cleavage analysis.
  • Guide RNA containing the nucleotide sequence of SEQ ID NO: 5 is a wild-type guide RNA (wild sgRNA) capable of detecting MET c.2888 Int13-Exon14 Acceptor (Exon-14 Skipping) mutation, and when used for in vitro cleavage analysis, the sequence Number 22 or 23 can be used as a target sequence.
  • wild sgRNA wild-type guide RNA
  • Guide RNA containing the nucleotide sequence of SEQ ID NO: 6 is a wild-type guide RNA (wild sgRNA) capable of detecting MET c.3028 Exon14-Int14 Donor (Exon-14 Skipping) mutation, and when used for in vitro cleavage analysis, the sequence Number 24 or 25 can be used as a target sequence.
  • wild sgRNA wild-type guide RNA
  • Guide RNA containing the nucleotide sequence of SEQ ID NO: 7 is a wild-type guide RNA (wild sgRNA) capable of detecting MET 'TAC' Y1003X (Exon-14 Skipping) mutation, and when used for in vitro cleavage analysis, SEQ ID NO: 26 or 27 can be used as a target sequence.
  • wild sgRNA wild-type guide RNA
  • MET 'TAC' Y1003X Exon-14 Skipping
  • the guide RNA containing the nucleotide sequence of SEQ ID NO: 8 is a wild-type guide RNA (wild sgRNA) capable of detecting EGFR (L718Q) mutation, and SEQ ID NO: 28 can be used as a target sequence when used for in vitro cleavage analysis.
  • wild sgRNA wild-type guide RNA capable of detecting EGFR (L718Q) mutation
  • Guide RNA containing the nucleotide sequence of SEQ ID NO: 9 is a transversion guide RNA (transversion sgRNA) capable of detecting EGFR (L718Q) mutation, and SEQ ID NO: 29 can be used as a target sequence when used for in vitro cleavage analysis. .
  • transversion sgRNA transversion guide RNA
  • SEQ ID NO: 29 can be used as a target sequence when used for in vitro cleavage analysis.
  • the mutant sequence can be amplified from 0.8% to 23.7%.
  • the guide RNA containing the nucleotide sequence of SEQ ID NO: 10 is a wild-type guide RNA (wild sgRNA) capable of detecting KRAS (c.35G) mutation, and SEQ ID NO: 30 or 31 is used as the target sequence when used for in vitro cleavage analysis. can do.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 30 or 31 is used as the target sequence when used for in vitro cleavage analysis. can do.
  • the mutant sequence can be amplified by 1.5% to 50%.
  • Guide RNA containing the nucleotide sequence of SEQ ID NO: 11 is a wild-type guide RNA (wild sgRNA) capable of detecting EGFR, 15 bp Del p. (729_761) mutation, and SEQ ID NO: 32 or 33 when used for in vitro cleavage analysis
  • a target sequence can be used.
  • the mutant sequence can be amplified from 0.5% to 23%.
  • Guide RNA containing the nucleotide sequence of SEQ ID NO: 12 is a wild-type guide RNA (wild sgRNA) capable of detecting EGFR (p.L858R) mutation, and SEQ ID NO: 34 can be used as a target sequence when used for in vitro cleavage analysis have.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 34 can be used as a target sequence when used for in vitro cleavage analysis have.
  • the guide RNA containing the nucleotide sequence of SEQ ID NO: 13 is a transversion guide RNA (transversion sgRNA) capable of detecting EGFR (p.L858R) mutation, and SEQ ID NO: 35 is the target sequence when used for in vitro cleavage analysis.
  • transversion sgRNA transversion guide RNA
  • SEQ ID NO: 35 is the target sequence when used for in vitro cleavage analysis.
  • the guide RNA comprising the nucleotide sequence of SEQ ID NO: 14 is a wild-type guide RNA (wild sgRNA) capable of detecting PIK3CA (p.E542K or c.1624G>A) mutation, and SEQ ID NO: 36 when used for in vitro cleavage analysis. Or 37 can be used as a target sequence.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 36 when used for in vitro cleavage analysis.
  • Or 37 can be used as a target sequence.
  • Guide RNA containing the nucleotide sequence of SEQ ID NO: 15 is a wild-type guide RNA (wild sgRNA) capable of detecting PIK3CA (p.E545? or c.1633G>?) mutation, and when used for in vitro cleavage analysis, SEQ ID NO: 38 or 39 can be used as a target sequence.
  • wild sgRNA wild-type guide RNA
  • Guide RNA containing the nucleotide sequence of SEQ ID NO: 16 is a wild-type guide RNA (wild sgRNA) capable of detecting PIK3CA (p.H1047? or c.3140A>?) mutation, and when used for in vitro cleavage analysis, SEQ ID NO: 40 or 41 can be used as a target sequence.
  • wild sgRNA wild-type guide RNA
  • the guide RNA comprising the nucleotide sequence of SEQ ID NO: 17 is a wild-type guide RNA (wild sgRNA) capable of detecting PIK3CA (p.V600E or c.1799T>A) mutation, and SEQ ID NO: 42 when used for in vitro cleavage analysis. Or 43 can be used as a target sequence.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 42 when used for in vitro cleavage analysis.
  • 43 can be used as a target sequence.
  • the guide RNA is characterized in that a transversion mutation has occurred in one or more regions selected from the group consisting of a trunk region, a semi-seed region, and a seed region of the guide RNA guide RNA.
  • Targeting DNA cleavage with SpCas9 mainly requires a specific 20 nucleotides of the target protospacer sequence along with 3 PAM sequence (NGG) nucleotides adjacent to the 3′ end of the target sequence. Mutations within the PAM sequence (caused by either mismatched PAM-NGN or any oncogenic mutation) cause Cas9 to cut from cell-free DNA to the wild-type target allele (PAM-NGG) to enrich for the mutant allele in wild-type DNA. Easy is the best candidate. However, it is not possible to have such discordant PAM target sequences for all cancer-associated mutations.
  • the present inventors have prepared a transversion mutation (purine to pyrimidine) in the trunk region of guide RNA to solve the above problems and target all kinds of mutations.
  • a transversion mutation purine to pyrimidine
  • single base mismatches in guide RNA are classified into semi-seed, seed, trunk, and promiscuous regions.
  • the guide RNA resistance to a single base mismatch within the seed region from position 4 to 7 is the lowest resistance of the corresponding sgRNA.
  • both sides of the seed region at positions 1-3 and 8-11 are medium tolerance for mismatches and are defined as semi-seed regions.
  • a single base mismatch at positions 12–19 reduced the cleavage frequency to an intermediate level but retained sgRNA activity and this intermediate region is termed the trunk region.
  • a single base mismatch slightly reduces the frequency of cleavage induced by the Cas9 nuclease and this position is termed a multiple region.
  • the Cas9 nuclease can be treated with transversion mutation guide RNA to enrich for the low-frequency mutant allele, followed by PCR amplification to remove the wild-type target allele. Mutant target alleles are not recognized or cleaved by the Cas9 nuclease. This is because of the low resistance to two mutations, one is a conversion mutation in the sgRNA and the second is a target mutation of the oncogenic mutation (Fig. 3a, Fig. 3b).
  • the Cas9 nuclease may include various variants and may be Cas9, eCas9 or HFCas9.
  • the guide RNA in which the transversion mutation occurred comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 9, and SEQ ID NO: 13 it may be
  • the guide RNA may detect one or more cancer-related mutations selected from the group consisting of EGFR, MET, KRAS, PIK3CA, and BRAF.
  • the guide RNA when detecting the EGFR mutation, should include any one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 1 to 4, 8, 9, and 11 to 13 can
  • the guide RNA when detecting the MET mutation, may include one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 5 to 7.
  • the guide RNA when detecting the KRAS mutation, may include the nucleotide sequence of SEQ ID NO: 10.
  • the guide RNA when detecting the PIK3CA mutation, may include one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 14 to 16.
  • the guide RNA when detecting the BRAF mutation, may include the nucleotide sequence of SEQ ID NO: 17.
  • the present invention can provide a CRISPR/Cas9 guide RNA comprising any one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 1 to 17.
  • the guide RNA may cleave wild-type cell-free DNA.
  • the guide RNA is a conversion mutation in any one or more regions selected from the group consisting of a trunk region, a semi-seed region, and a seed region of the guide RNA (transversion mutation) may have occurred.
  • the present invention may also provide a composition for diagnosing or predicting prognosis of cancer containing the guide RNA.
  • the cancer may be any one or more cancers selected from the group consisting of lung cancer, pancreatic cancer, colon cancer, stomach cancer, breast cancer, kidney cancer, liver cancer, blood cancer, bladder cancer and uterine cancer, but EGFR , cancers caused by MET, KRAS, PIK3CA or BRAF mutations may be applicable without limitation.
  • the present invention may also provide a kit for diagnosing cancer or predicting prognosis containing the composition.
  • kits may consist of one or more other component compositions, solutions or devices suitable for commonly used expression level analysis methods.
  • a kit for measuring protein expression levels may include a substrate, an appropriate buffer, a secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, a chromogenic substrate, and the like for immunological detection of the antibody.
  • the kit of the present invention may include a sample extraction means for obtaining a sample from an evaluation subject.
  • the sample extraction means may include a needle or a syringe.
  • a kit may include a sample collection container for receiving an extracted sample, which may be liquid, gaseous or semi-solid. Kits may further include instructions for use.
  • the sample may be any body sample in which an oncogenic mutant gene may be present or secreted.
  • the sample may be urine, feces, hair, sweat, saliva, bodily fluid, blood, cells or tissue. Measurement of oncogenic mutant genes in body samples can be performed on whole samples or processed samples.
  • the present invention may also provide a method for providing information for diagnosing cancer or predicting prognosis, comprising the step of processing a patient's sample with the guide RNA of claim 1.
  • the sample may be urine, feces, hair, sweat, saliva, body fluid, blood, cells or tissues.
  • Figure 1 shows disease progression and options for drug therapy or systemic chemotherapy for patients with non-squamous (adenocarcinoma; EGFR-TK, ALK or ROS-1 positive) carcinoma and non-small cell carcinoma NICE for lung cancer Indicates a summary with guidelines.
  • non-squamous (adenocarcinoma; EGFR-TK, ALK or ROS-1 positive) carcinoma and non-small cell carcinoma NICE for lung cancer Indicates a summary with guidelines.
  • Figure 2 shows a schematic for amplifying mutant alleles in cell-free DNA (cfDNA) using Cas9-sgRNA.
  • 3A and 3B show a guide RNA design strategy to amplify all possible mutant alleles with Cas9 treatment in cell-free DNA (cfDNA).
  • 4a and 4b show an in vitro cleavage assay for detecting a KRAS mutant (c.35G>C) sequence using the guide RNA of the present invention and the results thereof.
  • FIG. 5 shows an in vitro cleavage assay for detecting an EGFR mutation (c.2369C>T or p.T790M) sequence using the guide RNA of the present invention and the results thereof.
  • 6a and 6b show an in vitro cleavage assay for detecting an EGFR mutation (c.2573 T>G or p.L858R) sequence using the guide RNA of the present invention and the result thereof.
  • Figure 7 is an in vitro cleavage assay for detecting the EGFR mutation (c.2573 T>G or p.L858R) sequence in a patient (LA-29) sample using the guide RNA of the present invention and the result indicates
  • Figure 8 is an in vitro detection of EGFR mutation (p.C7975, L718Q or p.(729_761) loss) or MET mutation (c.2888, c.3028 or 'TAC'Y1003X) sequence using the guide RNA of the present invention.
  • the cleavage assay in vitro cleavage assay and its results are shown.
  • FIG. 10 shows the PCR results of detecting the EGFR mutation (T790M) sequence using the guide RNA of the present invention.
  • Figure 11 quantitatively shows the PCR results of detecting the EGFR mutation (T790M) sequence using the guide RNA of the present invention.
  • 17 shows PCR results for mutant genes using the guide RNA of the present invention based on a cfDNA reference standard set.
  • FIG. 19 shows the results of detecting the L858R mutation among the EGFR mutations in patient (LA-29, LA-209 or LA-292) samples using the guide RNA and Cas9 of the present invention.
  • Figure 21 shows the results of multiple detection of the T790M or E19del mutation among EGFR mutations in a patient (LA-232) sample using the guide RNA and Cas9 of the present invention.
  • Figure 22 shows the results of single detection of the T790M or E19del mutation among EGFR mutations in a patient (LA-322) sample using the guide RNA and Cas9 of the present invention.
  • Figure 23 shows the results of multiplex detection of the T790M or E19del mutation among EGFR mutations in a patient (LA-322) sample using the guide RNA and Cas9 of the present invention.
  • Wild-type and mutant target sequences of selected genes and guide RNA sequences were prepared for testing in vitro transcription cleavage (IVT) analysis.
  • GAAATGGTTTCAAATGAATCTGTAGAC tac CGAGCTACTTT (SEQ ID NO: 27) AAATGAATCTGTAGAC tac C GAG EGFR (L718Q or c.2153 T> A) WT-T GAATTCAAAAAGATCAAAGTGC t GGGCTCCGGTGCGTTCGG (SEQ ID NO: 28) AAGATCAAAGTGC t GGGCTC CGG (SEQ ID NO: 8) Wild sgRNAs Mut-A GAATTCAAAAAGATCAAAGTGC a GGGCTCCGGTGCGTTCGG (SEQ ID NO: 29) AAGATCA c AGTGC t GGGCTC CGG (SEQ ID NO: 9) Transversion sgRNAs KRAS (c.35G) WT-G TGACTGAATATAAACTTGTGGTAGTTGGAGCTG g TGGCGTAGGCA (SEQ ID NO: 30) AAACTTGTGGTAGTTGGAGC TGG (SEQ ID NO:
  • [Table 1] shows guide RNAs for drug resistance mutations.
  • Both wild-type and mutant target sequences of selected genes for testing in vitro transcription cleavage (IVT) analysis were subcloned into a T-blunt cloning vector for IVT testing, the positions of mutations in the wild-type target sequences are highlighted in bold and the corresponding nucleotides Mutations are shown in red (lower case).
  • Mutational '?' Marking means any nucleotide that is not a wild-type nucleotide.
  • Small guide RNAs for each target were designed and the PAM sequences are shown in blue (italic). Transversion mutations are shown in green. After confirming the IVT analysis, the samples were PCR amplified and analyzed through NGS.
  • sgRNAs were designed to target 20 nucleotides together with the PAM site, but were disrupted by oncogenic mutations (c.35G>C) in the case of KRAS mutations (PAM).
  • PAM KRAS mutations
  • IVTT in vitro cleavage assay
  • target sequences were subcloned into T-blunt cloning vectors (wild-type and mutant KRAS sequences) and the plasmids were linearized with the vector's restriction enzymes.
  • the linearized product was further cleaved by treatment with Cas9 nuclease and wild type sequence specific sgRNA.
  • the sgRNA was designed to target a sequence of 20 nucleotides with the PAM site, but for EGFR mutations (c.2369C>T or p.T790M), the target mutation site is the trunk of the sgRNA binding site. (trunk) is found within the area.
  • This activity of wild-type targeting sgRNA can also cleave mutant target alleles in cell-free DNA.
  • TmWT sgRNA transversion mutation in the trunk region of the sgRNA.
  • This TmWT-sgRNA is neither recognized nor cleaved by the Cas9 nuclease at the mutant allele because of its low resistance to both mutations.
  • target sequences were subcloned into a T-blunt cloning vector (wild-type and mutant EGFR sequences) and the plasmid was linearized with the vector's restriction enzymes.
  • Linearized products were further cleaved by treatment with different combinations of Cas9 nuclease variants with wild type sequence specific sgRNA (WT sgRNA) and inversion mutant sgRNA (TmWT sgRNA). After electrophoresis of wild-type or mutant DNA on a 0.8% gel, linearized fragments (uncleaved) and cleaved fragments (cleaved) were separated by size and indicated by red arrows. The DNA targeted in the wild type was completely cleaved by the Cas9 variant with WT-sgRNA and even with the mutant target sequence by Cas9 and WT-sgRNA.
  • WT sgRNA wild type sequence specific sgRNA
  • TmWT sgRNA inversion mutant sgRNA
  • the sgRNA (TmWT-sgRNA) in the transmutation mutant showed different cleavage patterns for Cas9 variants. This indicates that the TmWT-sgRNA is low resistant to both mutations and cannot completely cleave the mutation target allele.
  • the wild-type target allele was excised and removed to generate the mutant allele (EGFR mutation (c.2369C>T or p.T790M; c.2573 T>G or p.L858R; p.C797S, L718Q or p.(729_761) deletion), MET mutation (c.2888, c.3028 or 'TAC'Y1003X), BRAF mutation (p.V600E or c.1799T>A) or PIK3CA mutation (c.1624G>A or p. E542K; p.H1047? or c.3140A>?)) could be enriched (Figs. 5 to 11).
  • transversion mutant sgRNA was not designed because the mutation site was in the seed region.
  • the fold increase of the target sequence was compared to the fold increase of the untreated control product.
  • the amount of EGFR target region relative to the untreated control product in each lane was calculated by NGS analysis.
  • the plasmid mixture in the presence of the mutant plasmid was subjected to CUT-PCR after (orange or pink bars) or without (purple or blue bars) targeted deep sequencing was performed. It was originally mixed with the wild-type plasmid at a ratio of 0.5 to 5%.
  • the resulting PCR amplicons were subjected to paired-end sequencing with MiSeq.
  • NGS results were analyzed for wild-type and mutant sequence fold change for all mixing ratios of mutant DNA fragments in both Cas9 and eCas9 variants compared with TmWT-sgRNA.
  • the multiplex cfDNA standard sample contained 4 genes with 8 different mutations and included 3 proportions of each gene (FIG. 16).
  • the mixed sgRNA was treated with KRAS, EGFR-T790M or EGFR 729-761bp deletion samples, and then the results of in vitro cleavage assay were performed are shown in [Table 2].
  • Mutation targets in cell-free DNA were detected using the guide RNA of the present invention in the blood of lung cancer patients with mutations (FIG. 18).
  • Table 3 below shows patient samples with the L858R mutation
  • Table 4 shows patient samples with the T790M and E19del mutations.
  • SEQ ID NO: 1 is a wild-type guide RNA (wild sgRNA) capable of detecting EGFR (p.T790M or c.2369C>T) mutation, and SEQ ID NO: 18 can be used as a target sequence when used for in vitro cleavage analysis.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 18 can be used as a target sequence when used for in vitro cleavage analysis.
  • SEQ ID NO: 2 is a transversion guide RNA (transversion sgRNA) capable of detecting EGFR (p.T790M or c.2390 G>C) mutation, and SEQ ID NO: 19 can be used as a target sequence when used for in vitro cleavage analysis have.
  • transversion guide RNA comprising the nucleotide sequence of SEQ ID NO: 2
  • the mutant sequence can be amplified by 1% to 32%.
  • SEQ ID NO: 3 is a wild-type guide RNA (wild sgRNA) capable of detecting EGFR (p.C797S) mutation, and SEQ ID NO: 20 can be used as a target sequence when used for in vitro cleavage analysis.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 20 can be used as a target sequence when used for in vitro cleavage analysis.
  • SEQ ID NO: 4 is a transversion guide RNA (transversion sgRNA) capable of detecting EGFR (p.C797S) mutation, and SEQ ID NO: 21 can be used as a target sequence when used for in vitro cleavage analysis.
  • transversion guide RNA transversion sgRNA
  • SEQ ID NO: 21 can be used as a target sequence when used for in vitro cleavage analysis.
  • the mutant sequence can be amplified by 1% to 13%.
  • SEQ ID NO: 5 is a wild-type guide RNA (wild sgRNA) capable of detecting MET c.2888 Int13-Exon14 Acceptor (Exon-14 Skipping) mutation, and SEQ ID NO: 22 or 23 is used as a target sequence when used for in vitro cleavage analysis. can do.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 22 or 23 is used as a target sequence when used for in vitro cleavage analysis. can do.
  • SEQ ID NO: 6 is a wild-type guide RNA (wild sgRNA) capable of detecting MET c.3028 Exon14-Int14 Donor (Exon-14 Skipping) mutation, and SEQ ID NO: 24 or 25 is used as a target sequence when used for in vitro cleavage analysis. can do.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 24 or 25 is used as a target sequence when used for in vitro cleavage analysis. can do.
  • SEQ ID NO: 7 is a wild-type guide RNA (wild sgRNA) capable of detecting MET 'TAC' Y1003X (Exon-14 Skipping) mutation, and SEQ ID NO: 26 or 27 can be used as a target sequence when used for in vitro cleavage analysis .
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 26 or 27 can be used as a target sequence when used for in vitro cleavage analysis .
  • SEQ ID NO: 8 is a wild-type guide RNA (wild sgRNA) capable of detecting EGFR (L718Q or c.2153 T> A) mutation, and SEQ ID NO: 28 can be used as a target sequence when used for in vitro cleavage analysis.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 28 can be used as a target sequence when used for in vitro cleavage analysis.
  • SEQ ID NO: 9 is a transversion guide RNA (transversion sgRNA) capable of detecting EGFR (L718Q) mutation, and SEQ ID NO: 29 can be used as a target sequence when used for in vitro cleavage analysis.
  • transversion guide RNA transversion sgRNA
  • SEQ ID NO: 29 can be used as a target sequence when used for in vitro cleavage analysis.
  • the mutant sequence can be amplified from 0.8% to 23.7%.
  • SEQ ID NO: 10 is a wild-type guide RNA (wild sgRNA) capable of detecting KRAS (c.35G) mutation, and SEQ ID NO: 30 or 31 can be used as a target sequence when used for in vitro cleavage analysis.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 30 or 31 can be used as a target sequence when used for in vitro cleavage analysis.
  • the mutant sequence can be amplified by 1.5% to 50%.
  • SEQ ID NO: 11 is a wild-type guide RNA (wild sgRNA) capable of detecting EGFR, 15bp Del p. (729_761) mutation, and SEQ ID NO: 32 or 33 can be used as a target sequence when used for in vitro cleavage analysis.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 32 or 33 can be used as a target sequence when used for in vitro cleavage analysis.
  • the mutant sequence can be amplified from 0.5% to 23%.
  • SEQ ID NO: 12 is a wild-type guide RNA (wild sgRNA) capable of detecting EGFR (p.L858R or c.2573 T>G) mutation, and SEQ ID NO: 34 can be used as a target sequence when used for in vitro cleavage analysis. .
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 34 can be used as a target sequence when used for in vitro cleavage analysis.
  • SEQ ID NO: 13 is a transversion guide RNA (transversion sgRNA) capable of detecting EGFR (p.L858R) mutation, and SEQ ID NO: 35 can be used as a target sequence when used for in vitro cleavage analysis.
  • transversion sgRNA transversion guide RNA
  • SEQ ID NO: 35 can be used as a target sequence when used for in vitro cleavage analysis.
  • the mutant sequence can be amplified from 1.7% to 63%.
  • SEQ ID NO: 14 is a wild-type guide RNA (wild sgRNA) capable of detecting PIK3CA (p.E542K or c.1624G>A) mutation, and SEQ ID NO: 36 or 37 can be used as a target sequence when used for in vitro cleavage analysis have.
  • wild sgRNA wild-type guide RNA
  • PIK3CA p.E542K or c.1624G>A
  • SEQ ID NO: 15 is a wild-type guide RNA (wild sgRNA) capable of detecting PIK3CA (p.E545? or c.1633G>?) mutation, and SEQ ID NO: 38 or 39 can be used as a target sequence when used for in vitro cleavage analysis.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 38 or 39 can be used as a target sequence when used for in vitro cleavage analysis.
  • SEQ ID NO: 16 is a wild-type guide RNA (wild sgRNA) capable of detecting PIK3CA (p.H1047? or c.3140A>?) mutation, and SEQ ID NO: 40 or 41 can be used as a target sequence when used for in vitro cleavage analysis.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 40 or 41 can be used as a target sequence when used for in vitro cleavage analysis.
  • SEQ ID NO: 17 is a wild-type guide RNA (wild sgRNA) capable of detecting PIK3CA (p.V600E or c.1799T>A) mutation, and SEQ ID NO: 42 or 43 can be used as a target sequence when used for in vitro cleavage analysis have.
  • wild sgRNA wild-type guide RNA
  • SEQ ID NO: 42 or 43 can be used as a target sequence when used for in vitro cleavage analysis have.
  • SEQ ID NO: 18 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 1 capable of detecting EGFR (p.T790M or c.2369C>T) mutation.
  • SEQ ID NO: 19 represents a target sequence of the transversion guide RNA (transversion sgRNA) of SEQ ID NO: 2 capable of detecting EGFR (p.T790M or c.2390 G>C) mutation.
  • transversion guide RNA transversion sgRNA
  • SEQ ID NO: 20 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 3 capable of detecting EGFR (p.C797S) mutation.
  • SEQ ID NO: 21 represents a target sequence of the conversion mutation guide RNA (transversion sgRNA) of SEQ ID NO: 4 capable of detecting EGFR (p.C797S) mutation.
  • conversion sgRNA conversion sgRNA
  • SEQ ID NO: 22 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 5 capable of detecting MET c.2888 Int13-Exon14 Acceptor (Exon-14 Skipping) mutation.
  • SEQ ID NO: 23 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 5 capable of detecting MET c.2888 Int13-Exon14 Acceptor (Exon-14 Skipping) mutation.
  • SEQ ID NO: 24 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 6 capable of detecting MET c.3028 Exon14-Int14 Donor (Exon-14 Skipping) mutation.
  • SEQ ID NO: 25 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 6 capable of detecting MET c.3028 Exon14-Int14 Donor (Exon-14 Skipping) mutation.
  • SEQ ID NO: 26 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 7 capable of detecting MET 'TAC' Y1003X (Exon-14 Skipping) mutation.
  • SEQ ID NO: 27 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 7 capable of detecting MET 'TAC' Y1003X (Exon-14 Skipping) mutation.
  • SEQ ID NO: 28 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 8 capable of detecting EGFR (L718Q or c.2153 T> A) mutation.
  • SEQ ID NO: 29 represents a target sequence of the conversion mutation guide RNA (transversion sgRNA) of SEQ ID NO: 9 capable of detecting EGFR (L718Q) mutation.
  • conversion sgRNA conversion sgRNA
  • SEQ ID NO: 30 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 10 capable of detecting KRAS (c.35G) mutation.
  • SEQ ID NO: 31 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 10 capable of detecting KRAS (c.35G) mutation.
  • SEQ ID NO: 32 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 11 capable of detecting EGFR, 15 bp Del p. (729_761) mutation.
  • SEQ ID NO: 33 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 11 capable of detecting EGFR, 15 bp Del p. (729_761) mutation.
  • SEQ ID NO: 34 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 12 capable of detecting EGFR (p.L858R or c.2573 T>G) mutation.
  • SEQ ID NO: 35 represents a target sequence of the transversion guide RNA (transversion sgRNA) of SEQ ID NO: 13 capable of detecting EGFR (p.L858R) mutation.
  • SEQ ID NO: 36 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 14 capable of detecting PIK3CA (p.E542K or c.1624G>A) mutation.
  • SEQ ID NO: 37 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 14 capable of detecting PIK3CA (p.E542K or c.1624G>A) mutation.
  • SEQ ID NO: 38 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 15 capable of detecting PIK3CA (p.E545? or c.1633G>?) mutation.
  • SEQ ID NO: 39 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 15 capable of detecting PIK3CA (p.E545? or c.1633G>?) mutation.
  • SEQ ID NO: 40 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 16 capable of detecting PIK3CA (p.H1047? or c.3140A>?) mutation.
  • SEQ ID NO: 41 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 16 capable of detecting PIK3CA (p.H1047? or c.3140A>?) mutation.
  • SEQ ID NO: 42 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 17 capable of detecting PIK3CA (p.V600E or c.1799T>A) mutation.
  • SEQ ID NO: 43 represents a target sequence of wild-type guide RNA (wild sgRNA) of SEQ ID NO: 17 capable of detecting PIK3CA (p.V600E or c.1799T>A) mutation.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 CRISPR/Cas9 를 이용하여 야생형 암세포 유전자를 절단함으로써 발암성 돌연변이 유전자를 검출하는데 사용되는 가이드 RNA 내지 이의 용도에 대한 것이다. 본 발명의 가이드 RNA 를 이용하여 CRISPR/Cas9 시스템으로 암 돌연변이를 검출하는 경우, 야생형 무 세포 DNA(cfDNA) 만을 절단하고 발암성 돌연변이 DNA 는 절단하지 않아 기존 CRISPR/Cas9 시스템의 가이드 RNA 를 이용하는 경우에 비하여 발암성 돌연변이 DNA 만을 선택적으로 증폭하는데 효과적으로 사용될 수 있다.

Description

발암성 돌연변이 유전자 검출용 가이드 RNA 내지 이의 용도
본 출원은 2021년 05월 11일 출원된 대한민국 특허출원 제10-2021-0061037호 를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 CRISPR/Cas9 시스템을 이용하여 야생형 암세포 유전자를 절단함으로써 발암성 돌연변이 유전자를 검출하는데 사용되는 가이드 RNA 내지 이의 용도에 대한 것이다.
이 출원은 보건복지부로부터 지원받았다(No. HR14C0005020021(1465033586)).
시퀀싱 기술의 발전에 기초하여 암은 일반적으로 발암성 돌연변이에 의해 유발된다는 것으로 알려져 있다. 여러 연구에서 종양 형성이 특정 유형의 암에서 체세포 돌연변이의 유병률과 밀접한 관련이 있다는 증거를 제공했다. COSMIC (Catalogue of Somatic Mutations in Cancer) 데이터베이스에는 종양 유형 및 질병별로 분류된 수십만 개의 인간 암 관련 체세포 돌연변이가 포함되어 있다.
이와 함께, 최근 액체 생검은 기존의 조직 생검에 대한 유용한 대안으로 부상하고 있으며, 혈류에서 순환하는 종양 유래 요소를 탐지하고 모니터링하기 위한 비 침습적 접근 방식을 제공하며 암 바이오 마커의 원천으로 직접 또는 간접적으로 사용할 수 있다. 혈액에는 상세한 분자 분석에 취약한 두 가지 유형의 암 유래 성분이 포함되어 있다. 하나는 온전한 순환 종양 세포 (CTC, circulating tumor cells)와 무 세포 순환 종양 DNA (cfDNA 또는 순환 종양 DNA; ctDNA)이다. 종양의 부피가 증가함에 따라 세포 사멸 및 괴사성 단편을 제거하고 제거하는 식세포의 능력이 초과되어 cfDNA가 혈류로 수동 방출될 수 있다. 이 액체 생검은 종양이 일반적으로 혈류로 방출하는 DNA를 분석하는데 도움이 된다. 종양의 크기에 따라 혈류로 방출되는 cfDNA의 양은 혈장에 존재하는 모든 DNA의 0.01 %에서 90 %까지 다양하다. 따라서 액체 생검은 종양 조직을 확보하지 않고도 종양 분자 프로파일링에 대한 대규모 비 침습적 접근 방식을 제공한다.
그러나 혈장의 cfDNA에는 일반적으로 매우 적은 양의 종양 DNA가 포함되어 있으며 이는 종양 부담이나 암 단계에 따라 달라지는 것으로 알려졌다. 따라서 특히 암 초기 단계에서는 ctDNA를 검출하여 종양을 진단하기 위해 매우 민감하고 구체적인 방법이 필요하다. 원핵 생물의 적응성 면역 반응인 CRISPR (Clustered regular interspaced short palindromic repeats) 및 Cas(CRISPR-associated) 단백질 시스템은 특정 DNA 표적 인식 및 절단으로 잘 알려져 있다. CRISPR 시스템의 다양성은 우리와 다른 그룹은 다양한 유기체의 게놈 편집뿐만 아니라 시험관 내에서 DNA를 절단하는 데 광범위하게 활용한다. CRISPR 엔도뉴클레아제(예 : II 형 Cas9 또는 V 형 Cpf1)는 가이드 RNA(gRNA)에 해당하는 표적 DNA 서열의 각각 프로토 스페이서-인접 모티프 (PAM) 다운 스트림 또는 업스트림을 각각 인식하여 표적 DNA에서 이중 가닥 파손을 유도한다. 암 진단에 ctDNA를 사용하려면 비교적 많은 양의 야생형 cfDNA 중에서 미스 센스 돌연변이(missense mutation)가 있는 소량의 ctDNA를 매우 정확한 방식으로 검출해야 한다. 야생형 DNA를 특이적으로 절단함으로써 종양 특이적 대 야생형 대립 유전자를 풍부하게 할 수 있는데, Cas9-sgRNA 를 이용하여 야생형 표적 DNA를 절단하려면 단일 가이드 RNA가 PAM 부위의 서열을 표적화하도록 설계되어야 한다. 그러나 cfDNA에서 표적화된 DNA PAM 부위는 발암성 돌연변이에 의해 파괴되므로 CRISPR 엔도뉴클레아제(endonuclease)에 의해 인식되지 않아 검출하기 어렵다는 문제점이 존재한다.
이에 본 발명자들은 PAM 서열이 존재하지않는 암 관련 돌연변이에도 활용할 수 있는 암 진단 등을 위한 CRISPR 엔도뉴클라아제 및 Cas9(CRISPR/Cas9) 을 이용하여 검출하는 시스템을 제공하고자 예의 노력한 결과, 암세포의 돌연변이 DNA 가 아닌 야생형 DNA 만을 특이적으로 절단할 수 있는 가이드 RNA 를 제작하여 본 발명을 완성하였다.
따라서, 본 발명의 목적은 CRISPR/Cas9 시스템의 가이드 RNA(guide RNA) 내지 이를 포함하는 암 진단 또는 예후 예측용 조성물 내지 키트를 제공하는 것이다.
본 발명의 또 다른 목적은, 환자의 시료에 CRISPR/Cas9 시스템의 가이드 RNA(guide RNA) 를 처리하는 단계를 포함하는 포함하는 암 진단 또는 예후 예측을 위한 정보제공 방법을 제공하는 것이다.
본 발명은, CRISPR/Cas9 시스템에 이용되는 가이드 RNA(guide RNA) 로서,
상기 가이드 RNA 는 야생형 무 세포 DNA 를 절단하는 것을 특징으로 하는 가이드 RNA를 제공한다.
본 발명의 바람직한 일실시예에 다르면, 상기 가이드 RNA는 서열번호 1 내지 17 로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명의 바람직한 일실시예에 따르면, 상기 가이드 RNA 는 가이드 RNA 의 트렁크(trunk) 영역, 세미 시드(semi-seed) 영역 및 시드(seed) 영역으로 이루어진 군에서 선택되는 어느 하나 이상의 영역에서 전환 돌연변이(transversion mutation) 가 발생한 것일 수 있다.
본 발명의 바람직한 일실시예에 따르면, 상기 가이드 RNA 는 서열번호 2, 서열번호 4, 서열번호 9 및 서열번호 13 으로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명의 바람직한 일실시예에 따르면, 상기 가이드 RNA 는 EGFR, MET, KRAS, PIK3CA 및 BRAF 로 이루어진 군에서 선택되는 어느 하나 이상의 암 관련 돌연변이를 검출할 수 있는 것일 수 있다.
본 발명의 바람직한 일실시에에 따르면, 상기 EGFR 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 1 내지 4, 8, 9 및 11 내지 13 으로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명의 바람직한 일실시에에 따르면, 상기 MET 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 5 내지 7 로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명의 바람직한 일실시에에 따르면, 상기 KRAS 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 10 의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명의 바람직한 일실시에에 따르면, 상기 PIK3CA 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 14 내지 16 으로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명의 바람직한 일실시에에 따르면, 상기 BRAF 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 17 의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명은, 서열번호 1 내지 17 로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 CRISPR/Cas9 의 가이드 RNA 를 포함하는 암 진단 또는 예후 예측용 조성물을 제공한다.
본 발명의 바람직한 일실시예에 따르면, 상기 가이드 RNA 는 가이드 RNA 의 트렁크(trunk) 영역, 세미 시드(semi-seed) 영역 및 시드(seed) 영역으로 이루어진 군에서 선택되는 어느 하나 이상의 영역에서 전환 돌연변이(transversion mutation) 가 발생한 것일 수 있다.
본 발명의 바람직한 일실시예에 따르면, 상기 가이드 RNA 는 EGFR, MET, KRAS, PIK3CA 및 BRAF 로 이루어진 군에서 선택되는 어느 하나 이상의 암 관련 돌연변이를 검출할 수 있는 것일 수 있다.
본 발명의 바람직한 일실시예에 따르면, 상기 가이드 RNA 는 야생형 무 세포 DNA 를 절단하는 것일 수 있다.
본 발명은 또한, 상기 본 발명의 바람직한 일실시예에 따르면, 상기 암은 폐암, 췌장암, 대장암, 위암, 유방암, 신장암, 간암, 혈액암, 방광암 및 자궁암 으로 이루어진 군에서 선택되는 어느 하나 이상의 암인 것일 수 있다.
본 발명은 또한, 상기 조성물을 포함하는 암 진단 또는 예후 예측용 키트를 제공한다.
본 발명은 또한, 환자의 시료에 상기 조성물을 처리하는 단계를 포함하는 암 진단 또는 예후 예측을 위한 정보제공 방법을 제공한다.
상기 기재한 바와 같이, 기존 CRISPR/Cas9 시스템 으로 무 세포 DNA 를 이용한 발암성 돌연변이 유전자 검출은 3 개의 PAM 서열 (NGG) 뉴클레오티드의 돌연변이 를 타겟으로 하여 가이드 RNA 로 검출할 확률이 낮다는 점 등 발암성 돌연변이 유전자를 검출하는데에 한계가 존재하였다.
상기와 같은 한계점을 극복하기 위하여, 본 발명의 가이드 RNA 는 CRISPR/Cas 9 시스템을 통하여 발암성 돌연변이 유전자가 아닌 야생형 무 세포 DNA 를 타겟 및 절단하며, 특히 가이드 RNA의 트렁크(trunk) 영역에서 전환 돌연변이(transversion mutation)를 일으킨 가이드 RNA을 이용함으로써 발암성 돌연변이 유전자만을 선택적으로 타겟 및 증폭할 수 있다.
따라서, 본 발명은 CRISPR/Cas9 시스템에 이용되는 가이드 RNA(guide RNA) 로서, 상기 가이드 RNA 는 야생형 무 세포 DNA 를 절단하는 것일 수 있다.
상기 'CRISPR/Cas 9 시스템' 이란, Cas9 이라는 특정한 염기서열을 인식하여 유전자를 자를 수 있는 효소가 그 염기서열을 포함하고 있는 단일가닥 가이드 RNA(single guide RNA; sgRNA)를 인식하여 특정한 DNA를 자를 수 있는 시스템을 의미한다. CRISPR/Cas9 시스템은 타겟 DNA를 정확히 인식할 수 있게 디자인된 sgRNA와 이를 토대로 타겟 DNA를 자를 수 있는 Cas9으로 구성 되며, sgRNA를 인식한 Cas9은 DNA 이중나선을 절단한다.
본 발명의 바람직한 일실시예에 다르면, 상기 가이드 RNA는 서열번호 1 내지 17 로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
서열번호 1 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 EGFR (p.T790M) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 18 을 타겟 서열로 할 수 있다.
서열번호 2 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 EGFR (p.T790M) 돌연변이를 검출할 수 있는 전환 돌연변이 가이드 RNA(transversion sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 19 를 타겟 서열로 할 수 있다. 서열번호 2 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 1% 내지 32% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 3 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 EGFR (p.C797S) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 20 을 타겟 서열로 할 수 있다.
서열번호 4 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 EGFR (p.C797S) 돌연변이를 검출할 수 있는 전환 돌연변이 가이드 RNA(transversion sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 21 을 타겟 서열로 할 수 있다. 서열번호 4 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 1% 내지 13% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 5 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 MET c.2888 Int13-Exon14 Acceptor (Exon-14 Skipping) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 22 또는 23 을 타겟 서열로 할 수 있다.
서열번호 6 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 MET c.3028 Exon14-Int14 Donor (Exon-14 Skipping) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 24 또는 25 를 타겟 서열로 할 수 있다.
서열번호 7 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 MET 'TAC' Y1003X (Exon-14 Skipping) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 26 또는 27 을 타겟 서열로 할 수 있다.
서열번호 8 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 EGFR (L718Q) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 28 을 타겟 서열로 할 수 있다.
서열번호 9 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 EGFR (L718Q) 돌연변이를 검출할 수 있는 전환 돌연변이 가이드 RNA(transversion sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 29 를 타겟 서열로 할 수 있다. 서열번호 9 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 0.8% 내지 23.7% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 10 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 KRAS (c.35G) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 30 또는 31 을 타겟 서열로 할 수 있다. 서열번호 10 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 1.5% 내지 50% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 11 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 EGFR, 15bp Del p.(729_761) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 32 또는 33 을 타겟 서열로 할 수 있다. 서열번호 11 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 0.5% 내지 23% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 12 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 EGFR (p.L858R) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 34 를 타겟 서열로 할 수 있다.
서열번호 13 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 EGFR (p.L858R) 돌연변이를 검출할 수 있는 전환 돌연변이 가이드 RNA(transversion sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 35 를 타겟 서열로 할 수 있다. 서열번호 13 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 1.7% 내지 63% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 14 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 PIK3CA (p.E542K 또는 c.1624G>A) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 36 또는 37 을 타겟 서열로 할 수 있다.
서열번호 15 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 PIK3CA (p.E545? 또는 c.1633G>?) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 38 또는 39 를 타겟 서열로 할 수 있다.
서열번호 16 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 PIK3CA (p.H1047? 또는 c.3140A>?) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 40 또는 41 을 타겟 서열로 할 수 있다.
서열번호 17 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 는 PIK3CA (p.V600E 또는 c.1799T>A) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 42 또는 43 을 타겟 서열로 할 수 있다.
상기 가이드 RNA 는 가이드 RNA 의 트렁크(trunk) 영역, 세미 시드(semi-seed) 영역 및 시드(seed) 영역으로 이루어진 군에서 선택되는 어느 하나 이상의 영역에서 전환 돌연변이(transversion mutation) 가 발생한 것을 특징으로 하는 가이드 RNA 일 수 있다.
SpCas9로 DNA 절단을 표적화하려면 주로 표적 서열의 3 '말단에 인접한 3 개의 PAM 서열 (NGG) 뉴클레오티드와 함께 표적 프로토 스페이서 서열의 특정 20 개 뉴클레오티드가 필요하다. PAM 서열 내 돌연변이 (mismatched PAM-NGN 또는 임의의 발암성 돌연변이에 의해 유발됨)는 Cas9가 무 세포 DNA에서 야생형 표적 대립 유전자 (PAM-NGG)로 절단하여 야생형 DNA에서 돌연변이 대립 유전자를 풍부하게하기 위한 쉬운 최상의 후보이다. 그러나 모든 암 관련 돌연변이에 대해 이와 같이 일치하지 않는 PAM 표적 서열을 갖는 것은 불가능하다. 본 발명자들은 상기 문제점을 해결하고 모든 종류의 돌연변이를 표적으로 하기 위해 가이드 RNA의 트렁크(trunk) 영역에서 전환 돌연변이(transversion mutation, 퓨린에서 피리미딘으로)를 제조하였다. sgRNA 활성에 대한 내성에 따라 가이드 RNA 내의 1 염기 불일치(mismatch)는 세미 시드(semi-seed), 시드(seed), 트렁크(trunk) 및 다중(promiscuous) 영역으로 구분된다. 위치 4에서 7까지의 시드 영역 내 1 염기 불일치에 대한 가이드 RNA 내성은 해당 sgRNA의 가장 낮은 내성이다. 다음으로, 위치 1-3 및 8-11에서 시드 영역의 양쪽은 불일치에 대한 중간 허용 오차이며 세미 시드 영역으로 정의된다. 위치 12-19에서 1 염기 불일치는 절단 빈도를 중간 수준으로 줄였지만 sgRNA 활성을 유지하고 이 중간 영역을 트렁크 영역이라고 한다. 위치 20에서, 1 염기 불일치는 Cas9 뉴클레아제에 의해 유도된 절단 빈도를 약간 감소시키고 이 위치를 다중 영역으로 명명한다. 이 전략을 기반으로 Cas9 뉴클레아제를 전환 돌연변이(transversion mutation) 가이드 RNA로 처리하여 낮은 빈도의 돌연변이 대립 유전자를 강화한 다음 PCR 증폭을 통해 야생형 표적 대립 유전자를 제거할 수 있다. 돌연변이 표적 대립 유전자는 Cas9 뉴클레아제에 의해 인식되지 않거나 절단되지 않는다. 왜냐하면 2 개의 돌연변이에 대한 낮은 내성, 즉 하나는 sgRNA 내의 전환 돌연변이이고 두 번째는 발암성 돌연변이의 표적 돌연변이이기 때문이다(도 3a, 도 3b).
상기 Cas9 뉴클레아제는 다양한 변이체를 포함할 수 있으며, Cas9, eCas9 또는 HFCas9 일 수 있다.
본 발명의 바람직한 일실시예에 따르면, 상기 전환 돌연변이(transversion mutation) 가 발생한 가이드 RNA 는 서열번호 2, 서열번호 4, 서열번호 9 및 서열번호 13 으로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명의 바람직한 일실시예에 따르면, 상기 가이드 RNA 는 EGFR, MET, KRAS, PIK3CA 및 BRAF 로 이루어진 군에서 선택되는 어느 하나 이상의 암 관련 돌연변이를 검출할 수 있는 것일 수 있다.
본 발명의 바람직한 일실시에에 따르면, 상기 EGFR 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 1 내지 4, 8, 9 및 11 내지 13 으로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명의 바람직한 일실시에에 따르면, 상기 MET 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 5 내지 7 로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명의 바람직한 일실시에에 따르면, 상기 KRAS 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 10 의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명의 바람직한 일실시에에 따르면, 상기 PIK3CA 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 14 내지 16 으로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
본 발명의 바람직한 일실시에에 따르면, 상기 BRAF 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 17 의 뉴클레오타이드 서열을 포함하는 것일 수 있다.
또한, 본 발명은, 서열번호 1 내지 17 로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 CRISPR/Cas9 의 가이드 RNA를 제공할 수 있다. 상기 가이드 RNA 는 야생형 무 세포 DNA 를 절단하는 것 일 수 있다.
본 발명의 바람직한 일실시예에 따르면, 상기 가이드 RNA 는 가이드 RNA 의 트렁크(trunk) 영역, 세미 시드(semi-seed) 영역 및 시드(seed) 영역으로 이루어진 군에서 선택되는 어느 하나 이상의 영역에서 전환 돌연변이(transversion mutation) 가 발생한 것일 수 있다.
본 발명은 또한, 상기 가이드 RNA 를 포함하는 암 진단 또는 예후 예측용 조성물을 제공할 수 있다.
본 발명의 바람직한 일실시예에 따르면, 상기 암은 폐암, 췌장암, 대장암, 위암, 유방암, 신장암, 간암, 혈액암, 방광암 및 자궁암 으로 이루어진 군에서 선택되는 어느 하나 이상의 암인 것일 수 있으나, EGFR, MET, KRAS, PIK3CA 또는 BRAF 돌연변이로 인해 발생하는 암이라면 제한 없이 해당할 수 있다.
본 발명은 또한, 상기 조성물을 포함하는 암 진단 또는 예후 예측용 키트를 제공할 수 있다.
상기 키트는 통상적으로 사용되는 발현 수준 분석방법에 적합한 한 종류 또는 그 이상의 다른 구성성분 조성물, 용액 또는 장치로 구성될 수 있다. 예를 들어, 단백질 발현 수준을 측정하기 위한 키트는 항체의 면역학적 검출을 위하여 기질, 적당한 완충용액, 발색 효소 또는 형광물질로 표지된 2차 항체, 발색 기질 등을 포함할 수 있다.
본 발명의 키트는 평가 대상체로부터 샘플을 수득하기 위한 샘플 추출 수단을 포함할 수 있다. 샘플 추출 수단은 바늘 또는 시린지 등을 포함할 수 있다. 키트는 액체, 기체 또는 반고체일 수 있는, 추출된 샘플을 수용하기 위한 샘플 수집 용기를 포함할 수 있다. 키트는 사용 지침을 추가로 포함할 수 있다. 상기 샘플은 발암성 돌연변이 유전자가 존재하거나 분비될 수 있는 임의의 신체 샘플일 수 있다. 예를 들어, 샘플은 소변, 대변, 모발, 땀, 타액, 체액, 혈액, 세포 또는 조직일 수 있다. 신체 샘플에서 발암성 돌연변이 유전자의 측정은 전체 샘플 또는 가공된 샘플 상에서 수행될 수 있다.
본 발명은 또한, 환자의 시료에 제1항의 가이드 RNA 를 처리하는 단계를 포함하는 암 진단 또는 예후 예측을 위한 정보제공 방법을 제공할 수 있다.
상기 시료는 소변, 대변, 모발, 땀, 타액, 체액, 혈액, 세포 또는 조직일 수 있다.
본 발명의 가이드 RNA 를 이용하여 CRISPR/Cas9 시스템으로 암 돌연변이를 검출하는 경우, 야생형 무 세포 DNA(cfDNA) 만을 절단하고 발암성 돌연변이 DNA 는 절단하지 않아 기존 CRISPR/Cas9 시스템의 가이드 RNA 를 이용하는 경우에 비하여 발암성 돌연변이 DNA 만을 선택적으로 증폭하는데 효과적으로 사용될 수 있다. 특히, 본 발명의 가이드 RNA(야생형 가이드 RNA)와 전환 돌연변이 가이드 RNA(transversion sgRNA)를 병용하는 경우 cf DNA 만을 절단하고 발암성 돌연변이 DNA 만을 선택적으로 증폭하는 효과가 유의적으로 증가할 수 있다.
도 1은 비편평성(non-squamous; 선암, adenocarcinoma; EGFR-TK, ALK 또는 ROS-1 양성) 암종 및 비소세포암종 환자를 위한 약물 치료 또는 전신 항암 요법을 위한 질병 진행 및 옵션을 폐암에 대한 NICE 가이드 라인과 함께 요약한 것을 나타낸다.
도 2는 Cas9-sgRNA 를 이용하여 무세포 DNA(cfDNA) 내 돌연변이 대립 유전자를 증폭하기 위한 도식을 나타낸다.
도 3a 및 도 3b 는 무세포 DNA(cfDNA) 에서 Cas9 처리로 가능한 모든 돌연변이 대립 유전자를 증폭시키기 위한 가이드 RNA 설계 전략을 나타낸다.
도 4a 및 도 4b는 본 발명의 가이드 RNA를 이용하여 KRAS 돌연변이(c.35G>C) 서열을 검출하는 in vitro 절단 분석(in vitro cleavage assay) 및 그 결과를 나타낸다.
도 5는 본 발명의 가이드 RNA를 이용하여 EGFR 돌연변이(c.2369C>T 또는 p.T790M) 서열을 검출하는 in vitro 절단 분석(in vitro cleavage assay) 및 그 결과를 나타낸다.
도 6a 및 도 6b 는 본 발명의 가이드 RNA를 이용하여 EGFR 돌연변이(c.2573 T>G 또는 p.L858R) 서열을 검출하는 in vitro 절단 분석(in vitro cleavage assay) 및 그 결과를 나타낸다.
도 7 는 본 발명의 가이드 RNA를 이용하여 환자(LA-29) 시료 내 EGFR 돌연변이(c.2573 T>G 또는 p.L858R) 서열을 검출하는 in vitro 절단 분석(in vitro cleavage assay) 및 그 결과를 나타낸다.
도 8은 본 발명의 가이드 RNA를 이용하여 EGFR 돌연변이(p.C7975, L718Q 또는 p.(729_761)손실) 또는 MET 돌연변이(c.2888, c.3028 또는 'TAC'Y1003X) 서열을 검출하는 in vitro 절단 분석(in vitro cleavage assay) 및 그 결과를 나타낸다.
도 9 은 본 발명의 가이드 RNA를 이용하여 BRAF 돌연변이(p.V600E 또는 c.1799T>A) 또는 PIK3CA 돌연변이(c.1624G>A 또는 p.E542K; p.H1047? 또는 c.3140A>?) 서열을 검출하는 in vitro 절단 분석(in vitro cleavage assay) 및 그 결과를 나타낸다.
도 10은 본 발명의 가이드 RNA를 이용하여 EGFR 돌연변이(T790M) 서열을 검출한 PCR 결과를 나타낸다.
도 11은 본 발명의 가이드 RNA를 이용하여 EGFR 돌연변이(T790M) 서열을 검출한 PCR 결과를 정량적으로 나타낸다.
도 12은 야생형 유전자 및 돌연변이 유전자(KRAS c.35G>C)를 다양한 비율로 혼합한 후 Cas9 을 처리한 결과를 나타낸다.
도 13 은 야생형 유전자 및 돌연변이 유전자(EGFR-c.2369C>T 또는p.T790M)를 다양한 비율로 혼합한 후 Cas9 을 처리한 결과를 나타낸다.
도 14 는 야생형 유전자 및 돌연변이 유전자(EGFR c.2390G>C 또는 p.C797S)를 다양한 비율로 혼합한 후 Cas9 을 처리한 결과를 나타낸다.
도 15 은 야생형 유전자 및 돌연변이 유전자(EGFR c.2153T to A (L718Q))를 다양한 비율로 혼합한 후 Cas9 을 처리한 결과를 나타낸다.
도 16는 cfDNA 참조 표준 세트로서, ddPCR(Droplet digital PCR )에 의해 수집된 대립 유전자 빈도 및 카피 수 데이터를 나타낸다. 다른 내인성 변이체가 미리 설정되어 있지만 제시된 데이터만 각 배치 내에서 테스트 되었다(분석 배경으로 인해 예상 AF에 대해 확인되지 않았지만 ddPCR에 의해 변이체가 검출되었다; 사용된 QC 분석으로 인해 NRAS Q61K와의 프로브 경쟁이 입증 되었기 때문에 예상 AF에 대해 확인되지 않았지만 ddPCR에 의해 변이체가 검출되었다).
도 17은 cfDNA 참조 표준 세트를 기초로 본 발명의 가이드 RNA를 이용하여 돌연변이 유전자에 대한 PCR 결과를 나타낸다.
도 18은 환자 시료 내 무 세포 DNA 검출을 위한 워크플로우를 나타낸다.
도 19는 환자(LA-29, LA-209 또는 LA-292) 시료 내 EGFR 돌연변이 중 L858R 돌연변이를 본 발명의 가이드 RNA 및 Cas9 를 이용하여 검출한 결과를 나타낸다.
도 20은 환자(LA-232) 시료 내 EGFR 돌연변이 중 T790M 또는 E19del 돌연변이를 본 발명의 가이드 RNA 및 Cas9 를 이용하여 단일 검출한 결과를 나타낸다.
도 21는 환자(LA-232) 시료 내 EGFR 돌연변이 중 T790M 또는 E19del 돌연변이를 본 발명의 가이드 RNA 및 Cas9 를 이용하여 다중 검출한 결과를 나타낸다.
도 22는 환자(LA-322) 시료 내 EGFR 돌연변이 중 T790M 또는 E19del 돌연변이를 본 발명의 가이드 RNA 및 Cas9 를 이용하여 단일 검출한 결과를 나타낸다.
도 23은 환자(LA-322) 시료 내 EGFR 돌연변이 중 T790M 또는 E19del 돌연변이를 본 발명의 가이드 RNA 및 Cas9 를 이용하여 다중 검출한 결과를 나타낸다.
[실시예 1]
약물 내성 돌연변이에 대한 가이드 RNA 제작
IVT(In-vitro transcription cleavage) 분석을 테스트하기 위한 선택된 유전자의 야생형 및 돌연변이 표적 서열과, 가이드 RNA 서열을 제작하였다.
유전자/
Mut.AA 		뉴클레오타이드 (WT/Mut) In-vitro Cleavage Assay 타겟 서열 sgRNA + PAM 서열 sgRNA 유형
EGFR (p.T790M or c.2369C> T) WT - C TCACCTCCACCGTGCAGCTCATCAcGCAGCTCATGCCCTTC (서열번호 18) CTGCgTGATGAGCTGCACGG TGG (서열번호 1) Wild sgRNA
Mut - T TCACCTCCACCGTGCAGCTCATCAtGCAGCTCATGCCCTTC (서열번호 19) CTGCgTGcTGAGCTGCACGG TGG (서열번호 2) Transversion sgRNA
EGFR (p.C797S or c.2390 G> C) WT - G ACGCAGCTCATGCCCTTCGGCTgCCTCCTGGACTATGTCCG (서열번호 20) CATGCCCTTCGGCTgCCTCC TGG (서열번호 3) Wild sgRNA
Mut - C ACGCAGCTCATGCCCTTCGGCTcCCTCCTGGACTATGTCCG (서열번호 21) CATGCaCTTCGGCTgCCTCC TGG (서열번호 4) Transversion sgRNA
MET c.2888 Int13-Exon14 Acceptor (Exon-14 Skipping) WT - GA TTAACAAGCTCTTTCTTTCTCTCTGTTTTAAgaTCTGGGCA (서열번호 22) TTTCTCTCTGTTTTAAgaTC TGG (서열번호 5) Wild sgRNA
Mut - ?? TTAACAAGCTCTTTCTTTCTCTCTGTTTTAAgaTCTGGGCA (서열번호 23) TTTCTCTCTGTTTTAAgaTC TGG
MET c.3028 Exon14-Int14 Donor (Exon-14 Skipping) WT - AC ATTTCTCAGAACAATAAACTGAAATATacCTTCTGGAAAAG (서열번호 24) ATAAACTGAAATATacCTTC TGG (서열번호 6) Wild sgRNA
Mut - ?? ATTTCTCAGAACAATAAACTGAAATATacCTTCTGGAAAAG (서열번호 25) ATAAACTGAAATATacCTTC TGG
MET 'TAC' Y1003X
(Exon-14 Skipping)		 WT - TAC GAAATGGTTTCAAATGAATCTGTAGACtacCGAGCTACTTT (서열번호 26) AAATGAATCTGTAGACtacC GAG (서열번호 7) Wild sgRNA
Mut - ??? GAAATGGTTTCAAATGAATCTGTAGACtacCGAGCTACTTT (서열번호 27) AAATGAATCTGTAGACtacC GAG
EGFR (L718Q or c.2153 T> A) WT - T GAATTCAAAAAGATCAAAGTGCtGGGCTCCGGTGCGTTCGG (서열번호 28) AAGATCAAAGTGCtGGGCTC CGG (서열번호 8) Wild sgRNA
Mut - A GAATTCAAAAAGATCAAAGTGCaGGGCTCCGGTGCGTTCGG (서열번호 29) AAGATCAcAGTGCtGGGCTC CGG (서열번호 9) Transversion sgRNA
KRAS (c.35G) WT - G TGACTGAATATAAACTTGTGGTAGTTGGAGCTGgTGGCGTAGGCA (서열번호 30) AAACTTGTGGTAGTTGGAGC TGG (서열번호 10) Wild sgRNA
Mut - C (A or T) TGACTGAATATAAACTTGTGGTAGTTGGAGCTGcTGGCGTAGGCA (서열번호 31) AAACTTGTGGTAGTTGGAGC TGg
EGFR, 15bp Del p.(729_761) WT - GGAATTAAGAGAAGC AAGTTAAAATTCCCGTCGCTATCAAggaattaagagaagcAACATC (서열번호 32) TAAAATTCCCGTCGCTATCA AGG (서열번호 11) Wild sgRNA
Mut - 15bp Deletion AAGTTAAAATTCCCGTCGCTATCAAggaattaagagaagcAACATC (서열번호 33 TAAAATTCCCGTCGCTATCA AGG
EGFR (p.L858R or c.2573 T>G) WT - T GATCACAGATTTTGGGCtGGCCAAACTGCTGGGTGCGGAAG (서열번호 34) TTTTGGGCtGGCCAAACTGC TGG (서열번호 12) Wild sgRNA
Mut - G GATCACAGATTTTGGGCgGGCCAAACTGCTGGGTGCGGAAG (서열번호 35) TTTTGtGCtGGCCAAACTGC TGG (서열번호 13) Transversion sgRNA
PIK3CA p.E542K or c.1624G>A WT - G CACGAGATCCTCTCTCTgAAATCACTGAGCAGGAGAAAG (서열번호 36) TGCTCAGTGATTTcAGAGAG AGG (서열번호 14) Wild sgRNA
Mut - A CACGAGATCCTCTCTCTaAAATCACTGAGCAGGAGAAAG (서열번호 37) TGCTCAGTGATTTcAGAGAG AGG
PIK3CA p.E545? or c.1633G>? WT - G CACGAGATCCTCTCTCTGAAATCACTgAGCAGGAGAAAG (서열번호 38) TCTCTCTGAAATCACTgAGC AGG (서열번호 15) Wild sgRNA
Mut - ?? (A or C or T) CACGAGATCCTCTCTCTGAAATCACTaAGCAGGAGAAAG (서열번호 39) TCTCTCTGAAATCACTgAGC AGG
PIK3CA p.H1047? or c.3140A>? WT - T CATGAAACAAATGAATGATGCACaTCATGGTGGCTGG (서열번호 40) CAAATGAATGATGCACaTCA TGG (서열번호 16) Wild sgRNA
Mut - ?? (G or C or T) CATGAAACAAATGAATGATGCACgTCATGGTGGCTGG (서열번호 41) CAAATGAATGATGCACaTCA TGG
BRAF p.V600E or c.1799T>A WT - T GATTTTGGTCTAGCTACAGtGAAATCTCGATGGAGTGGG (서열번호 42) TAGCTACAGtGAAATCTCGA TGG (서열번호 17) Wild sgRNA
Mut - A GATTTTGGTCTAGCTACAGaGAAATCTCGATGGAGTGGG (서열번호 43) TAGCTACAGtGAAATCTCGA TGG
상기 [표 1]은 약물 내성 돌연변이에 대한 가이드 RNA를 나타낸다. IVT(In-vitro transcription cleavage) 분석을 테스트하기 위한 선택된 유전자의 야생형 및 돌연변이 표적 서열은 모두 IVT 테스트를 위해 T-블런트 클로닝 벡터로 서브 클로닝되고, 야생형 표적 서열에서 돌연변이 위치는 굵게 강조 표시되고 해당 뉴클레오티드 돌연변이는 빨간색(소문자)으로 표시된다. 돌연변이의 '?' 표시는 야생형 뉴클레오타이드가 아닌 임의의 뉴클레오타이드를 의미한다. 각 표적에 대한 작은 가이드 RNA가 설계되었으며 PAM 서열은 파란색(기울임)으로 표시된다. Transversion 돌연변이는 녹색으로 표시된다. IVT 분석을 확인한 후 샘플을 PCR 증폭하여 NGS를 통해 분석하였다.
[실시예 2]
야생형 및 KRAS 돌연변이 (c.35G>C) 서열 및 sgRNA 활성 결과를 포함하는 플라스미드를 사용한 in vitro 절단 분석
야생형 DNA를 특이적으로 절단하기 위해 sgRNA는 PAM 부위와 함께 20 개의 뉴클레오티드를 표적으로 삼도록 설계되었지만, KRAS 돌연변이 (PAM)의 경우 발암성 돌연변이 (c.35G>C)에 의해 파괴되었다. In vitro 절단 분석(IVT)을 사용하여 이 접근법을 테스트하기 위해, 표적 서열을 T-블런트 클로닝 벡터 (야생형 및 돌연변이 KRAS 서열)에 서브 클로닝하고 벡터의 제한 효소로 플라스미드를 선형화했다. 선형화된 생성물은 Cas9 뉴클레아제 및 야생형 서열 특이적 sgRNA로 처리하여 추가로 절단되었다. 야생형 또는 돌연변이 DNA를 0.8 % 겔로 전기영동한 후, 선형화된 단편 (절단되지 않은) 및 절단된 단편 (절단된)을 크기로 구분하고 빨간색 화살표로 표시하였다(도 4a 및 도 4b). 야생형에서 표적화된 DNA는 Cas9/sgRNA에 의해 완전히 절단되지만 돌연변이 표적 서열은 Cas9 및 sgRNA에 의해 절단되지 않았다. 왜냐하면 PAM 부위의 돌연변이와 이 돌연변이 대립 유전자는 Cas9 뉴클레아제에 의해 인식되지 않기 때문이다.
[실시예 3]
발암성 유전자의 야생형 또는 돌연변이 서열을 포함하는 플라스미드를 사용한 in vitro 절단 분석 및 Cas9 변이체를 사용한 sgRNA 활성 분석
야생형 표적 DNA를 특이적으로 절단하기 위해 sgRNA는 PAM 부위가 있는 20 개 뉴클레오티드의 서열을 표적화하도록 설계되었지만 EGFR 돌연변이 (c.2369C> T 또는 p.T790M)의 경우 표적 돌연변이 위치는 sgRNA 결합 부위의 트렁크(trunk) 영역 내에서 발견된다. sgRNA 결합 부위의 스페이서의 트렁크 영역 (12 -19) 내에서 1 염기 불일치(mismatch), Cas9 절단 활성은 약간 또는 중간 수준으로 감소하지만 절단 활성은 유지한다. sgRNA를 표적으로 하는 야생형의 이러한 활성은 또한 무 세포 DNA에서 돌연변이 표적 대립 유전자를 절단할 수 있다. 이 문제를 극복하고 돌연변이 표적 대립 유전자의 절단을 피하기 위해 sgRNA (TmWT sgRNA)의 트렁크 영역에 전환 돌연변이(transversion mutation)을 생성했다. 이 TmWT-sgRNA는 두 돌연변이에 대한 낮은 내성 때문에 돌연변이 대립 유전자에서 Cas9 뉴클레아제에 의해 인식되거나 절단되지 않는다. In vitro 절단 분석을 사용하여 이 접근법을 테스트하기 위해 표적 서열을 T-블런트 클로닝 벡터 (야생형 및 돌연변이 EGFR 서열)에 서브 클로닝하고 벡터의 제한 효소로 플라스미드를 선형화했다. 선형화된 생성물은 Cas9 뉴클레아제 변이체와 야생형 서열 특이적 sgRNA (WT sgRNA) 및 전환 돌연변이 sgRNA (TmWT sgRNA)의 상이한 조합으로 처리하여 추가로 절단되었다. 야생형 또는 돌연변이 DNA를 0.8 % 겔로 전기영동한 후, 선형화된 단편 (절단되지 않은) 및 절단된 단편 (절단된)을 크기로 구분하고 빨간색 화살표로 표시하였다. 야생형에서 표적화된 DNA는 WT-sgRNA로 Cas9 변이체에 의해 완전히 절단되고 심지어 돌연변이 표적 서열에서도 Cas9 및 WT-sgRNA에 의해 완전히 절단되었다. 그러나 전환 돌연변이에서 sgRNA (TmWT-sgRNA)는 Cas9 변이체에 대해 서로 다른 절단 패턴을 보여주고 있다. 이것은 TmWT-sgRNA가 두 돌연변이에 대해 낮은 내성이며 돌연변이 표적 대립 유전자를 완전히 절단할 수 없음을 나타낸다.
상기 전략을 기반으로 야생형 표적 대립 유전자를 절단하고 제거하여 cfDNA에서 돌연변이 대립 유전자(EGFR 돌연변이 (c.2369C> T 또는 p.T790M; c.2573 T>G 또는 p.L858R; p.C797S, L718Q 또는 p.(729_761) 결실), MET 돌연변이(c.2888, c.3028 또는 'TAC'Y1003X), BRAF 돌연변이(p.V600E 또는 c.1799T>A) 또는 PIK3CA 돌연변이(c.1624G>A 또는 p.E542K; p.H1047? 또는 c.3140A>?)) 를 풍부하게 할 수 있었다(도 5 ~ 도 11). EGFR p.729-761 결실 및 MET 유전자 돌연변이의 경우 돌연변이 위치가 seed 영역에 있기 때문에 Transversion 돌연변이 sgRNA를 설계하지 않았다.
[실시예 4]
다양한 비율의 야생형 및 돌연변이 플라스미드 혼합물을 사용한 EGFR 돌연변이의 CUT-PCR 기반 농축 분석
상기 <실시예 3> 과 동일한 방법으로 다양한 타겟 서열 및 가이드 RNA 를 이용하여 분석하였다. 야생형 또는 돌연변이 EGFR (c.2369C> T 또는 p.T790M) 서열을 포함하는 다양한 비율의 플라스미드 혼합물에 대한 CUT-PCR 실험을 수행하였다. 야생형 및 돌연변이 서열을 포함하는 DNA 플라스미드를 다양한 비율로 혼합하고 시험관 내에서 Cas9 변이체 절단을 실시했다. 플라스미드 혼합물을 Cas9 변이체와 함께 Transversion 돌연변이 sgRNA (TmWT-sgRNA)로 처리하여 야생형 DNA를 절단했다. 처리 후 PCR cleanup kit를 사용하여 시료를 정제 하였다. 표적 특이적 절단을 정량화하기 위해 표적 서열의 배수 증가를 처리되지 않은 대조군 제품의 배수 증가와 비교했다. 각 레인에서 처리되지 않은 대조군 제품에 대한 EGFR 표적 영역의 양은 NGS 분석에 의해 계산되었다. EGFR (c.2369C> T 또는 p.T790M) 돌연변이의 경우, 돌연변이 플라스미드가 존재하는 플라스미드 혼합물에 대해 CUT-PCR을 처리한 후 (주황색 또는 분홍색 막대) 또는 하지 않은 (보라색 또는 파란색 막대) 표적화된 깊은 시퀀싱을 수행했다. 원래 0.5 ~ 5 %의 비율로 야생형 플라스미드와 혼합되었다. 생성된 PCR 앰플리콘은 MiSeq로 페어드 엔드 시퀀싱에 적용되었다. NGS 결과는 Cas9 및 eCas9 변이체 모두에서 돌연변이 DNA 단편의 모든 혼합 비율에 대한 야생형 및 돌연변이 서열 배수 변화를 TmWT-sgRNA와 비교하여 분석했다.
돌연변이 서열은 4.8 ~ 5.4 배로 풍부하였다(도 10, 도 11).
[실시예 5]
다양한 비율의 야생형 및 돌연변이 플라스미드 혼합물을 사용한 다중 유전자 돌연변이의 CUT-PCR 기반 농축 분석
상기 <실시예 3> 과 동일한 방법으로 다양한 타겟 서열 및 가이드 RNA 를 이용하여 분석하였다. KRAS (c.35 G> C) 및 EGFR (c.2369 C> T, c.2390 G> C 및 c.2153 T> A)의 야생형 또는 돌연변이 서열을 포함하는 다양한 비율의 플라스미드 혼합물에 대한 CUT-PCR 실험을 수행하였다. 다중 유전자 돌연변이의 야생형 및 돌연변이 서열을 포함하는 DNA 플라스미드를 다양한 비율로 혼합하고 시험관 내에서 Cas9 변이체 절단을 수행했다. 플라스미드 혼합물은 야생형 DNA를 절단하기 위해 Cas9 변이체가 있는 각 유전자에 해당하는 혼합 sgRNA로 처리되었다. 처리 후 PCR cleanup kit를 사용하여 시료를 정제하였다. 다중 표적 특이적 절단을 정량화하기 위해 표적 서열의 배수 증가를 처리되지 않은 대조군 제품의 배수 증가와 비교했다. 각 레인에서 처리되지 않은 대조군 제품에 대한 각 표적 영역의 양은 NGS 분석에 의해 계산되었다. NGS 결과는 Cas9 및 eCas9 변이체 모두에서 돌연변이 DNA 단편의 모든 혼합 비율에 대한 야생형 및 돌연변이 서열 백분율을 다중 sgRNA와 비교하여 분석했다.
돌연변이 서열은 0.6 ~ 46.5 % 범위로 풍부했다(도 12 ~ 도 15).
[실시예 6]
cfDNA 참조 표준 세트를 사용한 다중 돌연변이의 CUT-PCR 기반 강화
sgRNA 활성 및 cfDNA에서 돌연변이 대립 유전자를 강화하기 위한 실험 방법을 확인하거나 증명하기 위해 시판되는 다중 cfDNA 샘플을 참조 표준으로 활용했으며, 3 개의 sgRNA의 활성을 확인했다. 상기 다중 cfDNA 표준 샘플은 8 개의 다른 돌연변이를 가진 4 개의 유전자를 포함하며 각 유전자의 세 가지 비율을 포함하였다(도 16).
sgRNA 활성 및 cfDNA에서 돌연변이 대립 유전자를 풍부하게하는 실험 방법을 확인하거나 증명하였다. 참조 표준 혼합물은 야생형 DNA를 절단하기 위해 SpCas9로 각 유전자에 상응하는 sgRNA로 처리되었다. 처리 후 PCR cleanup kit를 사용하여 시료를 정제하였다. 다중 표적 특이적 절단을 정량화하기 위해 각 표적 서열의 백분율을 처리되지 않은 대조군 제품의 백분율과 비교했다. 각 레인에서 처리되지 않은 대조군 제품에 대한 각 표적 영역의 양은 NGS 분석에 의해 계산되었다. NGS 결과는 SpCas9 및 multi-sgRNA와 다른 비율로 cfDNA의 모든 혼합 비율에 대한 미처리 및 처리된 샘플 비율을 비교하여 분석했으며, 돌연변이 서열은 1.44 ~ 9.39 % 범위로 풍부하였다(도 17).
또한, 혼합된 sgRNA 를 KRAS, EGFR-T790M 또는 EGFR 729-761bp deletion 샘플에 처리한 후 In vitro Cleavage assay 를 수행한 결과를 하기 [표 2]에 나타냈다.
Cas9 with Mixed-sgRNA's Treated for Multiplex 1 KRAS PCR EGFR T790M PCR EGFR Deletion PCR
0.1 1 5 100 0.1 1 5 100 0.1 1 5 100
Cas9 Not Treated 0.10 1.71 7.77 0.05 0.34 1.24 5.79 0.17 0.04 0.94 5.53 0.05
Cas9 Treated 2.33 9.91 4.12 0.09 0.05 0.02 7.92 0.05 4.59 0.02 25.96 0.27
Fold Change(mut Seq Enreached) 22.28 5.81 0.53 1.87 0.14 0.02 1.37 0.32 102.34 0.02 4.69 5.86
[실시예 7]
환자 샘플의 무 세포 DNA에서 돌연변이 표적의 초 민감도 검출
돌연변이를 보유한 폐암 환자의 혈액 내에서 본원발명의 가이드 RNA 를 이용하여 무세포 DNA 내 돌연변이 타겟을 검출하고자 하였다(도 18).
하기 [표 3] 은 L858R 돌연변이를 보유한 환자 샘플을, [표 4] 는 T790M 및 E19del 돌연변이를 보유한 환자 샘플을 나타낸다.
ID 날짜 성별 구분
LA-29 2015-06-19 남 말기
LA-209 2016-10-04 여 후기
LA-292 2019-04-19 남 후기
ID 날짜 성별 구분
LA-232 2017-02-14 남 후기
LA-322 2019-10-07 남 후기
LA-323 2019-10-14 여 후기
상기 <실시예 3> 과 동일한 방법으로 다양한 타겟 서열 및 가이드 RNA 를 이용하여 분석하였다. NGS 결과는 환자 cfDNA 각각에 대한 처리되지 않은 샘플 비율과 SpCas9 및 해당 sgRNA를 비교하여 분석되었으며, 돌연변이 시퀀스는 풍부하게 검출되었다(도 19 ~ 도 25).
본 발명의 가이드 RNA 를 이용하여 CRISPR/Cas9 시스템으로 암 돌연변이를 검출하는 경우, 야생형 무 세포 DNA(cfDNA) 만을 절단하고 발암성 돌연변이 DNA 는 절단하지 않아 기존 CRISPR/Cas9 시스템의 가이드 RNA 를 이용하는 경우에 비하여 발암성 돌연변이 DNA 만을 선택적으로 증폭하는데 효과적으로 사용될 수 있다. 특히, 본 발명의 가이드 RNA(야생형 가이드 RNA)와 전환 돌연변이 가이드 RNA(transversion sgRNA)를 병용하는 경우 cfDNA 만을 절단하고 발암성 돌연변이 DNA 만을 선택적으로 증폭하는 효과가 유의적으로 증가할 수 있어 산업상 이용가능성이 있다.
서열번호 1 은 EGFR (p.T790M 또는 c.2369C>T) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 18 을 타겟 서열로 할 수 있다.
서열번호 2 는 EGFR (p.T790M 또는 c.2390 G>C) 돌연변이를 검출할 수 있는 전환 돌연변이 가이드 RNA(transversion sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 19 를 타겟 서열로 할 수 있다. 서열번호 2 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 1% 내지 32% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 3 은 EGFR (p.C797S) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 20 을 타겟 서열로 할 수 있다.
서열번호 4 는 EGFR (p.C797S) 돌연변이를 검출할 수 있는 전환 돌연변이 가이드 RNA(transversion sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 21 을 타겟 서열로 할 수 있다. 서열번호 4 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 1% 내지 13% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 5 는 MET c.2888 Int13-Exon14 Acceptor (Exon-14 Skipping) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 22 또는 23 을 타겟 서열로 할 수 있다.
서열번호 6 은 MET c.3028 Exon14-Int14 Donor (Exon-14 Skipping) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 24 또는 25 를 타겟 서열로 할 수 있다.
서열번호 7 은 MET 'TAC' Y1003X (Exon-14 Skipping) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 26 또는 27 을 타겟 서열로 할 수 있다.
서열번호 8 은 EGFR (L718Q 또는 c.2153 T> A) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 28 을 타겟 서열로 할 수 있다.
서열번호 9 는 EGFR (L718Q) 돌연변이를 검출할 수 있는 전환 돌연변이 가이드 RNA(transversion sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 29 를 타겟 서열로 할 수 있다. 서열번호 9 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 0.8% 내지 23.7% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 10 은 KRAS (c.35G) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 30 또는 31 을 타겟 서열로 할 수 있다. 서열번호 10 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 1.5% 내지 50% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 11 은 EGFR, 15bp Del p.(729_761) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 32 또는 33 을 타겟 서열로 할 수 있다. 서열번호 11 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 0.5% 내지 23% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 12 는 EGFR (p.L858R 또는 c.2573 T>G) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 34 를 타겟 서열로 할 수 있다.
서열번호 13 은 EGFR (p.L858R) 돌연변이를 검출할 수 있는 전환 돌연변이 가이드 RNA(transversion sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 35 를 타겟 서열로 할 수 있다. 서열번호 13 의 뉴클레오타이드 서열을 포함하는 가이드 RNA 를 이용하는 경우 1.7% 내지 63% 로 돌연변이 서열을 증폭시킬 수 있다.
서열번호 14 는 PIK3CA (p.E542K 또는 c.1624G>A) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 36 또는 37 을 타겟 서열로 할 수 있다.
서열번호 15 는 PIK3CA (p.E545? 또는 c.1633G>?) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 38 또는 39 를 타겟 서열로 할 수 있다.
서열번호 16 은 PIK3CA (p.H1047? 또는 c.3140A>?) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 40 또는 41 을 타겟 서열로 할 수 있다.
서열번호 17 은 PIK3CA (p.V600E 또는 c.1799T>A) 돌연변이를 검출할 수 있는 야생형 가이드 RNA(wild sgRNA) 로서, in vitro 절단 분석에 사용되는 경우 서열번호 42 또는 43 을 타겟 서열로 할 수 있다.
서열번호 18 은 EGFR (p.T790M 또는 c.2369C>T) 돌연변이를 검출할 수 있는 서열번호 1 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 19 는 EGFR (p.T790M 또는 c.2390 G>C) 돌연변이를 검출할 수 있는 서열번호 2 의 전환 돌연변이 가이드 RNA(transversion sgRNA)의 타겟 서열을 나타낸다.
서열번호 20 은 EGFR (p.C797S) 돌연변이를 검출할 수 있는 서열번호 3 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 21 은 EGFR (p.C797S) 돌연변이를 검출할 수 있는 서열번호 4 의 전환 돌연변이 가이드 RNA(transversion sgRNA)의 타겟 서열을 나타낸다.
서열번호 22 는 MET c.2888 Int13-Exon14 Acceptor (Exon-14 Skipping) 돌연변이를 검출할 수 있는 서열번호 5 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 23 은 MET c.2888 Int13-Exon14 Acceptor (Exon-14 Skipping) 돌연변이를 검출할 수 있는 서열번호 5 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 24 는 MET c.3028 Exon14-Int14 Donor (Exon-14 Skipping) 돌연변이를 검출할 수 있는 서열번호 6 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 25 는 MET c.3028 Exon14-Int14 Donor (Exon-14 Skipping) 돌연변이를 검출할 수 있는 서열번호 6 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 26 은 MET 'TAC' Y1003X (Exon-14 Skipping) 돌연변이를 검출할 수 있는 서열번호 7 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 27 은 MET 'TAC' Y1003X (Exon-14 Skipping) 돌연변이를 검출할 수 있는 서열번호 7 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 28 은 EGFR (L718Q 또는 c.2153 T> A) 돌연변이를 검출할 수 있는 서열번호 8 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 29 는 EGFR (L718Q) 돌연변이를 검출할 수 있는 서열번호 9 의 전환 돌연변이 가이드 RNA(transversion sgRNA)의 타겟 서열을 나타낸다.
서열번호 30 은 KRAS (c.35G) 돌연변이를 검출할 수 있는 서열번호 10 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 31 은 KRAS (c.35G) 돌연변이를 검출할 수 있는 서열번호 10 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 32 는 EGFR, 15bp Del p.(729_761) 돌연변이를 검출할 수 있는 서열번호 11 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 33 은 EGFR, 15bp Del p.(729_761) 돌연변이를 검출할 수 있는 서열번호 11 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 34 는 EGFR (p.L858R 또는 c.2573 T>G) 돌연변이를 검출할 수 있는 서열번호 12 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 35 는 EGFR (p.L858R) 돌연변이를 검출할 수 있는 서열번호 13 의 전환 돌연변이 가이드 RNA(transversion sgRNA)의 타겟 서열을 나타낸다.
서열번호 36 은 PIK3CA (p.E542K 또는 c.1624G>A) 돌연변이를 검출할 수 있는 서열번호 14 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 37 은 PIK3CA (p.E542K 또는 c.1624G>A) 돌연변이를 검출할 수 있는 서열번호 14 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 38 은 PIK3CA (p.E545? 또는 c.1633G>?) 돌연변이를 검출할 수 있는 서열번호 15 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 39 는 PIK3CA (p.E545? 또는 c.1633G>?) 돌연변이를 검출할 수 있는 서열번호 15 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 40 은 PIK3CA (p.H1047? 또는 c.3140A>?) 돌연변이를 검출할 수 있는 서열번호 16 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 41 은 PIK3CA (p.H1047? 또는 c.3140A>?) 돌연변이를 검출할 수 있는 서열번호 16 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 42 는 PIK3CA (p.V600E 또는 c.1799T>A) 돌연변이를 검출할 수 있는 서열번호 17 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.
서열번호 43 은 PIK3CA (p.V600E 또는 c.1799T>A) 돌연변이를 검출할 수 있는 서열번호 17 의 야생형 가이드 RNA(wild sgRNA)의 타겟 서열을 나타낸다.

Claims (17)

  1. CRISPR/Cas9 시스템에 이용되는 가이드 RNA(guide RNA) 로서,
    상기 가이드 RNA 는 야생형 무 세포 DNA 를 절단하는 것을 특징으로 하는 가이드 RNA.
  2. 제1항에 있어서, 상기 가이드 RNA는 서열번호 1 내지 17 로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것을 특징으로 하는 가이드 RNA.
  3. 제1항에 있어서, 상기 가이드 RNA 는 가이드 RNA 의 트렁크(trunk) 영역, 세미 시드(semi-seed) 영역 및 시드(seed) 영역으로 이루어진 군에서 선택되는 어느 하나 이상의 영역에서 전환 돌연변이(transversion mutation) 가 발생한 것을 특징으로 하는 가이드 RNA.
  4. 제3항에 있어서, 상기 가이드 RNA 는 서열번호 2, 서열번호 4, 서열번호 9 및 서열번호 13 으로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것을 특징으로 하는 가이드 RNA.
  5. 제1항에 있어서, 상기 가이드 RNA 는 EGFR, MET, KRAS, PIK3CA 및 BRAF 로 이루어진 군에서 선택되는 어느 하나 이상의 암 관련 돌연변이를 검출할 수 있는 것을 특징으로 하는 가이드 RNA.
  6. 제5항에 있어서, 상기 EGFR 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 1 내지 4, 8, 9 및 11 내지 13 으로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것을 특징으로 하는 가이드 RNA.
  7. 제5항에 있어서, 상기 MET 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 5 내지 7 로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것을 특징으로 하는 가이드 RNA.
  8. 제5항에 있어서, 상기 KRAS 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 10 의 뉴클레오타이드 서열을 포함하는 것을 특징으로 하는 가이드 RNA.
  9. 제5항에 있어서, 상기 PIK3CA 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 14 내지 16 으로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 것을 특징으로 하는 가이드 RNA.
  10. 제5항에 있어서, 상기 BRAF 돌연변이를 검출하는 경우, 상기 가이드 RNA 는 서열번호 17 의 뉴클레오타이드 서열을 포함하는 것을 특징으로 하는 가이드 RNA.
  11. 서열번호 1 내지 17 로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오타이드 서열을 포함하는 CRISPR/Cas9 의 가이드 RNA 를 포함하는 암 진단 또는 예후 예측용 조성물.
  12. 제11항에 있어서, 상기 가이드 RNA 는 가이드 RNA 의 트렁크(trunk) 영역, 세미 시드(semi-seed) 영역 및 시드(seed) 영역으로 이루어진 군에서 선택되는 어느 하나 이상의 영역에서 전환 돌연변이(transversion mutation) 가 발생한 것을 특징으로 하는 조성물.
  13. 제11항에 있어서, 상기 가이드 RNA 는 EGFR, MET, KRAS, PIK3CA 및 BRAF 로 이루어진 군에서 선택되는 어느 하나 이상의 암 관련 돌연변이를 검출할 수 있는 것을 특징으로 하는 조성물.
  14. 제11항에 있어서, 상기 가이드 RNA 는 야생형 무 세포 DNA 를 절단하는 것을 특징으로 하는 조성물.
  15. 제11항에 있어서, 상기 암은 폐암, 췌장암, 대장암, 위암, 유방암, 신장암, 간암, 혈액암, 방광암 및 자궁암 으로 이루어진 군에서 선택되는 어느 하나 이상의 암인 것을 특징으로 하는 조성물.
  16. 제11항의 조성물을 포함하는 암 진단 또는 예후 예측용 키트.
  17. 환자의 시료에 제11항의 조성물을 처리하는 단계를 포함하는 암 진단 또는 예후 예측을 위한 정보제공 방법.
PCT/KR2022/006665 2021-05-11 2022-05-10 발암성 돌연변이 유전자 검출용 가이드 rna 내지 이의 용도 WO2022240143A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2023571114A JP2024517984A (ja) 2021-05-11 2022-05-10 発がん突然変異遺伝子検出用ガイドｒｎａおよびその用途
CA3218653A CA3218653A1 (en) 2021-05-11 2022-05-10 Guide rna for detecting oncogenic mutant gene and use thereof
EP22807791.3A EP4339285A1 (en) 2021-05-11 2022-05-10 Guide rna for detecting oncogenic mutant gene and use thereof
AU2022273481A AU2022273481A1 (en) 2021-05-11 2022-05-10 Guide rna for detecting oncogenic mutant gene and use thereof
CN202280034885.XA CN117597445A (zh) 2021-05-11 2022-05-10 致癌性突变基因检测用向导rna及其用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210061037A KR102616916B1 (ko) 2021-05-11 2021-05-11 발암성 돌연변이 유전자 검출용 가이드 rna 내지 이의 용도
KR10-2021-0061037 2021-05-11

Publications (1)

Publication Number Publication Date
WO2022240143A1 true WO2022240143A1 (ko) 2022-11-17

Family

ID=84028603

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/006665 WO2022240143A1 (ko) 2021-05-11 2022-05-10 발암성 돌연변이 유전자 검출용 가이드 rna 내지 이의 용도

Country Status (7)

Country Link
EP (1) EP4339285A1 (ko)
JP (1) JP2024517984A (ko)
KR (1) KR102616916B1 (ko)
CN (1) CN117597445A (ko)
AU (1) AU2022273481A1 (ko)
CA (1) CA3218653A1 (ko)
WO (1) WO2022240143A1 (ko)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150322457A1 (en) * 2012-10-23 2015-11-12 Toolgen Incorporated Composition for cleaving a target dna comprising a guide rna specific for the target dna and cas protein-encoding nucleic acid or cas protein, and use thereof
KR20150138075A (ko) * 2014-05-28 2015-12-09 주식회사 툴젠 불활성화된 표적 특이적 뉴클레아제를 이용한 표적 dna의 분리 방법
KR20180041606A (ko) * 2016-10-14 2018-04-24 연세대학교 산학협력단 Kras 유전자에 상보적인 가이드 rna 및 이의 용도
KR20190095160A (ko) * 2018-02-06 2019-08-14 주식회사 진씨커 돌연변이 세포 유리 유전자 분리 키트 및 이를 이용한 돌연변이 세포 유리 유전자 분리 방법
KR20190113687A (ko) * 2018-03-27 2019-10-08 (주)지플러스 생명과학 가이드 rna 및 엔도뉴클레아제를 유효성분으로 포함하는 암 치료용 약학적 조성물
KR20210061037A (ko) 2019-11-19 2021-05-27 히즈케어스 주식회사 마비 장애인 일상생활 재활운동 서비스 시스템

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150322457A1 (en) * 2012-10-23 2015-11-12 Toolgen Incorporated Composition for cleaving a target dna comprising a guide rna specific for the target dna and cas protein-encoding nucleic acid or cas protein, and use thereof
KR20150138075A (ko) * 2014-05-28 2015-12-09 주식회사 툴젠 불활성화된 표적 특이적 뉴클레아제를 이용한 표적 dna의 분리 방법
KR20180041606A (ko) * 2016-10-14 2018-04-24 연세대학교 산학협력단 Kras 유전자에 상보적인 가이드 rna 및 이의 용도
KR20190095160A (ko) * 2018-02-06 2019-08-14 주식회사 진씨커 돌연변이 세포 유리 유전자 분리 키트 및 이를 이용한 돌연변이 세포 유리 유전자 분리 방법
KR20190113687A (ko) * 2018-03-27 2019-10-08 (주)지플러스 생명과학 가이드 rna 및 엔도뉴클레아제를 유효성분으로 포함하는 암 치료용 약학적 조성물
KR20210061037A (ko) 2019-11-19 2021-05-27 히즈케어스 주식회사 마비 장애인 일상생활 재활운동 서비스 시스템

Also Published As

Publication number Publication date
EP4339285A1 (en) 2024-03-20
JP2024517984A (ja) 2024-04-23
KR20220153436A (ko) 2022-11-18
CA3218653A1 (en) 2022-11-17
CN117597445A (zh) 2024-02-23
KR102616916B1 (ko) 2023-12-21
AU2022273481A1 (en) 2023-11-30

Similar Documents

Publication Publication Date Title
WO2015183025A1 (ko) 표적 특이적 뉴클레아제를 이용한 표적 dna의 민감한 검출 방법
WO2016076672A1 (ko) 유전체에서 유전자 가위의 비표적 위치를 검출하는 방법
WO2016195382A1 (ko) 바코드 서열을 포함하는 어댑터를 이용한 차세대 염기서열 분석 방법
WO2017122896A1 (ko) 수산생물전염병 원인바이러스의 판별 및 검출용 유전자 마커,및 이를 이용한 원인바이러스의 판별 및 검출 방법
WO2020027569A1 (ko) 피부 세포에서 IDE 유전자 프로모터의 CpG 메틸화 변화를 이용한 알츠하이머 질환 진단용 조성물 및 이의 이용
WO2020171573A1 (ko) 혈중 무세포 dna 기반 간암 치료 예후예측 방법
WO2020096248A1 (ko) 폐암 조직 내 세포 유래 돌연변이를 검출하기 위한 프로브 제조 및 검출 방법
WO2021075797A2 (ko) 특정 유전자의 cpg 메틸화 변화를 이용한 간암 진단용 조성물 및 이의 용도
Eberherr et al. Rescue of STAT3 function in hyper-IgE syndrome using adenine base editing
WO2017222248A1 (ko) 선천성 기능장애 진단용 조성물 및 이의 용도
WO2022240143A1 (ko) 발암성 돌연변이 유전자 검출용 가이드 rna 내지 이의 용도
WO2022075788A1 (ko) LINC01798 유전자의 CpG 메틸화 변화를 이용한 대장암, 직장암 또는 대장 선종 진단용 조성물 및 이의 용도
WO2017094941A1 (ko) 핵산의 혼합물을 포함하는 샘플에서 복제수 변이를 결정하는 방법
WO2021154009A1 (ko) 특정 유전자의 CpG 메틸화 변화를 이용한 방광암 진단용 조성물 및 이의 용도
WO2022097844A1 (ko) 유전자 복제수 변이 정보를 이용하여 췌장암 환자의 생존 예후를 예측하는 방법
WO2017007241A1 (ko) Parp 및 탄키라제 동시 저해제에 대한 감수성 결정 방법
WO2011059285A2 (ko) 지노타이핑 방법
WO2022216066A1 (ko) 암 환자의 예후 예측용 바이오마커 및 이의 용도
WO2018194280A1 (ko) SDC2(Syndecan 2) 유전자의 메틸화 검출방법
WO2022114732A1 (ko) Pcr 과정 동안 생성되는 가닥들의 정보를 연결하여 하나의 클러스터를 만들고, 생성된 가닥들의 생성 순서를 추적할 수 있는 방법
WO2020204297A1 (ko) 개인의 전이효소-접근가능한 염색질 시퀀싱 정보를 이용한 암 진단 마커 및 이의 용도
WO2023132626A1 (ko) 특정 유전자의 cpg 메틸화 변화를 이용한 전립선암 진단용 조성물 및 이의 용도
WO2020096247A1 (ko) 유방암 조직 내 세포 유래 돌연변이를 검출하기 위한 프로브 제조 및 검출 방법
WO2022039565A1 (ko) 연령 관련 황반변성 진단용 바이오마커 및 이의 용도
WO2019194640A1 (ko) 분자 인덱스된 바이설파이트 시퀀싱

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22807791

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 3218653

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 202280034885.X

Country of ref document: CN

Ref document number: 18560548

Country of ref document: US

Ref document number: 2023571114

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2022273481

Country of ref document: AU

Ref document number: 805587

Country of ref document: NZ

Ref document number: AU2022273481

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2022273481

Country of ref document: AU

Date of ref document: 20220510

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022807791

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022807791

Country of ref document: EP

Effective date: 20231211