WO2022231158A1 - 약물전달물질로서의 간세포암 특이적 표적 엑소좀 조성물 및 이의 용도 - Google Patents

약물전달물질로서의 간세포암 특이적 표적 엑소좀 조성물 및 이의 용도 Download PDF

Info

Publication number
WO2022231158A1
WO2022231158A1 PCT/KR2022/004966 KR2022004966W WO2022231158A1 WO 2022231158 A1 WO2022231158 A1 WO 2022231158A1 KR 2022004966 W KR2022004966 W KR 2022004966W WO 2022231158 A1 WO2022231158 A1 WO 2022231158A1
Authority
WO
WIPO (PCT)
Prior art keywords
hepatocellular carcinoma
stem cells
derived stem
adipose
present
Prior art date
Application number
PCT/KR2022/004966
Other languages
English (en)
French (fr)
Inventor
김세준
김옥희
Original Assignee
주식회사 서지넥스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 서지넥스 filed Critical 주식회사 서지넥스
Publication of WO2022231158A1 publication Critical patent/WO2022231158A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/51—Umbilical cord; Umbilical cord blood; Umbilical stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/001—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0667—Adipose-derived stem cells [ADSC]; Adipose stromal stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2509/00—Methods for the dissociation of cells, e.g. specific use of enzymes

Definitions

  • the present invention relates to a hepatocellular carcinoma-specific targeting exosome composition comprising exosomes transformed from a recombinant expression vector and uses thereof.
  • Hepatocellular carcinoma is a primary liver cancer that occurs in the liver. According to the 2014 national cancer registration statistics, it ranks sixth in the incidence rate among all cancers, but the 5-year survival rate is only 32.8%, so it is a cancer with a very high mortality compared to the incidence rate. In particular, in Asia, including Korea, where the hepatitis virus carrier rate is high, the incidence is high, and it is one of the cancers with a poor prognosis, with the second to third highest mortality compared to cancer, and prevention and early detection are important. The treatment of hepatocellular carcinoma is still a complex and difficult problem, because hepatocellular carcinoma expresses resistance genes for various drugs and shows low sensitivity to chemotherapy.
  • Exosomes are only 30-100 nm in size, but contain various substances such as proteins, nucleic acids, and lipids in original cells. They are nanoparticles secreted by our adipose-derived stem cells, such as immune cells or stem cells. . As the function of exosomes as an intercellular information carrier is known, it is attracting attention as a next-generation anticancer substance.
  • the present inventors have made intensive efforts to develop hepatocellular carcinoma-specific target extracellular vesicles as drug delivery materials. completed.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating hepatocellular carcinoma comprising the extracellular vesicles transformed with the recombinant expression vector.
  • Another object of the present invention is to (a) introducing a gene expressing a ligand that binds to a receptor of hepatocellular carcinoma into the gene expressed in the extracellular vesicles of adipose-derived stem cells; And (b) culturing the cell into which the gene is introduced in a medium to obtain an extracellular vesicle; to provide a method for producing an expression vector for preventing or treating hepatocellular carcinoma, comprising.
  • One aspect of the present invention provides a recombinant expression vector in which a gene for expressing a ligand that binds to a receptor of hepatocellular carcinoma is inserted into a gene expressed in the extracellular vesicles of stem cells.
  • the "expression vector" in the present invention may be selected from the group consisting of a linear DNA vector, a plasmid DNA vector, and a recombinant viral vector, but is not limited thereto, and all conventional vectors used for transformation in the art are the present invention. can be used in the method of In one embodiment of the present invention, the expression vector may be a pDisplay vector.
  • ligand refers to a substance that is inserted into a gene expressed in the extracellular vesicles of stem cells and binds to the receptors of hepatocellular carcinoma cells when expressed in the extracellular vesicles.
  • the ligand may be one represented by the nucleotide sequence of SEQ ID NO: 1.
  • another aspect of the present invention provides a pharmaceutical composition for preventing or treating hepatocellular carcinoma comprising the extracellular vesicles transformed with the recombinant expression vector.
  • extracellular vesicle refers to a small sphere surrounded by a membrane derived from a cell
  • the extracellular vesicle is an extracellular vesicle derived from a natural system, such as a plant, animal, microorganism, or an artificially produced extracellular vesicle. It may be an endoplasmic reticulum.
  • the cell may be a cell isolated from a living organism in nature.
  • the "extracellular vesicle” may be an exosome, an ectosome, or a microvesicle, but in one embodiment of the present invention, the "extracellular vesicle” may be an exosome.
  • exosome refers to a small vesicle with a membrane structure secreted from various cells, and refers to a vesicle that is released into the extracellular environment due to fusion of the polycystic body and the plasma membrane.
  • the exosome may be derived or isolated from adipose-derived stem cells.
  • the exosome may have a diameter of 50 to 150 nm.
  • the exosome may be included at a concentration of 1 to 50 ⁇ L/ml.
  • stem cells refers to cells of various origins as pluripotent cells that can be differentiated into various tissue cells when appropriate conditions are met in an undifferentiated state.
  • the stem cells may be bone marrow-derived stem cells, cord blood-derived stem cells or adipose-derived stem cells.
  • the stem cells may be adipose-derived stem cells.
  • the bone marrow-derived stem cells, cord blood-derived stem cells or adipose-derived stem cells may be human or animal-derived stem cells.
  • Adipose-derived stem cells in the present invention are stem cells derived from adipose tissue, and refer to cells with pluripotency and self-renewal capacity, and the adipose-derived stem cells of the present invention are obtained through liposuction and various surgical procedures. can, but is not limited thereto.
  • the exosome is transformed to express a ligand that binds to a receptor of a hepatocellular carcinoma in a gene expressed as an exosome of a host cell, such as stem cells, to act as a target on hepatocellular carcinoma cells.
  • the exo-some may be additionally equipped with a self-assembly.
  • Self-assembly in the present invention is a material that exists as several small peptides and combines with each other under certain conditions to form hard polymers.
  • the self-assembly formed in nano size can interact with cells to adjust the survival rate of cells.
  • the "self-assembly” may be Mito-FF, and the “Mito-FF” may be a self-assembly that targets mitochondria.
  • another aspect of the present invention comprises the steps of (a) introducing a gene expressing a ligand that binds to a receptor of hepatocellular carcinoma into a gene expressed in the extracellular vesicles of adipose-derived stem cells; and (b) culturing the cells into which the gene is introduced in a medium to obtain an extracellular vesicle;
  • extracellular vesicle in the present invention may be an exosome, an ectosome or a microvesicle, but in one embodiment of the present invention, the "extracellular vesicle” may be an exosome have.
  • “Medium” in the present invention may be an adipose-derived stem cell culture medium.
  • the adipose-derived stem cell culture medium may be a medium with FBS-Free DMEM low glucose.
  • prevention refers to any action that suppresses or delays the onset of hepatocellular carcinoma by administration of the pharmaceutical composition according to the present invention.
  • Treatment in the present invention means any action in which symptoms for hepatocellular carcinoma are improved or beneficially changed by administration of the pharmaceutical composition according to the present invention.
  • hepatocellular carcinoma refers to a primary liver cancer occurring in the liver as a cancer occurring in the liver cells themselves.
  • the liver cancer refers to all types of malignant tumors occurring in the liver, and may be hepatocellular carcinoma (HCC), selected from the group consisting of hepatoblastoma, cholangiocarcinoma, cholangiocarcinoma, or liver cancer generated from viral infection. It may be one or more cancers. Hepatocellular carcinoma is the most important histological subtype, accounting for 70-85% of primary liver cancers.
  • exosomes can be used as drug delivery materials to selectively bind to hepatocellular carcinoma cells, which are target cells, and thus act specifically for hepatocellular carcinoma. Therefore, the target exosomes can be applied in the field of hepatocellular carcinoma treatment, in particular, as a clinical application technology.
  • 1 is a schematic diagram showing the binding of exosomes to cancer cells, which are target cells, by expressing a targeting ligand in the exosomes through an expression vector.
  • 2A is a vector configuration in pDisplay for expression of the recombinant protein of the present invention
  • B is a diagram showing aspects according to the expression of the vector.
  • Figure 3 is the result of confirming the peptide expression as the expression of the exosome marker CD9 and Myc-taq protein after introduction of the expression vector of the present invention.
  • the horizontal axis means processing capacity ( ⁇ L/ml)
  • the vertical axis means relative density.
  • the horizontal axis means processing capacity ( ⁇ L/ml)
  • the vertical axis means relative density.
  • the horizontal axis means processing capacity ( ⁇ L/ml)
  • the vertical axis means relative density.
  • H&E Hematoxylin & eosin
  • the exosomes were extracted using adipose-derived stem cells.
  • adipose-derived stem cells were used as donor cells for producing target exosomes, immune cells such as NK cells are also possible, so the present invention is not limited thereto.
  • Adipose-derived stem cells were transduced with a nucleotide sequence (TCATTTAGTATAATACACACGCCTATACTCCCGCTC) encoding a liver cancer cell target ligand in a pDisplay vector (invitrogen) using a transfection reagent (lipofectamine, invitrogen) according to the manufacturer's instructions. After cloning the vector, the result of cloning the vector was confirmed (FIG. 2), and a target exosome was prepared by inserting it into adipose-derived stem cells.
  • adipose-derived stem cells were treated in DMEM low glucose medium supplemented with 10% FBS (inactivated fetal bovine serum) and 1% P/S (penicillin-streptomycin) at 37°C, 5% CO 2 condition. incubated with 10% FBS (inactivated fetal bovine serum) and 1% P/S (penicillin-streptomycin) at 37°C, 5% CO 2 condition. incubated with
  • the medium was exchanged with FBS-Free DMEM low glucose, and after 24 hours after the medium exchange, the culture medium of adipose-derived stem cells was removed and centrifuged at 1000 rpm by differential centrifugation method. Cells were removed.
  • Hepatocellular carcinoma target exosomes were obtained from the culture medium from which the cells were removed according to the manufacturer's instructions using a thermo exosome extraction kit (Thermo fisher scientific).
  • a plasmid capable of mounting a hepatocellular carcinoma target marker on the exosome surface of adipose-derived stem cells was introduced. Accordingly, it was confirmed that the peptide was expressed by the expression of the exosome markers CD9 and Myc-taq protein (FIG. 3). ).
  • Neon invitrogen
  • the mitochondrial target mito-FF was transformed into the target exosome using electroporation.
  • Targetable exosomes were additionally prepared.
  • Example 2 Efficacy evaluation of adipose-derived stem cell-derived target exosomes in HepG2, a liver cancer cell line
  • each exosome composition was added to the liver cancer cell lines HepG2, Hep3B and Huh7 0, 5 , by comparing the expression level of Myeloid cell leukemia 1 (Mcl-1), an anti-apoptotic factor involved in the apoptosis mechanism, treated at doses of 12.5, 25, and 50 ⁇ L/ml, was observed ( FIGS. 4 to 6 ).
  • Mcl-1 Myeloid cell leukemia 1
  • Mcl-1 was reduced in the adipose-derived stem cell-derived liver cancer target exosome cloned with the recombinant vector according to the present invention. It was confirmed that the expression level was decreased, and it was confirmed that the expression of the adipose-derived stem cell-derived exosome Mcl-1 was decreased compared to the adipose-derived stem cell exosome compared to the adipose-derived stem cell exosome cloned with the adipose-derived stem cell-derived liver cancer target exo.
  • Example 3 Efficacy evaluation of adipose-derived stem cell-derived target exosomes using an animal model of liver cancer following transplantation of the liver cancer cell line Huh7
  • Example 4 Efficacy evaluation of adipose-derived stem cell-derived target exosomes using an animal model of liver cancer following transplantation of the liver cancer cell line Huh7
  • Example 5 Evaluation of histological characteristics of adipose-derived stem cell-derived target exosomes using an animal model of liver cancer
  • liver cancer cell line Huh7 was transplanted into BALB/C Nude mice (in vivo) at 5x10 5 .
  • the purpose of this study was to determine the changes in the histological characteristics of hepatocellular carcinoma using adipose-derived stem cell-derived exosomes.
  • Mito-FF mounted exosomes (Exo + Mito) and Mito-FF mounted target exosomes (T-Exo + Mito) were injected into the constructed tumor model for 2 weeks in a tail vein injection method, then mice were sacrificed and the Hematoxylin & eosin (H&E) staining was performed on the lesion tissue, and histological changes according to the delivery of each exosome were observed (FIG. 10).
  • H&E Hematoxylin & eosin

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Reproductive Health (AREA)
  • Physics & Mathematics (AREA)
  • Rheumatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 줄기세포의 세포외소포체로 발현되는 유전자 내에 간세포암 세포의 수용체와 결합하는 리간드를 발현시키는 유전자가 삽입된 재조합 발현벡터, 상기 발현벡터로 형질전환된 세포외소포체를 포함하는 약학적 조성물 및 간세포암 예방 또는 치료용 발현벡터 제조방법에 대한 것으로, 본 발명은 세포외소포체로서 엑소좀을 약물전달물질로서 활용하여 표적 세포인 간세포암 세포에 선별적으로 결합하여 간세포암을 표적으로 특이적 작용이 가능한 이점이 있다.

Description

약물전달물질로서의 간세포암 특이적 표적 엑소좀 조성물 및 이의 용도
본 발명은 재조합 발현벡터로부터 형질전환된 엑소좀을 포함하는 간세포암 특이적 표적 엑소좀 조성물 및 이의 용도에 관한 것이다.
간세포암은 간에서 발생하는 원발성 간암으로 2014년 국가 암 등록 통계에 따르면 전체 암 중 발생률이 6위에 해당되나 5년 생존율은 32.8%에 불과하여 발생빈도 대비 사망률이 매우 높은 암에 해당한다. 특히 간염 바이러스 보균율이 높은 우리나라를 포함한 아시아권에서는 발생 빈도가 높을 뿐만 아니라, 암 발생대비 2~3위의 사망률을 나타낼 정도로 예후가 불량한 암 중의 하나로 예방과 조기 발견이 중요하다는 특징이 있다. 이러한　간세포암의　치료는 복합적으로 여전히 어려운 문제이며, 이는 간세포암이 다양한 약물의 내성 유전자를 발현하고 있고 화학요법치료에도 낮은 민감도를 나타냄에 기인한다.
엑소좀은 그 크기가 30-100nm에 불과하지만, 원세포에 들어있는 단백질, 핵산, 지질 등 여러 물질을 포함하고 있는 물질로서, 면역세포나 줄기세포 등 우리 지방유래줄기세포가 분비하는 나노입자이다. 엑소좀의 세포간 정보 전달체 역할을 하는 기능이 알려지면서 차세대 항암물질로 주목받고 있다.
이에, 본 발명자들은 약물전달물질로서의 간세포암 특이적 표적 세포외소포체를 개발하기 위하여 예의 노력한 결과, 지방유래줄기세포로부터 추출된 엑소좀이 간세포암 표적 항암제의 기능이 있음을 확인함으로써, 본 발명을 완성하였다.
본 발명의 목적은 줄기세포의 세포외소포체로 발현되는 유전자 내에 간세포암 세포의 수용체와 결합하는 리간드를 발현시키는 유전자가 삽입된 재조합 발현벡터를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 재조합 발현벡터로 형질전환된 세포외소포체를 포함하는 간세포암의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 (a) 지방유래줄기세포의 세포외소포체로 발현되는 유전자 내에 간세포암 세포의 수용체와 결합하는 리간드를 발현시키는 유전자를 도입하는 단계; 및 (b) 상기 유전자가 도입된 세포를 배지에서 배양하여 세포외소포체를 수득하는 단계;를 포함하는 간세포암 예방 또는 치료용 발현벡터 제조방법을 제공하는 것이다.
본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
본 발명의 일 측면은 줄기세포의 세포외소포체로 발현되는 유전자 내에 간세포암 세포의 수용체와 결합하는 리간드를 발현시키는 유전자가 삽입된 재조합 발현벡터를 제공한다.
본 발명에서의 "발현벡터"는 선형 DNA 벡터, 플라스미드 DNA 벡터 및 재조합 바이러스 벡터로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아니며 당업계에서 형질전환을 위해 사용되는 통상적인 벡터들은 모두 본 발명의 방법에 사용될 수 있다. 본 발명의 일 구체예에 있어서, 상기　발현벡터는 pDisplay 벡터일 수 있다.
본 발명에서의 "리간드"는 줄기세포의 세포외소포체로 발현되는 유전자 내에 내에 삽입되어 세포외소포체로 발현 시 간세포암 세포의 수용체와 결합하는 물질을 의미한다. 바람직하게, 상기 리간드는 서열번호 1의 염기서열로 표시되는 것일 수 있다.
또한, 본 발명의 또 다른 측면은 상기 재조합 발현벡터로 형질전환된 세포외소포체를 포함하는 간세포암의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에서의 "세포외소포체"는 세포에서 유래되는 막으로 둘러싸인 작은 구체를 의미하는 것으로, 상기 세포외소포체는 자연계, 예컨대 식물, 동물, 미생물로부터 유래된 세포외 소포체 또는 인공적으로 제조된 세포외소포체일 수 있다. 또한, 상기 세포는 자연계 생물 개체로부터 분리된 세포인 것일 수 있다.
상기 "세포외소포체"는 엑소좀(exosome), 엑토솜(ectosome) 또는 미세소포(microvesicle)일 수 있으나, 본 발명의 일 구체예에 있어서, 상기 "세포외소포체"는 엑소좀일 수 있다.
본 발명에서의 "엑소좀"은 다양한 세포들로부터 분비되는 막 구조의 작은 소낭으로서, 다낭체와 원형질막의 융합이 일어나 세포 밖 환경으로 방출되는 소낭을 의미한다. 본 발명의 일 구체예에 있어서, 상기　엑소좀은 지방유래줄기세포로부터 유래 또는 분리한 것일 수 있다.
본 발명의 일 구체예에 있어서, 상기　엑소좀은 50 내지 150 nm의 직경을 갖는 것일 수 있다. 또한, 상기 엑소좀은 1 내지 50 μL/ml의 농도로 포함될 수 있다.
본 발명에서의 "줄기세포(stem cells)"는 미분화 상태에서 적절한 조건을 맞춰주면 다양한 조직 세포로 분화될 수 있는 만능세포로서 다양한 유래의 세포를 의미한다.
상기 줄기세포는 골수유래줄기세포, 제대혈유래줄기세포 또는 지방유래줄기세포일 수 있다. 본 발명의 일 구체예에 있어서, 상기　줄기세포는 지방유래줄기세포일 수 있다. 또한, 상기 골수유래줄기세포, 제대혈유래줄기세포 또는 지방유래줄기세포는 인체 또는 동물유래 줄기세포인 것일 수 있다.
본 발명에서의 "지방유래줄기세포"는 지방 조직으로부터 유래한 줄기세포로서, 다분화능 및 자기증식능을 가진 세포를 의미하며, 본 발명의 지방유래줄기세포는 지방흡입술 및 다양한 외과적 수술을 통해 수득할 수 있으나, 이에 한정되지 않는다.
본 발명의 일 구체예에 있어서, 상기　엑소좀은 줄기세포 등 호스트세포의 엑소좀으로 발현하는 유전자 내에 간세포암 세포의 수용체와 결합하는 리간드를 발현시키도록 형질전환되어 간세포암 세포에 표적으로 작용할 수 있는 것을 의미한다.
또한, 본 발명의 일 구체예에 있어서, 상기 엑소좀은 자기조립체를 추가로 장착한 것일 수 있다.
본 발명에서의 "자기조립체"는 작은 여러 개의 펩타이드로서 존재하다가 특정 조건 하에서 상호 결합하여 단단한 polymers를 형성하는 물질로서, 나노 크기로 형성된 자기조립체는 세포와 상호작용하여 세포의 생존율을 조정할 수 있다. 본 발명의 일 구체예에 있어서, 상기 "자기조립체"는 Mito-FF일 수 있으며, 상기 "Mito-FF"는 미토콘드리아를 표적으로 하는 자기조립체일 수 있다.
또한, 본 발명의 또 다른 측면은 (a) 지방유래줄기세포의 세포외소포체로 발현되는 유전자 내에 간세포암 세포의 수용체와 결합하는 리간드를 발현시키는 유전자를 도입하는 단계; 및 (b) 상기 유전자가 도입된 세포를 배지에서 배양하여 세포외소포체를 수득하는 단계;를 포함하는 간세포암 예방 또는 치료용 발현벡터 제조방법을 제공한다.
본 발명에서의 "세포외소포체"는 엑소좀(exosome), 엑토솜(ectosome) 또는 미세소포(microvesicle)일 수 있으나, 본 발명의 일 구체예에 있어서, 상기 "세포외소포체"는 엑소좀일 수 있다.
본 발명에서의 "배지"는 지방유래줄기세포 배양배지인 것일 수 있다. 본 발명의 일 구체예에 있어서, 상기 지방유래줄기세포 배양배지는 FBS-Free DMEM low glucose로 배지일 수 있다.
본 발명에서의 “예방”은 본 발명에 따른 약학적 조성물의 투여에 의해 간세포암을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.
본 발명에서의 “치료”는 본 발명에 따른 약학적 조성물의 투여에 의해 간세포암에 대한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에서의 "간세포암"은 간세포 자체에서 발생하는 암으로 간에서 발생하는 원발성 간암을 의미한다. 한편, 상기 간암은 간에 발생하는 모든 종류의 악성 종양을 의미하며 간세포암(Hepatocellular carcinoma, HCC)일 수 있으며, 간모세포종, 담관암종, 담관세포 낭샘암종 또는 바이러스 감염으로부터 생성되는 간암으로 이루어지는 군에서 선택되는 하나 이상의 암일 수 있다. 간세포암은 일차 간암의 70 내지 85%에 해당하는 가장 주요한 조직학적 하위 유형에 해당한다.
본 발명의 줄기세포의 세포외소포체로 발현되는 유전자 내에 간세포암 세포의 수용체와 결합하는 리간드를 발현시키는 유전자가 삽입된 재조합 발현벡터, 상기 발현벡터로 형질전환된 세포외소포체를 포함하는 약학적 조성물은 세포외소포체로서 엑소좀을 약물전달물질로서 활용하여 표적 세포인 간세포암 세포에 선별적으로 결합하여 간세포암에 특이적으로 작용할 수 있다. 따라서, 상기 표적 엑소좀은 간세포암 치료 분야, 특히 임상적 적용 기술로 응용될 수 있다.
도 1은 발현벡터를 통하여 엑소좀에 타겟팅 리간드를 발현시켜 표적 세포인 암세포에 엑소좀이 결합하는 모습을 나타낸 모식도이다.
도 2의 A는 본 발명의 재조합 단백질의 발현을 위한 pDisplay에서의 벡터 구성이고, B는 벡터의 발현에 따른 양상을 나타낸 것이다.
도 3은 본 발명의 발현벡터 도입 이 후, 엑소좀 마커인 CD9및 Myc-taq protein의 발현으로서 펩타이드 발현을 확인한 결과이다.
도 4는 간암세포주인 HepG2에서의 지방유래줄기세포 유래 표적 엑소좀에 의한 Mcl-1의 발현 수준을 확인한 결과이다. 하단 그래프의 가로축은 처리용량(μL/ml)을, 세로축은 Relative density을 의미한다.
도 5는 간암세포주인 Hep3B 에서의 지방유래줄기세포 유래 표적 엑소좀에 의한 Mcl-1의 발현 수준을 확인한 결과이다. 하단 그래프의 가로축은 처리용량(μL/ml)을, 세로축은 Relative density을 의미한다.
도 6은 간암세포주인 Huh7에서의 지방유래줄기세포 유래 표적 엑소좀에 의한 Mcl-1의 발현 수준을 확인한 결과이다. 하단 그래프의 가로축은 처리용량(μL/ml)을, 세로축은 Relative density을 의미한다.
도 7은 BALB/C Nude mouse에 간암세포주인 Huh7을 이식한 간암 동물 모델에서의 PCNA, Mcl-1, Bcl-xL 및 Bax의 발현 수준을 확인한 결과이다.
도 8은 BALB/C Nude mouse에 간암세포주인 Huh7을 이식한 간암 동물 모델에서의 PCNA, Mcl-1, Bcl-xL 및 Bax의 발현 수준을 확인한 결과이다.
도 9는 BALB/C Nude mouse에 간암세포주인 Huh7을 이식한 간암 동물 모델에서의 Mcl-1 및 Bcl-xL의 발현 수준을 확인한 결과이다. 그래프의 세로축은 Relative density을 의미한다.
도 10은 BALB/C Nude mouse에 간암세포주인 Huh7을 이식한 간암 동물 모델에서의 Hematoxylin & eosin (H&E) 염색을 실시한 결과를 나타낸 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1. 지방유래줄기세포 유래의　표적 엑소좀　제작 및 확인
본 발명의 간세포암에 특이적으로 작용하는 표적 엑소좀을 제작하기 위하여 지방유래줄기세포를 사용하여 엑소좀을 추출하였다. 참고적으로, 본 발명에서는 표적 엑소좀을 생산하기 위한 donor cells로서 지방유래줄기세포를 사용하였지만, NK세포와 같은 면역세포도 가능하므로, 이에 한정하지 않는다.
지방유래줄기세포를 제조사의 지침에 따라 형질감염시약(lipofectamine, invitrogen)을 사용하여 pDisplay 벡터(invitrogen)에 간암세포 표적 리간드를 인코딩하는 염기서열(TCATTTAGTATAATACACACGCCTATACTCCCGCTC)로 형질도입(transduction)시켰다. 상기 벡터를 클로닝한 후 해당 벡터가 클로닝된 결과를 확인하였으며(도 2), 지방유래줄기세포에 삽입하여 표적 엑소좀을 제작하였다.
제작된 표적 엑소좀을 추출하기 위하여 지방유래줄기세포를 10% FBS(inactivated fetal bovine serum) 및 1% P/S(penicillin-streptomycin)을 첨가한 DMEM low glucose 배지에서 37℃, 5% CO2조건으로 배양하였다.
24시간 경과 후 상기 배지를 FBS-Free DMEM low glucose로 배지를 교환하였으며, 배지 교환 후 24시간 경과 후 지방유래줄기세포의 배양 배지를 걷어 분별원심분리(differential centrifugation) 방법으로 1000rpm조건으로 원심분리하여 세포를 제거하였다.
상기 세포가 제거된 배양 배지를 thermo exosome 추출 kit(Thermo fisher scientific)을 사용하여 제조사의 지침에 따라 간세포암 표적 엑소좀을 확보하였다.
한편, 지방유래줄기세포의 엑소좀 표면에 간세포암 표적 마커를 장착할 수 있는 플라스미드를 도입하였으며, 이에 따라 엑소좀 마커인 CD9 및 Myc-taq protein의 발현으로 펩타이드가 발현된 것을 확인하였다(도 3).
여기에, 상기 과정을 통하여 확보한 표적 엑소좀에 Neon(invitrogen)을 사용하여 미토콘드리아 표적 mito-FF를 전기천공법(electroporation)을 사용하여 표적 엑소좀 내에 형질전환하였으며 이를 통해 간암 및 미토콘드리아 모두에 이중 표적이 가능한 엑소좀을 추가적으로 제작하였다.
실시예 2. 간암세포주인 HepG2에서의 지방유래줄기세포 유래 표적 엑소좀의 효능 평가
지방유래줄기세포 유래 엑소좀 대비 본 발명에 따른 재조합 벡터가 클로닝된 지방유래줄기세포 유래 간암 표적 엑소좀의 항암 효능을 평가하기 위하여 간암세포주인 HepG2, Hep3B 및 Huh7에 각 엑소좀 조성물을 0, 5, 12.5, 25, 50 μL/ml의 용량으로 처리하고 세포사멸 기전에 관여하는 항-세포사멸 인자(anti-apoptotic factor)인 Mcl-1(Myeloid cell leukemia 1)의 발현 수준을 비교함으로써, 변화를 관찰하였다(도 4 내지 도 6).
그 결과, 도 4 내지 도 6에 나타낸 바와 같이, 저농도 보다 고농도에서 또한, 지방유래줄기세포 유래 엑소좀 대비 본 발명에 따른 재조합 벡터가 클로닝된 지방유래줄기세포 유래 간암 표적 엑소좀에서 Mcl-1의 발현 수준이 감소하는 것을 확인할 수 있었으며, 저농도 처리시에도 지방유래줄기세포 엑소좀 대비 본 발명에 따른 재조합 벡터가 클로닝된 지방유래줄기세포 유래 간암 표적 엑소좀 Mcl-1의 발현이 감소되는 경향을 확인할 수 있었다.
실시예 3. 간암세포주 Huh7 이식에 따른 간암 동물 모델을 이용한 지방유래줄기세포 유래 표적 엑소좀의 효능 평가
BALB/C Nude mouse(in vivo)에 간암세포주인 Huh7을 5x105으로 이식하여 간암을 유도한 뒤, 지방유래줄기세포 유래　엑소좀을 이용한 간세포암의 치료 효능을 확인하고자 하였다. 엑소좀(Exo), 표적 엑소좀(T-Exo), Mito-FF 장착 엑소좀(Exo+Mito) 및 Mito-FF 장착 표적 엑소좀(T-Exo+Mito) 각각을 상기 구축된 종양모델에 Tail vein injection 방식으로 2주간 주입한 후, 마우스를 희생하여 간암의 항 종양효과에 엑소좀이 미치는 영향을 확인하였다.
그 결과, 세포증식마커인 PCNA의 발현이 엑소좀(Exo), 표적 엑소좀(T-Exo), Mito-FF 장착 엑소좀(Exo+Mito) 및 Mito-FF 장착 표적 엑소좀(T-Exo+Mito) 순으로 유의하게 감소함을 알 수 있었다(도 7 및 도 8).
또한, 도 7 및 도 8에 나타낸 바와 같이, 표적 엑소좀(T-Exo)가 첨가된 군에서 항-세포사멸 인자(anti-apoptotic factor)인 Mcl-1(Myeloid cell leukemia 1) 및 Bcl-xL(B-cell lymphoma-extra large)의 발현이 감소하고, 전-세포사멸 인자(pro-apoptotic factor)인　Bax(Bcl-2-associated X protein)의 수준은 증가하는 것을 알 수 있었다.
실시예 4. 간암세포주 Huh7 이식에 따른 간암 동물 모델을 이용한 지방유래줄기세포 유래 표적 엑소좀의 효능 평가
BALB/C Nude mouse(in vivo)에 간암세포주인 Huh7을 5x105으로 이식하여 간암을 유도한 뒤, 지방유래줄기세포 유래　엑소좀을 이용한 간세포암의 치료 효능을 확인하고자 하였다. 엑소좀(Exo), 표적 엑소좀(T-Exo), Mito-FF 장착 엑소좀(Exo+Mito) 및 Mito-FF 장착 표적 엑소좀(T-Exo+Mito) 각각을 상기 구축된 종양모델에 Tail vein injection 방식으로 2주간 주입한 후, 마우스를 희생하여 간암의 항 종양효과에 엑소좀이 미치는 영향을 확인하였다(도 9).
그 결과, 도 9에 나타낸 바와 같이, 본 발명의 표적 엑소좀(T-Exo)이 첨가된 군에서 항-세포사멸 인자(anti-apoptotic factor)인 Mcl-1(Myeloid cell leukemia 1) 및 Bcl-xL(B-cell lymphoma-extra large)의 발현이 감소됨을 확인할 수 있었고, 특히, Mito-FF 장착 표적 엑소좀(T-Exo+Mito)에서 Mcl-1 및 Bcl-xL의 발현이 가장 억제됨을 확인할 수 있었다.
실시예 5. 간암 동물 모델을 이용한 지방유래줄기세포 유래 표적 엑소좀의 조직학적 특징 평가
BALB/C Nude mouse(in vivo)에 간암세포주인 Huh7을 5x105으로 이식하여 간암을 유도한 뒤, 지방유래줄기세포 유래　엑소좀을 이용한 간세포암의 조직학적 특징 변화를 확인하고자 하였다.
Mito-FF 장착 엑소좀(Exo+Mito) 및 Mito-FF 장착 표적 엑소좀(T-Exo+Mito) 각각을 상기 구축된 종양모델에 Tail vein injection 방식으로 2주간 주입한 후, 마우스를 희생하고 상기 병변 조직에 대하여 Hematoxylin & eosin (H&E) 염색을 실시하여, 상기 각　엑소좀의 전달에 따른 조직학적 변화를 관찰하였다(도 10).
그 결과, 도 10에 나타낸 바와 같이, 구축된 간암모델에 Mito-FF 장착 표적 엑소좀(T-Exo+Mito)에 의한 항종양 효과가 더 크게 나타나는 경향을 확인할 수 있었다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.

Claims (10)

  1. 줄기세포의 세포외소포체로 발현되는 유전자 내에 간세포암 세포의 수용체와 결합하는 리간드를 발현시키는 유전자가 삽입된 재조합 발현벡터.
  2. 제1항에 있어서, 상기 간세포암 세포의 수용체와 결합하는 리간드는 서열번호 1의 염기서열로 표시되는 재조합 발현벡터.
  3. 제1항의 재조합 발현벡터로 형질전환된 세포외소포체를 포함하는 간세포암의 예방 또는 치료용 약학적 조성물.
  4. 제3항에 있어서, 상기 세포외소포체는 엑소좀인 것을 특징으로 하는 간세포암의 예방 또는 치료용 약학적 조성물.
  5. 제4항에 있어서, 상기 엑소좀은 자기조립체를 추가로 장착한 것을 특징으로 하는 간세포암의 예방 또는 치료용 약학적 조성물.
  6. 제4항에 있어서, 상기 상기　엑소좀은 1 내지 50 μL/ml의 농도로 포함되는 것을 특징으로 하는 간세포암의 예방 또는 치료용 약학적 조성물.
  7. 제1항에 있어서, 상기 줄기세포는 골수유래줄기세포, 제대혈유래줄기세포 또는 지방유래줄기세포인 것을 특징으로 하는 간세포암의 예방 또는 치료용 약학적 조성물.
  8. 제7항에 있어서, 상기 골수유래줄기세포, 제대혈유래줄기세포 또는 지방유래줄기세포는 인체 또는 동물유래 줄기세포인 것을 특징으로 하는 간세포암의 예방 또는 치료용 약학적 조성물.
  9. (a) 지방유래줄기세포의 세포외소포체로 발현되는 유전자 내에 간세포암 세포의 수용체와 결합하는 리간드를 발현시키는 유전자를 도입하는 단계; 및
    (b) 상기 유전자가 도입된 세포를 배지에서 배양하여 세포외소포체를 수득하는 단계;를 포함하는 간세포암 예방 또는 치료용 발현벡터 제조방법.
  10. 제9항에 있어서, 상기 세포외소포체는 엑소좀인 것을 특징으로 하는 간세포암 예방 또는 치료용 발현벡터 제조방법.
PCT/KR2022/004966 2021-04-29 2022-04-06 약물전달물질로서의 간세포암 특이적 표적 엑소좀 조성물 및 이의 용도 WO2022231158A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0055791 2021-04-29
KR1020210055791A KR20220148567A (ko) 2021-04-29 2021-04-29 약물전달물질로서의 간세포암 특이적 표적 엑소좀 조성물 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2022231158A1 true WO2022231158A1 (ko) 2022-11-03

Family

ID=83847032

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/004966 WO2022231158A1 (ko) 2021-04-29 2022-04-06 약물전달물질로서의 간세포암 특이적 표적 엑소좀 조성물 및 이의 용도

Country Status (2)

Country Link
KR (1) KR20220148567A (ko)
WO (1) WO2022231158A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240000385A (ko) 2022-06-17 2024-01-02 주식회사 일리아스바이오로직스 슈퍼-리프레서(super-repressor, SR)-IκB(srIκB)를 포함하는 엑소좀의 간질환에 대한 치료적 용도

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120002942A (ko) * 2010-07-01 2012-01-09 포항공과대학교 산학협력단 세포의 원형질체에서 유래한 마이크로베시클 및 이의 용도
KR20120084900A (ko) * 2011-01-21 2012-07-31 광주과학기술원 외막소포체를 유효성분으로 포함하는 항암용 약제학적 조성물
KR20190019872A (ko) * 2017-08-17 2019-02-27 주식회사 셀렉스라이프사이언스 표적특이적으로 물질을 전달하는 엑소좀의 제조방법 및 상기 방법으로 제조된 엑소좀
WO2019213706A1 (en) * 2018-05-08 2019-11-14 Deakin University Extracellular vesicle-based drug-delivery
WO2020082005A2 (en) * 2018-10-19 2020-04-23 Ohio State Innovation Foundation Extracellular vesicles for targeted therapies against myeloid-derived suppressor cells
US20200208157A1 (en) * 2016-04-06 2020-07-02 Ohio State Innovation Foundation Rna ligand-displaying exosomes for specific delivery of therapeutics to cell by rna nanotechnology

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101662975B1 (ko) 2016-02-15 2016-10-06 서울대학교산학협력단 간암 치료 또는 예방용 조성물

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120002942A (ko) * 2010-07-01 2012-01-09 포항공과대학교 산학협력단 세포의 원형질체에서 유래한 마이크로베시클 및 이의 용도
KR20120084900A (ko) * 2011-01-21 2012-07-31 광주과학기술원 외막소포체를 유효성분으로 포함하는 항암용 약제학적 조성물
US20200208157A1 (en) * 2016-04-06 2020-07-02 Ohio State Innovation Foundation Rna ligand-displaying exosomes for specific delivery of therapeutics to cell by rna nanotechnology
KR20190019872A (ko) * 2017-08-17 2019-02-27 주식회사 셀렉스라이프사이언스 표적특이적으로 물질을 전달하는 엑소좀의 제조방법 및 상기 방법으로 제조된 엑소좀
WO2019213706A1 (en) * 2018-05-08 2019-11-14 Deakin University Extracellular vesicle-based drug-delivery
WO2020082005A2 (en) * 2018-10-19 2020-04-23 Ohio State Innovation Foundation Extracellular vesicles for targeted therapies against myeloid-derived suppressor cells

Also Published As

Publication number Publication date
KR20220148567A (ko) 2022-11-07

Similar Documents

Publication Publication Date Title
Gunassekaran et al. M1 macrophage exosomes engineered to foster M1 polarization and target the IL-4 receptor inhibit tumor growth by reprogramming tumor-associated macrophages into M1-like macrophages
US10548853B2 (en) Oncolytic virus formulation and preparation method thereof
Huang et al. Macrophage membrane-coated nanovesicles for dual-targeted drug delivery to inhibit tumor and induce macrophage polarization
WO2022231158A1 (ko) 약물전달물질로서의 간세포암 특이적 표적 엑소좀 조성물 및 이의 용도
WO2013115608A1 (ko) 12량체 trail 및 hsv-tk 자살유전자를 동시에 발현하는 벡터 및 이를 이용한 항암 줄기세포 치료제
Mo et al. Effects of hypoxia and radiation-induced exosomes on migration of lung cancer cells and angiogenesis of umbilical vein endothelial cells
CN108546679B (zh) 在体外大量扩增人类成熟高活性树突状细胞的方法及其应用
El-Mayta et al. Delivery technologies to engineer natural killer cells for cancer immunotherapy
Wang et al. Neural stem cell-based dual suicide gene delivery for metastatic brain tumors
Hassanzadeh et al. Genetically-modified stem cell in regenerative medicine and cancer therapy; a new era
WO2014114023A1 (zh) 一种能够大规模并快速高纯度地诱导间充质干细胞转决定成造血干细胞的方法
Song et al. Influence of gene modification in biological behaviors and responses of mouse lung telocytes to inflammation
Mekers et al. cGAS/cGAMP/STING signal propagation in the tumor microenvironment: key role for myeloid cells in antitumor immunity
Wen et al. Nanovaccines fostering tertiary lymphoid structure to attack mimicry nasopharyngeal carcinoma
Hu et al. Hypoxia preconditioning promotes the proliferation and migration of human urine-derived stem cells in chronically injured liver of mice by upregulating CXCR4
WO2022250268A1 (ko) 약물전달물질로서의 위암 특이적 표적 엑소좀 조성물 및 이의 용도
CN110423812B (zh) Skiv2l2（MTR4）基因在肿瘤治疗中的用途
US20220265723A1 (en) Non-viral modification of mesenchymal stem cells
Heineman et al. Targeted mitochondrial delivery to hepatocytes: a review
Shin et al. Cytokine engineered NK-92 therapy to improve persistence and anti-tumor activity
WO2022231114A1 (ko) 약물전달물질로서의 대장암 특이적 표적 엑소좀 조성물 및 이의 용도
WO2022231157A1 (ko) 약물전달물질로서의 대장암 특이적 표적 엑소좀 조성물 및 이의 용도
WO2020116989A1 (ko) 생체내 세포 투입칩을 포함하는 항암용 조성물
Zhao et al. Hepatic telocytes
Nagaraj et al. Dendritic cell, the immunotherapeutic cell for cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22795992

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22795992

Country of ref document: EP

Kind code of ref document: A1