WO2022211486A1 - 사이토카인 억제제와 활성산소 생성억제제 및 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물 - Google Patents

사이토카인 억제제와 활성산소 생성억제제 및 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물 Download PDF

Info

Publication number
WO2022211486A1
WO2022211486A1 PCT/KR2022/004500 KR2022004500W WO2022211486A1 WO 2022211486 A1 WO2022211486 A1 WO 2022211486A1 KR 2022004500 W KR2022004500 W KR 2022004500W WO 2022211486 A1 WO2022211486 A1 WO 2022211486A1
Authority
WO
WIPO (PCT)
Prior art keywords
ros
inhibitor
group
cytokine
composition
Prior art date
Application number
PCT/KR2022/004500
Other languages
English (en)
French (fr)
Inventor
최상윤
Original Assignee
주식회사 소젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220038858A external-priority patent/KR20220136910A/ko
Application filed by 주식회사 소젠 filed Critical 주식회사 소젠
Publication of WO2022211486A1 publication Critical patent/WO2022211486A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/111—Aromatic compounds
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/142—Amino acids; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/12—Ketones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/192—Carboxylic acids, e.g. valproic acid having aromatic groups, e.g. sulindac, 2-aryl-propionic acids, ethacrynic acid 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198—Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/35—Ketones, e.g. benzophenone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating viral infections, including a cytokine inhibitor and a reactive oxygen scavenger complex as an active ingredient in addition to an active oxygen production inhibitor.
  • Cytokines are a broad category of small proteins important for cell signal transduction, and since they are mainly protein components, they are difficult to penetrate across the lipid bilayer of cells and into the cytoplasm. In general, cytokines are immune modulators involved in autocrine, paracrine and endocrine signaling.
  • a cytokine storm also called hypercytokinemia, is an inflammation-inducing signal phenomenon due to the overexpression of cytokines as a physiological response of higher organisms. Cytokines are known to be part of the body's immune response to infection, but their sudden over-release can lead to organ failure and, in severe cases, death.
  • cytokine storms can be caused by viral respiratory infections, particularly H1N1, H5N1 Influenza virus type A (IAV) or Corona virus.
  • IAV Influenza virus type A
  • Corona virus a virus that influences the production of coronavirus.
  • Viruses can replicate by invading lung epithelial cells and alveolar macrophages, which are known to stimulate infected cells to release cytokines and chemokines and activate macrophages and dendritic cells.
  • Dihydrochalcone and Phloretin are natural phenolic flavonoids mainly found in the fruits, leaves and roots of apple trees, and are known to exhibit antioxidant and anti-inflammatory activity in mammalian cells. Phloretin has been reported to be involved in the regulation of superoxide dismutase (SOD) and glutathione (GSH) peroxidase (GSH peroxidase: GPx) activities and the amount of lipid peroxidation markers in animal experiments. In addition, phloretin is known to affect the regulation of the activity of several kinases in A549 human lung epithelial cells. The present inventors confirmed that the antioxidant and anti-inflammatory effects of phloretin exhibit a function of inhibiting virus proliferation by regulating reactions such as reactive oxygen species and cytokine storm accompanying virus infection.
  • ROS Reactive oxygen species
  • NOXs NADPH oxidases
  • ROS protein disulfide bonds
  • ERO1 endoplasmic reticulum oxidoreductin 1
  • PDI protein disulfide isomerase
  • ROS at an appropriate concentration in vivo are useful in cell physiology, such as cell differentiation, cell signaling, and homeostasis, but high-concentration ROS generation by UV irradiation and infection has a fatal adverse effect on lipids, proteins, and DNA. Therefore, it has its own ROS catabolism in vivo to control ROS concentration, but excessive ROS generation causes oxidative stress.
  • Enzymatic antioxidants include superoxide dismutases (SODs) and catalase. SODs and ROS not cleared by catalase have a short half-life and are converted into highly reactive hydroxyl radicals ( ⁇ OH). Unlike superoxide and hydrogen peroxide that can be detoxified by SODs and catalase, hydroxyl group ( ⁇ OH) is also generated as a by-product of immune reactions such as macrophages in vivo, and the generated ⁇ OH is an enzymatic reaction It cannot be eliminated by the body, so it is very harmful to the organism. In addition, there are three types of SOD in the living body. SOD1 mainly acts in the cytoplasm, SOD2 acts in mitochondria, and SOD3 acts extracellularly. SOD1 and SOD3 contain copper and zinc ions, and SOD2 contains manganese ions.
  • Influenza A virus which is commonly known to cause influenza, is one of the representative causes of acute respiratory diseases. IAV causes large and small epidemics worldwide every year, and is highly contagious enough to infect 10-20% of the normal population within 2-3 weeks. Increased ROS during IAV infection leads to apoptosis and severe cellular stress.
  • ROS-mutation theory was established by oxidative DNA damage, and when ROS is overproduced in the cell, not only short-term results such as inflammatory response and apoptosis, but also endoplasmic reticulum stress worsens when continuously exposed to ROS. It has been found to have a serious effect on the induction of various degenerative diseases related to aging.
  • the present invention has been completed by examining the correlation between JNK cycle activation and virus proliferation caused by viral infection, suppressing viral proliferation through inhibition of the JNK pathway, and improving, preventing, and treating viral infections.
  • the technical problem to be achieved by the present invention is to improve, prevent, or treat viral infections through inhibition of cytokine production activated by the JNK pathway.
  • the present invention confirmed that viral infection can be more effectively controlled by co-administering a ROS production inhibitor and a ROS scavenger together with a cytokine inhibitor. It aims to improve, prevent, or treat viral infections including as an active ingredient.
  • the present inventors investigated the correlation between JNK cycle activation and virus proliferation caused by viral infection, and confirmed that virus proliferation can be inhibited through inhibition of the JNK pathway. Accordingly, the present inventors provide a pharmaceutical composition for the prevention or treatment of viral infections comprising a cytokine inhibitor that inhibits JNK pathway activation as an active ingredient.
  • the present invention provides a food composition for the prevention or improvement of viral infections, comprising a cytokine inhibitor as an active ingredient.
  • the present invention provides a feed additive for the prevention or improvement of viral infections, comprising a cytokine inhibitor as an active ingredient.
  • the present invention provides a composition for preventing viral infections, comprising a cytokine inhibitor as an active ingredient.
  • the present invention provides a cosmetic composition comprising a cytokine inhibitor as an active ingredient.
  • the present invention may provide a composition for improving, preventing or treating viral infections, which further comprises an ROS generation inhibitor and a ROS scavenger in the composition as an embodiment.
  • the ROS production inhibitor may be to reduce the amount of ROS production by preventing or inhibiting endoplasmic reticulum stress activation
  • the ROS production inhibitor is 4-phenylbutyrate (4-phenylbutyrate: 4-PBA) , taurine-conjugated ursodeoxycholic acid (TUDCA), 3-MA (3-Methyladenine) and chloroquine (chloroquine diphosphate)
  • 4-PBA 4-phenylbutyrate
  • 3-MA 3-Methyladenine
  • chloroquine chloroquine diphosphate
  • the ROS scavenger is N-acetyl cysteine (NAC) superoxide dismutase 1: SOD1, glutathione, catalase, butylhydride It may be at least one selected from the group consisting of butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ascorbic acid, and tocopherol, but preferably NAC. have.
  • NAC N-acetyl cysteine
  • the cytokine inhibitor may be phloretin
  • the composition of the present invention may be a combination of phloretin and at least one from the ROS generation inhibitor and scavenger group, , More preferably, it may include a complex with phloretin, 4-PBA and NAC.
  • the composition may be for nasal, oral, or inhalation administration, but preferably may be for inhalation administration administered into the bronchi of an individual using breathing.
  • the virus may be a group of viruses that induce oxidative stress and cytokine storm, and non-limiting examples of the virus include avian influenza virus in addition to influenza A virus, human immunodeficiency virus and coronavirus, There are livestock transmission viruses such as African swine fever virus (ASFV).
  • the virus may be a respiratory disease-inducing virus including influenza A virus and coronavirus (SARS-CoV-2) in particular in consideration of the formulation and administration method of the pharmaceutical composition of the present invention.
  • the present invention provides a method for preventing or treating a viral infection comprising administering a cytokine inhibitor to a subject.
  • the method may be to administer a ROS generation inhibitor and/or a ROS scavenger to a subject together with a cytokine inhibitor.
  • the ROS and cytokine production inhibitor and ROS scavenger may be administered simultaneously or sequentially, but preferably mixed in one composition and administered simultaneously.
  • the ROS and cytokine production inhibitor and ROS scavenger combination formulation may be administered through the mouth or nose of an individual, and when administered through the nose, spray the combination formulation can be administered. That is, the administration is not limited as long as it is an administration method that can deliver the combination preparation into the bronchi of the subject, but preferably, it may be administered through the subject's breathing. In another embodiment of the present invention, the administration may be performed more than once a day.
  • the NAC may be administered in an amount of 0.1 to 5 mg per unit body weight (1 kg) of the individual.
  • the present invention provides the use of a cytokine inhibitor for the manufacture of a medicament for the prevention or treatment of viral infections.
  • the cytokine inhibitor may be used together with a ROS generation inhibitor and/or a ROS scavenger for the preparation of a medicament for the prevention or treatment of viral infections.
  • the present inventors confirmed that IAV and SARS-CoV-2 proliferation was inhibited using ROS and cytokine storm inhibitors and ROS scavengers in vitro . Furthermore, inhibition of IAV proliferation was confirmed using ROS and cytokine storm inhibitors and ROS scavengers in animal models. As a result of the present inventors' study, it was found that the increase in cytokine storm and ROS generated in the host cell after virus infection has a great influence on virus proliferation.
  • the present invention relates to a composition capable of preventing, treating, and ameliorating viral infection diseases, and the safety of active oxygen and cytokine production inhibitors and active oxygen scavengers has already been verified, so that the composition of the present invention is also safe for human application do.
  • the present invention reversely uses the mechanism in which a virus causes a cytokine storm and oxidative damage in a host cell to activate virus replication and infection under that condition, and has direct specificity to a specific virus like a conventional vaccine.
  • it has the advantage of effectively inhibiting the proliferation of all viruses that cause cytokine storms and oxidative stress, regardless of the type or mutation of the virus.
  • the composition of the present invention can inhibit virus proliferation regardless of virus mutation, it can be applied as a sub-universal anti-infective agent and therapeutic agent as a limited replacement for a vaccine that must be newly developed every year due to virus mutation. It can be used as a preventive agent or adjuvant for quarantine.
  • the composition of the present invention has the advantage of being able to minimize the damage to cells and tissues caused by oxidative stress and cytokine storm at the same time as the inhibition of virus proliferation.
  • Figure 1a is a diagram showing that the degree of phosphorylation (p-JNK) of JNK that activates c-Jun in the host cell (pc-Jun) increases proportionally as the influenza A virus (IAV) infectivity increases in vitro ; to be.
  • Figure 1b is a diagram showing the increase or decrease of the replication enzyme (PB1) of IAV according to p-JNK activation (PMA treatment) or inhibition (Go6893, PKC inhibitor treatment).
  • PB1 replication enzyme
  • PMA treatment p-JNK activation
  • Go6893 PKC inhibitor treatment
  • Figure 2 confirms that the amount of viral replication enzyme (PB1) is significantly reduced as the cytokine inhibitor treatment concentration increases during IAV infection in vitro .
  • the synergistic effect of phloretin (Phl) used as a cytokine inhibitor on IAV infection inhibition is a drawing showing
  • PB1 cytokine inhibitor (Phl) treatment during influenza A virus (IAV) infection in vitro when the activation degree of JNK (p-JNK) is reduced when the cytokine tumor necrosis factor- ⁇ (TNF ⁇ ) protein is reduced while IAV A diagram showing the effect of proportionally decreasing the viral protein (PB1).
  • Figure 4a is a diagram showing that the IAV virus titer (titer) decreases when increasing the concentration of Phloretin (Phl) in vitro .
  • Figure 4b is a view showing that the virus infectivity (infectivity) is rapidly reduced according to the cytokine inhibitor treatment concentration after SARS-CoV-2 infection, showing the inhibition rate of virus proliferation of each inhibitor compared to cell viability. IC 50 (50% inhibitory concentration) was measured.
  • 5 is a view comparing and confirming the effect of inhibiting virus proliferation and infection through weight change in mice by administering the cytokine inhibitor phloretin (Phl) alone in an in vivo experiment using IAV-infected mice.
  • Figure 6a shows when the activation degree of JNK (p-JNK) and IAV (viral protein PB1) are increased during influenza A virus (IAV) infection in vitro , ROS production inhibitor (4-PBA) and scavenger (NAC) treatment IAV proliferation was decreased but JNK activity was not significantly changed, but when the cytokine inhibitor phloretin (Phl) was treated, both p-JNK and PB1 were significantly reduced, that is, a correlation showing a synergistic effect of Phloretin on IAV infection inhibition. It is a drawing showing
  • 6B is a diagram showing the correlation between the synergistic effect of phloretin (Phl) on IAV infection in vitro and the inhibitory effect of the AP1-induced gene cytokine interleukin 6 (IL-6) and TNF- ⁇ .
  • Phl phloretin
  • the present invention minimizes tissue damage through effective inhibition of ROS and cytokine production and ROS scavenging action in respiratory infections and related diseases that cause overproduction and inflammation of ROS, and is an antioxidant, anti-inflammatory, and anti-oxidant applied to the prevention and treatment of viral infections And to the antiviral agent complex composition.
  • the present inventors studied the relationship between oxidative stress that occurs in host cells during influenza virus infection and virus infection and proliferation. As a result, it was confirmed that ROS production is increased according to viral infection. confirmed to give. In addition, the increase in ROS is due to activation of the main reaction pathway of endoplasmic reticulum stress and autophagy reaction mechanism. In this case, it was observed that the titer of the virus decreased. At the same time, it was confirmed that the cytokine storm, which is caused by IAV infection stress and accelerates inflammation, is effectively controlled by the cytokine inhibitor treatment that acts directly.
  • phloretin is a kind of natural polyphenols, flavonoids, and has antioxidant and anti-inflammatory effects.
  • phloretin was used as a cytokine inhibitor, and as a result, it was confirmed that the replication of viral genes was inhibited depending on the treatment concentration of floretin (see Example 2), and furthermore, inhibition of viral proliferation of phloretin It was confirmed that activity was achieved by blocking JNK pathway activity in virus-infected cells (see Example 3).
  • the target virus infection disease is not limited to influenza virus, but various viruses through JNK pathway blockade. It was found that it can be universally applied to diseases (see Example 3).
  • the present inventors have confirmed that it can inhibit virus proliferation by regulating the JNK pathway that is activated during viral infection and promotes cytokine production. and for therapeutic use.
  • the present inventors tried to check whether viral infection diseases can be more effectively controlled by simultaneously achieving inhibition and elimination of ROS production and cytokine inhibitors that block JNK pathway activation.
  • 4PBA as a ROS generation inhibitor and NAC as a ROS scavenger were selected and phloretin as a cytokine inhibitor was co-administered to virus-infected cells to confirm the level of JNK phosphorylation and the expression level of the viral protein PB1.
  • the cytokine inhibitor, the ROS generation inhibitor, and the ROS scavenger were administered at the same time, the virus proliferation could be significantly inhibited as compared to administration alone (see Example 6).
  • cytokine inhibitors can inhibit the synthesis of viral proteins alone or in combination with ROS generation blockers and scavengers in in vitro experiments.
  • ROS generation blockers and scavengers in in vitro experiments.
  • the effect on virus proliferation when combined administration of ROS generation inhibitor and scavenger in the animal model for IAV was confirmed by analyzing the weight measurement of the animal model. It was confirmed that the obtained body weight was recovered significantly, and further, the body weight of the rats that were additionally administered with a cytokine inhibitor was maintained and recovered more closely to normal. That is, it was confirmed that the cytokine inhibitor added to the treatment with the ROS generation inhibitor and the scavenger has a synergistic effect as an antiviral agent and can effectively control viral infection (see Example 7).
  • the present invention can provide a composition for preventing, treating, or improving a viral infection comprising ROS and a cytokine inhibitor and a ROS scavenger as active ingredients.
  • GSH glutathione
  • NAC N-acetyl cysteine
  • NAC acts as a direct antioxidant and also acts as a precursor of GSH to show an indirect antioxidant effect. It is known to cause Therefore, when NAC is included in the composition of the present invention, NAC is adjusted to be administered in an amount of 1 mg or less per unit body weight (20 g) of an animal administered nasally.
  • NAC is treated with 4-PBA, Phloretin, etc., including SOD1, even a small dose can effectively achieve weight recovery of an individual due to infection, reduction of ROS accumulation in the bronchi, and reduction of viral titer, especially in oral complexes. It is desirable to reduce the dose during administration.
  • “4-phenylbutyrate (4-PBA)” inhibits the generation of ROS through endoplasmic reticulum stress suppression, and has a function of stabilizing effective proteins having an antiviral function at the same time.
  • the oral dosage is preferably adjusted to be administered to 50 mg or less per unit body weight (1 Kg) of the animal subject.
  • phloretin was administered at a small dose of 10-30 mg/Kg when administered intranasally and 1/3 when administered orally, the effective effect to be confirmed in this experiment was observed.
  • the present invention treats ROS and a cytokine production inhibitor and a ROS scavenger combination preparation to suppress and eliminate ROS production, as well as fundamentally inhibit cytokine production to significantly improve the inhibition efficiency of tissue damage caused by inflammation and virus proliferation and transmission of infection It is suggested that it not only increases, but also prevents or minimizes damage to infected cells and surrounding tissues of the host, and can be used as an antiviral agent and an anti-infection agent.
  • the pharmaceutical composition for preventing or treating viral diseases according to the present invention is formulated in the form of external preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. and sterile injection solutions, respectively, according to conventional methods. may be used, and preferably may have a spray formulation.
  • Carriers, excipients and diluents that may be included in the composition include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the extract, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate talc are also used.
  • Liquid preparations for oral use include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances, preservatives, etc. may be included. .
  • the preferred dosage of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the drug form, the route and duration of administration, but may be appropriately selected by those skilled in the art. However, for a desirable effect, the pharmaceutical composition of the present invention is preferably administered at 0.0001 to 100 mg/kg per day, preferably 0.001 to 10 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition according to the present invention can be administered to mammals such as rats, mice, livestock, and humans by various routes such as parenteral and oral administration, and all modes of administration can be expected, especially in the case of inhalation spray. or nasal administration.
  • the oral dosage form although it may vary depending on the age, sex, and weight of the patient, an amount of 0.1 to 100 mg/kg may be administered once to several times a day.
  • the dosage may be increased or decreased depending on the route of administration, the degree of disease, sex, weight, age, and the like. Accordingly, the above dosage does not limit the scope of the present invention in any way.
  • the present invention provides a health functional food composition for preventing or treating viral diseases.
  • the composition of the present invention may be added to food for the purpose of reducing body fat or improving viral diseases.
  • the cytokine inhibitor, ROS generation inhibitor, and/or ROS scavenger of the present invention is used as a food additive, each of the above components may be added as it is or used together with other foods or food ingredients, and may be used appropriately according to a conventional method.
  • the mixed amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).
  • the pixion of the present invention is added in an amount of 15 wt% or less, preferably 10 wt% or less, based on the raw material.
  • the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount greater than the above range.
  • the health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, as in a conventional beverage.
  • the above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol.
  • natural sweeteners such as taumatine and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used.
  • the proportion of the natural carbohydrate is generally about 0.01-0.20 g, preferably about 0.04-0.10 g per 100 mL of the composition of the present invention.
  • the composition of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, It may contain a carbonation agent used for carbonated beverages, and the like.
  • the composition of the present invention may contain fruit for the production of natural fruit juice, fruit juice beverage, and vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not critical, but is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention.
  • Recombinant IAV (A/WSN/1933) was obtained from R.G. Webster (University of Tennessee, TN, USA) provided a plasmid containing cDNA (SEQ ID NOs: 1 to 8) for 8 viral RNAs was co-transfected into 293T cells, and the cell culture medium was collected and centrifuged after the The supernatant was obtained.
  • lipofectamine 2000 was used as the transfection agent, and transfection was performed for 24 hours.
  • 293T cells were transfected by culturing in a medium containing 10% FBS in DMEM and cultured the next day by replacing them with Opti-MEM medium containing 0.3% BSA. After 48 hours of medium replacement, only the cell culture medium was collected, centrifuged at 13,000 rpm for 1 to 2 minutes, and the virus was obtained from the supernatant.
  • the obtained IAV was infected with Madin-Darby canine kidney (MDCK) cells, and the virus to be used after 24 to 48 hours was obtained.
  • MDCK Madin-Darby canine kidney
  • MDCK line As cells for the Plaque assay, MDCK line was used. Dispense 1.0 ⁇ 10 6 MDCK cells into each well of a 6-well plate, and inject 500 ⁇ l of virus diluted through serial dilution at 100% confluency into each well to infect the infection process for 1 hour. carried out. At this time, Opti-MEM, 0.3% BSA, 1 ⁇ g/ml TPCK-trypsin was used as the medium, and agar media (2x L-15 medium, 0.8% agar, 0.075% NaHCO 3 , 1 ⁇ g/ml TPCK- trypsin, 0.3% BSA, 1x glutamate/antibiotics). After replacing the medium, it was maintained at room temperature until solidified, and then cultured for 2-3 days at 37°C and 5 atm CO 2 conditions.
  • tissue culture infection the titer of the virus was mostly infected with human alveolar epithelial cells A549 at an MOI of 0.01. After 1 hour of infection, the cells were washed with PBS (phosphate-buered saline) and incubated with RPMI 1640 or DMEM containing 2% FBS for 24 hours.
  • PBS phosphate-buered saline
  • IL-6 primer sense, 5′-AGCGCCTTCGGTCCAGTTGC-3′; anti-sense, 5′-TGCCAGTGCCTCTTTGCTGCT-3′
  • TNF- ⁇ primer sense, 5′-CTGGGCAGGTCTACTTTGGG-3′; anti-sense, 5′-CTGGAGGCCCCAGTTTGAAT -3′
  • GADPH primer sense, 5′-AGAAGGCTGGGGCTCATTTG -3′; anti-sense, 5′-AGGGGCCATCCACAGTCTTC -3′
  • IL-6, TNF- ⁇ , and GADPH mRNA expression were compared using polymerase chain reaction.
  • 384-well plates were seeded with 1.2x10 4 Vero cells per well. Approximately 1 h after compound treatment, cells were infected with SARS-CoV-2 (0.0125 MOI) in the BSL3 facility and incubated at 37 °C for 24 h. After fixing the cells with 4% paraformaldehyde (PFA), permeabilization was performed. Thereafter, cells were stained with anti-SARS-CoV-2 nucleocapsid (N) primary antibody, Alexa Fluor 488-conjugated goat anti-rabbit IgG secondary antibody and Hoechst 33342. Fluorescence images of infected cells were acquired using a large-capacity image analysis instrument, Operetta (Perkin Elmer).
  • A549 lung cell line was infected with IAV at an MOI (multiplicity of infection) of 0.01 for 24 hours. After virus infection, Western blot was performed on the infected A549 cell line to determine the change in JNK activity according to the degree of virus infection. As a result, it was observed that the degree of phosphorylation of JNK (p-JNK), which activates c-Jun (p-c-Jun) in the host cell, increases proportionally as the degree of IAV infectivity increases. That is, it shows the possibility of activation of AP1 (c-Jun/Fos) inducible genes due to IAV infection.
  • MOI multiplicity of infection
  • Example 2 Inhibitory effect of phloretin on virus proliferation
  • Example 3 Inhibitory effect of phloretin on JNK activation: correlation between cytokine storm and virus proliferation
  • the IAV virus titer was measured after treatment with floretin at different concentrations. As a result, the titer was significantly reduced in proportion to the floretin treatment concentration.
  • Vero cells were infected with SARS-CoV-2 (0.0125 MOI) in a BSL3 facility, treated with Phloretin at a given concentration, and anti-SARS-CoV-2 nucleocapsid (N ) Fluorescence images of infected cells were measured using the antibody.
  • Phloretin at a given treatment concentration did not significantly affect cell viability and showed efficacy in effectively suppressing the rate of virus infection.
  • the IC 50 (50% inhibitory concentration) and CC 50 (50% cytotoxic concentration) of Phloretin against SARS-CoV-2 were also measured.
  • Example 5 As an antiviral agent in influenza virus infection animal model Inhibitory effect of phloretin in viral infection rate
  • mice 3 to 4 week old mice (BALB/c) were infected with IAV 500 PFU and then phloretin was administered intranasally. Infection inhibitory effect was observed.
  • Example 6 Combined treatment with active oxygen production inhibitor and scavenger: antiviral synergistic effect of cytokine inhibitor
  • interleukin 6 interleukin 6
  • tumor necrosis factor- ⁇ tumor necrosis factor- ⁇
  • TNF- ⁇ tumor necrosis factor- ⁇
  • Example 7 Synergistic effect of phloretin in suppressing viral infection rate as an antiviral agent in an animal model infected with influenza virus
  • the present invention can provide a composition for preventing, treating, or ameliorating a viral infection disease by using a cytokine production inhibitor alone or in combination with a ROS production inhibitor and a scavenger.
  • the present invention relates to a composition capable of preventing, treating, and ameliorating viral infection diseases, and the safety of the active oxygen production inhibitor and active oxygen scavenger and cytokine inhibitor used has already been verified, so that the composition of the present invention is also safe for human application.
  • the present invention reversely uses the mechanism in which a virus causes oxidative damage of host cells, cytokine storm, and activates virus replication and infection under that condition, and is directly specific for a specific virus like a conventional vaccine. It is not a mechanism that acts as a bacterium, it is not dependent on the type or mutation of the virus, and it can effectively inhibit the proliferation of most viruses that cause oxidative stress and cytokine storm.
  • As a limited replacement for vaccines that must be newly developed every year due to virus mutation it can be applied as a sub-universal anti-infective agent and therapeutic agent, and is expected to be used as a preventive agent or adjuvant for quarantine purposes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Virology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Communicable Diseases (AREA)
  • Animal Husbandry (AREA)
  • Zoology (AREA)
  • Emergency Medicine (AREA)
  • Birds (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

본 발명은 바이러스 감염 질환을 예방, 치료 및 개선할 수 있는 조성물에 관한 것으로서, 사용한 활성산소 생성억제제 및 활성산소 소거제 그리고 사이토카인 억제제는 안전성이 이미 검증되어 본 발명의 조성물도 인체 적용에 안전성이 보장되고, 본 발명은 바이러스가 숙주세포의 산화적 손상, 사이토카인 폭풍을 야기하여 그 조건에서 바이러스 복제 및 감염을 활성화시키는 기전을 역으로 이용한 것으로서, 기존의 백신과 같이 특정 바이러스에 대한 직접 특이적으로 작용하는 기작이 아니고, 바이러스의 종류나 변이에 의존도가 낮으며 산화적 스트레스와 사이토카인 폭풍을 유발하는 대부분의 바이러스에 대한 증식을 효율적으로 억제할 수 있다.

Description

사이토카인 억제제와 활성산소 생성억제제 및 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물
본 발명은 활성산소 생성억제제 외에 사이토카인 억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방 또는 치료용 약학적 조성물 등에 관한 것이다.
사이토카인(cytokine)은 세포 신호 전달에 중요한 광범위한 범주의 작은 단백질이며, 주로 단백질 성분이기 때문에 세포의 지질 이중층을 가로 질러 세포질에 침투가 어렵다. 일반적으로 사이토카인은 면역 조절제로서 자가분비(autocrine), 파라크린(paracrine) 및 내분비 신호에 관여한다.
고 사이토카인혈증 (hypercytokinemia)이라고도 하는 사이토카인 폭풍 (cytokine storm)은 고등 생명체의 생리적 반응으로 사이토카인이 과다하게 발현됨으로 인하여 염증 유발신호 현상라고 할 수 있다. 사이토 카인은 감염에 대한 신체의 면역 반응의 일부로 알려져 있지만 갑작스런 과다 방출은 장기 부전 등과 심한 경우 사망을 유발할 수 있다.
많은 경우 사이토카인 폭풍은 특히 H1N1, H5N1 Influenza virus type A (IAV) 혹은 Corona virus와 같은 바이러스성 호흡기 감염으로 인해 발생할 수 있다. 신종 코로나바이러스로 알려진 SARS-CoV-2에 감염된 환자와 관련하여, 사이토카인 폭풍을 경험하는 바이러스감염 중환자는 예후가 나쁘고 사망률이 증가하는 것으로 보고되어 있다. 바이러스는 폐 상피 세포와 폐포의 대식세포를 침범하여 복제할 수 있으며, 이는 감염된 세포가 사이토카인과 케모카인(chemokine)을 방출하도록 자극하고 대식세포, 수지상 세포 등을 활성화하는 것으로 알려져 있다.
디하이드로칼콘(Dihydrochalcone), 플로레틴(Phloretin)은 주로 사과 나무의 과일, 잎 및 뿌리에서 발견되는 천연 phenol류 플라보노이드(flavonoid)로 포유류 세포에서 항산화 및 항염증 활성을 나타내는 것으로 알려졌다. 플로레틴은 동물실험에서 슈퍼옥사이드 디스뮤타제 (SOD) 및 글루타티온(Glutathione: GSH) 퍼옥시다제(GSH peroxidase: GPx) 활성과 지질 과산화 마커 양 조절에 관여하는 것으로 보고되고 있다. 또한 플로레틴은 A549 인간 폐 상피 세포에서 여러 인산화 효소의 활성 조절에도 영향을 주는 것으로 알려져있다. 본 발명자들은 이러한 플로레틴의 항산화 및 항염증 효과가 바이러스 감염시 수반되는 활성산소와 사이토카인 폭풍 등의 반응을 조절하여 바이러스 증식을 억제하는 기능을 나타내는 것으로 확인하였다.
사이토카인 보다 일반적으로 잘 알려진 활성산소(reactive oxygen species: ROS)는 정상적인 세포의 대사산물로서 산소분자의 환원작용으로 생성되는 기본적인 경로 이외에 감염이나 염증 등의 요인으로 세포 및 조직 종류에 따라 다양한 기전을 통해 생성된다. ROS 생성에는 세포막의 NADPH oxidases (NOXs), 미토콘드리아, 과산화소체(peroxisome)가 관여한다. 또한 최근에 단백질 접힘(protein folding) 및 분비와 세포 내 칼슘조절에 관련하는 소포체(endoplasmic reticulum, ER)에서 endoplasmic reticulum oxidoreductin 1 (ERO1)과 protein disulfide isomerase (PDI) 효소 작용으로 단백질의 이황화 결합(disulfide bond) 형성시에 ROS가 생성될 수 있음이 알려졌다. 생체내에서 적절한 농도의 ROS는 세포분화, 세포 신호전달 및 항상성(homeostasis) 등 세포 생리학적으로 유용하게 작용하나, 자외선 조사 및 감염 등에 의한 고농도 ROS 생성은 지질, 단백질, DNA에 치명적인 악영향을 미친다. 따라서 생체 내에서 자체 ROS catabolism을 갖추어 ROS 농도를 조절하지만, 과도한 ROS 생성은 산화적 스트레스를 야기한다.
과도한 ROS 생산에 대응하기 위하여 생체 내에 효소적 또는 비효소적 항산화시스템이 있다. 효소적 항산화제로는 superoxide dismutases(SODs)와 카탈라아제(catalase)가 있다. SODs와 catalase에의하여 소거되지 못한 ROS들은 반감기가 짧으며 반응성이 매우 높은 하이드록시기(hydroxyl radical: ㆍOH)로 전환된다. SODs와 catalase에　의해 해독될 수 있는　초과산화물(superoxide) 및 과산화수소와 달리, 하이드록시기(ㆍOH)는 생체 내에서 대식세포 등의 면역반응의 부산물로도 생성되며,　생성된　ㆍOH은　효소　반응에　의해 제거될 수 없으므로 유기체에 매우 유해하다. 또한, 생체에는 3 가지 형태의 SOD가 존재하는데, SOD1은 주로 세포질, SOD2는 미토콘드리아, SOD3는 세포 외에서 작용한다. SOD1과 SOD3는 구리와 아연 이온을 함유하고 SOD2는 망간 이온이 관여한다.
생체 내에서 산화적 스트레스가 발생되는 여러 경우가 있는데, 이 중에 하나인 바이러스 감염에 의한 ROS 과다생성에 대한 연구가 최근 집중되고 있다. 흔히 독감을 유발하는 것으로 알려져 있는 인플루엔자 A 바이러스(Influenza A Virus, IAV)는 급성 호흡기 질환을 일으키는 대표적인 원인 중의 하나이다. IAV는 매년 전 세계적으로 크고 작은 유행을 일으키며, 2~3주 내로 통상 인구의 10~20%가 감염될 수 있을 정도로 전염성이 매우 크다. IAV 감염 중에 나타나는 ROS 증가는 세포사멸을 일으키며, 심각한 세포 스트레스를 일으킨다. 이러한 산화적 스트레스의 결과로서 oxidative DNA damage에 의하여 ROS-mutation theory 개념이 성립되었으며, 세포 내에서 ROS가 과량 생산되면 염증반응, 세포사멸 등 단기적 결과뿐 아니라, 나아가 ROS에 지속적으로 노출 시 소포체스트레스 악화로 노화 관련 각종 퇴행성 질병 유발 등의 심각한 영향을 미치는 것이 밝혀졌다.
본 발명은 바이러스 감염에 의한 JNK 회로 활성화와 바이러스 증식의 상관관계를 규명하고, JNK 경로 억제를 통해서 바이러스 증식을 억제하고 바이러스 감염질환을 개선, 예방, 및 치료가 가능함을 확인하고 완성되었다.
이에, 본 발명이 이루고자 하는 기술적 과제는 JNK 경로로 활성화되는 사이토카인 생성 억제를 통해 바이러스 감염 질환을 개선, 예방, 또는 치료하는 것이다.
또한, 본 발명은 사이토카인 억제제와 함께 ROS 생성 억제제 및 ROS 소거제를 병용 투여하여 바이러스 감염 질환을 보다 효과적으로 조절할 수 있음을 확인하였는바, 본 발명은 사이토카인 억제제와 ROS 생성 억제제 및 ROS 소거제를 유효성분으로 포함하는 바이러스 감염 질환의 개선, 예방, 또는 치료를 목적으로 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당해 기술분야의 통상의 기술자에게 명확하게 이해될 수 있을 것이다.
본 발명자들은 바이러스 감염에 의한 JNK 회로 활성화와 바이러스 증식의 상관관계를 규명하고, JNK 경로 억제를 통해서 바이러스 증식을 억제할 수 있음을 확인하였다. 이에, 본 발명자들은 JNK 경로 활성화를 억제하는 사이토카인 억제제를 유효성분으로 포함하는 바이러스 감염 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 사이토카인 억제제를 유효성분으로 포함하는, 바이러스 감염 질환의 예방 또는 개선용 식품 조성물을 제공한다.
또한, 본 발명은 사이토카인 억제제를 유효성분으로 포함하는, 바이러스 감염 질환의 예방 또는 개선용 사료 첨가제를 제공한다.
또한, 본 발명은 사이토카인 억제제를 유효성분으로 포함하는, 바이러스 감염 질환의 방역용 조성물을 제공한다.
또한, 본 발명은 사이토카인 억제제를 유효성분으로 포함하는, 향장 조성물을 제공한다.
또한, 본 발명자들은 현재까지 IAV가 일으키는 ROS의 정확한 생성기전과 그의 원인은 아직도 불명확하나 in vitro 및 동물실험에서의 IAV 감염으로 유도되는 ROS가 바이러스 복제율과 감염율을 증가시킨다는 것을 관찰하고 보고하였다. 또한, 본 발명자들의 연구 결과 바이러스 감염 후 단백질 합성과 관련된 감염 스트레스로 인한 ROS 및 사이토카인 과다증가가 숙주세포 염증과 손상과 더불어 바이러스 증식에 많은 영향을 끼치는 것을 확인하였다. 따라서 감염으로 인한 소포체스트레스를 포함한 감염스트레스 활성을 차단함과 동시에 기존 ROS 및 사이토카인 수준을 효과적으로 제어함으로써 항바이러스 및 항염증 효과를 얻는 방안을 제안한다.
따라서, 본 발명은 일 구현예로서 상기 조성물에 ROS 생성 억제제와 ROS 소거제를 추가로 포함하는 바이러스 감염 질환의 개선, 예방 또는 치료용 조성물을 제공할 수 있다.
본 발명의 다른 구현예로서, 상기 ROS 생성억제제는 소포체스트레스 활성화 방지 또는 억제를 통해 ROS 생성량을 감소시키는 것일 수 있으며, 구체적으로 상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA), 타우린 컨쥬게이티드 우르소데옥시콜산(taurine-conjugated ursodeoxycholic acid: TUDCA), 3-MA(3-Methyladenine) 및 클로로퀸(chloroquine diphosphate)으로 이루어진 군으로부터 선택된 하나 이상일 수 있으며, 바람직하게는 4-PBA일 수 있다.
본 발명의 다른 구현예로서, 상기 ROS 소거제는 N-아세틸 시스테인(N-acetyl cysteine: NAC) 초과산화물 불균등화효소 (superoxide dismutase 1: SOD1), 글루타치온(glutathione), 카탈라아제(catalase), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 바람직하게는 NAC일 수 있다.
본 발명의 다른 구현예로서, 상기 사이토카인 억제제는 플로레틴(Phloretin)일 수 있으며, 본 발명의 조성물은 바람직하게는 플로레틴과 상기 ROS 생성 억제제 및 소거제 군으로부터 하나 이상과의 복합일 수 있으며, 더욱 바람직하게는 플로레틴, 4-PBA 및 NAC와 복합물을 포함하는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 비강, 구강, 또는 흡입 투여용일 수 있으나, 바람직하게는 호흡을 이용하여 개체의 기관지 내부로 투여하는 흡입 투여용일 수 있다.
본 발명의 또 다른 구현예로서, 상기 바이러스는 산화적 스트레스와 사이토카인 폭풍을 유발하는 바이러스군일 수 있으며, 상기 바이러스의 비제한적인 예로 인플루엔자 A 바이러스, 인간면역결핍바이러스 및 코로나바이러스 외에 조류독감바이러스, 아프리카 돼지 열병바이러스(African swine fever virus, ASFV) 등 가축 전염 바이러스들이 있다. 본 발명에서 상기 바이러스는 본 발명의 약학적 조성물의 제형과 투여방법을 고려하여 특히 인플루엔자 A 바이러스 및 코로나바이러스(SARS-CoV-2)를 포함하는 호흡기 질환 유발 바이러스일 수 있다.
또한, 본 발명은 사이토카인 억제제를 개체에 투여하는 단계를 포함하는 바이러스 감염 질환의 예방 또는 치료 방법을 제공한다.
본 발명의 일 구현예로서, 상기 방법은 사이토카인 억제제와 함께 ROS 생성 억제제 및/또는 ROS 소거제를 개체에 투여하는 것일 수 있다.
본 발명의 다른 구현예로서, 상기 ROS 및 사이토카인 생성 억제제와 ROS 소거제는 동시에 또는 각각 순차로 투여되는 것일 수 있으나, 바람직하게는 하나의 조성물안에 혼합되어 동시에 투여하는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 ROS 및 사이토카인 생성 억제제와 ROS 소거제 복합제제는 개체의 입 또는 코를 통해 투여되는 것일 수 있으며, 코를 통해 투여되는 경우 상기 복합제제를 분사(spray)하여 투여할 수 있다. 즉, 상기 투여는 개체의 기관지 내부로 상기 복합제제가 전달될 수 있는 투여방법이라면 제한되지 아니하나, 바람직하게는 개체의 호흡을 통해 투여하는 것일 수 있다. 본 발명의 또 다른 구현예로서, 상기 투여는 1일 1회 이상 수행되는 것일 수 있다.
한편, 본 발명의 또 다른 구현예로서, 상기 ROS 생성 억제제 및 ROS 소거제가 각각 4-PBA 및 NAC인 경우, 상기 NAC은 개체의 단위 체중(1kg) 당 0.1 내지 5 mg 투여하는 것일 수 있다.
또한, 본 발명은 바이러스 감염 질환의 예방 또는 치료용 약제의 제조를 위한 사이토카인 억제제의 용도를 제공한다.
본 발명의 일 구현예로서, 상기 사이토카인 억제제는 ROS 생성 억제제 및/또는 ROS 소거제와 함께 바이러스 감염 질환의 예방 또는 치료용 약제의 제조를 위해 사용될 수 있다.
본 발명자들은 in vitro 실험에서 ROS 및 사이토카인 폭풍 억제제와 ROS 소거제를 사용하여 IAV 및 SARS-CoV-2 증식이 억제되는 것을 확인하였다. 나아가 동물모델에서 ROS 및 사이토카인 폭풍 억제제와 ROS 소거제를 사용하여 IAV 증식 억제를 확인하였다. 본 발명자들의 연구 결과 바이러스 감염 후 숙주세포에서 발생되는 사이토카인 폭풍과 ROS의 증가가 바이러스 증식에 많은 영향을 끼치는 것을 알 수 있었다. 본 발명은 바이러스 감염 질환을 예방, 치료, 및 개선할 수 있는 조성물에 관한 것으로서, 활성산소 및 사이토카인 생성억제제와 활성산소 소거제는 안전성이 이미 검증되어 본 발명의 조성물도 인체 적용에 안전성이 보장된다. 또한, 본 발명은 바이러스가 숙주세포의 사이토카인 폭풍과 산화적 손상을 야기하여 그 조건에서 바이러스 복제 및 감염을 활성화시키는 기전을 역으로 이용한 것으로서, 기존의 백신과 같이 특정 바이러스에 대한 직접적인 특이성(specificity)은 없으나, 바이러스의 종류나 변이(mutation)와 무관하게 사이토카인 폭풍과 산화적 스트레스를 유발하는 모든 바이러스에 대한 증식을 효율적으로 억제할 수 있는 장점이 있다. 또한, 본 발명의 조성물은 바이러스 돌연변이에 무관하게 바이러스 증식을 억제할 수 있는 바, 바이러스 변이에 의해 매년 새로 개발해야 하는 백신의 제한적 대체제로서 준범용 (sub-universal) 감염억제제 및 치료제로 적용될 수 있으며 방역 차원의 예방제 또는 보조제 등으로 활용될 수 있다. 아울러, 본 발명의 조성물은 바이러스 증식 억제와 동시에 산화적 스트레스와 사이토카인 폭풍에 의한 세포 및 조직의 손상을 최소화할 수 있다는 장점이 있다.
도 1a는 in vitro에서 인플루엔자 A 바이러스(IAV) 감염도가 증가함에 따라 숙주세포내 c-Jun을 활성화(p-c-Jun)하는 JNK의 인산화 정도(p-JNK)가 비례적으로 증가하는 것을 보여주는 도면이다.
도 1b는 p-JNK 활성화(PMA 처리) 혹은 억제(Go6893, PKC inhibitor 처리)에 따라 IAV의 복제효소(PB1)가 증가 혹은 감소함을 보여주는 도면이다. 즉 AP1(c-Jun/Fos) 유도 유전자(AP1-inducible genes)들을 포함한 사이토카인의 활성화가 IAV 복제에 영향주는 가능성을 보여주고 있다.
도 2는 in vitro에서 IAV 감염시 사이토카인 억제제 처리 농도가 높아질수록 바이러스 복제효소(PB1) 양이 현격히 감소됨을 확인한 것으로서 사이토카인 억제제로 이용한 플로레틴(Phloretin, Phl)의 IAV 감염억제에 대한 상승효과를 보여주는 도면이다.
도 3은 in vitro에서 인플루엔자 A 바이러스(IAV) 감염시 사이토카인 억제제(Phl) 처리로 JNK의 활성화 정도(p-JNK)가 감소될 때 사이토카인 tumor necrosis factor-α (TNFα) 단백질이 감소되면서 IAV 바이러스 단백질(PB1)이 비례적으로 감소되는 효과를 보여주는 도면이다.
도 4a는 in vitro에서 Phloretin (Phl) 처리 농도를 높여줄 때 IAV 바이러스 역가(titer)가 감소함을 보여주는 도면이다.
도 4b는 SARS-CoV-2를 감염 시킨 후 사이토카인 억제제 처리 농도에 따라 바이러스의 감염율(infectivity)가 급격히 감소됨을 보여주는 도면으로 cell viability 대비 각각의 억제제들의 바이러스 증식 억제율을 보여주는 도면이다. IC50(50% inhibitory concentration)가 측정되었다.
도 5는 IAV 감염 쥐를 이용한 in vivo 실험에서 사이토카인 억제제 phloretin (Phl)을 단독 투여하여 쥐의 체중변화를 통한 바이러스의 증식 및 감염 억제 효과를 비교 확인한 도면이다.
도 6a는 in vitro에서 인플루엔자 A 바이러스(IAV) 감염시 JNK의 활성화 정도(p-JNK)와 IAV(바이러스 단백질 PB1)가 증가될 때, ROS 생성억제제(4-PBA) 및 소거제(NAC) 처리로 IAV 증식이 감소되나 JNK 활성에 큰 변화가 없으나, 추가로 사이토카인 억제제 phloretin (Phl) 처리시 p-JNK와 PB1 모두 현격히 감소되는, 즉 Phloretin의 IAV 감염억제에 대한 상승효과를 보여주는 상호관계를 보여주는 도면이다.
도 6b는 in vitro에서 phloretin (Phl)의 IAV 감염에 대한 상승효과는 AP1 유도 유전자인 사이토카인류 interleukin 6 (IL-6)와 TNF-α의 발현 억제 효과와의 상호관계를 보여주는 도면이다.
도 7은 IAV 감염 쥐를 이용한 in vivo 실험에서 ROS 생성억제제(4-PBA) 및 ROS 소거제(NAC)의 처리 경우와 사이토카인 억제제(Phloretin, Phl)를 병용 투여하여 쥐의 체중변화를 통한 바이러스의 증식 및 감염 억제 효과를 비교 확인한 도면이다.
본 발명은 ROS의 과다생성과 염증을 유발하는 호흡기 감염 및 관련 질환에서 효율적인 ROS 및 사이토카인 생성억제와 ROS 소거작용을 통하여 조직 손상을 최소화하고 바이러스 감염 질환의 예방 및 치료에 적용되는 항산화, 항염증 및 항바이러스제 복합 조성물에 대한 것이다.
본 발명자들은 인플루엔자바이러스의 감염시 숙주세포에서 발생하는 산화적 스트레스와 바이러스의 감염 및 증식간의 관계에 대해 연구한 결과, 바이러스 감염에 따라 ROS의 생성이 증가됨을 확인하여 바이러스 증식에 ROS 누적이 도움을 주는 것을 확인하였다. 또한, 상기 ROS 증가는 소포체스트레스의 주요 반응경로와 자가포식(autophagy) 반응기작의 활성화에 의한 것으로서, 이러한 바이러스 감염 기작을 역으로 이용하여 생성되는 ROS 생성경로를 차단하고 기생성된 ROS를 소거하는 경우 바이러스의 역가(titer)가 감소함을 관찰하였다. 동시에 IAV 감염스트레스에 의하여 발생되어 염증을 가속화하는 사이토카인 폭풍은 직접적으로 작용하는 사이토카인 억제제 처리로 효율적으로 대표적인 염증 사이토카인들이 제어됨을 확인하였다. 이에, ROS 및 사이토카인 생성억제와 ROS 소거제의 복합 투여가 세포 및 조직 손상을 효과적으로 억제하고 바이러스 감염 질환의 예방 효과가 있음을 확인하였으며, 나아가 사이토카인 생성억제제를 동시에 투여하는 경우 ROS 생성억제 및 소거제를 처리하는 경우보다 현저하게 우수한 바이러스 감염 및 증식을 제어할 수 있음을 실험적으로 확인하고 본 발명을 완성하였다.
보다 구체적으로, 인간 폐포상피 세포주(alveolar epithelial cell line) A549를 이용한 in vitro 실험에서 인플루엔자 바이러스 감염 정도에 따라 JNK의 활성화를 나타내는 인산화 수준이 크게 증가하는 것이 관찰되었으며, 상기 JNK 경로의 활성화를 조절함으로서 바이러스 증식 또한 조절할 수 있음을 확인하였다(실시예 1 참조).
한편, 플로레틴은 천연 폴리페놀류인 플라보노이드(flavonoid)의 일종으로서 항산화 및 항염증 효과가 있다. 본 발명자의 구체적인 실험에서는 플로레틴을 사이토카인 억제제로서 이용하였으며, 그 결과 플로레틴의 처리 농도에 의존하여 바이러스 유전자의 복제가 억제됨을 확인하였고(실시예 2 참조), 나아가, 플로레틴의 바이러스 증식 억제 활성이 바이러스 감염된 세포에서 JNK 경로 활성을 차단함으로써 달성됨을 확인하였다(실시예 3 참조).
또한, 본 발명자들은 인플루엔자 A 바이러스 외에도 SARS-CoV-2 바이러스에서도 플로레틴의 동일한 작용을 확인하였는바, JNK 경로 차단을 통하여 개선, 예방, 및 치료 대상 바이러스 감염 질환이 인플루엔자 바이러스에 한정되지 않고 다양한 바이러스 질환에 범용적으로 적용될 수 있음을 알 수 있었다(실시예 3 참조).
즉, 본 발명자들은 바이러스 감염시 활성화되어 사이토카인 생성을 촉진시키는 JNK 경로를 조절하여 바이러스 증식을 억제할 수 있음을 확인하였는바, JNK 경로 억제를 통한 사이토카인 억제제를 바이러스 감염 질환의 개선, 예방, 및 치료의 용도로 제공한다.
세포실에서 확인한 사이토카인 억제를 통한 바이러스 증식 억제 전략의 임상적 제공 가능성을 확인하고자 바이러스에 감염시킨 쥐에 플로레틴을 단독 비강 투여하여 쥐의 체중 변화를 확인하여 바이러스 증식 및 감염 억제 효과를 in vivo에서 평가하였다. 그 결과, 플로레틴 단독 투여 시 바이러스 감염에 의해 감소된 쥐의 체중을 회복하고 바이러스의 감염에 따른 쥐의 사망률을 감소시킴을 확인하였다(실시예 5 참조).
한편, 본 발명자들은 이전의 연구에서 바이러스 감염에 따른 ER 스트레스 증가와, 상기 ER 스트레스 증가에 따른 ROS 축적이 바이러스 증식을 가속화하고, ER 스트레스 조절에 따른 ROS 생성 억제와 축적된 ROS를 소거함으로써 바이러스 감염 질환을 예방 및 치료할 수 있음을 확인하였다.
이에, 본 발명자들은 JNK 경로 활성화를 차단하는 사이토카인 억제제와 ROS 생성 억제 및 소거를 동시에 달성하는 것으로 바이러스 감염 질환을 보다 효과적으로 제어할 수 있는지 확인하고자 하였다. 구체적으로, ROS 생성 억제제로서 4PBA와 ROS 소거제로서 NAC을 선정하여 바이러스 감염된 세포에 사이토카인 억제제로서 플로레틴을 병용투여 하여 JNK 인산화 수준과 viral protein인 PB1의 발현 수준을 확인하였다. 그 결과, 사이토카인 억제제와 ROS 생성 억제제 및 ROS 소거제를 동시에 투여하는 경우 각각 단독으로 투여하는 것과 비교하여 현저하게 바이러스 증식을 억제할 수 있음을 확인하였다(실시예 6 참조).
또한 인플루엔자 바이러스 감염 후 ROS 생성억제제와 소거제에 복합하여 사이토카인 억제제를 처리한 실험군에서 인산화 JNK의 수준이 급격하게 줄어들었으며, 비례적으로 바이러스 단백질(PB1)의 발현양도 현저하게 줄어드는 것을 확인할 수 있었다. 나아가, 상기 병용투여군에서는 염증 유발 사이토카인인 IL-6 및 TNF-α의 mRNA 양이 현저하게 감소됨을 알 수 있었다(실시예 6 참조).
이전의 연구와 본 출원의 연구 결과를 종합하여 볼 때, in vitro 실험에서 사이토카인 억제제는 단독 또는 ROS 생성 차단 및 제거제와 함께 바이러스 단백질의 합성을 억제할 수 있다. 또한, 바이러스가 유도하는 ROS를 차단 및 제거를 하면 바이러스의 단백질합성을 제어하며 바이러스 감염전파와 증식 억제에 효과가 있음을 재확인하였으며, 이러한 조건에서 사이토카인 억제제를 추가로 복합처리하면 효율적인 상승효과로 인하여 더욱 신속하게 바이러스 증식을 현저히 억제함을 알 수 있다.
본 발명의 구체적인 실시예에서는 ROS 누적과 사이토카인 증가가 인플루엔자바이러스(IAV) 이외에도 코로나바이러스(SARS-CoV-2)의 복제능에도 영향을 나타냄을 확인하였다. SARS-CoV-2 감염에도 ROS 생성억제제(4-PBA), ROS 소거제(NAC), 사이토카인 억제제(Phloretin)를 각각 농도별로 처리한 결과, 코로나바이러스의 증식억제에도 현저한 효과를 보였으며 각각의 유효 농도에서 세포독성은 유의할 수준이 아님을 확인하였다. 코로나바이러스 분석 시험 시, 대조구로는 일반적인 항코로나바이러스 감염 치료제를 사용하여 비교하였다(data 생략). 즉, 바이러스 감염 시, ROS 누적 및 염증 사이토카인의 증가는 바이러스 복제의 충분필요조건임을 SARS-CoV-2 (Covid 19)에서도 검증하였다.
또한, IAV에 대한 동물모델에서 ROS 생성 억제제와 소거제의 복합 투여시 바이러스 증식에 미치는 영향을 동물모델의 체중측정을 분석하여 확인하였으며, 그결과, ROS 누적을 억제하는 처리만으로도 바이러스 감염에 의해 감소된 체중이 유의하게 회복되었음을 확인하였고, 나아가 사이토카인 억제제를 추가로 복합 투여한 쥐들의 체중은 보다 더 정상에 가깝게 유지되며 회복되었다. 즉, ROS 생성 억제제와 소거제 처리에 추가한 사이토카인 억제제는 항바이러스제로서 상승작용이 있어 효율적으로 바이러스 감염을 제어할 수 있음을 확인하였다 (실시예 7 참조).
따라서 본 발명은 ROS 및 사이토카인 억제제와 ROS 소거제를 유효성분으로 포함하는 바이러스 감염질환의 예방, 치료, 또는 개선을 위한 조성물을 제공할 수 있다.
본 발명에서 "글루타치온(glutathione: GSH)"은 생체내 가장 풍부하고 여러 효소를 보조하는 대표적인 항산화제로서, 세포 내의 산화적 스트레스가 유발되면 GSH 감소되거나 결핍되는 현상이 나타나는 것이 알려져 있다.
또한, 본 발명에서 "N-아세틸 시스테인(N-acetyl cysteine: NAC)"은 직접 항산화제로 작용하기도 하며 GSH의 전구물질로도 작용하여 간접적인 항산화 효과를 나타내기도 하나, 생체내 처리시 경미한 부작용을 유발하는 것이 알려져 있다. 따라서, 본 발명의 조성물에서 NAC이 포함되는 경우 NAC은 비강으로 투여되는 동물 개체의 단위 체중(20g) 당 1 mg 이하로 투여되도록 조절한다. 또한, NAC은 SOD1을 포함하여 4-PBA, Phloretin 등과 함께 처리되는 경우에 적은 용량으로도 효과적으로 감염에 의한 개체의 체중 회복, 기관지에서의 ROS 누적 감소 및 바이러스 역가 감소를 달성할 수 있으므로 특히 경구 복합투여시 감량하는 것이 바람직하다.
한편, 본 발명에서 "4-페닐부티레이트(4-phenylbutyrate: 4-PBA)"는 소포체스트레스 억제를 통해 ROS의 생성을 억제하는 것으로서 항바이러스 기능을 지닌 유효 단백질들을 안정화시키는 기능을 동시에 갖는다. 경구 투여량은 동물 개체의 단위 체중(1 Kg) 당 50 mg 이하로 투여되도록 조절하는 것이 바람직하다. 한편, Phloretin의 비강 투여시 10-30 mg/Kg, 경구 투여시 1/3 수준의 적은 용량을 처리할 때 본 실험에서 확인하고자 하는 유효 효과가 관찰되었다.
본 발명은 ROS 및 사이토카인 생성억제제와 ROS 소거제 복합제제를 처리하여 ROS 생성억제와 소거뿐만 아니라 원천적으로 사이토카인 생성을 억제하여 염증으로 인한 조직손상과 바이러스 증식 및 감염전파의 억제 효율을 현저하게 증가시킬 뿐만 아니라, 숙주의 감염세포 및 주변 조직 등의 손상을 방지하거나 최소화하며 항바이러스제 및 감염치료제로 사용할 수 있음을 제안한다.
본 발명에 따른 바이러스 질환 예방 또는 치료용 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 외용제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있으며, 바람직하게는 분무제의 제형을 가질 수 있다.
상기 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
본 발명의 약학적 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나 바람직한 효과를 위해서, 본 발명의 약학적 조성물은 1일 0.0001 내지 100㎎/㎏으로, 바람직하게는 0.001 내지 10㎎/㎏으로 투여하는 것이 좋다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명에 따른 약제학적 조성물은 쥐, 생쥐, 가축, 인간 등의 포유동물에 비경구, 경구 등의 다양한 경로로 투여될 수 있으며, 투여의 모든 방식은 예상될 수 있는데, 특히 흡입 분무를 통한 경우 또는 비강 투여일 수 있다. 또한, 경구형 제형의 경우도 환자의 나이, 성별, 체중에 따라 달라질 수 있으나, 0.1 내지 100㎎/㎏의 양을 1일 1회 내지 수회 투여할 수 있다. 또한 그 투여량은 투여경로, 질병의 정도, 성별, 체중, 나이 등에 따라서 증감될 수 있다. 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
아울러, 본 발명은 바이러스 질환 예방 또는 치료용 건강기능식품 조성물을 제공한다. 또한, 본 발명의 조성물은 체지방 감소 또는 바이러스 질환 개선을 목적으로 식품에 첨가될 수 있다. 본 발명의 사이토카인 억제제, ROS 생성 억제제, 및/또는 ROS 소거제를 식품 첨가물로 사용할 경우, 상기 각 구성을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조 시 본 발명의 피시온은 원료에 대하여 15 중량% 이하, 바람직하게는 10 중량% 이하의 양으로 첨가된다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.
상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다.
본 발명에 따른 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당 및 과당과 같은 모노사카라이드, 말토오스 및 수크로오스와 같은 디사카라이드, 덱스트린 및 시클로덱스트린과 같은 폴리사카라이드, 및 자일리톨, 소르비톨 및 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 mL당 일반적으로 약 0.01-0.20g, 바람직하게는 약 0.04-0.10g이다.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01-0.20 중량부의 범위에서 선택되는 것이 일반적이다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[재료 및 방법]
1. 인플루엔자 바이러스 생산 및 배양
재조합 IAV (A/WSN/1933)는 R.G. Webster (University of Tennessee, TN, USA)가 제공한 8개의 바이러스 RNA에 대한 cDNA(서열번호 1 내지 8)가 들어있는 플라스미드를 293T 세포에 co-transfection하고, 세포 배양액을 채취하여 원심분리한 후 그 상등액을 획득하였다.
구체적으로, transfection agent는 lipofectamine 2000을 사용하였으며, transfection은 24시간 동안 수행되었다. 293T 세포는 DMEM에 10% FBS이 포함된 배지에서 배양하여 transfection시켰으며, 다음날 BSA 0.3%을 포함한 Opti-MEM 배지로 교체하여 배양하였다. 배지 교체 48시간 이후에 세포 배양액만을 채취하여 13,000 rpm으로 1~2 분 동안 원심분리 후 상등액에서 바이러스를 획득하였다.
이어서, 상기 획득된 IAV를 Madin-Darby canine kidney (MDCK) 세포에 감염시키고 24 내지 48 시간 이후에 사용할 바이러스를 획득하였다.
2. 바이러스역가 분석(Plaque assay)
Plaque assay를 위한 세포로는 MDCK line을 사용하였다. 6-웰 플레이트의 각 웰(well)당 MDCK 세포를 1.0×106개씩 분주하고 100% confluency에서 연속희석법(serial dilution)을 통해 희석된 바이러스를 각 웰당 500 μl씩 투입하여 감염 과정을 1시간 동안 수행하였다. 이때 배지는 Opti-MEM, 0.3% BSA, 1 μg/ml TPCK-trypsin을 사용하였으며, 감염 과정 이후에 agar media(2x L-15 medium, 0.8% agar, 0.075% NaHCO3, 1 μg/ml TPCK-trypsin, 0.3% BSA, 1x glutamate/antibiotics)로 교체하였다. 배지 교체 후 굳을 때까지 상온에서 유지한 후 37℃, 5기압 CO2 조건에서 2~3일 동안 배양하였다.
3. 바이러스 감염 및 동물실험
조직배양의 감염은 역가(titer)가 측정된 바이러스를 인간 폐상피세포 (Human alveolar epithelial cells) A549에 대부분 0.01 MOI로 감염시켰다. 1시간 감염 후, 세포들을 PBS (phosphate-buered saline)으로 세척하고 2% FBS가 포함된 RPMI 1640 혹은 DMEM과 함께 24시간 동안 배양하였다.
동물 감염 실험은 5주령의 쥐(BALB/c)를 이용하였고 쥐의 경구(oral) 혹은 비강(intranasal)을 통하여 IAV 150 ~ 500 PFU (Plaque forming unit)로 감염시킨 후, 사육하는 기간 동안 체중을 측정하였다.
4. 웨스턴 블럿 (Western blot)
세포주 실험에서는 12-well 플레이트에서 2×105 cells/well 씩 감염 후 24시간 동안 배양하였다. 사용한 세포주들을 Nonidet-P40 (150mM NaCl, 1% NP-40, 50 mM Tris pH 8.0, 2 mg/ml aprotinan, 1 mM lupeptin, 0.1 mM PMSF)으로 ice에서 15분 분해시킨 후 13,000 rpm으로 15분 동안 원심분리하고 그 상층액을 12.5% PAGE로 분리하였다. PVDF membrane에 옮긴 후 PB1, p-JNK, p-c-Jun 그리고 actin 항체를 사용하여 분석하였다.
5. RT-PCR
12-웰 플레이트의 각 웰에 2×105 개의 세포를 분주하여 배양하고 상기 세포를 IAV로 감염시킨 후 24시간 동안 배양하였다. 배지만 첨가된 음성대조군과 감염만 시킨 대조군(MOI 0.01) 세포주에서 RNA를 분리하여 역전사 반응으로 cDNA를 획득하였다. 발현 정도를 측정하기 위해 획득된 cDNA를 형판(template)으로 사용하고, IL-6 프라이머(sense, 5´-AGCGCCTTCGGTCCAGTTGC-3´; anti-sense, 5´-TGCCAGTGCCTCTTTGCTGCT-3´), TNF-α 프라이머(sense, 5´- CTGGGCAGGTCTACTTTGGG-3′; anti-sense, 5′- CTGGAGGCCCCAGTTTGAAT -3′) 그리고 GADPH 프라이머(sense, 5´- AGAAGGCTGGGGCTCATTTG -3′; anti-sense, 5′- AGGGGCCATCCACAGTCTTC -3′)를 이용해 중합효소연쇄반응으로 IL-6, TNF-α 그리고 GADPH mRNA 발현을 비교하였다.
6. SARS-CoV-2 감염 후 면역 형광법에 의한 용량반응곡선 분석
384-웰 플레이트에 웰당 1.2x104 개의 Vero 세포를 접종하였다. 화합물 처리 약 1 시간 후, BSL3 시설에서 세포에 SARS-CoV-2 (0.0125 MOI)를 감염시키고 37°C에서 24 시간 동안 배양하였다. 이후 4% paraformaldehyde (PFA)로 세포를 고정한 뒤, permeabilization 하였다. 그 후 anti-SARS-CoV-2 nucleocapsid (N) 1 차 항체를 처리하고, Alexa Fluor 488-conjugated goat anti-rabbit IgG 2 차 항체와 Hoechst 33342를 처리하여 세포를 염색하였다. 감염된 세포의 형광 이미지는 대용량 이미지 분석 기기인 Operetta (Perkin Elmer)를 이용하여 획득했다.
약물 농도에 따른반응 곡선과 IC50, CC50 값은 XLFit 4 (IDBS) 소프트웨어의 Y = Bottom + (Top-Bottom)/(1 + (IC50/X)Hillslope) 수식을 활용해 도출하였다. 모든 IC50 와 CC50 값은 두번의 반복실험으로 획득한 적합 용량반응곡선 (fitted dose-response curve)에서 산출하였고, 선택지수 (Selectivity index; SI) 값은 CC50/IC50으로 계산되었다.
7. 통계적 분석
대조군과 실험군의 차이는 paired Student's t-test에 의해서 평가되었으며, P-values<0.05 인 경우 유의한 차이로 고려되었다.
[실험 결과]
실시예 1. 인플루엔자 바이러스 감염과 JNK 활성화 상호관계 확인
인플루엔자 바이러스 감염 시 염증 유발하는 AP1-유도 사이토카인 발현에 영향을 주는 JNK 인산화 효소의 활성을 측정하기 위하여 A549 폐세포주에 MOI (multiplicity of infection) 0.01로 IAV를 24시간 동안 감염시켰다. 바이러스 감염 후 바이러스 감염 정도에 따라 JNK 활성도 변화를 알아보기 위하여 감염시킨 A549 세포주를 Western blot을 수행하여 JNK와 c-Jun의 인산화 정도 증감을 비교하였다. 결과는 IAV 감염도가 증가함에 따라 숙주세포내 c-Jun을 활성화(p-c-Jun)하는 JNK의 인산화 정도(p-JNK)가 비례적으로 증가하는 것이 관찰되었다. 즉 IAV 감염으로 AP1(c-Jun/Fos) 유도 유전자(AP1-inducible genes)들의 활성화 가능성을 보여주고 있다.
또한 바이러스 감염으로 인한 PKC-JNK 회로의 활성과 IAV 복제효소(PB1)와의 상관관계를 확인하기 위하여 PKC-JNK 활성화제(PMA) 혹은 억제제(Go6893) 처리에 따라 JNK의 인산화 정도(p-JNK)와 IAV PB1에 대한 Western blot을 수행하였다. 실험 결과, p-JNK와 IAV PB1 수준이 상호 비례하는 것으로 보아 바이러스 감염 유래 유도 유전자(AP1-inducible genes)들을 포함한 사이토카인의 생성 억제 혹은 활성화 억제시 바이러스 복제를 감소시킬 가능성을 알 수 있다.
실시예 2. 플로레틴(phloretin)의 바이러스 증식의 억제 효과
인플루엔자 A 바이러스(IAV) 플로레틴 처리 농도가 높아질수록 바이러스 복제효소(PB1) 양이 현격히 감소되는 것이 관찰되었다. 즉 플로레틴 처리 농도가 증가할 수록 IAV 바이러스 유전자 복제를 억제하여 바이러스 증식을 억제할 수 있음을 알 수 있다.
실시예 3. 플로레틴의 JNK 활성화 억제 효과 : 사이토카인 폭풍과 바이러스 증식과의 상관관계
인플루엔자 A 바이러스(IAV) 감염시 Phloretin의 처리로 바이러스 증식이 억제되는 효과가 사이토카인 억제제 처리로 인한 JNK의 활성화 정도와 관련이 있는지 확인하였다. 플로레틴의 처리 농도가 높을수록 JNK의 활성화 정도(p-JNK)가 감소하고 동시에 비례적으로 사이토카인 TNFα 단백질이 감소되면서 IAV 바이러스 복제효소(PB1) 수준이 감소하였다. 즉 플로레틴 처리에 의한 바이러스 증식 억제 현상은 AP1-유도 사이토카인 발현에 영향을 주는 JNK 인산화 효소의 활성 정도와 긴밀한 관계가 있음을 확인하였다.
실시예 4. 플로레틴의 바이러스 역가 및 감염율 억제 효과
플로레틴 처리가 직접적으로 바이러스 증식을 억제하는 지를 확인하기 위하여 농도를 달리하여 플로레틴을 처리한 후 IAV 바이러스 역가(titer)를 측정한 결과, 플로레틴 처리 농도에 비례하여 역가가 현저히 감소하였다.
또한, SARS-CoV-2에 대한 Phloretin 효능을 측정하기 위하여 BSL3 시설에서 Vero 세포에 SARS-CoV-2 (0.0125 MOI)를 감염시키고 Phloretin을 주어진 농도별로 처리하고 anti-SARS-CoV-2 nucleocapsid (N) 항체를 이용하여 감염된 세포의 형광 이미지를 측정하였다. 실험 결과, 주어진 처리 농도의 Phloretin은 cell viability를 크게 영향주지 않으며 효율적으로 바이러스 감염율을 억제하는 efficacy를 보여주었다. SARS-CoV-2에 대한 Phloretin의 IC50(50% inhibitory concentration)과 CC50(50% cytotoxic concentration)도 측정되었다.
실시예 5. 인플루엔자 바이러스 감염 동물모델에서 항바이러스제로서 플로레틴의 바이러스 감염율 억제 효과
바이러스 감염 후 플로레틴의 바이러스 증식 억제 효과를 알아보기 위하여 3~4주령 쥐(BALB/c)에 IAV 500 PFU로 감염시킨 후 플로레틴을 단독 비강 투여하고 매일 쥐의 체중 변화를 통한 바이러스의 증식 및 감염 억제 효과를 관찰하였다.
그 결과, 플로레틴 단독 처리만으로 바이러스 감염에 의해 감소된 체중이 93% 이상으로 유의하게 회복되고, 사망률이 감소하였음을 확인하였다(도 5).
실시예 6. 활성산소 생성억제 및 소거제와 병용 처리: 사이토카인 억제제의 항바이러스 상승 효과
A549 세포에 인플루엔자바이러스 감염 후, 항바이러스 효능의 ROS 생성억제제(4-PBA)와 소거제(NAC)에 대한 바이러스 증식억제 상승(synergy) 효과 여부를 확인하기 위하여 사이토카인 억제제(Phloretin)의 병용처리 효과를 측정하였다. 바이러스 감염 세포에 대한 항바이러스 후보물질 처리 후 Western blot을 수행하여 JNK 인산화 수준과 바이러스 단백질인 PB1의 발현 수준 증감을 비교하였다.
대조구인 IAV 바이러스 감염만 시킨 것은 JNK의 활성화 정도(p-JNK)와 IAV PB1 단백질량이 크게 증가된 한편, ROS 생성억제제(4-PBA) 및 소거제(NAC) 처리시 IAV PB1 단백질양은 감소되나 JNK 활성에 큰 변화가 없었다(도 6a).
그러나, 추가로 사이토카인 억제제로서 플로레틴을 병용처리시 p-JNK와 PB1 모두 현격히 감소되는 것이 관찰되어 Phloretin의 IAV 감염억제에 대한 상승효과를 보여주는 상호관계를 보여주고 있음이 확인되었다. 상기 결과로부터 인플루엔자 바이러스 감염이 활성화된 p-JNK의 양이 바이러스의 증식과 밀접한 상관관계가 있음을 확인하였다(도 6b).
일반적으로 염증 유발 사이토카인으로 인터루킨(interleukin 6: IL-6)와 종양괴사인자- α(tumor necrosis factor-α: TNF-α)가 알려져 있으며, JNK 활성에 의존되는 AP1에 의하여 유도되는 유전자들이다. 본 실험에서 IAV 바이러스 증식 억제 효과를 보이는 각 처리 조건에서 사이토카인 IL-6과 TNF-α의 양적 변화 여부를 관찰하였다. IAV 바이러스 감염 후 ROS 생성억제제 및 소거제 처리에 사이토카인 억제제를 추가로 복합처리한 in vitro 실험에서 사이토카인 IL-6 및 TNF-α의 mRNA 양이 현저하게 감소됨과 동시에 바이러스 증식을 급속하게 억제하였음을 확인하였다. 즉, 처리 농도별 Phloretin의 IAV 감염에 대한 항바이러스제로서 상승효과는 사이토카인 폭풍의 주요 인자인 IL-6와 TNF-α의 발현 억제에 대한 효과와의 상호관계를 보여주고 있다.
실시예 7. 인플루엔자 바이러스 감염 동물모델에서 항바이러스제로서 phloretin의 바이러스 감염율 억제 상승효과
감염 동물모델에서 바이러스 감염억제제로서 ROS 생성 억제제와 소거제 외에 추가적으로 플로레틴을 처리시 항바이러스 상승효과 여부에 대한 확인 실험을 하였다. IAV 감염 쥐(BALB/c)에 ROS 생성억제제(4-PBA) 및 소거제(NAC)의 처리 경우와 사이토카인 억제제(Phloretin)를 병용 투여한 경우에서 쥐의 체중변화를 통한 바이러스의 증식 및 감염 억제 효과를 관찰하였다. 그 결과, ROS 누적을 억제하는 처리만으로도 바이러스 감염에 의해 감소된 체중이 유의하게 회복되었음을 확인하였고, 나아가 사이토카인 억제제인 플로레틴을 추가로 복합 투여한 쥐들의 체중은 보다 더 정상(~96%)에 가깝게 유지되며 회복되었다(도 7). 즉, ROS 생성 억제제와 소거제 처리에 추가한 사이토카인 억제제는 항바이러스제로서 상승작용이 있어 효율적으로 바이러스 감염을 제어할 수 있음을 확인하였다. 한편, 플로레틴과 4-PBA 및 NAC의 병용 투여는 플로레틴 단독 투여보다 바이러스 감염에 의해 감소된 체중을 정상에 가깝게 회복할 수 있음을 알 수 있다(도 5 참조).
따라서 본 발명은 사이토카인 생성억제제 단독 혹은 ROS 생성억제제 및 소거제와 혼합된 병용물을 바이러스 감염질환의 예방, 치료, 또는 개선을 위한 조성물을 제공할 수 있다.
이상과 같이 실시예들이 비록 한정된 도면에 의해 설명되었으나, 해당 기술분야에서 통상의 지식을 가진 자라면 상기를 기초로 다양한 기술적 수정 및 변형을 적용할 수 있다. 예를 들어, 설명된 기술들이 설명된 방법과 다른 순서로 수행되거나, 및/또는 설명된 시스템, 구조, 장치, 회로 등의 구성요소들이 설명된 방법과 다른 형태로 결합 또는 조합되거나, 다른 구성요소 또는 균등물에 의하여 대치되거나 치환되더라도 적절한 결과가 달성될 수 있다.
그러므로, 다른 구현들, 다른 실시예들 및 특허청구범위와 균등한 것들도 후술하는 청구범위의 범위에 속한다.
본 발명은 바이러스 감염 질환을 예방, 치료, 및 개선할 수 있는 조성물에 관한 것으로서, 사용한 활성산소 생성억제제 및 활성산소 소거제 그리고 사이토카인 억제제는 안전성이 이미 검증되어 본 발명의 조성물도 인체 적용에 안전성이 보장되고, 본 발명은 바이러스가 숙주세포의 산화적 손상, 사이토카인 폭풍을 야기하여 그 조건에서 바이러스 복제 및 감염을 활성화시키는 기전을 역으로 이용한 것으로서, 기존의 백신과 같이 특정 바이러스에 대한 직접 특이적으로 작용하는 기작이 아니고, 바이러스의 종류나 변이(mutation)에 의존도가 낮으며 산화적 스트레스와 사이토카인 폭풍을 유발하는 대부분의 바이러스에 대한 증식을 효율적으로 억제할 수 있는 바, 신종바이러스의 출현이나 바이러스 변이에 의해 매년 새로 개발해야 하는 백신의 제한적 대체제로서 준범용(sub-universal) 감염억제제 및 치료제로 적용될 수 있으며 방역 차원의 예방제 또는 보조제 등으로 활용될 것으로 기대된다.

Claims (22)

  1. 사이토카인 억제제를 유효성분으로 포함하는 바이러스 감염 질환의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 사이토카인 억제제는 JNK 경로 활성화를 차단 또는 억제하는 것인, 약학적 조성물.
  3. 제1항에 있어서,
    상기 사이토카인 억제제는 플로레틴(Phloretin) 및 플로리진(phloridzin)으로 이루어진 군으로부터 선택된 하나 이상의 플라보노이드(Flavonoid)인 것인, 약학적 조성물.
  4. 제1항에 있어서,
    상기 바이러스는 인플루엔자 바이러스 및 코로나바이러스를 포함하는 산화적 스트레스와 사이토카인 폭풍을 유발하는 바이러스로 이루어진 군으로부터 선택되는 하나 이상의 바이러스인 것을 특징으로 하는, 약학적 조성물.
  5. 제1항에 있어서,
    상기 조성물은 흡입 분무에 의한 비강 또는 구강 투여용인 것을 특징으로 하는, 약학적 조성물.
  6. 제1항에 있어서,
    상기 조성물은 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제로 이루어진 군으로부터 선택된 하나 이상의 항산화제를 추가로 포함하며,
    상기 ROS 생성 억제제는 소포체 스트레스 활성화 억제를 통한 ROS 생성을 억제하는 것이며,
    상기 ROS 소거제는 기생성된 ROS를 제거하는 것인, 약학적 조성물.
  7. 제6항에 있어서,
    상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA), 타우린 컨쥬게이티드 우르소데옥시콜산 (taurine-conjugated ursodeoxycholic acid: TUDCA), 3-MA (3-Methyladenine) 및 클로로퀸 (chloroquine diphosphate)으로 이루어진 군으로부터 선택된 하나 이상인 것인, 약학적 조성물.
  8. 제6항에 있어서,
    상기 ROS 소거제는 N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상인 것인, 약학적 조성물.
  9. JNK 경로 활성화를 차단 또는 억제하는 사이토카인 억제제를 유효성분으로 포함하는 바이러스 감염 질환의 예방 또는 개선용 식품 조성물.
  10. 제9항에 있어서,
    상기 사이토카인 억제제는 플로레틴(Phloretin) 및 플로리진(phloridzin)으로 이루어진 군으로부터 선택된 하나 이상의 플라보노이드(Flavonoid)인 것인, 식품 조성물.
  11. 제9항에 있어서,
    상기 조성물은 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제로 이루어진 군으로부터 선택된 하나 이상의 항산화제를 추가로 포함하며,
    상기 ROS 생성 억제제는 소포체 스트레스 활성화 억제를 통한 ROS 생성을 억제하는 것이며,
    상기 ROS 소거제는 기생성된 ROS를 제거하는 것인, 식품 조성물.
  12. 제11항에 있어서,
    상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA), 타우린 컨쥬게이티드 우르소데옥시콜산(taurine-conjugated ursodeoxycholic acid: TUDCA), 3-MA(3-Methyladenine) 및 클로로퀸(chloroquine diphosphate)으로 이루어진 군으로부터 선택된 하나 이상이고,
    상기 ROS 소거제는 N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 식품 조성물.
  13. 제9항에 있어서,
    상기 바이러스는 인플루엔자 바이러스 및 코로나바이러스로 이루어진 군으로부터 선택되는 하나 이상의 바이러스인 것을 특징으로 하는, 식품 조성물.
  14. 사이토카인 억제제를 유효성분으로 포함하는, 바이러스 감염 질환의 예방 또는 개선용 사료 첨가제로서,
    상기 사이토카인 억제제는 플로레틴(Phloretin) 및 플로리진(phloridzin)으로 이루어진 군으로부터 선택된 하나 이상의 플라보노이드(Flavonoid)인 것인, 사료 첨가제.
  15. 제14항에 있어서,
    상기 첨가제는 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제로 이루어진 군으로부터 선택된 하나 이상의 항산화제를 추가로 포함하며,
    상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA), 타우린 컨쥬게이티드 우르소데옥시콜산(taurine-conjugated ursodeoxycholic acid: TUDCA), 3-MA(3-Methyladenine) 및 클로로퀸(chloroquine diphosphate)으로 이루어진 군으로부터 선택된 하나 이상이고,
    상기 ROS 소거제는 N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 사료 첨가제.
  16. JNK 경로 활성화를 차단 또는 억제하는 사이토카인 억제제를 유효성분으로 포함하는, 바이러스 감염 질환 방역용 조성물.
  17. 제16항에 있어서,
    상기 조성물은 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제로 이루어진 군으로부터 선택된 하나 이상의 항산화제를 추가로 포함하며,
    상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA), 타우린 컨쥬게이티드 우르소데옥시콜산(taurine-conjugated ursodeoxycholic acid: TUDCA), 3-MA(3-Methyladenine) 및 클로로퀸(chloroquine diphosphate)으로 이루어진 군으로부터 선택된 하나 이상이고,
    상기 ROS 소거제는 N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상이며,
    상기 사이토카인 억제제는 플로레틴(Phloretin) 및 플로리진(phloridzin)으로 이루어진 군으로부터 선택된 하나 이상의 플라보노이드(Flavonoid)인 것인, 방역용 조성물.
  18. JNK 경로 활성화를 차단 또는 억제하는 사이토카인 억제제를 유효성분으로 포함하는, 바이러스 감염 질환 예방 또는 개선용 향장 조성물로서,
    상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA), 타우린 컨쥬게이티드 우르소데옥시콜산(taurine-conjugated ursodeoxycholic acid: TUDCA), 3-MA(3-Methyladenine) 및 클로로퀸(chloroquine diphosphate)으로 이루어진 군으로부터 선택된 하나 이상이고,
    상기 ROS 소거제는 N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상이며,
    상기 사이토카인 억제제는 플로레틴(Phloretin) 및 플로리진(phloridzin)으로 이루어진 군으로부터 선택된 하나 이상의 플라보노이드(Flavonoid)인 것인, 향장 조성물.
  19. JNK 경로 활성화를 차단 또는 억제하는 사이토카인 억제제를 개체에 투여하는 단계를 포함하는 바이러스 감염 질환 예방 또는 치료 방법.
  20. 제19항에 있어서,
    상기 방법은 사이토카인 억제제와 함께 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제로 이루어진 군으로부터 선택된 하나 이상의 항산화제를 추가로 개체에 투여하는 것인, 방법.
  21. 제20항에 있어서,
    상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA)이고,
    상기 ROS 소거제는 N-아세틸 시스테인(N-acetyl cysteine: NAC)이고,
    상기 NAC은 개체의 단위 체중(1kg) 당 0.1 내지 5 mg 투여하고
    상기 사이토카인 억제제는 플로레틴(Phloretin)을 투여하는 것을 특징으로 하는, 방법.
  22. 바이러스 감염 질환의 예방 또는 치료용 약제의 제조를 위한 활성산소(reactive oxygen species: ROS) 및 사이토카인 생성억제제와 ROS 소거제의 복합제제의 용도.
PCT/KR2022/004500 2021-03-30 2022-03-30 사이토카인 억제제와 활성산소 생성억제제 및 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물 WO2022211486A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210040870 2021-03-30
KR10-2021-0040870 2021-03-30
KR10-2022-0038858 2022-03-29
KR1020220038858A KR20220136910A (ko) 2021-03-30 2022-03-29 사이토카인 억제제와 활성산소 생성억제제 및 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물

Publications (1)

Publication Number Publication Date
WO2022211486A1 true WO2022211486A1 (ko) 2022-10-06

Family

ID=83459432

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/004500 WO2022211486A1 (ko) 2021-03-30 2022-03-30 사이토카인 억제제와 활성산소 생성억제제 및 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물

Country Status (1)

Country Link
WO (1) WO2022211486A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014185603A1 (ko) * 2013-05-16 2014-11-20 (주)케어젠 T 세포 활성 억제용 신규 펩타이드 및 이의 용도
KR20180068230A (ko) * 2016-12-13 2018-06-21 건국대학교 산학협력단 플로레틴 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 결핵 예방 또는 치료용 조성물
KR20190139407A (ko) * 2018-06-08 2019-12-18 건국대학교 산학협력단 플로레틴을 유효성분으로 포함하는 염증성 질환의 예방 또는 치료용 조성물
KR20210011894A (ko) * 2019-07-22 2021-02-02 고려대학교 산학협력단 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014185603A1 (ko) * 2013-05-16 2014-11-20 (주)케어젠 T 세포 활성 억제용 신규 펩타이드 및 이의 용도
KR20180068230A (ko) * 2016-12-13 2018-06-21 건국대학교 산학협력단 플로레틴 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 결핵 예방 또는 치료용 조성물
KR20190139407A (ko) * 2018-06-08 2019-12-18 건국대학교 산학협력단 플로레틴을 유효성분으로 포함하는 염증성 질환의 예방 또는 치료용 조성물
KR20210011894A (ko) * 2019-07-22 2021-02-02 고려대학교 산학협력단 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LIN SHIH-CHAO, CHEN MEI-CHUN, LIU SHUFENG, CALLAHAN VICTORIA M., BRACCI NICOLE R., LEHMAN CAITLIN W., DAHAL BIBHA, DE LA FUENTE CY: "Phloretin inhibits Zika virus infection by interfering with cellular glucose utilisation", INTERNATIONAL JOURNAL OF ANTIMICROBIAL AGENTS, ELSEVIER, AMSTERDAM, NL, vol. 54, no. 1, 1 July 2019 (2019-07-01), AMSTERDAM, NL , pages 80 - 84, XP055972750, ISSN: 0924-8579, DOI: 10.1016/j.ijantimicag.2019.03.017 *

Similar Documents

Publication Publication Date Title
WO2021015437A1 (ko) 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물
WO2017039365A1 (ko) Ｄ-싸이코스를 이용한 지질 흡수 억제 및/또는 배출 촉진 방법
WO2010087565A2 (ko) 피페린의 신규한 용도
US20210236580A1 (en) Methods and Compositions for Mitigating Symptoms of Acute Respiratory Distress Syndrome
WO2019054758A1 (ko) 익지 추출물을 유효성분으로 함유하는 골관절염의 예방, 개선 또는 치료용 조성물
WO2019225953A2 (ko) 잣나무 부산물 추출물을 함유하는 헬리코박터파일로리균 제균 효과를 갖는 조성물
WO2022211486A1 (ko) 사이토카인 억제제와 활성산소 생성억제제 및 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물
WO2020235828A1 (ko) 곽향 추출물을 유효성분으로 함유하는 파골세포 억제용 조성물 및 이의 용도
WO2014126285A1 (ko) 디메틸푸마레이트를 유효성분으로 포함하는 신섬유증의 예방 또는 치료용 조성물
KR20220136910A (ko) 사이토카인 억제제와 활성산소 생성억제제 및 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물
WO2022124800A1 (ko) 푸코실락토스를 유효성분으로 함유하는 항바이러스 조성물
KR102539642B1 (ko) 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물
WO2022031151A1 (ko) 고사리 추출물 또는 이의 분획물을 포함하는 항바이러스용 조성물
KR102531663B1 (ko) 소포체스트레스 억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물
WO2014084669A1 (ko) 프래럽토린 a 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 골다공증 예방 또는 치료용 약학적 조성물
KR102311070B1 (ko) 퀘리세틴을 유효성분으로 포함하는 엡스타인 바 바이러스 연관 위암 예방 및 치료용 약학적 조성물
WO2023085664A1 (ko) 타우로데옥시콜린산 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 바이러스 감염 질환 예방 또는 치료용 조성물
WO2019124608A1 (ko) 4&#39;-(p-톨루엔설포닐아미도)-4-하이드록시칼콘을 유효성분으로 함유하는 류마티스 관절염 예방 또는 치료용 약학 조성물
WO2019124604A1 (ko) 프로안토시아니딘을 유효성분으로 함유하는 편평상피암의 예방 또는 치료용 약학 조성물
WO2023033535A1 (en) Composition comprising horse chestnut extract
WO2019078381A1 (ko) 엔테로코커스 패칼리스, 이의 배양액 또는 이의 사균체를 유효성분으로 함유하는 근육감퇴, 약화 및 근위축 예방, 개선 또는 치료용 약학 조성물, 식품 조성물 및 식품첨가제
WO2023027540A1 (ko) 진세노사이드 rc를 포함하는 근육 질환의 예방, 개선 또는 치료용 조성물
WO2022215827A1 (ko) Sars-cov-2 3cl 프로테아제와 rdrp활성을 억제하는 지유 추출 조성물
WO2023090781A1 (ko) 이소클로로겐산 또는 이의 염을 유효성분으로 포함하는 피부 로사시아 예방 및 개선용 조성물
WO2022164012A1 (ko) 락토바실러스 파라카제이 유래 소포를 포함하는 바이러스 감염 질환 또는 호흡기 질환의 예방, 치료, 또는 개선용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22781605

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22781605

Country of ref document: EP

Kind code of ref document: A1