WO2022114784A1 - Composition comprising fermentation product of cactus oil and use thereof for improving skin condition - Google Patents

Composition comprising fermentation product of cactus oil and use thereof for improving skin condition Download PDF

Info

Publication number
WO2022114784A1
WO2022114784A1 PCT/KR2021/017424 KR2021017424W WO2022114784A1 WO 2022114784 A1 WO2022114784 A1 WO 2022114784A1 KR 2021017424 W KR2021017424 W KR 2021017424W WO 2022114784 A1 WO2022114784 A1 WO 2022114784A1
Authority
WO
WIPO (PCT)
Prior art keywords
skin
composition
oil
cactus
fermented product
Prior art date
Application number
PCT/KR2021/017424
Other languages
French (fr)
Korean (ko)
Inventor
이원희
이찬우
김면수
Original Assignee
엘리케이파크 주식회사
주식회사 미그림
(주)인터케어
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 엘리케이파크 주식회사, 주식회사 미그림, (주)인터케어 filed Critical 엘리케이파크 주식회사
Publication of WO2022114784A1 publication Critical patent/WO2022114784A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783—Angiosperms [Magnoliophyta]
    • A61K8/9789—Magnoliopsida [dicotyledons]
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L29/00—Foods or foodstuffs containing additives; Preparation or treatment thereof
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L29/00—Foods or foodstuffs containing additives; Preparation or treatment thereof
    • A23L29/065—Microorganisms
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/115—Fatty acids or derivatives thereof; Fats or oils
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/33—Cactaceae (Cactus family), e.g. pricklypear or Cereus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/92—Oils, fats or waxes; Derivatives thereof, e.g. hydrogenation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/92—Oils, fats or waxes; Derivatives thereof, e.g. hydrogenation products thereof
    • A61K8/922—Oils, fats or waxes; Derivatives thereof, e.g. hydrogenation products thereof of vegetable origin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318—Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/20—Natural extracts
    • A23V2250/21—Plant extracts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/10—Preparation or pretreatment of starting material
    • A61K2236/19—Preparation or pretreatment of starting material involving fermentation using yeast, bacteria or both; enzymatic treatment
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
    • A61K2800/85—Products or compounds obtained by fermentation, e.g. yoghurt, beer, wine

Definitions

  • It relates to the use of a fermented product of cactus oil, jojoba seed oil, or a combination thereof for improving skin condition.
  • the skin is a primary barrier of the human body from the external environment and is one of the important organs of the human body that regulates body temperature, barrier function, and various physiological functions.
  • Human skin undergoes an aging process as it ages, and the causes can be largely divided into intrinsic aging and extrinsic aging.
  • Intrinsic aging is a process that cannot be avoided by anyone with aging, and wrinkles occur, the skin loses elasticity, moisture in the skin cells is lost, and the structure of the stratum corneum changes.
  • exogenous aging is caused by external stress such as environmental factors, and among them, ultraviolet rays are the main cause, also called photoaging.
  • Another phenomenon of skin aging is that the ability to retain moisture is reduced and the skin becomes dry and rough. Water constitutes about 70% of the human body and helps to keep the skin moist and shiny.
  • the stratum corneum of a healthy epidermis contains 15-20% of moisture, and when the level falls below 10%, an abnormality occurs in the skin barrier and the skin becomes dry and wrinkles increase.
  • the water content of the stratum corneum is determined by the sebum membrane, a lipid mixture produced and secreted by the epidermis, and natural moisturizing factor (NMF), a water-soluble component present in the stratum corneum.
  • NMF natural moisturizing factor
  • Hyaluronic acid one of the natural moisturizing factors, is formed in fibroblasts and keratinocytes, and as a component of point polysaccharide, it contains a lot of polysaccharides, so it has the characteristic that it can contain a considerable amount of moisture.
  • the cycle is 2 to 4.5 days, and by combining with water that is 1,000 times its own weight, it regulates the skin barrier function and hydrates the extracellular matrix to maintain the homeostasis of water in the tissue. Therefore, when the moisture content in the skin decreases and the amount of hyaluronic acid decreases, it is directly related to skin aging.
  • Hyaluronan synthase has HAS-1, 2, and 3, and glucuronic acid and N-acetylglucosamine are repeatedly added to polysaccharides in the initial stage of the synthetase to produce hyaluronic acid.
  • Aquaporin is present in the protein that regulates the movement of water.
  • Aquaporin-3 (AQP-3), which is mainly present in keratinocytes of the epidermis and is a water passage through which water, glycerol, urea, etc. move, provides smooth moisture between cells.
  • Patent Document 1 KR 10-1036933 B1
  • composition comprising a fermented product obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by a microorganism of the genus Candida .
  • a method for preparing the fermented product is provided.
  • It provides a method for improving the skin condition of a subject, comprising administering to a subject in need thereof an effective amount of the fermented product or a composition comprising the same.
  • It provides a method for preventing or treating skin aging or premature aging, comprising administering an effective amount of the fermented product or a composition comprising the same to an individual in need thereof.
  • fermented product for use in preparing a composition for improving skin conditions.
  • fermented product for use in the manufacture of a medicament for the prevention or treatment of skin aging or premature aging.
  • compositions comprising a fermented product obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by a microorganism of the genus Candida .
  • the composition may be a composition for improving skin condition, improving skin beauty, preventing, improving or treating skin diseases.
  • the composition may be for improving skin condition.
  • the skin condition improvement may be skin aging prevention, skin wrinkle improvement, skin elasticity enhancement, skin moisturizing, skin barrier strengthening, or a combination of two or more thereof.
  • skin aging refers to the tangible and intangible changes that appear on the skin with age, such as a thinning of the epidermis, the number of cells or blood vessels in the dermis, DNA damage repair ability, cell replacement cycle, wound healing, It refers to a decrease in skin barrier function, epidermal moisture retention, sweat secretion, sebum secretion, vitamin D production, physical damage protection, chemical removal ability, immune response, sensory function, and thermoregulation.
  • the fermented product may be for preventing skin aging caused by extrinsic factors or intrinsic factors, improving skin aging, or for anti-aging.
  • the extrinsic factor refers to various external factors, such as ultraviolet light (light).
  • the intrinsic factor is also referred to as a chronological factor, and refers to a factor mainly caused by the passage of time. That is, the skin aging specifically refers to not only the premature aging symptoms induced by external stimuli such as ultraviolet rays, pollution, cigarette smoke, chemical substances, etc., but also a natural aging phenomenon that occurs as the proliferation of skin cells decreases with aging. , that is, it is a concept that includes skin aging due to age, and includes all of wrinkles, loss of elasticity, skin sagging and dryness. In addition, wrinkles include those that cause wrinkles by stimulation by changes in internal and external factors by changing the components constituting the skin tissue.
  • the aging may be photoaging.
  • photoaging is a phenomenon induced by external environmental factors, and the most representative factor is ultraviolet rays.
  • UVB ultraviolet B
  • skin wrinkle improvement is interpreted to include not only an action of reducing the number or depth of skin wrinkles, but also inhibiting skin aging through wrinkle improvement.
  • the term “enhancement of skin elasticity” may refer to any action that increases skin elasticity, which is reduced due to aging, or prevents deterioration of skin elasticity.
  • moistureturizing the skin may refer to any action that retains moisture in the skin or prevents moisture loss.
  • the skin moisturizing effect can help improve skin wrinkles and increase elasticity.
  • stressening the skin barrier may refer to any action that enhances the function of the skin barrier, which is located at the outermost part of the skin and prevents loss of moisture and nutrients.
  • skin disease may be a disease caused by skin aging, premature aging, or damage to the skin barrier function.
  • prevention includes inhibiting the development of a disease.
  • treatment includes inhibiting, alleviating, or eliminating the development of a disease.
  • the skin aging may be photoaging or skin aging due to age.
  • progeria also called “Hutchinson-Gilford Progeria Syndrome” or “Gilford's syndrome” is a disease in which premature aging occurs in young children.
  • the damage to the skin barrier function may refer to any change that appears in the skin as the function of the skin barrier is reduced or damaged. For example, it may include increased skin wrinkles, dryness, dermatitis, atopic dermatitis, allergic dermatitis, acne, and the like.
  • the composition may inhibit the expression of progerin (Progerin).
  • Progerin is a protein associated with progeria, or Hutchinson-Gilford Progeria syndrome, and appears due to a defect in the LaminA protein. When progerin increases, the cell nucleus becomes unstable and the aging phenomenon occurs quickly.
  • the composition may exhibit an anti-aging effect by inhibiting the expression of progerin, or an effect of preventing or treating premature aging, such as progeria (or Hutchinson-Gilford Progeria syndrome).
  • the composition may increase the expression of SIRT1.
  • SIRT1 deacetylates histones and is involved in chromatin modification and gene silencing, etc., and is involved in lifespan extension effects. It has also been reported to be involved in inflammation and DNA damage responses.
  • the composition may exhibit an anti-aging effect by increasing the expression of SIRT1.
  • the composition may increase the expression of procollagen.
  • procollagen collagen related to wrinkles of skin cells is synthesized in the form of a precursor called procollagen. Therefore, by measuring the amount of the procollagen peptide, it is possible to grasp the degree of collagen synthesis in the cell.
  • the composition may exhibit the effect of improving skin wrinkles and enhancing skin elasticity by increasing the expression of procollagen.
  • the composition may increase the expression of collagen synthesis factor (Collagen, type 1, alpha 1, COL1A1). By measuring the expression level of COL1A1, the degree of collagen synthesis in the cell can be determined.
  • the composition induces collagen synthesis in the skin by increasing the expression of COL1A1, thereby improving skin wrinkles and enhancing skin elasticity.
  • the composition may increase the expression of aquaporin 3 (AQP3).
  • the composition may exhibit a skin moisturizing effect by smoothly supplying moisture to skin cells by increasing the expression of AQP3.
  • the composition may increase the expression of hyaluronan synthase 3 (HAS3).
  • HAS3 hyaluronan synthase 3
  • the composition induces hyaluronic acid synthesis by increasing the expression of HAS3, thereby exhibiting skin moisturizing and skin barrier strengthening effects.
  • the composition may increase the expression of filaggrin.
  • the filaggrin is a moisturizing component that forms the skin barrier.
  • the composition may exhibit skin moisturizing and skin barrier strengthening effects by increasing the expression of filaggrin.
  • composition may inhibit the expression of progerin or increase the expression of any one or more of SIRT1, procollagen, COL1A1, AQP3, HAS3, and filaggrin.
  • the fermented product is excellent in preventing skin aging, preventing or treating premature aging, improving skin wrinkles, enhancing skin elasticity, moisturizing the skin, and strengthening the skin barrier.
  • the fermented product may be obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by microorganisms of the genus Candida.
  • cactus is a generic term for dicotyledonous plants belonging to the cactus family.
  • the cactus is not limited to a specific type, but may be, for example, a bogum cactus ( Opuntia Ficus-Indica ), a marginal cactus ( Carnegiea gigantea ), a pre-clear cactus ( Opuntia engelmannii , Engelmann Prickly Pear Cactus ), and the like.
  • the bogum cactus is also called baeknyeoncho.
  • the marginal cactus is also called Saguaro cactus.
  • cactus oil is an oil obtained by extraction or pressing from a cactus.
  • the cactus oil may be oil obtained from cactus seeds. Accordingly, “cactus oil” may be used interchangeably with “cactus seed oil”.
  • the cactus oil may be bogum cactus oil, alfalfa cactus oil, or pre-clear cactus oil, but is not limited thereto.
  • the cactus oil may be cactus oil collected in Arizona, USA, but is not limited to this specific type.
  • Standard Seed Oil is a substance obtained from a nonvolatile oil extracted or pressed from the seeds of the desert shrub Simmondsia Chinensis .
  • the fermented product may be obtained by fermenting cactus oil by microorganisms of the genus Candida.
  • the fermented product may be obtained by fermenting jojoba seed oil by microorganisms of the genus Candida.
  • the fermented product may be obtained by fermenting a combination of cactus oil and jojoba seed oil by a microorganism of the genus Candida.
  • the fermented product may be obtained by fermenting a mixture containing cactus oil and jojoba seed oil.
  • the mixing weight ratio of the cactus oil and jojoba seed oil is not limited to a specific weight ratio.
  • the fermented product is cactus oil and jojoba seed oil in a weight ratio of 1:100 to 100:1, for example, a weight ratio of 1:50 to 50:1, a weight ratio of 1:20 to 20:1, 1:10 to 10 Obtained by fermenting a mixture comprising a weight ratio of :1, a weight ratio of 1:5 to 5:1, a weight ratio of 1:2 to 2:1, a weight ratio of 1:1.5 to 1.5:1, or a weight ratio of about 1:1 it could be
  • the fermented product obtained by fermenting a mixture containing cactus oil and jojoba seed oil in a weight ratio of 1:1 is skin aging compared to the case of using cactus oil or jojoba seed oil alone or using a different weight ratio It was confirmed that it was excellent in preventing, preventing or treating progeria, improving skin wrinkles, enhancing skin elasticity, moisturizing the skin
  • the Candida ( Candida sp.) genus microorganisms may be Candida bombicola ( Candida bombicola ), but is not limited thereto.
  • the Candida bombicola may be isolated from soil, but is not limited thereto.
  • an appropriate temperature and time may be selected according to the type of microorganism.
  • the fermentation may be performed at 20 to 40° C., but is not particularly limited thereto.
  • the fermentation may be performed for 1 to 200 hours, 1 to 180 hours, 24 to 200 hours, 24 to 180 hours, 72 to 200 hours, 72 to 180 hours, 100 to 200 hours, or 100 to 180 hours. , which is not particularly limited thereto.
  • the fermentation may be performed in a medium capable of culturing the microorganisms of the genus Candida.
  • a medium capable of culturing the microorganisms of the genus Candida may be used.
  • the fermented product is a fermentation broth obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by a microorganism of the genus Candida, a diluted or concentrated solution of the fermentation broth, a dried product obtained by drying the fermentation broth, or a prepared or purified product thereof; It may include a fraction obtained by fractionation thereof.
  • the fermented product is 0.0001 to 99.9999% by weight, 0.0001 to 90% by weight, 0.0001 to 50% by weight, 0.0001 to 10% by weight, 0.01 to 99.9999% by weight, 0.01 to 90% by weight, 0.01 to 50% by weight based on the total weight of the composition , 0.01 to 10% by weight, 0.1 to 99.9999% by weight, 0.1 to 90% by weight, 0.1 to 50% by weight, or may be included in 0.1 to 10% by weight, but is not particularly limited thereto.
  • the fermented product is 0.0001 to 99.9999% (v / v), 0.0001 to 90% (v / v), 0.0001 to 50% (v / v), 0.0001 to 10% (v / v), 0.01 based on the total weight of the composition to 99.9999% (v/v), 0.01 to 90% (v/v), 0.01 to 50% (v/v), 0.01 to 10% (v/v), 0.1 to 99.9999% (v/v), 0.1 to 90% (v/v), 0.1 to 50% (v/v), 0.1 to 10% (v/v), or 0.1 to 1% (v/v), but is not particularly limited thereto.
  • the term "included as an active ingredient” means that the fermented product of the present specification is added to an extent capable of exhibiting the above-mentioned effects. In addition, this may include being formulated in various forms by adding various components as sub-components for drug delivery and stabilization.
  • the composition may be a cosmetic composition.
  • the cosmetic composition may be prepared in any conventionally prepared formulation.
  • the cosmetic composition may be a lotion, cream, essence, cleansing foam, cleansing water, pack, ampoule, body lotion, body oil, body gel, shampoo, conditioner, hair conditioner, hair gel, foundation, lipstick, mascara, makeup It may have a cosmetic formulation of a base or skin adhesion type.
  • the skin adhesion type cosmetic formulation may be, for example, a mask pack, but is not limited thereto.
  • Components included in the cosmetic composition may include components commonly used in cosmetic compositions in addition to the composition as an active ingredient, for example, conventional adjuvants and carriers such as stabilizers, solubilizers, vitamins, pigments and fragrances. may include
  • composition may be a composition for external application to the skin.
  • the external preparation for skin may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal patch, drug-containing bandage, lotion, or a combination thereof.
  • the external preparation for skin is a component usually used in external preparations for skin such as cosmetics or pharmaceuticals, for example, an aqueous component, an oily component, a powder component, alcohol, a moisturizer, a thickener, an ultraviolet absorber, a whitening agent, a preservative, an antioxidant, a surfactant, a fragrance , colorant, various skin nutrients, or a combination thereof may be appropriately formulated as needed.
  • the external preparation for skin includes metal-blocking agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, belapamil, licorice extract, glablidine, and kaline.
  • metal-blocking agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, belapamil, licorice extract, glablidine, and kaline.
  • Fruit hot water extracts, various herbal medicines, tocopherol acetate, glitylittic acid, tranexamic acid and derivatives or salts thereof, vitamin C, magnesium ascorbate phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, Sugars, such as trehalose, etc. can be mix
  • the composition may be a food composition.
  • the composition may be a health functional food composition.
  • the food composition may be used alone or in combination with other foods or food ingredients, and may be appropriately used according to a conventional method.
  • the mixing amount of the active ingredient may be appropriately determined depending on the purpose of use (prophylactic, health or therapeutic treatment).
  • the composition of the present specification may be added in an amount of 15 parts by weight or less based on the raw material.
  • the beverage composition may contain various flavoring agents or natural carbohydrates as an additional component like a conventional beverage.
  • the natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • sweetener natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used.
  • the health food composition can also be added to nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonated beverages carbonation agent used, or a combination thereof.
  • the health functional food composition may also contain natural fruit juice, fruit juice beverage, fruit flesh for the production of vegetable beverage, or a combination thereof.
  • the composition may be a pharmaceutical composition.
  • the pharmaceutical composition may be for preventing or treating skin aging or premature aging.
  • the skin aging may be photoaging or skin aging due to age.
  • the pharmaceutical composition may further include a pharmaceutically acceptable diluent or carrier.
  • the diluent may be lactose, corn starch, soybean oil, microcrystalline cellulose, or mannitol, and the lubricant may be magnesium stearate, talc, or a combination thereof.
  • the carrier may be an excipient, a disintegrant, a binder, a lubricant, or a combination thereof.
  • the excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof.
  • the disintegrant may be carboxymethyl cellulose calcium, sodium starch glycolate, anhydrous calcium monohydrogen phosphate, or a combination thereof.
  • the binder may be polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose, or a combination thereof.
  • the lubricant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.
  • the pharmaceutical composition may be formulated as an oral or parenteral dosage form.
  • Oral dosage forms may be granules, powders, solutions, tablets, capsules, dry syrups, or a combination thereof.
  • the parenteral dosage form may be an injection.
  • Another aspect provides a method for preparing a fermented product of cactus oil, jojoba seed oil, or a combination thereof.
  • the method includes incubating cactus oil, jojoba seed oil, or a combination thereof with a microorganism of the genus Candida to obtain a fermented product.
  • the method may be a method for producing a fermented cactus oil comprising the step of incubating the cactus oil with a microorganism of the genus Candida to obtain a fermented product.
  • the method may be a method for producing a fermented jojoba seed oil comprising the step of incubating the jojoba seed oil with a microorganism of the genus Candida to obtain a fermented product.
  • the method may be a method for producing a co-fermented product of cactus oil and jojoba seed oil, comprising the step of incubating a combination of cactus oil and jojoba seed oil with a microorganism of the genus Candida to obtain a fermented product .
  • the combination of cactus oil and jojoba seed oil may be a mixture comprising cactus oil and jojoba seed oil. Details regarding the mixing weight ratio of the cactus oil and jojoba seed oil are the same as described above.
  • the microorganism of the genus Candida may be Candida bombicola.
  • the Candida bombicola may be used in an amount sufficient to allow fermentation to occur, which may be appropriately selected by those skilled in the art in consideration of the amount of fermentation raw materials.
  • the incubation temperature and time may be selected as sufficient temperature and time for fermentation to occur, which may be appropriately selected by those skilled in the art in consideration of the amount of fermentation raw material, the type of microorganism, and the like.
  • the incubation may be performed at 20 to 40° C., but is not particularly limited thereto.
  • the incubation may be performed for 1 to 200 hours, 1 to 180 hours, 24 to 200 hours, 24 to 180 hours, 72 to 200 hours, 72 to 180 hours, 100 to 200 hours, or 100 to 180 hours. , which is not particularly limited thereto.
  • the fermentation may be performed in a medium capable of culturing the microorganisms of the genus Candida.
  • a medium capable of culturing the microorganisms of the genus Candida may be used.
  • the method may further include the step of obtaining an oil component by separating moisture and cells from the fermented product.
  • the separation of water and cells may use a known conventional method, for example, stationary, centrifugation, a combination thereof, etc. may be used.
  • the method may further include filtering the fermented product.
  • the filtration may use a known conventional method.
  • the method may further include deodorizing and/or decolorizing the fermented product.
  • the deodorization and/or decolorization may be performed using an adsorbent.
  • an adsorbent a known conventional adsorbent may be used, for example, activated carbon, zeolite, and the like, but is not particularly limited thereto.
  • Another aspect provides a method for improving a skin condition in a subject comprising administering to a subject in need thereof an effective amount of the fermented product or a composition comprising the same.
  • Another aspect provides a method for preventing or treating skin aging or premature aging, comprising administering to an individual in need thereof an effective amount of the fermented product or a composition comprising the same.
  • administering means the arrangement of the composition according to
  • Administration may be administered by methods known in the art. Administration can be administered directly to a subject by any means, for example, intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal or subcutaneous administration. can The administration may be systemically or locally. The administration may be applied to the skin.
  • the subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat.
  • the subject may be an individual in need of improving skin condition, for example, preventing skin aging, improving skin wrinkles, enhancing skin elasticity, moisturizing skin, strengthening skin barrier, preventing or treating premature aging.
  • the administration is 0.1 mg to 1,000 mg, for example, 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1 mg of the composition according to one embodiment per day 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or 10 mg to 25 mg may be administered.
  • the dosage may be prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and reaction sensitivity, and those skilled in the art
  • the dosage may be appropriately adjusted in consideration of these factors.
  • the number of administration may be once a day or twice or more within the range of clinically acceptable side effects, and may be administered to one or two or more sites for the administration site, and total daily or at intervals of 2 to 5 days
  • the number of days of administration may range from 1 to 30 days per treatment. If necessary, the same treatment can be repeated after a titration period.
  • the dose is the same as that of a human per kg, or the above dose is converted, for example, by the volume ratio (for example, average value) of the target animal and the organ (heart, etc.) of the human One dose can be administered.
  • Another aspect provides the use of the fermented product for use in preparing a composition for improving skin conditions.
  • Another aspect provides the use of the fermented product for use in the manufacture of a medicament for the prevention or treatment of skin aging or premature aging.
  • a composition comprising a fermented product obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by microorganisms of the genus Candida according to an aspect prevents skin aging, prevents or treats premature aging, improves skin wrinkles, improves skin elasticity, skin It can be usefully used for preventing, improving, or treating skin-related conditions such as moisturizing and strengthening the skin barrier.
  • 1 is a result of measuring progerin production in neonatal fibroblasts.
  • 5 is a result showing the relative expression level of COL1A1 mRNA.
  • 6 is a result showing the relative expression level of AQP-3 mRNA.
  • Fermentation raw materials were prepared in a weight ratio as shown in Table 1 below. Fermentation microorganisms were prepared with Candida bombicola isolated from soil.
  • Example 1 a mixture containing cactus oil and jojoba seed oil in a weight ratio of 1:1 was used as a fermentation raw material.
  • Example 2 cactus oil alone was used as a fermentation raw material.
  • Example 3 jojoba seed oil alone was used as a fermentation raw material.
  • Example 4 a mixture containing cactus oil and jojoba seed oil in a weight ratio of 1:0.5 was used as a fermentation raw material.
  • Example 5 a mixture containing cactus oil and jojoba seed oil in a weight ratio of 0.5:1 was used as a fermentation raw material.
  • the method for preparing the fermented product is as follows.
  • the fermentation raw material was inoculated with Candida bombicola and fermented at 25° C. for 150 minutes.
  • As the medium a medium of general components capable of culturing Candida bombicola was used.
  • the mixing weight ratio of the fermentation raw material and the medium was set to 1:1.
  • water and cells were separated using stationary and centrifugation, and only pure oil was obtained.
  • the obtained oil was deodorized and decolorized using an adsorbent such as activated carbon or zeolite. Then, it was filtered through 1 um and 0.45 um filters to obtain an oily ferment.
  • Example 1 Example 2
  • Example 3 Example 4
  • Example 5 cactus oil One One - One 0.5 Simmondsia Chinensis (Jojoba) Seed Oil One - One 0.5 One
  • the fermented products of Examples 1 to 5 were added at a concentration of 0.1% (v/v), respectively, and ELISA assay was performed. was performed to confirm the production of progerin.
  • the group to which no fermented product was added was used as a negative control group.
  • 1 is a result of measuring progerin production in neonatal fibroblasts.
  • progerin production was higher in adult fibroblasts than in neonatal fibroblasts.
  • the fermented products of Examples 1 to 5 were added, there was an effect of reducing progerin production in both neonatal fibroblasts and adult fibroblasts.
  • the fermented product of Example 1 using cactus oil and jojoba seed oil in a weight ratio of 1:1 reduced progerin synthesis by about 25% in neonatal fibroblasts compared to negative control, and in adult fibroblasts compared to negative control, The effect was the most excellent by reducing the synthesis of progerin by 50%.
  • SIRT1 an anti-aging longevity gene
  • the fermented products of Examples 1 to 5 were pretreated at a concentration of 0.1% (v/v) for 1 hour, and 20 mJ/cm 2 of It was irradiated with UV and reacted for 24 hours. After completion of the reaction, cells were harvested, proteins were separated through SDS-PAGE, and transferred to a polyvinylidene fluoride (PVDF) membrane. Thereafter, the primary antibody was reacted at room temperature for 1 hour using a monoclonal mouse anti-SIRT1 antibody (Sigma), and the secondary antibody was reacted for 1 hour using a goat anti-mouse IgG-HRP (Santa Cruz).
  • PVDF polyvinylidene fluoride
  • the membrane was washed 3 times with 1X TBS-T buffer and reacted with ECL (enhanced chemiluminescence) solution.
  • the protein was identified as a band using Chemi-Doc and quantified in comparison with ⁇ -actin through the image J program.
  • the group not irradiated with UV and not treated with the fermented products of Examples 1 to 5 was used as a positive control group, and the group irradiated with UV of 20 mJ/cm 2 was used as a negative control group.
  • FIG. 5 is a result showing the relative expression level of COL1A1 mRNA. As shown in FIG. 5, when the fermented products of Examples 1 to 5 were added, the expression of COL1A1 was increased in both cases. In particular, it was confirmed that the fermented product of Example 1 increased the expression of COL1A1 by about 1.58 times compared to the negative control group.
  • the fermented products of Examples 1 to 5 were added at a concentration of 0.1% (v/v).
  • mRNA was obtained and AQP-3, HAS3, and filaggrin expression levels were compared and analyzed by performing Real-Time PCR.
  • the group to which no fermentation was added was used as a negative control group, and the group to which 1 uM of retinoic acid was added was used as a positive control group.
  • the primer sequences used in the PCR are shown in Table 3 below.
  • 6 is a result showing the relative expression level of AQP-3 mRNA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Botany (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Birds (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Polymers & Plastics (AREA)
  • Dermatology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Medical Informatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cosmetics (AREA)

Abstract

The present invention relates to a composition comprising a fermentation product obtained from fermentation of a cactus oil, Jojoba oil, or a combination thereof with Candida sp., and a use of the composition for improving a skin condition. The composition may be used in the prevention, alleviation, or treatment of skin-related conditions, such as prevention of skin aging, prevention or treatment of progeria, reduction of skin wrinkles, enhancement of skin elasticity, skin moisturization, skin barrier enhancement, and the like.

Description

선인장오일 발효물을 포함하는 조성물 및 그의 피부 상태 개선 용도Composition comprising fermented cactus oil and its use for improving skin condition
선인장오일, 호호바씨오일, 또는 이들의 조합의 발효물의 피부 상태 개선 용도에 관한 것이다.It relates to the use of a fermented product of cactus oil, jojoba seed oil, or a combination thereof for improving skin condition.
피부는 외부 환경으로부터 인체의 일차 방어막으로서 체온 조절, 장벽 기능 및 여러 가지 생리 기능 등을 조절하는 인체의 중요 기관 중 하나이다. 인간의 피부는 나이가 들어가면서 노화 과정을 거치게 되는데, 그 원인은 크게 내인성 노화(Intrinsic aging)와 외인성 노화(Extrinsic aging)로 나눌 수 있다. 내인성 노화는 나이가 듦에 따라 누구나 피할 수 없는 과정으로 주름이 생기고 피부의 탄력이 없어지며 피부 세포 내 수분이 손실되고 각질층의 구조가 변한다. 반면, 외인성 노화는 환경적 요인 등 외부 스트레스에 의해 생기며, 그 중 자외선이 주원인으로 광노화 라고도 불린다. The skin is a primary barrier of the human body from the external environment and is one of the important organs of the human body that regulates body temperature, barrier function, and various physiological functions. Human skin undergoes an aging process as it ages, and the causes can be largely divided into intrinsic aging and extrinsic aging. Intrinsic aging is a process that cannot be avoided by anyone with aging, and wrinkles occur, the skin loses elasticity, moisture in the skin cells is lost, and the structure of the stratum corneum changes. On the other hand, exogenous aging is caused by external stress such as environmental factors, and among them, ultraviolet rays are the main cause, also called photoaging.
한편, 피부 노화의 또 다른 현상은 수분을 유지하는 능력이 저하되어 피부가 건조하고 거칠게 변하는 것이다. 수분은 인체의 약 70%를 구성하며 피부의 촉촉함과 윤기를 유지하도록 돕는다. 건강한 표피의 각질층은 15~20%의 수분을 함유하며, 10% 이하로 수치가 떨어지게 되면 피부 장벽에 이상이 생기고 피부가 건조해져 주름이 증가하게 된다. 각질층의 수분 함량은 표피에서 생성 분비되는 지질 혼합체인 피지막과 각질층 내에 존재하는 수용성 성분인 자연 보습인자(NMF; natural moisturizing factor)에 의해 결정된다. 자연 보습인자 중 하나인 히알루론산 (Hyaluronic acid)은 섬유아세포 및 각질형성세포에서 형성되며 점다당질의 구성 성분으로 다당류가 많이 들어있어 수분을 상당량 함유할 수 있는 특징이 있다. 주기는 2~4.5일이며, 무게가 자신의 1,000배인 수분과 결합하여 피부장벽 기능의 조절과 세포외기질을 수화시켜 조직 내 수분의 항상성을 유지시킨다. 따라서, 피부 내 수분 함량이 줄어들고 히알루론산 양이 감소하면, 피부노화로 직결된다. 히알루론산 합성효소(Hyaluronan synthase, HAS)는 HAS-1, 2, 3이 있으며, 합성효소의 초기단계에 다당류에 글루쿠론산와 N-아세틸글루코사민을 반복적으로 추가하여 히알루론산을 생성한다. On the other hand, another phenomenon of skin aging is that the ability to retain moisture is reduced and the skin becomes dry and rough. Water constitutes about 70% of the human body and helps to keep the skin moist and shiny. The stratum corneum of a healthy epidermis contains 15-20% of moisture, and when the level falls below 10%, an abnormality occurs in the skin barrier and the skin becomes dry and wrinkles increase. The water content of the stratum corneum is determined by the sebum membrane, a lipid mixture produced and secreted by the epidermis, and natural moisturizing factor (NMF), a water-soluble component present in the stratum corneum. Hyaluronic acid, one of the natural moisturizing factors, is formed in fibroblasts and keratinocytes, and as a component of point polysaccharide, it contains a lot of polysaccharides, so it has the characteristic that it can contain a considerable amount of moisture. The cycle is 2 to 4.5 days, and by combining with water that is 1,000 times its own weight, it regulates the skin barrier function and hydrates the extracellular matrix to maintain the homeostasis of water in the tissue. Therefore, when the moisture content in the skin decreases and the amount of hyaluronic acid decreases, it is directly related to skin aging. Hyaluronan synthase (HAS) has HAS-1, 2, and 3, and glucuronic acid and N-acetylglucosamine are repeatedly added to polysaccharides in the initial stage of the synthetase to produce hyaluronic acid.
수분의 이동을 조절하는 단백질에는 아쿠아포린(aquaporin, AQP)이 존재한다. 표피의 각질형성세포(keratinocyte)에 주로 존재하게 되며, 수분 및 글리세롤, 유레아 등이 이동하는 수분 통로인 아쿠아포린-3(AQP-3)은 세포 사이사이 원활한 수분을 공급한다.Aquaporin (AQP) is present in the protein that regulates the movement of water. Aquaporin-3 (AQP-3), which is mainly present in keratinocytes of the epidermis and is a water passage through which water, glycerol, urea, etc. move, provides smooth moisture between cells.
이에, 피부 관련된 상태에 유용하게 사용될 수 있는 천연물 유래 성분의 개발이 필요하다.Accordingly, there is a need for the development of ingredients derived from natural products that can be usefully used for skin-related conditions.
(특허문헌 1) KR 10-1036933 B1(Patent Document 1) KR 10-1036933 B1
선인장오일, 호호바씨오일, 또는 이들의 조합을 칸디다 속(Candida sp.) 미생물에 의해 발효시켜 수득한 발효물을 포함하는 조성물을 제공한다.Provided is a composition comprising a fermented product obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by a microorganism of the genus Candida .
상기 발효물을 제조하는 방법을 제공한다.A method for preparing the fermented product is provided.
유효량의 상기 발효물 또는 이를 포함하는 조성물을 그를 필요로 하는 개체에 투여하는 단계를 포함하는 개체의 피부 상태를 개선하는 방법을 제공한다.It provides a method for improving the skin condition of a subject, comprising administering to a subject in need thereof an effective amount of the fermented product or a composition comprising the same.
유효량의 상기 발효물 또는 이를 포함하는 조성물을 그를 필요로 하는 개체에 투여하는 단계를 포함하는 피부 노화 또는 조로증을 예방 또는 치료하는 방법을 제공한다.It provides a method for preventing or treating skin aging or premature aging, comprising administering an effective amount of the fermented product or a composition comprising the same to an individual in need thereof.
피부 상태 개선용 조성물을 제조하는데 사용하기 위한 상기 발효물의 용도를 제공한다.Provided is the use of the fermented product for use in preparing a composition for improving skin conditions.
피부 노화 또는 조로증의 예방 또는 치료용 약제를 제조하는데 사용하기 위한 상기 발효물의 용도를 제공한다.Provided is the use of the fermented product for use in the manufacture of a medicament for the prevention or treatment of skin aging or premature aging.
일 양상은 선인장오일, 호호바씨오일, 또는 이들의 조합을 칸디다 속(Candida sp.) 미생물에 의해 발효시켜 수득한 발효물을 포함하는 조성물을 제공한다.One aspect provides a composition comprising a fermented product obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by a microorganism of the genus Candida .
상기 조성물은 피부 상태 개선용, 피부 미용 개선용, 피부 질환의 예방, 개선 또는 치료용 조성물일 수 있다.The composition may be a composition for improving skin condition, improving skin beauty, preventing, improving or treating skin diseases.
일 구체예에서, 상기 조성물은 피부 상태 개선용일 수 있다.In one embodiment, the composition may be for improving skin condition.
상기 피부 상태 개선은 피부 노화 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화, 또는 이들의 2 이상의 조합일 수 있다.The skin condition improvement may be skin aging prevention, skin wrinkle improvement, skin elasticity enhancement, skin moisturizing, skin barrier strengthening, or a combination of two or more thereof.
용어 "피부 노화"란 나이가 들어가면서 피부에 나타나게 되는 유형과 무형상의 변화를 통틀어 말하는 것으로, 예컨대 표피 두께가 얇아지는 현상, 진피의 세포 수나 혈관 수, DNA 손상복구 능력, 세포교체주기, 상처 회복, 피부 장벽 기능, 표피의 수분 유지, 땀분비, 피지분비, 비타민D 생산, 물리적 손상방어, 화학물질 제거능력, 면역반응, 감각 기능, 체온조절의 감소를 말한다.The term "skin aging" refers to the tangible and intangible changes that appear on the skin with age, such as a thinning of the epidermis, the number of cells or blood vessels in the dermis, DNA damage repair ability, cell replacement cycle, wound healing, It refers to a decrease in skin barrier function, epidermal moisture retention, sweat secretion, sebum secretion, vitamin D production, physical damage protection, chemical removal ability, immune response, sensory function, and thermoregulation.
상기 발효물은 외인성 요인 또는 내인성 요인에 의해 유발되는 피부 노화 방지용, 피부 노화 개선용, 또는 항노화용일 수 있다. 상기 외인성 요인은 여러 가지 외부 요인, 예컨대 자외선(광)을 말한다. 상기 내인성 요인은 연대기적 요인이라고도 지칭되며 주로 시간의 흐름에 의해 발생하는 요인을 말한다. 즉, 상기 피부 노화는 구체적으로는 자외선, 공해, 담배연기, 화학물질 등에 의한 외부 자극에 의해 유도되는 조기 노화 증상뿐만 아니라, 나이가 들어감에 의해 피부세포의 증식이 감소함에 따라 발생하는 자연 노화 현상, 즉, 연령에 의한 피부 노화를 포함하며, 주름, 탄력 감소, 피부 처짐 및 건조 현상 등을 모두 포함하는 개념이다. 또한, 주름은 내ㆍ외부 요인의 변화에 의한 자극이 피부조직을 구성하고 있는 성분을 변화시켜 주름을 유발하는 것을 포함한다. The fermented product may be for preventing skin aging caused by extrinsic factors or intrinsic factors, improving skin aging, or for anti-aging. The extrinsic factor refers to various external factors, such as ultraviolet light (light). The intrinsic factor is also referred to as a chronological factor, and refers to a factor mainly caused by the passage of time. That is, the skin aging specifically refers to not only the premature aging symptoms induced by external stimuli such as ultraviolet rays, pollution, cigarette smoke, chemical substances, etc., but also a natural aging phenomenon that occurs as the proliferation of skin cells decreases with aging. , that is, it is a concept that includes skin aging due to age, and includes all of wrinkles, loss of elasticity, skin sagging and dryness. In addition, wrinkles include those that cause wrinkles by stimulation by changes in internal and external factors by changing the components constituting the skin tissue.
상기 노화는 광노화일 수 있다. 용어 "광노화(Photoaging)"는 외부 환경적인 요인에 의해 유발되는 현상으로, 가장 대표적인 인자로는 자외선이 있다. 자외선은 단백질 분해효소의 활성화와 기질단백질의 사슬절단 및 비정상적인 교차결합 등의 생체 구성 성분들의 손상을 가져오고, 이러한 메커니즘의 반복은 외관상으로도 확연한 피부 노화를 초래하게 된다. 따라서, 상기 조성물은 자외선B(ultraviolet B, UVB)에 의한 광노화 예방, 개선, 또는 치료용일 수 있다.The aging may be photoaging. The term “photoaging” is a phenomenon induced by external environmental factors, and the most representative factor is ultraviolet rays. Ultraviolet rays cause damage to biological components such as activation of proteolytic enzymes, chain cleavage of matrix proteins, and abnormal cross-linking, and repetition of these mechanisms leads to apparent skin aging. Accordingly, the composition may be for preventing, improving, or treating photoaging caused by ultraviolet B (UVB).
용어 "피부 주름 개선"은 피부의 주름의 수를 감소시키거나 깊이를 감소시키는 작용을 의미할 뿐만 아니라, 주름 개선을 통하여 피부 노화를 억제하는 것도 포함하는 것으로 해석된다.The term "skin wrinkle improvement" is interpreted to include not only an action of reducing the number or depth of skin wrinkles, but also inhibiting skin aging through wrinkle improvement.
용어 "피부 탄력 증진"은 노화 등의 원인에 의해 저하된 피부 탄력이 증가하거나 피부 탄력의 저하를 방지하는 모든 작용을 의미할 수 있다.The term “enhancement of skin elasticity” may refer to any action that increases skin elasticity, which is reduced due to aging, or prevents deterioration of skin elasticity.
용어 "피부 보습" 은 피부 수분을 유지하거나 수분 손실을 방지하는 모든 작용을 의미할 수 있다. 피부　보습　효과는 피부의 주름 개선, 탄력도 증가에 도움을 줄 수 있다.The term “moisturizing the skin” may refer to any action that retains moisture in the skin or prevents moisture loss. The skin 　 moisturizing effect can help improve skin wrinkles and increase elasticity.
용어 "피부 장벽 강화"는 피부 가장 바깥쪽에 위치하여 수분과 영양 손실을 막아주는 피부 장벽의 기능이 증진되는 모든 작용을 의미할 수 있다.The term “strengthening the skin barrier” may refer to any action that enhances the function of the skin barrier, which is located at the outermost part of the skin and prevents loss of moisture and nutrients.
용어 "피부 질환"은 피부 노화, 조로증, 또는 피부 장벽 기능 손상에 의한 질환일 수 있다. 용어 "예방"은 질병의 발생을 억제하는 것을 포함한다. 용어 "치료"는 질병의 발전의 억제, 경감, 또는 제거를 포함한다. The term “skin disease” may be a disease caused by skin aging, premature aging, or damage to the skin barrier function. The term “prevention” includes inhibiting the development of a disease. The term “treatment” includes inhibiting, alleviating, or eliminating the development of a disease.
상기 피부 노화에 관한 상세는 상술한 바와 같다. 따라서, 상기 피부 노화는 광노화, 또는 연령에 의한 피부 노화일 수 있다.Details of the skin aging are the same as described above. Accordingly, the skin aging may be photoaging or skin aging due to age.
용어 "조로증(progeria)"은 "허친슨 길포오드 조로증 증후군(Hutchinson-Gilford Progeria Syndrome)" 또는 "길포오드 증후군"이라고도 하며, 어린 아이들에게 조기 노화 현상이 나타나는 질환이다.The term "progeria", also called "Hutchinson-Gilford Progeria Syndrome" or "Gilford's syndrome", is a disease in which premature aging occurs in young children.
상기 피부 장벽 기능 손상은 피부 장벽의 기능이 저하되거나 손상되어 피부에 나타나는 모든 변화를 의미할 수 있다. 예를 들어, 피부 주름 증가, 건조, 피부염, 아토피 피부염, 알레르기성 피부염, 여드름 등을 포함할 수 있다.The damage to the skin barrier function may refer to any change that appears in the skin as the function of the skin barrier is reduced or damaged. For example, it may include increased skin wrinkles, dryness, dermatitis, atopic dermatitis, allergic dermatitis, acne, and the like.
상기 조성물은 프로게린(Progerin)의 발현을 억제할 수 있다. 프로게린은 조로증, 또는 허친슨 길포오드 조로증 증후군과 관련된 단백질로 라민A(LaminA) 단백질에 결함이 생겨 나타난다. 프로게린이 증가하면 세포핵이 불안정해지고, 노화 현상이 빨리 일어나게 된다. 상기 조성물은 프로게린의 발현을 억제함으로써 노화 방지 효과, 또는 조기 노화, 예컨대 조로증(또는 허친슨 길포오드 조로증 증후군) 예방 또는 치료 효과를 나타낼 수 있다. The composition may inhibit the expression of progerin (Progerin). Progerin is a protein associated with progeria, or Hutchinson-Gilford Progeria syndrome, and appears due to a defect in the LaminA protein. When progerin increases, the cell nucleus becomes unstable and the aging phenomenon occurs quickly. The composition may exhibit an anti-aging effect by inhibiting the expression of progerin, or an effect of preventing or treating premature aging, such as progeria (or Hutchinson-Gilford Progeria syndrome).
상기 조성물은 SIRT1의 발현을 증가시킬 수 있다. 일반적으로 SIRT1은 히스톤을 탈아세틸화시켜 크로마틴 변형 및 유전자 침묵에 관여하는 등 수명연장 효과에 연관이 되어있으며, 다양한 비히스톤 단백질, 특히, 전사인자들을 기질로 탈아세틸화시켜 생존 및 세포사멸, 염증, DNA손상반응 등에도 관여하는 것으로 보고되고 있다. 상기 조성물은 SIRT1의 발현을 증가시킴으로써 노화 방지 효과를 나타낼 수 있다.The composition may increase the expression of SIRT1. In general, SIRT1 deacetylates histones and is involved in chromatin modification and gene silencing, etc., and is involved in lifespan extension effects. It has also been reported to be involved in inflammation and DNA damage responses. The composition may exhibit an anti-aging effect by increasing the expression of SIRT1.
상기 조성물은 프로콜라겐(procollagen)의 발현을 증가시킬 수 있다. 일반적으로 피부 세포의 주름과 관련된 콜라겐은 프로콜라겐이라는 전구 물질의 형태로 합성된다고 알려져 있다. 따라서, 프로콜라겐 펩타이드의 양을 측정함으로써, 세포 내에서의 콜라겐 합성 정도를 파악할 수 있다. 상기 조성물은 프로콜라겐의 발현을 증가시킴으로써 피부 주름 개선 및 피부 탄력 증진 효과를 나타낼 수 있다.The composition may increase the expression of procollagen. In general, it is known that collagen related to wrinkles of skin cells is synthesized in the form of a precursor called procollagen. Therefore, by measuring the amount of the procollagen peptide, it is possible to grasp the degree of collagen synthesis in the cell. The composition may exhibit the effect of improving skin wrinkles and enhancing skin elasticity by increasing the expression of procollagen.
상기 조성물은 콜라겐 합성 인자(Collagen, type 1, alpha 1, COL1A1)의 발현을 증가시킬 수 있다. COL1A1의 발현 수준을 측정함으로써, 세포 내에서의 콜라겐 합성 정도를 파악할 수 있다. 상기 조성물은 COL1A1의 발현을 증가시킴으로써 피부에서 콜라겐 합성을 유도하여 피부 주름 개선, 피부 탄력 증진 효과를 나타낼 수 있다.The composition may increase the expression of collagen synthesis factor (Collagen, type 1, alpha 1, COL1A1). By measuring the expression level of COL1A1, the degree of collagen synthesis in the cell can be determined. The composition induces collagen synthesis in the skin by increasing the expression of COL1A1, thereby improving skin wrinkles and enhancing skin elasticity.
상기 조성물은 아쿠아포린 3(aquaporin 3, AQP3)의 발현을 증가시킬 수 있다. 상기 조성물은 AQP3의 발현을 증가시킴으로써 피부 세포에 원활하게 수분을 공급하여 피부 보습 효과를 나타낼 수 있다.The composition may increase the expression of aquaporin 3 (AQP3). The composition may exhibit a skin moisturizing effect by smoothly supplying moisture to skin cells by increasing the expression of AQP3.
상기 조성물은 히알루론산 합성효소 3(hyaluronan synthase, HAS3)의 발현을 증가시킬 수 있다. 상기 조성물은 HAS3의 발현을 증가시킴으로써 히알루론산 합성을 유도하여 피부 보습, 피부 장벽 강화 효과를 나타낼 수 있다.The composition may increase the expression of hyaluronan synthase 3 (HAS3). The composition induces hyaluronic acid synthesis by increasing the expression of HAS3, thereby exhibiting skin moisturizing and skin barrier strengthening effects.
상기 조성물은 필라그린(filaggrin)의 발현을 증가시킬 수 있다. 상기 필라그린은 피부 장벽을 이루는 보습 성분이다. 상기 조성물은 필라그린의 발현을 증가시킴으로써 피부 보습 및 피부 장벽 강화 효과를 나타낼 수 있다.The composition may increase the expression of filaggrin. The filaggrin is a moisturizing component that forms the skin barrier. The composition may exhibit skin moisturizing and skin barrier strengthening effects by increasing the expression of filaggrin.
따라서, 상기 조성물은 프로게린의 발현을 억제하거나, SIRT1, 프로콜라겐, COL1A1, AQP3, HAS3, 및 필라그린 중 어느 하나 이상의 발현을 증가시킬 수 있다.Accordingly, the composition may inhibit the expression of progerin or increase the expression of any one or more of SIRT1, procollagen, COL1A1, AQP3, HAS3, and filaggrin.
일 실시예에서, 상기 발효물은 피부 노화 방지, 조로증 예방 또는 치료, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 및 피부 장벽 강화 효과가 우수함을 확인하였다. In one embodiment, it was confirmed that the fermented product is excellent in preventing skin aging, preventing or treating premature aging, improving skin wrinkles, enhancing skin elasticity, moisturizing the skin, and strengthening the skin barrier.
상기 발효물은 선인장오일, 호호바씨오일, 또는 이들의 조합을 칸디다 속 미생물에 의해 발효시켜 수득할 수 있다.The fermented product may be obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by microorganisms of the genus Candida.
용어 “선인장(Cactus)”은 쌍떡잎식물 선인장목 선인장과에 속하는 식물의 총칭이다. 상기 선인장은 특정 종류에 제한되지 않으나, 예를 들어, 보검선인장(Opuntia Ficus-Indica), 변경주선인장(Carnegiea gigantea), 프리클리페어선인장(Opuntia engelmannii, Engelmann Prickly Pear Cactus) 등일 수 있다. 상기 보검선인장은 백년초라고도 한다. 상기 변경주선인장은 사와로선인장(Saguaro cactus)이라고도 한다.The term “cactus” is a generic term for dicotyledonous plants belonging to the cactus family. The cactus is not limited to a specific type, but may be, for example, a bogum cactus ( Opuntia Ficus-Indica ), a marginal cactus ( Carnegiea gigantea ), a pre-clear cactus ( Opuntia engelmannii , Engelmann Prickly Pear Cactus ), and the like. The bogum cactus is also called baeknyeoncho. The marginal cactus is also called Saguaro cactus.
용어 “선인장오일(Cactus oil)”은 선인장으로부터 추출하거나 압착하여 얻은 오일이다. 상기 선인장오일은 선인장 씨로부터 얻은 오일일 수 있다. 따라서, “선인장오일”은 “선인장씨오일”과 상호교환적으로 사용될 수 있다. 일 구체예에서, 상기 선인장오일은 보검선인장오일, 변경주선인장오일, 또는 프리클리페어선인장오일일 수 있으나, 이러한 특정 종류에 제한되지 않는다. 예를 들어, 상기 선인장오일은 미국 애리조나에서 채취한 선인장오일일 수 있으나, 이러한 특정 종류에 제한되지 않는다.The term “cactus oil” is an oil obtained by extraction or pressing from a cactus. The cactus oil may be oil obtained from cactus seeds. Accordingly, “cactus oil” may be used interchangeably with “cactus seed oil”. In one embodiment, the cactus oil may be bogum cactus oil, alfalfa cactus oil, or pre-clear cactus oil, but is not limited thereto. For example, the cactus oil may be cactus oil collected in Arizona, USA, but is not limited to this specific type.
용어 “호호바씨오일(Simmondsia Chinensis (Jojoba) Seed Oil)”은 사막 관목인 호호바(Simmondsia Chinensis) 씨에서 추출하거나 압착하여 만든 불휘발성 오일에서 얻은 물질이다.The term “Simmondsia Chinensis (Jojoba) Seed Oil” is a substance obtained from a nonvolatile oil extracted or pressed from the seeds of the desert shrub Simmondsia Chinensis .
일 구체예에서, 상기 발효물은 선인장오일을 칸디다 속 미생물에 의해 발효시켜 수득할 수 있다.In one embodiment, the fermented product may be obtained by fermenting cactus oil by microorganisms of the genus Candida.
다른 구체예에서, 상기 발효물은 호호바씨오일을 칸디다 속 미생물에 의해 발효시켜 수득할 수 있다.In another embodiment, the fermented product may be obtained by fermenting jojoba seed oil by microorganisms of the genus Candida.
또 다른 구체예에서, 상기 발효물은 선인장오일 및 호호바씨오일의 조합을 칸디다 속 미생물에 의해 발효시켜 수득할 수 있다. 선인장오일 및 호호바씨오일의 조합을 사용할 경우, 상기 발효물은 선인장오일 및 호호바씨오일을 포함하는 혼합물을 발효시켜 수득한 것일 수 있다. In another embodiment, the fermented product may be obtained by fermenting a combination of cactus oil and jojoba seed oil by a microorganism of the genus Candida. When a combination of cactus oil and jojoba seed oil is used, the fermented product may be obtained by fermenting a mixture containing cactus oil and jojoba seed oil.
상기 선인장오일 및 호호바씨오일의 혼합 중량비는 특정 중량비에 제한되지 않는다. 상기 발효물은 선인장오일 및 호호바씨오일을 1:100 내지 100:1의 중량비, 예를 들어, 1:50 내지 50:1의 중량비, 1:20 내지 20:1의 중량비, 1:10 내지 10:1의 중량비, 1:5 내지 5:1의 중량비, 1:2 내지 2:1의 중량비, 1:1.5 내지 1.5:1의 중량비 또는 약 1:1의 중량비로 포함하는 혼합물을 발효시켜 수득한 것일 수 있다. 일 실시예에서, 선인장오일 및 호호바씨오일을 1:1의 중량비로 포함하는 혼합물을 발효시켜 수득한 발효물은 선인장오일 또는 호호바씨오일을 단독으로 사용하거나, 다른 중량비로 사용한 경우에 비해 피부 노화 방지, 조로증 예방 또는 치료, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 및 피부 장벽 강화 효과가 우수함을 확인하였다.The mixing weight ratio of the cactus oil and jojoba seed oil is not limited to a specific weight ratio. The fermented product is cactus oil and jojoba seed oil in a weight ratio of 1:100 to 100:1, for example, a weight ratio of 1:50 to 50:1, a weight ratio of 1:20 to 20:1, 1:10 to 10 Obtained by fermenting a mixture comprising a weight ratio of :1, a weight ratio of 1:5 to 5:1, a weight ratio of 1:2 to 2:1, a weight ratio of 1:1.5 to 1.5:1, or a weight ratio of about 1:1 it could be In one embodiment, the fermented product obtained by fermenting a mixture containing cactus oil and jojoba seed oil in a weight ratio of 1:1 is skin aging compared to the case of using cactus oil or jojoba seed oil alone or using a different weight ratio It was confirmed that it was excellent in preventing, preventing or treating progeria, improving skin wrinkles, enhancing skin elasticity, moisturizing the skin, and strengthening the skin barrier.
상기 칸디다(Candida sp.) 속 미생물은 칸디다 봄비콜라(Candida bombicola)일 수 있으나, 이에 제한되지 않는다. 상기 칸디다 봄비콜라는 흙으로부터 분리된 것일 수 있으나, 이에 제한되지 않는다.The Candida ( Candida sp.) genus microorganisms may be Candida bombicola ( Candida bombicola ), but is not limited thereto. The Candida bombicola may be isolated from soil, but is not limited thereto.
상기 발효 조건은 미생물의 종류에 따라 적절한 온도 및 시간을 선택할 수 있다. 예를 들어, 상기 발효는 20 내지 40℃에서 수행될 수 있으나, 특별히 이에 제한되지 않는다. 또한, 상기 발효는 1 내지 200시간, 1 내지 180시간, 24 내지 200시간, 24 내지 180시간, 72 내지 200시간, 72 내지 180시간, 100 내지 200시간, 또는 100 내지 180시간 동안 수행될 수 있으나, 특별히 이에 제한되지 않는다.As the fermentation conditions, an appropriate temperature and time may be selected according to the type of microorganism. For example, the fermentation may be performed at 20 to 40° C., but is not particularly limited thereto. In addition, the fermentation may be performed for 1 to 200 hours, 1 to 180 hours, 24 to 200 hours, 24 to 180 hours, 72 to 200 hours, 72 to 180 hours, 100 to 200 hours, or 100 to 180 hours. , which is not particularly limited thereto.
상기 발효는 칸디다 속 미생물을 배양할 수 있는 배지에서 수행될 수 있다. 상기 배지는 칸디다 속 미생물을 배양할 수 있는 공지된 배지 또는 통상적인 배지를 사용할 수 있다.The fermentation may be performed in a medium capable of culturing the microorganisms of the genus Candida. As the medium, a known medium or a conventional medium capable of culturing the microorganisms of the genus Candida may be used.
상기 발효물은 선인장오일, 호호바씨오일, 또는 이들의 조합을 칸디다 속 미생물에 의해 발효시켜 수득한 발효액, 상기 발효액의 희석액 또는 농축액, 상기 발효액을 건조하여 얻어지는 건조물, 또는 이들 조정제물 또는 정제물, 이를 분획한 분획물 등을 포함할 수 있다.The fermented product is a fermentation broth obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by a microorganism of the genus Candida, a diluted or concentrated solution of the fermentation broth, a dried product obtained by drying the fermentation broth, or a prepared or purified product thereof; It may include a fraction obtained by fractionation thereof.
상기 발효물은 조성물 총 중량에 대해 0.0001 내지 99.9999 중량%, 0.0001 내지 90 중량%, 0.0001 내지 50 중량%, 0.0001 내지 10 중량%, 0.01 내지 99.9999 중량%, 0.01 내지 90 중량%, 0.01 내지 50 중량%, 0.01 내지 10 중량%, 0.1 내지 99.9999 중량%, 0.1 내지 90 중량%, 0.1 내지 50 중량%, 또는 0.1 내지 10 중량%로 포함될 수 있으나, 특별히 이에 제한되지 않는다.The fermented product is 0.0001 to 99.9999% by weight, 0.0001 to 90% by weight, 0.0001 to 50% by weight, 0.0001 to 10% by weight, 0.01 to 99.9999% by weight, 0.01 to 90% by weight, 0.01 to 50% by weight based on the total weight of the composition , 0.01 to 10% by weight, 0.1 to 99.9999% by weight, 0.1 to 90% by weight, 0.1 to 50% by weight, or may be included in 0.1 to 10% by weight, but is not particularly limited thereto.
상기 발효물은 조성물 총 중량에 대해 0.0001 내지 99.9999%(v/v), 0.0001 내지 90%(v/v), 0.0001 내지 50%(v/v), 0.0001 내지 10%(v/v), 0.01 내지 99.9999%(v/v), 0.01 내지 90%(v/v), 0.01 내지 50%(v/v), 0.01 내지 10%(v/v), 0.1 내지 99.9999%(v/v), 0.1 내지 90%(v/v), 0.1 내지 50%(v/v), 0.1 내지 10%(v/v), 또는 0.1 내지 1%(v/v)로 포함될 수 있으나, 특별히 이에 제한되지 않는다.The fermented product is 0.0001 to 99.9999% (v / v), 0.0001 to 90% (v / v), 0.0001 to 50% (v / v), 0.0001 to 10% (v / v), 0.01 based on the total weight of the composition to 99.9999% (v/v), 0.01 to 90% (v/v), 0.01 to 50% (v/v), 0.01 to 10% (v/v), 0.1 to 99.9999% (v/v), 0.1 to 90% (v/v), 0.1 to 50% (v/v), 0.1 to 10% (v/v), or 0.1 to 1% (v/v), but is not particularly limited thereto.
용어 "유효성분으로 포함"은 상기에서 언급한 효과를 나타낼 수 있는 정도로 본 명세서의 발효물이 첨가되는 것을 의미한다. 또한, 이는 약물전달 및 안정화 등을 위하여 다양한 성분을 부성분으로 첨가하여 다양한 형태로 포뮬레이션(formulation)되는 것을 포함할 수 있다.The term "included as an active ingredient" means that the fermented product of the present specification is added to an extent capable of exhibiting the above-mentioned effects. In addition, this may include being formulated in various forms by adding various components as sub-components for drug delivery and stabilization.
상기 조성물은 화장료 조성물일 수 있다.The composition may be a cosmetic composition.
상기 화장료 조성물은 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있다. 예를 들면, 상기 화장료 조성물은 화장수, 크림, 에센스, 클렌징 폼, 클렌징 워터, 팩, 앰플, 바디 로션, 바디 오일, 바디 젤, 샴푸, 린스, 헤어 컨디셔너, 헤어 젤, 파운데이션, 립스틱, 마스카라, 메이크업 베이스, 또는 피부 점착 타입의 화장료 제형을 갖는 것일 수 있다. 상기 피부 점착 타입의 화장료 제형은 예를 들어, 마스크팩일 수 있으나, 이에 제한되지 않는다.The cosmetic composition may be prepared in any conventionally prepared formulation. For example, the cosmetic composition may be a lotion, cream, essence, cleansing foam, cleansing water, pack, ampoule, body lotion, body oil, body gel, shampoo, conditioner, hair conditioner, hair gel, foundation, lipstick, mascara, makeup It may have a cosmetic formulation of a base or skin adhesion type. The skin adhesion type cosmetic formulation may be, for example, a mask pack, but is not limited thereto.
상기 화장료 조성물에 포함되는 성분은 유효성분으로서 상기 조성물 이외에 화장료 조성물에 통상적으로 이용되는 성분들을 포함할 수 있으며, 예를 들면, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제 및 담체를 포함할 수 있다.Components included in the cosmetic composition may include components commonly used in cosmetic compositions in addition to the composition as an active ingredient, for example, conventional adjuvants and carriers such as stabilizers, solubilizers, vitamins, pigments and fragrances. may include
또한, 상기 조성물은 피부외용제용 조성물일 수 있다. In addition, the composition may be a composition for external application to the skin.
상기 피부외용제는 크림, 겔, 연고, 피부 유화제, 피부 현탁액, 경피전달성 패치, 약물 함유 붕대, 로션, 또는 그 조합일 수 있다. 상기 피부외용제는 통상 화장품이나 의약품 등의 피부외용제에 사용되는 성분, 예를 들면 수성성분, 유성성분, 분말성분, 알코올류, 보습제, 증점제, 자외선흡수제, 미백제, 방부제, 산화방지제, 계면활성제, 향료, 색제, 각종 피부 영양제, 또는 이들의 조합과 필요에 따라서 적절하게 배합될 수 있다. 상기 피부외용제는, 에데트산이나트륨, 에데트산삼나트륨, 시트르산나트륨, 폴리인산나트륨, 메타인산나트륨, 글루콘산 등의 금속봉쇄제, 카페인, 탄닌, 벨라파밀, 감초추출물, 글라블리딘, 칼린의 과실의 열수추출물, 각종생약, 아세트산토코페롤, 글리틸리틴산, 트라넥삼산 및 그 유도체 또는 그 염등의 약제, 비타민 C, 아스코르브산인산마그네슘, 아스코르브산글루코시드, 알부틴, 코지산, 글루코스, 프룩토스, 트레할로스 등의 당류등도 적절하게 배합할 수 있다.The external preparation for skin may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal patch, drug-containing bandage, lotion, or a combination thereof. The external preparation for skin is a component usually used in external preparations for skin such as cosmetics or pharmaceuticals, for example, an aqueous component, an oily component, a powder component, alcohol, a moisturizer, a thickener, an ultraviolet absorber, a whitening agent, a preservative, an antioxidant, a surfactant, a fragrance , colorant, various skin nutrients, or a combination thereof may be appropriately formulated as needed. The external preparation for skin includes metal-blocking agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, belapamil, licorice extract, glablidine, and kaline. Fruit hot water extracts, various herbal medicines, tocopherol acetate, glitylittic acid, tranexamic acid and derivatives or salts thereof, vitamin C, magnesium ascorbate phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, Sugars, such as trehalose, etc. can be mix|blended suitably.
상기 조성물은 식품 조성물일 수 있다. 상기 조성물은 건강기능식품 조성물일 수 있다.The composition may be a food composition. The composition may be a health functional food composition.
상기 식품 조성물은 상기 효소 가수분해물 단독, 또는 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효 성분의 혼합양은 사용 목적 (예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시에 본 명세서의 조성물은 원료에 대하여 15 중량부 이하의 양으로 첨가될 수 있다. 상기 건강기능식품의 종류에는 특별한 제한은 없다. 건강기능식품의 종류 중 음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상기 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드, 말토스, 슈크로스와 같은 디사카라이드, 및 덱스트린, 사이클로덱스트린과 같은 폴리사카라이드, 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 건강식품 조성물은 또한 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제, 또는 그 조합을 함유할 수 있다. 상기 건강기능식품 조성물은 또한, 천연 과일쥬스, 과일쥬스 음료, 야채 음료의 제조를 위한 과육, 또는 그 조합을 함유할 수 있다.The food composition may be used alone or in combination with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined depending on the purpose of use (prophylactic, health or therapeutic treatment). In general, in the production of food or beverage, the composition of the present specification may be added in an amount of 15 parts by weight or less based on the raw material. There is no particular limitation on the type of the health functional food. Among the types of health functional food, the beverage composition may contain various flavoring agents or natural carbohydrates as an additional component like a conventional beverage. The natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used. The health food composition can also be added to nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonated beverages carbonation agent used, or a combination thereof. The health functional food composition may also contain natural fruit juice, fruit juice beverage, fruit flesh for the production of vegetable beverage, or a combination thereof.
상기 조성물은 약학적 조성물일 수 있다. The composition may be a pharmaceutical composition.
일 구체예에서, 상기 약학적 조성물은 피부 노화 또는 조로증의 예방 또는 치료용일 수 있다.In one embodiment, the pharmaceutical composition may be for preventing or treating skin aging or premature aging.
상기 피부 노화는 광노화, 또는 연령에 의한 피부 노화일 수 있다.The skin aging may be photoaging or skin aging due to age.
상기 약학적 조성물은 약제학적으로 허용가능한 희석제 또는 담체를 추가적으로 포함할 수 있다. 상기 희석제는 유당, 옥수수 전분, 대두유, 미정질 셀룰로오스, 또는 만니톨, 활택제로는 스테아린산 마그네슘, 탈크, 또는 그 조합일 수 있다. 상기 담체는 부형제, 붕해제, 결합제, 활택제, 또는 그 조합일 수 있다. 상기 부형제는 미결정 셀룰로오즈, 유당, 저치환도 히드록시셀룰로오즈, 또는 그 조합일 수 있다. 상기 붕해제는 카르복시메틸셀룰로오스 칼슘, 전분글리콜산 나트륨, 무수인산일수소 칼슘, 또는 그 조합일 수 있다. 상기 결합제는 폴리비닐피롤리돈, 저치환도 히드록시프로필셀룰로오즈, 히드록시프로필셀룰로오즈, 또는 그 조합일 수 있다. 상기 활택제는 스테아린산 마그네슘, 이산화규소, 탈크, 또는 그 조합일 수 있다.The pharmaceutical composition may further include a pharmaceutically acceptable diluent or carrier. The diluent may be lactose, corn starch, soybean oil, microcrystalline cellulose, or mannitol, and the lubricant may be magnesium stearate, talc, or a combination thereof. The carrier may be an excipient, a disintegrant, a binder, a lubricant, or a combination thereof. The excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof. The disintegrant may be carboxymethyl cellulose calcium, sodium starch glycolate, anhydrous calcium monohydrogen phosphate, or a combination thereof. The binder may be polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose, or a combination thereof. The lubricant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.
상기 약학적 조성물은 경구 또는 비경구 투여 제형으로 제형화될 수 있다. 경구 투여 제형은 과립제, 산제, 액제, 정제, 캅셀제, 건조시럽제, 또는 그 조합일 수 있다. 비경구 투여 제형은 주사제일 수 있다.The pharmaceutical composition may be formulated as an oral or parenteral dosage form. Oral dosage forms may be granules, powders, solutions, tablets, capsules, dry syrups, or a combination thereof. The parenteral dosage form may be an injection.
다른 양상은 선인장오일, 호호바씨오일, 또는 이들의 조합의 발효물을 제조하는 방법을 제공한다.Another aspect provides a method for preparing a fermented product of cactus oil, jojoba seed oil, or a combination thereof.
상기 방법은, 선인장오일, 호호바씨오일, 또는 이들의 조합을 칸디다 속(Candida sp.) 미생물과 인큐베이션하여 발효물을 수득하는 단계를 포함한다.The method includes incubating cactus oil, jojoba seed oil, or a combination thereof with a microorganism of the genus Candida to obtain a fermented product.
상기 선인장오일, 호호바씨오일, 및 발효물에 관한 상세는 상술한 바와 같다.Details regarding the cactus oil, jojoba seed oil, and fermented product are as described above.
일 구체예에서, 상기 방법은 선인장오일을 칸디다 속 미생물과 인큐베이션하여 발효물을 수득하는 단계를 포함하는 선인장오일 발효물을 제조하는 방법일 수 있다.In one embodiment, the method may be a method for producing a fermented cactus oil comprising the step of incubating the cactus oil with a microorganism of the genus Candida to obtain a fermented product.
다른 구체예에서, 상기 방법은 호호바씨오일을 칸디다 속 미생물과 인큐베이션하여 발효물을 수득하는 단계를 포함하는 호호바씨오일 발효물을 제조하는 방법일 수 있다.In another embodiment, the method may be a method for producing a fermented jojoba seed oil comprising the step of incubating the jojoba seed oil with a microorganism of the genus Candida to obtain a fermented product.
또 다른 구체예에서, 상기 방법은 선인장오일 및 호호바씨오일의 조합을 칸디다 속 미생물과 인큐베이션하여 발효물을 수득하는 단계를 포함하는 선인장오일 및 호호바씨오일의 동시 발효물을 제조하는 방법일 수 있다. 상기 선인장오일 및 호호바씨오일의 조합은 선인장오일 및 호호바씨오일을 포함하는 혼합물일 수 있다. 상기 선인장오일 및 호호바씨오일의 혼합 중량비에 관한 상세는 상술한 바와 같다.In another embodiment, the method may be a method for producing a co-fermented product of cactus oil and jojoba seed oil, comprising the step of incubating a combination of cactus oil and jojoba seed oil with a microorganism of the genus Candida to obtain a fermented product . The combination of cactus oil and jojoba seed oil may be a mixture comprising cactus oil and jojoba seed oil. Details regarding the mixing weight ratio of the cactus oil and jojoba seed oil are the same as described above.
상기 칸디다 속 미생물은 칸디다 봄비콜라일 수 있다.The microorganism of the genus Candida may be Candida bombicola.
상기 칸디다 봄비콜라는 발효가 일어날 수 있도록 충분한 양을 사용할 수 있으며, 이는 발효 원료의 양 등을 고려하여 당업자가 적절히 선택할 수 있다.The Candida bombicola may be used in an amount sufficient to allow fermentation to occur, which may be appropriately selected by those skilled in the art in consideration of the amount of fermentation raw materials.
상기 인큐베이션 온도 및 시간은 발효가 일어날 수 있도록 충분한 온도 및 시간을 선택할 수 있으며, 이는 발효 원료의 양, 미생물의 종류 등을 고려하여 당업자가 적절히 선택할 수 있다. 예를 들어, 상기 인큐베이션은 20 내지 40℃에서 수행될 수 있으나, 특별히 이에 제한되지 않는다. 또한, 상기 인큐베이션은 1 내지 200시간, 1 내지 180시간, 24 내지 200시간, 24 내지 180시간, 72 내지 200시간, 72 내지 180시간, 100 내지 200시간, 또는 100 내지 180시간 동안 수행될 수 있으나, 특별히 이에 제한되지 않는다.The incubation temperature and time may be selected as sufficient temperature and time for fermentation to occur, which may be appropriately selected by those skilled in the art in consideration of the amount of fermentation raw material, the type of microorganism, and the like. For example, the incubation may be performed at 20 to 40° C., but is not particularly limited thereto. In addition, the incubation may be performed for 1 to 200 hours, 1 to 180 hours, 24 to 200 hours, 24 to 180 hours, 72 to 200 hours, 72 to 180 hours, 100 to 200 hours, or 100 to 180 hours. , which is not particularly limited thereto.
상기 발효는 칸디다 속 미생물을 배양할 수 있는 배지에서 수행될 수 있다. 상기 배지는 칸디다 속 미생물을 배양할 수 있는 공지된 배지 또는 통상적인 배지를 사용할 수 있다.The fermentation may be performed in a medium capable of culturing the microorganisms of the genus Candida. As the medium, a known medium or a conventional medium capable of culturing the microorganisms of the genus Candida may be used.
상기 방법은, 상기 발효물로부터 수분 및 균체를 분리하여 오일 성분을 수득하는 단계를 더 포함할 수 있다. 상기 수분 및 균체의 분리는 공지된 통상적인 방법을 사용할 수 있으며, 예를 들어, 정치, 원심분리, 이들의 조합 등을 사용할 수 있다.The method may further include the step of obtaining an oil component by separating moisture and cells from the fermented product. The separation of water and cells may use a known conventional method, for example, stationary, centrifugation, a combination thereof, etc. may be used.
상기 방법은, 상기 발효물을 여과하는 단계를 더 포함할 수 있다. 상기 여과는 공지된 통상적인 방법을 사용할 수 있다.The method may further include filtering the fermented product. The filtration may use a known conventional method.
상기 방법은, 상기 발효물을 탈취 및/또는 탈색하는 단계를 더 포함할 수 있다. 상기 탈취 및/또는 탈색은 흡착제를 사용하여 수행할 수 있다. 상기 흡착제는 공지된 통상적인 흡착제를 사용할 수 있으며, 예를 들어 활성탄, 제오라이트 등이 있으나, 특별히 이에 제한되지 않는다.The method may further include deodorizing and/or decolorizing the fermented product. The deodorization and/or decolorization may be performed using an adsorbent. As the adsorbent, a known conventional adsorbent may be used, for example, activated carbon, zeolite, and the like, but is not particularly limited thereto.
다른 양상은 유효량의 상기 발효물 또는 이를 포함하는 조성물을 그를 필요로 하는 개체에 투여하는 단계를 포함하는 개체의 피부 상태를 개선하는 방법을 제공한다.Another aspect provides a method for improving a skin condition in a subject comprising administering to a subject in need thereof an effective amount of the fermented product or a composition comprising the same.
다른 양상은 유효량의 상기 발효물 또는 이를 포함하는 조성물을 그를 필요로 하는 개체에 투여하는 단계를 포함하는 피부 노화 또는 조로증을 예방 또는 치료하는 방법을 제공한다.Another aspect provides a method for preventing or treating skin aging or premature aging, comprising administering to an individual in need thereof an effective amount of the fermented product or a composition comprising the same.
상기 발효물, 조성물, 피부 상태 개선, 피부 노화, 및 조로증에 관한 상세는 상술한 바와 같다.Details of the fermented product, composition, skin condition improvement, skin aging, and premature aging are the same as described above.
용어 "유효량"이란 상기에서 언급한 효과를 나타낼 수 있을 정도로 유효한 양을 의미한다.The term "effective amount" means an amount effective enough to produce the above-mentioned effects.
용어 "투여하는", "도입하는", 및 "이식하는"은 상호교환적으로 사용되고 일 구체예에 따른 조성물의 원하는 부위로의 적어도 부분적 국소화를 초래하는 방법 또는 경로에 의한 개체 내로의 일 구체예에 따른 조성물의 배치를 의미할 수 있다. The terms "administering", "introducing", and "implanting" are used interchangeably and in one embodiment into a subject by a method or route that results in at least partial localization of the composition according to one embodiment to a desired site. It may mean the arrangement of the composition according to
투여는 당업계에 알려진 방법에 의하여 투여될 수 있다. 투여는 예를 들면, 정맥내, 근육내, 경구, 경피(transdermal), 점막, 코안(intranasal), 기관내(intratracheal) 또는 피하 투여와 같은 경로로, 임의의 수단에 의하여 개체로 직접적으로 투여될 수 있다. 상기 투여는 전신적으로 또는 국부적으로 투여될 수 있다. 상기 투여는 피부에 도포하는 것일 수 있다.Administration may be administered by methods known in the art. Administration can be administered directly to a subject by any means, for example, intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal or subcutaneous administration. can The administration may be systemically or locally. The administration may be applied to the skin.
상기 개체는 포유동물, 예를 들면, 사람, 소, 말, 돼지, 개, 양, 염소, 또는 고양이일 수 있다. 상기 개체는 피부 상태 개선, 예를 들어 피부 노화 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화, 조로증 예방 또는 치료를 필요로 하는 개체일 수 있다.The subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat. The subject may be an individual in need of improving skin condition, for example, preventing skin aging, improving skin wrinkles, enhancing skin elasticity, moisturizing skin, strengthening skin barrier, preventing or treating premature aging.
상기 투여는 일 구체예에 따른 조성물을 개체당 일당 0.1 mg 내지 1,000 mg, 예를 들면, 0.1 mg 내지 500 mg, 0.1 mg 내지 100 mg, 0.1 mg 내지 50 mg, 0.1 mg 내지 25 mg, 1 mg 내지 1,000 mg, 1 mg 내지 500 mg, 1 mg 내지 100 mg, 1 mg 내지 50 mg, 1 mg 내지 25 mg, 5mg 내지 1,000 mg, 5 mg 내지 500 mg, 5 mg 내지 100 mg, 5 mg 내지 50 mg, 5 mg 내지 25 mg, 10mg 내지 1,000 mg, 10 mg 내지 500 mg, 10 mg 내지 100 mg, 10 mg 내지 50 mg, 또는 10 mg 내지 25 mg을 투여하는 것일 수 있다. 다만, 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성별, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있고, 당업자라면 이러한 요인들을 고려하여 투여량을 적절히 조절할 수 있다. 투여 횟수는 1일 1회 또는 임상적으로 용인가능한 부작용의 범위 내에서 2회 이상이 가능하고, 투여 부위에 대해서도 1개소 또는 2개소 이상에 투여할 수 있으며, 매일 또는 2 내지 5일 간격으로 총 투여 일수는 한번 치료 시 1일에서 30일까지 투여될 수 있다. 필요한 경우, 적정 시기 이후에 동일한 치료를 반복할 수 있다. 인간 이외의 동물에 대해서도, kg당 인간과 동일한 투여량으로 하거나, 또는 예를 들면 목적의 동물과 인간과의 기관(심장 등)의 용적비(예를 들면, 평균값) 등으로 상기의 투여량을 환산한 양을 투여할 수 있다.The administration is 0.1 mg to 1,000 mg, for example, 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1 mg of the composition according to one embodiment per day 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or 10 mg to 25 mg may be administered. However, the dosage may be prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and reaction sensitivity, and those skilled in the art The dosage may be appropriately adjusted in consideration of these factors. The number of administration may be once a day or twice or more within the range of clinically acceptable side effects, and may be administered to one or two or more sites for the administration site, and total daily or at intervals of 2 to 5 days The number of days of administration may range from 1 to 30 days per treatment. If necessary, the same treatment can be repeated after a titration period. For animals other than humans, the dose is the same as that of a human per kg, or the above dose is converted, for example, by the volume ratio (for example, average value) of the target animal and the organ (heart, etc.) of the human One dose can be administered.
다른 양상은 피부 상태 개선용 조성물을 제조하는데 사용하기 위한 상기 발효물의 용도를 제공한다.Another aspect provides the use of the fermented product for use in preparing a composition for improving skin conditions.
다른 양상은 피부 노화 또는 조로증의 예방 또는 치료용 약제를 제조하는데 사용하기 위한 상기 발효물의 용도를 제공한다.Another aspect provides the use of the fermented product for use in the manufacture of a medicament for the prevention or treatment of skin aging or premature aging.
상기 피부 상태 개선, 발효물, 피부 노화, 및 조로증에 관한 상세는 상술한 바와 같다.Details of the skin condition improvement, fermented product, skin aging, and premature aging are the same as described above.
일 양상에 따른 선인장오일, 호호바씨오일, 또는 이들의 조합을 칸디다 속 미생물에 의해 발효시켜 수득한 발효물을 포함하는 조성물은 피부 노화 방지, 조로증 예방 또는 치료, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화 등 피부 관련 상태의 예방, 개선, 또는 치료에 유용하게 사용될 수 있다.A composition comprising a fermented product obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by microorganisms of the genus Candida according to an aspect prevents skin aging, prevents or treats premature aging, improves skin wrinkles, improves skin elasticity, skin It can be usefully used for preventing, improving, or treating skin-related conditions such as moisturizing and strengthening the skin barrier.
도 1은 신생아 섬유아세포에서 프로게린 생산량을 측정한 결과이다.1 is a result of measuring progerin production in neonatal fibroblasts.
도 2는 성인 섬유아세포에서 프로게린 생산량을 측정한 결과이다.2 is a result of measuring progerin production in adult fibroblasts.
도 3은 SIRT1의 상대적 발현 수준을 나타낸 결과이다.3 is a result showing the relative expression level of SIRT1.
도 4는 음성대조군 대비 프로콜라겐 생산율(%)을 나타낸 그래프이다.4 is a graph showing the procollagen production rate (%) compared to the negative control group.
도 5는 COL1A1 mRNA의 상대적인 발현 수준을 나타낸 결과이다.5 is a result showing the relative expression level of COL1A1 mRNA.
도 6은 AQP-3 mRNA의 상대적인 발현 수준을 나타낸 결과이다.6 is a result showing the relative expression level of AQP-3 mRNA.
도 7은 HAS3 mRNA의 상대적인 발현 수준을 나타낸 결과이다.7 is a result showing the relative expression level of HAS3 mRNA.
도 8은 필라그린 mRNA의 상대적인 발현 수준을 나타낸 결과이다.8 is a result showing the relative expression level of filaggrin mRNA.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.
실시예 1 내지 5. 선인장오일, 호호바씨오일, 또는 이들의 조합의 발효물의 제조Examples 1 to 5. Preparation of fermented products of cactus oil, jojoba seed oil, or a combination thereof
하기 표 1과 같은 중량비로 발효 원료를 준비하였다. 발효 미생물은 흙에서 분리한 칸디다 봄비콜라(Candida bombicola)를 준비하였다.Fermentation raw materials were prepared in a weight ratio as shown in Table 1 below. Fermentation microorganisms were prepared with Candida bombicola isolated from soil.
구체적으로, 실시예 1은 선인장오일 및 호호바씨오일을 1:1의 중량비로 포함하는 혼합물을 발효 원료로 사용하였다. Specifically, in Example 1, a mixture containing cactus oil and jojoba seed oil in a weight ratio of 1:1 was used as a fermentation raw material.
실시예 2는 선인장오일 단독을 발효 원료로 사용하였다.In Example 2, cactus oil alone was used as a fermentation raw material.
실시예 3은 호호바씨오일 단독을 발효 원료로 사용하였다.In Example 3, jojoba seed oil alone was used as a fermentation raw material.
실시예 4는 선인장오일 및 호호바씨오일을 1:0.5의 중량비로 포함하는 혼합물을 발효 원료로 사용하였다.In Example 4, a mixture containing cactus oil and jojoba seed oil in a weight ratio of 1:0.5 was used as a fermentation raw material.
실시예 5는 선인장오일 및 호호바씨오일을 0.5:1의 중량비로 포함하는 혼합물을 발효 원료로 사용하였다.In Example 5, a mixture containing cactus oil and jojoba seed oil in a weight ratio of 0.5:1 was used as a fermentation raw material.
발효물 제조 방법은 다음과 같다. 발효 원료에 칸디다 봄비콜라(Candida bombicola)를 접종하여 25℃에서 150분 동안 발효를 진행하였다. 이때 배지로는 칸디다 봄비콜라를 배양할 수 있는 일반적인 성분의 배지를 사용하였다. 발효 원료와 배지의 혼합 중량비는 1:1로 하였다. 발효가 끝난 후, 정치 및 원심분리를 이용하여 수분과 균체를 분리하고, 순수 오일만을 수득하였다. 수득한 오일은 활성탄, 제오라이트 등 흡착제를 이용하여 탈취 및 탈색을 수행하였다. 그 다음, 1 um 및 0.45 um 필터로 여과하여 오일 발효물을 수득하였다. The method for preparing the fermented product is as follows. The fermentation raw material was inoculated with Candida bombicola and fermented at 25° C. for 150 minutes. At this time, as the medium, a medium of general components capable of culturing Candida bombicola was used. The mixing weight ratio of the fermentation raw material and the medium was set to 1:1. After fermentation, water and cells were separated using stationary and centrifugation, and only pure oil was obtained. The obtained oil was deodorized and decolorized using an adsorbent such as activated carbon or zeolite. Then, it was filtered through 1 um and 0.45 um filters to obtain an oily ferment.
실시예1Example 1 실시예2Example 2 실시예3Example 3 실시예4Example 4 실시예5Example 5
선인장오일cactus oil 1One 1One -- 1One 0.50.5
호호바씨오일 (Simmondsia Chinensis (Jojoba) Seed Oil)Simmondsia Chinensis (Jojoba) Seed Oil 1One -- 1One 0.50.5 1One
실험예 1. 발효물의 노화 방지 효과 확인Experimental Example 1. Confirmation of anti-aging effect of fermented product
발효물의 노화 방지 효과를 확인하기 위해, 상기 실시예 1 내지 5의 발효물 처리에 따른 프로게린 생산 분석을 수행하였다. In order to confirm the anti-aging effect of the fermented product, progerin production analysis according to the fermented product treatment of Examples 1 to 5 was performed.
구체적으로, 신생아 섬유아세포(neonatal fibroblast)와 성인 섬유아세포(adult fibroblast)를 배양한 다음, 상기 실시예 1 내지 5의 발효물을 0.1%(v/v)의 농도로 각각 첨가하고, ELISA assay을 수행하여 프로게린의 생산량을 확인하였다. 발효물을 첨가하지 않은 군을 음성대조군으로 하였다.Specifically, after culturing neonatal fibroblasts and adult fibroblasts, the fermented products of Examples 1 to 5 were added at a concentration of 0.1% (v/v), respectively, and ELISA assay was performed. was performed to confirm the production of progerin. The group to which no fermented product was added was used as a negative control group.
도 1은 신생아 섬유아세포에서 프로게린 생산량을 측정한 결과이다.1 is a result of measuring progerin production in neonatal fibroblasts.
도 2는 성인 섬유아세포에서 프로게린 생산량을 측정한 결과이다.2 is a result of measuring progerin production in adult fibroblasts.
도 1 및 2에 나타낸 바와 같이, 신생아 섬유아세포보다 성인 섬유아세포에서 프로게린 생산량이 높게 나타났다. 실시예 1 내지 5의 발효물을 첨가한 경우, 신생아 섬유아세포와 성인 섬유아세포 모두에서 프로게린 생산을 감소시키는 효과가 있었다. 특히, 선인장오일 및 호호바씨오일을 1:1의 중량비로 사용한 실시예 1의 발효물은 신생아 섬유아세포에서 음성대조군 대비 약 25%의 프로게린 합성을 감소시켰으며, 성인 섬유아세포에서 음성대조군 대비 약 50%의 프로게린 합성을 감소시켜 효과가 가장 우수하였다.1 and 2, progerin production was higher in adult fibroblasts than in neonatal fibroblasts. When the fermented products of Examples 1 to 5 were added, there was an effect of reducing progerin production in both neonatal fibroblasts and adult fibroblasts. In particular, the fermented product of Example 1 using cactus oil and jojoba seed oil in a weight ratio of 1:1 reduced progerin synthesis by about 25% in neonatal fibroblasts compared to negative control, and in adult fibroblasts compared to negative control, The effect was the most excellent by reducing the synthesis of progerin by 50%.
따라서, 실시예 1 내지 5의 발효물은 프로게린 발현을 억제함으로써 노화 방지 또는 조로증 예방 또는 치료 효과를 나타냄을 확인할 수 있었다.Therefore, it was confirmed that the fermented products of Examples 1 to 5 exhibit anti-aging or progerin prevention or treatment effects by inhibiting progerin expression.
실험예 2. 발효물의 노화 방지 장수유전자(SIRT1) 발현 증가 효과 확인Experimental Example 2. Confirmation of the effect of increasing expression of anti-aging longevity gene (SIRT1) in fermented products
노화 방지 장수유전자인 SIRT1의 발현 수준을 웨스턴블롯(WesternBlot)을 수행하여 확인하였다.The expression level of SIRT1, an anti-aging longevity gene, was confirmed by performing Western Blot.
구체적으로, 인간 각질형성세포(Human Epidermal keratinocyte)를 24시간 배양한 다음, 실시예 1 내지 5의 발효물을 0.1%(v/v)의 농도로 1시간 동안 전처리하고, 20 mJ/cm2의 UV를 조사하여 24시간 반응하였다. 반응 종료 후, 세포를 수확하여 SDS-PAGE를 통해 단백질을 분리하고, PVDF(Polyvinylidene fluoride) 멤브레인으로 옮겨주었다. 그 후, 1차 항체는 단일클론 마우스 항-SIRT1 항체(Sigma)를 사용하여 1시간 동안 상온에서 반응시켰고, 2차 항체는 염소 항-마우스 IgG-HRP(Santa Cruz)를 사용하여 1시간 동안 반응시켰다. 반응이 끝난 멤브레인은 1X TBS-T 완충액으로 3회 세척하여 ECL(enhanced chemiluminescence) 용액으로 반응시켰다. 단백질은 Chemi-Doc을 이용하여 밴드를 확인하였고, image J 프로그램을 통하여 β-actin과 대비해 수치화 하였다. UV를 조사하지 않고 실시예 1 내지 5의 발효물을 처리하지 않은 군을 양성대조군으로 하였고, 20 mJ/cm2의 UV를 조사한 군을 음성대조군으로 하였다.Specifically, after culturing human epidermal keratinocytes for 24 hours, the fermented products of Examples 1 to 5 were pretreated at a concentration of 0.1% (v/v) for 1 hour, and 20 mJ/cm 2 of It was irradiated with UV and reacted for 24 hours. After completion of the reaction, cells were harvested, proteins were separated through SDS-PAGE, and transferred to a polyvinylidene fluoride (PVDF) membrane. Thereafter, the primary antibody was reacted at room temperature for 1 hour using a monoclonal mouse anti-SIRT1 antibody (Sigma), and the secondary antibody was reacted for 1 hour using a goat anti-mouse IgG-HRP (Santa Cruz). made it After the reaction, the membrane was washed 3 times with 1X TBS-T buffer and reacted with ECL (enhanced chemiluminescence) solution. The protein was identified as a band using Chemi-Doc and quantified in comparison with β-actin through the image J program. The group not irradiated with UV and not treated with the fermented products of Examples 1 to 5 was used as a positive control group, and the group irradiated with UV of 20 mJ/cm 2 was used as a negative control group.
도 3은 SIRT1의 상대적 발현 수준을 나타낸 결과이다.3 is a result showing the relative expression level of SIRT1.
도 3에 나타낸 바와 같이, 실시예 1 내지 5의 발효물은 모두 SIRT1의 발현을 증가시켰다. 특히, 선인장오일 및 호호바씨오일을 1:1의 중량비로 사용한 실시예 1의 발효물은 SIRT1 발현 수준을 약 65% 증가시켜 SIRT1 발현 증가 효과가 가장 우수하였다. As shown in FIG. 3 , all of the ferments of Examples 1 to 5 increased the expression of SIRT1. In particular, the fermented product of Example 1 using cactus oil and jojoba seed oil in a weight ratio of 1:1 increased the SIRT1 expression level by about 65%, so that the SIRT1 expression increase effect was the best.
따라서, 실시예 1 내지 5의 발효물은 SIRT1 발현을 증가시킴으로써 노화 방지효과를 나타냄을 확인할 수 있었다.Therefore, it was confirmed that the fermented products of Examples 1 to 5 exhibited an anti-aging effect by increasing the expression of SIRT1.
실험예 3. 발효물의 피부 주름 개선 및 피부 탄력 증진 효과 확인Experimental Example 3. Confirmation of skin wrinkle improvement and skin elasticity enhancement effect of fermented product
발효물의 피부 주름 개선 및 피부 탄력 증진 효과를 확인하기 위해, 상기 실시예 1 내지 5의 발효물 처리에 따른 프로콜라겐 및 COL1A1의 생산 분석을 수행하였다. In order to confirm the skin wrinkle improvement and skin elasticity enhancing effect of the fermented product, production analysis of procollagen and COL1A1 according to the fermented products of Examples 1 to 5 was performed.
먼저, 인간 섬유아세포(Human Fibroblast)를 배양한 다음, 실시예 1 내지 5의 발효물을 0.1%(v/v)의 농도로 첨가하고, 프로콜라겐의 상대적인 생산율을 ELISA assay를 통해 확인하였다. 발효물을 첨가하지 않은 군을 음성대조군으로 하였고, TGF-β 10 ng/ml을 첨가한 군을 양성대조군으로 하였다.First, after culturing human fibroblasts (Human Fibroblast), the fermented products of Examples 1 to 5 were added at a concentration of 0.1% (v/v), and the relative production rate of procollagen was confirmed by ELISA assay. A group to which no fermentation was added was used as a negative control group, and a group to which 10 ng/ml of TGF-β was added was used as a positive control group.
도 4는 음성대조군 대비 프로콜라겐 생산율(%)을 나타낸 그래프이다.4 is a graph showing the procollagen production rate (%) compared to the negative control group.
도 4에 나타낸 바와 같이, 실시예 1 내지 5의 발효물을 첨가한 경우 모두 프로콜라겐의 합성을 증가시켰다. 특히, 실시예 1의 발효물은 프로콜라겐의 합성을 음성대조군 대비 약 39% 증가시킴을 확인하였다.As shown in FIG. 4, when the fermented products of Examples 1 to 5 were added, the synthesis of procollagen was increased. In particular, it was confirmed that the fermented product of Example 1 increased the synthesis of procollagen by about 39% compared to the negative control group.
다음으로, 인간 섬유아세포(Human Fibroblast)를 배양한 다음, 실시예 1 내지 5의 발효물을 0.1%(v/v)의 농도로 첨가하고, COL1A1 mRNA의 발현 수준을 Real-time PCR을 수행하여 확인하였다. 발효물을 첨가하지 않은 군을 음성대조군으로 하였고, TGF-β 10 ng/ml을 첨가한 군을 양성대조군으로 하였다. 상기 PCR에 사용된 프라이머 서열은 하기 표 2에 나타내었다.Next, after culturing human fibroblasts (Human Fibroblast), the fermented products of Examples 1 to 5 were added at a concentration of 0.1% (v/v), and the expression level of COL1A1 mRNA was measured by real-time PCR. Confirmed. A group to which no fermentation was added was used as a negative control group, and a group to which 10 ng/ml of TGF-β was added was used as a positive control group. The primer sequences used in the PCR are shown in Table 2 below.
프라이머명Primer name 서열order 서열번호SEQ ID NO:
Col1a1_forwardCol1a1_forward AGGGCCAAGACGAAGACATCAGGGCCAAGACGAAGACATC 1One
Col1a1_reverseCol1a1_reverse AGATCACGTCATCGCACAACAAGATCACGTCATCGCACAACA 22
도 5는 COL1A1 mRNA의 상대적인 발현 수준을 나타낸 결과이다.도 5에 나타낸 바와 같이, 실시예 1 내지 5의 발효물을 첨가한 경우 모두 COL1A1의 발현을 증가시켰다. 특히, 실시예 1의 발효물은 COL1A1의 발현을 음성대조군 대비 약 1.58배 증가시킴을 확인하였다.5 is a result showing the relative expression level of COL1A1 mRNA. As shown in FIG. 5, when the fermented products of Examples 1 to 5 were added, the expression of COL1A1 was increased in both cases. In particular, it was confirmed that the fermented product of Example 1 increased the expression of COL1A1 by about 1.58 times compared to the negative control group.
따라서, 실시예 1 내지 5의 발효물은 프로콜라겐 및 COL1A1 발현을 증가시킴으로써 피부 주름 개선 및 피부 탄력 증진 효과를 나타냄을 확인할 수 있었다.Therefore, it was confirmed that the fermented products of Examples 1 to 5 exhibited the effect of improving skin wrinkles and enhancing skin elasticity by increasing the expression of procollagen and COL1A1.
실험예 4. 발효물의 피부 보습 및 피부 장벽 강화 효과 확인Experimental Example 4. Confirmation of skin moisturizing and skin barrier strengthening effect of fermented product
발효물의 피부 보습 및 피부 장벽 강화 효과를 확인하기 위해, 상기 실시예 1 내지 5의 발효물 처리에 따른 아쿠아포린-3(AQP-3), 히알루론산 합성효소(Hyaluronan synthase 3, HAS3) 및 필라그린(Filaggrin) mRNA 발현 수준을 확인하였다. In order to confirm the skin moisturizing and skin barrier strengthening effect of the fermented product, aquaporin-3 (AQP-3), hyaluronic acid synthase 3, HAS3, and filaggrin according to the fermented product treatment of Examples 1 to 5 above (Filaggrin) mRNA expression level was confirmed.
구체적으로, 인간 각질형성세포(Human Epidermal keratinocyte)를 배양한 다음, 실시예 1 내지 5의 발효물을 0.1%(v/v)의 농도로 첨가하였다. mRNA를 수득하여 AQP-3, HAS3, 필라그린 발현량을 Real-Time PCR을 수행하여 비교 분석하였다. 발효물을 첨가하지 않은 군을 음성대조군으로 하였고, 레티노산(Retinoic acid) 1 uM을 첨가한 군을 양성대조군으로 하였다. 상기 PCR에 사용된 프라이머 서열은 하기 표 3에 나타내었다.Specifically, after culturing human epidermal keratinocytes, the fermented products of Examples 1 to 5 were added at a concentration of 0.1% (v/v). mRNA was obtained and AQP-3, HAS3, and filaggrin expression levels were compared and analyzed by performing Real-Time PCR. The group to which no fermentation was added was used as a negative control group, and the group to which 1 uM of retinoic acid was added was used as a positive control group. The primer sequences used in the PCR are shown in Table 3 below.
프라이머명Primer name 서열order 서열번호SEQ ID NO:
AQP3_forwardAQP3_forward AGACAGCCCCTTCAGGATTTAGACAGCCCCTTCAGGATTT 33
AQP3_reverseAQP3_reverse TCCCTTGCCCTGAATATCTGTCCCTTGCCCTGAATATCTG 44
HAS3_forwardHAS3_forward CTTAAGGGTTGCTTGCTTGCCTTAAGGGTTGCTTGCTTGC 55
HAS3_reverseHAS3_reverse GTTCGTGGGAGATGAAGGAAGTTCGTGGGAGATGAAGGAA 66
Filaggrin_forwardFilaggrin_forward AGTGCACTCAGGGGGCTCACAAGTGCACTCAGGGGGCTCCACA 77
Filaggrin_reverseFilaggrin_reverse CCGGCTTGGCCGTAATGTGTCCGGCTTGGCCGTAATGTGT 88
도 6은 AQP-3 mRNA의 상대적인 발현 수준을 나타낸 결과이다.6 is a result showing the relative expression level of AQP-3 mRNA.
도 7은 HAS3 mRNA의 상대적인 발현 수준을 나타낸 결과이다.7 is a result showing the relative expression level of HAS3 mRNA.
도 8은 필라그린 mRNA의 상대적인 발현 수준을 나타낸 결과이다.8 is a result showing the relative expression level of filaggrin mRNA.
도 6 내지 8에 나타낸 바와 같이, 실시예 1 내지 5의 발효물을 첨가한 경우 모두 AQP-3, HAS3, 필라그린의 발현을 증가시켰다. 특히, 실시예 1의 발효물은 AQP-3, HAS3, 필라그린 mRNA 발현 수준을 음성대조군 대비 각각 1.56배, 1.72배, 1.49배 증가시킴을 확인하였다.6 to 8, when the fermented products of Examples 1 to 5 were added, the expression of AQP-3, HAS3, and filaggrin was increased. In particular, it was confirmed that the fermented product of Example 1 increased AQP-3, HAS3, and filaggrin mRNA expression levels by 1.56 times, 1.72 times, and 1.49 times, respectively, compared to the negative control group.
따라서, 실시예 1 내지 5의 발효물은 AQP-3, HAS3 및 필라그린 발현을 증가시킴으로써 피부 보습 및 피부 장벽 강화 효과를 나타냄을 확인할 수 있었다.Therefore, it was confirmed that the fermented products of Examples 1 to 5 exhibit skin moisturizing and skin barrier strengthening effects by increasing the expression of AQP-3, HAS3 and filaggrin.
종합하면, 실시예 1 내지 5의 발효물은 피부 노화 방지, 조로증 예방 또는 치료, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화 효과가 우수함을 알 수 있었다.Taken together, it was found that the fermented products of Examples 1 to 5 were excellent in skin aging prevention, progeria prevention or treatment, skin wrinkle improvement, skin elasticity enhancement, skin moisturizing, and skin barrier strengthening effects.

Claims (10)

  1. 선인장오일, 호호바씨오일, 또는 이들의 조합을 칸디다 속(Candida sp.) 미생물에 의해 발효시켜 수득한 발효물을 포함하는 조성물.A composition comprising a fermented product obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by a microorganism of the genus Candida .
  2. 청구항 1에 있어서, 피부 상태 개선용인 것인 조성물.The composition of claim 1, wherein the composition is for improving skin conditions.
  3. 청구항 2에 있어서, 상기 피부 상태 개선은 피부 노화 방지, 피부 주름 개선, 피부 탄력 증진, 피부 보습, 피부 장벽 강화, 또는 이들의 2 이상의 조합인 것인 조성물.The composition according to claim 2, wherein the skin condition improvement is prevention of skin aging, improvement of skin wrinkles, enhancement of skin elasticity, moisturizing of skin, strengthening of skin barrier, or a combination of two or more thereof.
  4. 청구항 1에 있어서, 프로게린의 발현을 억제하거나, SIRT1, 프로콜라겐, COL1A1, AQP3, HAS3, 및 필라그린 중 어느 하나 이상의 발현을 증가시키는 것인 조성물. The composition of claim 1, wherein the composition inhibits the expression of progerin or increases the expression of any one or more of SIRT1, procollagen, COL1A1, AQP3, HAS3, and filaggrin.
  5. 청구항 1에 있어서, 상기 발효물은 선인장오일 및 호호바씨오일을 1:100 내지 100:1의 중량비로 포함하는 혼합물을 발효시켜 수득한 것인 조성물.The composition of claim 1, wherein the fermented product is obtained by fermenting a mixture containing cactus oil and jojoba seed oil in a weight ratio of 1:100 to 100:1.
  6. 청구항 1에 있어서, 상기 칸디다(Candida sp.) 속 미생물은 칸디다 봄비콜라(Candida bombicola)인 것인 조성물.The composition according to claim 1, wherein the microorganism of the genus Candida sp. is Candida bombicola .
  7. 청구항 1에 있어서, 상기 조성물은 화장료 조성물, 피부외용제용 조성물, 또는 식품 조성물인 것인 조성물.The composition according to claim 1, wherein the composition is a cosmetic composition, a composition for external application to the skin, or a food composition.
  8. 선인장오일, 호호바씨오일, 또는 이들의 조합을 칸디다 속(Candida sp.) 미생물에 의해 발효시켜 수득한 발효물을 포함하는 피부 노화 또는 조로증의 예방 또는 치료용 약학적 조성물.A pharmaceutical composition for preventing or treating skin aging or premature aging, comprising a fermented product obtained by fermenting cactus oil, jojoba seed oil, or a combination thereof by a microorganism of the genus Candida .
  9. 청구항 8에 있어서, 프로게린의 발현을 억제하거나, SIRT1, 프로콜라겐, COL1A1, AQP3, HAS3, 및 필라그린 중 어느 하나 이상의 발현을 증가시키는 것인 약학적 조성물.The pharmaceutical composition according to claim 8, which inhibits the expression of progerin or increases the expression of any one or more of SIRT1, procollagen, COL1A1, AQP3, HAS3, and filaggrin.
  10. 선인장오일, 호호바씨오일, 또는 이들의 조합을 칸디다 속(Candida sp.) 미생물과 인큐베이션하여 발효물을 수득하는 단계를 포함하는, 선인장오일, 호호바씨오일, 또는 이들의 조합의 발효물을 제조하는 방법.Incubating cactus oil, jojoba seed oil, or a combination thereof with a microorganism of the genus Candida to obtain a fermented product, producing a fermented product of cactus oil, jojoba seed oil, or a combination thereof Way.
PCT/KR2021/017424 2020-11-30 2021-11-24 Composition comprising fermentation product of cactus oil and use thereof for improving skin condition WO2022114784A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0165069 2020-11-30
KR1020200165069A KR102466455B1 (en) 2020-11-30 2020-11-30 Composition comprising fermented cactus oil and its use for improving skin condition

Publications (1)

Publication Number Publication Date
WO2022114784A1 true WO2022114784A1 (en) 2022-06-02

Family

ID=81754852

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/017424 WO2022114784A1 (en) 2020-11-30 2021-11-24 Composition comprising fermentation product of cactus oil and use thereof for improving skin condition

Country Status (2)

Country Link
KR (1) KR102466455B1 (en)
WO (1) WO2022114784A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150058635A (en) * 2013-11-19 2015-05-29 샘표식품 주식회사 Composition containing fermentated opuntia humifusa showing biological activity of skin
CN109464313A (en) * 2019-01-22 2019-03-15 杭州百芮生物科技有限公司 A kind of preparation method and biology cellulose diaphragm of external preparation for skin Essence
KR20190062394A (en) * 2016-10-06 2019-06-05 갸브리엘라 아이아스 New use of vine tears for cosmetic composition manufacturing
KR101989750B1 (en) * 2018-10-25 2019-06-14 주식회사 카버코리아 Spherical multiple liquid-crystalline composition comprising fermented glycolipid and oil, cosmetic composition comprising the same, and preparation method thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101036933B1 (en) 2010-07-27 2011-05-25 김진 (multi-functional cosmetic composition
KR101615909B1 (en) 2014-03-25 2016-04-28 코스맥스 주식회사 Fermentation oil cosmetic composition having anti-oxidant effect.
KR101781589B1 (en) * 2015-10-01 2017-09-25 (주)삼경코스텍 Cosmetic composition containing fermented vegetable oil

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150058635A (en) * 2013-11-19 2015-05-29 샘표식품 주식회사 Composition containing fermentated opuntia humifusa showing biological activity of skin
KR20190062394A (en) * 2016-10-06 2019-06-05 갸브리엘라 아이아스 New use of vine tears for cosmetic composition manufacturing
KR101989750B1 (en) * 2018-10-25 2019-06-14 주식회사 카버코리아 Spherical multiple liquid-crystalline composition comprising fermented glycolipid and oil, cosmetic composition comprising the same, and preparation method thereof
CN109464313A (en) * 2019-01-22 2019-03-15 杭州百芮生物科技有限公司 A kind of preparation method and biology cellulose diaphragm of external preparation for skin Essence

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "([600% Increased Water] Non-Irritating Vegan Skin Care Made by Skin Specialist_Monage", WADIZ., 1 January 2019 (2019-01-01), pages 1 - 50, XP055933423, Retrieved from the Internet <URL:https://www.wadiz.kr/web/campaign/detail/40545> [retrieved on 20220621] *

Also Published As

Publication number Publication date
KR102466455B1 (en) 2022-11-15
KR20220076577A (en) 2022-06-08

Similar Documents

Publication Publication Date Title
KR102273950B1 (en) Cutibacterium acnes subsp. acnes strain and skin condition improving uses of thereof
WO2023177188A1 (en) Cosmetic composition having anti-inflammatory and barrier effects, comprising fresh centella asiatica extract obtained through diffusion-based sugar extraction, and use thereof
WO2019143055A1 (en) Composition, comprising extract of fermented beans obtained from fermentation by aspergillus fumigatus strain, for skin care improvement
KR20170093694A (en) Collagen hydrolysate having high concentration of collagen tripeptide and uses thereof
WO2020246766A1 (en) Composition for preventing or alleviating skin aging, containing rhodiola sachalinensis extract fermented with bovista plumbea
WO2021060659A1 (en) Staphylococcus capitis st-1 strain, and use thereof for improving skin condition
WO2021060656A1 (en) Staphylococcus gallinarum st-4 strain, and use thereof for improving skin condition
WO2022114784A1 (en) Composition comprising fermentation product of cactus oil and use thereof for improving skin condition
WO2019139403A1 (en) Composition containing sericin, torilis japonica extract, and viscum album extract for skin generation, skin soothing, or wound healing
WO2022114783A1 (en) Composition containing fermented product of cactus honey and use thereof for improving skin condition
WO2021060652A1 (en) Staphylococcus haemolyticus strain st-8 and use thereof for improving condition of skin
WO2021060658A1 (en) Staphylococcus lentus st-2 strain and use thereof for skin condition improvement
WO2019225891A1 (en) Skin anti-aging composition containing irilin b
WO2023149766A1 (en) Cosmetic composition comprising saffron flower extract and danshen extract
WO2024005443A1 (en) Micrococcus flavus strain and use thereof for improving skin condition
WO2022145960A1 (en) Weissella cibaria strain and use thereof
KR102394429B1 (en) Composition comprising fermented snowberry and its use for improving skin condition
WO2023243924A1 (en) Micrococcus terreus strain and use thereof for improving skin condition
KR102484422B1 (en) Cosmetic composition comprising extract of Cactus and fermented product of Lactobacillus
WO2023018077A1 (en) Microccocus cohnii strain, and use thereof for improving condition of skin
WO2024025173A1 (en) Cosmetic composition comprising staphylococcus sp. strain, streptococcus sp. strain, cutibacterium sp. strain, enhydrobacter sp. strain, and dna fragment mixture
KR102367436B1 (en) Composition comprising mixed fermented product of young trifoliate orange, young green tea and bitter orange flower, and its use for improving skin condition
WO2023018078A1 (en) Micrococcus antarcticus strain and skin condition improving use thereof
KR102416653B1 (en) Cosmetic composition for improving skin conditions comprising protein hydrolysate of Agastache rugosa
KR102515074B1 (en) Cosmetic composition comprising fermented producrt of Perilla frutescens

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21898610

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 26.10.2023)