KR102394429B1 - Composition comprising fermented snowberry and its use for improving skin condition - Google Patents

Abstract

The present invention relates to a composition comprising a fermented product of Symphoricarpos albus, and a use thereof for improving skin condition. The composition comprising a fermented product of Symphoricarpos albus according to one aspect of the present invention can be effectively used for improving a condition associated with the skin such as preventing skin aging, ameliorating skin wrinkles, enhancing skin elasticity, whitening the skin, moisturizing the skin, and strengthening the skin barrier.

Description

Composition comprising fermented snowberry and its use for improving skin condition

It relates to a cosmetic composition comprising a fermented snowberry, a food composition, and a use thereof for improving skin condition.

The skin is a primary barrier of the human body from the external environment and is one of the important organs of the human body that regulates body temperature, barrier function, and various physiological functions. Human skin undergoes an aging process as it ages, and the causes can be largely divided into intrinsic aging and extrinsic aging. Intrinsic aging is a process that cannot be avoided by anyone as we get older, and wrinkles occur, the skin loses elasticity, moisture in the skin cells is lost, and the structure of the stratum corneum changes. On the other hand, exogenous aging is caused by external stress such as environmental factors, and among them, ultraviolet rays are the main cause, also called photoaging.

Matrix proteins such as collagen and elastin exist in the skin, and when these matrix proteins are reduced by degrading enzymes such as matrix metalloproteinase (MMP), wrinkles occur and elasticity of the skin is reduced. Conversely, increased synthesis of procollagen in the skin helps to improve skin wrinkles and increase skin elasticity.

Another phenomenon of skin aging is that the ability to retain moisture decreases, causing the skin to become dry and rough. Water constitutes about 70% of the human body and helps to keep the skin moist and shiny. The stratum corneum of a healthy epidermis contains 15-20% of moisture, and when the level falls below 10%, an abnormality occurs in the skin barrier and the skin becomes dry and wrinkles increase. Aquaporin (AQP) is present in the protein that regulates the movement of water. Aquaporin-3 (AQP-3), which is mainly present in keratinocytes of the epidermis and is a water passage through which water, glycerol, urea, etc. move, provides smooth moisture between cells. In addition, when filaggrin, a moisturizing component constituting the skin barrier, increases, skin moisture can be increased as well as the skin barrier can be strengthened.

In addition, melanin pigment determines skin color, and melanin produced by excessive stimulation also causes skin troubles such as freckles, freckles, and hyperpigmentation.

On the other hand, Patent Document 1 discloses a composition containing a snowberry extract. However, there are no studies on the efficacy of fermented snowberry.

Accordingly, the present inventors completed the present invention by confirming the use of fermented snowberry for improving skin condition.

KR 10-1601908 B1

Provided is a composition comprising a fermented product obtained by fermenting snowberries with microorganisms.

A method for preparing a snowberry ferment is provided.

A method for improving the skin condition of a subject is provided, comprising administering to a subject in need thereof an effective amount of a snowberry ferment or a composition comprising the same.

Provided is the use of a fermented snowberry for use in preparing a composition for improving skin conditions.

One aspect provides a composition comprising a fermented product obtained by fermenting snowberries by microorganisms.

The term "snowberry" is a plant of the genus Symphoricarpos sp. , and in English, it is also called Snowberry, waxberry, ghostberry. Snowberry berries vary in color depending on the type, such as white (eg Common Snowberry), pink (eg Little Leaf Snowberry), Red (eg Coralberry), or dark purple (eg Chinese Coralberry). indicates

Exemplary varieties of snowberry include Common snowberry ( Symphoricarpos albus ), Mexican snowberry ( Symphoricarpos mexicanus ), Little leaf snowberry ( Symphoricarpos microphyllus ), Creeping snowberry ( Symphoricarpos ) mollis ), Western snowberry or Wolfberry, Symphoricarpos occidentalis ), Coralberry (Coralberry, Symphoricarpos orbiculatus ), Mountain snowberry (Symphoricarpos rotundifolius ), Roundleaf snowberry (Roundleaf snowberry, Symphoricarpos rotundifolius ) , Chinese coralberry ( Symphoricarpos sinensis ) and the like.

In one embodiment, the snowberry may be common snowberry, Mexican snowberry, little leaf snowberry, creeping snowberry, western snowberry, coralberry, mountain snowberry, Chinese coralberry, or a combination of two or more thereof. .

The fermented product may be obtained by fermenting snowberries with microorganisms. The above "fermented product obtained by fermenting snowberry by microorganisms" is used interchangeably with "fermented snowberry". Snowberry is known to only be consumed by animals, as it has ingredients that cause some vomiting symptoms when ingested by humans. However, since toxicity is removed through fermentation of snowberry, the fermented snowberry can be consumed as food by humans.

The microorganism may be one or more microorganisms selected from the group consisting of Bacillus sp. , Lactobacillus sp. , and Leuconostoc sp. , but is not limited thereto.

The Bacillus genus ( Bacillus sp. ) Microorganisms include both aerobic or facultative anaerobic bacteria widely distributed in nature. The Bacillus genus microorganism is not limited to a specific type, but, for example, Bacillus subtilis ( B. subtilis ), Bacillus coagulans ( B. coagulans ), Bacillus velezensis ( B. velezensis ), Bacillus lichenifor Miss ( B. licheniformis ), Bacillus polyfermenticus ( B. polyfermenticus ), Bacillus methylotrophicus ( B. methylotrophicus ), and Bacillus amyloliquefaciens ( B. amyloliquefaciens ) It may be selected from the group consisting of.

The Lactobacillus genus ( Lactobacillus sp. ) The microorganism is not limited to a specific type, but, for example, Lactobacillus acidophilus ( L. acidophilus ), Lactobacillus casei ( L. casei ), Lactobacillus gasseri ( L gasseri ), Lactobacillus Delbruecki bulgaricus ( L. delbrueckii ssp. bulgaricus ), Lactobacillus helveticus ( L. helveticus ), Lactobacillus fermentum ( L. fermentum ), Lactobacillus paracasei ( L. paracasei ) ), Lactobacillus plantarum ( L. plantarumm ), Lactobacillus reuteri ( L. reuteri ), Lactobacillus rhamnosus ( L. rhamnosus ), and Lactobacillus salivarius ( L. salivarius ) It may be selected from the group consisting of there is.

The Leuconostoc genus ( Leuconostoc sp. ) Microorganisms are Leuconostok mesenteroides ( L. mesenteroides ), Leukonostok citreum ( L. citreum ), Leuconostok holjappeli ( L. holzapfelii ), and Leukonostoc Lactis ( L. lactis ) It may be selected from the group consisting of.

As the fermentation conditions, an appropriate temperature and time may be selected according to the type of microorganism. For example, the fermentation may be performed at 20 to 40° C., but is not particularly limited thereto. In addition, the fermentation may be performed for 1-200 hours, 1-180 hours, 24-200 hours, 24-180 hours, 24-120 hours, 48-200 hours, 48-180 hours, or 48-120 hours. , which is not particularly limited thereto.

The fermentation medium may be appropriately selected according to the type of microorganism. As the medium, a known medium or a conventional medium capable of culturing the microorganism may be used depending on the type of the microorganism. For example, the medium may include one or a mixture of two or more selected from glucose, yeast extract, malt extract, peptone, glutamic acid, K ₂ HPO ₄ , KH ₂ PO ₄ , NaCl, but is not limited thereto. .

In one embodiment, when the microorganism is a microorganism of the genus Bacillus, the medium may include glucose, peptone, yeast extract, glutamic acid, K ₂ HPO ₄ , and KH ₂ PO ₄ .

In another embodiment, when the microorganism is a microorganism of the genus Lactobacillus, the medium may include glucose, peptone, and yeast extract.

In another embodiment, when the microorganism is a microorganism of the genus Leuconostok, the medium may include glucose, peptone, yeast extract, K ₂ HPO ₄ , and NaCl.

The fermented product may include a fermentation broth obtained by fermenting snowberries by microorganisms, a diluted or concentrated solution of the fermentation broth, a dried product obtained by drying the fermentation broth, or these crude or purified products, and a fraction obtained by fractionating the same.

The fermented product is 0.0001 to 99.9999% by weight, 0.0001 to 90% by weight, 0.0001 to 50% by weight, 0.0001 to 10% by weight, 0.001 to 99.9999% by weight, 0.001 to 90% by weight, 0.001 to 50% by weight based on the total weight of the composition , 0.001 to 10% by weight, 0.01 to 99.9999% by weight, 0.01 to 90% by weight, 0.01 to 50% by weight, 0.01 to 20% by weight, or 0.01 to 10% by weight may be included, but is not particularly limited thereto.

The term "included as an active ingredient" means that the fermented product of the present specification is added to an extent capable of exhibiting the above-mentioned effects. In addition, this may include being formulated in various forms by adding various components as sub-components for drug delivery and stabilization.

The composition may be a composition for improving skin conditions, improving skin beauty, or preventing or treating skin diseases.

In one embodiment, the composition may be for improving skin condition.

The skin condition improvement may be skin aging prevention, skin wrinkle improvement, skin elasticity enhancement, skin whitening, skin moisturizing, skin barrier strengthening, or a combination of two or more thereof.

The term "skin aging" refers to the tangible and intangible changes that appear on the skin with age, such as a thinning of the epidermis, the number of cells or blood vessels in the dermis, DNA damage repair ability, cell replacement cycle, wound healing, It refers to a decrease in skin barrier function, epidermal moisture retention, sweat secretion, sebum secretion, vitamin D production, physical damage protection, chemical removal ability, immune response, sensory function, and thermoregulation.

The fermented product may be for preventing skin aging caused by extrinsic factors or intrinsic factors, improving skin aging, or for anti-aging. The extrinsic factor refers to various external factors, such as ultraviolet light (light). The intrinsic factor is also referred to as a chronological factor, and refers to a factor mainly caused by the passage of time. That is, the skin aging specifically refers to not only the premature aging symptoms induced by external stimuli such as ultraviolet rays, pollution, cigarette smoke, chemical substances, etc., but also a natural aging phenomenon that occurs as the proliferation of skin cells decreases with aging. , that is, it is a concept that includes skin aging due to age, and includes all of wrinkles, loss of elasticity, skin sagging and dryness. In addition, wrinkles include those that cause wrinkles by stimulation by changes in internal and external factors by changing the components constituting the skin tissue.

The aging may be photoaging. The term “photoaging” is a phenomenon induced by external environmental factors, and the most representative factor is ultraviolet rays. Ultraviolet rays cause damage to biological components such as activation of proteolytic enzymes, chain cleavage of matrix proteins, and abnormal cross-linking, and repetition of these mechanisms leads to apparent skin aging. Accordingly, the composition may be used for preventing, improving, or treating photoaging caused by ultraviolet (UV) light.

The term "skin wrinkle improvement" is interpreted to include not only an action of reducing the number or depth of skin wrinkles, but also inhibiting skin aging through wrinkle improvement.

The term “enhancement of skin elasticity” may refer to any action that increases skin elasticity, which is reduced due to aging, or prevents deterioration of skin elasticity.

The term "skin whitening" may mean not only to brighten skin tone by inhibiting the synthesis of melanin pigment, but also to improve skin hyperpigmentation such as spots or freckles caused by ultraviolet rays, hormones, or heredity.

The term “moisturizing the skin” may refer to any action that retains moisture in the skin or prevents moisture loss. The skin 　 moisturizing effect can help improve skin wrinkles and increase elasticity.

The term “strengthening the skin barrier” may refer to any action that enhances the function of the skin barrier, which is located at the outermost part of the skin and prevents loss of moisture and nutrients.

The term “skin disease” may be a disease caused by aging of the skin, hyperpigmentation of the skin, or damage to the skin barrier function. The term “prevention” includes inhibiting the development of a disease. The term “treatment” includes inhibiting, alleviating, or eliminating the development of a disease.

Details of the skin aging are the same as described above. Accordingly, the skin aging may be photoaging or skin aging due to age.

The skin hyperpigmentation may include spots or freckles caused by ultraviolet rays, hormones, or heredity.

The damage to the skin barrier function may refer to any change that appears in the skin as the function of the skin barrier is reduced or damaged. For example, it may include increased skin wrinkles, dryness, dermatitis, atopic dermatitis, allergic dermatitis, acne, and the like.

The composition may inhibit the expression of MMP-1. The skin secretes various factors as it ages or by irritants such as external ultraviolet rays and fine dust, and it secretes MMP (matrix metalloproteinase), an extracellular matrix proteolytic enzyme, to produce matrix proteins such as collagen and elastin fibers. decompose In particular, collagen occupies most of the matrix structure of the skin, and when it is reduced by degrading enzymes such as MMP, wrinkles occur in the skin and elasticity is reduced. The composition may exhibit an anti-aging effect on the skin by inhibiting the expression of MMP-1.

The composition may increase the expression of procollagen. In general, it is known that collagen related to wrinkles of skin cells is synthesized in the form of a precursor called procollagen. Therefore, by measuring the amount of the procollagen peptide, it is possible to grasp the degree of collagen synthesis in the cell. The composition may exhibit the effect of improving skin wrinkles and enhancing skin elasticity by increasing the expression of procollagen.

The composition may inhibit melanin synthesis. Melanin pigment is synthesized in melanocytes in the basal layer of the skin. Melanin synthesized by stimulation such as ultraviolet rays is accumulated in melanosomes and then transferred back to adjacent keratinocytes, giving the stratum corneum a reddish-brown color. Melanin determines the color of eyes, hair, and skin, and plays a major role in scavenging free radicals generated by UV rays and protecting the skin from UV rays. However, melanin produced by excessive stimulation causes skin troubles such as spots, freckles, and hyperpigmentation, and in severe cases, apoptosis and even skin cancer. The composition may exhibit a skin whitening effect by inhibiting melanin synthesis.

The composition may increase the expression of aquaporin 3 (AQP3). The composition may exhibit a skin moisturizing effect by smoothly supplying moisture to skin cells by increasing the expression of AQP3.

The composition may increase the expression of filaggrin. The filaggrin is a moisturizing component that forms the skin barrier. The composition may exhibit skin moisturizing and skin barrier strengthening effects by increasing the expression of filaggrin.

Accordingly, the composition may inhibit the expression of MMP-1, inhibit melanin synthesis, or increase the expression of any one or more of procollagen, AQP-3, and filaggrin.

In one embodiment, it was confirmed that the fermented product is excellent in skin aging prevention, skin wrinkle improvement, skin elasticity enhancement, skin whitening, skin moisturizing, and skin barrier strengthening effect. In addition, when using microorganisms of the genus Bacillus, genus Lactobacillus, and leuconostok as fermenting microorganisms, all of the effects were excellent.

The composition may be a cosmetic composition.

The cosmetic composition may be prepared in any conventionally prepared formulation. For example, the cosmetic composition may be a lotion, cream, essence, cleansing foam, cleansing water, pack, ampoule, body lotion, body oil, body gel, shampoo, conditioner, hair conditioner, hair gel, foundation, lipstick, mascara, makeup It may have a cosmetic formulation of a base or skin adhesion type. The skin adhesion type cosmetic formulation may be, for example, a mask pack, but is not limited thereto.

Components included in the cosmetic composition may include components commonly used in cosmetic compositions in addition to the composition as an active ingredient, for example, conventional adjuvants and carriers such as stabilizers, solubilizers, vitamins, pigments and fragrances. may include

In addition, the composition may be a composition for external application to the skin.

The external preparation for skin may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal patch, drug-containing bandage, lotion, or a combination thereof. The external preparation for skin is a component usually used in external preparations for skin such as cosmetics or pharmaceuticals, for example, an aqueous component, an oily component, a powder component, alcohol, a moisturizer, a thickener, an ultraviolet absorber, a whitening agent, a preservative, an antioxidant, a surfactant, a fragrance , colorant, various skin nutrients, or a combination thereof may be appropriately formulated as needed. The external preparation for skin includes metal-blocking agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, belapamil, licorice extract, glablidine, and kaline. Fruit hot water extracts, various herbal medicines, tocopherol acetate, glitylittic acid, tranexamic acid and derivatives or salts thereof, vitamin C, magnesium ascorbate phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, Sugars, such as trehalose, etc. can be mix|blended suitably.

The composition may be a food composition. The composition may be a health functional food composition.

The food composition may be used alone or in combination with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined depending on the purpose of use (prophylactic, health or therapeutic treatment). There is no particular limitation on the type of the health functional food. Among the types of health functional food, the beverage composition may contain various flavoring agents or natural carbohydrates as an additional component like a conventional beverage. The natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used. The health food composition can also be added to nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonated beverages carbonation agent used, or a combination thereof. The health functional food composition may also contain natural fruit juice, fruit juice beverage, fruit flesh for the production of vegetable beverage, or a combination thereof.

The composition may be a pharmaceutical composition.

In one embodiment, the pharmaceutical composition may be for preventing or treating skin aging.

The skin aging may be photoaging or skin aging due to age.

The pharmaceutical composition may further include a pharmaceutically acceptable diluent or carrier. The diluent may be lactose, corn starch, soybean oil, microcrystalline cellulose, or mannitol, and the lubricant may be magnesium stearate, talc, or a combination thereof. The carrier may be an excipient, a disintegrant, a binder, a lubricant, or a combination thereof. The excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof. The disintegrant may be carboxymethyl cellulose calcium, sodium starch glycolate, anhydrous calcium monohydrogen phosphate, or a combination thereof. The binder may be polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose, or a combination thereof. The lubricant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.

The pharmaceutical composition may be formulated as an oral or parenteral dosage form. Oral dosage forms may be granules, powders, solutions, tablets, capsules, dry syrups, or a combination thereof. The parenteral dosage form may be an injection.

Another aspect provides a method of making a snowberry ferment.

The method includes incubating snowberries with a microorganism to obtain a fermented product.

The step of obtaining the fermented product includes: adding snowberries to the medium and sterilizing; and inoculating and incubating the medium with microorganisms to obtain a fermented product.

Details regarding the snowberry, microorganism, and fermented product are as described above.

The snowberry may be added in an amount of 0.01 to 20% by weight, or 0.1 to 10% by weight based on the total weight of the medium, but is not limited thereto.

The sterilization may be performed using a known conventional method.

The microorganism may be used in an amount sufficient to allow fermentation to occur, which may be appropriately selected by those skilled in the art in consideration of the amount of fermentation raw materials.

The incubation temperature and time may be selected as sufficient temperature and time for fermentation to occur, which may be appropriately selected by those skilled in the art in consideration of the amount of fermentation raw material, the type of microorganism, and the like. For example, the incubation may be performed at 20 to 40° C., but is not particularly limited thereto. In addition, the incubation may be performed for 1 to 200 hours, 1 to 180 hours, 24 to 200 hours, 24 to 180 hours, 24 to 120 hours, 48 to 200 hours, 48 to 180 hours, or 48 to 120 hours. , which is not particularly limited thereto.

The fermentation may be performed in a medium capable of culturing microorganisms. As the medium, a known medium or a conventional medium capable of culturing the microorganism may be used depending on the type of the microorganism. Exemplary medium components according to the type of microorganism are as described above.

The method may further include isolating the cells from the fermented product. For the separation of the cells, a known conventional method may be used, for example, stationary, centrifugation, a combination thereof, and the like may be used.

The method may further include filtering the fermented product. The filtration may use a known conventional method.

Another aspect provides a method of improving a skin condition in a subject comprising administering to the subject in need thereof an effective amount of a snowberry ferment or a composition comprising the same.

Details of the snowberry fermented product, composition, and skin condition improvement are as described above.

The term "effective amount" means an amount effective enough to produce the above-mentioned effects.

The terms "administering", "introducing", and "implanting" are used interchangeably and in one embodiment into a subject by a method or route that results in at least partial localization of the composition according to one embodiment to a desired site. It may mean the arrangement of the composition according to the

Administration may be administered by methods known in the art. Administration can be administered directly to a subject by any means, for example, intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal or subcutaneous administration. can The administration may be systemically or locally. The administration may be applied to the skin.

The subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat. The subject may be an individual in need of improving skin condition, for example, preventing skin aging, improving skin wrinkles, enhancing skin elasticity, whitening skin, moisturizing skin, or strengthening skin barrier.

The dosage may be prescribed in various ways depending on factors such as formulation method, administration mode, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity of the patient, and those skilled in the art will appreciate these factors The dosage can be appropriately adjusted taking these factors into account. The number of administration may be once a day or twice or more within the range of clinically acceptable side effects, and may be administered to one or two or more sites for the administration site, and total daily or at intervals of 2 to 5 days The number of days of administration may range from 1 to 30 days per treatment. If necessary, the same treatment can be repeated after a titration period. For animals other than humans, the dose is the same as that of a human per kg, or the above dose is converted, for example, by the volume ratio (for example, average value) of the target animal and the organ (heart, etc.) of the human One dose can be administered.

Another aspect provides the use of a fermented snowberry for use in preparing a composition for improving skin conditions.

Details of the skin condition improvement, composition, and fermented snowberry are the same as described above.

The composition comprising the snowberry fermented product according to an aspect may be usefully used to improve skin-related conditions, such as skin aging prevention, skin wrinkle improvement, skin elasticity enhancement, skin whitening, skin moisturizing, skin barrier strengthening.

1 is a result of analyzing the expression level of MMP-1 in human fibroblasts. Media Only, untreated control; UV, negative control; EGCG, positive control; Snowberry extract, Comparative Example 1; Snowberry Fermented 1, Example 1; Snowberry Ferment 2, Example 2; Snowberry Fermented 3, Example 3.
2 is a result of analyzing the procollagen production rate in human fibroblasts. Media Only, negative control; TGF-β, positive control; Snowberry extract, Comparative Example 1; Snowberry Fermented 1, Example 1; Snowberry Ferment 2, Example 2; Snowberry Fermented 3, Example 3.
3 is a result of analyzing the melanin content in melanoma cell lines. Media Only, untreated control; α-MSH, negative control; Arbutin, positive control; Snowberry extract, Comparative Example 1; Snowberry Fermented 1, Example 1; Snowberry Ferment 2, Example 2; Snowberry Fermented 3, Example 3.
4 is a result showing the relative expression level of AQP-3 in human keratinocytes. Media Only, negative control; Retinoic acid, positive control; Snowberry extract, Comparative Example 1; Snowberry Fermented 1, Example 1; Snowberry Ferment 2, Example 2; Snowberry Fermented 3, Example 3.
5 is a result showing the relative expression level of filaggrin in human keratinocytes. Media Only, negative control; Retinoic acid, positive control; Snowberry extract, Comparative Example 1; Snowberry Fermented 1, Example 1; Snowberry Ferment 2, Example 2; Snowberry Fermented 3, Example 3.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Examples 1 to 3. Preparation of fermented snowberry broth

Snowberry was fermented by microorganisms to prepare a snowberry fermented broth. A specific manufacturing method is as follows.

First, the snowberry was prepared by pulverizing the raw material. Snowberry was added to the prepared medium and sterilized at 121° C. for 15 minutes. The medium is preferably selected appropriately according to the type of microorganism to be inoculated. For example, a medium prepared from one or a mixture of two or more selected from glucose, yeast extract, malt extract, peptone, glutamic acid, K ₂ HPO ₄ , KH ₂ PO ₄ , NaCl may be used. Snowberry added to the medium may be added at 0.1% (w/w) to 10% (w/w), but in this example, it was added at 1% (w/w). Next, after inoculating the microorganisms in the sterilized medium, the fermentation was performed for 72 hours by stirring at 150rpm at 30 to 40°C. The composition of the medium and the types of microorganisms used in Examples 1 to 3 are shown in Table 1 below.

content (wt%) ingredient Example 1 Example 2 Example 3 glucose 2 2 2 peptone 0.5 One One yeast extract 0.5 4 0.5 glutamic acid 0.5 - - K ₂ HPO ₄ 0.1 - 0.1 KH ₂ PO ₄ 0.05 - - NaCl - - 0.5 water To 100 To 100 To 100 microbe bacillus genus
( Bacillus sp. ) genus Lactobacillus
( Lactobacillus sp. ) in leuconostock
( Leuconostoc sp. )

Next, a step of filtering and obtaining the fermented product was performed. After completion of fermentation, by centrifugation, cells and fermentation residues were separated, and fermented snowberry was prepared through 0.45 μm filtration.

Comparative Example 1. Preparation of snowberry extract

Snowberry extract was prepared by hot water extraction of snowberry in a conventional manner.

Examples 4 to 6 and Comparative Example 2. Preparation of composition comprising snowberry fermented broth or extract

A composition including the fermented snowberry or extract was prepared with the composition shown in Table 2 below.

Specifically, Examples 4 to 6 are compositions comprising the snowberry fermentation broth of Examples 1 to 3, respectively. Comparative Example 2 is a composition comprising the snowberry extract of Comparative Example 1.

ingredient division content (wt%) Comparative Example 2 Example 4 Example 5 Example 6 water Distilled water Up to 100 Up to 100 Up to 100 Up to 100 butylene glycol moisturizer 3 3 3 3 glycerin moisturizer 2 2 2 2 1,2-Hexanediol antiseptic 2 2 2 2 Comparative Example 1 extract 10 - - - Example 1 fermentation broth - 10 - - Example 2 fermentation broth - - 10 - Example 3 fermentation broth - - - 10

Experimental Example 1. Confirmation of skin aging efficacy of fermented snowberry

In order to confirm the skin aging effect of the fermented snowberry, an analysis of the MMP-1 expression level according to the treatment of the fermented snowberry prepared above was performed.

Specifically, human dermal fibroblasts were irradiated with ultraviolet (UV) light and treated with the snowberry extract of Comparative Example 1 or the fermented snowberry of Examples 1 to 3, and then the MMP-1 expression level was confirmed. . In each experimental group, the treatment concentration of the extract or fermented product was 100 ppm. A group that was not treated with ultraviolet light was used as an untreated control group. In addition, the group treated with only UV light was used as a negative control group, and the group treated with 10 μM of epigallocatechin (EGCG) was used as a positive control group.

1 is a result of analyzing the expression level of MMP-1 in human fibroblasts.

As a result, as shown in FIG. 1 , the negative control group treated with UV to human fibroblasts showed a high MMP-1 expression level. In addition, it was confirmed that the MMP-1 expression level was decreased when the fermented snowberry was treated than when the snowberry extract was treated, compared to the negative control group. In particular, the snowberry fermented product 1 of Example 1 using a microorganism of the genus Bacillus reduced the expression level of MMP-1 by about 47% compared to the negative control group.

From the above results, it can be confirmed that the fermented snowberry reduces the MMP-1 expression level, thereby exhibiting a remarkably excellent anti-aging effect.

Experimental Example 2. Confirmation of skin wrinkle improvement effect of fermented snowberry

In order to confirm the skin wrinkle improvement effect of the snowberry fermented product, procollagen production analysis was performed according to the treatment of the snowberry fermented product prepared above.

Specifically, human fibroblasts were treated with the snowberry extract of Comparative Example 1 or the fermented snowberry of Examples 1 to 3, and the relative production rate of procollagen was confirmed. In each experimental group, the treatment concentration of the extract or fermented product was 100 ppm. The group not treated with the snowberry extract or fermented product was used as a negative control group, and the group treated with TGF-β was used as a positive control group.

2 is a result of analyzing the procollagen production rate in human fibroblasts.

As a result, as shown in FIG. 2 , it was confirmed that the synthesis of procollagen was increased when the fermented snowberry was treated than when the extract was treated with the snowberry, compared to the negative control group. In particular, the snowberry fermented product 1 of Example 1 using a microorganism of the genus Bacillus had the best effect of increasing procollagen synthesis.

From the above results, it can be confirmed that the snowberry fermented product increases procollagen synthesis, thereby exhibiting a remarkably excellent skin wrinkle improvement effect and skin elasticity enhancement effect.

Experimental Example 3. Confirmation of skin whitening effect of fermented snowberry

In order to confirm the skin whitening effect of the fermented snowberry, an experiment was performed to determine the amount of melanin synthesized according to the treatment of the fermented snowberry prepared above.

Specifically, the melanoma B16F10 cell line was treated with the snowberry extract of Comparative Example 1 or the fermented snowberry of Examples 1 to 3 with 250 nM of α-MSH, and then the melanin generated in the cells was dissolved to compare the melanin content. analyzed. In each experimental group, the treatment concentration of the extract or fermented product was 100 ppm. The group treated with arbutin (Arbutin) 50 μg/ml was used as a positive control group, and the group treated with only α-MSH was used as a negative control group.

3 is a result of analyzing the melanin content in melanoma cell lines.

As a result, as shown in FIG. 3 , the amount of melanin synthesis was decreased when the snowberry fermented product was treated than when the snowberry extract was treated, compared to the negative control group. In particular, the fermented snowberry of Example 1 using a microorganism of the genus Bacillus 1 reduced melanin synthesis the most.

From the above results, it can be confirmed that the fermented snowberry reduces melanin synthesis, thereby exhibiting a remarkably excellent skin whitening effect.

Experimental Example 4. Confirmation of skin moisturizing effect of fermented snowberry

In order to confirm the skin moisturizing effect of the snowberry fermented product, real-time PCR was performed to confirm the aquaporin-3 (AQP-3), Filaggrin mRNA expression level according to the treatment of the snowberry fermented product prepared above. did

Specifically, after culturing human keratinocytes, the snowberry extract of Comparative Example 1 or the snowberry fermented product of Examples 1 to 3 was treated to obtain mRNA, and AQP-3 and filaggrin expression levels were compared. analyzed. In each experimental group, the treatment concentration of the extract or fermented product was 100 ppm. A group not treated with snowberry extract or fermented product was used as a negative control group, and a group treated with 1 μM of retinoic acid was used as a positive control group. AQP-3, HAS-3, and Filaggrin primer sequences used in the PCR are shown in Table 3 below.

Primer name Sequence (5'→3') SEQ ID NO: AQP3_forward AGACAGCCCCTTCAGGATTT One AQP3_reverse TCCCTTGCCCTGAATATCTG 2 Filaggrin_forward AGTGCACTCAGGGGGCTCCACA 3 Filaggrin_reverse CCGGCTTGGCCGTAATGTGT 4

4 is a result showing the relative expression level of AQP-3 in human keratinocytes.

5 is a result showing the relative expression level of filaggrin in human keratinocytes.

As a result, as shown in FIGS. 4 and 5 , the expression levels of AQP-3 and filaggrin mRNA were further increased in the group treated with the fermented snowberry than when the extract was treated with the snowberry. In particular, the snowberry fermented product 1 of Example 1 using a microorganism of the genus Bacillus showed the most excellent results of increasing the expression of AQP-3 and filaggrin.

From the above results, it can be confirmed that the fermented snowberry exhibits a remarkably excellent skin moisturizing effect and skin barrier strengthening effect.

In summary, it can be confirmed that the cosmetic composition of the present invention contains fermented snowberry as an active ingredient, thereby exhibiting significantly improved anti-aging, skin wrinkle improvement, skin elasticity enhancement, skin whitening, skin moisturizing and skin barrier strengthening effects. .

SEQUENCE LISTING <110> MIGLIM COMPANY LIMITED <120> Composition comprising fermented snowberry and its use for improving skin condition <130> PN137763 <160> 4 <170> PatentIn version 3.2 <210> 1 <211> 20 <212> DNA <213> <220> <223> AQP3_forward primer <400> 1 agacagcccc ttcaggattt 20 <210> 2 <211> 20 <212> DNA <213> <220> <223> AQP3_reverse primer <400> 2 tcccttgccc tgaatatctg 20 <210> 3 <211> 21 <212> DNA <213> <220> <223> Filaggrin_forward primer <400> 3 agtgcactca gggggctcac a 21 <210> 4 <211> 20 <212> DNA <213> <220> <223> Filaggrin_reverse primer <400> 4 ccggcttggc cgtaatgtgt 20

Claims (8)

As a cosmetic composition for improving skin condition comprising a fermented product obtained by fermenting snowberries with microorganisms,
The microorganism is a Bacillus genus ( Bacillus sp. ) is a microorganism,
The skin condition improvement is skin aging prevention, skin wrinkle improvement, skin elasticity enhancement, skin whitening, skin moisturizing, skin barrier strengthening, or a cosmetic composition of two or more thereof. The method according to claim 1, wherein the snowberry is common snowberry, Mexican snowberry, little leaf snowberry, creeping snowberry, western snowberry, coralberry, mountain snowberry, Chinese coralberry, or a combination of two or more thereof. cosmetic composition. delete delete delete The cosmetic composition according to claim 1, which inhibits the expression of MMP-1, inhibits melanin synthesis, or increases the expression of any one or more of procollagen, AQP-3, and filaggrin. As a food composition for improving skin condition comprising a fermented product obtained by fermenting snowberries by microorganisms,
The microorganism is a Bacillus genus ( Bacillus sp. ) is a microorganism,
The skin condition improvement is skin aging prevention, skin wrinkle improvement, skin elasticity enhancement, skin whitening, skin moisturizing, skin barrier strengthening, or a food composition of two or more thereof. Incubating the snowberry with a microorganism to obtain a fermented product,
The microorganism is a Bacillus genus ( Bacillus sp. ) The method for producing a fermented snow berry will be a microorganism.

Images