WO2022089486A1 - Arnsi pour inhiber l'expression du gene pcsk9 et son modificateur et son utilisation - Google Patents

Arnsi pour inhiber l'expression du gene pcsk9 et son modificateur et son utilisation Download PDF

Info

Publication number
WO2022089486A1
WO2022089486A1 PCT/CN2021/126724 CN2021126724W WO2022089486A1 WO 2022089486 A1 WO2022089486 A1 WO 2022089486A1 CN 2021126724 W CN2021126724 W CN 2021126724W WO 2022089486 A1 WO2022089486 A1 WO 2022089486A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sense strand
antisense strand
strand
galnac
Prior art date
Application number
PCT/CN2021/126724
Other languages
English (en)
Chinese (zh)
Inventor
秦引林
苏梅
段春晓
张佩琢
Original Assignee
江苏柯菲平医药股份有限公司
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 江苏柯菲平医药股份有限公司 filed Critical 江苏柯菲平医药股份有限公司
Publication of WO2022089486A1 publication Critical patent/WO2022089486A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing

Definitions

  • the invention relates to the field of biomedicine, in particular to siRNA for inhibiting the expression of PCSK9 gene and its modification and application.
  • Hyperlipidemia refers to high blood lipid levels, which directly cause some diseases that seriously endanger human health, such as atherosclerosis, coronary heart disease, pancreatitis, etc. Hyperlipidemia is a high risk factor for cardiovascular disease.
  • a large amount of evidence-based medical evidence shows that statins are the first choice for the prevention and treatment of hyperlipidemia.
  • statins are the first choice for the prevention and treatment of hyperlipidemia.
  • some clinical studies have shown that some patients with high risk of cardiovascular disease are still not significantly lowering lipids after receiving adequate statin therapy, and still have a high risk of cardiovascular disease.
  • some patients are intolerant to high-dose statins. Therefore, it is necessary to find a drug that can safely and effectively reduce the level of LDL-C, which has become a research hotspot in the field of lipid lowering.
  • PCSK9 is a liver protease that attaches and internalizes LDLR into lysosomes and promotes its destruction. Experiments have found that inhibiting PCSK9 can significantly increase the number of LDLR, and then combine with more LDL-C to reduce blood LDL-C levels, which are 50%-60% lower than LDL-C levels achieved by statin therapy alone.
  • PCSK9 proprotein convertase subtilisin/kexin type 9
  • Regulatory agencies have approved PCSK9 antibodies for use in patients with suboptimal therapeutic levels of LDL-C.
  • This class of drugs is able to reduce LDL-C levels by up to 60% more than that achieved with statins.
  • these drugs have clinical benefits, such as reducing the incidence of stroke and myocardial infarction.
  • PCSK9 Proprotein convertase subtilisin/kexin type 9
  • LDL receptor low density lipoprotein receptor
  • Antibodies to PCSK9 can interfere with its binding to LDL-R, causing the liver to express more LDL-R, thereby reducing plasma LDL-C levels.
  • Alisizumab and ilovolumab are fully humanized monoclonal antibodies that bind to free PCSK9 in plasma and promote its degradation. As a result, the free PCSK9 that can bind to LDL-R in the plasma decreases, so that more LDL-R is recycled to the surface of hepatocytes. As a direct result, the liver is able to remove more LDL-C from the circulation, reducing plasma LDL-C levels.
  • Such antibodies are able to specifically bind PCSK9, but not other members of the PCSK superfamily of enzymes.
  • RNA interference inhibitors can achieve similar lipid reductions and have many other advantages.
  • siRNA interferes with PCSK9 by blocking its mRNA-dependent synthesis.
  • PCSK9 small interfering RNA molecules can replace monoclonal antibodies to reduce PCSK9. In theory, these molecules could significantly reduce intracellular and extracellular PCSK9 levels, administer less frequently, and potentially cost less. All of these drugs significantly lower serum levels of low-density lipoprotein cholesterol (LDL-C), which is a major component of arterial plaque, which narrows or blocks arteries.
  • LDL-C low-density lipoprotein cholesterol
  • siRNA has the advantage of being cheap to manufacture and easy to store for a long time. For physicians, siRNA is certainly more convenient and requires fewer injections.
  • the purpose of the present invention is to provide a siRNA for inhibiting the expression of PCSK9 gene, and its modification and application.
  • PCSK9 refers to the proprotein convertase subtilisin Kexin9 gene or protein.
  • PCSK9 refers to the gene whose mRNA sequence is shown in Genbank accession number NM_174936.3.
  • the present invention claims a siRNA that inhibits the expression of PCSK9 gene.
  • the siRNA for inhibiting PCSK9 gene expression as claimed in the present invention may include a sense strand and an antisense strand; the sense strand and/or the antisense strand have a length in the range of 19-30 nucleotides.
  • the length of the sense or antisense strand can be between 19-21 nucleotides in length, 19-23 nucleotides in length, 19-25 nucleotides in length, 21-23 nucleotides in length, 21- 25 nucleotides in length, 23-25 nucleotides in length, 21-30 nucleotides in length, 23-30 nucleotides in length, or 25-30 nucleotides in length.
  • the sense strand and the antisense strand can complement each other to form a double-stranded RNA, and the complementary region forming the double-strand has a length in the range of 15-30 nucleotides.
  • the double-stranded complementary region of the siRNA provided by the present invention may have a length of 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.
  • the 3' end and/or the 5' end of the sense strand and/or the antisense strand constituting the siRNA may have an overhang.
  • the overhang may have a length of 1-6 nucleotides.
  • 2-6 nucleotides in length 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length Nucleotide length, 2-3 nucleotides in length, or 1-2 nucleotides in length.
  • These overhangs can be the result of one strand being longer than the other, or the staggering of two strands of the same length.
  • the overhang can form a mismatch with the PCSK9 mRNA, or it can be complementary to the targeted gene sequence or can be another sequence.
  • the first and second strands can also be linked, eg, by additional bases to form a hairpin or by other non-basic linkers.
  • an overhang with a length of 2 nucleotides is formed at the 3' ends of the two strands, and the siRNA double-stranded The region is 19 nucleotides in length.
  • an overhang with a length of 3 nucleotides is formed at the 3' ends of the two strands.
  • an overhang with a length of 4 nucleotides is formed at the 3' ends of the two strands.
  • an overhang with a length of 5 nucleotides is formed at the 3' ends of the two strands.
  • the siRNA may contain only a single overhang, which can enhance the interference activity of the siRNA without affecting its overall stability.
  • the single-stranded overhang can be located at the 3' end of the sense strand, or alternatively, at the 3' end of the antisense strand.
  • the siRNA may also have blunt ends at the 5' end of the antisense strand (or the 3' end of the sense strand), or vice versa.
  • the antisense strand comprising the siRNA has a nucleotide overhang at the 3' end and a blunt end at the 5' end.
  • siRNA with "nucleotide overhang at the 3' end and blunt end at the 5' end" provided by the present invention can be specifically numbered as GR90168.22, GR90243.22, GR90303.22, GR90320 in Table 10 of the Examples section .22, GR91024.22, GR90165.22, GR90169.22, or siRNA indicated by GR90166.22.
  • the siRNA (unmodified) is specifically any of the following:
  • (21) formed by complementation of the sense strand shown in SEQ ID No.31 and the antisense strand shown in SEQ ID No.196;
  • (161) formed by complementation of the sense strand shown in SEQ ID No.171 and the antisense strand shown in SEQ ID No.336;
  • (205) is formed by complementation of the sense strand shown in SEQ ID No. 350 and the antisense strand shown in SEQ ID No. 390.
  • At least one nucleotide of the siRNA provided by the present invention may be modified.
  • the nucleotides at the 5' or 3' overhangs at the sense strand, antisense strand or both strands of the siRNA can be independently chemically modified. In some embodiments provided by the present invention, one or more nucleotides in the sense strand or antisense strand of the siRNA can be independently chemically modified.
  • the modifications may include, but are not limited to, any one or more of the following: 2'-fluoro modification, 2'-O-methyl modification, 2'-fluorothymidine modification, 2'-O-methoxyethyl yl-5-methyluridine modification, 2 ⁇ -O-methoxyethyladenosine modification, 2 ⁇ -O-methoxyethyl-5-methylcytidine modification, 2'-methoxyethyl base modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-deoxy modification, 2'-hydroxyl modification, phosphorothioate backbone modification, locked nucleic acid modification, fluorescent probe modification, Ligand modification, or any combination thereof.
  • the 5' or 3' overhang at the sense strand, antisense strand, or both strands of the siRNA may be phosphorylated, eg, the overhang region(s) contain two A nucleotide with a phosphorothioate between the two nucleotides, where the two nucleotides may be the same or different.
  • the overhang is present at the 3' end of the sense strand, the antisense strand, or both strands.
  • At least one nucleotide of the sense strand, at least one nucleotide of the antisense strand, or at least one nucleotide of both strands of the siRNA is a modified nucleotide.
  • the majority of nucleotides on the sense strand are modified nucleotides
  • the majority of nucleotides on the antisense strand are modified nucleotides
  • the majority of nucleotides on both strands are Modified Nucleotides.
  • all nucleotides on the sense strand are modified nucleotides
  • all nucleotides on the antisense strand are modified nucleotides
  • all nucleotides on both strands are modified nucleotides Glycosides.
  • the 7th and 9th positions of the sense strand constituting the siRNA are 2'-F modified nucleotides, and the 1, 2, and 3 positions are passed through phosphorothioate dinucleotides.
  • Ester linkage, the 1st, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 nucleotides are all 2' -OMe-modified nucleotides; 2'-F modified nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 18 of the antisense strand constituting the siRNA , the 1st, 2nd, and 3rd positions are connected by thiophosphodiester bonds, the 19th, 20th, and 21st positions are connected by thiophosphodiester bonds, the 1st, 3rd, 7th, 9th, 11th, 13th, The 15, 17, 19, 20 and 21 nucleotides are all 2'-OMe modified nucleotides.
  • siRNAs have siRNAs that can be identified as GR90168.1, GR90243.1, GR90303.1 or GR90320.1 in Table 5 of the Examples section.
  • positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 1 and 3 , 5, 7, 9-11, 13, 15, 17, 19, 21 are nucleotides modified by 2'-F, and the 1, 2, and 3 positions are connected by phosphorothioate bonds;
  • the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 23 positions of the siRNA antisense strand are 2'-OMe modified nucleotides,
  • the 2, 4, 6, 8, 10, 14, 16, 18, 20, 22 are 2′-F modified nucleotides, connected by phosphorothioate bonds between the 1, 2, and 3 positions, and between the 19, 20, and 21 positions Linked by phosphorothioate bond.
  • positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 1 and 3 , 5, 7, 9-11, 13, 15, 17, 19, 21 are nucleotides modified by 2'-F, and the 1, 2, and 3 positions are connected by phosphorothioate bonds;
  • the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 23rd positions of the siRNA antisense strand are 2'-OMe modified nucleotides, 2, 4, 6, 8 , 10, 14, 16, 18, 20 are 2′-F modified nucleotides, the 1, 2, and 3 positions are connected by a phosphorothioate bond, and the 19, 20, and 21 positions are connected by Phosphorothioate linkages.
  • positions 2, 4, 6, 8, 12, 14-21 of the sense strand of the siRNA are 2'-OMe modified nucleotides
  • positions 1, 3, 5, 7 , 9-11, 13 positions are 2'-F modified nucleotides
  • the 1, 2, and 3 positions are connected by phosphorothioate bonds
  • the 1, 3, 5- of the siRNA antisense strand 7,9,11-13,15,17-19,21,22,23 are 2'-OMe modified nucleotides
  • 2,4,8,10,14,16,20 are 2'-
  • the F-modified nucleotides are linked by phosphorothioate bonds between positions 1, 2, and 3, and linked by phosphorothioate bonds between positions 19, 20, and 21.
  • positions 1-6, 8, 10-21 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 7 and 9 are 2'-F modified nucleotides Nucleotides, connected by phosphorothioate bonds between positions 1, 2, and 3; the first, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22, 23 are 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 are 2'-F modified nucleotides, 1, 2, 3 They are connected by thiophosphodiester bonds, and the 19th, 20th, and 21st positions are connected by thiophosphodiester bonds.
  • positions 1-6, 8, 10-21 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 7 and 9 are 2'-F modified nucleotides Nucleotides, connected by phosphorothioate bonds between positions 1, 2, and 3; positions 1, 3, 7, 9, 11, 13, 15, 17, 19-23 of the siRNA antisense strand 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are 2'-F modified nucleotides, between positions 1, 2, and 3 It is connected by a phosphorothioate bond, and the 19th, 20th, and 21st positions are connected by a phosphorothioate bond.
  • positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are 2'-OMe-modified nucleotides, and the first, 3, 5, 7, 9, 10, 13, 15, 17, 19, 21 are 2′-F modified nucleotides, the 11th position is LNA modified nucleotides, and the 1st, 2nd, and 3rd positions are The siRNA is connected by a phosphorothioate bond; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, and 23 positions of the siRNA antisense strand are 2'-OMe modified cores 2,4,6,8,10,14,16,18,20,22 is a nucleotide modified by 2′-F, through phosphorothioate between the 1, 2, and 3 positions Bonding, the 19th, 20th, 21st positions are connected by a phosphorothioate bond.
  • positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 1 and 3 , 5, 7, 9, 10, 13, 15, 17, 19, 21 are 2′-F modified nucleotides, 11 is LNA modified nucleotides, between positions 1, 2, and 3 Linked by phosphorothioate bond; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22, 23 positions of the siRNA antisense strand are 2'-OMe modified Nucleotides, 2'-F modified nucleotides at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20, with phosphorothioate bonds between positions 1, 2, and 3 Linked, the 19th, 20th, and 21st positions are connected by phosphorothioate bonds.
  • positions 2, 4, 6, 8, 12, 14-21 of the sense strand of the siRNA are 2'-OMe modified nucleotides
  • positions 1, 3, 5, 7 , 9, 10, and 13 are 2′-F modified nucleotides
  • the 11th position is LNA-modified nucleotides
  • the 1, 2, and 3 positions are connected by a phosphorothioate bond
  • the The 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22, 23 positions of the siRNA antisense strand are 2'-OMe modified nucleotides
  • the 2, 4, 8, The 10, 14, 16, and 20 positions are 2′-F modified nucleotides.
  • the 1, 2, and 3 positions are connected by a phosphorothioate bond
  • the 19, 20, and 21 positions are connected by a phosphorothioate bond. diester linkage.
  • positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 7 and 9 are 2'-F Modified nucleotides, the 11th position is LNA modified nucleotides, and the 1st, 2nd, and 3rd positions are connected by phosphorothioate bonds; the 1, 3, 5-7 of the siRNA antisense strand ,9,11-13,15,17-19,21,22,23 are 2'-OMe modified nucleotides, 2,4,8,10,14,16,20 are 2'-F The modified nucleotides are connected by phosphorothioate bonds between positions 1, 2, and 3, and are connected by phosphorothioate bonds between positions 19, 20, and 21.
  • positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 7 and 9 are 2'-F Modified nucleotides, the 11th position is LNA-modified nucleotides, and the 1, 2, and 3 positions are connected by phosphorothioate bonds; the 1, 3, 7, 9, 11, 13, 15, 17, 19-23 are 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are 2'-F modified The nucleotides of 1, 2, and 3 are connected by phosphorothioate bonds, and the 19th, 20, and 21 positions are connected by phosphorothioate bonds.
  • positions 1-6, 8, 10-22 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 7 and 9 are 2'-F modified nucleotides Nucleotides, the 11th position is a deoxyribonucleotide, and the 1st, 2nd, and 3rd positions are connected by a phosphorothioate bond; the 1, 3, 7, 9, 11, 13, 15, 17, 19-23 are 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are 2'-F modified nucleotides , the 1st, 2nd, and 3rd positions are connected by thiophosphodiester bonds, and the 19th, 20th, and 21st positions are connected by thiophosphodiester bonds.
  • the ligands include, but are not limited to, GalNAc, cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylglucosamine derivatives or analogs.
  • the siRNA is ligand-modified.
  • the ligand is conjugated to the 3' end of the sense strand of the siRNA.
  • the ligand is a GalNAc ligand.
  • the ligand is GalNAc3, as shown in formula I; the schematic diagram of its conjugation to the 3' end of the sense strand of siRNA is shown in formula II.
  • X is O or S. In one embodiment, X is O.
  • the GalNAc3-modified siRNA provided by the present invention has a sense strand and an antisense strand as shown in GR90168.34; or a sense strand and an antisense strand as shown in GR90168.35 (see Table 13 for details).
  • the GalNAc3-modified siRNA provided by the present invention has a sense strand and an antisense strand as shown in GR90243.53; or a sense strand and an antisense strand as shown in GR90243.54 (see Table 13 for details).
  • the GalNAc3-modified siRNA provided by the present invention has a sense strand and an antisense strand as shown in GR90303.72; or a sense strand and an antisense strand as shown in GR90303.73 (see Table 13 for details).
  • the GalNAc3-modified siRNA provided by the present invention has a sense strand and an antisense strand as shown in GR90320.91; or a sense strand and an antisense strand as shown in GR90320.92 (see Table 13 for details).
  • the siRNA (after modification) is specifically any of the following:
  • Sense strand CmsCmsCmGmUmGmCfGmCfAmGmGmAmGmGmAmCmGmAmGmGmAmGmGmGmGmAmGmGmGmGmGmGmGm;
  • Antisense strand UmsCfsGmUfCfCfUmCfCmUfGmCfGmCfAmCfGmGfGmsCmsGm;
  • Sense strand CmsGmsAmAmGmCmAfCmCfCmGmAmGmCmAmCmGmGmAmAmCm;
  • Antisense strand UmsCfsCmGfUfGfCmUfCmGfGmGfUmGfCmUfUmCfGmsGmsCm;
  • Sense strand AmsCmsCmCmGmAmGfCmAfCmGmGmAmAmCmCmAmGmCm; Antisense strand: UmsGfsUmGfGfUfUmCfCmGfUmGfCmUfCmGfGmGfUmsGmsCm;
  • Sense strand CmsCmsGmAmGmCmAfCmGfGmAmAmCmCmAmGmCmCmAm; Antisense strand: GmsCfsUmGfUfGfGmUfUmCfCmGfUmGfCmUfCmGfGmsGmsUm;
  • Sense strand GmsAmsGmAmCmCmCfAmCfCmUmCmUmCmGmCmAmGmUmCmAm; antisense strand: AmsCfsUmGfCfGfAmGfAmGfGmUfGmGfGmUfCmUfCmsCmsUm;
  • Sense strand CmsUmsCmUmCmGmCfAmGfUmCmAmGmAmGmAmGmCmGmCmAmCmUm;
  • Antisense strand UmsGfsCmGfCfUfCmUfGmAfCmUfGmCfGmAfGmAfGmAfGmsGmsUm;
  • Sense strand CmsCmsCmGmCmCmGfGmGfGmAmUmAmCmCmUmCmAmCmCmAm;
  • Antisense strand GmsUfsGmAfGfGfUmAfUmCfCmCfCmGfGmCfGmGfGmsCmsAm;
  • Sense strand GmsGmsGmGmAmUmAfCmCfUmCmAmCmCmCamAmGmamUmCmCm;
  • Antisense strand AmsUfsCmUfUfGfGmUfGmAfGmGfUmAfUmCfCmCfCfCmsGmsGm;
  • Sense strand GmsGmsGmAmUmAmCfCmUfCmAmCmCmAmAmGmAmUmCmUm;
  • Antisense strand GmsAfsUmCfUfUfGmGfUmGfAmGfGmUfAmUfCmCfCmsCmsGm;
  • Sense strand AmsCmsCmAmAmGmAfUmCfCmUmGmCmAmUmGmUmCmUmUmCm; antisense strand: AmsGfsAmCfAfUfGmCfAmGfGmAfUmCfUmUfGmGfUmsGmsAm;
  • Sense strand AmsCmsGmGmAmUmGfGmCfCmAmCmAmGmCmCmGmUmCmGmCm;
  • Antisense strand GmsAfsCmGfGfCfUmGfUmGfGmCfCmAfUmCfCmGfUmsGmsUm;
  • Sense strand GmsAmsAmGmUmUmGfCmCfCmCmAmUmGmUmCmGmAmCmUmAm; antisense strand: GmsUfsCmGfAfCfAmUfGmGfGmGfCmAfAmCfUmUfCmsAmsAm;
  • Sense strand CmsCmsCmAmUmGmUfCmGfAmCmUmAmCmAmUmCmGmAmGmGmGm;
  • Antisense strand UmsCfsGmAfUfGfUmAfGmUfCmGfAmCfAmUfGmGfGmsGmsCm;
  • Sense strand AmsCmsCmGmGmGmGmCfGmGfAmUmGmAmAmUmAmCmCmAmGmCm;
  • Antisense strand UmsGfsGmUfAfUfUmCfAmUfCmCfGmCfCmCfGmGfUmsAmsCm;
  • Sense strand UmsGmsGmUmCmAmCfCmGfAmCmUmUmCmGmAmGmAmAmUmGm; Antisense strand: UmsUfsCmUfCfGfAmAfGmUfCmGfGmUfGmAfCmCfAmsUmsGm;
  • Sense strand GmsUmsCmAmCmCmGfAmCfUmUmCmGmAmGmAmAmUmGmUmGm; Antisense strand: CmsAfsUmUfCfUfCmGfAmAfGmUfCmGfGmUfGmAfCmsCmsAm;
  • Sense strand CmsAmsCmCmGmAmCfUmUfCmGmAmGmAmAmUmGmUmGmCmCm;
  • Antisense strand CmsAfsCmAfUfUfCmUfCmGfAmAfGmUfCmGfGmUfGmsAmsCm;
  • Sense strand AmsCmsCmGmAmCmUfUmCfGmAmGmAmAmUmGmUmGmCmCmCm; Antisense strand: GmsCfsAmCfAfUfUmCfUmCfGmAfAmGfUmCfGmGfUmsGmsAm;
  • Sense strand AmsCmsUmUmCmGmAfGmAfAmUmGmUmGmCmCmGmAmGmGm; Antisense strand: UmsCfsGmGfGfCfAmCfAmUfUmCfUmCfGmAfAmGfUmsCmsGm;
  • Sense strand UmsGmsGmAmCmCmUfCmUfUmUmGmCmCmCmAmGmGmGmGmGm; Antisense strand: CmsCfsUmGfGfGfGmCfAmAfAmGfAmGfGmUfCmCfAmsCmsAm;
  • Sense strand CmsGmsCmUmGmUmGfUmGfGmAmCmCmUmCmUmUmUmUmGmCmCmCm;
  • Antisense strand CmsAfsAmAfGfAfGmGfUmCfCmAfCmAfGmCfGmsGmsCm;
  • Sense strand CmsGmsGmAmGmCmUfCmAfCmCmCmUmGmGmCmCmGmAmGmUm;
  • Antisense strand UmsCfsGmGfCfCfAmGfGmGfUmGfAmGfCmUfCmCfGmsGmsCm;
  • Sense strand CmsUmsGmUmUmUmUfGmCfAmGmGmAmCmUmGmUmAmUmGmGmGm; Antisense strand: AmsUfsAmCfAfGfUmCfCmUfGmCfAmAfAmAfCmAfGmsCmsUm;
  • Sense strand GmsGmsAmCmUmGmUfAmUfGmGmUmCmAmGmCmAmCmAmCmUm;
  • Antisense strand UmsGfsUmGfCfUfGmAfCmCfAmUfAmCfAmGfUmCfCmsUmsGm;
  • Sense strand CmsGmsAmGmCmGmCfAmUfGmGmAmGmGmCmCmAmAmGmGm; Antisense strand: UmsUfsGmGfGfCfCmUfCmCfAmUfGmCfGmCfUmCfGmsCmsCm;
  • Sense strand GmsGmsGmGmCmAmAfGmCfUmGmGmUmCmUmGmCmCmGmGmGmGmGm; antisense strand: CmsGfsGmCfAfGfAmCfCmAfGmCfUmUfGmCfCmCfCmsCmsUm;
  • Sense strand GmsGmsGmCmAmAmGfCmUfGmGmUmCmUmGmCmCmGmGmGmCm; antisense strand: CmsCfsGmGfCfAfGmAfCmCfAmGfCmUfUmGfCmCfCmsCm;
  • Sense strand UmsGmsGmUmCmUmGfCmCfGmGmGmGmCmCmAmCmamAmCmGm; Antisense strand: UmsUfsGmUfGfGfGmCfCmCfGmGfCmAfGmAfCmCfAmsGmsCm;
  • Sense strand CmsAmsCmAmAmCmGfCmUfUmUmUmGmGmGmGmGmGmUmGmAmGm; antisense strand: CmsAfsCmCfCfCmAfAmAfAmGfCmGfUmUfGmUfGmsGm;
  • Sense strand AmsCmsAmAmCmGmCfUmUfUmUmGmGmGmGmGmGmGmUmGmAmGmGm; antisense strand: UmsCfsAmCfCfCfCmCfAmAfAmAfGmCfGmUfUmGfUmsGmsGm;
  • Sense strand CmsAmsAmCmGmCmUfUmUfUmGmGmGmGmGmGmGmUmGmAmGmGmGmGmGmGmGmUmGmAmGmGmGmGmGmGmGmGmUmGmAmGmGmGmGmGmGmGmGmUmGmAmGmGmGmGmGmGmGmGmGmGmGmGmGmGmGmsUmsGm;
  • Sense strand GmsUmsGmAmGmGmGfUmGfUmCmUmAmCmGmCmCmAmUmUmGm; Antisense strand: AmsUfsGmGfCfGfUmAfGmAfCmAfCmCfCmUfCmAfCmsCmsCm;
  • Sense strand UmsGmsAmGmGmGmUfGmUfCmUmAmCmGmCmCmAmUmUmGmCm; antisense strand: AmsAfsUmGfGfCfGmUfAmGfAmCfCmCfUmCfAmsCmsCm;
  • Sense strand GmsAmsGmGmGmUmGfUmCfUmAmCmGmCmCmAmUmUmGmCmCmCmCm; antisense strand: CmsAfsAmUfGfGfCmGfUmAfGmAfCmAfCmCfCmUfCmsAmsCm;
  • Sense strand GmsGmsGmUmGmUmCfUmAfCmGmCmCmAmUmUmGmCmCmAmGm; antisense strand: GmsGfsCmAfAfUfGmGfCmGfUmAfGmAfCmAfCmCfCmsUm;
  • Sense strand GmsGmsUmGmUmCmUfAmCfGmCmAmUmUmGmCmCmAmGmGmGm; antisense strand: UmsGfsGmCfAfAfUmGfGmCfGmUfAmGfAmCfCmsCmsUm;
  • Sense strand GmsUmsGmUmCmUmAfCmGfCmCmAmUmUmGmCmCmAmGmGmUm;
  • Antisense strand CmsUfsGmGfCfAfAmUfGmGfCmGfUmAfGmAfCmAfCmsCmsCm;
  • Sense strand UmsGmsUmCmUmAmCfGmCfCmAmUmUmGmCmCmAmGmGmUmGm; Antisense strand: CmsCfsUmGfGfCfAmAfUmGfGmCfGmUfAmGfAmCfAmsCmsCm;
  • Sense strand CmsUmsAmCmGmCmCfAmUfUmGmCmCmAmGmGmUmGmCmUmGmUmGm; antisense strand: GmsCfsAmCfCfUfGmGfCmAfAmUfGmGfCmGfUmAfGmsAmsCm;
  • Sense strand UmsAmsCmGmCmCmAfUmUfGmCmCmAmGmGmUmGmCmUmGmCmCm; antisense strand: AmsGfsCmAfCfCfUmGfGmCfAmAfUmGfGmCfGmUfAmsGmsAm;
  • Sense strand GmsAmsCmCmCmGmUfGmUfCmCmAmCmUmGmCmCmAmCmCmCmAm; antisense strand: GmsUfsGmGfCfAfGmUfGmGfAmCfAmCfGmGfGmUfCmsCm;
  • Sense strand CmsCmsUmUmGmGmCfAmCfCmCmAmCmAmAmGmCmGmCmCmCmCmCmCm; Antisense strand: CmsGfsGmCfUfUfGmUfGmGfGmUfGmCfCmAfAmGfGmsUmsCm;
  • Sense strand CmsAmsCmCmCmAmCfAmAfGmCmCmGmCmUmGmUmGmUmGmCmUmGmCmUmGmCmUm; antisense strand: CmsAfsCmAfGfGfCmGfGmCfUmUfGmUfGmGfGmUfGmsCmsCm;
  • Sense strand CmsCmsCmAmCmAmAfGmCfCmGmCmUmGmUmGmUmGmCmUmGmUmGmUmGmUmGmGmUmGmAm; Antisense strand: AmsGfsCmAfCfAfGmGfCmGfGmCfUmUfGmUfGmGfGmsUmsGm;
  • Sense strand CmsCmsAmCmAmAmGfCmCfGmCmCmUmGmUmGmUmGmCmUmGmAmGm; Antisense strand: CmsAfsGmCfAfCfAmGfGmCfGmGfCmUfUmGfUmGfGmsGmsUm;
  • Sense strand CmsCmsAmCmGmAmGfGmUfCmAmGmCmCmAmAmCmCmAmGm; Antisense strand: GmsGfsUmUfGfGfGmCfUmGfAmCfCmUfCmGfUmGfGmsCm;
  • Sense strand CmsAmsCmGmAmGmGfUmCfAmGmCmCmAmAmCmCmAmGmUm; Antisense strand: UmsGfsGmUfUfGfGmGfCmUfGmAfCmCfUmCfGmUfGmsGmsCm;
  • Sense strand CmsGmsAmGmGmUmCfAmGfCmCmCmAmAmCmCmAmGmUmGmCm; Antisense strand: AmsCfsUmGfGfUfUmGfGmGfCmUfGmAfCmCfUmCfGmsUmsGm;
  • Sense strand GmsAmsGmGmUmCmAfGmCfCmCmAmAmCmCmAmGmUmGmCmGm; Antisense strand: CmsAfsCmUfGfGfUmUfGmGfGmCfUmGfAmCfCmUfCmsGmsUm;
  • Sense strand CmsCmsAmAmCmCmAfGmUfGmCmGmUmGmGmGmGmCmAmCmAm; antisense strand: UmsGfsGmCfCfCfAmCfGmCfAmCfUmGfGmUfUmGfGmsGmsCm;
  • Sense strand AmsGmsUmGmCmGmUfGmGfGmCmAmCmAmGmGmGmAmGmGmGmAmGmGmGmGmGmGmGm; antisense strand: UmsCfsCmCfUfGfUmGfGmCfCmCfAmCfGmCfAmCfUmsGmsGm;
  • Sense strand AmsCmsGmCmCmGmUfAmGfAmCmAmCmGmUmGmUmGmUmGm; Antisense strand: CmsAfsCmGfUfGfUmUfGmUfCmUfAmCfGmGfCmGfUmsAmsGm;
  • Sense strand CmsCmsGmUmAmGmAfCmAfAmCmAmCmGmUmGmUmGmUmAmGm; Antisense strand: AmsCfsAmCfAfCfGmUfGmUfUmGfUmCfUmAfCmGfGmsCmsGm;
  • Sense strand CmsGmsUmAmGmAmCfAmAfCmAmCmGmUmGmUmGmUmAmGmUm; Antisense strand: UmsAfsCmAfCfAfCmGfUmGfUmUfGmUfCmUfAmCfGmsGmsCm;
  • Sense strand GmsUmsAmGmAmCmAfAmCfAmCmGmUmGmUmGmUmAmGmUmCmUmCm;
  • Antisense strand CmsUfsAmCfAfCfAmCfGmUfGmUfUmGfUmCfUmAfCmsGmsGm;
  • Sense strand GmsUmsCmAmGmGmAfGmCfCmGmGmGmamCmGmUmCmAmGmCm; antisense strand: UmsGfsAmCfGfUfCmCfCmGfGmCfUmCfCmUfGmAfCmsUmsAm;
  • Sense strand GmsGmsCmUmGmGmGfGmCfUmGmAmGmCmUmUmUmAmAmAm;
  • Antisense strand CmsAfsUmUfUfUfAmAfAmGfCmUfCmAfGmCfCmCfCmsAmsGm;
  • Sense strand UmsGmsGmGmGmGmCmUfGmAfGmCmUmUmUmAmAmAmUmGmGm; antisense strand: AmsAfsCmCfAfUfUmUfUmAfAmAfGmCfUmCfAmGfCmsCmsCm;
  • Sense strand GmsGmsGmCmUmGmAfGmCfUmUmAmAmAmUmGmGmUmUm;
  • Antisense strand GmsGfsAmAfCfCfAmUfUmUfUmAfAmAfGmCfUmCfAmsGmsCm;
  • Sense strand UmsGmsAmGmCmUmUfUmAfAmAmAmUmGmGmUmUmCmCmGmAm; Antisense strand: AmsGfsUmCfGfGfAmAfCmCfAmUfUmUfUmAfAmAfGmsCmsUm;
  • Sense strand UmsUmsAmAmAmUfGmGfUmUmCmCmGmAmCmUmUmGmUmCm; Antisense strand: GmsGfsGmAfCfAfAmGfUmCfGmGfAmAfCmCfAmUfUmsUm;
  • Sense strand AmsAmsAmUmGmGmUfUmCfCmGmAmCmUmUmGmUmCmCmUm; antisense strand: AmsGfsAmGfGfGfAmCfAmAfGmUfCmGfGmAfAmCfCmsAmsUm;
  • Sense strand AmsUmsGmGmUmUmCfCmGfAmCmUmUmGmUmCmCmUmCmUmUm; antisense strand: AmsGfsAmGfAfGfGmGfAmCfAmAfGmUfCmGfGmAfAmsCmsCm;
  • Sense strand GmsUmsUmCmCmGmAfCmUfUmGmUmCmCmUmCmUmCmUmCmUmCmUmCmUmCmUmCmUmCmUmCm; antisense strand: CmsUfsGmAfGfAfGmAfGmGfGmAfCmAfAmGfUmCfGmsGmsAm;
  • Sense strand GmsCmsCmCmUmCmCfAmUfGmGmCmCmUmGmGmCmAmCmGmAm;
  • Antisense strand CmsCfsUmCfGfUfGmCfCmAfGmGfCmCfAmUfGmGfAmsGmsGm;
  • Sense strand GmsGmsCmCmUmGmGfCmAfCmGmAmGmGmGmGmGmAmUmGmGmGmGmGmGmGmGmGm;
  • Antisense strand UmsCfsCmCfCfAfUmCfCmCfCmUfCmGfUmGfCmCfAmsGmsGm;
  • Sense strand AmsGmsGmGmGmAmUfGmGfGmGmAmUmGmCmUmUmCmCmGmCm; Antisense strand: AmsGfsGmCfGfGfAmAfGmCfAmUfCmCfCmCfAmUfCmsCmsCm;
  • Sense strand GmsGmsGmAmUmGmGfGmGfAmUmGmCmUmUmCmCmGmCmUm; Antisense strand: AmsAfsAmGfGfCfGmGfAmAfGmCfAmUfCmCfCmCfAmsUmsCm;
  • Sense strand GmsGmsGmGmAmUmGfCmUfUmCmCmGmCmUmUmUmCmCmGm; antisense strand: CmsCfsCmGfGfAfAmAfGmGfCmGfGmAfAmGfCmAfUmsCmsCm;
  • Sense strand AmsUmsGmCmUmUmCfCmGfCmCmUmUmUmUmCmCmGmGmGmGmGmCm; antisense strand: CmsAfsGmCfCfCmGfGmAfAmAfGmGfCmGfGmAfAmsGmsCm;
  • Sense strand UmsUmsCmCmGmCmCfUmUfUmCmCmGmGmGmGmGmCmUmGmCmUmUm; antisense strand: CmsCfsAmGfCfAfGmCfCmCfCmGfGmAfAmAfGmGfCmsGmsGm;
  • Sense strand UmsCmsCmGmCmCmUfUmUfCmCmGmGmGmGmGmCmUmGmCmUmGmUmGmUmGmGm; antisense strand: GmsCfsCmAfGfCfAmGfCmCfCmCfGmGfAmAfAmGfGmsCmsGm;
  • Sense strand GmsGmsCmCmUmGmGfCmCfCmUmUmGmamGmUmGmGmGmGmCm; antisense strand: CmsUfsGmCfCfCmAfCmUfCmAfAmGfGmGfCmCfAmsGmsGm;
  • Sense strand CmsCmsUmCmCmUmUfGmCfCmUmGmGmAmAmCmUmCmAmCmUm; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmsGmsAm;
  • Sense strand CmsUmsCmCmUmUmGfCmCfUmGmGmAmAmCmUmCmAmCmUmCm;
  • Antisense strand GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmsGmsGm;
  • Sense strand CmsCmsUmUmGmCmCfUmGfGmAmAmCmUmCmAmCmUmCmAmCm;
  • Antisense strand GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmsAm;
  • Sense strand CmsUmsUmGmCmCmUfGmGfAmAmCmUmCmAmCmUmCmAmCmUmAmCmUm; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmsCmsAm;
  • Sense strand UmsUmsGmCmCmUmGfGmAfAmCmUmCmAmCmUmCmAmCmUmCmUmCmAmCmUmCm;
  • Antisense strand CmsAfsGmAfGfUfGmAfGmUfGmAfGmUfUmCfCmAfGmsGmsCm;
  • Sense strand UmsGmsCmCmUmGmGfAmAfCmUmCmAmCmUmCmAmCmUmCmUmCmUm; Antisense strand: CmsCfsAmGfAfGfUmGfAmGfUmGfAmGfUmUfCmCfAmsGmsGm;
  • Sense strand GmsUmsGmGmAmGmGfUmGfCmCmAmGmGmAmAmGmCmUmCmCm;
  • Antisense strand AmsGfsGmGfAfGfCmUfUmCfCmUfGmGfCmAfCmCfUmsCmsCm;
  • Sense strand UmsGmsGmAmGmGmUfGmCfCmAmGmGmAmAmGmCmUmCmCmCmCm;
  • Antisense strand GmsAfsGmGfGfAfGmCfUmUfCmCfUmGfGmCfAmCfCmsUmsCm;
  • Sense strand CmsCmsCmUmCmAmCfUmGfUmGmGmGmGmGmCmAmUmUmUmCmAm;
  • Antisense strand GmsGfsUmGfAfAfAmUfGmCfCmCfCmAfCmAfGmUfGmsAmsGm;
  • Sense strand AmsCmsUmGmUmGmGfGmGfCmAmUmUmUmCmAmCmCmAmUmUm; Antisense strand: UmsGfsAmAfUfGfGmUfGmAfAmAfUmGfCmCfCmCfAmsCmsAm;
  • Sense strand CmsUmsGmUmGmGmGfGmCfAmUmUmUmCmAmCmCmAmUmUmCm;
  • Antisense strand UmsUfsGmAfAfUfGmGfUmGfAmAfAmUfGmCfCmCfCmsAmsCm;
  • Sense strand UmsGmsUmGmGmGmGfCmAfUmUmUmCmAmCmCmAmUmUmCmAm;
  • Antisense strand UmsUfsUmGfAfAfUmGfGmUfGmAfAmAfUmGfCmCfCmsCmsAm;
  • sense strand GmsUmsGmGmGmGmGmCfAmUfUmUmCmAmCmCmAmUmUmCmAmAm; antisense strand: GmsUfsUmUfGfAfAmUfGmGfUmGfAmAfAmUfGmCfCmsCm;
  • Sense strand UmsGmsGmGmGmGmCmAfUmUfUmCmAmCmCmAmUmUmCmAmAmm; Antisense strand: UmsGfsUmUfUfGfAmAfUmGfGmUfGmAfAmAfUmGfCmsCmsCm;
  • Sense strand GmsGmsGmGmCmAmUfUmUfCmAmCmCmAmUmUmCmAmAmCm;
  • Antisense strand CmsUfsGmUfUfUfGmAfAmUfGmGfUmGfAmAfAmUfGmsCmsCm;
  • Sense strand GmsGmsGmCmAmUmUfUmCfAmCmCmCmAmUmUmCmAmAmAmCmAm;
  • Antisense strand CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmsGmsCm;
  • Sense strand GmsGmsCmAmUmUmUfCmAfCmCmAmUmUmCmAmAmAmCmAmGm; Antisense strand: AmsCfsCmUfGfUfUmUfGmAfAmUfGmGfUmGfAmAfAmsUmsGm;
  • Sense strand GmsCmsAmUmUmUmCfAmCfCmAmUmUmCmAmAmAmCmAmGmGm;
  • Antisense strand GmsAfsCmCfUfGfUmUfUmGfAmAfUmGfGmUfGmAfAmsAmsUm;
  • Sense strand CmsAmsUmUmUmCmAfCmCfAmUmUmCmAmAmAmCmAmGmGmUm; Antisense strand: CmsGfsAmCfCfUfGmUfUmUfGmAfAmUfGmGfUmGfAmsAm;
  • Sense strand AmsUmsUmUmCmAmCfCmAfUmUmCmAmAmAmCmAmGmGmUmCm; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmsAmsAm;
  • Sense strand UmsCmsAmCmCmAmUfUmCfAmAmAmCmAmGmGmUmCmGmAmGm; Antisense strand: AmsGfsCmUfCfGfAmCfCmUfGmUfUmUfGmAfAmUfGmsGmsUm;
  • Sense strand CmsAmsCmCmAmUmUfCmAfAmAmCmAmGmGmUmCmGmAmGmCm; Antisense strand: CmsAfsGmCfUfCfGmAfCmCfUmGfUmUfUmGfAmAfUmsGmsGm;
  • Sense strand CmsUmsGmCmCmAmGfCmUfGmCmUmCmCmAmAmUmGmUmGm; Antisense strand: GmsGfsCmAfCfAfUmUfGmGfGmAfGmCfAmGfCmUfGmsGmsCm;
  • Sense strand GmsCmsCmAmGmCmUfGmCfUmCmCmAmAmUmGmUmGmCmCmCmAmAmUmGmUmGmCmCmCm;
  • Antisense strand UmsCfsGmGfCfAfCmAfUmUfGmGfGmAfGmCfAmGfCmsUmsGm;
  • Sense strand GmsCmsUmGmCmUmCfCmCfAmAmUmGmUmGmCmCmGmamUmGm; antisense strand: GmsAfsCmAfUfCfGmGfCmAfCmAfUmUfGmGfGmAfGmsCmsAm;
  • Sense strand CmsUmsGmCmUmCmCfCmAfAmUmGmUmGmCmCmGmAmUmGmUm; Antisense strand: GmsGfsAmCfAfUfCmGfGmCfAmCfAmUfUmGfGmGfAmsGmsCm;
  • Sense strand GmsCmsUmCmCmCmAfAmUfGmUmGmCmCmGmAmUmGmUmCmCm; Antisense strand: AmsCfsGmGfAfCfAmUfCmGfGmCfAmCfAmUfUmGfGmsGmsAm;
  • Sense strand CmsCmsAmAmUmGmUfGmCfCmGmAmUmGmUmCmCmGmUmGmGmGm; antisense strand: GmsCfsCmCfAfCfGmGfAmCfAmUfCmGfGmCfAmCfAmsUmsUm;
  • Sense strand CmsAmsAmUmGmUmGfCmCfGmAmUmGmUmCmCmGmUmGmGmGmGmGm; antisense strand: UmsGfsCmCfCfAfCmGfGmAfCmAfUmCfGmGfCmAfCmsAmsUm;
  • Sense strand UmsGmsCmCmGmAmUfGmUfCmCmGmUmGmGmGmCmAmGmAmAm; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmsGmsGm;
  • Sense strand CmsGmsAmUmGmUmCfCmGfUmGmGmGmCmAmGmAmAmUmGmAm; Antisense strand: AmsGfsUmCfAfUfUmCfUmGfCmCfCmAfCmGfGmAfCmsAmsUm;
  • Sense strand GmsAmsUmGmUmCmCfGmUfGmGmGmCmAmGmAmAmUmGmAmCm; Antisense strand: AmsAfsGmUfCfAfUmUfCmUfGmCfCmCfAmCfGmGfAmsCmsAm;
  • Sense strand AmsUmsGmUmCmCmGfUmGfGmGmCmAmGmAmAmUmGmamCmUm; Antisense strand: AmsAfsAmGfUfCfAmUfUmCfUmGfCmCfCmAfCmGfGmsAmsCm;
  • Sense strand UmsGmsUmCmCmGmUfGmGfGmCmAmGmAmAmUmGmAmCmUmUm; Antisense strand: AmsAfsAmAfGfUfCmAfUmUfCmUfGmCfCmCfAmCfGmsGmsAm;
  • Sense strand GmsUmsCmCmGmUmGfGmGfCmAmGmAmAmUmGmAmCmUmUmUm;
  • Antisense strand UmsAfsAmAfAfGfUmCfAmUfUmCfUmGfCmCfCmAfCmsGmsGm;
  • Sense strand AmsGmsAmAmUmGmAfCmUfUmUmUmUmUmUmUmGmAmGmCmUmCm; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmsUmsUm;
  • Sense strand UmsUmsUmAmUmUmGfAmGfCmUmCmUmUmGmUmUmCmCmGmUmUmCmGmUmUm; Antisense strand: GmsCfsAmCfGfGfAmAfCmAfAmGfAmGfCmUfCmAfAmsUmsAm;
  • Sense strand UmsUmsAmUmUmGmAfGmCfUmCmUmUmGmUmUmUmGmUmUmCmCmGmUmGm; Antisense strand: GmsGfsCmAfCfGfGmAfAmCfAmAfGmAfGmCfUmCfAmsAmsUm;
  • Sense strand GmsCmsUmCmUmUmGfUmUfCmCmGmUmGmCmAmGmGmCmAm;
  • Antisense strand AmsAfsUmGfCfCfUmGfGmCfAmCfGmGfAmAfCmAfAmsGmsAm;
  • Sense strand UmsCmsCmGmUmGmCfCmAfGmGmCmAmUmUmCmAmAmUmCmCm; Antisense strand: GmsAfsGmGfAfUfUmGfAmAfUmGfCmCfUmGfGmCfAmsCmsGm;
  • Sense strand GmsGmsCmAmGmGmAfUmUfCmUmUmCmCmAmUmGmamUm; Antisense strand: CmsUfsAmUfCfCfAmUfGmGfGmAfAmGfAmAfUmCfCmsUmsGm;
  • Sense strand AmsUmsGmGmCmCmCfUmCfAmUmCmUmCmCmAmGmCmUmAmAm;
  • Antisense strand AmsGfsUmUfAfGfCmUfGmGfAmGfAmUfGmAfGmGfGmsCmsCm;
  • Sense strand GmsCmsUmUmUmCmUfGmGfAmUmGmGmCmAmUmCmUmAmGmCm; Antisense strand: UmsGfsGmCfUfAfGmAfUmGfCmCfAmUfCmCfAmGfAmsAm;
  • Sense strand UmsGmsGmCmAmUmCfUmAfGmCmCmAmGmAmGmGmCmUmGmGm; Antisense strand: CmsUfsCmCfAfGfCmCfUmCfUmGfGmCfUmAfGmAfUmsGmsCm;
  • Sense strand UmsGmsGmAmGmAmCfAmGfGmUmGmCmGmCmCmCmUmGmGm; antisense strand: CmsAfsCmCfAfGfGmGfGmCfGmCfAmCfCmUfGmUfCmsUmsCm;
  • Sense strand GmsGmsAmGmAmCmAfGmGfUmGmCmGmCmCmCmUmGmGmUm; antisense strand: CmsCfsAmCfCfAfGmGfGmGfCmGfCmAfCmCfUmGfUmsCmsUm;
  • Sense strand GmsAmsGmAmCmAmGfGmUfGmCmGmCmCmCmUmGmGmUmGmGmUmGm; Antisense strand: AmsCfsCmAfCfCfAmGfGmGfGmCfGmCfAmCfCmUfGmsUmsCm;
  • Sense strand AmsGmsAmCmAmGmGfUmGfCmGmCmCmCmUmGmGmUmGmGmUmGmGmUmGmGmGmGmGmGmGmGmGmGmGmGmGm; antisense strand: GmsAfsCmCfAfCfCmAfGmGfGmGfCmGfCmAfCmCfUmsGmsUm;
  • Sense strand AmsGmsGmUmGmCmGfCmCfCmCmUmGmGmUmGmGmUmGmUmCmAmCm; Antisense strand: CmsUfsGmUfGfAfCmCfAmCfCmAfGmGfGmGfCmGfCmsAmsCm;
  • sense strand UmsUmsUmCmCmUmGfAmGfCmCmAmCmCmUmUmUmAmCmUmUmCm; antisense strand: CmsAfsGmAfGfUfAmAfAmGfGmUfGmGfCmUfCmAfGmsGmsAm;
  • Sense strand GmsGmsCmCmUmGmGfCmGfGmAmGmAmUmGmCmUmUmCmUmUmAm;
  • Antisense strand CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmsGmsGm;
  • Sense strand GmsCmsUmUmUmUmGfUmAfAmCmUmUmGmAmAmGmAmUmAmUm; Antisense strand: AmsAfsAmUfAfUfCmUfUmCfAmAfGmUfUmAfCmAfAmsAm;
  • Sense strand UfsUmsGfCmCfUmGfGmAfAfCfUmCfAmCfUmCfAmCfUmCf-GALNAC; Antisense strand: GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGfsGm;
  • Sense strand UfsUmsGfCmCfUmGfGmAfAfCfUmCfAmCfUmCfAmCfUmCf-GALNAC; Antisense strand: GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGmsGm;
  • Sense strand UfsUmsGfCmCfUmGfGmAfAfCfUmCfAmCmUmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;
  • Sense strand UmsUmsGmCmCmUmGfGmAfAmCmUmCmAmCmUmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;
  • Sense strand UmsUmsGmCmCmUmGfGmAfAmCmUmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmAmAmsGmsGm;
  • Sense strand UfsUmsGfCmCfUmGfGmAfAfC(LNA)UmCfAmCfUmCfAmCfUmCf-GALNAC;
  • Antisense strand GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGfsGm;
  • Sense strand UfsUmsGfCmCfUmGfGmAfAfC(LNA)UmCfAmCfUmCfAmCfUmCf-GALNAC; Antisense strand: GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGmsGm;
  • Sense strand UfsUmsGfCmCfUmGfGmAfAfC(LNA)UmCfAmCmUmCmAmCmUmCm-GALNAC;
  • Antisense strand GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;
  • Sense strand UmsUmsGmCmCmUmGfGmAfAmC(LNA) UmCmAmCmUmCmAmCmUmCm-GALNAC;
  • Antisense strand GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;
  • Sense strand UmsUmsGmCmCmUmGfGmAfAmC(LNA) UmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmAmAmsGmsGm;
  • Sense strand UmsUmsGmCmCmUmGfGmAfAmC(d) UmCmAmCmUmCmAmCmUmCm-GALNAC;
  • Antisense strand GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmAmAmsGmsGm;
  • Sense strand UfsUfsGfCCUGGAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAGUGAGUUCCAGGCAAfsGfsGf;
  • Sense strand CHO-UfsUfsGfCCUGGAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAGUGAGUUCCAGGCAAfsGfsGf;
  • Sense strand UfsUfsGfCCUG(LNA)GAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAGUGAGUUCCAGGCAAfsGfsGf;
  • Sense strand UfsUfsGfCCUGGAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAG(LNA)UGAGUUCCAGGCAAfsGfsGf;
  • Sense strand UmsUmsGmCCUGGAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAGUGAGUUCCAGGCAAmsGmsGm;
  • Sense strand CHO-UmsUmsGmCCUGGAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAGUGAGUUCCAGGCAAmsGmsGm;
  • Sense strand UmsUmsGmCCUG(LNA)GAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAGUGAGUUCCAGGCAAmsGmsGm;
  • Sense strand UmsUmsGmCCUGGAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAG(LNA)UGAGUUCCAGGCAAmsGmsGm;
  • Sense strand GfsCmsAfUmUfUmCfAmCfCfAfUmUfCmAfAmAfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCfsCm;
  • Sense strand GfsCmsAfUmUfUmCfAmCfCfAfUmUfCmAfAmAfCmAfGmGf-GALNAC;
  • Antisense strand CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCm;
  • Sense strand GfsCmsAfUmUfUmCfAmCfCfAfUmUfCmAmAmAmCmAmGmGm-GALNAC;
  • Antisense strand CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCm;
  • Sense strand GmsCmsAmUmUmUmCfAmCfCmAmUmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCm;
  • Sense strand GmsCmsAmUmUmUmCfAmCfCmAmUmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmGmCmsCmsCm;
  • Sense strand GfsCmsAfUmUfUmCfAmCfCfA(LNA)UmUfCmAfAmAfCmAfGmGf-GALNAC;
  • Antisense strand CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCfsCm;
  • Sense strand GfsCmsAfUmUfUmCfAmCfCfA(LNA)UmUfCmAfAmAfCmAfGmGf-GALNAC;
  • Antisense strand CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCm;
  • Sense strand GfsCmsAfUmUfUmCfAmCfCfA(LNA)UmUfCmAmAmAmCmAmGmGm-GALNAC;
  • Antisense strand CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCm;
  • Sense strand GmsCmsAmUmUmUmCfAmCfCmA(LNA)UmUmCmAmAmAmCmAmGmGm-GALNAC;
  • Antisense strand CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCm;
  • Sense strand GmsCmsAmUmUmUmCfAmCfCmA(LNA)UmUmCmAmAmAmCmAmGmGm-GALNAC;
  • Antisense strand CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmGmCmsCmsCm;
  • Sense strand GmsCmsAmUmUmUmCfAmCfCmA(d)UmUmCmAmAmAmCmAmGmGm-GALNAC;
  • Antisense strand CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmGmCmsCmsCm;
  • Sense strand GfsCfsAfUUUCACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUUGAAUGGUGAAAUGCfsCfsCf;
  • Sense strand CHO-GfsCfsAfUUUCACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUUGAAUGGUGAAAUGCfsCfsCf;
  • Sense strand GfsCfsAfUUUC(LNA)ACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUUGAAUGGUGAAAUGCfsCfsCf;
  • Sense strand GfsCfsAfUUUCACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUU(LNA)GAAUGGUGAAAUGCfsCfsCf;
  • Sense strand GmsCmsAmUUUCACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUUGAAUGGUGAAAUGCmsCmsCm;
  • Sense strand CHO-GmsCmsAmUUUCACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUUGAAUGGUGAAAUGCmsCmsCm;
  • Sense strand GmsCmsAmUUUC(LNA)ACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUUGAAUGGUGAAAUGCmsCmsCm;
  • Sense strand GmsCmsAmUUUCACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUU(LNA)GAAUGGUGAAAUGCmsCmsCm;
  • Sense strand CfsCmsGfAmUfGmUfCmCfGfUfGmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCfsAm;
  • Sense strand CfsCmsGfAmUfGmUfCmCfGfUfGmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCmsAm;
  • Sense strand CfsCmsGfAmUfGmUfCmCfGfUfGmGfGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;
  • Sense strand CmsCmsGmAmUmGmUfCmCfGmUmGmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;
  • Sense strand CmsCmsGmAmUmGmUfCmCfGmUmGmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmGmGmsCmsAm;
  • Sense strand CfsCmsGfAmUfGmUfCmCfGfU(LNA)GmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCfsAm;
  • Sense strand CfsCmsGfAmUfGmUfCmCfGfU(LNA)GmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCmsAm;
  • Sense strand CfsCmsGfAmUfGmUfCmCfGfU(LNA)GmGfGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;
  • Sense strand CmsCmsGmAmUmGmUfCmCfGmU(LNA)GmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;
  • Sense strand CmsCmsGmAmUmGmUfCmCfGmU(LNA)GmGmGmCmAmGmAmamUmGm-GALNAC; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmGmGmsCmsAm;
  • Sense strand CmsCmsGmAmUmGmUfCmCfGmU(d)GmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmGmGmsCmsAm;
  • Sense strand CfsCfsGfAUGUCCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUGCCCACGGACAUCGGfsCfsAf;
  • Sense strand CHO-CfsCfsGfAUGUCCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUGCCCACGGACAUCGGfsCfsAf;
  • Sense strand CfsCfsGfAUGU(LNA)CCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUGCCCACGGACAUCGGfsCfsAf;
  • Sense strand CfsCfsGfAUGUCCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUG(LNA)CCCACGGACAUCGGfsCfsAf;
  • Sense strand CmsCmsGmAUGUCCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUGCCCACGGACAUCGGmsCmsAm;
  • Sense strand CHO-CmsCmsGmAUGUCCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUGCCCACGGACAUCGGmsCmsAm;
  • Sense strand CmsCmsGmAUGU(LNA)CCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUGCCCACGGACAUCGGmsCmsAm;
  • Sense strand CmsCmsGmAUGUCCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUG(LNA)CCCACGGACAUCGGmsCmsAm;
  • Sense strand AfsAmsUfGmAfCmUfUmUfUfAfUmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCfsUm;
  • Sense strand AfsAmsUfGmAfCmUfUmUfUfAfUmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCmsUm;
  • Sense strand AfsAmsUfGmAfCmUfUmUfUfAfUmUfGmAmGmCmUmCmUmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;
  • Sense strand AmsAmsUmGmAmCmUfUmUfUmAmUmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;
  • Sense strand AmsAmsUmGmAmCmUfUmUfUmAmUmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmUmUmsCmsUm;
  • Sense strand AfsAmsUfGmAfCmUfUmUfUfA(LNA)UmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCfsUm;
  • Sense strand AfsAmsUfGmAfCmUfUmUfUfA(LNA)UmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCmsUm;
  • Sense strand AfsAmsUfGmAfCmUfUmUfUfA(LNA)UmUfGmAmGmCmUmCmUmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;
  • Sense strand AmsAmsUmGmAmCmUfUmUfUmA(LNA)UmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;
  • Sense strand AmsAmsUmGmAmCmUfUmUfUmA(LNA)UmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmUmUmsCmsUm;
  • Sense strand AmsAmsUmGmAmCmUfUmUfUmA(d)UmUmGmAmGmCmUmCmUmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmUmUmsCmsUm;
  • Sense strand AfsAfsUfGACUUUUAUUGAGCUCfsUfsUf-GALNAC; Antisense strand: AfsAfsGfAGCUCAAUAAAAGUCAUUfsCfsUf;
  • Sense strand CHO-AfsAfsUfGACUUUUAUUGAGCUCfsUfsUf-GALNAC; Antisense strand: AfsAfsGfAGCUCAAUAAAAGUCAUUfsCfsUf;
  • Sense strand AfsAfsUfGACU(LNA)UUUAUUGAGCUCfsUfsUf-GALNAC; Antisense strand: AfsAfsGfAGCUCAAUAAAAGUCAUUfsCfsUf;
  • Sense strand AfsAfsUfGACUUUUAUUGAGCUCfsUfsUf-GALNAC;
  • Antisense strand AfsAfsGfAGCU(LNA)CAAUAAAAGUCAUUfsCfsUf;
  • Sense strand AmsAmsUmGACUUUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCUCAAUAAAAGUCAUUmsCmsUm;
  • Sense strand CHO-AmsAmsUmGACUUUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCUCAAUAAAAGUCAUUmsCmsUm;
  • Sense strand AmsAmsUmGACU(LNA)UUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCUCAAUAAAAGUCAUUmsCmsUm;
  • Sense strand AmsAmsUmGACUUUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCU(LNA)CAAUAAAAGUCAUUmsCmsUm;
  • Sense strand CfsCmsUfGmGfCmGfGmAfGfAfUmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAfsGm;
  • Sense strand CfsCmsUfGmGfCmGfGmAfGfAfUmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAmsGm;
  • Sense strand CfsCmsUfGmGfCmGfGmAfGfAfUmGfCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;
  • Sense strand CmsCmsUmGmGmCmGfGmAfGmAmUmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;
  • Sense strand CmsCmsUmGmGmCmGfGmAfGmAmUmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmGmGmsAmsGm;
  • Sense strand CfsCmsUfGmGfCmGfGmAfGfA(LNA)UmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAfsGm;
  • Sense strand CfsCmsUfGmGfCmGfGmAfGfA(LNA)UmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAmsGm;
  • Sense strand CfsCmsUfGmGfCmGfGmAfGfA(LNA)UmGfCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;
  • Sense strand CmsCmsUmGmGmCmGfGmAfGmA(LNA)UmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;
  • Sense strand CmsCmsUmGmGmCmGfGmAfGmA(LNA)UmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmGmGmsAmsGm;
  • Sense strand CmsCmsUmGmGmCmGfGmAfGmA(d) UmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmGmGmsAmsGm;
  • Sense strand CfsCfsUfGGCGGAGAUGCUUCUAfsAfsGf-GALNAC; Antisense strand: CfsUfsUfAGAAGCAUCUCCGCCAGGfsAfsGf;
  • Sense strand CHO-CfsCfsUfGGCGGAGAUGCUUCUAfsAfsGf-GALNAC; Antisense strand: CfsUfsUfAGAAGCAUCUCCGCCAGGfsAfsGf;
  • Sense strand CfsCfsUfGGCG(LNA)GAGAUGCUUCUAfsAfsGf-GALNAC; Antisense strand: CfsUfsUfAGAAGCAUCUCCGCCAGGfsAfsGf;
  • Sense strand CfsCfsUfGGCGGAGAUGCUUCUAfsAfsGf-GALNAC;
  • Antisense strand CfsUfsUfAGAA(LNA)GCAUCUCCGCCAGGfsAfsGf;
  • Sense strand CmsCmsUmGGCGGAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAAGCAUCUCCGCCAGGmsAmsGm;
  • Sense strand CHO-CmsCmsUmGGCGGAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAAGCAUCUCCGCCAGGmsAmsGm;
  • Sense strand CmsCmsUmGGCG(LNA)GAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAAGCAUCUCCGCCAGGmsAmsGm;
  • Sense strand CmsCmsUmGGCGGAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAA(LNA)GCAUCUCCGCCAGGmsAmsGm;
  • Sense strand UfsCmsCfUmUfGmCfCmUfGfGfAmAfCmUfCmAfCmUfCmAf-GALNAC; Antisense strand: UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCfsUm;
  • Sense strand UfsCmsCfUmUfGmCfCmUfGfGfAmAfCmUfCmAfCmUfCmAf-GALNAC; Antisense strand: UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCmsUm;
  • Sense strand UfsCmsCfUmUfGmCfCmUfGfGfAmAfCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;
  • Sense strand UmsCmsCmUmUmGmCfCmUfGmGmAmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;
  • Sense strand UmsCmsCmUmUmGmCfCmUfGmGmAmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmGmAmsCmsUm;
  • Sense strand UfsCmsCfUmUfGmCfCmUfGfG(LNA)AmAfCmUfCmAfCmUfCmAf-GALNAC;
  • Antisense strand UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCfsUm;
  • Sense strand UfsCmsCfUmUfGmCfCmUfGfG(LNA)AmAfCmUfCmAfCmUfCmAf-GALNAC;
  • Antisense strand UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCmsUm;
  • Sense strand UfsCmsCfUmUfGmCfCmUfGfG(LNA)AmAfCmUmCmAmCmUmCmAm-GALNAC;
  • Antisense strand UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;
  • Sense strand UmsCmsCmUmUmGmCfCmUfGmG(LNA)AmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;
  • Sense strand UmsCmsCmUmUmGmCfCmUfGmG(LNA)AmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmGmAmsCmsUm;
  • Sense strand UmsCmsCmUmUmGmCfCmUfGmG(d)AmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmGmAmsCmsUm;
  • Sense strand UfsCfsCfUUGCCUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGAGUUCCAGGCAAGGAfsCfsUf;
  • Sense strand CHO-UfsCfsCfUUGCCUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGAGUUCCAGGCAAGGAfsCfsUf;
  • Sense strand UfsCfsCfUUGC(LNA)CUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGAGUUCCAGGCAAGGAfsCfsUf;
  • Sense strand UfsCfsCfUUGCCUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGA(LNA)GUUCCAGGCAAGGAfsCfsUf;
  • Sense strand UmsCmsCmUUGCCUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGAGUUCCAGGCAAGGAmsCmsUm;
  • Sense strand CHO-UmsCmsCmUUGCCUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGAGUUCCAGGCAAGGAmsCmsUm;
  • Sense strand UmsCmsCmUUGC(LNA)CUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGAGUUCCAGGCAAGGAmsCmsUm;
  • Sense strand UmsCmsCmUUGCCUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGA(LNA)GUUCCAGGCAAGGAmsCmsUm;
  • Sense strand CfsCmsUfUmGfCmCfUmGfGfAfAmCfUmCfAmCfUmCfAmCf-GALNAC;
  • Antisense strand GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAfsGm;
  • Sense strand CfsCmsUfUmGfCmCfUmGfGfAfAmCfUmCfAmCfUmCfAmCf-GALNAC; Antisense strand: GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAmsGm;
  • Sense strand CfsCmsUfUmGfCmCfUmGfGfAfAmCfUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;
  • Sense strand CmsCmsUmUmGmCmCfUmGfGmAmAmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;
  • Sense strand CmsCmsUmUmGmCmCfUmGfGmAmAmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmGmGmsAmsGm;
  • Sense strand CfsCmsUfUmGfCmCfUmGfGfA(LNA)AmCfUmCfAmCfUmCfAmCf-GALNAC;
  • Antisense strand GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAfsGm;
  • Sense strand CfsCmsUfUmGfCmCfUmGfGfA(LNA)AmCfUmCfAmCfUmCfAmCf-GALNAC;
  • Antisense strand GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAmsGm;
  • Sense strand CfsCmsUfUmGfCmCfUmGfGfA(LNA)AmCfUmCmAmCmUmCmAmCm-GALNAC;
  • Antisense strand GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;
  • Sense strand CmsCmsUmUmGmCmCfUmGfGmA(LNA)AmCmUmCmAmCmUmCmAmCm-GALNAC;
  • Antisense strand GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;
  • Sense strand CmsCmsUmUmGmCmCfUmGfGmA(LNA)AmCmUmCmAmCmUmCmAmCm-GALNAC;
  • Antisense strand GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmGmGmsAmsGm;
  • Sense strand CmsCmsUmUmGmCmCfUmGfGmA(d) AmCmUmCmAmCmUmCmAmCm-GALNAC;
  • Antisense strand GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmGmGmsAmsGm;
  • Sense strand CfsCfsUfUGCCUGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUGAGUUCCAGGCAAGGfsAfsGf;
  • Sense strand CHO-CfsCfsUfUGCCUGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUGAGUUCCAGGCAAGGfsAfsGf;
  • Sense strand CfsCfsUfUGCC(LNA)UGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUGAGUUCCAGGCAAGGfsAfsGf;
  • Sense strand CfsCfsUfUGCCUGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUG(LNA)AGUUCCAGGCAAGGfsAfsGf;
  • Sense strand CmsCmsUmUGCCUGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUGAGUUCCAGGCAAGGmsAmsGm;
  • Sense strand CHO-CmsCmsUmUGCCUGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUGAGUUCCAGGCAAGGmsAmsGm;
  • Sense strand CmsCmsUmUGCC(LNA)UGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUGAGUUCCAGGCAAGGmsAmsGm;
  • Sense strand CmsCmsUmUGCCUGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUG(LNA)AGUUCCAGGCAAGGmsAmsGm;
  • Sense strand UfsGmsCfCmUfGmGfAmAfCfUfCmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAfsGm;
  • Sense strand UfsGmsCfCmUfGmGfAmAfCfUfCmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAmsGm;
  • Sense strand UfsGmsCfCmUfGmGfAmAfCfUfCmAfCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsAmsGm;
  • Sense strand UmsGmsCmCmUmGmGfAmAfCmUmCmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsGm;
  • Sense strand UmsGmsCmCmUmGmGfAmAfCmUmCmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmCmAmsAmsGm;
  • Sense strand UfsGmsCfCmUfGmGfAmAfCfU(LNA)CmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAfsGm;
  • Sense strand UfsGmsCfCmUfGmGfAmAfCfU(LNA)CmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAmsGm;
  • Sense strand UfsGmsCfCmUfGmGfAmAfCfU(LNA)CmAfCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsAmsGm;
  • Sense strand UmsGmsCmCmUmGmGfAmAfCmU(LNA)CmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsGm;
  • Sense strand UmsGmsCmCmUmGmGfAmAfCmU(LNA)CmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmCmAmsAmsGm;
  • Sense strand UmsGmsCmCmUmGmGfAmAfCmU(d)CmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmCmAmsAmsGm;
  • Sense strand UfsGfsCfCUGGAACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGAGUGAGUUCCAGGCAfsAfsGf;
  • Sense strand CHO-UfsGfsCfCUGGAACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGAGUGAGUUCCAGGCAfsAfsGf;
  • Sense strand UfsGfsCfCUGG(LNA)AACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGAGUGAGUUCCAGGCAfsAfsGf;
  • Sense strand UfsGfsCfCUGGAACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGA(LNA)GUGAGUUCCAGGCAfsAfsGf;
  • Sense strand UmsGmsCmCUGGAACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGAGUGAGUUCCAGGCAmsAmsGm;
  • Sense strand CHO-UmsGmsCmCUGGAACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGAGUGAGUUCCAGGCAmsAmsGm;
  • Sense strand UmsGmsCmCUGG(LNA)AACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGAGUGAGUUCCAGGCAmsAmsGm;
  • Sense strand UmsGmsCmCUGGAACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGA(LNA)GUGAGUUCCAGGCAmsAmsGm;
  • Sense strand UfsUmsCfAmCfCmAfUmUfCfAfAfCmAfGmGfUmCfGmAf-GALNAC; Antisense strand: UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAfsUm;
  • Sense strand UfsUmsCfAmCfCmAfUmUfCfAfAfAfCmAfGmGfUmCfGmAf-GALNAC; Antisense strand: UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAmsUm;
  • Sense strand UfsUmsCfAmCfCmAfUmUfCfAfAmAfCmAmGmGmUmCmGmAm-GALNAC;
  • Antisense strand UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;
  • Sense strand UmsUmsCmAmCmCmAfUmUfCmAmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;
  • Sense strand UmsUmsCmAmCmCmAfUmUfCmAmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmAmAmsAmsUm;
  • Sense strand UfsUmsCfAmCfCmAfUmUfCfA(LNA)AmAfCmAfGmGfUmCfGmAf-GALNAC;
  • Antisense strand UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAfsUm;
  • Sense strand UfsUmsCfAmCfCmAfUmUfCfA(LNA)AmAfCmAfGmGfUmCfGmAf-GALNAC;
  • Antisense strand UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAmsUm;
  • Sense strand UfsUmsCfAmCfCmAfUmUfCfA(LNA)AmAfCmAmGmGmUmCmGmAm-GALNAC;
  • Antisense strand UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;
  • Sense strand UmsUmsCmAmCmCmAfUmUfCmA(LNA)AmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;
  • Sense strand UmsUmsCmAmCmCmAfUmUfCmA(LNA)AmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmAmAmsAmsUm;
  • Sense strand UmsUmsCmAmCmCmAfUmUfCmA(d)AmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmAmAmsAmsUm;
  • Sense strand UfsUfsCfACCAUUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCUGUUUGAAUGGUGAAfsAfsUf;
  • Sense strand CHO-UfsUfsCfACCAUUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCUGUUUGAAUGGUGAAfsAfsUf;
  • Sense strand UfsUfsCfACCA(LNA)UUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCUGUUUGAAUGGUGAAfsAfsUf;
  • Sense strand UfsUfsCfACCAUUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCU(LNA)GUUUGAAUGGUGAAfsAfsUf;
  • Sense strand UmsUmsCmACCAUUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCUGUUUGAAUGGUGAAmsAmsUm;
  • Sense strand CHO-UmsUmsCmACCAUUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCUGUUUGAAUGGUGAAmsAmsUm;
  • Sense strand UmsUmsCmACCA(LNA)UUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCUGUUUGAAUGGUGAAmsAmsUm;
  • Sense strand UmsUmsCmACCAUUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCU(LNA)GUUUGAAUGGUGAAmsAmsUm;
  • Sense strand CfsCmsCfGmUfGmCfGmCfAfGfGmAfGmGfAmCfGmAfGmGf-GALNAC;
  • Antisense strand CmsCfsUmCfGmUfCmCfUmCfCmUmGmCfGmCfAmCfGmGfGmsCmsGm;
  • Sense strand CfsCmsCfGmCfCmGfGmGfGfAfUmAfCmCfUmCfAmCfCmAf-GALNAC;
  • Antisense strand UmsGfsGmUfGmAfGmGfUmAfUmCmCmCfCmGfGmCfGmGfGmsCmsAm;
  • Sense strand GfsGmsGfGmAfUmAfCmCfUfCfAmCfCmAfAmGfAmUfCmCf-GALNAC;
  • Antisense strand GmsGfsAmUfCmUfUmGfGmUfGmAmGmGfUmAfUmCfCmCfCmsGmsGm;
  • Sense strand GfsGmsGfAmUfAmCfCmUfCfAfCmCfAmAfGmAfUmCfCmUf-GALNAC;
  • Antisense strand AmsGfsGmAfUmCfUmUfGmGfUmGmAmGfGmUfAmUfCmCfCmsCmsGm;
  • Sense strand AfsCmsCfAmAfGmAfUmCfCfUfGmCfAmUfGmUfCmUfUmCf-GALNAC; Antisense strand: GmsAfsAmGfAmCfAmUfGmCfAmGmGmAfUmCfUmUfGmGfUmsGmsAm;
  • Sense strand GfsAmsAfGmUfUmGfCmCfCfCfAmUfGmUfCmGfAmCfUmAf-GALNAC;
  • Antisense strand UmsAfsGmUfCmGfAmCfAmUfGmGmGmGfCmAfAmCfUmUfCmsAmsAm;
  • Sense strand CfsCmsCfAmUfGmUfCmGfAfCfUmAfCmAfUmCfGmAfGmGf-GALNAC; Antisense strand: CmsCfsUmCfGmAfUmGfUmAfGmUmCmGfAmCfAmUfGmGfGmsGmsCm;
  • Sense strand AfsCmsCfGmGfGmCfGmGfAfUfGmAfAmUfAmCfCmAfGmCf-GALNAC; Antisense strand: GmsCfsUmGfGmUfAmUfUmCfAmUmCmCfGmCfCmCfGmGfUmsAmsCm;
  • Sense strand GfsAmsCfCmAfAmCfUmUfUfGfGmCfCmGfCmUfGmUfGmUfGmUf-GALNAC; Antisense strand: AmsCfsAmCfAmGfCmGfGmCfCmAmAmAfGmUfUmGfGmUfCmsCm;
  • Sense strand CfsCmsAfAmCfUmUfUmGfGfCfCmGfCmUfGmUfGmUfGmUfGmGf-GALNAC; Antisense strand: CmsCfsAmCfAmCfAmGfCmGfGmCmAfAmAfGmUfUmGfGmsUmsCm;
  • Sense strand GfsCmsCfGmCfUmGfUmGfUfGfGmAfCmCfUmCfUmUfUmGf-GALNAC; Antisense strand: CmsAfsAmAfGmAfGmGfUmCfCmAmCmAfCmAfGmCfGmGfCmsCmsAm;
  • Sense strand CfsGmsCfUmGfUmGfUmGfUmGfGfAfCmCfUmCfUmUfUmGfCmCf-GALNAC; Antisense strand: GmsGfsCmAfAmAfGmAfGmGfUmCmCmAfCmAfGmCfGmsGmsCm;
  • Sense strand CfsAmsCfAmAfCmGfCmUfUfUfUmGfGmGfGmGfUmGfAmGf-GALNAC; Antisense strand: CmsUfsCmAfCmCfCmCfCmAfAmAmAmGfCmGfUmUfGmUfGmsGm;
  • Sense strand AfsCmsAfAmCfGmCfUmUfUfUfGmGfGmGfGmUfGmAfGmGf-GALNAC; Antisense strand: CmsCfsUmCfAmCfCmCfCmCfAmAmAmAfGmCfGmUfUmGfUmsGmsGm;
  • Sense strand CfsAmsAfCmGfCmUfUmUfUfGfGmGfGmGfUmGfAmGfGmGf-GALNAC; Antisense strand: CmsCfsCmUfCmAfCmCfCmCfCmAmAmAfAmGfCmGfUmUfGmsUmsGm;
  • Sense strand GfsUmsGfAmGfGmGfUmGfUfCfUmAfCmGfCmCfAmUfUmGf-GALNAC; Antisense strand: CmsAfsAmUfGmGfCmGfUmAfGmAmCmAfCmCfCmUfCmAfCmsCmsCm;
  • Sense strand UfsGmsAfGmGfGmUfGmUfCfUfAmCfGmCfCmAfUmUfGmCf-GALNAC; Antisense strand: GmsCfsAmAfUmGfGmCfGmUfAmGmAmCfAmCfCmCfUmCfAmsCmsCm;
  • Sense strand GfsGmsGfUmGfUmCfUmAfCfGfCmCfAmUfUmGfCmCfAmGf-GALNAC; Antisense strand: CmsUfsGmGfCmAfAmUfGmGfCmGmUmAfGmAfCmAfCmCfCfCmsUm;
  • Sense strand GfsGmsUfGmUfCmUfAmCfGfCfCmAfUmUfGmCfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfGmCfAmAfUmGfGmCmGmUfAmGfAmCfAmCfCmsCmsUm;
  • Sense strand GfsUmsGfUmCfUmAfCmGfCfCfAmUfUmGfCmCfAmGfGmUf-GALNAC;
  • Antisense strand AmsCfsCmUfGmGfCmAfAmUfGmGmCmGfUmAfGmAfCmAfCmsCmsCm;
  • Sense strand UfsGmsUfCmUfAmCfGmCfCfAfUmUfGmCfCmAfGmGfUmGf-GALNAC; Antisense strand: CmsAfsCmCfUmGfGmCfAmAfUmGmGmCfGmUfAmGfAmCfAmsCmsCm;
  • Sense strand CfsUmsAfCmGfCmCfAmUfUfGfCmCfAmGfGmUfGmCfUmGf-GALNAC; Antisense strand: CmsAfsGmCfAmCfCmUfGmGfCmAmAmUfGmGfCmGfUmAfGmsAmsCm;
  • Sense strand UfsAmsCfGmCfCmAfUmUfGfCfCmAfGmGfUmGfCmUfGmCf-GALNAC; Antisense strand: GmsCfsAmGfCmAfCmCfUmGfGmCmAmAfUmGfGmCfGmUfAmsGmsAm;
  • Sense strand CfsCmsUfUmGfGmCfAmCfCfCfAmCfAmAfGmCfCmGfCmCf-GALNAC;
  • Antisense strand GmsGfsCmGfGmCfUmUfGmUfGmGmGmGmUfGmCfCmAfAmGfGmsUmsCm;
  • Sense strand CfsAmsCfCmCfAmCfAmAfGfCfCmGfCmCfUmGfUmGfCmUf-GALNAC; Antisense strand: AmsGfsCmAfCmAfGmGfCmGfGmCmUmUfGmUfGmGfGmUfGmsCmsCm;
  • Sense strand CfsCmsCfAmCfAmAfGmCfCfGfCmCfUmGfUmGfCmUfGmAf-GALNAC; Antisense strand: UmsCfsAmGfCmAfCmAfGmGfCmGmGmCfUmUfGmUfGmGfGmsUmsGm;
  • Sense strand CfsCmsAfCmAfAmGfCmCfGfCfCmUfGmUfGmUfGmCfUmGfAmGf-GALNAC; Antisense strand: CmsUfsCmAfGmCfAmCfAmGfGmCmGmGfCmUfUmGfUmGfGmsGmsUm;
  • Sense strand CfsCmsAfCmGfAmGfGmUfCfAfGmCfCmCfAmAfCmCfAmGf-GALNAC; Antisense strand: CmsUfsGmGfUmUfGmGfGmCfUmGmAmCfCmUfCmGfUmGfGmsCm;
  • Sense strand CfsAmsCfGmAfGmGfUmCfAfGfCmCfCmAfAmCfCmAfGmUf-GALNAC;
  • Antisense strand AmsCfsUmGfGmUfUmGfGmGfCmUmGmAfCmCfUmCfGmUfGmsGmsCm;
  • Sense strand GfsUmsCfAmGfGmAfGmCfCfGfGmGfAmCfGmUfCmAfGmCf-GALNAC;
  • Antisense strand GmsCfsUmGfAmCfGmUfCmCfCmGmGmCfUmCfCmUfGmAfCmsUmsAm;
  • Sense strand CfsUmsGfGmGfGmCfUmGfAfGfCmUfUmUfAmAfAmAfUmGf-GALNAC;
  • Antisense strand CmsAfsUmUfUmUfAmAfAmGfCmUmCmAfGmCfCmCfCmAfGmsCmsCm;
  • Sense strand GfsGmsGfCmUfGmAfGmCfUfUmAfAmAfAmUfGmGfUmUf-GALNAC; Antisense strand: AmsAfsCmCfAmUfUmUfUmAfAmAmGmCfUmCfAmGfCmCfCmsCmsAm;
  • Sense strand GfsCmsUfGmAfGmCfUmUfUfAfAmAfAmUfGmGfUmUfCmCf-GALNAC;
  • Antisense strand GmsGfsAmAfCmCfAmUfUmUfUmAmAmAfGmCfUmCfAmGfCmsCm;
  • Sense strand CfsCmsUfGmGfCmCfCmUfUfGfAmGfUmGfGmGfGmCfAmGf-GALNAC; Antisense strand: CmsUfsGmCfCmCfCmAfCmUfCmAmAmGfGmGfCmCfAmGfGmsCmsCm;
  • Sense strand GfsGmsAfGmGfUmGfCmCfAfGfGmAfAmGfCmUfCmCfCmUf-GALNAC; Antisense strand: AmsGfsGmGfAmGfCmUfUmCfCmUmGmGfCmAfCmCfUmCfCmsAmsCm;
  • Sense strand GfsAmsGfGmUfGmCfCmAfGfGfAmAfGmCfUmCfCmCfUmCf-GALNAC; Antisense strand: GmsAfsGmGfGmAfGmCfUmUfCmCmUmGfGmCfAmCfCmUfCmsCmsAm;
  • Sense strand CfsUmsCfAmCfUmGfUmGfGfGfGmCfAmUfUmUfCmAfCmCf-GALNAC; Antisense strand: GmsGfsUmGfAmAfAmUfGmCfCmCmAfCmAfGmUfGmAfGmsGmsGm;
  • Sense strand UfsGmsUfGmGfGmGfCmAfUfUfUmCfAmCfCmAfUmUfCmAf-GALNAC; Antisense strand: UmsGfsAmAfUmGfGmUfGmAfAmAmUmGfCmCfCmCfAmCfAmsGmsUm;
  • Sense strand GfsCmsAfUmCfUmAfGmCfCfAfGmAfGmGfCmUfGmGfAmGf-GALNAC; Antisense strand: CmsUfsCmCfAmGfCmCfUmCfUmGmGmCfUmAfGmAfUmGfCmsCmsAm;
  • Sense strand UfsUmsUfUmGfUmAfAmCfUfUfGmAfAmGfAmUfAmUfUmUf-GALNAC; antisense strand: AmsAfsAmUfAmUfCmUfUmCfAmAmGmUfUmAfCmAfAmAfAmsGmsCm.
  • A, C, G, U to the left of m represent the pentose group in the nucleotide residue is 2'-methoxyribosyl
  • Af, Cf, Gf, Uf represent the pentose group in the nucleotide residue
  • the group is a 2'-fluorine modified ribose group
  • s represents that the phosphate group between the ribonucleotide residues on its left and right sides is a phosphorothioate group.
  • LNA locked nucleic acid modification
  • (d) represents deoxyribonucleotide
  • CHO represents cholesterol
  • GALNAC represents GalNAc ligand (GalNAc3 shown in formula I)
  • the schematic diagram of conjugation to the 3' end of the sense strand of siRNA is shown in the formula As shown in II, X is O or S.
  • the siRNA provided by the present invention can inhibit the expression of PCSK9 gene in human, monkey, rat or mouse.
  • the present invention claims DNA molecules capable of producing the siRNAs described above.
  • the present invention claims a vector capable of expressing the aforementioned siRNA.
  • the present invention claims a reagent or kit.
  • the reagent or kit claimed in the present invention contains the aforementioned siRNA or the aforementioned DNA molecule or the aforementioned vector.
  • the present invention claims a pharmaceutical composition.
  • the pharmaceutical composition claimed in the present invention consists of the aforementioned siRNA molecules and other pharmaceutically acceptable components or pharmaceutically acceptable carriers.
  • the pharmaceutically acceptable other components include but are not limited to water, saline, pH buffer, protective agent, osmotic pressure regulator, excipient, diluent, disintegrant, binding agent, lubricant, sweetener flavors, preservatives or combinations thereof.
  • the pH buffer can be tris buffer at pH 7.5-8.5 and/or phosphate buffer at pH 5.5-8.5, preferably phosphate buffer at pH 5.5-8.5 liquid.
  • the protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose and glucose.
  • the pharmaceutically acceptable carrier includes but is not limited to magnetic nanoparticles (such as Fe 3 O 4 , Fe 2 O 3 ), carbon nanotubes, mesoporous silicon, calcium phosphate nanometers Calcium phosphate nanoparticles, polyethyleneimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine, PLL), chitosan Sugar (chitosan), 1,2-dioleoyl-3-trimethylammonium-propane (1,2-dioleoyl-3-trimethylammonium-propane, DOTAP), poly (D&L) -lactic/glycolic acid) copolymer, PLGA), poly(2-aminoethyl ethylene phosphate) (poly(2-aminoethyl ethylene phosphate), PPEEA) and poly(N,N-dimethylaminoethyl methacrylate) (poly(2-dimethylaminoethyl me
  • the dosage form of the pharmaceutical composition can be a liquid preparation (eg injection) or a lyophilized powder for injection.
  • the freeze-dried powder for injection is mixed with liquid auxiliary materials during administration to prepare a liquid preparation.
  • the liquid preparation can be used for, but not limited to, subcutaneous, intramuscular or intravenous administration, and can also be administered to the lungs by spraying, or to other organ tissues (such as liver) by spraying through the lungs.
  • the present invention claims that the aforementioned siRNA or the aforementioned DNA molecule or the aforementioned vector or the aforementioned reagent or kit or the aforementioned pharmaceutical composition inhibits PCSK9 gene expression, or Use in the preparation of products for inhibiting PCSK9 gene expression.
  • the present invention also provides a method for inhibiting or reducing the expression level of PCSK9 gene in vivo or in vitro, comprising introducing the siRNA, DNA molecule, vector, reagent, or pharmaceutical composition of the present invention into cells, so that the expression level of PCSK9 gene is inhibited or Reduced by at least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, at least 5%.
  • the term "introduced” refers to facilitating uptake or absorption into a cell, which can occur through unassisted diffusion or active cellular processes, or through auxiliary reagents or devices.
  • siRNA can be injected into target tissues or administered systemically. Introduction into cells in vitro can be accomplished by methods known in the art, such as electroporation.
  • the cells are preferably mammalian cells expressing PCSK9, eg primate cells, such as human cells.
  • PCSK9 eg primate cells, such as human cells.
  • the PCSK9 gene is expressed at a high level in the target cells.
  • the cells are derived from the brain, salivary glands, heart, spleen, lung, liver, gut or tumor. More preferably, the cells are liver cancer cells or cervical cancer cells. Still more preferably, the cells are selected from Hela cells or HEP3B cells or HepG2 cells or 293T cells.
  • the working concentration of siRNA molecules is 0.1-1000 nM, preferably 0.1-50 nM or 10-50 mM.
  • Detection of target gene, target RNA or target protein levels can be used to predict or assess the activity, efficacy or therapeutic outcome of siRNA. Detection of target gene, target RNA or target protein levels can be performed using methods known in the art.
  • the present invention claims that the aforementioned siRNA or the aforementioned DNA molecule or the aforementioned carrier or the aforementioned reagent or kit or the aforementioned pharmaceutical composition reduces low-density lipids in serum. protein and/or low density lipoprotein cholesterol concentration, or use in the preparation of a product for lowering serum low density lipoprotein and/or low density lipoprotein cholesterol concentration.
  • the present invention claims that the aforementioned siRNA or the aforementioned DNA molecule or the aforementioned carrier or the aforementioned reagent or kit or the aforementioned pharmaceutical composition is used in the prevention and/or treatment of PCSK9 gene-mediated diseases, or use in the preparation of products for the prevention and/or treatment of PCSK9 gene-mediated diseases;
  • the present invention claims to protect the aforementioned siRNA or the aforementioned DNA molecule or the aforementioned vector or the aforementioned reagent or kit or the aforementioned pharmaceutical composition in remission mediated by the PCSK9 gene. symptoms of a disease, or use in the preparation of a product for relieving symptoms of a disease mediated by the PCSK9 gene.
  • the disease mediated by the PCSK9 gene can be caused by overexpression of the PCSK9 gene, overproduction of the PCSK9 protein, and can be modulated by down-regulating the expression of the PCSK9 gene.
  • treatment refers to the alleviation, alleviation or cure of PCSK9 gene-mediated disease or symptoms, such as reduction in blood lipid levels, including reduction in serum L, LDLC levels.
  • the level or concentration of serum LD, serum LDL-C is reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70% %, 80%, or 90%.
  • the diseases mediated by the PCSK9 gene include, but are not limited to, cardiovascular diseases or neoplastic diseases.
  • the cardiovascular disease such as mammalian hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia or heterozygous familial hypercholesterolemia; such neoplastic diseases as melanoma or metastatic liver cancer associated with PCSK9.
  • the present invention provides an in vivo method comprising alleviating or treating a disease or condition mediated by a PCSK gene in a subject, the disease or condition comprising cardiovascular disease, dyslipidemia; cardiovascular disease Atherosclerotic cardiovascular disease may be included, while dyslipidemia may include elevated serum cholesterol and/or triglyceride levels, elevated low-density lipoprotein cholesterol, or elevated apolipoprotein B (ApOB).
  • the disease or symptom is preferably hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or Heterozygous familial hypercholesterolemia.
  • the subject may be a mammal, preferably a human.
  • the method may comprise administering to the subject an effective amount, eg, a prophylactically effective amount or a therapeutically effective amount of the siRNA.
  • the present invention also provides a method of combination therapy comprising co-administration of one or more siRNAs of the present invention or a pharmaceutical composition comprising the same with one or more other therapeutic agents or in combination with other therapeutic methods.
  • Other therapeutic agents may include agents known to prevent, alleviate or treat lipid disorders such as hypercholesterolemia, atherosclerosis or dyslipidemia, eg cholesterol absorption inhibitors, lipid lowering agents, analgesics, anti-inflammatory agents , antitumor drugs, etc.
  • Other treatments include radiation therapy, immunotherapy, hormone therapy, surgery, etc.
  • Figure 1 is a plasmid map of the psiCHECK-2 vector.
  • Figure 2 shows that the ligand-conjugated siRNA in Example 11 inhibits PCSK9 mRNA levels in Hep3B cells.
  • Example 3 is a graph of the average body weight of the intravenous administration group in Example 12. There were no significant differences between the groups.
  • Figure 4 is the liver drug content curve of the animals in the GR90243.55, GR90243.51, GR90320.93, and GR90320.893 mg/kg s.c groups in Example 14 after administration.
  • Figure 5 shows the detection result of PSCK9 protein content detected by ELISA in step 1 of Example 15.
  • Fig. 6 is the detection result of PSCK9 protein content detected by ELISA in step 2 of Example 15.
  • FIG. 7 shows the LDL-C results of mice in each group in step 3 of Example 15.
  • FIG. 8 is the detection result of PSCK9 protein content in the serum of each group of mice in step 3 of Example 15.
  • the following examples facilitate a better understanding of the present invention, but do not limit the present invention.
  • the experimental methods in the following examples are conventional methods unless otherwise specified.
  • the test materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified.
  • the quantitative tests in the following examples are all set to repeat the experiments at least three times, and the results are averaged.
  • the 293T cell line, the Hep3B cell line, the HepG2 cell line and the Hela cell line used in the following examples were purchased from the Chinese Academy of Sciences Collection Cell Bank.
  • Opti-MEM (Gibco manufacturer), DEPC water, Exfect Transfection Reagent (Vazyme manufacturer), DMEM medium, PBS (Sigma), dual luciferase detection kit, siRNA NC (Negative Control and PCSK9 gene no inhibition negative control) ), siRNA NC-cy3 (siRNA NC linked to cy3), siRNA NC-FAM (siRNA NC linked to FAM), Lipofectamine2000 transfection reagent (Thermo), PCSK9Matched ELISA Antibody Pair Set (SinoBiological), ELISA stop solution (Solarbio), Protein lysate (Thermo), TMB substrate system for ELISA (Sigma).
  • Embodiment 1 double luciferase reporter gene plasmid construction
  • the dual-luciferase reporter gene plasmid used in this example is the psiCHECK-2 vector (the sequence of the empty vector is shown in its specification), which was purchased from Promega (Item No.: C8021), and the map information is shown in Figure 1 .
  • the specific construction method is to insert a sequence of PCSK9 gene (NCBI Reference Sequence: NM_174936.3) between the two restriction sites of XhoI and NotI of the psiCHECKTM-2 vector.
  • the length of the inserted sequence is generally between 300-400bp, including PCSK9 gene CDS region and 3'UTR region.
  • the specific insertion information is shown in Table 1.
  • the recombinant plasmids were verified to be correct by sequencing.
  • Plasmid number gene location gene region SEQ ID No. GPT0001 363-752 CDS 1 GPT0002 713-1102 CDS 2 GPT0003 1063-1452 CDS 3 GPT0004 1413-1802 CDS 4 GPT0005 1763-2152 CDS 5 GPT0006 2113-2441 CDS 6 GPT0007 2442-2791 3' UTR region 7 GPT0008 2762-3111 3' UTR region 8 GPT0009 3082-3431 3' UTR region 9 GPT0010 3392-3731 3' UTR region 10
  • the PCSK9 gene (NCBI Reference Sequence: NM_174936.3) was selected as the template to select a nucleotide sequence of 21 bp, and a series of small interfering nucleic acids (siRNA) spanning the PCSK9 mRNA sequence were designed and synthesized.
  • siRNA small interfering nucleic acids
  • SEQ ID No. chain of justice SEQ ID No. antisense strand GP90083 11 CCCGUGCAGGAGGACGAGG 176 UCGUCCUCCUGCGCACGGGCG GP90158 12 CCGAAGCACCCGAGCACGGAA 177 CCGUGCUCGGGGUGCUUCGGCC GP90159 13 CGAAGCACCCGAGCACGGAAC 178 UCCGUGCUCGGGUGCUUCGGC GP90165 14 ACCCGAGCACGGAACCACAGC 179 UGUGGUUCCGUGCUCGGGUGC GP90167 15 CCGAGCACGGAACCACAGGCA 180 GCUGUGGUUCCGUGCUCGGGU GP90253 16 GAGACCCACCUCUCGCCAGUCA 181 ACUGCGAGAGGUGGGUCUCCU GP90262 17 CUCUCGCAGUCAGCGCACU 182 UGCGCUCUGACUGCGAGAGGU GP90308 18 CCCGCCGGGGAUACCUCACCA 183 GUGAGGUAUCCCCGGCG
  • GR90050 74 UGAGCUUUAAAAUGGUUCCGA 239 AGUCGGAACCAUUUUAAAGCU GR90056 75 UUAAAAUGGUUCCGACUUGUC 240 GGGACAAGUCGGAACCAUUUU GR90059 76 AAAUGGUUCCGACUUGUCCCU 241 AGAGGGACAAGUCGGAACCAU GR90061 77 AUGGUUCCGACUUGUCCCUCU 242 AGAGAGGGACAAGUCGGAACC GR90064 78 GUUCCGACUUGUCCCUCUCUCUC 243 CUGAGAGAGGGACAAGUCGGA GR90086 79 GCCCUCCCAUGGCCUGGCACGA 244 CCUCGUGCCAGGCCAUGGAGG GR90095 80 GGCCUGGCACGAGGGGAUGGG 245 UCCCCAUCCCCUCGUGCCAGG GR90106 81 AGGGGAUGGGGAUGCUUCCGC 246 AGGCGGAAGCAUCCCCAUCCC GR90108 82 GGGA
  • GR90251 CACCAUUCAAACAGGUCGAGC 274 CAGCUCGACCUGUUUGAAUGG GR90284 110 CUGCCAGCUGCUCCCAAUGUG 275 GGCACAUUGGGAGCAGCUGGC GR90286 111 GCCAGCUGCUCCCAAUGUGCC 276 UCGGCACAUUGGGAGCAGCUG GR90290 112 GCUGCUCCCAAUGUGCCGAUG 277 GACAUCGGCACAUUGGGAGCA GR90291 113 CUGCUCCCAAUGUGCCGAUGU 278 GGACAUCGGCACAUUGGGAGC GR90293 114 GCUCCCAAUGUGCCGAUGUCC 279 ACGGACAUCGGCACAUUGGGA GR90297 115 CCAAUGUGCCGAUGUCCGUGG 280 GCCCACGGACAUCGGCACAUU GR90298 116 CAAUGUGCCCGAUGUCCGUGGG 281 UGCCCACGGACAUCGGCACAU GR90303 117 U
  • GP90315.11 20 GGGAUACCUCACCAAGAUCCU 354 AGGAUCUUGGUGAGGUAUCCCCG GP90325.11 twenty one ACCAAGAUCCUGCAUGUCUUC 355 GAAGACAUGCAGGAUCUUGGUGA GP90405.11 twenty three GAAGUUGCCCCAUGUCGACUA 356 UAGUCGACAUGGGGCAACUUCAA GP90413.11 twenty four CCCAUGUCGACUACAUCGAGG 357 CCUCGAUGAUGUAGUCGACAUGGGGC GP90497.11 25 ACCGGGCGGAUGAAUACCAGC 358 GCUGGUAUUCAUCCGCCCCGGUAC GP91056.11 31 GACCAACUUUGGCCGCUGUGU 359 ACACAGCGGCCAAAGUUGGUCCC GP91058.11 32 CCAACUUUGGCCGCUGUGUGG 360 CCACACAGCGGCCAAAGUUGGUCCC GP91058.11 32 CCAACUUUGGCCGCUGUGUGG 360 CCACACAGC
  • GR90210.11 346 GAGGUGCCAGGAAGCUCCCUC 386 GAGGGAGCUUCCUGGCACCUCCA GR90232.11 347 CUCACUGUGGGGCAUUUCACC 387 GGUGAAAUGCCCCACAGUGAGGG GR90237.11 348 UGUGGGGCAUUUCACCAUUCA 388 UGAAUGGUGAAAUGCCCCACAGU GR90543.11 349 GCAUCUAGCCAGAGGCUGGAG 389 CUCCAGCCUCUGGCUAGAUGCCA GR91177.11 350 UUUUGUAACUUGAAGAUAUUU 390 AAAUAUCUUCAAGUUACAAAAGC
  • Example 3 Detection of the inhibition rate of the siRNA of Example 2 on the expression level of PCSK9 gene in the dual-luciferase reporter plasmid in 293T cells
  • This example is used to detect the inhibition rate of the dual-luciferase reporter plasmid obtained in Example 1 and the siRNA obtained in Example 2 on the expression level of PCSK9 gene in 293T cells by siRNA on the dual-luciferase reporter plasmid.
  • the final concentration of siRNA is 50nM and 10nM.
  • the following is the experimental method for the final concentration of siRNA of 50nM.
  • the method for the final concentration of 10nM is to replace the final concentration of siRNA in the following method with 10nM, and other steps remain unchanged.
  • siRNA RNA oligo
  • N Negative Control
  • siRNA dilution plate 32 ⁇ l of 1.25 pmol/ul siRNA and 68 ⁇ l of opti-MEM per well.
  • the Renilla value/Firefly value of the same complex plate was used to obtain the ratio results, and the average values were taken for data analysis.
  • siRNAs such as GR90168, GR90303, GR90320, GR91024, GR90165, GR90166, GR90169 and GR90247 can very well inhibit the expression of PCSK9 gene at the concentration of 10nM and 50nM.
  • the siRNA sense strand and antisense strand in Example 2 are chemically modified, A, C, G, U on the left of m represent that the pentose group in the nucleotide residue is a 2'-methoxyribose group, Af, Cf, Gf, Uf represent that the pentose group in the nucleotide residue is a 2'-fluorine modified ribose group, and s represents that the phosphate group between the ribonucleotide residues on the left and right sides is a phosphorothioate group .
  • the specific modified siRNA sequences are shown in Table 5.
  • Example 5 Detection of the inhibition rate of the modified siRNA obtained in Example 4 on the expression level of PCSK9 gene in the dual-luciferase reporter plasmid
  • This example is used to detect the inhibition rate of the modified siRNA obtained in Example 4 on the expression level of PCSK9 gene in 293T cells by the siRNA on the dual-luciferase reporter plasmid.
  • the experimental method was the same as that in Example 3, the final concentrations of siRNA were 50 nM and 10 nM, and the detection results were shown in Table 6. It can be seen from the table that the modified siRNA can better inhibit the PCSK9 gene, GR90320.1, GR90247.1, GR90306.1, GR90330.1, GR90293.1, GR90303.1, GR90251.1, GR90297.1, GR90329. 1. GR90046.1, GR90239.1, GR90244.1, GR90246.1 can very well inhibit the expression of PCSK9 gene in 293T cells.
  • Example 6 Detection of the inhibition rate of the siRNA prepared in Example 2 on the expression level of PCSK9 mRNA in Hela cells
  • This example is used to detect the inhibition rate of the siRNA prepared in Example 2 on the expression level of PCSK9 mRNA in Hela cells.
  • HeLa cells cultured in 10 cm dishes were routinely trypsinized after passage for 48 h. Resuspend in complete medium and adjust the cell concentration to 4 ⁇ 10 5 /ml. Then, 100 ⁇ l/well was inoculated in a 96-well plate. The 25 siRNA sequences in Example 2 were selected, and another siRNA NC was used as a control.
  • Transfection conditions siRNA 50nM transfection, ExFect transfection reagent 0.5 ⁇ l/well. After considering the loss, the transfection complex was prepared by diluting the siRNA and ExFect transfection reagent with opti-MEM, and after standing for 5 minutes, the two components were mixed and left standing for about 15 minutes.
  • the 96-well plate plated on the previous day was taken out, 20 ⁇ l/well of the original medium was aspirated and discarded, and 80 ⁇ l of medium remained in each well.
  • 20 ⁇ l/well of the transfection complex is added to the corresponding well.
  • the transfection complex was discarded, 100 ⁇ l of complete medium was added to each well, and the cells were placed in an incubator to continue culturing.
  • the wells transfected with NC-cy3 and NC-FAM were washed with PBS and photographed using a fluorescent inverted microscope.
  • the transfected 96-well plate was taken out, and the medium in the well was aspirated and discarded. After washing once with PBS, 100 ⁇ l/well of PBS was added for subsequent qPCR detection.
  • the expression of PCSK9 mRNA in Hela cells transfected with siRNA was detected by real-time quantitative PCR (qPCR).
  • the specific steps are: using OMEGA EZ 96Total RNA Kit to extract the total RNA of the above Hela cells (Blank, blank control; NC; negative control group) using the 96-well plate for transfection test; II U+One Step qRT-PCR Probe Kit (qPCR kit), according to the instructions, use the RT-PCR one-step double fluorescence quantitative detection system of PCSK9 gene and internal reference ACTB gene to detect the expression of PCSK9 gene in Hela cells and analyze .
  • the specific primers are as follows:
  • H-ACTB-FO-3 5'-TGCCGACAGGATGCAGAAG-3';
  • H-ACTB-RE-3 5'-GCCGATCCACACGGAGTACT-3';
  • H-ACTB-PR-3-FAM 5'-ATCAAGATCATTGCTCCTCCTGAGCGC-3';
  • H-PCSK9V1-FO-1 5'-GATCCTGCATGTCTTCCA-3';
  • H-PCSK9V1-RE-1 5'-GTCCCTCCTCGATGTAGTC-3';
  • H-PCSK9V1-PR1-1-JOE 5'-CCTTCTTCCTGGCTTCCTGGT-3'.
  • PCSK9 mRNA value in the table is the ratio after ACTB expression level is regarded as 1.
  • Example 7 Detection of the inhibition rate of the siRNA prepared in Example 2 on the expression level of PCSK9 protein in Hela cells
  • This example is used to detect the inhibition rate of the siRNA prepared in Example 2 on the expression level of PCSK9 protein in Hela cells.
  • the cell transfection method was the same as that in Example 6, and the expression level of PCSK9 protein in Hela cells transfected with siRNA was detected by enzyme-linked immunosorbent assay (ELISA).
  • ELISA enzyme-linked immunosorbent assay
  • the specific steps are: after culturing the transfected cells for 24 hours, use the PCSK9Matched ELISA Antibody Pair Set kit (SinoBiological Company) to detect the expression of PCSK9 protein.
  • This example was used to detect the expression of PCSK9 mRNA in Hela cells by GP91511, GR91024, GR90165, GR90166, GR90168, GR90169, GR90243, GR90247, GR90303 and GR90320 at 0, 0.001, 0.01, 0.1, 1, 10, 100 nM concentrations level of inhibition.
  • Cell transfection and qPCR detection methods were the same as those in Example 6, and the calculated IC50s were shown in Table 9. It can be seen from the table that GP91511, GR90165, GR90168, GR90169, GR90320 and GR90243 can well inhibit the expression of PCSK9 mRNA.
  • the inhibitory effect of siRNA in Table 10 on PCSK9 mRNA expression level and protein expression level in Hela cells was detected.
  • the detection method is shown in Example 6 and Example 7, and the final concentration of siRNA was 10 nM or 0.1 nM, and PCSK9 mRNA was detected by qPCR.
  • the results of expression levels are shown in Table 11, and the results of ELISA detection of PCSK9 protein expression levels are shown in Table 12. The results show that after adjusting the sequence, the inhibitory effect on the PCSK9 gene and protein can be further enhanced on the basis of the original sequence.
  • SEQ ID No. chain of justice SEQ ID No. antisense strand GR90168.0 90 CCUUGCCUGGAACUCACUCAC 255 GAGUGAGUGAGUUCCAGGCAA GR90168.20 140 GCCUGGAACUCACUCUG 305 GAGUGAGUGAGUUCCAGGCAA GR90168.21 141 GCCUGGAACUCACUCUG 306 CAGAGUGAGUGAGUUCCAGGCAA GR90168.22 142 UUGCCUGGAACUCACUC 307 GAGUGAGUGAGUUCCAGGCAAGG GR90168.23 143 UGCCUGGAACUCACUCACUCU 308 AGAGUGAGUGAGUUCCAGGCAAG GR90243.0 103 GGGCAUUUCACCAUUCAAACA 268 CCUGUUUGAAUGGUGAAAUGC GR90243.20 144 AUUUCACCAUUCAAACAGGUC 309 CCUGUUUGAAUGGUGAAAUGC GR90243.21 145
  • GR90247.23 175 UCACCAUUCAAACAGGUCgag 340 cUCGACCUGUUUGAAUGGUGAAa
  • Example 10 Modification of the siRNA in Example 9
  • the siRNA in Example 9 was further modified in this example, and the siRNA in Table 13 was prepared.
  • A, C, G, U on the left of m represent the pentose group in the nucleotide residue is 2'-methoxyribosyl
  • Af, Cf, Gf, Uf represent the pentose group in the nucleotide residue is 2'-Fluorine modifies the ribose group
  • s represents that the phosphate group between the ribonucleotide residues on the left and right sides is a phosphorothioate group.
  • LNA locked nucleic acid modification
  • d means deoxyribonucleotide
  • CHO means cholesterol
  • GALNAC means GalNAc ligand (GalNAc3 shown in formula I above)
  • the schematic diagram of conjugation to the 3' end of the sense strand of siRNA is as follows As shown in Formula II above, X is O.
  • the IC50 values of the partial modifiers for inhibiting the expression of PCSK9 mRNA were detected in both Hela and HEP3B cells (see Example 8 for specific methods), and the results are shown in Table 14. It can be seen that the modified siRNA significantly reduces the IC50 value of inhibiting PCSK9 mRNA expression compared with the unmodified sequence.
  • Example 2 part of the sequence in Example 2 is further modified, its nucleotides are modified, targeting ligands are added to the sense strand of siRNA, and modified siRNA molecules as shown in Table 15 are prepared and synthesized.
  • the inhibitory effect of siRNA in Table 15 on the expression level of PCSK9 mRNA in Hep3B cells was tested.
  • the detection method is shown in Example 6.
  • the final concentration of siRNA is 1 nM or 10 nM, and the results of qPCR detection of the expression level of PCSK9 mRNA are shown in Figure 2 .
  • the results show that after the modification of the sequence, the inhibitory effect on the PCSK9 gene can be further enhanced on the basis of the original sequence.
  • mice 60 C57 mice (half female/male, weighing about 20g, 6-8 weeks old) were randomly divided into five groups according to body weight: normal saline group, GR90243.55, GR90243.51, GR90320.93, GR90320.89 The concentration of the drug was 10 mg/kg, and the corresponding doses of drugs were administered intravenously/subcutaneously to 6 animals in each group (3 males and 3 females). Dissection and visual inspection of organ lesions.
  • the average body weight of the mice in the intravenous administration group is shown in Figure 3, and the biomarkers of the mice in the subcutaneous administration and intravenous administration groups are shown in Table 16 and Table 17, respectively.
  • the results showed that there was no significant difference in the average body weight among the groups, and there was no significant difference in the biochemical indexes between the groups.
  • mice The pharmacokinetics of siRNA drugs in mice were detected by intravenous injection and subcutaneous injection into mice. The experiment was divided into 4 groups, 9 male C57 mice in each group, 6-8 weeks old, a total of 36*2 mice. By subcutaneous injection or tail vein injection, the administration concentration was 3 mg/kg, and the day of administration was recorded as day 1. After administration, 100 microliters of blood was collected from mice, and serum was separated for use. There were 9 time points, 5min, 15min, 30min, 1h, 2h, 4h, 8h, 24h, 48h.
  • Detection method (1) Serum separation: After the whole blood was allowed to stand at room temperature for 60 minutes, centrifuge at 1500g at 4°C for 15min, pipette the supernatant, and store it at -80°C until sent for inspection.
  • PK parameters of GR90243.55 at 3 mg/kg subcutaneously and 3 mg/kg intravenously are shown in Table 18 and Table 19.
  • PK parameters of GR90243.51 at 3 mg/kg subcutaneously and 3 mg/kg intravenously are shown in Table 20 and Table 21.
  • PK parameters of GR90320.93 subcutaneous 3 mg/kg and intravenous administration 3 mg/kg are shown in Table 22 and Table 23.
  • PK parameters of GR90320.89 for subcutaneous 3mpk and intravenous administration of 3mg/kg are shown in Table 24 and Table 25.
  • the concentration of siRNA drugs in the liver was assessed by subcutaneous injection of mice. The experiment was divided into 4 groups, 9 male C57B6 mice in each group, a total of 36 mice. A one-time subcutaneous injection of 3 mg/kg was administered. After administration, the liver was collected at 6 time points of 4h, 24h, 48h, 72h, 96h, and 168h, and the concentration of siRNA in the liver was determined. The following table is the average value of the concentration.
  • the concentration of administered siRNA in total liver RNA of GR90243.55, GR90243.51, GR90320.93, and GR90320.89 is summarized in Table 26.
  • the drug content curve is shown in Figure 4.
  • C57 transgenic mice (transformed into humanized PSCK9 gene sequence, male, weighing about 20 g, 8-10 weeks old, for the specific construction method, see "Luo, Y., Warren, L., Xia, D., Jensen, H. , Sand, T., Petras, S., Hawkins, J. (2008). Function and distribution of circulating human PCSK9expressed extrahepatically in transgenic mice. Journal of Lipid Research,50(8),1581–1588.doi:10.1194/jlr .m800542-jlr200" article, the same below) were randomly divided into 5 groups according to body weight, the normal saline group and the drug group.
  • the day of the drug was recorded as day 1, and 72 hours later, blood was collected for biochemical detection (lipids including triglycerides, cholesterol, LDL, etc.), PSCK9 protein content was detected by ELISA, and the expression level of PSCK9 mRNA was detected by qPCR in liver.
  • the hPCSK9 transgenic mice (transformed into humanized PSCK9 gene sequence in C57 strain mice, SPF grade, half male and female, about 20g body weight, 6-10 weeks old) were randomly divided into GR90320.93 according to the baseline serum LDL index.
  • siRNA NC group (3mg/kg, a total of 7 groups, 4 animals in each group (half male and female), respectively, were given subcutaneous injection of corresponding doses of drugs, the day of administration was recorded as day 1, and blood was collected before and 72h after administration.
  • Biochemical tests lipids including triglycerides, cholesterol, LDL, etc.
  • ELISA were used to detect serum PSCK9 levels, and the liver was used as the end point for qPCR detection.
  • hPCSK9 transgenic mice humanized PSCK9 gene sequence was transferred into C57 strain mice, 18 males and 12 females, body weight about 20g, 6-10 weeks old
  • GR90320.93 low-dose 3mg/kg) according to body weight , twice a week
  • medium dose (6 mg/kg, once a week)
  • GR90320.89 low dose (3 mg/kg, twice a week)
  • medium dose (6 mg/kg, once a week)
  • normal saline group a total of 5 groups, the administration time was one week (single or 2 administrations), 5 animals in each group (2 females, 3 males) were given subcutaneous injection of corresponding doses of drugs respectively, the day of administration was recorded as day 1, and the administration Before (day-3) and the first 2 weeks after administration, blood was collected twice a week for blood biochemical detection (LDL-C) and serum PSCK9 content once a week.
  • the experimental period was 3 months.
  • the serum PCSK9 protein level GR90320.93 3mg/kg began to decrease on day8, and returned to normal level on day22.
  • GR90320.93 6mg/kg, GR90320.89 3mg/kg, GR90320.89 6mg/kg and before administration began to decrease compared with day 5, day 22 returned to normal levels, GR90320.89 3mg/kg group day 5, day 8, day 12, day 15
  • the decrease is more obvious, and there is a significant difference compared with day-3.
  • GR90320.89 6mg/kg group on day 5, day 8 decreased significantly, and there was a significant difference compared with day-3 ( Figure 8).
  • the siRNA molecule provided by the invention has high inhibitory activity and high stability; can well specifically inhibit the expression of PCSK9 gene and protein, has good liver targeting and the ability to promote cell endocytosis; ligand modification
  • the siRNA molecules can enter target cells and target tissues without transfection reagents, reducing the negative effects of transfection reagents, such as cell or tissue toxicity.
  • the ligand-modified siRNA molecule of the present invention provides the possibility for PCSK9 gene-mediated targeted therapy of diseases, including reducing low-density lipoprotein cholesterol, reducing the incidence of coronary heart disease, myocardial infarction, stroke, atherosclerosis, etc. risk or even treat these diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Biotechnology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'Invention concerne un ARNsi pour inhiber l'expression du gène PCSK9 et son modificateur et son utilisation. La présente invention concerne un ARNsi pour inhiber l'expression du gène PCSK9, comprenant un brin sens et un brin antisens ; le brin sens et/ou le brin antisens ont une longueur dans la gamme de 19 à 30 nucléotides ; le brin sens et le brin antisens peuvent être complémentaires pour former un ARN double brin ; et la région complémentaire formant l'ARN double brin a une longueur dans la gamme de 15 à 30 nucléotides. Les molécules de siRNA présentes ont une activité inhibitrice élevée et une grande stabilité, et ont un meilleur effet de ciblage hépatique et une meilleure capacité à promouvoir l'endocytose cellulaire ; et les molécules de siRNA modifiées par un ligand peuvent entrer dans les cellules cibles et les tissus cibles sans réactifs de transfection, ce qui réduit les effets négatifs des réactifs de transfection, tels que la toxicité cellulaire ou tissulaire. Les molécules d'arnsi modifiées par un ligand fournissent un potentiel pour une thérapie ciblant un gène PCSK9.
PCT/CN2021/126724 2020-10-28 2021-10-27 Arnsi pour inhiber l'expression du gene pcsk9 et son modificateur et son utilisation WO2022089486A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202011170091.5 2020-10-28
CN202011170091 2020-10-28

Publications (1)

Publication Number Publication Date
WO2022089486A1 true WO2022089486A1 (fr) 2022-05-05

Family

ID=81381950

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2021/126724 WO2022089486A1 (fr) 2020-10-28 2021-10-27 Arnsi pour inhiber l'expression du gene pcsk9 et son modificateur et son utilisation

Country Status (1)

Country Link
WO (1) WO2022089486A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023017004A1 (fr) * 2021-08-09 2023-02-16 Cargene Therapeutics Pte. Ltd. Acides nucléiques inhibiteurs destiné à pcsk9
CN117210468A (zh) * 2023-11-06 2023-12-12 北京悦康科创医药科技股份有限公司 靶向调控PCSK9基因表达的siRNA及其应用

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050245475A1 (en) * 2002-11-14 2005-11-03 Dharmacon, Inc. Functional and hyperfunctional siRNA directed against Bcl-2
CN101484588A (zh) * 2006-05-11 2009-07-15 阿尔尼拉姆医药品有限公司 抑制pcsk9基因表达的组合物和方法
WO2009114475A2 (fr) * 2008-03-09 2009-09-17 Intradigm Corporation Compositions comprenant de la pcsk9 humaine et un siarn d’apolipoprotéine b, et procédés d’utilisation de celles-ci
EP2667197A1 (fr) * 2012-05-25 2013-11-27 Zora Biosciences OY Biomarqueurs à efficacité et spécificité sensibles pour l'inhibition de proprotéine convertase de subtilisine/kexin de type 9 (PCSK9)
CN104854242A (zh) * 2012-12-05 2015-08-19 阿尔尼拉姆医药品有限公司 PCSK9 iRNA组合物及其使用方法
CN109957565A (zh) * 2017-12-26 2019-07-02 广州市锐博生物科技有限公司 一种修饰的siRNA分子及其应用
WO2019204021A1 (fr) * 2018-04-18 2019-10-24 Dicerna Pharmaceuticals, Inc. Oligonucléotides ciblant la pcsk9 pour le traitement de l'hypercholestérolémie et d'états apparentés
CN110446784A (zh) * 2017-03-24 2019-11-12 Ionis制药公司 Pcsk9表达的调节剂

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050245475A1 (en) * 2002-11-14 2005-11-03 Dharmacon, Inc. Functional and hyperfunctional siRNA directed against Bcl-2
CN101484588A (zh) * 2006-05-11 2009-07-15 阿尔尼拉姆医药品有限公司 抑制pcsk9基因表达的组合物和方法
WO2009114475A2 (fr) * 2008-03-09 2009-09-17 Intradigm Corporation Compositions comprenant de la pcsk9 humaine et un siarn d’apolipoprotéine b, et procédés d’utilisation de celles-ci
EP2667197A1 (fr) * 2012-05-25 2013-11-27 Zora Biosciences OY Biomarqueurs à efficacité et spécificité sensibles pour l'inhibition de proprotéine convertase de subtilisine/kexin de type 9 (PCSK9)
CN104854242A (zh) * 2012-12-05 2015-08-19 阿尔尼拉姆医药品有限公司 PCSK9 iRNA组合物及其使用方法
CN110446784A (zh) * 2017-03-24 2019-11-12 Ionis制药公司 Pcsk9表达的调节剂
CN109957565A (zh) * 2017-12-26 2019-07-02 广州市锐博生物科技有限公司 一种修饰的siRNA分子及其应用
WO2019204021A1 (fr) * 2018-04-18 2019-10-24 Dicerna Pharmaceuticals, Inc. Oligonucléotides ciblant la pcsk9 pour le traitement de l'hypercholestérolémie et d'états apparentés

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LANDMESSER ULF, HAGHIKIA ARASH, LEITER LAWRENCE A, WRIGHT R SCOTT, KALLEND DAVID, WIJNGAARD PETER, STOEKENBROEK ROBERT, KASTELEIN : "Effect of inclisiran, the small-interfering RNA against proprotein convertase subtilisin/kexin type 9, on platelets, immune cells, and immunological biomarkers: a pre-specified analysis from ORION-1", CARDIOVASCULAR RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 117, no. 1, 1 January 2021 (2021-01-01), GB , pages 284 - 291, XP055925949, ISSN: 0008-6363, DOI: 10.1093/cvr/cvaa077 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023017004A1 (fr) * 2021-08-09 2023-02-16 Cargene Therapeutics Pte. Ltd. Acides nucléiques inhibiteurs destiné à pcsk9
CN117210468A (zh) * 2023-11-06 2023-12-12 北京悦康科创医药科技股份有限公司 靶向调控PCSK9基因表达的siRNA及其应用
CN117210468B (zh) * 2023-11-06 2024-02-20 北京悦康科创医药科技股份有限公司 靶向调控PCSK9基因表达的siRNA及其应用

Similar Documents

Publication Publication Date Title
Zhang et al. The growth of siRNA-based therapeutics: Updated clinical studies
AU2019210578B2 (en) C/EBP alpha saRNA compositions and methods of use
US20220170025A1 (en) Compositions and methods for inhibiting gene expression in the central nervous system
CA2619533C (fr) Conjugues siarn-polymeres hydrophiles pour l'administration intracellulaire de petits arn interferents et methode associee
WO2022089486A1 (fr) Arnsi pour inhiber l'expression du gene pcsk9 et son modificateur et son utilisation
KR101670085B1 (ko) 단백질 키나아제 3의 발현을 억제하기 위한 수단
JP7476422B2 (ja) Ｌｐａ発現を阻害するための組成物及び方法
CN108220293A (zh) 一种小干扰核酸和药物组合物及其用途
JP7398007B2 (ja) Ａｎｇｐｔｌ３発現を阻害する組成物及び方法
CN108265052A (zh) 一种小干扰核酸和药物组合物及其用途
JP2019524151A5 (fr)
CN113811311A (zh) 用于组织特异性apoe调节的寡核苷酸
US20220160880A1 (en) Antisense nucleic acid targeting pcsk9
JP2019196384A (ja) ＮＯＴＣＨ １特異的なｓｉＲＮＡ分子
KR20150006743A (ko) 간암 연관 유전자 특이적 siRNA, 그러한 siRNA를 포함하는 이중나선 올리고 RNA 구조체 및 이를 포함하는 암 예방 또는 치료용 조성물
KR20150006742A (ko) 간암 연관 유전자 특이적 siRNA, 그러한 siRNA를 포함하는 이중나선 올리고 RNA 구조체 및 이를 포함하는 암 예방 또는 치료용 조성물
WO2023051822A1 (fr) Oligonucléotide de ciblage pour le traitement de maladies associées à pcsk9
US20230099345A1 (en) Nanometric pharmaceutical composition in the form of liposomes or nanoemulsion containing specific sequences of interference rna
US20110274745A1 (en) Instillation of liposomal formulation of sirna and antisense oligonucleotides
US11459569B2 (en) Nanometric pharmaceutical composition in the form of liposomes or nanoemulsion containing specific sequences of interference RNA
US11771777B2 (en) Three-dimensional self-assembled nucleic acid nanoparticles and use thereof
CN117136236B (zh) 用于抑制TMPRSS6基因表达的siRNA或其盐、药物及其应用
Cortinhas et al. Toward the therapeutic application of small interfering RNA bioconjugates in the central nervous system
KR102630164B1 (ko) 펩티드 핵산 복합체를 유효성분으로 함유하는 비알콜성 지방간염 예방 또는 치료용 조성물
KR101888104B1 (ko) MET 엑손 14 스키핑 특이적 siRNA 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21885213

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21885213

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 21885213

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC