WO2022089486A1

WO2022089486A1 - Sirna for inhibiting pcsk9 gene expression and modifier thereof and use thereof

Info

Publication number: WO2022089486A1
Application number: PCT/CN2021/126724
Authority: WO
Inventors: 秦引林; 苏梅; 段春晓; 张佩琢
Original assignee: 江苏柯菲平医药股份有限公司
Priority date: 2020-10-28
Filing date: 2021-10-27
Publication date: 2022-05-05

Abstract

An siRNA for inhibiting PCSK9 gene expression and a modifier thereof and the use thereof. Provided is an siRNA for inhibiting PCSK9 gene expression, which comprises a sense strand and an antisense strand; the sense strand and/or the antisense strand have a length in the range of 19-30 nucleotides; the sense strand and the antisense strand can be complementary to form a double-stranded RNA; and the complementary region forming the double-stranded RNA has a length in the range of 15-30 nucleotides. The siRNA molecules provided have a high inhibitory activity and a high stability, and have a better hepatic targeting effect and ability to promote cell endocytosis; and the ligand-modified siRNA molecules can enter target cells and target tissues without transfection reagents, reducing the negative effects of transfection reagents, such as cell or tissue toxicity. The ligand-modified siRNA molecules provide potential for a PCSK9 gene-mediated disease targeting therapy.

Description

siRNA for inhibiting the expression of PCSK9 gene and its modification and application

technical field

The invention relates to the field of biomedicine, in particular to siRNA for inhibiting the expression of PCSK9 gene and its modification and application.

Background technique

Hyperlipidemia refers to high blood lipid levels, which directly cause some diseases that seriously endanger human health, such as atherosclerosis, coronary heart disease, pancreatitis, etc. Hyperlipidemia is a high risk factor for cardiovascular disease. A large amount of evidence-based medical evidence shows that statins are the first choice for the prevention and treatment of hyperlipidemia. However, some clinical studies have shown that some patients with high risk of cardiovascular disease are still not significantly lowering lipids after receiving adequate statin therapy, and still have a high risk of cardiovascular disease. In addition, some patients are intolerant to high-dose statins. Therefore, it is necessary to find a drug that can safely and effectively reduce the level of LDL-C, which has become a research hotspot in the field of lipid lowering. PCSK9 is a liver protease that attaches and internalizes LDLR into lysosomes and promotes its destruction. Experiments have found that inhibiting PCSK9 can significantly increase the number of LDLR, and then combine with more LDL-C to reduce blood LDL-C levels, which are 50%-60% lower than LDL-C levels achieved by statin therapy alone.

Elevated levels of proprotein convertase subtilisin/kexin type 9 (PCSK9) are associated with elevated LDL and adverse cardiovascular outcomes. Regulatory agencies have approved PCSK9 antibodies for use in patients with suboptimal therapeutic levels of LDL-C. This class of drugs is able to reduce LDL-C levels by up to 60% more than that achieved with statins. In addition, these drugs have clinical benefits, such as reducing the incidence of stroke and myocardial infarction.

Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a serine protease encoded by the PCSK9 gene, mainly produced by the liver. PCSK9 binds to the LDL receptor (low density lipoprotein receptor, LDL-R) on the surface of hepatocytes to degrade LDL-R, thereby increasing the level of plasma LDL-C.

Antibodies to PCSK9 can interfere with its binding to LDL-R, causing the liver to express more LDL-R, thereby reducing plasma LDL-C levels. Alisizumab and ilovolumab are fully humanized monoclonal antibodies that bind to free PCSK9 in plasma and promote its degradation. As a result, the free PCSK9 that can bind to LDL-R in the plasma decreases, so that more LDL-R is recycled to the surface of hepatocytes. As a direct result, the liver is able to remove more LDL-C from the circulation, reducing plasma LDL-C levels. Such antibodies are able to specifically bind PCSK9, but not other members of the PCSK superfamily of enzymes.

Approved anti-PCSK9 antibodies that reduce LDL-C by nearly 60% are disappointing on the market. RNA interference inhibitors can achieve similar lipid reductions and have many other advantages. siRNA interferes with PCSK9 by blocking its mRNA-dependent synthesis. PCSK9 small interfering RNA molecules can replace monoclonal antibodies to reduce PCSK9. In theory, these molecules could significantly reduce intracellular and extracellular PCSK9 levels, administer less frequently, and potentially cost less. All of these drugs significantly lower serum levels of low-density lipoprotein cholesterol (LDL-C), which is a major component of arterial plaque, which narrows or blocks arteries. But compared with two approved mAb-based PCSK9 inhibitors, Repatha (evolocumab; Amgen) and Praluent (alirocumab; Sanofi, Regeneron Pharmaceuticals), siRNA has the advantage of being cheap to manufacture and easy to store for a long time. For physicians, siRNA is certainly more convenient and requires fewer injections.

Invention Disclosure

The purpose of the present invention is to provide a siRNA for inhibiting the expression of PCSK9 gene, and its modification and application.

In the present invention, PCSK9 refers to the proprotein convertase subtilisin Kexin9 gene or protein. In the present invention, PCSK9 refers to the gene whose mRNA sequence is shown in Genbank accession number NM_174936.3.

In a first aspect, the present invention claims a siRNA that inhibits the expression of PCSK9 gene.

The siRNA for inhibiting PCSK9 gene expression as claimed in the present invention may include a sense strand and an antisense strand; the sense strand and/or the antisense strand have a length in the range of 19-30 nucleotides. For example, the length of the sense or antisense strand can be between 19-21 nucleotides in length, 19-23 nucleotides in length, 19-25 nucleotides in length, 21-23 nucleotides in length, 21- 25 nucleotides in length, 23-25 nucleotides in length, 21-30 nucleotides in length, 23-30 nucleotides in length, or 25-30 nucleotides in length. The sense strand and the antisense strand can complement each other to form a double-stranded RNA, and the complementary region forming the double-strand has a length in the range of 15-30 nucleotides. According to the embodiments disclosed in the present invention, the double-stranded complementary region of the siRNA provided by the present invention may have a length of 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.

Further, the 3' end and/or the 5' end of the sense strand and/or the antisense strand constituting the siRNA may have an overhang.

Wherein, the overhang may have a length of 1-6 nucleotides. For example, 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length Nucleotide length, 2-3 nucleotides in length, or 1-2 nucleotides in length. These overhangs can be the result of one strand being longer than the other, or the staggering of two strands of the same length. The overhang can form a mismatch with the PCSK9 mRNA, or it can be complementary to the targeted gene sequence or can be another sequence. The first and second strands can also be linked, eg, by additional bases to form a hairpin or by other non-basic linkers.

In one embodiment of the present invention, after complementary pairing of the sense strand and the antisense strand that make up the siRNA, an overhang with a length of 2 nucleotides is formed at the 3' ends of the two strands, and the siRNA double-stranded The region is 19 nucleotides in length. In one embodiment of the present invention, after complementary pairing of the sense strand and the antisense strand constituting the siRNA, an overhang with a length of 3 nucleotides is formed at the 3' ends of the two strands. In one embodiment of the present invention, after complementary pairing of the sense strand and the antisense strand constituting the siRNA, an overhang with a length of 4 nucleotides is formed at the 3' ends of the two strands. In one embodiment of the present invention, after complementary pairing of the sense strand and the antisense strand constituting the siRNA, an overhang with a length of 5 nucleotides is formed at the 3' ends of the two strands.

In one embodiment of the present invention, the siRNA may contain only a single overhang, which can enhance the interference activity of the siRNA without affecting its overall stability. For example, the single-stranded overhang can be located at the 3' end of the sense strand, or alternatively, at the 3' end of the antisense strand. The siRNA may also have blunt ends at the 5' end of the antisense strand (or the 3' end of the sense strand), or vice versa. Generally, the antisense strand comprising the siRNA has a nucleotide overhang at the 3' end and a blunt end at the 5' end.

The siRNA with "nucleotide overhang at the 3' end and blunt end at the 5' end" provided by the present invention can be specifically numbered as GR90168.22, GR90243.22, GR90303.22, GR90320 in Table 10 of the Examples section .22, GR91024.22, GR90165.22, GR90169.22, or siRNA indicated by GR90166.22.

In a specific embodiment of the present invention, the siRNA (unmodified) is specifically any of the following:

(1) Complementary formation of the sense strand shown in SEQ ID No.11 and the antisense strand shown in SEQ ID No.176;

(2) Complementary formation of the sense strand shown in SEQ ID No.12 and the antisense strand shown in SEQ ID No.177;

(3) formed by complementation of the sense strand shown in SEQ ID No.13 and the antisense strand shown in SEQ ID No.178;

(4) Complementary formation of the sense strand shown in SEQ ID No.14 and the antisense strand shown in SEQ ID No.179;

(5) Complementary formation of the sense strand shown in SEQ ID No.15 and the antisense strand shown in SEQ ID No.180;

(6) Complementary formation of the sense strand shown in SEQ ID No.16 and the antisense strand shown in SEQ ID No.181;

(7) Complementary formation of the sense strand shown in SEQ ID No.17 and the antisense strand shown in SEQ ID No.182;

(8) Complementary formation of the sense strand shown in SEQ ID No.18 and the antisense strand shown in SEQ ID No.183;

(9) formed by complementation of the sense strand shown in SEQ ID No.19 and the antisense strand shown in SEQ ID No.184;

(10) formed by complementation of the sense strand shown in SEQ ID No.20 and the antisense strand shown in SEQ ID No.185;

(11) formed by complementation of the sense strand shown in SEQ ID No.21 and the antisense strand shown in SEQ ID No.186;

(12) formed by complementation of the sense strand shown in SEQ ID No.22 and the antisense strand shown in SEQ ID No.187;

(13) formed by complementation of the sense strand shown in SEQ ID No.23 and the antisense strand shown in SEQ ID No.188;

(14) formed by complementation of the sense strand shown in SEQ ID No.24 and the antisense strand shown in SEQ ID No.189;

(15) formed by complementation of the sense strand shown in SEQ ID No.25 and the antisense strand shown in SEQ ID No.190;

(16) formed by complementation of the sense strand shown in SEQ ID No.26 and the antisense strand shown in SEQ ID No.191;

(17) complementary to the sense strand shown in SEQ ID No.27 and the antisense strand shown in SEQ ID No.192;

(18) formed by complementation of the sense strand shown in SEQ ID No.28 and the antisense strand shown in SEQ ID No.193;

(19) formed by complementation of the sense strand shown in SEQ ID No.29 and the antisense strand shown in SEQ ID No.194;

(20) formed by complementation of the sense strand shown in SEQ ID No.30 and the antisense strand shown in SEQ ID No.195;

(21) formed by complementation of the sense strand shown in SEQ ID No.31 and the antisense strand shown in SEQ ID No.196;

(22) formed by complementation of the sense strand shown in SEQ ID No.32 and the antisense strand shown in SEQ ID No.197;

(23) formed by complementation of the sense strand shown in SEQ ID No.33 and the antisense strand shown in SEQ ID No.198;

(24) formed by complementation of the sense strand shown in SEQ ID No.34 and the antisense strand shown in SEQ ID No.199;

(25) formed by complementation of the sense strand shown in SEQ ID No.35 and the antisense strand shown in SEQ ID No.200;

(26) complementary to the sense strand shown in SEQ ID No.36 and the antisense strand shown in SEQ ID No.201;

(27) formed by complementation of the sense strand shown in SEQ ID No.37 and the antisense strand shown in SEQ ID No.202;

(28) formed by complementation of the sense strand shown in SEQ ID No.38 and the antisense strand shown in SEQ ID No.203;

(29) complementary to the sense strand shown in SEQ ID No.39 and the antisense strand shown in SEQ ID No.204;

(30) formed by complementation of the sense strand shown in SEQ ID No.40 and the antisense strand shown in SEQ ID No.205;

(31) formed by complementation of the sense strand shown in SEQ ID No.41 and the antisense strand shown in SEQ ID No.206;

(32) formed by complementation of the sense strand shown in SEQ ID No.42 and the antisense strand shown in SEQ ID No.207;

(33) complementary to the sense strand shown in SEQ ID No.43 and the antisense strand shown in SEQ ID No.208;

(34) complementary to the sense strand shown in SEQ ID No.44 and the antisense strand shown in SEQ ID No.209;

(35) formed by complementation of the sense strand shown in SEQ ID No.45 and the antisense strand shown in SEQ ID No.210;

(36) complementary to the sense strand shown in SEQ ID No.46 and the antisense strand shown in SEQ ID No.211;

(37) formed by complementation of the sense strand shown in SEQ ID No.47 and the antisense strand shown in SEQ ID No.212;

(38) complementary to the sense strand shown in SEQ ID No.48 and the antisense strand shown in SEQ ID No.213;

(39) formed by complementation of the sense strand shown in SEQ ID No.49 and the antisense strand shown in SEQ ID No.214;

(40) complementary to the sense strand shown in SEQ ID No.50 and the antisense strand shown in SEQ ID No.215;

(41) formed by complementation of the sense strand shown in SEQ ID No.51 and the antisense strand shown in SEQ ID No.216;

(42) complementary to the sense strand shown in SEQ ID No.52 and the antisense strand shown in SEQ ID No.217;

(43) formed by complementation of the sense strand shown in SEQ ID No.53 and the antisense strand shown in SEQ ID No.218;

(44) formed by complementation of the sense strand shown in SEQ ID No.54 and the antisense strand shown in SEQ ID No.219;

(45) formed by complementation of the sense strand shown in SEQ ID No.55 and the antisense strand shown in SEQ ID No.220;

(46) formed by complementation of the sense strand shown in SEQ ID No.56 and the antisense strand shown in SEQ ID No.221;

(47) formed by complementation of the sense strand shown in SEQ ID No.57 and the antisense strand shown in SEQ ID No.222;

(48) complementary to the sense strand shown in SEQ ID No.58 and the antisense strand shown in SEQ ID No.223;

(49) formed by complementation of the sense strand shown in SEQ ID No.59 and the antisense strand shown in SEQ ID No.224;

(50) formed by complementation of the sense strand shown in SEQ ID No.60 and the antisense strand shown in SEQ ID No.225;

(51) formed by complementation of the sense strand shown in SEQ ID No.61 and the antisense strand shown in SEQ ID No.226;

(52) formed by complementation of the sense strand shown in SEQ ID No.62 and the antisense strand shown in SEQ ID No.227;

(53) formed by complementation of the sense strand shown in SEQ ID No.63 and the antisense strand shown in SEQ ID No.228;

(54) formed by complementation of the sense strand shown in SEQ ID No.64 and the antisense strand shown in SEQ ID No.229;

(55) complementary to the sense strand shown in SEQ ID No.65 and the antisense strand shown in SEQ ID No.230;

(56) formed by complementation of the sense strand shown in SEQ ID No.66 and the antisense strand shown in SEQ ID No.231;

(57) formed by complementation of the sense strand shown in SEQ ID No.67 and the antisense strand shown in SEQ ID No.232;

(58) formed by complementation of the sense strand shown in SEQ ID No.68 and the antisense strand shown in SEQ ID No.233;

(59) formed by complementation of the sense strand shown in SEQ ID No.69 and the antisense strand shown in SEQ ID No.234;

(60) formed by complementation of the sense strand shown in SEQ ID No.70 and the antisense strand shown in SEQ ID No.235;

(61) formed by complementation of the sense strand shown in SEQ ID No.71 and the antisense strand shown in SEQ ID No.236;

(62) formed by complementation of the sense strand shown in SEQ ID No.72 and the antisense strand shown in SEQ ID No.237;

(63) formed by complementation of the sense strand shown in SEQ ID No.73 and the antisense strand shown in SEQ ID No.238;

(64) formed by complementation of the sense strand shown in SEQ ID No.74 and the antisense strand shown in SEQ ID No.239;

(65) formed by complementation of the sense strand shown in SEQ ID No.75 and the antisense strand shown in SEQ ID No.240;

(66) formed by complementation of the sense strand shown in SEQ ID No.76 and the antisense strand shown in SEQ ID No.241;

(67) formed by complementation of the sense strand shown in SEQ ID No.77 and the antisense strand shown in SEQ ID No.242;

(68) formed by complementation of the sense strand shown in SEQ ID No.78 and the antisense strand shown in SEQ ID No.243;

(69) formed by complementation of the sense strand shown in SEQ ID No.79 and the antisense strand shown in SEQ ID No.244;

(70) formed by complementation of the sense strand shown in SEQ ID No.80 and the antisense strand shown in SEQ ID No.245;

(71) complementary to the sense strand shown in SEQ ID No.81 and the antisense strand shown in SEQ ID No.246;

(72) formed by complementation of the sense strand shown in SEQ ID No.82 and the antisense strand shown in SEQ ID No.247;

(73) complementary to the sense strand shown in SEQ ID No.83 and the antisense strand shown in SEQ ID No.248;

(74) formed by complementation of the sense strand shown in SEQ ID No.84 and the antisense strand shown in SEQ ID No.249;

(75) complementary to the sense strand shown in SEQ ID No.85 and the antisense strand shown in SEQ ID No.250;

(76) complementary to the sense strand shown in SEQ ID No.86 and the antisense strand shown in SEQ ID No.251;

(77) formed by complementation of the sense strand shown in SEQ ID No.87 and the antisense strand shown in SEQ ID No.252;

(78) complementary to the sense strand shown in SEQ ID No.88 and the antisense strand shown in SEQ ID No.253;

(79) formed by complementation of the sense strand shown in SEQ ID No.89 and the antisense strand shown in SEQ ID No.254;

(80) formed by complementation of the sense strand shown in SEQ ID No.90 and the antisense strand shown in SEQ ID No.255;

(81) formed by complementation of the sense strand shown in SEQ ID No.91 and the antisense strand shown in SEQ ID No.256;

(82) formed by complementation of the sense strand shown in SEQ ID No.92 and the antisense strand shown in SEQ ID No.257;

(83) complementary to the sense strand shown in SEQ ID No.93 and the antisense strand shown in SEQ ID No.258;

(84) formed by complementation of the sense strand shown in SEQ ID No.94 and the antisense strand shown in SEQ ID No.259;

(85) formed by complementation of the sense strand shown in SEQ ID No.95 and the antisense strand shown in SEQ ID No.260;

(86) complementary to the sense strand shown in SEQ ID No.96 and the antisense strand shown in SEQ ID No.261;

(87) formed by complementation of the sense strand shown in SEQ ID No.97 and the antisense strand shown in SEQ ID No.262;

(88) formed by complementation of the sense strand shown in SEQ ID No.98 and the antisense strand shown in SEQ ID No.263;

(89) formed by complementation of the sense strand shown in SEQ ID No.99 and the antisense strand shown in SEQ ID No.264;

(90) formed by complementation of the sense strand shown in SEQ ID No.100 and the antisense strand shown in SEQ ID No.265;

(91) complementary to the sense strand shown in SEQ ID No.101 and the antisense strand shown in SEQ ID No.266;

(92) formed by complementation of the sense strand shown in SEQ ID No.102 and the antisense strand shown in SEQ ID No.267;

(93) complementary to the sense strand shown in SEQ ID No.103 and the antisense strand shown in SEQ ID No.268;

(94) formed by complementation of the sense strand shown in SEQ ID No.104 and the antisense strand shown in SEQ ID No.269;

(95) complementary to the sense strand shown in SEQ ID No.105 and the antisense strand shown in SEQ ID No.270;

(96) complementary to the sense strand shown in SEQ ID No.106 and the antisense strand shown in SEQ ID No.271;

(97) formed by complementation of the sense strand shown in SEQ ID No.107 and the antisense strand shown in SEQ ID No.272;

(98) formed by complementation of the sense strand shown in SEQ ID No.108 and the antisense strand shown in SEQ ID No.273;

(99) complementary to the sense strand shown in SEQ ID No.109 and the antisense strand shown in SEQ ID No.274;

(100) formed by complementation of the sense strand shown in SEQ ID No.110 and the antisense strand shown in SEQ ID No.275;

(101) formed by complementation of the sense strand shown in SEQ ID No.111 and the antisense strand shown in SEQ ID No.276;

(102) formed by complementation of the sense strand shown in SEQ ID No.112 and the antisense strand shown in SEQ ID No.277;

(103) formed by complementation of the sense strand shown in SEQ ID No.113 and the antisense strand shown in SEQ ID No.278;

(104) formed by complementation of the sense strand shown in SEQ ID No.114 and the antisense strand shown in SEQ ID No.279;

(105) formed by complementation of the sense strand shown in SEQ ID No.115 and the antisense strand shown in SEQ ID No.280;

(106) formed by complementation of the sense strand shown in SEQ ID No.116 and the antisense strand shown in SEQ ID No.281;

(107) formed by complementation of the sense strand shown in SEQ ID No.117 and the antisense strand shown in SEQ ID No.282;

(108) formed by complementation of the sense strand shown in SEQ ID No.118 and the antisense strand shown in SEQ ID No.283;

(109) formed by complementation of the sense strand shown in SEQ ID No. 119 and the antisense strand shown in SEQ ID No. 284;

(110) formed by complementation of the sense strand shown in SEQ ID No.120 and the antisense strand shown in SEQ ID No.285;

(111) formed by complementation of the sense strand shown in SEQ ID No.121 and the antisense strand shown in SEQ ID No.286;

(112) formed by complementation of the sense strand shown in SEQ ID No.122 and the antisense strand shown in SEQ ID No.287;

(113) formed by complementation of the sense strand shown in SEQ ID No.123 and the antisense strand shown in SEQ ID No.288;

(114) formed by complementation of the sense strand shown in SEQ ID No.124 and the antisense strand shown in SEQ ID No.289;

(115) formed by complementation of the sense strand shown in SEQ ID No.125 and the antisense strand shown in SEQ ID No.290;

(116) formed by complementation of the sense strand shown in SEQ ID No.126 and the antisense strand shown in SEQ ID No.291;

(117) formed by complementation of the sense strand shown in SEQ ID No.127 and the antisense strand shown in SEQ ID No.292;

(118) formed by complementation of the sense strand shown in SEQ ID No.128 and the antisense strand shown in SEQ ID No.293;

(119) formed by complementation of the sense strand shown in SEQ ID No.129 and the antisense strand shown in SEQ ID No.294;

(120) formed by complementation of the sense strand shown in SEQ ID No.130 and the antisense strand shown in SEQ ID No.295;

(121) complementary to the sense strand shown in SEQ ID No.131 and the antisense strand shown in SEQ ID No.296;

(122) formed by complementation of the sense strand shown in SEQ ID No.132 and the antisense strand shown in SEQ ID No.297;

(123) formed by complementation of the sense strand shown in SEQ ID No.133 and the antisense strand shown in SEQ ID No.298;

(124) complementary to the sense strand shown in SEQ ID No.134 and the antisense strand shown in SEQ ID No.299;

(125) formed by complementation of the sense strand shown in SEQ ID No.135 and the antisense strand shown in SEQ ID No.300;

(126) formed by complementation of the sense strand shown in SEQ ID No.136 and the antisense strand shown in SEQ ID No.301;

(127) formed by complementation of the sense strand shown in SEQ ID No.137 and the antisense strand shown in SEQ ID No.302;

(128) formed by complementation of the sense strand shown in SEQ ID No.138 and the antisense strand shown in SEQ ID No.303;

(129) formed by complementation of the sense strand shown in SEQ ID No.139 and the antisense strand shown in SEQ ID No.304;

(130) formed by complementation of the sense strand shown in SEQ ID No.140 and the antisense strand shown in SEQ ID No.305;

(131) formed by complementation of the sense strand shown in SEQ ID No.141 and the antisense strand shown in SEQ ID No.306;

(132) formed by complementation of the sense strand shown in SEQ ID No.142 and the antisense strand shown in SEQ ID No.307;

(133) formed by complementation of the sense strand shown in SEQ ID No.143 and the antisense strand shown in SEQ ID No.308;

(134) formed by complementation of the sense strand shown in SEQ ID No.144 and the antisense strand shown in SEQ ID No.309;

(135) formed by complementation of the sense strand shown in SEQ ID No.145 and the antisense strand shown in SEQ ID No.310;

(136) complementary to the sense strand shown in SEQ ID No.146 and the antisense strand shown in SEQ ID No.311;

(137) formed by complementation of the sense strand shown in SEQ ID No.147 and the antisense strand shown in SEQ ID No.312;

(138) formed by complementation of the sense strand shown in SEQ ID No.148 and the antisense strand shown in SEQ ID No.313;

(139) complementary to the sense strand shown in SEQ ID No.149 and the antisense strand shown in SEQ ID No.314;

(140) formed by complementation of the sense strand shown in SEQ ID No.150 and the antisense strand shown in SEQ ID No.315;

(141) formed by complementation of the sense strand shown in SEQ ID No.151 and the antisense strand shown in SEQ ID No.316;

(142) formed by complementation of the sense strand shown in SEQ ID No.152 and the antisense strand shown in SEQ ID No.317;

(143) formed by complementation of the sense strand shown in SEQ ID No.153 and the antisense strand shown in SEQ ID No.318;

(144) formed by complementation of the sense strand shown in SEQ ID No.154 and the antisense strand shown in SEQ ID No.319;

(145) formed by complementation of the sense strand shown in SEQ ID No.155 and the antisense strand shown in SEQ ID No.320;

(146) formed by complementation of the sense strand shown in SEQ ID No.156 and the antisense strand shown in SEQ ID No.321;

(147) formed by complementation of the sense strand shown in SEQ ID No.157 and the antisense strand shown in SEQ ID No.322;

(148) formed by complementation of the sense strand shown in SEQ ID No.158 and the antisense strand shown in SEQ ID No.323;

(149) formed by complementation of the sense strand shown in SEQ ID No.159 and the antisense strand shown in SEQ ID No.324;

(150) formed by complementation of the sense strand shown in SEQ ID No.160 and the antisense strand shown in SEQ ID No.325;

(151) formed by complementation of the sense strand shown in SEQ ID No.161 and the antisense strand shown in SEQ ID No.326;

(152) complementary to the sense strand shown in SEQ ID No.162 and the antisense strand shown in SEQ ID No.327;

(153) formed by complementation of the sense strand shown in SEQ ID No.163 and the antisense strand shown in SEQ ID No.328;

(154) formed by complementation of the sense strand shown in SEQ ID No.164 and the antisense strand shown in SEQ ID No.329;

(155) formed by complementation of the sense strand shown in SEQ ID No.165 and the antisense strand shown in SEQ ID No.330;

(156) formed by complementation of the sense strand shown in SEQ ID No.166 and the antisense strand shown in SEQ ID No.331;

(157) formed by complementation of the sense strand shown in SEQ ID No.167 and the antisense strand shown in SEQ ID No.332;

(158) formed by complementation of the sense strand shown in SEQ ID No.168 and the antisense strand shown in SEQ ID No.333;

(159) formed by complementation of the sense strand shown in SEQ ID No.169 and the antisense strand shown in SEQ ID No.334;

(160) formed by complementation of the sense strand shown in SEQ ID No.170 and the antisense strand shown in SEQ ID No.335;

(161) formed by complementation of the sense strand shown in SEQ ID No.171 and the antisense strand shown in SEQ ID No.336;

(162) formed by complementation of the sense strand shown in SEQ ID No.172 and the antisense strand shown in SEQ ID No.337;

(163) formed by complementation of the sense strand shown in SEQ ID No.173 and the antisense strand shown in SEQ ID No.338;

(164) formed by complementation of the sense strand shown in SEQ ID No.174 and the antisense strand shown in SEQ ID No.339;

(165) formed by complementation of the sense strand shown in SEQ ID No.175 and the antisense strand shown in SEQ ID No.340;

(166) formed by complementation of the sense strand shown in SEQ ID No.11 and the antisense strand shown in SEQ ID No.351;

(167) formed by complementation of the sense strand shown in SEQ ID No.18 and the antisense strand shown in SEQ ID No.352;

(168) formed by complementation of the sense strand shown in SEQ ID No.19 and the antisense strand shown in SEQ ID No.353;

(169) formed by complementation of the sense strand shown in SEQ ID No.20 and the antisense strand shown in SEQ ID No.354;

(170) formed by complementation of the sense strand shown in SEQ ID No.21 and the antisense strand shown in SEQ ID No.355;

(171) formed by complementation of the sense strand shown in SEQ ID No.23 and the antisense strand shown in SEQ ID No.356;

(172) formed by complementation of the sense strand shown in SEQ ID No.24 and the antisense strand shown in SEQ ID No.357;

(173) formed by complementation of the sense strand shown in SEQ ID No.25 and the antisense strand shown in SEQ ID No.358;

(174) formed by complementation of the sense strand shown in SEQ ID No.31 and the antisense strand shown in SEQ ID No.359;

(175) formed by complementation of the sense strand shown in SEQ ID No.32 and the antisense strand shown in SEQ ID No.360;

(176) formed by complementation of the sense strand shown in SEQ ID No.33 and the antisense strand shown in SEQ ID No.361;

(177) formed by complementation of the sense strand shown in SEQ ID No.34 and the antisense strand shown in SEQ ID No.362;

(178) formed by complementation of the sense strand shown in SEQ ID No.43 and the antisense strand shown in SEQ ID No.363;

(179) formed by complementation of the sense strand shown in SEQ ID No.44 and the antisense strand shown in SEQ ID No.364;

(180) formed by complementation of the sense strand shown in SEQ ID No.45 and the antisense strand shown in SEQ ID No.365;

(181) formed by complementation of the sense strand shown in SEQ ID No.46 and the antisense strand shown in SEQ ID No.366;

(182) formed by complementation of the sense strand shown in SEQ ID No.47 and the antisense strand shown in SEQ ID No.367;

(183) formed by complementation of the sense strand shown in SEQ ID No.49 and the antisense strand shown in SEQ ID No.368;

(184) formed by complementation of the sense strand shown in SEQ ID No.50 and the antisense strand shown in SEQ ID No.369;

(185) formed by complementation of the sense strand shown in SEQ ID No.51 and the antisense strand shown in SEQ ID No.370;

(186) formed by complementation of the sense strand shown in SEQ ID No.52 and the antisense strand shown in SEQ ID No.371;

(187) formed by complementation of the sense strand shown in SEQ ID No.53 and the antisense strand shown in SEQ ID No.372;

(188) formed by complementation of the sense strand shown in SEQ ID No.54 and the antisense strand shown in SEQ ID No.373;

(189) formed by complementation of the sense strand shown in SEQ ID No.56 and the antisense strand shown in SEQ ID No.374;

(190) formed by complementation of the sense strand shown in SEQ ID No.57 and the antisense strand shown in SEQ ID No.375;

(191) formed by complementation of the sense strand shown in SEQ ID No.58 and the antisense strand shown in SEQ ID No.376;

(192) formed by complementation of the sense strand shown in SEQ ID No.59 and the antisense strand shown in SEQ ID No.377;

(193) formed by complementation of the sense strand shown in SEQ ID No.60 and the antisense strand shown in SEQ ID No.378;

(194) formed by complementation of the sense strand shown in SEQ ID No.61 and the antisense strand shown in SEQ ID No.379;

(195) formed by complementation of the sense strand shown in SEQ ID No.70 and the antisense strand shown in SEQ ID No.380;

(196) formed by complementation of the sense strand shown in SEQ ID No.341 and the antisense strand shown in SEQ ID No.381;

(197) formed by complementation of the sense strand shown in SEQ ID No.342 and the antisense strand shown in SEQ ID No.382;

(198) formed by complementation of the sense strand shown in SEQ ID No.343 and the antisense strand shown in SEQ ID No.383;

(199) formed by complementation of the sense strand shown in SEQ ID No.344 and the antisense strand shown in SEQ ID No.384;

(200) formed by complementation of the sense strand shown in SEQ ID No.345 and the antisense strand shown in SEQ ID No.385;

(201) formed by complementation of the sense strand shown in SEQ ID No.346 and the antisense strand shown in SEQ ID No.386;

(202) complementary to the sense strand shown in SEQ ID No.347 and the antisense strand shown in SEQ ID No.387;

(203) formed by complementation of the sense strand shown in SEQ ID No.348 and the antisense strand shown in SEQ ID No.388;

(204) formed by complementation of the sense strand shown in SEQ ID No.349 and the antisense strand shown in SEQ ID No.389;

(205) is formed by complementation of the sense strand shown in SEQ ID No. 350 and the antisense strand shown in SEQ ID No. 390.

Further, at least one nucleotide of the siRNA provided by the present invention may be modified.

In some embodiments provided by the present invention, the nucleotides at the 5' or 3' overhangs at the sense strand, antisense strand or both strands of the siRNA can be independently chemically modified. In some embodiments provided by the present invention, one or more nucleotides in the sense strand or antisense strand of the siRNA can be independently chemically modified.

The modifications may include, but are not limited to, any one or more of the following: 2'-fluoro modification, 2'-O-methyl modification, 2'-fluorothymidine modification, 2'-O-methoxyethyl yl-5-methyluridine modification, 2`-O-methoxyethyladenosine modification, 2`-O-methoxyethyl-5-methylcytidine modification, 2'-methoxyethyl base modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-deoxy modification, 2'-hydroxyl modification, phosphorothioate backbone modification, locked nucleic acid modification, fluorescent probe modification, Ligand modification, or any combination thereof.

In some embodiments of the invention, the 5' or 3' overhang at the sense strand, antisense strand, or both strands of the siRNA may be phosphorylated, eg, the overhang region(s) contain two A nucleotide with a phosphorothioate between the two nucleotides, where the two nucleotides may be the same or different. In one embodiment of the invention, the overhang is present at the 3' end of the sense strand, the antisense strand, or both strands.

In some embodiments of the present invention, at least one nucleotide of the sense strand, at least one nucleotide of the antisense strand, or at least one nucleotide of both strands of the siRNA is a modified nucleotide. In some embodiments of the invention, the majority of nucleotides on the sense strand are modified nucleotides, the majority of nucleotides on the antisense strand are modified nucleotides, or the majority of nucleotides on both strands are Modified Nucleotides. In some embodiments of the invention, all nucleotides on the sense strand are modified nucleotides, all nucleotides on the antisense strand are modified nucleotides, or all nucleotides on both strands are modified nucleotides Glycosides.

In some embodiments of the present invention, the 7th and 9th positions of the sense strand constituting the siRNA are 2'-F modified nucleotides, and the 1, 2, and 3 positions are passed through phosphorothioate dinucleotides. Ester linkage, the 1st, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 nucleotides are all 2' -OMe-modified nucleotides; 2'-F modified nucleotides at

positions

2, 4, 5, 6, 8, 10, 12, 14, 16, and 18 of the antisense strand constituting the siRNA , the 1st, 2nd, and 3rd positions are connected by thiophosphodiester bonds, the 19th, 20th, and 21st positions are connected by thiophosphodiester bonds, the 1st, 3rd, 7th, 9th, 11th, 13th, The 15, 17, 19, 20 and 21 nucleotides are all 2'-OMe modified nucleotides.

Such said siRNAs have siRNAs that can be identified as GR90168.1, GR90243.1, GR90303.1 or GR90320.1 in Table 5 of the Examples section.

In some embodiments provided by the present invention, positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and

positions

1 and 3 , 5, 7, 9-11, 13, 15, 17, 19, 21 are nucleotides modified by 2'-F, and the 1, 2, and 3 positions are connected by phosphorothioate bonds; the

The

1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 23 positions of the siRNA antisense strand are 2'-OMe modified nucleotides, the 2, 4, 6, 8, 10, 14, 16, 18, 20, 22 are 2′-F modified nucleotides, connected by phosphorothioate bonds between the 1, 2, and 3 positions, and between the 19, 20, and 21 positions Linked by phosphorothioate bond.

positions

The

1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22 23rd positions of the siRNA antisense strand are 2'-OMe modified nucleotides, 2, 4, 6, 8 , 10, 14, 16, 18, 20 are 2′-F modified nucleotides, the 1, 2, and 3 positions are connected by a phosphorothioate bond, and the 19, 20, and 21 positions are connected by Phosphorothioate linkages.

In some embodiments provided by the present invention, positions 2, 4, 6, 8, 12, 14-21 of the sense strand of the siRNA are 2'-OMe modified nucleotides,

positions

1, 3, 5, 7 , 9-11, 13 positions are 2'-F modified nucleotides, and the 1, 2, and 3 positions are connected by phosphorothioate bonds; the 1, 3, 5- of the siRNA antisense strand 7,9,11-13,15,17-19,21,22,23 are 2'-OMe modified nucleotides, 2,4,8,10,14,16,20 are 2'- The F-modified nucleotides are linked by phosphorothioate bonds between

positions

1, 2, and 3, and linked by phosphorothioate bonds between

positions

19, 20, and 21.

In some embodiments provided by the present invention, positions 1-6, 8, 10-21 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 7 and 9 are 2'-F modified nucleotides Nucleotides, connected by phosphorothioate bonds between

positions

1, 2, and 3; the first, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22, 23 are 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 are 2'-F modified nucleotides, 1, 2, 3 They are connected by thiophosphodiester bonds, and the 19th, 20th, and 21st positions are connected by thiophosphodiester bonds.

positions

1, 2, and 3;

positions

1, 3, 7, 9, 11, 13, 15, 17, 19-23 of the siRNA antisense strand 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are 2'-F modified nucleotides, between

positions

1, 2, and 3 It is connected by a phosphorothioate bond, and the 19th, 20th, and 21st positions are connected by a phosphorothioate bond.

In some embodiments provided by the present invention, positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand of the siRNA are 2'-OMe-modified nucleotides, and the first, 3, 5, 7, 9, 10, 13, 15, 17, 19, 21 are 2′-F modified nucleotides, the 11th position is LNA modified nucleotides, and the 1st, 2nd, and 3rd positions are The siRNA is connected by a phosphorothioate bond; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, and 23 positions of the siRNA antisense strand are 2'-OMe modified

cores

2,4,6,8,10,14,16,18,20,22 is a nucleotide modified by 2′-F, through phosphorothioate between the 1, 2, and 3 positions Bonding, the 19th, 20th, 21st positions are connected by a phosphorothioate bond.

positions

1 and 3 , 5, 7, 9, 10, 13, 15, 17, 19, 21 are 2′-F modified nucleotides, 11 is LNA modified nucleotides, between

positions

1, 2, and 3 Linked by phosphorothioate bond; the 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22, 23 positions of the siRNA antisense strand are 2'-OMe modified Nucleotides, 2'-F modified nucleotides at

positions

2, 4, 6, 8, 10, 14, 16, 18, and 20, with phosphorothioate bonds between

positions

1, 2, and 3 Linked, the 19th, 20th, and 21st positions are connected by phosphorothioate bonds.

positions

1, 3, 5, 7 , 9, 10, and 13 are 2′-F modified nucleotides, the 11th position is LNA-modified nucleotides, and the 1, 2, and 3 positions are connected by a phosphorothioate bond; the

The

1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22, 23 positions of the siRNA antisense strand are 2'-OMe modified nucleotides, and the 2, 4, 8, The 10, 14, 16, and 20 positions are 2′-F modified nucleotides. The 1, 2, and 3 positions are connected by a phosphorothioate bond, and the 19, 20, and 21 positions are connected by a phosphorothioate bond. diester linkage.

In some embodiments provided by the present invention, positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 7 and 9 are 2'-F Modified nucleotides, the 11th position is LNA modified nucleotides, and the 1st, 2nd, and 3rd positions are connected by phosphorothioate bonds; the 1, 3, 5-7 of the siRNA antisense strand ,9,11-13,15,17-19,21,22,23 are 2'-OMe modified nucleotides, 2,4,8,10,14,16,20 are 2'-F The modified nucleotides are connected by phosphorothioate bonds between

positions

1, 2, and 3, and are connected by phosphorothioate bonds between

positions

19, 20, and 21.

In some embodiments provided by the present invention, positions 1-6, 8, 10, 12-21 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 7 and 9 are 2'-F Modified nucleotides, the 11th position is LNA-modified nucleotides, and the 1, 2, and 3 positions are connected by phosphorothioate bonds; the 1, 3, 7, 9, 11, 13, 15, 17, 19-23 are 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are 2'-F modified The nucleotides of 1, 2, and 3 are connected by phosphorothioate bonds, and the 19th, 20, and 21 positions are connected by phosphorothioate bonds.

In some embodiments provided by the present invention, positions 1-6, 8, 10-22 of the sense strand of the siRNA are 2'-OMe modified nucleotides, and positions 7 and 9 are 2'-F modified nucleotides Nucleotides, the 11th position is a deoxyribonucleotide, and the 1st, 2nd, and 3rd positions are connected by a phosphorothioate bond; the 1, 3, 7, 9, 11, 13, 15, 17, 19-23 are 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are 2'-F modified nucleotides , the 1st, 2nd, and 3rd positions are connected by thiophosphodiester bonds, and the 19th, 20th, and 21st positions are connected by thiophosphodiester bonds.

The ligands include, but are not limited to, GalNAc, cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylglucosamine derivatives or analogs.

In some embodiments of the invention, the siRNA is ligand-modified. In a preferred embodiment of the present invention, the ligand is conjugated to the 3' end of the sense strand of the siRNA. The ligand is a GalNAc ligand. In a particularly preferred embodiment, the ligand is GalNAc3, as shown in formula I; the schematic diagram of its conjugation to the 3' end of the sense strand of siRNA is shown in formula II.

In formula II, X is O or S. In one embodiment, X is O.

The GalNAc3-modified siRNA provided by the present invention has a sense strand and an antisense strand as shown in GR90168.34; or a sense strand and an antisense strand as shown in GR90168.35 (see Table 13 for details).

The GalNAc3-modified siRNA provided by the present invention has a sense strand and an antisense strand as shown in GR90243.53; or a sense strand and an antisense strand as shown in GR90243.54 (see Table 13 for details).

The GalNAc3-modified siRNA provided by the present invention has a sense strand and an antisense strand as shown in GR90303.72; or a sense strand and an antisense strand as shown in GR90303.73 (see Table 13 for details).

The GalNAc3-modified siRNA provided by the present invention has a sense strand and an antisense strand as shown in GR90320.91; or a sense strand and an antisense strand as shown in GR90320.92 (see Table 13 for details).

In a specific embodiment of the present invention, the siRNA (after modification) is specifically any of the following:

(1) Sense strand: CmsCmsCmGmUmGmCfGmCfAmGmGmAmGmGmAmCmGmAmGmGm; Antisense strand: UmsCfsGmUfCfCfUmCfCmUfGmCfGmCfAmCfGmGfGmsCmsGm;

(2) Sense strand: CmsCmsGmAmAmGmCfAmCfCmCmGmAmGmCmAmCmGmGmAmAm; Antisense strand: CmsCfsGmUfGfCfUmCfGmGfGmUfGmCfUmUfCmGfGmsCmsCm;

(3) Sense strand: CmsGmsAmAmGmCmAfCmCfCmGmAmGmCmAmCmGmGmAmAmCm; Antisense strand: UmsCfsCmGfUfGfCmUfCmGfGmGfUmGfCmUfUmCfGmsGmsCm;

(4) Sense strand: AmsCmsCmCmGmAmGfCmAfCmGmGmAmAmCmCmAmCmAmGmCm; Antisense strand: UmsGfsUmGfGfUfUmCfCmGfUmGfCmUfCmGfGmGfUmsGmsCm;

(5) Sense strand: CmsCmsGmAmGmCmAfCmGfGmAmAmCmCmAmCmAmGmCmCmAm; Antisense strand: GmsCfsUmGfUfGfGmUfUmCfCmGfUmGfCmUfCmGfGmsGmsUm;

(6) Sense strand: GmsAmsGmAmCmCmCfAmCfCmUmCmUmCmGmCmAmGmUmCmAm; antisense strand: AmsCfsUmGfCfGfAmGfAmGfGmUfGmGfGmUfCmUfCmsCmsUm;

(7) Sense strand: CmsUmsCmUmCmGmCfAmGfUmCmAmGmAmGmCmGmCmAmCmUm; Antisense strand: UmsGfsCmGfCfUfCmUfGmAfCmUfGmCfGmAfGmAfGmsGmsUm;

(8) Sense strand: CmsCmsCmGmCmCmGfGmGfGmAmUmAmCmCmUmCmAmCmCmAm; Antisense strand: GmsUfsGmAfGfGfUmAfUmCfCmCfCmGfGmCfGmGfGmsCmsAm;

(9) Sense strand: GmsGmsGmGmAmUmAfCmCfUmCmAmCmCmCamAmGmamUmCmCm; Antisense strand: AmsUfsCmUfUfGfGmUfGmAfGmGfUmAfUmCfCmCfCfCmsGmsGm;

(10) Sense strand: GmsGmsGmAmUmAmCfCmUfCmAmCmCmAmAmGmAmUmCmCmUm; Antisense strand: GmsAfsUmCfUfUfGmGfUmGfAmGfGmUfAmUfCmCfCmsCmsGm;

(11) Sense strand: AmsCmsCmAmAmGmAfUmCfCmUmGmCmAmUmGmUmCmUmUmCm; antisense strand: AmsGfsAmCfAfUfGmCfAmGfGmAfUmCfUmUfGmGfUmsGmsAm;

(12) Sense strand: AmsCmsGmGmAmUmGfGmCfCmAmCmAmGmCmCmGmUmCmGmCm; Antisense strand: GmsAfsCmGfGfCfUmGfUmGfGmCfCmAfUmCfCmGfUmsGmsUm;

(13) Sense strand: GmsAmsAmGmUmUmGfCmCfCmCmAmUmGmUmCmGmAmCmUmAm; antisense strand: GmsUfsCmGfAfCfAmUfGmGfGmGfCmAfAmCfUmUfCmsAmsAm;

(14) Sense strand: CmsCmsCmAmUmGmUfCmGfAmCmUmAmCmAmUmCmGmAmGmGm; Antisense strand: UmsCfsGmAfUfGfUmAfGmUfCmGfAmCfAmUfGmGfGmsGmsCm;

(15) Sense strand: AmsCmsCmGmGmGmCfGmGfAmUmGmAmAmUmAmCmCmAmGmCm; Antisense strand: UmsGfsGmUfAfUfUmCfAmUfCmCfGmCfCmCfGmGfUmsAmsCm;

(16) Sense strand: UmsGmsGmUmCmAmCfCmGfAmCmUmUmCmGmAmGmAmAmUmGm; Antisense strand: UmsUfsCmUfCfGfAmAfGmUfCmGfGmUfGmAfCmCfAmsUmsGm;

(17) Sense strand: GmsUmsCmAmCmCmGfAmCfUmUmCmGmAmGmAmAmUmGmUmGm; Antisense strand: CmsAfsUmUfCfUfCmGfAmAfGmUfCmGfGmUfGmAfCmsCmsAm;

(18) Sense strand: CmsAmsCmCmGmAmCfUmUfCmGmAmGmAmAmUmGmUmGmCmCm; Antisense strand: CmsAfsCmAfUfUfCmUfCmGfAmAfGmUfCmGfGmUfGmsAmsCm;

(19) Sense strand: AmsCmsCmGmAmCmUfUmCfGmAmGmAmAmUmGmUmGmCmCmCm; Antisense strand: GmsCfsAmCfAfUfUmCfUmCfGmAfAmGfUmCfGmGfUmsGmsAm;

(20) Sense strand: AmsCmsUmUmCmGmAfGmAfAmUmGmUmGmCmCmCmGmAmGmGm; Antisense strand: UmsCfsGmGfGfCfAmCfAmUfUmCfUmCfGmAfAmGfUmsCmsGm;

(21) Sense strand: GmsAmsCmCmAmAmCfUmUfUmGmGmCmCmGmCmUmGmUmGmUm; antisense strand: AmsCfsAmGfCfGfGmCfCmAfAmAfGmUfUmGfGmUfCmsCmsCm;

(22) Sense strand: CmsCmsAmAmCmUmUfUmGfGmCmCmGmCmUmGmUmGmUmGmGm; antisense strand: AmsCfsAmCfAfGfCmGfGmCfCmAfAmAfGmUfUmGfGmsUmsCm;

(23) Sense strand: UmsGmsGmAmCmCmUfCmUfUmUmGmCmCmCmCmAmGmGmGmGm; Antisense strand: CmsCfsUmGfGfGfGmCfAmAfAmGfAmGfGmUfCmCfAmsCmsAm;

(24) Sense strand: CmsGmsCmUmGmUmGfUmGfGmAmCmCmUmCmUmUmUmGmCmCm; Antisense strand: CmsAfsAmAfGfAfGmGfUmCfCmAfCmAfCmAfGmCfGmsGmsCm;

(25) Sense strand: CmsGmsGmAmGmCmUfCmAfCmCmCmUmGmGmCmCmGmAmGmUm; Antisense strand: UmsCfsGmGfCfCfAmGfGmGfUmGfAmGfCmUfCmCfGmsGmsCm;

(26) Sense strand: CmsUmsGmUmUmUmUfGmCfAmGmGmAmCmUmGmUmAmUmGmGm; Antisense strand: AmsUfsAmCfAfGfUmCfCmUfGmCfAmAfAmAfCmAfGmsCmsUm;

(27) Sense strand: GmsGmsAmCmUmGmUfAmUfGmGmUmCmAmGmCmAmCmAmCmUm; Antisense strand: UmsGfsUmGfCfUfGmAfCmCfAmUfAmCfAmGfUmCfCmsUmsGm;

(28) Sense strand: GmsGmsGmCmGmAmGfCmGfCmAmUmGmGmAmGmGmCmCmCmAm; Antisense strand: GmsGfsCmCfUfCfCmAfUmGfCmGfCmUfCmGfCmCfCmsCmsGm;

(29) Sense strand: CmsGmsAmGmCmGmCfAmUfGmGmAmGmGmCmCmCmAmAmGmGm; Antisense strand: UmsUfsGmGfGfCfCmUfCmCfAmUfGmCfGmCfUmCfGmsCmsCm;

(30) Sense strand: GmsGmsGmGmCmAmAfGmCfUmGmGmUmCmUmGmCmCmGmGmGm; antisense strand: CmsGfsGmCfAfGfAmCfCmAfGmCfUmUfGmCfCmCfCmsCmsUm;

(31) Sense strand: GmsGmsGmCmAmAmGfCmUfGmGmUmCmUmGmCmCmGmGmGmCm; antisense strand: CmsCfsGmGfCfAfGmAfCmCfAmGfCmUfUmGfCmCfCmsCmsCm;

(32) Sense strand: UmsGmsGmUmCmUmGfCmCfGmGmGmCmCmCmAmCmamAmCmGm; Antisense strand: UmsUfsGmUfGfGfGmCfCmCfGmGfCmAfGmAfCmCfAmsGmsCm;

(33) Sense strand: CmsAmsCmAmAmCmGfCmUfUmUmUmGmGmGmGmGmUmGmAmGm; antisense strand: CmsAfsCmCfCfCfCmAfAmAfAmGfCmGfUmUfGmUfGmsGmsGm;

(34) Sense strand: AmsCmsAmAmCmGmCfUmUfUmUmGmGmGmGmGmUmGmAmGmGm; antisense strand: UmsCfsAmCfCfCfCmCfAmAfAmAfGmCfGmUfUmGfUmsGmsGm;

(35) Sense strand: CmsAmsAmCmGmCmUfUmUfUmGmGmGmGmGmUmGmAmGmGmGm; Antisense strand: CmsUfsCmAfCfCfCmCfCmAfAmAfAmGfCmGfUmUfGmsUmsGm;

(36) Sense strand: GmsUmsGmAmGmGmGfUmGfUmCmUmAmCmGmCmCmAmUmUmGm; Antisense strand: AmsUfsGmGfCfGfUmAfGmAfCmAfCmCfCmUfCmAfCmsCmsCm;

(37) Sense strand: UmsGmsAmGmGmGmUfGmUfCmUmAmCmGmCmCmAmUmUmGmCm; antisense strand: AmsAfsUmGfGfCfGmUfAmGfAmCfAmCfCmCfUmCfAmsCmsCm;

(38) Sense strand: GmsAmsGmGmGmUmGfUmCfUmAmCmGmCmCmAmUmUmGmCmCm; antisense strand: CmsAfsAmUfGfGfCmGfUmAfGmAfCmAfCmCfCmUfCmsAmsCm;

(39) Sense strand: GmsGmsGmUmGmUmCfUmAfCmGmCmCmAmUmUmGmCmCmAmGm; antisense strand: GmsGfsCmAfAfUfGmGfCmGfUmAfGmAfCmAfCmCfCmsUmsCm;

(40) Sense strand: GmsGmsUmGmUmCmUfAmCfGmCmCmAmUmUmGmCmCmAmGmGm; antisense strand: UmsGfsGmCfAfAfUmGfGmCfGmUfAmGfAmCfAmCfCmsCmsUm;

(41) Sense strand: GmsUmsGmUmCmUmAfCmGfCmCmAmUmUmGmCmCmAmGmGmUm; Antisense strand: CmsUfsGmGfCfAfAmUfGmGfCmGfUmAfGmAfCmAfCmsCmsCm;

(42) Sense strand: UmsGmsUmCmUmAmCfGmCfCmAmUmUmGmCmCmAmGmGmUmGm; Antisense strand: CmsCfsUmGfGfCfAmAfUmGfGmCfGmUfAmGfAmCfAmsCmsCm;

(43) Sense strand: CmsUmsAmCmGmCmCfAmUfUmGmCmCmAmGmGmUmGmCmUmGm; antisense strand: GmsCfsAmCfCfUfGmGfCmAfAmUfGmGfCmGfUmAfGmsAmsCm;

(44) Sense strand: UmsAmsCmGmCmCmAfUmUfGmCmCmAmGmGmUmGmCmUmGmCm; antisense strand: AmsGfsCmAfCfCfUmGfGmCfAmAfUmGfGmCfGmUfAmsGmsAm;

(45) Sense strand: GmsAmsCmCmCmGmUfGmUfCmCmAmCmUmGmCmCmAmCmCmAm; antisense strand: GmsUfsGmGfCfAfGmUfGmGfAmCfAmCfGmGfGmUfCmsCmsCm;

(46) Sense strand: CmsCmsUmUmGmGmCfAmCfCmCmAmCmAmAmGmCmCmGmCmCm; Antisense strand: CmsGfsGmCfUfUfGmUfGmGfGmUfGmCfCmAfAmGfGmsUmsCm;

(47) Sense strand: CmsAmsCmCmCmAmCfAmAfGmCmCmGmCmCmUmGmUmGmCmUm; antisense strand: CmsAfsCmAfGfGfCmGfGmCfUmUfGmUfGmGfGmUfGmsCmsCm;

(48) Sense strand: CmsCmsCmAmCmAmAfGmCfCmGmCmCmUmGmUmGmCmUmGmAm; Antisense strand: AmsGfsCmAfCfAfGmGfCmGfGmCfUmUfGmUfGmGfGmsUmsGm;

(49) Sense strand: CmsCmsAmCmAmAmGfCmCfGmCmCmUmGmUmGmCmUmGmAmGm; Antisense strand: CmsAfsGmCfAfCfAmGfGmCfGmGfCmUfUmGfUmGfGmsGmsUm;

(50) Sense strand: CmsCmsAmCmGmAmGfGmUfCmAmGmCmCmCmAmAmCmCmAmGm; Antisense strand: GmsGfsUmUfGfGfGmCfUmGfAmCfCmUfCmGfUmGfGmsCmsCm;

(51) Sense strand: CmsAmsCmGmAmGmGfUmCfAmGmCmCmCmAmAmCmCmAmGmUm; Antisense strand: UmsGfsGmUfUfGfGmGfCmUfGmAfCmCfUmCfGmUfGmsGmsCm;

(52) Sense strand: CmsGmsAmGmGmUmCfAmGfCmCmCmAmAmCmCmAmGmUmGmCm; Antisense strand: AmsCfsUmGfGfUfUmGfGmGfCmUfGmAfCmCfUmCfGmsUmsGm;

(53) Sense strand: GmsAmsGmGmUmCmAfGmCfCmCmAmAmCmCmAmGmUmGmCmGm; Antisense strand: CmsAfsCmUfGfGfUmUfGmGfGmCfUmGfAmCfCmUfCmsGmsUm;

(54) Sense strand: CmsCmsAmAmCmCmAfGmUfGmCmGmUmGmGmGmCmCmAmCmAm; antisense strand: UmsGfsGmCfCfCfAmCfGmCfAmCfUmGfGmUfUmGfGmsGmsCm;

(55) Sense strand: AmsGmsUmGmCmGmUfGmGfGmCmCmAmCmAmGmGmGmAmGmGm; antisense strand: UmsCfsCmCfUfGfUmGfGmCfCmCfAmCfGmCfAmCfUmsGmsGm;

(56) Sense strand: AmsCmsGmCmCmGmUfAmGfAmCmAmAmCmAmCmGmUmGmUmGm; Antisense strand: CmsAfsCmGfUfGfUmUfGmUfCmUfAmCfGmGfCmGfUmsAmsGm;

(57) Sense strand: CmsCmsGmUmAmGmAfCmAfAmCmAmCmGmUmGmUmGmUmAmGm; Antisense strand: AmsCfsAmCfAfCfGmUfGmUfUmGfUmCfUmAfCmGfGmsCmsGm;

(58) Sense strand: CmsGmsUmAmGmAmCfAmAfCmAmCmGmUmGmUmGmUmAmGmUm; Antisense strand: UmsAfsCmAfCfAfCmGfUmGfUmUfGmUfCmUfAmCfGmsGmsCm;

(59) Sense strand: GmsUmsAmGmAmCmAfAmCfAmCmGmUmGmUmGmUmAmGmUmCm; Antisense strand: CmsUfsAmCfAfCfAmCfGmUfGmUfUmGfUmCfUmAfCmsGmsGm;

(60) Sense strand: GmsUmsCmAmGmGmAfGmCfCmGmGmGmamCmGmUmCmAmGmCm; antisense strand: UmsGfsAmCfGfUfCmCfCmGfGmCfUmCfCmUfGmAfCmsUmsAm;

(61) Sense strand: GmsGmsCmUmGmGmGfGmCfUmGmAmGmCmUmUmUmAmAmAm; Antisense strand: CmsAfsUmUfUfUfAmAfAmGfCmUfCmAfGmCfCmCfCmsAmsGm;

(62) Sense strand: UmsGmsGmGmGmCmUfGmAfGmCmUmUmUmAmAmAmUmGmGm; antisense strand: AmsAfsCmCfAfUfUmUfUmAfAmAfGmCfUmCfAmGfCmsCmsCm;

(63) Sense strand: GmsGmsGmCmUmGmAfGmCfUmUmUmAmAmAmUmGmGmUmUm; Antisense strand: GmsGfsAmAfCfCfAmUfUmUfUmAfAmAfGmCfUmCfAmsGmsCm;

(64) Sense strand: UmsGmsAmGmCmUmUfUmAfAmAmAmUmGmGmUmUmCmCmGmAm; Antisense strand: AmsGfsUmCfGfGfAmAfCmCfAmUfUmUfUmAfAmAfGmsCmsUm;

(65) Sense strand: UmsUmsAmAmAmAmUfGmGfUmUmCmCmGmAmCmUmUmGmUmCm; Antisense strand: GmsGfsGmAfCfAfAmGfUmCfGmGfAmAfCmCfAmUfUmsUmsUm;

(66) Sense strand: AmsAmsAmUmGmGmUfUmCfCmGmAmCmUmUmGmUmCmCmCmUm; antisense strand: AmsGfsAmGfGfGfAmCfAmAfGmUfCmGfGmAfAmCfCmsAmsUm;

(67) Sense strand: AmsUmsGmGmUmUmCfCmGfAmCmUmUmGmUmCmCmCmUmCmUm; antisense strand: AmsGfsAmGfAfGfGmGfAmCfAmAfGmUfCmGfGmAfAmsCmsCm;

(68) Sense strand: GmsUmsUmCmCmGmAfCmUfUmGmUmCmCmCmUmCmUmCmUmCm; antisense strand: CmsUfsGmAfGfAfGmAfGmGfGmAfCmAfAmGfUmCfGmsGmsAm;

(69) Sense strand: GmsCmsCmCmUmCmCfAmUfGmGmCmCmUmGmGmCmAmCmGmAm; Antisense strand: CmsCfsUmCfGfUfGmCfCmAfGmGfCmCfAmUfGmGfAmsGmsGm;

(70) Sense strand: GmsGmsCmCmUmGmGfCmAfCmGmAmGmGmGmGmAmUmGmGmGm; Antisense strand: UmsCfsCmCfCfAfUmCfCmCfCmUfCmGfUmGfCmCfAmsGmsGm;

(71) Sense strand: AmsGmsGmGmGmAmUfGmGfGmGmAmUmGmCmUmUmCmCmGmCm; Antisense strand: AmsGfsGmCfGfGfAmAfGmCfAmUfCmCfCmCfAmUfCmsCmsCm;

(72) Sense strand: GmsGmsGmAmUmGmGfGmGfAmUmGmCmUmUmCmCmGmCmCmUm; Antisense strand: AmsAfsAmGfGfCfGmGfAmAfGmCfAmUfCmCfCmCfAmsUmsCm;

(73) Sense strand: GmsGmsGmGmAmUmGfCmUfUmCmCmGmCmCmUmUmUmCmCmGm; antisense strand: CmsCfsCmGfGfAfAmAfGmGfCmGfGmAfAmGfCmAfUmsCmsCm;

(74) Sense strand: AmsUmsGmCmUmUmCfCmGfCmCmUmUmUmCmCmGmGmGmGmCm; antisense strand: CmsAfsGmCfCfCfCmGfGmAfAmAfGmGfCmGfGmAfAmsGmsCm;

(75) Sense strand: UmsUmsCmCmGmCmCfUmUfUmCmCmGmGmGmGmCmUmGmCmUm; antisense strand: CmsCfsAmGfCfAfGmCfCmCfCmGfGmAfAmAfGmGfCmsGmsGm;

(76) Sense strand: UmsCmsCmGmCmCmUfUmUfCmCmGmGmGmGmCmUmGmCmUmGm; antisense strand: GmsCfsCmAfGfCfAmGfCmCfCmCfGmGfAmAfAmGfGmsCmsGm;

(77) Sense strand: GmsGmsCmCmUmGmGfCmCfCmUmUmGmamGmUmGmGmGmGmCm; antisense strand: CmsUfsGmCfCfCfCmAfCmUfCmAfAmGfGmGfCmCfAmsGmsGm;

(78) Sense strand: CmsCmsUmCmCmUmUfGmCfCmUmGmGmAmAmCmUmCmAmCmUm; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmsGmsAm;

(79) Sense strand: CmsUmsCmCmUmUmGfCmCfUmGmGmAmAmCmUmCmAmCmUmCm; Antisense strand: GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmsGmsGm;

(80) Sense strand: CmsCmsUmUmGmCmCfUmGfGmAmAmCmUmCmAmCmUmCmAmCm; Antisense strand: GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmsAmsAm;

(81) Sense strand: CmsUmsUmGmCmCmUfGmGfAmAmCmUmCmAmCmUmCmAmCmUm; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmsCmsAm;

(82) Sense strand: UmsUmsGmCmCmUmGfGmAfAmCmUmCmAmCmUmCmAmCmUmCm; Antisense strand: CmsAfsGmAfGfUfGmAfGmUfGmAfGmUfUmCfCmAfGmsGmsCm;

(83) Sense strand: UmsGmsCmCmUmGmGfAmAfCmUmCmAmCmUmCmAmCmUmCmUm; Antisense strand: CmsCfsAmGfAfGfUmGfAmGfUmGfAmGfUmUfCmCfAmsGmsGm;

(84) Sense strand: GmsUmsGmGmAmGmGfUmGfCmCmAmGmGmAmAmGmCmUmCmCm; Antisense strand: AmsGfsGmGfAfGfCmUfUmCfCmUfGmGfCmAfCmCfUmsCmsCm;

(85) Sense strand: UmsGmsGmAmGmGmUfGmCfCmAmGmGmAmAmGmCmUmCmCmCm; Antisense strand: GmsAfsGmGfGfAfGmCfUmUfCmCfUmGfGmCfAmCfCmsUmsCm;

(86) Sense strand: CmsCmsCmUmCmAmCfUmGfUmGmGmGmGmCmAmUmUmUmCmAm; Antisense strand: GmsGfsUmGfAfAfAmUfGmCfCmCfCmAfCmAfGmUfGmsAmsGm;

(87) Sense strand: AmsCmsUmGmUmGmGfGmGfCmAmUmUmUmCmAmCmCmAmUmUm; Antisense strand: UmsGfsAmAfUfGfGmUfGmAfAmAfUmGfCmCfCmCfAmsCmsAm;

(88) Sense strand: CmsUmsGmUmGmGmGfGmCfAmUmUmUmCmAmCmCmAmUmUmCm; Antisense strand: UmsUfsGmAfAfUfGmGfUmGfAmAfAmUfGmCfCmCfCmsAmsCm;

(89) Sense strand: UmsGmsUmGmGmGmGfCmAfUmUmUmCmAmCmCmAmUmUmCmAm; Antisense strand: UmsUfsUmGfAfAfUmGfGmUfGmAfAmAfUmGfCmCfCmsCmsAm;

(90) sense strand: GmsUmsGmGmGmGmCfAmUfUmUmCmAmCmCmAmUmUmCmAmAm; antisense strand: GmsUfsUmUfGfAfAmUfGmGfUmGfAmAfAmUfGmCfCmsCmsCm;

(91) Sense strand: UmsGmsGmGmGmCmAfUmUfUmCmAmCmCmAmUmUmCmAmAmm; Antisense strand: UmsGfsUmUfUfGfAmAfUmGfGmUfGmAfAmAfUmGfCmsCmsCm;

(92) Sense strand: GmsGmsGmGmCmAmUfUmUfCmAmCmCmAmUmUmCmAmAmCm; Antisense strand: CmsUfsGmUfUfUfGmAfAmUfGmGfUmGfAmAfAmUfGmsCmsCm;

(93) Sense strand: GmsGmsGmCmAmUmUfUmCfAmCmCmCmAmUmUmCmAmAmAmCmAm; Antisense strand: CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmsGmsCm;

(94) Sense strand: GmsGmsCmAmUmUmUfCmAfCmCmAmUmUmCmAmAmAmCmAmGm; Antisense strand: AmsCfsCmUfGfUfUmUfGmAfAmUfGmGfUmGfAmAfAmsUmsGm;

(95) Sense strand: GmsCmsAmUmUmUmCfAmCfCmAmUmUmCmAmAmAmCmAmGmGm; Antisense strand: GmsAfsCmCfUfGfUmUfUmGfAmAfUmGfGmUfGmAfAmsAmsUm;

(96) Sense strand: CmsAmsUmUmUmCmAfCmCfAmUmUmCmAmAmAmCmAmGmGmUm; Antisense strand: CmsGfsAmCfCfUfGmUfUmUfGmAfAmUfGmGfUmGfAmsAmsAm;

(97) Sense strand: AmsUmsUmUmCmAmCfCmAfUmUmCmAmAmAmCmAmGmGmUmCm; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmsAmsAm;

(98) Sense strand: UmsCmsAmCmCmAmUfUmCfAmAmAmCmAmGmGmUmCmGmAmGm; Antisense strand: AmsGfsCmUfCfGfAmCfCmUfGmUfUmUfGmAfAmUfGmsGmsUm;

(99) Sense strand: CmsAmsCmCmAmUmUfCmAfAmAmCmAmGmGmUmCmGmAmGmCm; Antisense strand: CmsAfsGmCfUfCfGmAfCmCfUmGfUmUfUmGfAmAfUmsGmsGm;

(100) Sense strand: CmsUmsGmCmCmAmGfCmUfGmCmUmCmCmCmAmAmUmGmUmGm; Antisense strand: GmsGfsCmAfCfAfUmUfGmGfGmAfGmCfAmGfCmUfGmsGmsCm;

(101) Sense strand: GmsCmsCmAmGmCmUfGmCfUmCmCmCmAmAmUmGmUmGmCmCm; Antisense strand: UmsCfsGmGfCfAfCmAfUmUfGmGfGmAfGmCfAmGfCmsUmsGm;

(102) Sense strand: GmsCmsUmGmCmUmCfCmCfAmAmUmGmUmGmCmCmGmamUmGm; antisense strand: GmsAfsCmAfUfCfGmGfCmAfCmAfUmUfGmGfGmAfGmsCmsAm;

(103) Sense strand: CmsUmsGmCmUmCmCfCmAfAmUmGmUmGmCmCmGmAmUmGmUm; Antisense strand: GmsGfsAmCfAfUfCmGfGmCfAmCfAmUfUmGfGmGfAmsGmsCm;

(104) Sense strand: GmsCmsUmCmCmCmAfAmUfGmUmGmCmCmGmAmUmGmUmCmCm; Antisense strand: AmsCfsGmGfAfCfAmUfCmGfGmCfAmCfAmUfUmGfGmsGmsAm;

(105) Sense strand: CmsCmsAmAmUmGmUfGmCfCmGmAmUmGmUmCmCmGmUmGmGm; antisense strand: GmsCfsCmCfAfCfGmGfAmCfAmUfCmGfGmCfAmCfAmsUmsUm;

(106) Sense strand: CmsAmsAmUmGmUmGfCmCfGmAmUmGmUmCmCmGmUmGmGmGm; antisense strand: UmsGfsCmCfCfAfCmGfGmAfCmAfUmCfGmGfCmAfCmsAmsUm;

(107) Sense strand: UmsGmsCmCmGmAmUfGmUfCmCmGmUmGmGmGmCmAmGmAmAm; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmsGmsGm;

(108) Sense strand: CmsGmsAmUmGmUmCfCmGfUmGmGmGmCmAmGmAmAmUmGmAm; Antisense strand: AmsGfsUmCfAfUfUmCfUmGfCmCfCmAfCmGfGmAfCmsAmsUm;

(109) Sense strand: GmsAmsUmGmUmCmCfGmUfGmGmGmCmAmGmAmAmUmGmAmCm; Antisense strand: AmsAfsGmUfCfAfUmUfCmUfGmCfCmCfAmCfGmGfAmsCmsAm;

(110) Sense strand: AmsUmsGmUmCmCmGfUmGfGmGmCmAmGmAmAmUmGmamCmUm; Antisense strand: AmsAfsAmGfUfCfAmUfUmCfUmGfCmCfCmAfCmGfGmsAmsCm;

(111) Sense strand: UmsGmsUmCmCmGmUfGmGfGmCmAmGmAmAmUmGmAmCmUmUm; Antisense strand: AmsAfsAmAfGfUfCmAfUmUfCmUfGmCfCmCfAmCfGmsGmsAm;

(112) Sense strand: GmsUmsCmCmGmUmGfGmGfCmAmGmAmAmUmGmAmCmUmUmUm; Antisense strand: UmsAfsAmAfAfGfUmCfAmUfUmCfUmGfCmCfCmAfCmsGmsGm;

(113) Sense strand: AmsGmsAmAmUmGmAfCmUfUmUmUmUmUmUmGmAmGmCmUmCm; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmsUmsUm;

(114) Sense strand: UmsUmsUmAmUmUmGfAmGfCmUmCmUmUmGmUmUmCmCmGmUm; Antisense strand: GmsCfsAmCfGfGfAmAfCmAfAmGfAmGfCmUfCmAfAmsUmsAm;

(115) Sense strand: UmsUmsAmUmUmGmAfGmCfUmCmUmUmGmUmUmCmCmGmUmGm; Antisense strand: GmsGfsCmAfCfGfGmAfAmCfAmAfGmAfGmCfUmCfAmsAmsUm;

(116) Sense strand: GmsCmsUmCmUmUmGfUmUfCmCmGmUmGmCmCmAmGmGmCmAm; Antisense strand: AmsAfsUmGfCfCfUmGfGmCfAmCfGmGfAmAfCmAfAmsGmsAm;

(117) Sense strand: UmsCmsCmGmUmGmCfCmAfGmGmCmAmUmUmCmAmAmUmCmCm; Antisense strand: GmsAfsGmGfAfUfUmGfAmAfUmGfCmCfUmGfGmCfAmsCmsGm;

(118) Sense strand: GmsGmsCmAmGmGmAfUmUfCmUmUmCmCmCmAmUmGmGmamUm; Antisense strand: CmsUfsAmUfCfCfAmUfGmGfGmAfAmGfAmAfUmCfCmsUmsGm;

(119) Sense strand: AmsUmsGmGmCmCmCfUmCfAmUmCmUmCmCmAmGmCmUmAmAm; Antisense strand: AmsGfsUmUfAfGfCmUfGmGfAmGfAmUfGmAfGmGfGmsCmsCm;

(120) Sense strand: GmsCmsUmUmUmCmUfGmGfAmUmGmGmCmAmUmCmUmAmGmCm; Antisense strand: UmsGfsGmCfUfAfGmAfUmGfCmCfAmUfCmCfAmGfAmsAmsAm;

(121) Sense strand: UmsGmsGmCmAmUmCfUmAfGmCmCmAmGmAmGmGmCmUmGmGm; Antisense strand: CmsUfsCmCfAfGfCmCfUmCfUmGfGmCfUmAfGmAfUmsGmsCm;

(122) Sense strand: UmsGmsGmAmGmAmCfAmGfGmUmGmCmGmCmCmCmCmUmGmGm; antisense strand: CmsAfsCmCfAfGfGmGfGmCfGmCfAmCfCmUfGmUfCmsUmsCm;

(123) Sense strand: GmsGmsAmGmAmCmAfGmGfUmGmCmGmCmCmCmCmUmGmGmUm; antisense strand: CmsCfsAmCfCfAfGmGfGmGfCmGfCmAfCmCfUmGfUmsCmsUm;

(124) Sense strand: GmsAmsGmAmCmAmGfGmUfGmCmGmCmCmCmCmUmGmGmUmGm; Antisense strand: AmsCfsCmAfCfCfAmGfGmGfGmCfGmCfAmCfCmUfGmsUmsCm;

(125) Sense strand: AmsGmsAmCmAmGmGfUmGfCmGmCmCmCmCmUmGmGmUmGmGm; antisense strand: GmsAfsCmCfAfCfCmAfGmGfGmGfCmGfCmAfCmCfUmsGmsUm;

(126) Sense strand: AmsGmsGmUmGmCmGfCmCfCmCmUmGmGmUmGmGmUmCmAmCm; Antisense strand: CmsUfsGmUfGfAfCmCfAmCfCmAfGmGfGmGfCmGfCmsAmsCm;

(127) sense strand: UmsUmsUmCmCmUmGfAmGfCmCmAmCmCmUmUmUmAmCmUmCm; antisense strand: CmsAfsGmAfGfUfAmAfAmGfGmUfGmGfCmUfCmAfGmsGmsAm;

(128) Sense strand: GmsGmsCmCmUmGmGfCmGfGmAmGmAmUmGmCmUmUmCmUmAm; Antisense strand: CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmsGmsGm;

(129) Sense strand: GmsCmsUmUmUmUmGfUmAfAmCmUmUmGmAmAmGmAmUmAmUm; Antisense strand: AmsAfsAmUfAfUfCmUfUmCfAmAfGmUfUmAfCmAfAmsAmsAm;

(130) Sense strand: UfsUmsGfCmCfUmGfGmAfAfCfUmCfAmCfUmCfAmCfUmCf-GALNAC; Antisense strand: GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGfsGm;

(131) Sense strand: UfsUmsGfCmCfUmGfGmAfAfCfUmCfAmCfUmCfAmCfUmCf-GALNAC; Antisense strand: GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGmsGm;

(132) Sense strand: UfsUmsGfCmCfUmGfGmAfAfCfUmCfAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;

(133) Sense strand: UmsUmsGmCmCmUmGfGmAfAmCmUmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;

(134) Sense strand: UmsUmsGmCmCmUmGfGmAfAmCmUmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmAmAmsGmsGm;

(135) Sense strand: UfsUmsGfCmCfUmGfGmAfAfC(LNA)UmCfAmCfUmCfAmCfUmCf-GALNAC; Antisense strand: GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGfsGm;

(136) Sense strand: UfsUmsGfCmCfUmGfGmAfAfC(LNA)UmCfAmCfUmCfAmCfUmCf-GALNAC; Antisense strand: GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGmsGm;

(137) Sense strand: UfsUmsGfCmCfUmGfGmAfAfC(LNA)UmCfAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;

(138) Sense strand: UmsUmsGmCmCmUmGfGmAfAmC(LNA) UmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;

(139) Sense strand: UmsUmsGmCmCmUmGfGmAfAmC(LNA) UmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmAmAmsGmsGm;

(140) Sense strand: UmsUmsGmCmCmUmGfGmAfAmC(d) UmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmAmAmsGmsGm;

(141) Sense strand: UfsUfsGfCCUGGAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAGUGAGUUCCAGGCAAfsGfsGf;

(142) Sense strand: CHO-UfsUfsGfCCUGGAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAGUGAGUUCCAGGCAAfsGfsGf;

(143) Sense strand: UfsUfsGfCCUG(LNA)GAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAGUGAGUUCCAGGCAAfsGfsGf;

(144) Sense strand: UfsUfsGfCCUGGAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAG(LNA)UGAGUUCCAGGCAAfsGfsGf;

(145) Sense strand: UmsUmsGmCCUGGAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAGUGAGUUCCAGGCAAmsGmsGm;

(146) Sense strand: CHO-UmsUmsGmCCUGGAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAGUGAGUUCCAGGCAAmsGmsGm;

(147) Sense strand: UmsUmsGmCCUG(LNA)GAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAGUGAGUUCCAGGCAAmsGmsGm;

(148) Sense strand: UmsUmsGmCCUGGAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAG(LNA)UGAGUUCCAGGCAAmsGmsGm;

(149) Sense strand: GfsCmsAfUmUfUmCfAmCfCfAfUmUfCmAfAmAfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCfsCm;

(150) Sense strand: GfsCmsAfUmUfUmCfAmCfCfAfUmUfCmAfAmAfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCmsCm;

(151) Sense strand: GfsCmsAfUmUfUmCfAmCfCfAfUmUfCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCmsCm;

(152) Sense strand: GmsCmsAmUmUmUmCfAmCfCmAmUmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCmsCm;

(153) Sense strand: GmsCmsAmUmUmUmCfAmCfCmAmUmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmGmCmsCmsCm;

(154) Sense strand: GfsCmsAfUmUfUmCfAmCfCfA(LNA)UmUfCmAfAmAfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCfsCm;

(155) Sense strand: GfsCmsAfUmUfUmCfAmCfCfA(LNA)UmUfCmAfAmAfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCmsCm;

(156) Sense strand: GfsCmsAfUmUfUmCfAmCfCfA(LNA)UmUfCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCmsCm;

(157) Sense strand: GmsCmsAmUmUmUmCfAmCfCmA(LNA)UmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCmsCm;

(158) Sense strand: GmsCmsAmUmUmUmCfAmCfCmA(LNA)UmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmGmCmsCmsCm;

(159) Sense strand: GmsCmsAmUmUmUmCfAmCfCmA(d)UmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmGmCmsCmsCm;

(160) Sense strand: GfsCfsAfUUUCACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUUGAAUGGUGAAAUGCfsCfsCf;

(161) Sense strand: CHO-GfsCfsAfUUUCACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUUGAAUGGUGAAAUGCfsCfsCf;

(162) Sense strand: GfsCfsAfUUUC(LNA)ACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUUGAAUGGUGAAAUGCfsCfsCf;

(163) Sense strand: GfsCfsAfUUUCACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUU(LNA)GAAUGGUGAAAUGCfsCfsCf;

(164) Sense strand: GmsCmsAmUUUCACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUUGAAUGGUGAAAUGCmsCmsCm;

(165) Sense strand: CHO-GmsCmsAmUUUCACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUUGAAUGGUGAAAUGCmsCmsCm;

(166) Sense strand: GmsCmsAmUUUC(LNA)ACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUUGAAUGGUGAAAUGCmsCmsCm;

(167) Sense strand: GmsCmsAmUUUCACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUU(LNA)GAAUGGUGAAAUGCmsCmsCm;

(168) Sense strand: CfsCmsGfAmUfGmUfCmCfGfUfGmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCfsAm;

(169) Sense strand: CfsCmsGfAmUfGmUfCmCfGfUfGmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCmsAm;

(170) Sense strand: CfsCmsGfAmUfGmUfCmCfGfUfGmGfGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;

(171) Sense strand: CmsCmsGmAmUmGmUfCmCfGmUmGmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;

(172) Sense strand: CmsCmsGmAmUmGmUfCmCfGmUmGmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmGmGmsCmsAm;

(173) Sense strand: CfsCmsGfAmUfGmUfCmCfGfU(LNA)GmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCfsAm;

(174) Sense strand: CfsCmsGfAmUfGmUfCmCfGfU(LNA)GmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCmsAm;

(175) Sense strand: CfsCmsGfAmUfGmUfCmCfGfU(LNA)GmGfGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;

(176) Sense strand: CmsCmsGmAmUmGmUfCmCfGmU(LNA)GmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;

(177) Sense strand: CmsCmsGmAmUmGmUfCmCfGmU(LNA)GmGmGmCmAmGmAmamUmGm-GALNAC; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmGmGmsCmsAm;

(178) Sense strand: CmsCmsGmAmUmGmUfCmCfGmU(d)GmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmGmGmsCmsAm;

(179) Sense strand: CfsCfsGfAUGUCCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUGCCCACGGACAUCGGfsCfsAf;

(180) Sense strand: CHO-CfsCfsGfAUGUCCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUGCCCACGGACAUCGGfsCfsAf;

(181) Sense strand: CfsCfsGfAUGU(LNA)CCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUGCCCACGGACAUCGGfsCfsAf;

(182) Sense strand: CfsCfsGfAUGUCCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUG(LNA)CCCACGGACAUCGGfsCfsAf;

(183) Sense strand: CmsCmsGmAUGUCCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUGCCCACGGACAUCGGmsCmsAm;

(184) Sense strand: CHO-CmsCmsGmAUGUCCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUGCCCACGGACAUCGGmsCmsAm;

(185) Sense strand: CmsCmsGmAUGU(LNA)CCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUGCCCACGGACAUCGGmsCmsAm;

(186) Sense strand: CmsCmsGmAUGUCCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUG(LNA)CCCACGGACAUCGGmsCmsAm;

(187) Sense strand: AfsAmsUfGmAfCmUfUmUfUfAfUmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCfsUm;

(188) Sense strand: AfsAmsUfGmAfCmUfUmUfUfAfUmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCmsUm;

(189) Sense strand: AfsAmsUfGmAfCmUfUmUfUfAfUmUfGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;

(190) Sense strand: AmsAmsUmGmAmCmUfUmUfUmAmUmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;

(191) Sense strand: AmsAmsUmGmAmCmUfUmUfUmAmUmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmUmUmsCmsUm;

(192) Sense strand: AfsAmsUfGmAfCmUfUmUfUfA(LNA)UmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCfsUm;

(193) Sense strand: AfsAmsUfGmAfCmUfUmUfUfA(LNA)UmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCmsUm;

(194) Sense strand: AfsAmsUfGmAfCmUfUmUfUfA(LNA)UmUfGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;

(195) Sense strand: AmsAmsUmGmAmCmUfUmUfUmA(LNA)UmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;

(196) Sense strand: AmsAmsUmGmAmCmUfUmUfUmA(LNA)UmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmUmUmsCmsUm;

(197) Sense strand: AmsAmsUmGmAmCmUfUmUfUmA(d)UmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmUmUmsCmsUm;

(198) Sense strand: AfsAfsUfGACUUUUAUUGAGCUCfsUfsUf-GALNAC; Antisense strand: AfsAfsGfAGCUCAAUAAAAGUCAUUfsCfsUf;

(199) Sense strand: CHO-AfsAfsUfGACUUUUAUUGAGCUCfsUfsUf-GALNAC; Antisense strand: AfsAfsGfAGCUCAAUAAAAGUCAUUfsCfsUf;

(200) Sense strand: AfsAfsUfGACU(LNA)UUUAUUGAGCUCfsUfsUf-GALNAC; Antisense strand: AfsAfsGfAGCUCAAUAAAAGUCAUUfsCfsUf;

(201) Sense strand: AfsAfsUfGACUUUUAUUGAGCUCfsUfsUf-GALNAC; Antisense strand: AfsAfsGfAGCU(LNA)CAAUAAAAGUCAUUfsCfsUf;

(202) Sense strand: AmsAmsUmGACUUUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCUCAAUAAAAGUCAUUmsCmsUm;

(203) Sense strand: CHO-AmsAmsUmGACUUUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCUCAAUAAAAGUCAUUmsCmsUm;

(204) Sense strand: AmsAmsUmGACU(LNA)UUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCUCAAUAAAAGUCAUUmsCmsUm;

(205) Sense strand: AmsAmsUmGACUUUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCU(LNA)CAAUAAAAGUCAUUmsCmsUm;

(206) Sense strand: CfsCmsUfGmGfCmGfGmAfGfAfUmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAfsGm;

(207) Sense strand: CfsCmsUfGmGfCmGfGmAfGfAfUmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAmsGm;

(208) Sense strand: CfsCmsUfGmGfCmGfGmAfGfAfUmGfCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;

(209) Sense strand: CmsCmsUmGmGmCmGfGmAfGmAmUmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;

(210) Sense strand: CmsCmsUmGmGmCmGfGmAfGmAmUmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmGmGmsAmsGm;

(211) Sense strand: CfsCmsUfGmGfCmGfGmAfGfA(LNA)UmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAfsGm;

(212) Sense strand: CfsCmsUfGmGfCmGfGmAfGfA(LNA)UmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAmsGm;

(213) Sense strand: CfsCmsUfGmGfCmGfGmAfGfA(LNA)UmGfCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;

(214) Sense strand: CmsCmsUmGmGmCmGfGmAfGmA(LNA)UmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;

(215) Sense strand: CmsCmsUmGmGmCmGfGmAfGmA(LNA)UmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmGmGmsAmsGm;

(216) Sense strand: CmsCmsUmGmGmCmGfGmAfGmA(d) UmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmGmGmsAmsGm;

(217) Sense strand: CfsCfsUfGGCGGAGAUGCUUCUAfsAfsGf-GALNAC; Antisense strand: CfsUfsUfAGAAGCAUCUCCGCCAGGfsAfsGf;

(218) Sense strand: CHO-CfsCfsUfGGCGGAGAUGCUUCUAfsAfsGf-GALNAC; Antisense strand: CfsUfsUfAGAAGCAUCUCCGCCAGGfsAfsGf;

(219) Sense strand: CfsCfsUfGGCG(LNA)GAGAUGCUUCUAfsAfsGf-GALNAC; Antisense strand: CfsUfsUfAGAAGCAUCUCCGCCAGGfsAfsGf;

(220) Sense strand: CfsCfsUfGGCGGAGAUGCUUCUAfsAfsGf-GALNAC; Antisense strand: CfsUfsUfAGAA(LNA)GCAUCUCCGCCAGGfsAfsGf;

(221) Sense strand: CmsCmsUmGGCGGAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAAGCAUCUCCGCCAGGmsAmsGm;

(222) Sense strand: CHO-CmsCmsUmGGCGGAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAAGCAUCUCCGCCAGGmsAmsGm;

(223) Sense strand: CmsCmsUmGGCG(LNA)GAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAAGCAUCUCCGCCAGGmsAmsGm;

(224) Sense strand: CmsCmsUmGGCGGAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAA(LNA)GCAUCUCCGCCAGGmsAmsGm;

(225) Sense strand: UfsCmsCfUmUfGmCfCmUfGfGfAmAfCmUfCmAfCmUfCmAf-GALNAC; Antisense strand: UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCfsUm;

(226) Sense strand: UfsCmsCfUmUfGmCfCmUfGfGfAmAfCmUfCmAfCmUfCmAf-GALNAC; Antisense strand: UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCmsUm;

(227) Sense strand: UfsCmsCfUmUfGmCfCmUfGfGfAmAfCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;

(228) Sense strand: UmsCmsCmUmUmGmCfCmUfGmGmAmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;

(229) Sense strand: UmsCmsCmUmUmGmCfCmUfGmGmAmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmGmAmsCmsUm;

(230) Sense strand: UfsCmsCfUmUfGmCfCmUfGfG(LNA)AmAfCmUfCmAfCmUfCmAf-GALNAC; Antisense strand: UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCfsUm;

(231) Sense strand: UfsCmsCfUmUfGmCfCmUfGfG(LNA)AmAfCmUfCmAfCmUfCmAf-GALNAC; Antisense strand: UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCmsUm;

(232) Sense strand: UfsCmsCfUmUfGmCfCmUfGfG(LNA)AmAfCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;

(233) Sense strand: UmsCmsCmUmUmGmCfCmUfGmG(LNA)AmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;

(234) Sense strand: UmsCmsCmUmUmGmCfCmUfGmG(LNA)AmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmGmAmsCmsUm;

(235) Sense strand: UmsCmsCmUmUmGmCfCmUfGmG(d)AmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmGmAmsCmsUm;

(236) Sense strand: UfsCfsCfUUGCCUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGAGUUCCAGGCAAGGAfsCfsUf;

(237) Sense strand: CHO-UfsCfsCfUUGCCUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGAGUUCCAGGCAAGGAfsCfsUf;

(238) Sense strand: UfsCfsCfUUGC(LNA)CUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGAGUUCCAGGCAAGGAfsCfsUf;

(239) Sense strand: UfsCfsCfUUGCCUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGA(LNA)GUUCCAGGCAAGGAfsCfsUf;

(240) Sense strand: UmsCmsCmUUGCCUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGAGUUCCAGGCAAGGAmsCmsUm;

(241) Sense strand: CHO-UmsCmsCmUUGCCUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGAGUUCCAGGCAAGGAmsCmsUm;

(242) Sense strand: UmsCmsCmUUGC(LNA)CUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGAGUUCCAGGCAAGGAmsCmsUm;

(243) Sense strand: UmsCmsCmUUGCCUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGA(LNA)GUUCCAGGCAAGGAmsCmsUm;

(244) Sense strand: CfsCmsUfUmGfCmCfUmGfGfAfAmCfUmCfAmCfUmCfAmCf-GALNAC; Antisense strand: GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAfsGm;

(245) Sense strand: CfsCmsUfUmGfCmCfUmGfGfAfAmCfUmCfAmCfUmCfAmCf-GALNAC; Antisense strand: GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAmsGm;

(246) Sense strand: CfsCmsUfUmGfCmCfUmGfGfAfAmCfUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;

(247) Sense strand: CmsCmsUmUmGmCmCfUmGfGmAmAmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;

(248) Sense strand: CmsCmsUmUmGmCmCfUmGfGmAmAmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmGmGmsAmsGm;

(249) Sense strand: CfsCmsUfUmGfCmCfUmGfGfA(LNA)AmCfUmCfAmCfUmCfAmCf-GALNAC; Antisense strand: GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAfsGm;

(250) Sense strand: CfsCmsUfUmGfCmCfUmGfGfA(LNA)AmCfUmCfAmCfUmCfAmCf-GALNAC; Antisense strand: GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAmsGm;

(251) Sense strand: CfsCmsUfUmGfCmCfUmGfGfA(LNA)AmCfUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;

(252) Sense strand: CmsCmsUmUmGmCmCfUmGfGmA(LNA)AmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;

(253) Sense strand: CmsCmsUmUmGmCmCfUmGfGmA(LNA)AmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmGmGmsAmsGm;

(254) Sense strand: CmsCmsUmUmGmCmCfUmGfGmA(d) AmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmGmGmsAmsGm;

(255) Sense strand: CfsCfsUfUGCCUGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUGAGUUCCAGGCAAGGfsAfsGf;

(256) Sense strand: CHO-CfsCfsUfUGCCUGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUGAGUUCCAGGCAAGGfsAfsGf;

(257) Sense strand: CfsCfsUfUGCC(LNA)UGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUGAGUUCCAGGCAAGGfsAfsGf;

(258) Sense strand: CfsCfsUfUGCCUGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUG(LNA)AGUUCCAGGCAAGGfsAfsGf;

(259) Sense strand: CmsCmsUmUGCCUGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUGAGUUCCAGGCAAGGmsAmsGm;

(260) Sense strand: CHO-CmsCmsUmUGCCUGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUGAGUUCCAGGCAAGGmsAmsGm;

(261) Sense strand: CmsCmsUmUGCC(LNA)UGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUGAGUUCCAGGCAAGGmsAmsGm;

(262) Sense strand: CmsCmsUmUGCCUGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUG(LNA)AGUUCCAGGCAAGGmsAmsGm;

(263) Sense strand: UfsGmsCfCmUfGmGfAmAfCfUfCmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAfsGm;

(264) Sense strand: UfsGmsCfCmUfGmGfAmAfCfUfCmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAmsGm;

(265) Sense strand: UfsGmsCfCmUfGmGfAmAfCfUfCmAfCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsAmsGm;

(266) Sense strand: UmsGmsCmCmUmGmGfAmAfCmUmCmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsAmsGm;

(267) Sense strand: UmsGmsCmCmUmGmGfAmAfCmUmCmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmCmAmsAmsGm;

(268) Sense strand: UfsGmsCfCmUfGmGfAmAfCfU(LNA)CmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAfsGm;

(269) Sense strand: UfsGmsCfCmUfGmGfAmAfCfU(LNA)CmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAmsGm;

(270) Sense strand: UfsGmsCfCmUfGmGfAmAfCfU(LNA)CmAfCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsAmsGm;

(271) Sense strand: UmsGmsCmCmUmGmGfAmAfCmU(LNA)CmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsAmsGm;

(272) Sense strand: UmsGmsCmCmUmGmGfAmAfCmU(LNA)CmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmCmAmsAmsGm;

(273) Sense strand: UmsGmsCmCmUmGmGfAmAfCmU(d)CmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmCmAmsAmsGm;

(274) Sense strand: UfsGfsCfCUGGAACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGAGUGAGUUCCAGGCAfsAfsGf;

(275) Sense strand: CHO-UfsGfsCfCUGGAACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGAGUGAGUUCCAGGCAfsAfsGf;

(276) Sense strand: UfsGfsCfCUGG(LNA)AACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGAGUGAGUUCCAGGCAfsAfsGf;

(277) Sense strand: UfsGfsCfCUGGAACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGA(LNA)GUGAGUUCCAGGCAfsAfsGf;

(278) Sense strand: UmsGmsCmCUGGAACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGAGUGAGUUCCAGGCAmsAmsGm;

(279) Sense strand: CHO-UmsGmsCmCUGGAACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGAGUGAGUUCCAGGCAmsAmsGm;

(280) Sense strand: UmsGmsCmCUGG(LNA)AACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGAGUGAGUUCCAGGCAmsAmsGm;

(281) Sense strand: UmsGmsCmCUGGAACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGA(LNA)GUGAGUUCCAGGCAmsAmsGm;

(282) Sense strand: UfsUmsCfAmCfCmAfUmUfCfAfAfAfCmAfGmGfUmCfGmAf-GALNAC; Antisense strand: UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAfsUm;

(283) Sense strand: UfsUmsCfAmCfCmAfUmUfCfAfAfAfCmAfGmGfUmCfGmAf-GALNAC; Antisense strand: UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAmsUm;

(284) Sense strand: UfsUmsCfAmCfCmAfUmUfCfAfAmAfCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;

(285) Sense strand: UmsUmsCmAmCmCmAfUmUfCmAmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;

(286) Sense strand: UmsUmsCmAmCmCmAfUmUfCmAmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmAmAmsAmsUm;

(287) Sense strand: UfsUmsCfAmCfCmAfUmUfCfA(LNA)AmAfCmAfGmGfUmCfGmAf-GALNAC; Antisense strand: UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAfsUm;

(288) Sense strand: UfsUmsCfAmCfCmAfUmUfCfA(LNA)AmAfCmAfGmGfUmCfGmAf-GALNAC; Antisense strand: UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAmsUm;

(289) Sense strand: UfsUmsCfAmCfCmAfUmUfCfA(LNA)AmAfCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;

(290) Sense strand: UmsUmsCmAmCmCmAfUmUfCmA(LNA)AmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;

(291) Sense strand: UmsUmsCmAmCmCmAfUmUfCmA(LNA)AmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmAmAmsAmsUm;

(292) Sense strand: UmsUmsCmAmCmCmAfUmUfCmA(d)AmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmAmAmsAmsUm;

(293) Sense strand: UfsUfsCfACCAUUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCUGUUUGAAUGGUGAAfsAfsUf;

(294) Sense strand: CHO-UfsUfsCfACCAUUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCUGUUUGAAUGGUGAAfsAfsUf;

(295) Sense strand: UfsUfsCfACCA(LNA)UUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCUGUUUGAAUGGUGAAfsAfsUf;

(296) Sense strand: UfsUfsCfACCAUUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCU(LNA)GUUUGAAUGGUGAAfsAfsUf;

(297) Sense strand: UmsUmsCmACCAUUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCUGUUUGAAUGGUGAAmsAmsUm;

(298) Sense strand: CHO-UmsUmsCmACCAUUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCUGUUUGAAUGGUGAAmsAmsUm;

(299) Sense strand: UmsUmsCmACCA(LNA)UUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCUGUUUGAAUGGUGAAmsAmsUm;

(300) Sense strand: UmsUmsCmACCAUUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCU(LNA)GUUUGAAUGGUGAAmsAmsUm;

(301) Sense strand: CfsCmsCfGmUfGmCfGmCfAfGfGmAfGmGfAmCfGmAfGmGf-GALNAC; Antisense strand: CmsCfsUmCfGmUfCmCfUmCfCmUmGmCfGmCfAmCfGmGfGmsCmsGm;

(302) Sense strand: CfsCmsCfGmCfCmGfGmGfGfAfUmAfCmCfUmCfAmCfCmAf-GALNAC; Antisense strand: UmsGfsGmUfGmAfGmGfUmAfUmCmCmCfCmGfGmCfGmGfGmsCmsAm;

(303) Sense strand: GfsGmsGfGmAfUmAfCmCfUfCfAmCfCmAfAmGfAmUfCmCf-GALNAC; Antisense strand: GmsGfsAmUfCmUfUmGfGmUfGmAmGmGfUmAfUmCfCmCfCmsGmsGm;

(304) Sense strand: GfsGmsGfAmUfAmCfCmUfCfAfCmCfAmAfGmAfUmCfCmUf-GALNAC; Antisense strand: AmsGfsGmAfUmCfUmUfGmGfUmGmAmGfGmUfAmUfCmCfCmsCmsGm;

(305) Sense strand: AfsCmsCfAmAfGmAfUmCfCfUfGmCfAmUfGmUfCmUfUmCf-GALNAC; Antisense strand: GmsAfsAmGfAmCfAmUfGmCfAmGmGmAfUmCfUmUfGmGfUmsGmsAm;

(306) Sense strand: GfsAmsAfGmUfUmGfCmCfCfCfAmUfGmUfCmGfAmCfUmAf-GALNAC; Antisense strand: UmsAfsGmUfCmGfAmCfAmUfGmGmGmGfCmAfAmCfUmUfCmsAmsAm;

(307) Sense strand: CfsCmsCfAmUfGmUfCmGfAfCfUmAfCmAfUmCfGmAfGmGf-GALNAC; Antisense strand: CmsCfsUmCfGmAfUmGfUmAfGmUmCmGfAmCfAmUfGmGfGmsGmsCm;

(308) Sense strand: AfsCmsCfGmGfGmCfGmGfAfUfGmAfAmUfAmCfCmAfGmCf-GALNAC; Antisense strand: GmsCfsUmGfGmUfAmUfUmCfAmUmCmCfGmCfCmCfGmGfUmsAmsCm;

(309) Sense strand: GfsAmsCfCmAfAmCfUmUfUfGfGmCfCmGfCmUfGmUfGmUf-GALNAC; Antisense strand: AmsCfsAmCfAmGfCmGfGmCfCmAmAmAfGmUfUmGfGmUfCmsCmsCm;

(310) Sense strand: CfsCmsAfAmCfUmUfUmGfGfCfCmGfCmUfGmUfGmUfGmGf-GALNAC; Antisense strand: CmsCfsAmCfAmCfAmGfCmGfGmCmCmAfAmAfGmUfUmGfGmsUmsCm;

(311) Sense strand: GfsCmsCfGmCfUmGfUmGfUfGfGmAfCmCfUmCfUmUfUmGf-GALNAC; Antisense strand: CmsAfsAmAfGmAfGmGfUmCfCmAmCmAfCmAfGmCfGmGfCmsCmsAm;

(312) Sense strand: CfsGmsCfUmGfUmGfUmGfGfAfCmCfUmCfUmUfUmGfCmCf-GALNAC; Antisense strand: GmsGfsCmAfAmAfGmAfGmGfUmCmCmAfCmAfCmAfGmCfGmsGmsCm;

(313) Sense strand: CfsAmsCfAmAfCmGfCmUfUfUfUmGfGmGfGmGfUmGfAmGf-GALNAC; Antisense strand: CmsUfsCmAfCmCfCmCfCmAfAmAmAmGfCmGfUmUfGmUfGmsGmsGm;

(314) Sense strand: AfsCmsAfAmCfGmCfUmUfUfUfGmGfGmGfGmUfGmAfGmGf-GALNAC; Antisense strand: CmsCfsUmCfAmCfCmCfCmCfAmAmAmAfGmCfGmUfUmGfUmsGmsGm;

(315) Sense strand: CfsAmsAfCmGfCmUfUmUfUfGfGmGfGmGfUmGfAmGfGmGf-GALNAC; Antisense strand: CmsCfsCmUfCmAfCmCfCmCfCmAmAmAfAmGfCmGfUmUfGmsUmsGm;

(316) Sense strand: GfsUmsGfAmGfGmGfUmGfUfCfUmAfCmGfCmCfAmUfUmGf-GALNAC; Antisense strand: CmsAfsAmUfGmGfCmGfUmAfGmAmCmAfCmCfCmUfCmAfCmsCmsCm;

(317) Sense strand: UfsGmsAfGmGfGmUfGmUfCfUfAmCfGmCfCmAfUmUfGmCf-GALNAC; Antisense strand: GmsCfsAmAfUmGfGmCfGmUfAmGmAmCfAmCfCmCfUmCfAmsCmsCm;

(318) Sense strand: GfsGmsGfUmGfUmCfUmAfCfGfCmCfAmUfUmGfCmCfAmGf-GALNAC; Antisense strand: CmsUfsGmGfCmAfAmUfGmGfCmGmUmAfGmAfCmAfCmCfCfCmsUmsCm;

(319) Sense strand: GfsGmsUfGmUfCmUfAmCfGfCfCmAfUmUfGmCfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfGmCfAmAfUmGfGmCmGmUfAmGfAmCfAmCfCmsCmsUm;

(320) Sense strand: GfsUmsGfUmCfUmAfCmGfCfCfAmUfUmGfCmCfAmGfGmUf-GALNAC; Antisense strand: AmsCfsCmUfGmGfCmAfAmUfGmGmCmGfUmAfGmAfCmAfCmsCmsCm;

(321) Sense strand: UfsGmsUfCmUfAmCfGmCfCfAfUmUfGmCfCmAfGmGfUmGf-GALNAC; Antisense strand: CmsAfsCmCfUmGfGmCfAmAfUmGmGmCfGmUfAmGfAmCfAmsCmsCm;

(322) Sense strand: CfsUmsAfCmGfCmCfAmUfUfGfCmCfAmGfGmUfGmCfUmGf-GALNAC; Antisense strand: CmsAfsGmCfAmCfCmUfGmGfCmAmAmUfGmGfCmGfUmAfGmsAmsCm;

(323) Sense strand: UfsAmsCfGmCfCmAfUmUfGfCfCmAfGmGfUmGfCmUfGmCf-GALNAC; Antisense strand: GmsCfsAmGfCmAfCmCfUmGfGmCmAmAfUmGfGmCfGmUfAmsGmsAm;

(324) Sense strand: CfsCmsUfUmGfGmCfAmCfCfCfAmCfAmAfGmCfCmGfCmCf-GALNAC; Antisense strand: GmsGfsCmGfGmCfUmUfGmUfGmGmGmUfGmCfCmAfAmGfGmsUmsCm;

(325) Sense strand: CfsAmsCfCmCfAmCfAmAfGfCfCmGfCmCfUmGfUmGfCmUf-GALNAC; Antisense strand: AmsGfsCmAfCmAfGmGfCmGfGmCmUmUfGmUfGmGfGmUfGmsCmsCm;

(326) Sense strand: CfsCmsCfAmCfAmAfGmCfCfGfCmCfUmGfUmGfCmUfGmAf-GALNAC; Antisense strand: UmsCfsAmGfCmAfCmAfGmGfCmGmGmCfUmUfGmUfGmGfGmsUmsGm;

(327) Sense strand: CfsCmsAfCmAfAmGfCmCfGfCfCmUfGmUfGmCfUmGfAmGf-GALNAC; Antisense strand: CmsUfsCmAfGmCfAmCfAmGfGmCmGmGfCmUfUmGfUmGfGmsGmsUm;

(328) Sense strand: CfsCmsAfCmGfAmGfGmUfCfAfGmCfCmCfAmAfCmCfAmGf-GALNAC; Antisense strand: CmsUfsGmGfUmUfGmGfGmCfUmGmAmCfCmUfCmGfUmGfGmsCmsCm;

(329) Sense strand: CfsAmsCfGmAfGmGfUmCfAfGfCmCfCmAfAmCfCmAfGmUf-GALNAC; Antisense strand: AmsCfsUmGfGmUfUmGfGmGfCmUmGmAfCmCfUmCfGmUfGmsGmsCm;

(330) Sense strand: GfsUmsCfAmGfGmAfGmCfCfGfGmGfAmCfGmUfCmAfGmCf-GALNAC; Antisense strand: GmsCfsUmGfAmCfGmUfCmCfCmGmGmCfUmCfCmUfGmAfCmsUmsAm;

(331) Sense strand: CfsUmsGfGmGfGmCfUmGfAfGfCmUfUmUfAmAfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfUmUfAmAfAmGfCmUmCmAfGmCfCmCfCmAfGmsCmsCm;

(332) Sense strand: GfsGmsGfCmUfGmAfGmCfUfUfUmAfAmAfAmUfGmGfUmUf-GALNAC; Antisense strand: AmsAfsCmCfAmUfUmUfUmAfAmAmGmCfUmCfAmGfCmCfCmsCmsAm;

(333) Sense strand: GfsCmsUfGmAfGmCfUmUfUfAfAmAfAmUfGmGfUmUfCmCf-GALNAC; Antisense strand: GmsGfsAmAfCmCfAmUfUmUfUmAmAmAfGmCfUmCfAmGfCmsCmsCm;

(334) Sense strand: CfsCmsUfGmGfCmCfCmUfUfGfAmGfUmGfGmGfGmCfAmGf-GALNAC; Antisense strand: CmsUfsGmCfCmCfCmAfCmUfCmAmAmGfGmGfCmCfAmGfGmsCmsCm;

(335) Sense strand: GfsGmsAfGmGfUmGfCmCfAfGfGmAfAmGfCmUfCmCfCmUf-GALNAC; Antisense strand: AmsGfsGmGfAmGfCmUfUmCfCmUmGmGfCmAfCmCfUmCfCmsAmsCm;

(336) Sense strand: GfsAmsGfGmUfGmCfCmAfGfGfAmAfGmCfUmCfCmCfUmCf-GALNAC; Antisense strand: GmsAfsGmGfGmAfGmCfUmUfCmCmUmGfGmCfAmCfCmUfCmsCmsAm;

(337) Sense strand: CfsUmsCfAmCfUmGfUmGfGfGfGmCfAmUfUmUfCmAfCmCf-GALNAC; Antisense strand: GmsGfsUmGfAmAfAmUfGmCfCmCmCmAfCmAfGmUfGmAfGmsGmsGm;

(338) Sense strand: UfsGmsUfGmGfGmGfCmAfUfUfUmCfAmCfCmAfUmUfCmAf-GALNAC; Antisense strand: UmsGfsAmAfUmGfGmUfGmAfAmAmUmGfCmCfCmCfAmCfAmsGmsUm;

(339) Sense strand: GfsCmsAfUmCfUmAfGmCfCfAfGmAfGmGfCmUfGmGfAmGf-GALNAC; Antisense strand: CmsUfsCmCfAmGfCmCfUmCfUmGmGmCfUmAfGmAfUmGfCmsCmsAm;

(340) Sense strand: UfsUmsUfUmGfUmAfAmCfUfUfGmAfAmGfAmUfAmUfUmUf-GALNAC; antisense strand: AmsAfsAmUfAmUfCmUfUmCfAmAmGmUfUmAfCmAfAmAfAmsGmsCm.

Among them, A, C, G, U to the left of m represent the pentose group in the nucleotide residue is 2'-methoxyribosyl, Af, Cf, Gf, Uf represent the pentose group in the nucleotide residue The group is a 2'-fluorine modified ribose group, and s represents that the phosphate group between the ribonucleotide residues on its left and right sides is a phosphorothioate group. (LNA) represents locked nucleic acid modification; (d) represents deoxyribonucleotide; CHO represents cholesterol; GALNAC represents GalNAc ligand (GalNAc3 shown in formula I), and the schematic diagram of conjugation to the 3' end of the sense strand of siRNA is shown in the formula As shown in II, X is O or S.

The siRNA provided by the present invention can inhibit the expression of PCSK9 gene in human, monkey, rat or mouse.

In a second aspect, the present invention claims DNA molecules capable of producing the siRNAs described above.

In a third aspect, the present invention claims a vector capable of expressing the aforementioned siRNA.

In a fourth aspect, the present invention claims a reagent or kit.

The reagent or kit claimed in the present invention contains the aforementioned siRNA or the aforementioned DNA molecule or the aforementioned vector.

In a fifth aspect, the present invention claims a pharmaceutical composition.

The pharmaceutical composition claimed in the present invention consists of the aforementioned siRNA molecules and other pharmaceutically acceptable components or pharmaceutically acceptable carriers.

Wherein, the pharmaceutically acceptable other components include but are not limited to water, saline, pH buffer, protective agent, osmotic pressure regulator, excipient, diluent, disintegrant, binding agent, lubricant, sweetener flavors, preservatives or combinations thereof. The pH buffer can be tris buffer at pH 7.5-8.5 and/or phosphate buffer at pH 5.5-8.5, preferably phosphate buffer at pH 5.5-8.5 liquid. The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose and glucose.

The pharmaceutically acceptable carrier includes but is not limited to magnetic nanoparticles (such as Fe ₃ O ₄ , Fe ₂ O ₃ ), carbon nanotubes, mesoporous silicon, calcium phosphate nanometers Calcium phosphate nanoparticles, polyethyleneimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine, PLL), chitosan Sugar (chitosan), 1,2-dioleoyl-3-trimethylammonium-propane (1,2-dioleoyl-3-trimethylammonium-propane, DOTAP), poly (D&L) -lactic/glycolic acid) copolymer, PLGA), poly(2-aminoethyl ethylene phosphate) (poly(2-aminoethyl ethylene phosphate), PPEEA) and poly(N,N-dimethylaminoethyl methacrylate) (poly(2-dimethylaminoethyl methacrylate), PDMAEMA) and one or more of their derivatives.

Further, the dosage form of the pharmaceutical composition can be a liquid preparation (eg injection) or a lyophilized powder for injection.

The freeze-dried powder for injection is mixed with liquid auxiliary materials during administration to prepare a liquid preparation.

The liquid preparation can be used for, but not limited to, subcutaneous, intramuscular or intravenous administration, and can also be administered to the lungs by spraying, or to other organ tissues (such as liver) by spraying through the lungs.

In the sixth aspect, the present invention claims that the aforementioned siRNA or the aforementioned DNA molecule or the aforementioned vector or the aforementioned reagent or kit or the aforementioned pharmaceutical composition inhibits PCSK9 gene expression, or Use in the preparation of products for inhibiting PCSK9 gene expression.

The present invention also provides a method for inhibiting or reducing the expression level of PCSK9 gene in vivo or in vitro, comprising introducing the siRNA, DNA molecule, vector, reagent, or pharmaceutical composition of the present invention into cells, so that the expression level of PCSK9 gene is inhibited or Reduced by at least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, at least 5%. As used herein, the term "introduced" refers to facilitating uptake or absorption into a cell, which can occur through unassisted diffusion or active cellular processes, or through auxiliary reagents or devices. When introduced into cells in vivo, siRNA can be injected into target tissues or administered systemically. Introduction into cells in vitro can be accomplished by methods known in the art, such as electroporation.

The cells are preferably mammalian cells expressing PCSK9, eg primate cells, such as human cells. Preferably, the PCSK9 gene is expressed at a high level in the target cells. More preferably the cells are derived from the brain, salivary glands, heart, spleen, lung, liver, gut or tumor. More preferably, the cells are liver cancer cells or cervical cancer cells. Still more preferably, the cells are selected from Hela cells or HEP3B cells or HepG2 cells or 293T cells.

In the in vitro method, the working concentration of siRNA molecules is 0.1-1000 nM, preferably 0.1-50 nM or 10-50 mM.

Detection of target gene, target RNA or target protein levels can be used to predict or assess the activity, efficacy or therapeutic outcome of siRNA. Detection of target gene, target RNA or target protein levels can be performed using methods known in the art.

In the seventh aspect, the present invention claims that the aforementioned siRNA or the aforementioned DNA molecule or the aforementioned carrier or the aforementioned reagent or kit or the aforementioned pharmaceutical composition reduces low-density lipids in serum. protein and/or low density lipoprotein cholesterol concentration, or use in the preparation of a product for lowering serum low density lipoprotein and/or low density lipoprotein cholesterol concentration.

In the eighth aspect, the present invention claims that the aforementioned siRNA or the aforementioned DNA molecule or the aforementioned carrier or the aforementioned reagent or kit or the aforementioned pharmaceutical composition is used in the prevention and/or treatment of PCSK9 gene-mediated diseases, or use in the preparation of products for the prevention and/or treatment of PCSK9 gene-mediated diseases;

In the ninth aspect, the present invention claims to protect the aforementioned siRNA or the aforementioned DNA molecule or the aforementioned vector or the aforementioned reagent or kit or the aforementioned pharmaceutical composition in remission mediated by the PCSK9 gene. symptoms of a disease, or use in the preparation of a product for relieving symptoms of a disease mediated by the PCSK9 gene.

In the eighth and ninth aspects, the disease mediated by the PCSK9 gene can be caused by overexpression of the PCSK9 gene, overproduction of the PCSK9 protein, and can be modulated by down-regulating the expression of the PCSK9 gene. As used herein, the term "treatment" refers to the alleviation, alleviation or cure of PCSK9 gene-mediated disease or symptoms, such as reduction in blood lipid levels, including reduction in serum L, LDLC levels. In some embodiments, the level or concentration of serum LD, serum LDL-C is reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70% %, 80%, or 90%.

The diseases mediated by the PCSK9 gene include, but are not limited to, cardiovascular diseases or neoplastic diseases. The cardiovascular disease such as mammalian hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia or heterozygous familial hypercholesterolemia; such neoplastic diseases as melanoma or metastatic liver cancer associated with PCSK9.

In some embodiments, the present invention provides an in vivo method comprising alleviating or treating a disease or condition mediated by a PCSK gene in a subject, the disease or condition comprising cardiovascular disease, dyslipidemia; cardiovascular disease Atherosclerotic cardiovascular disease may be included, while dyslipidemia may include elevated serum cholesterol and/or triglyceride levels, elevated low-density lipoprotein cholesterol, or elevated apolipoprotein B (ApOB). The disease or symptom is preferably hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or Heterozygous familial hypercholesterolemia. The subject may be a mammal, preferably a human. The method may comprise administering to the subject an effective amount, eg, a prophylactically effective amount or a therapeutically effective amount of the siRNA.

The present invention also provides a method of combination therapy comprising co-administration of one or more siRNAs of the present invention or a pharmaceutical composition comprising the same with one or more other therapeutic agents or in combination with other therapeutic methods. Other therapeutic agents may include agents known to prevent, alleviate or treat lipid disorders such as hypercholesterolemia, atherosclerosis or dyslipidemia, eg cholesterol absorption inhibitors, lipid lowering agents, analgesics, anti-inflammatory agents , antitumor drugs, etc. Other treatments include radiation therapy, immunotherapy, hormone therapy, surgery, etc.

Description of drawings

Figure 1 is a plasmid map of the psiCHECK-2 vector.

Figure 2 shows that the ligand-conjugated siRNA in Example 11 inhibits PCSK9 mRNA levels in Hep3B cells.

3 is a graph of the average body weight of the intravenous administration group in Example 12. There were no significant differences between the groups.

Figure 4 is the liver drug content curve of the animals in the GR90243.55, GR90243.51, GR90320.93, and GR90320.893 mg/kg s.c groups in Example 14 after administration.

Figure 5 shows the detection result of PSCK9 protein content detected by ELISA in step 1 of Example 15.

Fig. 6 is the detection result of PSCK9 protein content detected by ELISA in step 2 of Example 15.

Figure 7 shows the LDL-C results of mice in each group in step 3 of Example 15.

FIG. 8 is the detection result of PSCK9 protein content in the serum of each group of mice in step 3 of Example 15.

Best way to implement your invention

The following examples facilitate a better understanding of the present invention, but do not limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples are all set to repeat the experiments at least three times, and the results are averaged.

The 293T cell line, the Hep3B cell line, the HepG2 cell line and the Hela cell line used in the following examples were purchased from the Chinese Academy of Sciences Collection Cell Bank.

The materials used in the embodiments of the present invention are as follows:

Opti-MEM (Gibco manufacturer), DEPC water, Exfect Transfection Reagent (Vazyme manufacturer), DMEM medium, PBS (Sigma), dual luciferase detection kit, siRNA NC (Negative Control and PCSK9 gene no inhibition negative control) ), siRNA NC-cy3 (siRNA NC linked to cy3), siRNA NC-FAM (siRNA NC linked to FAM), Lipofectamine2000 transfection reagent (Thermo), PCSK9Matched ELISA Antibody Pair Set (SinoBiological), ELISA stop solution (Solarbio), Protein lysate (Thermo), TMB substrate system for ELISA (Sigma). 2×One Step U+Mix, One Step U+Enzyme Mix, 50×ROX Reference Dye 1, RNase-free ddH ₂ O were from the vazyme manufacturer. H-PCSK9V1-FO-1, H-PCSK9V1-RE-1, H-PCSK9V1-PR1-1-JOE, H-ACTB-FO-3, H-ACTB-RE-3, H-ACTB-PR-3- FAM comes from Sheng Gong.

Embodiment 1, double luciferase reporter gene plasmid construction

The dual-luciferase reporter gene plasmid used in this example is the psiCHECK-2 vector (the sequence of the empty vector is shown in its specification), which was purchased from Promega (Item No.: C8021), and the map information is shown in Figure 1 . The specific construction method is to insert a sequence of PCSK9 gene (NCBI Reference Sequence: NM_174936.3) between the two restriction sites of XhoI and NotI of the psiCHECKTM-2 vector. The length of the inserted sequence is generally between 300-400bp, including PCSK9 gene CDS region and 3'UTR region.

The specific insertion information is shown in Table 1. The recombinant plasmids were verified to be correct by sequencing.

Table 1. Insert information

质粒编号Plasmid number	所处基因位置gene location	基因区域gene region	SEQ ID No.SEQ ID No.
GPT0001GPT0001	363-752363-752	CDS CDS	11
GPT0002GPT0002	713-1102713-1102	CDSCDS	22
GPT0003GPT0003	1063-14521063-1452	CDS CDS	33
GPT0004GPT0004	1413-18021413-1802	CDSCDS	44
GPT0005GPT0005	1763-21521763-2152	CDSCDS	55
GPT0006GPT0006	2113-24412113-2441	CDS CDS	66
GPT0007GPT0007	2442-27912442-2791	3’UTR区3' UTR region	77
GPT0008GPT0008	2762-31112762-3111	3’UTR区3' UTR region	88
GPT0009GPT0009	3082-34313082-3431	3’UTR区3' UTR region	99
GPT0010GPT0010	3392-37313392-3731	3’UTR区3' UTR region	1010

Example 2. Synthesis of siRNA

The PCSK9 gene (NCBI Reference Sequence: NM_174936.3) was selected as the template to select a nucleotide sequence of 21 bp, and a series of small interfering nucleic acids (siRNA) spanning the PCSK9 mRNA sequence were designed and synthesized. The above-synthesized siRNA sequences are shown in Table 2.

Table 2. siRNA sequences

编号Numbering	SEQ ID No.SEQ ID No.	正义链chain of justice	SEQ ID No.SEQ ID No.	反义链antisense strand
GP90083GP90083	1111	CCCGUGCGCAGGAGGACGAGGCCCGUGCGCAGGAGGACGAGG	176176	UCGUCCUCCUGCGCACGGGCGUCGUCCUCCUGCGCACGGGCG
GP90158GP90158	1212	CCGAAGCACCCGAGCACGGAACCGAAGCACCCGAGCACGGAA	177177	CCGUGCUCGGGUGCUUCGGCCCCGUGCUCGGGGUGCUUCGGCC
GP90159GP90159	1313	CGAAGCACCCGAGCACGGAACCGAAGCACCCGAGCACGGAAC	178178	UCCGUGCUCGGGUGCUUCGGC UCCGUGCUCGGGUGCUUCGGC

GP90165GP90165	1414	ACCCGAGCACGGAACCACAGCACCCGAGCACGGAACCACAGC	179179	UGUGGUUCCGUGCUCGGGUGCUGUGGUUCCGUGCUCGGGUGC
GP90167GP90167	1515	CCGAGCACGGAACCACAGCCACCGAGCACGGAACCACAGGCA	180180	GCUGUGGUUCCGUGCUCGGGU GCUGUGGUUCCGUGCUCGGGU

GP90253GP90253	1616	GAGACCCACCUCUCGCAGUCAGAGACCCACCUCUCGCCAGUCA	181181	ACUGCGAGAGGUGGGUCUCCUACUGCGAGAGGUGGGUCUCCU
GP90262GP90262	1717	CUCUCGCAGUCAGAGCGCACUCUCUCGCAGUCAGAGCGCACU	182182	UGCGCUCUGACUGCGAGAGGU UGCGCUCUGACUGCGAGAGGU

GP90308GP90308	1818	CCCGCCGGGGAUACCUCACCACCCGCCGGGGAUACCUCACCA	183183	GUGAGGUAUCCCCGGCGGGCAGUGAGGUAUCCCCGGCGGGCA
GP90314GP90314	1919	GGGGAUACCUCACCAAGAUCCGGGGAUACCUCACCAAGAUCC	184184	AUCUUGGUGAGGUAUCCCCGG AUCUUGGUGAGGAUCCCCGG

GP90315GP90315	2020	GGGAUACCUCACCAAGAUCCUGGGAUACCUCACCAAGAUCCU	185185	GAUCUUGGUGAGGUAUCCCCGGAUCUUGGUGAGGUAUCCCCG
GP90325GP90325	21twenty one	ACCAAGAUCCUGCAUGUCUUCACCAAGAUCCUGCAUGUCUUC	186186	AGACAUGCAGGAUCUUGGUGAAGACAUGCAGGAUCUUGGUGA
GP90404GP90404	22twenty two	ACGGAUGGCCACAGCCGUCGCACGGAUGGCCACAGCCGUCGC	187187	GACGGCUGUGGCCAUCCGUGUGACGGCUGUGGCCAUCCGUGU
GP90405GP90405	23twenty three	GAAGUUGCCCCAUGUCGACUAGAAGUUGCCCCAUGUCGACUA	188188	GUCGACAUGGGGCAACUUCAAGUCGACAUGGGGCAACUUCAA
GP90413GP90413	24twenty four	CCCAUGUCGACUACAUCGAGGCCCAUGUCGACUACAUCGAGG	189189	UCGAUGUAGUCGACAUGGGGCUCGAUGUAGUCGACAUGGGGC
GP90497GP90497	2525	ACCGGGCGGAUGAAUACCAGCACCGGGCGGAUGAAUACCAGC	190190	UGGUAUUCAUCCGCCCGGUAC UGGUAUUCAUCCGCCCCGGUAC

GP90602GP90602	2626	UGGUCACCGACUUCGAGAAUGUGGUCACCGACUUCGAGAAUG	191191	UUCUCGAAGUCGGUGACCAUGUUCUCGAAGUCGGUGACCAUG
GP90604GP90604	2727	GUCACCGACUUCGAGAAUGUGGUCACCGACUUCGAGAAUUGUG	192192	CAUUCUCGAAGUCGGUGACCA CAUUCUCGAAGUCGGUGACCA

GP90606GP90606	2828	CACCGACUUCGAGAAUGUGCCCACCGACUUCGAGAAUGUGCC	193193	CACAUUCUCGAAGUCGGUGACCACAUUCUCGAAGUCGGUGAC
GP90607GP90607	2929	ACCGACUUCGAGAAUGUGCCCACCGACUUCGAGAAUGUGCCC	194194	GCACAUUCUCGAAGUCGGUGA GCACAUUCUCGAAGUCGGUGA

GP90611GP90611	3030	ACUUCGAGAAUGUGCCCGAGGACUUCGAGAAUGUGCCCGAGG	195195	UCGGGCACAUUCUCGAAGUCGUCGGGCACAUUCUCGAAGUCG
GP91056GP91056	3131	GACCAACUUUGGCCGCUGUGUGACCAACUUUGGCCGCUGUGU	196196	ACAGCGGCCAAAGUUGGUCCCACAGCGGCCAAAGUUGGUCCC
GP91058GP91058	3232	CCAACUUUGGCCGCUGUGUGGCCAACUUUGGCCGCUGUGUGG	197197	ACACAGCGGCCAAAGUUGGUCACACAGCGGCCAAAGUUGGUC
GP91067GP91067	3333	GCCGCUGUGUGGACCUCUUUGGCCGCUGUGUGGACCUCUUUG	198198	AAGAGGUCCACACAGCGGCCAAAGAGGUCCACACAGCGGCCA
GP91069GP91069	3434	CGCUGUGUGGACCUCUUUGCCCGCUGUGUGGACCUCUUUGCC	199199	CAAAGAGGUCCACACAGCGGC CAAAGAGGUCCACACAGCGGC

GP91211GP91211	3535	CGGAGCUCACCCUGGCCGAGUCGGAGCUCACCCUGGCCGAGU	200200	UCGGCCAGGGUGAGCUCCGGCUCGGCCAGGGUGAGCUCCGGC
GP91363GP91363	3636	CUGUUUUGCAGGACUGUAUGGCUGUUUUGCAGGACUGUAUGG	201201	AUACAGUCCUGCAAAACAGCUAUACAGUCCUGCAAAACAGCU
GP91373GP91373	3737	GGACUGUAUGGUCAGCACACUGGACUGUAUGGUCAGCACACU	202202	UGUGCUGACCAUACAGUCCUGUGUGCUGACCAUACAGUCCUG
GP91488GP91488	3838	GGGCGAGCGCAUGGAGGCCCAGGGCGAGCGCAUGGAGGCCCA	203203	GGCCUCCAUGCGCUCGCCCCGGGCCUCCAUGCGCUCGCCCCG

GP91491GP91491	3939	CGAGCGCAUGGAGGCCCAAGGCGAGCGCAUGGAGGCCCAAGG	204204	UUGGGCCUCCAUGCGCUCGCCUUGGGCCUCCAUGCGCUCGCC
GP91511GP91511	4040	GGGGCAAGCUGGUCUGCCGGGGGGGCAAGCUGGUCUGCCGGG	205205	CGGCAGACCAGCUUGCCCCCUCGGCAGACCAGCUUGCCCCCU
GP91512GP91512	4141	GGGCAAGCUGGUCUGCCGGGCGGGCAAGCUGGUCUGCCGGGC	206206	CCGGCAGACCAGCUUGCCCCC CCGGCAGACCAGCUUGCCCCC

GP91520GP91520	4242	UGGUCUGCCGGGCCCACAACGUGGUCUGCCGGGCCCACAACG	207207	UUGUGGGCCCGGCAGACCAGCUUGUGGGCCCGGCAGACCAGC
GP91534GP91534	4343	CACAACGCUUUUGGGGGUGAGCACAACGCUUUUGGGGGUGAG	208208	CACCCCCAAAAGCGUUGUGGGCACCCCCAAAAGCGUUGUGGG
GP91535GP91535	4444	ACAACGCUUUUGGGGGUGAGGACAACGCUUUUGGGGGGUGAGG	209209	UCACCCCCAAAAGCGUUGUGGUCACCCCCAAAAGCGUUGUGG
GP91536GP91536	4545	CAACGCUUUUGGGGGUGAGGGCAACGCUUUUGGGGGUGAGGG	210210	CUCACCCCCAAAAGCGUUGUGCUCACCCCCAAAAGCGUUGUG
GP91550GP91550	4646	GUGAGGGUGUCUACGCCAUUGGUGAGGGUGUCUACGCCAUUG	211211	AUGGCGUAGACACCCUCACCCAUGGCGUAGACACCCUCACCC
GP91551GP91551	4747	UGAGGGUGUCUACGCCAUUGCUGAGGGUGUCUACGCCAUUGC	212212	AAUGGCGUAGACACCCUCACC AAUGGCGUAGACACCCUCACC

GP91552GP91552	4848	GAGGGUGUCUACGCCAUUGCCGAGGGUGUCUACGCCAUUGCC	213213	CAAUGGCGUAGACACCCUCACCAAUGGCGUAGACACCCUCAC
GP91554GP91554	4949	GGGUGUCUACGCCAUUGCCAGGGGUGUCUACGCCAUUGCCAG	214214	GGCAAUGGCGUAGACACCCUC GGCAAUGGCGUAGACACCCUC

GP91555GP91555	5050	GGUGUCUACGCCAUUGCCAGGGGUGUCUACGCCAUUGCCAGG	215215	UGGCAAUGGCGUAGACACCCUUGGCAAUGGCGUAGACACCCU
GP91556GP91556	5151	GUGUCUACGCCAUUGCCAGGUGUGUCUACGCCAUUGCCAGGU	216216	CUGGCAAUGGCGUAGACACCCCUGGCAAUGGCGUAGACACCC
GP91557GP91557	5252	UGUCUACGCCAUUGCCAGGUGUGUCUACGCCAUUGCCAGGGUG	217217	CCUGGCAAUGGCGUAGACACCCCUGGCAAUGGCGUAGACACC
GP91560GP91560	5353	CUACGCCAUUGCCAGGUGCUGCUACGCCAUUGCCAGGUGCUG	218218	GCACCUGGCAAUGGCGUAGACGCACCUGGCAAUGGCGUAGAC
GP91561GP91561	5454	UACGCCAUUGCCAGGUGCUGCUACGCCAUUGCCAGGGUGCUGC	219219	AGCACCUGGCAAUGGCGUAGAAGCACCUGGCAAUGGCGUAGA
GP91641GP91641	5555	GACCCGUGUCCACUGCCACCAGACCCGUGUCCCACUGCCACCA	220220	GUGGCAGUGGACACGGGUCCCGUGGCAGUGGACACGGGUCCC
GP91710GP91710	5656	CCUUGGCACCCACAAGCCGCCCCUUGGCACCCACAAGCCGCC	221221	CGGCUUGUGGGUGCCAAGGUCCGGCUUGUGGGUGCCAAGGUC
GP91716GP91716	5757	CACCCACAAGCCGCCUGUGCUCACCCACAAGCCGCCUGUGCU	222222	CACAGGCGGCUUGUGGGUGCC CACAGGCGGCUUGUGGGUGCC

GP91718GP91718	5858	CCCACAAGCCGCCUGUGCUGACCCACAAGCCGCCUUGUGCUGA	223223	AGCACAGGCGGCUUGUGGGUGAGCACAGGCGGCUUGUGGGUG
GP91719GP91719	5959	CCACAAGCCGCCUGUGCUGAGCCACAAGCCGCCUGUGCUGAG	224224	CAGCACAGGCGGCUUGUGGGUCAGCACAGGCGGCUUGUGGGU
GP91741GP91741	6060	CCACGAGGUCAGCCCAACCAGCCACGAGGUCAGCCCAACCAG	225225	GGUUGGGCUGACCUCGUGGCCGGUUGGGGCUGACCUCGUGGCC
GP91742GP91742	6161	CACGAGGUCAGCCCAACCAGUCACGAGUCAGCCCAACCAGU	226226	UGGUUGGGCUGACCUCGUGGCUGGUUGGGGCUGACCUCGUGGC
GP91744GP91744	6262	CGAGGUCAGCCCAACCAGUGCCGAGGUCAGCCCAACCAGUGC	227227	ACUGGUUGGGCUGACCUCGUGACUGGUUGGGCUGACCUCUGUG
GP91745GP91745	6363	GAGGUCAGCCCAACCAGUGCGGAGGUCAGCCCAACCAGUGCG	228228	CACUGGUUGGGCUGACCUCGUCACUGGUUGGGCUGACCUCGU
GP91754GP91754	6464	CCAACCAGUGCGUGGGCCACACCAACCAGUGCGUGGGGCCACA	229229	UGGCCCACGCACUGGUUGGGCUGGCCCACGCACUGGUUGGGC
GP91760GP91760	6565	AGUGCGUGGGCCACAGGGAGGAGUGCGUGGGCCACAGGGAGG	230230	UCCCUGUGGCCCACGCACUGGUCCCUGUGGCCCACGCACUGG
GP91943GP91943	6666	ACGCCGUAGACAACACGUGUGACGCCGUAGACAACACCGUGUG	231231	CACGUGUUGUCUACGGCGUAGCACGUGUUGUCUACGGCGUAG
GP91946GP91946	6767	CCGUAGACAACACGUGUGUAGCCGUAGACAACACGUGUGUAG	232232	ACACACGUGUUGUCUACGGCGACACACGUGUGUUGUCUACGGCG
GP91947GP91947	6868	CGUAGACAACACGUGUGUAGUCGUAGACAACACGUGUGUAGU	233233	UACACACGUGUUGUCUACGGCUACACACGUGUUGUCUACGGC
GP91948GP91948	6969	GUAGACAACACGUGUGUAGUCGUAGACAACACGUGUGUAGUC	234234	CUACACACGUGUUGUCUACGGCUACACACGUGUUGUCUACGG
GP91966GP91966	7070	GUCAGGAGCCGGGACGUCAGCGUCAGGAGCCGGGACGUCAGC	235235	UGACGUCCCGGCUCCUGACUAUGACGUCCCGGCUCCUGACUA
GR90041GR90041	7171	GGCUGGGGCUGAGCUUUAAAAGGCUGGGGCUGAGCUUUAAAA	236236	CAUUUUAAAGCUCAGCCCCAG CAUUUUAAAGCUCAGCCCCAG

GR90044GR90044	7272	UGGGGCUGAGCUUUAAAAUGGUGGGGCUGAGCUUUAAAAUGG	237237	AACCAUUUUAAAGCUCAGCCCAACCAUUUUAAAGCUCAGCCC
GR90046GR90046	7373	GGGCUGAGCUUUAAAAUGGUUGGGCUGAGCUUUAAAAUGGUU	238238	GGAACCAUUUUAAAGCUCAGCGGAACCAUUUUAAAGCUCAGC

GR90050GR90050	7474	UGAGCUUUAAAAUGGUUCCGAUGAGCUUUAAAAUGGUUCCGA	239239	AGUCGGAACCAUUUUAAAGCUAGUCGGAACCAUUUUAAAGCU
GR90056GR90056	7575	UUAAAAUGGUUCCGACUUGUCUUAAAAUGGUUCCGACUUGUC	240240	GGGACAAGUCGGAACCAUUUUGGGACAAGUCGGAACCAUUUU
GR90059GR90059	7676	AAAUGGUUCCGACUUGUCCCUAAAUGGUUCCGACUUGUCCCU	241241	AGAGGGACAAGUCGGAACCAUAGAGGGACAAGUCGGAACCAU
GR90061GR90061	7777	AUGGUUCCGACUUGUCCCUCUAUGGUUCCGACUUGUCCCUCU	242242	AGAGAGGGACAAGUCGGAACCAGAGAGGGACAAGUCGGAACC
GR90064GR90064	7878	GUUCCGACUUGUCCCUCUCUCGUUCCGACUUGUCCCUCUCUC	243243	CUGAGAGAGGGACAAGUCGGACUGAGAGAGGGACAAGUCGGA
GR90086GR90086	7979	GCCCUCCAUGGCCUGGCACGAGCCCUCCCAUGGCCUGGCACGA	244244	CCUCGUGCCAGGCCAUGGAGGCCUCGUGCCAGGCCAUGGAGG
GR90095GR90095	8080	GGCCUGGCACGAGGGGAUGGGGGCCUGGCACGAGGGGAUGGG	245245	UCCCCAUCCCCUCGUGCCAGGUCCCCAUCCCCUCGUGCCAGG
GR90106GR90106	8181	AGGGGAUGGGGAUGCUUCCGCAGGGGAUGGGGAUGCUUCCGC	246246	AGGCGGAAGCAUCCCCAUCCCAGGCGGAAGCAUCCCCAUCCC
GR90108GR90108	8282	GGGAUGGGGAUGCUUCCGCCUGGGAUGGGGAUGCUUCCGCCU	247247	AAAGGCGGAAGCAUCCCCAUCAAAGGCGGAAGCAUCCCCAUC
GR90113GR90113	8383	GGGGAUGCUUCCGCCUUUCCGGGGGAUGCUUCCGCCUUUCCG	248248	CCCGGAAAGGCGGAAGCAUCCCCCGGAAAGGCGGAAGCAUCC
GR90117GR90117	8484	AUGCUUCCGCCUUUCCGGGGCAUGCUUCCGCCUUUCCGGGGC	249249	CAGCCCCGGAAAGGCGGAAGCCAGCCCCCGGAAAGGCGGAAGC
GR90121GR90121	8585	UUCCGCCUUUCCGGGGCUGCUUUCCGCCUUUCCGGGGCUGCU	250250	CCAGCAGCCCCGGAAAGGCGGCCAGCAGCCCCCGGAAAGGCCG
GR90122GR90122	8686	UCCGCCUUUCCGGGGCUGCUGUCCGCCUUUCCGGGGCUCUG	251251	GCCAGCAGCCCCGGAAAGGCGGCCAGCAGCCCCGGAAAGGCG
GR90142GR90142	8787	GGCCUGGCCCUUGAGUGGGGCGGCCUGGCCCUUGAGUGGGGC	252252	CUGCCCCACUCAAGGGCCAGGCUGCCCCACUCAAGGGCCAGG
GR90165GR90165	8888	CCUCCUUGCCUGGAACUCACUCCUCCUUGCCUGGAACUCACU	253253	UGAGUGAGUUCCAGGCAAGGAUGAGUGAGUUCCAGGCAAGGA
GR90166GR90166	8989	CUCCUUGCCUGGAACUCACUCCUCCUUGCCUGGAACUCACUC	254254	GUGAGUGAGUUCCAGGCAAGGGUGAGUGAGUUCCAGGCAAGG
GR90168GR90168	9090	CCUUGCCUGGAACUCACUCACCCUUGCCUGGAACUCACUCAC	255255	GAGUGAGUGAGUUCCAGGCAAGAGUGAGUGAGUUCCAGGCAA
GR90169GR90169	9191	CUUGCCUGGAACUCACUCACUCUUGCCUGGAACUCACUCACU	256256	AGAGUGAGUGAGUUCCAGGCAAGAGUGAGUGAGUUCCAGGCA
GR90170GR90170	9292	UUGCCUGGAACUCACUCACUCUUGCCUGGAACUCACUCACUC	257257	CAGAGUGAGUGAGUUCCAGGCCAGAGUGAGUGAGUUCCAGGC
GR90171GR90171	9393	UGCCUGGAACUCACUCACUCUUGCCUGGAACUCACUCACUCU	258258	CCAGAGUGAGUGAGUUCCAGGCCAGAGUGAGUGAGUUCCAGG
GR90209GR90209	9494	GUGGAGGUGCCAGGAAGCUCCGUGGAGGUGCCAGGAAGCUCC	259259	AGGGAGCUUCCUGGCACCUCCAGGGAGCUUCCUGGCACCUCC
GR90210GR90210	9595	UGGAGGUGCCAGGAAGCUCCCUGGAGGUGCCAGGAAGCUCCC	260260	GAGGGAGCUUCCUGGCACCUC GAGGGAGCUUCCUGGCACCUC

GR90232GR90232	9696	CCCUCACUGUGGGGCAUUUCACCCUCACUGUGGGGCAUUUCA	261261	GGUGAAAUGCCCCACAGUGAGGGUGAAAUGCCCCACAGUGAG
GR90237GR90237	9797	ACUGUGGGGCAUUUCACCAUUACUGUGGGGCAUUUCACCAUU	262262	UGAAUGGUGAAAUGCCCCACAUGAAUGGUGAAAUGCCCCCACA
GR90238GR90238	9898	CUGUGGGGCAUUUCACCAUUCCUGUGGGGCAUUUCACCAUUC	263263	UUGAAUGGUGAAAUGCCCCACUUGAAUGGUGAAAUGCCCCAC
GR90239GR90239	9999	UGUGGGGCAUUUCACCAUUCAUGUGGGGCAUUUCACCAUUCA	264264	UUUGAAUGGUGAAAUGCCCCA UUUGAAUGGUGAAAUGCCCCCA

GR90240GR90240	100100	GUGGGGCAUUUCACCAUUCAAGUGGGGCAUUUCACCAUUCAA	265265	GUUUGAAUGGUGAAAUGCCCCGUUUGAAUGGUGAAAUGCCCC
GR90241GR90241	101101	UGGGGCAUUUCACCAUUCAAAUGGGGCAUUUCACCAUUCAAA	266 266	UGUUUGAAUGGUGAAAUGCCCUGUUUGAAUGGUGAAAUGCCC

GR90242GR90242	102102	GGGGCAUUUCACCAUUCAAACGGGGCAUUUCACCAUUCAAAC	267 267	CUGUUUGAAUGGUGAAAUGCCCUGUUUGAAUGGUGAAAUGCC

GR90243GR90243	103103	GGGCAUUUCACCAUUCAAACAGGGCAUUUCACCAUUCAAACA	268268	CCUGUUUGAAUGGUGAAAUGC CCUGUUUGAAUGGUGAAAUGC

GR90244GR90244	104104	GGCAUUUCACCAUUCAAACAGGGCAUUUCACCAUUCAAACAG	269269	ACCUGUUUGAAUGGUGAAAUG ACCUGUUUGAAUGGUGAAAUG

GR90245GR90245	105105	GCAUUUCACCAUUCAAACAGGGCAUUUCACCAUUCAAACAGG	270270	GACCUGUUUGAAUGGUGAAAU GACCUGUUUGAAUGGUGAAAU

GR90246GR90246	106106	CAUUUCACCAUUCAAACAGGUCAUUUCACCAUUCAAACAGGU	271271	CGACCUGUUUGAAUGGUGAAA CGACCUGUUUGAAUGGUGAAA

GR90247GR90247	107107	AUUUCACCAUUCAAACAGGUCAUUUCACCAUUCAAACAGGUC	272272	UCGACCUGUUUGAAUGGUGAA UCGACCUGUUUGAAUGGUGAA

GR90250GR90250	108108	UCACCAUUCAAACAGGUCGAGUCACCAUUCAAACAGGUCGAG	273273	AGCUCGACCUGUUUGAAUGGUAGCUCGACCUGUUUGAAUGGU

GR90251GR90251	109109	CACCAUUCAAACAGGUCGAGCCACCAUUCAAACAGGUCGAGC	274274	CAGCUCGACCUGUUUGAAUGGCAGCUCGACCUGUUUGAAUGG
GR90284GR90284	110110	CUGCCAGCUGCUCCCAAUGUGCUGCCAGCUGCUCCCAAUGUG	275275	GGCACAUUGGGAGCAGCUGGCGGCACAUUGGGAGCAGCUGGC
GR90286GR90286	111111	GCCAGCUGCUCCCAAUGUGCCGCCAGCUGCUCCCAAUGUGCC	276276	UCGGCACAUUGGGAGCAGCUGUCGGCACAUUGGGAGCAGCUG
GR90290GR90290	112112	GCUGCUCCCAAUGUGCCGAUGGCUGCUCCCAAUGUGCCGAUG	277277	GACAUCGGCACAUUGGGAGCAGACAUCGGCACAUUGGGAGCA
GR90291GR90291	113113	CUGCUCCCAAUGUGCCGAUGUCUGCUCCCAAUGUGCCGAUGU	278278	GGACAUCGGCACAUUGGGAGCGGACAUCGGCACAUUGGGAGC
GR90293GR90293	114114	GCUCCCAAUGUGCCGAUGUCCGCUCCCAAUGUGCCGAUGUCC	279279	ACGGACAUCGGCACAUUGGGAACGGACAUCGGCACAUUGGGA
GR90297GR90297	115115	CCAAUGUGCCGAUGUCCGUGGCCAAUGUGCCGAUGUCCGUGG	280280	GCCCACGGACAUCGGCACAUUGCCCACGGACAUCGGCACAUU
GR90298GR90298	116116	CAAUGUGCCGAUGUCCGUGGGCAAUGUGCCCGAUGUCCGUGGG	281281	UGCCCACGGACAUCGGCACAUUGCCCACGGACAUCGGCACAU
GR90303GR90303	117117	UGCCGAUGUCCGUGGGCAGAAUGCCGAUGUCCGUGGGCAGAA	282282	CAUUCUGCCCACGGACAUCGGCAUUCUGCCCACGGACAUCGG
GR90306GR90306	118118	CGAUGUCCGUGGGCAGAAUGACGAUGUCCGUGGGCAGAAUGA	283283	AGUCAUUCUGCCCACGGACAUAGUCAUUCUGCCCACGGACAU
GR90307GR90307	119119	GAUGUCCGUGGGCAGAAUGACGAUGUCCGUGGGCAGAAUGAC	284284	AAGUCAUUCUGCCCACGGACA AAGUCAUUCUGCCCACGGACA

GR90308GR90308	120120	AUGUCCGUGGGCAGAAUGACUAUGUCCGUGGGCAGAAUGACU	285285	AAAGUCAUUCUGCCCACGGACAAAGUCAUUCUGCCCACGGAC
GR90309GR90309	121121	UGUCCGUGGGCAGAAUGACUUUGUCCGUGGGCAGAAUGACUU	286286	AAAAGUCAUUCUGCCCACGGAAAAAGUCAUUCUGCCCACGGA
GR90310GR90310	122122	GUCCGUGGGCAGAAUGACUUUGUCCGUGGGCAGAAUGACUUU	287287	UAAAAGUCAUUCUGCCCACGGUAAAAGUCAUUCUGCCCCACGG
GR90320GR90320	123123	AGAAUGACUUUUAUUGAGCUCAGAAUGACUUUUAUUGAGCUC	288288	AAGAGCUCAAUAAAAGUCAUUAAGAGCUCAAUAAAAGUCAUU
GR90329GR90329	124124	UUUAUUGAGCUCUUGUUCCGUUUUAUUGAGCUCUUGUUCCGU	289289	GCACGGAACAAGAGCUCAAUAGCACGGAACAAGAGCUCAAUA
GR90330GR90330	125125	UUAUUGAGCUCUUGUUCCGUGUUAUUGAGCUCUUGUUCCGUG	290290	GGCACGGAACAAGAGCUCAAUGGCACGGAACAAGAGCUCAAU
GR90337GR90337	126126	GCUCUUGUUCCGUGCCAGGCAGCUCUUGUUCCGUGCCAGGCA	291291	AAUGCCUGGCACGGAACAAGAAAUGCCUGGCACGGAACAAGA
GR90345GR90345	127127	UCCGUGCCAGGCAUUCAAUCCUCCGUGCCAGGCAUUCAAUCC	292292	GAGGAUUGAAUGCCUGGCACGGAGGAUUGAAUGCCUGGCACG
GR90384GR90384	128128	GGCAGGAUUCUUCCCAUGGAUGGCAGGAUUCUUCCCAUGGAU	293293	CUAUCCAUGGGAAGAAUCCUGCUAUCCAUGGGAAGAAUCCUG
GR90469GR90469	129129	AUGGCCCUCAUCUCCAGCUAAAUGGCCCUCAUCUCCAGCUAA	294294	AGUUAGCUGGAGAUGAGGGCCAGUUAGCUGGAGAUGAGGGCC
GR90533GR90533	130130	GCUUUCUGGAUGGCAUCUAGCGCUUUCUGGAUGGCAUCUAGC	295295	UGGCUAGAUGCCAUCCAGAAAUGGCUAGAUGCCAUCCAGAAA
GR90543GR90543	131131	UGGCAUCUAGCCAGAGGCUGGUGGCAUCUAGCCAGAGGCUGG	296296	CUCCAGCCUCUGGCUAGAUGCCUCCAGCCUCUGGCUAGAUGC
GR90561GR90561	132132	UGGAGACAGGUGCGCCCCUGGUGGAGACAGGUGCGCCCCUGG	297297	CACCAGGGGCGCACCUGUCUCCACCAGGGGCGCACCUGUCUC
GR90562GR90562	133133	GGAGACAGGUGCGCCCCUGGUGGAGACAGGUGCGCCCCUGGU	298298	CCACCAGGGGCGCACCUGUCUCCACCAGGGGCGCACCUGUCU
GR90563GR90563	134134	GAGACAGGUGCGCCCCUGGUGGAGACAGGUGCGCCCCUGGUG	299299	ACCACCAGGGGCGCACCUGUCACCACCAGGGGCGCACCUGUC
GR90564GR90564	135135	AGACAGGUGCGCCCCUGGUGGAGACAGGUGCGCCCCUGGUGG	300300	GACCACCAGGGGCGCACCUGUGACCACCAGGGGCGCACCUGU
GR90568GR90568	136136	AGGUGCGCCCCUGGUGGUCACAGGUGCGCCCCUGGUGGUCAC	301301	CUGUGACCACCAGGGGCGCACCUGUGACCACCAGGGGCGCAC
GR90603GR90603	137137	UUUCCUGAGCCACCUUUACUCUUUCCUGAGCCACCUUUACUC	302302	CAGAGUAAAGGUGGCUCAGGACAGAGUAAAGGUGGCUCAGGA
GR91024GR91024	138138	GGCCUGGCGGAGAUGCUUCUAGGCCUGGCGGAGAUGCUUCUA	303303	CUUAGAAGCAUCUCCGCCAGGCUUAGAAGCAUCUCCCGCCAGG
GR91177GR91177	139139	GCUUUUGUAACUUGAAGAUAUGCUUUUGUAACUUGAAGAUAU	304304	AAAUAUCUUCAAGUUACAAAAAAAUAUCUUCAAGUUACAAAA
GP90083.11GP90083.11	1111	CCCGUGCGCAGGAGGACGAGGCCCGUGCGCAGGAGGACGAGG	351351	CCUCGUCCUCCUGCGCACGGGCGCCUCGUCCUCCUGCGCACGGGCG
GP90308.11GP90308.11	1818	CCCGCCGGGGAUACCUCACCACCCGCCGGGGAUACCUCACCA	352352	UGGUGAGGUAUCCCCGGCGGGCAUGGUGAGGUAUCCCCGGCGGGCA
GP90314.11GP90314.11	1919	GGGGAUACCUCACCAAGAUCCGGGGAUACCUCACCAAGAUCC	353353	GGAUCUUGGUGAGGUAUCCCCGGGGAUCUUGGUGAGGAUCCCCGG

GP90315.11GP90315.11	2020	GGGAUACCUCACCAAGAUCCUGGGAUACCUCACCAAGAUCCU	354354	AGGAUCUUGGUGAGGUAUCCCCGAGGAUCUUGGUGAGGUAUCCCCG
GP90325.11GP90325.11	21twenty one	ACCAAGAUCCUGCAUGUCUUCACCAAGAUCCUGCAUGUCUUC	355355	GAAGACAUGCAGGAUCUUGGUGAGAAGACAUGCAGGAUCUUGGUGA
GP90405.11GP90405.11	23twenty three	GAAGUUGCCCCAUGUCGACUAGAAGUUGCCCCAUGUCGACUA	356356	UAGUCGACAUGGGGCAACUUCAAUAGUCGACAUGGGGCAACUUCAA
GP90413.11GP90413.11	24twenty four	CCCAUGUCGACUACAUCGAGGCCCAUGUCGACUACAUCGAGG	357357	CCUCGAUGUAGUCGACAUGGGGCCCUCGAUGAUGUAGUCGACAUGGGGC
GP90497.11GP90497.11	2525	ACCGGGCGGAUGAAUACCAGCACCGGGCGGAUGAAUACCAGC	358358	GCUGGUAUUCAUCCGCCCGGUACGCUGGUAUUCAUCCGCCCCGGUAC
GP91056.11GP91056.11	3131	GACCAACUUUGGCCGCUGUGUGACCAACUUUGGCCGCUGUGU	359359	ACACAGCGGCCAAAGUUGGUCCCACACAGCGGCCAAAGUUGGUCCC
GP91058.11GP91058.11	3232	CCAACUUUGGCCGCUGUGUGGCCAACUUUGGCCGCUGUGUGG	360360	CCACACAGCGGCCAAAGUUGGUCCCACACAGCGGCCAAAGUUGGUC
GP91067.11GP91067.11	3333	GCCGCUGUGUGGACCUCUUUGGCCGCUGUGUGGACCUCUUUG	361361	CAAAGAGGUCCACACAGCGGCCACAAAGAGGUCCACACAGCGGCCA
GP91069.11GP91069.11	3434	CGCUGUGUGGACCUCUUUGCCCGCUGUGUGGACCUCUUUGCC	362362	GGCAAAGAGGUCCACACAGCGGCGGCAAAGAGGUCCCACACAGCGGC
GP91534.11GP91534.11	4343	CACAACGCUUUUGGGGGUGAGCACAACGCUUUUGGGGGUGAG	363363	CUCACCCCCAAAAGCGUUGUGGGCUCACCCCCAAAAGCGUUGUGGG
GP91535.11GP91535.11	4444	ACAACGCUUUUGGGGGUGAGGACAACGCUUUUGGGGGGUGAGG	364364	CCUCACCCCCAAAAGCGUUGUGGCCUCACCCCCAAAAGCGUUGUGG
GP91536.11GP91536.11	4545	CAACGCUUUUGGGGGUGAGGGCAACGCUUUUGGGGGUGAGGG	365365	CCCUCACCCCCAAAAGCGUUGUGCCCUCACCCCCAAAAGCGUUGUG
GP91550.11GP91550.11	4646	GUGAGGGUGUCUACGCCAUUGGUGAGGGUGUCUACGCCAUUG	366366	CAAUGGCGUAGACACCCUCACCCCAAUGGCGUAGACACCCUCACCC
GP91551.11GP91551.11	4747	UGAGGGUGUCUACGCCAUUGCUGAGGGUGUCUACGCCAUUGC	367367	GCAAUGGCGUAGACACCCUCACCGCAAUGGCGUAGACACCCUCACC
GP91554.11GP91554.11	4949	GGGUGUCUACGCCAUUGCCAGGGGUGUCUACGCCAUUGCCAG	368368	CUGGCAAUGGCGUAGACACCCUCCUGGCAAUGGCGUAGACACCCUC
GP91555.11GP91555.11	5050	GGUGUCUACGCCAUUGCCAGGGGUGUCUACGCCAUUGCCAGG	369369	CCUGGCAAUGGCGUAGACACCCUCCUGGCAAUGGCGUAGACACCCU
GP91556.11GP91556.11	5151	GUGUCUACGCCAUUGCCAGGUGUGUCUACGCCAUUGCCAGGU	370370	ACCUGGCAAUGGCGUAGACACCCACCUGGCAAUGGCGUAGACACCC
GP91557.11GP91557.11	5252	UGUCUACGCCAUUGCCAGGUGUGUCUACGCCAUUGCCAGGGUG	371371	CACCUGGCAAUGGCGUAGACACCCACCUGGCAAUGGCGUAGACACC
GP91560.11GP91560.11	5353	CUACGCCAUUGCCAGGUGCUGCUACGCCAUUGCCAGGUGCUG	372372	CAGCACCUGGCAAUGGCGUAGACCAGCACCUGGCAAUGGCGUAGAC
GP91561.11GP91561.11	5454	UACGCCAUUGCCAGGUGCUGCUACGCCAUUGCCAGGGUGCUGC	373373	GCAGCACCUGGCAAUGGCGUAGAGCAGCACCUGGCAAUGGCGUAGA
GP91710.11GP91710.11	5656	CCUUGGCACCCACAAGCCGCCCCUUGGCACCCACAAGCCGCC	374374	GGCGGCUUGUGGGUGCCAAGGUCGGCGGCUUGUGGGUGCCAAGGUC
GP91716.11GP91716.11	5757	CACCCACAAGCCGCCUGUGCUCACCCACAAGCCGCCUGUGCU	375375	AGCACAGGCGGCUUGUGGGUGCCAGCACAGGCGGCUUGUGGGUGCC
GP91718.11GP91718.11	5858	CCCACAAGCCGCCUGUGCUGACCCACAAGCCGCCUUGUGCUGA	376376	UCAGCACAGGCGGCUUGUGGGUGUCAGCACAGGCGGCUUGUGGGUG
GP91719.11GP91719.11	5959	CCACAAGCCGCCUGUGCUGAGCCACAAGCCGCCUGUGCUGAG	377377	CUCAGCACAGGCGGCUUGUGGGUCUCAGCACAGGCGGCUUGUGGGU
GP91741.11GP91741.11	6060	CCACGAGGUCAGCCCAACCAGCCACGAGGUCAGCCCAACCAG	378378	CUGGUUGGGCUGACCUCGUGGCCCUGGUUGGGCUGACCUCGUGGCC
GP91742.11GP91742.11	6161	CACGAGGUCAGCCCAACCAGUCACGAGUCAGCCCAACCAGU	379379	ACUGGUUGGGCUGACCUCGUGGCACUGGUUGGGCUGACCUCGUGGC
GP91966.11GP91966.11	7070	GUCAGGAGCCGGGACGUCAGCGUCAGGAGCCGGGACGUCAGC	380380	GCUGACGUCCCGGCUCCUGACUAGCUGACGUCCCGGCUCCUGACUA
GR90041.11GR90041.11	341341	CUGGGGCUGAGCUUUAAAAUGCUGGGGCUGAGCUUUAAAAUG	381381	CAUUUUAAAGCUCAGCCCCAGCCCAUUUUAAAGCUCAGCCCCAGCC
GR90044.11GR90044.11	342342	GGGCUGAGCUUUAAAAUGGUUGGGCUGAGCUUUAAAAUGGUU	382382	AACCAUUUUAAAGCUCAGCCCCAAACCAUUUUAAAGCUCAGCCCCCA
GR90046.11GR90046.11	343343	GCUGAGCUUUAAAAUGGUUCCGCUGAGCUUUAAAAUGGUUCC	383383	GGAACCAUUUUAAAGCUCAGCCCGGAACCAUUUUAAAGCUCAGCCC
GR90142.11GR90142.11	344344	CCUGGCCCUUGAGUGGGGCAGCCUGGCCCUUGAGUGGGGCAG	384384	CUGCCCCACUCAAGGGCCAGGCCCUGCCCCACUCAAGGGCCAGGCC
GR90209.11GR90209.11	345345	GGAGGUGCCAGGAAGCUCCCUGGAGGUGCCAGGAAGCUCCCU	385385	AGGGAGCUUCCUGGCACCUCCACAGGGAGCUUCCUGGCACCUCCAC

GR90210.11GR90210.11	346346	GAGGUGCCAGGAAGCUCCCUCGAGGUGCCAGGAAGCUCCCUC	386386	GAGGGAGCUUCCUGGCACCUCCAGAGGGAGCUUCCUGGCACCUCCA
GR90232.11GR90232.11	347347	CUCACUGUGGGGCAUUUCACCCUCACUGUGGGGCAUUUCACC	387387	GGUGAAAUGCCCCACAGUGAGGGGGUGAAAUGCCCCACAGUGAGGG
GR90237.11GR90237.11	348348	UGUGGGGCAUUUCACCAUUCAUGUGGGGCAUUUCACCAUUCA	388388	UGAAUGGUGAAAUGCCCCACAGUUGAAUGGUGAAAUGCCCCACAGU
GR90543.11GR90543.11	349349	GCAUCUAGCCAGAGGCUGGAGGCAUCUAGCCAGAGGCUGGAG	389389	CUCCAGCCUCUGGCUAGAUGCCACUCCAGCCUCUGGCUAGAUGCCA
GR91177.11GR91177.11	350350	UUUUGUAACUUGAAGAUAUUUUUUUGUAACUUGAAGAUAUUU	390390	AAAUAUCUUCAAGUUACAAAAGCAAAUAUCUUCAAGUUACAAAAGC

Example 3. Detection of the inhibition rate of the siRNA of Example 2 on the expression level of PCSK9 gene in the dual-luciferase reporter plasmid in 293T cells

This example is used to detect the inhibition rate of the dual-luciferase reporter plasmid obtained in Example 1 and the siRNA obtained in Example 2 on the expression level of PCSK9 gene in 293T cells by siRNA on the dual-luciferase reporter plasmid. The final concentration of siRNA is 50nM and 10nM. The following is the experimental method for the final concentration of siRNA of 50nM. The method for the final concentration of 10nM is to replace the final concentration of siRNA in the following method with 10nM, and other steps remain unchanged.

1. Cell plating on the first day. The 293T cells were resuspended in complete medium and the cell concentration was adjusted to 5×10 ⁵ /ml. Then, 100 μl/well was inoculated in a 96-well plate for subsequent experiments.

2. The next day cells were transfected.

(1) Dilution of transfection reagent. According to the actual number of wells transfected, and after considering the loss, dilute the transfection reagent with opti-MEM, so that each well contains 100 μl opti-MEM and 1.2 μl ExFect transfection reagent, which is the transfection reagent dilution plate.

(2) Dilution of siRNA (RNA oligo). Dilute to 1.25 pmol/μl for each siRNA plate. Then according to the layout, 1.25pmol/μl of Negative Control (NC) (a siRNA sequence unrelated to the inhibitory gene sequence) was added to the first two columns as a control. An siRNA dilution plate was obtained, 32 μl of 1.25 pmol/ul siRNA and 68 μl of opti-MEM per well.

3) Dilution of plasmids. Dilute with opti-MEM, mix well so that 80μl opti-MEM per well contains 128ng plasmid, this is the plasmid dilution plate.

4) Transfection. Pipette 50 μl/well from the siRNA dilution plate and the plasmid dilution plate respectively and add it to the transfection reagent dilution plate to obtain a transfection complex of 200 μl/well, and let it stand for about 20 minutes. Aspirate 50 μl of the original culture solution from each well of the 3 cell complex plates, and then pipette 50 μl/well from the transfection reagent dilution plate (containing 200 μl/well of transfection complex) and add it to the cell plate. To three cells complex plate. Shake the plate well into the incubator. At this time, the final concentration of siRNA was 50 nM, and the transfection reagent was 0.3 μl/well. The corresponding relationship between siRNA and dual-luciferase reporter plasmid is shown in Table 3.

Table 3. Correspondence between siRNA and dual-luciferase reporter plasmid

编号Numbering	对应质粒Corresponding plasmid	编号Numbering	对应质粒Corresponding plasmid	编号Numbering	对应质粒Corresponding plasmid	编号Numbering	对应质粒Corresponding plasmid
GP90083GP90083	GPT0001GPT0001	GP91534GP91534	GPT0005GPT0005	GR90056GR90056	GPT0007GPT0007	GR90247GR90247	GPT0007GPT0007
GP90158GP90158	GPT0001GPT0001	GP91535GP91535	GPT0005GPT0005	GR90059GR90059	GPT0007GPT0007	GR90250GR90250	GPT0007GPT0007
GP90159GP90159	GPT0001GPT0001	GP91536GP91536	GPT0005GPT0005	GR90061GR90061	GPT0007GPT0007	GR90251GR90251	GPT0007GPT0007
GP90165GP90165	GPT0001GPT0001	GP91550GP91550	GPT0005GPT0005	GR90064GR90064	GPT0007GPT0007	GR90284GR90284	GPT0007GPT0007

GP90167GP90167	GPT0001GPT0001	GP91551GP91551	GPT0005GPT0005	GR90086GR90086	GPT0007GPT0007	GR90286GR90286	GPT0007GPT0007
GP90253GP90253	GPT0001GPT0001	GP91552GP91552	GPT0005GPT0005	GR90095GR90095	GPT0007GPT0007	GR90290GR90290	GPT0007GPT0007
GP90262GP90262	GPT0001GPT0001	GP91554GP91554	GPT0005GPT0005	GR90106GR90106	GPT0007GPT0007	GR90291GR90291	GPT0007GPT0007
GP90308GP90308	GPT0001GPT0001	GP91555GP91555	GPT0005GPT0005	GR90108GR90108	GPT0007GPT0007	GR90293GR90293	GPT0007GPT0007
GP90314GP90314	GPT0001GPT0001	GP91556GP91556	GPT0005GPT0005	GR90113GR90113	GPT0007GPT0007	GR90297GR90297	GPT0007GPT0007
GP90315GP90315	GPT0001GPT0001	GP91557GP91557	GPT0005GPT0005	GR90117GR90117	GPT0007GPT0007	GR90298GR90298	GPT0007GPT0007
GP90325GP90325	GPT0001GPT0001	GP91560GP91560	GPT0005GPT0005	GR90121GR90121	GPT0007GPT0007	GR90303GR90303	GPT0007GPT0007
GP90404GP90404	GPT0002GPT0002	GP91561GP91561	GPT0005GPT0005	GR90122GR90122	GPT0007GPT0007	GR90306GR90306	GPT0007GPT0007
GP90405GP90405	GPT0002GPT0002	GP91641GP91641	GPT0005GPT0005	GR90142GR90142	GPT0007GPT0007	GR90307GR90307	GPT0007GPT0007
GP90413GP90413	GPT0002GPT0002	GP91710GP91710	GPT0005GPT0005	GR90165GR90165	GPT0007GPT0007	GR90308GR90308	GPT0007GPT0007
GP90497GP90497	GPT0002GPT0002	GP91716GP91716	GPT0005GPT0005	GR90166GR90166	GPT0007GPT0007	GR90309GR90309	GPT0007GPT0007
GP90602GP90602	GPT0002GPT0002	GP91718GP91718	GPT0005GPT0005	GR90168GR90168	GPT0007GPT0007	GR90310GR90310	GPT0007GPT0007
GP90604GP90604	GPT0002GPT0002	GP91719GP91719	GPT0005GPT0005	GR90169GR90169	GPT0007GPT0007	GR90320GR90320	GPT0007GPT0007
GP90606GP90606	GPT0002GPT0002	GP91741GP91741	GPT0005GPT0005	GR90170GR90170	GPT0007GPT0007	GR90329GR90329	GPT0007GPT0007
GP90607GP90607	GPT0002GPT0002	GP91742GP91742	GPT0005GPT0005	GR90171GR90171	GPT0007GPT0007	GR90330GR90330	GPT0007GPT0007
GP90611GP90611	GPT0002GPT0002	GP91744GP91744	GPT0005GPT0005	GR90209GR90209	GPT0007GPT0007	GR90337GR90337	GPT0008GPT0008
GP91056GP91056	GPT0003GPT0003	GP91745GP91745	GPT0005GPT0005	GR90210GR90210	GPT0007GPT0007	GR90345GR90345	GPT0008GPT0008
GP91058GP91058	GPT0003GPT0003	GP91754GP91754	GPT0005GPT0005	GR90232GR90232	GPT0007GPT0007	GR90384GR90384	GPT0008GPT0008
GP91067GP91067	GPT0003GPT0003	GP91760GP91760	GPT0005GPT0005	GR90237GR90237	GPT0007GPT0007	GR90469GR90469	GPT0008GPT0008
GP91069GP91069	GPT0003GPT0003	GP91943GP91943	GPT0006GPT0006	GR90238GR90238	GPT0007GPT0007	GR90533GR90533	GPT0008GPT0008
GP91211GP91211	GPT0004GPT0004	GP91946GP91946	GPT0006GPT0006	GR90239GR90239	GPT0007GPT0007	GR90543GR90543	GPT0008GPT0008
GP91363GP91363	GPT0004GPT0004	GP91947GP91947	GPT0006GPT0006	GR90240GR90240	GPT0007GPT0007	GR90561GR90561	GPT0008GPT0008
GP91373GP91373	GPT0004GPT0004	GP91948GP91948	GPT0006GPT0006	GR90241GR90241	GPT0007GPT0007	GR90562GR90562	GPT0008GPT0008
GP91488GP91488	GPT0005GPT0005	GP91966GP91966	GPT0006GPT0006	GR90242GR90242	GPT0007GPT0007	GR90563GR90563	GPT0008GPT0008
GP91491GP91491	GPT0005GPT0005	GR90041GR90041	GPT0007GPT0007	GR90243GR90243	GPT0007GPT0007	GR90564GR90564	GPT0008GPT0008
GP91511GP91511	GPT0005GPT0005	GR90044GR90044	GPT0007GPT0007	GR90244GR90244	GPT0007GPT0007	GR90568GR90568	GPT0008GPT0008
GP91512GP91512	GPT0005GPT0005	GR90046GR90046	GPT0007GPT0007	GR90245GR90245	GPT0007GPT0007	GR90603GR90603	GPT0008GPT0008
GP91520GP91520	GPT0005GPT0005	GR90050GR90050	GPT0007GPT0007	GR90246GR90246	GPT0007GPT0007	GR91024GR91024	GPT0010GPT0010
						GR91177GR91177	GPT0010GPT0010

3. Cell lysis detection on the third day.

(1) Change the fluid. First, take pictures of the siRNA NC-cy3, siRNA NC-FAM or fluorescent plasmid wells transfected the day before. Subsequently, for all cell plates, the medium in the wells was diluted twice with PBS, then aspirated, and finally the well plates were dried.

(2) Cracking. Dilute the 5× lysate in the dual luciferase detection kit with water to 1× lysate, and add it to a new 96-well plate, adding 50 μl/well of lysate to each cell plate. Cracking at room temperature for about 20 min.

(3) Detection. Pipette 30 μl/well of the lysate from the cell plate and add it to the opaque 96-well assay plate, each cell plate corresponds to an opaque 96-well assay plate. Take the dual luciferase detection kit and prepare the lysate and two substrates according to the instructions. The two substrates were also added to a new 96-well plate. Taking a detection plate as an example, 30 μl/well of substrate 1 and substrate 2 (substrates corresponding to firefly/renilla luciferases) were added respectively. ), and each time the substrate was added for detection with a multi-function microplate reader, the numerical results of Firefly and Renilla were obtained respectively.

4. Data analysis

According to the situation of the dual luciferase carrier used, the Renilla value/Firefly value of the same complex plate was used to obtain the ratio results, and the average values were taken for data analysis.

The experimental results of the final siRNA concentration of 50 nM and 10 nM are shown in Table 4. It can be seen from the table that siRNAs such as GR90168, GR90303, GR90320, GR91024, GR90165, GR90166, GR90169 and GR90247 can very well inhibit the expression of PCSK9 gene at the concentration of 10nM and 50nM.

Table 4. Experimental results with final siRNA concentration of 50 nM and 10 nM

Note: The results shown in the table are the ratio of "Renilla value/Firefly value". The lower the ratio, the lower the gene expression level and the better the siRNA inhibition effect.

Example 4. Preparation of modified siRNA sequences

The siRNA sense strand and antisense strand in Example 2 are chemically modified, A, C, G, U on the left of m represent that the pentose group in the nucleotide residue is a 2'-methoxyribose group, Af, Cf, Gf, Uf represent that the pentose group in the nucleotide residue is a 2'-fluorine modified ribose group, and s represents that the phosphate group between the ribonucleotide residues on the left and right sides is a phosphorothioate group . The specific modified siRNA sequences are shown in Table 5.

Table 5. siRNA modified products in Example 2

Example 5. Detection of the inhibition rate of the modified siRNA obtained in Example 4 on the expression level of PCSK9 gene in the dual-luciferase reporter plasmid

This example is used to detect the inhibition rate of the modified siRNA obtained in Example 4 on the expression level of PCSK9 gene in 293T cells by the siRNA on the dual-luciferase reporter plasmid. The experimental method was the same as that in Example 3, the final concentrations of siRNA were 50 nM and 10 nM, and the detection results were shown in Table 6. It can be seen from the table that the modified siRNA can better inhibit the PCSK9 gene, GR90320.1, GR90247.1, GR90306.1, GR90330.1, GR90293.1, GR90303.1, GR90251.1, GR90297.1, GR90329. 1. GR90046.1, GR90239.1, GR90244.1, GR90246.1 can very well inhibit the expression of PCSK9 gene in 293T cells.

Table 6. Experimental results of modified siRNA final concentrations of 50 nM and 10 nM

Example 6. Detection of the inhibition rate of the siRNA prepared in Example 2 on the expression level of PCSK9 mRNA in Hela cells

This example is used to detect the inhibition rate of the siRNA prepared in Example 2 on the expression level of PCSK9 mRNA in Hela cells.

HeLa cells cultured in 10 cm dishes were routinely trypsinized after passage for 48 h. Resuspend in complete medium and adjust the cell concentration to 4×10 ⁵ /ml. Then, 100 μl/well was inoculated in a 96-well plate. The 25 siRNA sequences in Example 2 were selected, and another siRNA NC was used as a control.

Transfection conditions: siRNA 50nM transfection, ExFect transfection reagent 0.5μl/well. After considering the loss, the transfection complex was prepared by diluting the siRNA and ExFect transfection reagent with opti-MEM, and after standing for 5 minutes, the two components were mixed and left standing for about 15 minutes.

The 96-well plate plated on the previous day was taken out, 20 μl/well of the original medium was aspirated and discarded, and 80 μl of medium remained in each well. When the standing time is up, 20 μl/well of the transfection complex is added to the corresponding well. About 5 hours after transfection, the transfection complex was discarded, 100 μl of complete medium was added to each well, and the cells were placed in an incubator to continue culturing. The wells transfected with NC-cy3 and NC-FAM were washed with PBS and photographed using a fluorescent inverted microscope.

24h after transfection, the transfected 96-well plate was taken out, and the medium in the well was aspirated and discarded. After washing once with PBS, 100 μl/well of PBS was added for subsequent qPCR detection.

The expression of PCSK9 mRNA in Hela cells transfected with siRNA was detected by real-time quantitative PCR (qPCR). The specific steps are: using OMEGA EZ 96Total RNA Kit to extract the total RNA of the above Hela cells (Blank, blank control; NC; negative control group) using the 96-well plate for transfection test;

II U+One Step qRT-PCR Probe Kit (qPCR kit), according to the instructions, use the RT-PCR one-step double fluorescence quantitative detection system of PCSK9 gene and internal reference ACTB gene to detect the expression of PCSK9 gene in Hela cells and analyze . The specific primers are as follows:

H-ACTB-FO-3: 5'-TGCCGACAGGATGCAGAAG-3';

H-ACTB-RE-3: 5'-GCCGATCCACACGGAGTACT-3';

H-ACTB-PR-3-FAM: 5'-ATCAAGATCATTGCTCCTCCTGAGCGC-3';

H-PCSK9V1-FO-1: 5'-GATCCTGCATGTCTTCCA-3';

H-PCSK9V1-RE-1:5'-GTCCCTCCTCGATGTAGTC-3';

H-PCSK9V1-PR1-1-JOE: 5'-CCTTCTTCCTGGCTTCCTGGT-3'.

The results are shown in Table 7. It can be seen from the table that GR90243, GR90303, GR90247, GP91511, GR90168, GR90108, GR90320, GR90244, GR90293, GR90106, GR91024, GR90306, GR90239, GR90246, GR90290, GR90297 can express very good PCSK9 mRNA.

Table 7. Results of inhibition rate of siRNA on PCSK9 mRNA expression level in Hela cells

编号Numbering	PCSK9 mRNA的值Value of PCSK9 mRNA	编号Numbering	PCSK9 mRNA的值Value of PCSK9 mRNA
GP91511GP91511	0.100.10	GR90568GR90568	0.670.67
GP91211GP91211	0.290.29	GR91024GR91024	0.140.14
GP91710GP91710	0.190.19	GR90247GR90247	0.090.09
GP91488GP91488	0.370.37	GR90320GR90320	0.120.12
GP91491GP91491	0.370.37	GR90330GR90330	0.170.17
GP91760GP91760	0.200.20	GR90329GR90329	0.180.18
GR90095GR90095	0.290.29	GR90244GR90244	0.120.12
GR90106GR90106	0.140.14	GR90306GR90306	0.140.14
GR90108GR90108	0.110.11	GR90293GR90293	0.120.12
GR90113GR90113	0.210.21	GR90239GR90239	0.140.14
GR90117GR90117	0.470.47	GR90297GR90297	0.150.15
GR90121GR90121	0.740.74	GR90251GR90251	0.360.36
GR90122GR90122	0.760.76	GR90250GR90250	0.280.28
GR90142GR90142	0.350.35	GR90243GR90243	0.060.06
GR90165GR90165	0.340.34	GR90246GR90246	0.140.14
GR90166GR90166	0.170.17	GR90290GR90290	0.140.14
GR90168GR90168	0.100.10	GR90303GR90303	0.070.07
GR90169GR90169	0.180.18	GR90286GR90286	0.190.19
GR90543GR90543	0.360.36	GR90309GR90309	0.180.18
GR90561GR90561	0.530.53	GR90284GR90284	0.260.26
GR90562GR90562	0.630.63	BlankBlank	1.131.13
GR90563GR90563	0.370.37	Negative controlNegative control	1.001.00
GR90564GR90564	0.41710.4171

Note: "PCSK9 mRNA value" in the table is the ratio after ACTB expression level is regarded as 1.

Example 7. Detection of the inhibition rate of the siRNA prepared in Example 2 on the expression level of PCSK9 protein in Hela cells

This example is used to detect the inhibition rate of the siRNA prepared in Example 2 on the expression level of PCSK9 protein in Hela cells.

The cell transfection method was the same as that in Example 6, and the expression level of PCSK9 protein in Hela cells transfected with siRNA was detected by enzyme-linked immunosorbent assay (ELISA). The specific steps are: after culturing the transfected cells for 24 hours, use the PCSK9Matched ELISA Antibody Pair Set kit (SinoBiological Company) to detect the expression of PCSK9 protein.

The test results are shown in Table 8. It can be seen from the table that GR91024, GR90563, GR90113, GP91710, GR90108, GR90165, GR90564, GR90169, GR90168, GR90166, GP91211, GR90106, GR90117, GR90142, GP91511 can very well inhibit the expression of PCSK9 protein.

Table 8. Results of the inhibition rate of siRNA on the expression level of PCSK9 protein in Hela cells

编号Numbering	平均值(pg/ml)Average (pg/ml)	编号Numbering	平均值(pg/ml)Average (pg/ml)
BlankBlank	14676.4914676.49	GR90562GR90562	6230.486230.48
NCNC	14344.7914344.79	GR90563GR90563	3853.393853.39
GP91511GP91511	5308.845308.84	GR90564GR90564	4641.584641.58
GP91211GP91211	5019.105019.10	GR90568GR90568	6217.976217.97
GP91710GP91710	4313.894313.89	GR91024GR91024	3215.333215.33
GP91488GP91488	6713.796713.79	GR90247GR90247	5943.465943.46
GP91491GP91491	7473.797473.79	GR90320GR90320	6715.626715.62
GP91760GP91760	6090.586090.58	GR90330GR90330	8243.638243.63
GR90095GR90095	5336.175336.17	GR90329GR90329	7623.527623.52
GR90106GR90106	5150.305150.30	GR90244GR90244	6965.766965.76
GR90108GR90108	4313.894313.89	GR90306GR90306	6394.806394.80
GR90113GR90113	4215.494215.49	GR90293GR90293	6905.676905.67
GR90117GR90117	5232.305232.30	GR90239GR90239	5394.255394.25
GR90121GR90121	8955.168955.16	GR90297GR90297	6199.046199.04
GR90122GR90122	8508.838508.83	GR90251GR90251	7732.077732.07
GR90142GR90142	5247.385247.38	GR90250GR90250	7324.417324.41
GR90165GR90165	4335.414335.41	GR90243GR90243	7359.847359.84
GR90166GR90166	4766.874766.87	GR90246GR90246	7343.537343.53
GR90168GR90168	4684.254684.25	GR90290GR90290	7325.147325.14
GR90169GR90169	4661.754661.75	GR90303GR90303	5733.455733.45
GR90543GR90543	5401.105401.10	GR90286GR90286	6171.886171.88
GR90561GR90561	7665.757665.75	GR90309GR90309	5974.045974.04
		GR90284GR90284	8755.138755.13

Example 8. Detection of IC50 of some siRNAs to PCSK9 mRNA in Hela cells

This example was used to detect the expression of PCSK9 mRNA in Hela cells by GP91511, GR91024, GR90165, GR90166, GR90168, GR90169, GR90243, GR90247, GR90303 and GR90320 at 0, 0.001, 0.01, 0.1, 1, 10, 100 nM concentrations level of inhibition. Cell transfection and qPCR detection methods were the same as those in Example 6, and the calculated IC50s were shown in Table 9. It can be seen from the table that GP91511, GR90165, GR90168, GR90169, GR90320 and GR90243 can well inhibit the expression of PCSK9 mRNA.

Table 9. IC50 detection results of some siRNAs on PCSK9 mRNA in Hela cells

编号Numbering	IC50(nM)IC50(nM)
GP91511GP91511	0.220.22
GR91024GR91024	11.9511.95
GR90165GR90165	1.201.20
GR90166GR90166	7.097.09
GR90168GR90168	0.930.93
GR90169GR90169	1.061.06
GR90243GR90243	0.860.86
GR90247GR90247	6.126.12
GR90303GR90303	6.276.27
GR90320GR90320	2.572.57

Example 9. Sequence-adjusted siRNA and detection of its inhibitory effect on PCSK9

In this example, the sequences of GR90168, GR90303, GR90320, GR91024, GR90165, GR90166, GR90169 and GR90247 were adjusted and the siRNAs shown in Table 10 were prepared.

In this example, the inhibitory effect of siRNA in Table 10 on PCSK9 mRNA expression level and protein expression level in Hela cells was detected. The detection method is shown in Example 6 and Example 7, and the final concentration of siRNA was 10 nM or 0.1 nM, and PCSK9 mRNA was detected by qPCR. The results of expression levels are shown in Table 11, and the results of ELISA detection of PCSK9 protein expression levels are shown in Table 12. The results show that after adjusting the sequence, the inhibitory effect on the PCSK9 gene and protein can be further enhanced on the basis of the original sequence.

Table 10. Sequence-adjusted siRNA

编号Numbering	SEQ ID No.SEQ ID No.	正义链chain of justice	SEQ ID No.SEQ ID No.	反义链antisense strand
GR90168.0GR90168.0	9090	CCUUGCCUGGAACUCACUCACCCUUGCCUGGAACUCACUCAC	255255	GAGUGAGUGAGUUCCAGGCAAGAGUGAGUGAGUUCCAGGCAA
GR90168.20GR90168.20	140140	GCCUGGAACUCACUCACUCUGGCCUGGAACUCACUCACUCUG	305305	GAGUGAGUGAGUUCCAGGCAAGAGUGAGUGAGUUCCAGGCAA
GR90168.21GR90168.21	141141	GCCUGGAACUCACUCACUCUGGCCUGGAACUCACUCACUCUG	306306	CAGAGUGAGUGAGUUCCAGGCAACAGAGUGAGUGAGUUCCAGGCAA
GR90168.22GR90168.22	142142	UUGCCUGGAACUCACUCACUCUUGCCUGGAACUCACUCACUC	307307	GAGUGAGUGAGUUCCAGGCAAGGGAGUGAGUGAGUUCCAGGCAAGG
GR90168.23GR90168.23	143143	UGCCUGGAACUCACUCACUCUUGCCUGGAACUCACUCACUCU	308308	AGAGUGAGUGAGUUCCAGGCAAGAGAGUGAGUGAGUUCCAGGCAAG
GR90243.0GR90243.0	103103	GGGCAUUUCACCAUUCAAACAGGGCAUUUCACCAUUCAAACA	268268	CCUGUUUGAAUGGUGAAAUGCCCUGUUUGAAUGGUGAAAUGC
GR90243.20GR90243.20	144144	AUUUCACCAUUCAAACAGGUCAUUUCACCAUUCAAACAGGUC	309309	CCUGUUUGAAUGGUGAAAUGCCCUGUUUGAAUGGUGAAAUGC
GR90243.21GR90243.21	145145	AUUUCACCAUUCAAACAGGUCAUUUCACCAUUCAAACAGGUC	310310	GACCUGUUUGAAUGGUGAAAUGCGACCUGUUUGAAUGGUGAAAUGC
GR90243.22GR90243.22	146146	GCAUUUCACCAUUCAAACAGGGCAUUUCACCAUUCAAACAGG	311311	CCUGUUUGAAUGGUGAAAUGCCCCCUGUUUGAAUGGUGAAAUGCCC
GR90243.23GR90243.23	147147	CAUUUCACCAUUCAAACAGGUCAUUUCACCAUUCAAACAGGU	312312	ACCUGUUUGAAUGGUGAAAUGCCACCUGUUUGAAUGGUGAAAUGCC

GR90303.0GR90303.0	117117	UGCCGAUGUCCGUGGGCAGAAUGCCGAUGUCCGUGGGCAGAA	282282	CAUUCUGCCCACGGACAUCGGCAUUCUGCCCACGGACAUCGG
GR90303.20GR90303.20	148148	GAUGUCCGUGGGCAGAAUGACGAUGUCCGUGGGCAGAAUGAC	313313	CAUUCUGCCCACGGACAUCGGCAUUCUGCCCACGGACAUCGG
GR90303.21GR90303.21	149149	GAUGUCCGUGGGCAGAAUGACGAUGUCCGUGGGCAGAAUGAC	314314	GUCAUUCUGCCCACGGACAUCGGGUCAUUCUGCCCACGGACAUCGG
GR90303.22GR90303.22	150150	CCGAUGUCCGUGGGCAGAAUGCCGAUGUCCGUGGGCAGAAUG	315315	CAUUCUGCCCACGGACAUCGGCACAUUCUGCCCACGGACAUCGGCA
GR90303.23GR90303.23	151151	CGAUGUCCGUGGGCAGAAUGACGAUGUCCGUGGGCAGAAUGA	316316	UCAUUCUGCCCACGGACAUCGGCUCAUUCUGCCCACGGACAUCGGC
GR90320.0GR90320.0	123123	AGAAUGACUUUUAUUGAGCUCAGAAUGACUUUUAUUGAGCUC	288288	AAGAGCUCAAUAAAAGUCAUUAAGAGCUCAAUAAAAGUCAUU
GR90320.20GR90320.20	152152	UGACUUUUAUUGAGCUCUUGUUGACUUUUAUUGAGCUCUUGU	317317	AAGAGCUCAAUAAAAGUCAUUAAGAGCUCAAUAAAAGUCAUU
GR90320.21GR90320.21	153153	UGACUUUUAUUGAGCUCUUGUUGACUUUUAUUGAGCUCUUGU	318318	ACAAGAGCUCAAUAAAAGUCAUUACAAGAGCUCAAUAAAAGUCAUU
GR90320.22GR90320.22	154154	AAUGACUUUUAUUGAGCUCUUAAUGACUUUUAUUGAGCUCUU	319319	AAGAGCUCAAUAAAAGUCAUUCUAAGAGCUCAAUAAAAGUCAUUCU
GR90320.23GR90320.23	155155	AUGACUUUUAUUGAGCUCUUGAUGACUUUUAUUGAGCUCUUG	320320	CAAGAGCUCAAUAAAAGUCAUUCCAAGAGCUCAAUAAAAGUCAUUC
GR91024.0GR91024.0	138138	GGCCUGGCGGAGAUGCUUCUAGGCCUGGCGGAGAUGCUUCUA	303303	CUUAGAAGCAUCUCCGCCAGGCUUAGAAGCAUCUCCCGCCAGG
GR91024.20GR91024.20	156156	UGGCGGAGAUGCUUCUAAGGCUGGCGGAGAUGCUUCUAAGGC	321321	CUUAGAAGCAUCUCCGCCAGGCUUAGAAGCAUCUCCCGCCAGG
GR91024.21GR91024.21	157157	UGGCGGAGAUGCUUCUAAGGCUGGCGGAGAUGCUUCUAAGGC	322322	GCCUUAGAAGCAUCUCCGCCAGGGCCUUAGAAGCAUCUCCCGCCAGG
GR91024.22GR91024.22	158158	CCUGGCGGAGAUGCUUCUAAGCCUGGCGGAGAUGCUUCUAAG	323323	CUUAGAAGCAUCUCCGCCAGGAGCUUAGAAGCAUCUCCGCCCAGGAG
GR91024.23GR91024.23	159159	CUGGCGGAGAUGCUUCUAAGGCUGGCGGAGAUGCUUCUAAGG	324324	CCUUAGAAGCAUCUCCGCCAGGACCUUAGAAGCAUCUCCGCCAGGA
GR90165.0GR90165.0	8888	CCUCCUUGCCUGGAACUCACUCCUCCUUGCCUGGAACUCACU	253253	UGAGUGAGUUCCAGGCAAGGAUGAGUGAGUUCCAGGCAAGGA
GR90165.20GR90165.20	160160	CUUGCCUGGAACUCACUCACUCUUGCCUGGAACUCACUCACU	325325	UGAGUGAGUUCCAGGCAAGGAUGAGUGAGUUCCAGGCAAGGA
GR90165.21GR90165.21	161161	CUUGCCUGGAACUCACUCACUCUUGCCUGGAACUCACUCACU	326326	UGAGUGAGUUCCAGGCAAGGAUGAGUGAGUUCCAGGCAAGGA
GR90165.22GR90165.22	162162	UCCUUGCCUGGAACUCACUCAUCCUUGCCUGGAACUCACUCA	327327	UGAGUGAGUUCCAGGCAAGGACUUGAGUGAGUUCCAGGCAAGGACU
GR90165.23GR90165.23	163163	CCUUGCCUGGAACUCACUcacCCUUGCCUGGAACUCACUcac	328328	gUGAGUGAGUUCCAGGCAAGGAcgUGAGUGAGUUCCAGGCAAGGAc
GR90166.0GR90166.0	8989	CUCCUUGCCUGGAACUCACUCCUCCUUGCCUGGAACUCACUC	254254	GUGAGUGAGUUCCAGGCAAGGGUGAGUGAGUUCCAGGCAAGG
GR90166.20GR90166.20	164164	UUGCCUGGAACUCACUCacucUUGCCUGGAACUCACUCacuc	329329	GUGAGUGAGUUCCAGGCAAGGGUGAGUGAGUUCCAGGCAAGG
GR90166.21GR90166.21	165165	UUGCCUGGAACUCACUCacucUUGCCUGGAACUCACUCacuc	330330	gaGUGAGUGAGUUCCAGGCAAGGgaGUGAGUGAGUUCCAGGCAAGG
GR90166.22GR90166.22	166166	CCUUGCCUGGAACUCACUCacCCUUGCCUGGAACUCACUCac	331331	GUGAGUGAGUUCCAGGCAAGGagGUGAGUGAGUUCCAGGCAAGGag
GR90166.23GR90166.23	167167	CUUGCCUGGAACUCACUCaCUUGCCUGGAACUCACUCa	332332	aGUGAGUGAGUUCCAGGCAAGGaaGUGAGUGAGUUCCAGGCAAGGa
GR90169.0GR90169.0	9191	CUUGCCUGGAACUCACUCACUCUUGCCUGGAACUCACUCACU	256256	AGAGUGAGUGAGUUCCAGGCAAGAGUGAGUGAGUUCCAGGCA
GR90169.20GR90169.20	168168	CCUGGAACUCACUCACUcuggCCUGGAACUCACUCACUCugg	333333	AGAGUGAGUGAGUUCCAGGCAAGAGUGAGUGAGUUCCAGGCA
GR90169.21GR90169.21	169169	CCUGGAACUCACUCACUcuggCCUGGAACUCACUCACUCugg	334334	ccAGAGUGAGUGAGUUCCAGGCAccAGAGUGAGUGAGUUCCAGGCA
GR90169.22GR90169.22	170170	UGCCUGGAACUCACUCACUcuUGCCUGGAACUCACUCACUcu	335335	AGAGUGAGUGAGUUCCAGGCAagAGAGUGAGUGAGUUCCAGGCAag
GR90169.23GR90169.23	171171	GCCUGGAACUCACUCACUcugGCCUGGAACUCACUCACUCug	336336	cAGAGUGAGUGAGUUCCAGGCAacAGAGUGAGUGAGUUCCAGGCAa
GR90247.0GR90247.0	107107	AUUUCACCAUUCAAACAGGUCAUUUCACCAUUCAAACAGGUC	272272	UCGACCUGUUUGAAUGGUGAAUCGACCUGUUUGAAUGGUGAA
GR90247.20GR90247.20	172172	CACCAUUCAAACAGGUCgagcCACCAUUCAAACAGGUCgagc	337337	UCGACCUGUUUGAAUGGUGAAUCGACCUGUUUGAAUGGUGAA
GR90247.21GR90247.21	173173	CACCAUUCAAACAGGUCgagcCACCAUUCAAACAGGUCgagc	338338	gcUCGACCUGUUUGAAUGGUGAAgcUCGACCUGUUUGAAUGGUGAA
GR90247.22GR90247.22	174174	UUCACCAUUCAAACAGGUCgaUUCACCAUUCAAACAGGUCga	339339	UCGACCUGUUUGAAUGGUGAAauUCGACCUGUUUGAAUGGUGAAau

GR90247.23

175

UCACCAUUCAAACAGGUCgag

340

cUCGACCUGUUUGAAUGGUGAAa

Table 11. Results of qPCR detection of PCSK9 mRNA expression level

	10nM10nM	0.1nM0.1nM
编号Numbering	平均值average value	平均值average value
GR90168.0GR90168.0	0.230.23	0.470.47
GR90168.20GR90168.20	0.120.12	0.400.40
GR90168.21GR90168.21	0.170.17	0.250.25
GR90168.22GR90168.22	0.140.14	0.320.32
GR90168.23GR90168.23	0.250.25	0.310.31
GR90243.0GR90243.0	0.140.14	0.610.61
GR90243.20GR90243.20	0.330.33	0.650.65
GR90243.21GR90243.21	0.160.16	0.540.54
GR90243.22GR90243.22	0.090.09	0.280.28
GR90243.23GR90243.23	0.130.13	0.250.25
GR90303.0GR90303.0	0.220.22	0.330.33
GR90303.20GR90303.20	0.110.11	0.560.56
GR90303.21GR90303.21	0.150.15	0.520.52
GR90303.22GR90303.22	0.150.15	0.320.32
GR90303.23GR90303.23	0.170.17	0.530.53
GR90320.0GR90320.0	0.140.14	0.430.43
GR90320.20GR90320.20	0.150.15	0.290.29
GR90320.21GR90320.21	0.120.12	0.350.35
GR90320.22GR90320.22	0.080.08	0.220.22
GR90320.23GR90320.23	0.200.20	0.310.31
BLANKBLANK	1.431.43
NC NC	11

Table 12. Results of ELISA detection of PCSK9 protein expression level

Example 10. Modification of the siRNA in Example 9

In order to further enhance the stability of siRNA, the siRNA in Example 9 was further modified in this example, and the siRNA in Table 13 was prepared. A, C, G, U on the left of m represent the pentose group in the nucleotide residue is 2'-methoxyribosyl, Af, Cf, Gf, Uf represent the pentose group in the nucleotide residue is 2'-Fluorine modifies the ribose group, and s represents that the phosphate group between the ribonucleotide residues on the left and right sides is a phosphorothioate group. (LNA) means locked nucleic acid modification; (d) means deoxyribonucleotide; CHO means cholesterol; GALNAC means GalNAc ligand (GalNAc3 shown in formula I above), the schematic diagram of conjugation to the 3' end of the sense strand of siRNA is as follows As shown in Formula II above, X is O. In addition, the IC50 values of the partial modifiers for inhibiting the expression of PCSK9 mRNA were detected in both Hela and HEP3B cells (see Example 8 for specific methods), and the results are shown in Table 14. It can be seen that the modified siRNA significantly reduces the IC50 value of inhibiting PCSK9 mRNA expression compared with the unmodified sequence.

Table 13 Product after further modification of siRNA in Example 9

Table 14. IC50 values of some siRNA modifiers for inhibiting PCSK9 mRNA expression

编号Numbering	Hela细胞(nmol/l)HeLa cells (nmol/l)	Hep3B细胞(nmol/l)Hep3B cells (nmol/l)
GR90320.0GR90320.0	3.7853.785	7.7647.764
GR90320.88GR90320.88	0.3980.398	0.00140.0014
GR90320.89GR90320.89	0.2010.201	0.01020.0102

GR90320.93GR90320.93	0.1620.162	0.05410.0541
GR90320.94GR90320.94	0.2740.274	0.30690.3069
GR90243.0GR90243.0	2.8082.808	1.1361.136
GR90243.50GR90243.50	0.1890.189	0.8650.865
GR90243.51GR90243.51	0.1180.118	0.3930.393
GR90243.55GR90243.55	0.1850.185	0.3190.319
GR90243.56GR90243.56	0.4490.449	0.8060.806

Example 11 Modified synthesis and screening of ligand-conjugated siRNA

In this example, part of the sequence in Example 2 is further modified, its nucleotides are modified, targeting ligands are added to the sense strand of siRNA, and modified siRNA molecules as shown in Table 15 are prepared and synthesized.

In this example, the inhibitory effect of siRNA in Table 15 on the expression level of PCSK9 mRNA in Hep3B cells was tested. The detection method is shown in Example 6. The final concentration of siRNA is 1 nM or 10 nM, and the results of qPCR detection of the expression level of PCSK9 mRNA are shown in Figure 2 . The results show that after the modification of the sequence, the inhibitory effect on the PCSK9 gene can be further enhanced on the basis of the original sequence.

Table 15. Synthetic sequences of ligand-conjugated siRNAs

Example 12. Evaluation of siRNA drug toxicity in vivo

Toxic effects of siRNA drugs in vivo were assessed by single intravenous injection and subcutaneous injection into mice. 60 C57 mice (half female/male, weighing about 20g, 6-8 weeks old) were randomly divided into five groups according to body weight: normal saline group, GR90243.55, GR90243.51, GR90320.93, GR90320.89 The concentration of the drug was 10 mg/kg, and the corresponding doses of drugs were administered intravenously/subcutaneously to 6 animals in each group (3 males and 3 females). Dissection and visual inspection of organ lesions.

The results showed that no obvious abnormality was observed in all animals before and after administration. No obvious abnormal behavior was found in each group of animals, and there was no significant difference in body weight compared with the normal saline group. Combined with the end-point autopsy, there were no obvious visible lesions, and the overall blood biochemistry did not increase significantly. No abnormality was found in liver HE staining and microscopy, indicating that GR90243 .55, GR90243.51, GR90320.93, GR90320.89 were well tolerated by subcutaneous and intravenous administration, and no obvious toxicity was observed. The average body weight of the mice in the intravenous administration group is shown in Figure 3, and the biomarkers of the mice in the subcutaneous administration and intravenous administration groups are shown in Table 16 and Table 17, respectively. The results showed that there was no significant difference in the average body weight among the groups, and there was no significant difference in the biochemical indexes between the groups.

Table 16. Biochemical indexes of mice in subcutaneous administration group (results are mean)

Note: There were no significant differences among the four biochemical indexes among the groups.

Table 17. Biochemical indexes of mice in intravenous administration group (results are mean)

Example 13. Pharmacokinetics of siRNA drugs in mice

The pharmacokinetics of siRNA drugs in mice were detected by intravenous injection and subcutaneous injection into mice. The experiment was divided into 4 groups, 9 male C57 mice in each group, 6-8 weeks old, a total of 36*2 mice. By subcutaneous injection or tail vein injection, the administration concentration was 3 mg/kg, and the day of administration was recorded as day 1. After administration, 100 microliters of blood was collected from mice, and serum was separated for use. There were 9 time points, 5min, 15min, 30min, 1h, 2h, 4h, 8h, 24h, 48h.

Detection method: (1) Serum separation: After the whole blood was allowed to stand at room temperature for 60 minutes, centrifuge at 1500g at 4°C for 15min, pipette the supernatant, and store it at -80°C until sent for inspection.

(2) Serum samples were detected by q-PCR for the sense and antisense strands of siRNA, and the corresponding blood drug concentrations at each time point were obtained. The corresponding results were analyzed with winonlin software to obtain T1/2 (half-life), Vd (apparent volume of distribution) , AUC (area under the drug-time curve) and other PK parameters.

result:

1. The PK parameters of GR90243.55 at 3 mg/kg subcutaneously and 3 mg/kg intravenously are shown in Table 18 and Table 19.

Table 18. PK parameters of GR90243.55 subcutaneous 3mg/kg

Table 19. PK parameters of GR90243.55 intravenous 3mg/kg

2. The PK parameters of GR90243.51 at 3 mg/kg subcutaneously and 3 mg/kg intravenously are shown in Table 20 and Table 21.

Table 20. PK parameters of GR90243.51 subcutaneous 3mpk

Table 21. PK parameters of GR90243.51 intravenous 3mg/kg

3. The PK parameters of GR90320.93 subcutaneous 3 mg/kg and intravenous administration 3 mg/kg are shown in Table 22 and Table 23.

Table 22. PK parameters of GR90320.93 subcutaneous 3mg/kg

Table 23. PK parameters of GR90320.93 intravenous 3mg/kg

4. The PK parameters of GR90320.89 for subcutaneous 3mpk and intravenous administration of 3mg/kg are shown in Table 24 and Table 25.

Table 24. PK parameters of GR90320.89 subcutaneous 3mg/kg

Table 25. PK parameters of GR90320.89 intravenous 3mg/kg

The above results show that GR90243.55, GR90243.51, GR90320.93, and GR90320.89 can be maintained in the blood for a long time.

Example 14. Assessing the concentration of siRNA drug in liver

The concentration of siRNA drugs in the liver was assessed by subcutaneous injection of mice. The experiment was divided into 4 groups, 9 male C57B6 mice in each group, a total of 36 mice. A one-time subcutaneous injection of 3 mg/kg was administered. After administration, the liver was collected at 6 time points of 4h, 24h, 48h, 72h, 96h, and 168h, and the concentration of siRNA in the liver was determined. The following table is the average value of the concentration.

The results showed that: GR90243.55, GR90243.51, GR90320.93, GR90320.89 3 mg/kg subcutaneous injection of drug concentration changes in liver after subcutaneous injection (after subtracting blank liver), the four sequences can still maintain higher drug levels 168h after administration concentration. The concentration of administered siRNA in total liver RNA of GR90243.55, GR90243.51, GR90320.93, and GR90320.89 is summarized in Table 26. The drug content curve is shown in Figure 4.

Table 26. Concentration of siRNA administered in total RNA of animal liver

Example 15. Evaluation of siRNA drug efficacy

1. Test (1)

C57 transgenic mice (transformed into humanized PSCK9 gene sequence, male, weighing about 20 g, 8-10 weeks old, for the specific construction method, see "Luo, Y., Warren, L., Xia, D., Jensen, H. , Sand, T., Petras, S., Hawkins, J. (2008). Function and distribution of circulating human PCSK9expressed extrahepatically in transgenic mice. Journal of Lipid Research,50(8),1581–1588.doi:10.1194/jlr .m800542-jlr200" article, the same below) were randomly divided into 5 groups according to body weight, the normal saline group and the drug group. The day of the drug was recorded as

day

1, and 72 hours later, blood was collected for biochemical detection (lipids including triglycerides, cholesterol, LDL, etc.), PSCK9 protein content was detected by ELISA, and the expression level of PSCK9 mRNA was detected by qPCR in liver.

The results showed that compared with the normal saline group, the levels of PSCK9 in plasma at the end point were decreased. Compared with the normal saline group, the three groups of GR90243.513mg/kg, GR90320.933mg/kg, and GR90320.893mg/kg could reduce the serum LDL level, the PSCK9 level in the plasma, and the hepatic PSCK9 mRNA expression in mice. The end-point blood biochemical results are shown in Table 27. See Figure 5 for PCSK9 protein levels.

Table 27. Average value of end-point blood biochemical indexes

2. Test (2)

The hPCSK9 transgenic mice (transformed into humanized PSCK9 gene sequence in C57 strain mice, SPF grade, half male and female, about 20g body weight, 6-10 weeks old) were randomly divided into GR90320.93 according to the baseline serum LDL index. Low dose (1mg/kg), medium dose (3mg/kg), high dose (10mg/kg); GR90320.89 low dose (1mg/kg), medium dose (3mg/kg), high dose (10mg/kg) , siRNA NC group (3mg/kg, a total of 7 groups, 4 animals in each group (half male and female), respectively, were given subcutaneous injection of corresponding doses of drugs, the day of administration was recorded as day 1, and blood was collected before and 72h after administration. Biochemical tests (lipids including triglycerides, cholesterol, LDL, etc.) and ELISA were used to detect serum PSCK9 levels, and the liver was used as the end point for qPCR detection.

The end-point blood biochemical and LDL-C results are shown in Table 28. There was no significant difference in AST and ALT among the groups.

After administration, LDL-C levels of GR90320.93 1mg/kg, GR90320.93 3mg/kg, GR90320.89 1mg/kg, GR90320.89 3mg/kg, GR90320.89 10mg/kg all decreased, and the end point GR90320. 93 3mg/kg, GR903 20.89 3mg/kg and NC 3mg/kg had significant difference p<0.05.

Table 28. Average value of end-point blood biochemical results (the result is the average value)

After administration, compared with the NC group, the PCSK9 protein content in the end point serum was shown in Figure 6. There was a very significant decrease in each group, and there was a dose-dependent relationship between the GR90320.93 and GR90320.89 groups.

3. Test (3)

hPCSK9 transgenic mice (humanized PSCK9 gene sequence was transferred into C57 strain mice, 18 males and 12 females, body weight about 20g, 6-10 weeks old) were randomly divided into GR90320.93 low-dose (3mg/kg) according to body weight , twice a week), medium dose (6 mg/kg, once a week); GR90320.89 low dose (3 mg/kg, twice a week), medium dose (6 mg/kg, once a week); normal saline group a total of 5 groups, the administration time was one week (single or 2 administrations), 5 animals in each group (2 females, 3 males) were given subcutaneous injection of corresponding doses of drugs respectively, the day of administration was recorded as day 1, and the administration Before (day-3) and the first 2 weeks after administration, blood was collected twice a week for blood biochemical detection (LDL-C) and serum PSCK9 content once a week. The experimental period was 3 months.

After administration, the LDL-C levels of GR90320.93 3mg/kg, GR90320.93 6mg/kg, GR90320.89 3mg/kg, and GR90320.89 6mg/kg started to decrease compared with those before administration, and returned to normal levels on day29. GR90320.89 3mg/kg group decreased significantly, and there was a significant difference compared with day-3 (Figure 7).

After administration, the serum PCSK9 protein level GR90320.93 3mg/kg began to decrease on day8, and returned to normal level on day22. GR90320.93 6mg/kg, GR90320.89 3mg/kg, GR90320.89 6mg/kg and before administration began to decrease compared with day 5, day 22 returned to normal levels, GR90320.89 3mg/kg group day 5, day 8, day 12, day 15 The decrease is more obvious, and there is a significant difference compared with day-3. GR90320.89 6mg/kg group on day 5, day 8 decreased significantly, and there was a significant difference compared with day-3 (Figure 8).

The results of this example show that both GR90320.93 and GR90320.89 can long-term inhibit the level of PCSK9 protein and LDL-C in serum.

The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention, and without unnecessary experimentation, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. While the invention has been given particular embodiments, it should be understood that the invention can be further modified. In conclusion, in accordance with the principles of the present invention, this application is intended to cover any alterations, uses or improvements of the present invention, including changes made using conventional techniques known in the art, departing from the scope disclosed in this application. The application of some of the essential features can be made within the scope of the following appended claims.

Industrial application

The siRNA molecule provided by the invention has high inhibitory activity and high stability; can well specifically inhibit the expression of PCSK9 gene and protein, has good liver targeting and the ability to promote cell endocytosis; ligand modification The siRNA molecules can enter target cells and target tissues without transfection reagents, reducing the negative effects of transfection reagents, such as cell or tissue toxicity. Thus, the ligand-modified siRNA molecule of the present invention provides the possibility for PCSK9 gene-mediated targeted therapy of diseases, including reducing low-density lipoprotein cholesterol, reducing the incidence of coronary heart disease, myocardial infarction, stroke, atherosclerosis, etc. risk or even treat these diseases.

Claims

A siRNA for inhibiting PCSK9 gene expression, comprising a sense strand and an antisense strand; the sense strand and/or the antisense strand have a length in the range of 19-30 nucleotides; the sense strand and the antisense strand The strands can be complementary to form double-stranded RNA, and the complementary region forming the double-stranded has a length in the range of 15-30 nucleotides;

Further, the length of the sense strand or the antisense strand is 19-21 nucleotides in length, 19-23 nucleotides in length, 19-25 nucleotides in length, 21-23 nucleotides in length length, 21-25 nucleotides in length, 23-25 nucleotides in length, 21-30 nucleotides in length, 23-30 nucleotides in length, or 25-30 nucleotides in length;

Further, the double-stranded complementary region of the siRNA has a length of 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.
The siRNA according to any one of claims 1, wherein the sense strand and/or the antisense strand has an overhang at the 3' end and/or the 5' end.
The siRNA of claim 2, wherein the overhang has a length of 1-6 nucleotides;

Further, the overhang has a length of 2-6 nucleotides, a length of 1-5 nucleotides, a length of 2-5 nucleotides, a length of 1-4 nucleotides, and a length of 2-4 nucleotides Acid length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length.
The siRNA according to any one of claims 1-3, wherein the siRNA is any of the following:

P1. After complementary pairing of the sense strand and the antisense strand constituting the siRNA, an overhang with a length of 2 nucleotides is formed at the 3' ends of the two strands;

P2. After complementary pairing of the sense strand and the antisense strand constituting the siRNA, an overhang with a length of 3 nucleotides is formed at the 3' ends of the two strands;

P3. After complementary pairing of the sense strand and the antisense strand constituting the siRNA, an overhang with a length of 4 nucleotides is formed at the 3' ends of the two strands;

P4. After complementary pairing of the sense strand and the antisense strand constituting the siRNA, an overhang with a length of 5 nucleotides is formed at the 3' ends of the two strands.
The siRNA according to any one of claims 1-4, wherein the siRNA has a single overhang, the single overhang is located at the 3' end of the antisense strand, and the 5' end of the antisense strand The ends are blunt ends.
The siRNA according to any one of claims 1-5, wherein the siRNA is any of the following:

(1) Complementary formation of the sense strand shown in SEQ ID No.11 and the antisense strand shown in SEQ ID No.176;

(2) Complementary formation of the sense strand shown in SEQ ID No.12 and the antisense strand shown in SEQ ID No.177;

(3) formed by complementation of the sense strand shown in SEQ ID No.13 and the antisense strand shown in SEQ ID No.178;

(4) Complementary formation of the sense strand shown in SEQ ID No.14 and the antisense strand shown in SEQ ID No.179;

(5) Complementary formation of the sense strand shown in SEQ ID No.15 and the antisense strand shown in SEQ ID No.180;

(6) Complementary formation of the sense strand shown in SEQ ID No.16 and the antisense strand shown in SEQ ID No.181;

(7) Complementary formation of the sense strand shown in SEQ ID No.17 and the antisense strand shown in SEQ ID No.182;

(8) Complementary formation of the sense strand shown in SEQ ID No.18 and the antisense strand shown in SEQ ID No.183;

(9) formed by complementation of the sense strand shown in SEQ ID No.19 and the antisense strand shown in SEQ ID No.184;

(10) formed by complementation of the sense strand shown in SEQ ID No.20 and the antisense strand shown in SEQ ID No.185;

(11) formed by complementation of the sense strand shown in SEQ ID No.21 and the antisense strand shown in SEQ ID No.186;

(12) formed by complementation of the sense strand shown in SEQ ID No.22 and the antisense strand shown in SEQ ID No.187;

(13) formed by complementation of the sense strand shown in SEQ ID No.23 and the antisense strand shown in SEQ ID No.188;

(14) formed by complementation of the sense strand shown in SEQ ID No.24 and the antisense strand shown in SEQ ID No.189;

(15) formed by complementation of the sense strand shown in SEQ ID No.25 and the antisense strand shown in SEQ ID No.190;

(16) formed by complementation of the sense strand shown in SEQ ID No.26 and the antisense strand shown in SEQ ID No.191;

(17) complementary to the sense strand shown in SEQ ID No.27 and the antisense strand shown in SEQ ID No.192;

(18) formed by complementation of the sense strand shown in SEQ ID No.28 and the antisense strand shown in SEQ ID No.193;

(19) formed by complementation of the sense strand shown in SEQ ID No.29 and the antisense strand shown in SEQ ID No.194;

(20) formed by complementation of the sense strand shown in SEQ ID No.30 and the antisense strand shown in SEQ ID No.195;

(21) formed by complementation of the sense strand shown in SEQ ID No.31 and the antisense strand shown in SEQ ID No.196;

(22) formed by complementation of the sense strand shown in SEQ ID No.32 and the antisense strand shown in SEQ ID No.197;

(23) formed by complementation of the sense strand shown in SEQ ID No.33 and the antisense strand shown in SEQ ID No.198;

(24) formed by complementation of the sense strand shown in SEQ ID No.34 and the antisense strand shown in SEQ ID No.199;

(25) formed by complementation of the sense strand shown in SEQ ID No.35 and the antisense strand shown in SEQ ID No.200;

(26) complementary to the sense strand shown in SEQ ID No.36 and the antisense strand shown in SEQ ID No.201;

(27) formed by complementation of the sense strand shown in SEQ ID No.37 and the antisense strand shown in SEQ ID No.202;

(28) formed by complementation of the sense strand shown in SEQ ID No.38 and the antisense strand shown in SEQ ID No.203;

(29) complementary to the sense strand shown in SEQ ID No.39 and the antisense strand shown in SEQ ID No.204;

(30) formed by complementation of the sense strand shown in SEQ ID No.40 and the antisense strand shown in SEQ ID No.205;

(31) formed by complementation of the sense strand shown in SEQ ID No.41 and the antisense strand shown in SEQ ID No.206;

(32) formed by complementation of the sense strand shown in SEQ ID No.42 and the antisense strand shown in SEQ ID No.207;

(33) complementary to the sense strand shown in SEQ ID No.43 and the antisense strand shown in SEQ ID No.208;

(34) formed by complementation of the sense strand shown in SEQ ID No.44 and the antisense strand shown in SEQ ID No.209;

(35) formed by complementation of the sense strand shown in SEQ ID No.45 and the antisense strand shown in SEQ ID No.210;

(36) complementary to the sense strand shown in SEQ ID No.46 and the antisense strand shown in SEQ ID No.211;

(37) formed by complementation of the sense strand shown in SEQ ID No.47 and the antisense strand shown in SEQ ID No.212;

(38) complementary to the sense strand shown in SEQ ID No.48 and the antisense strand shown in SEQ ID No.213;

(39) formed by complementation of the sense strand shown in SEQ ID No.49 and the antisense strand shown in SEQ ID No.214;

(40) complementary to the sense strand shown in SEQ ID No.50 and the antisense strand shown in SEQ ID No.215;

(41) formed by complementation of the sense strand shown in SEQ ID No.51 and the antisense strand shown in SEQ ID No.216;

(42) complementary to the sense strand shown in SEQ ID No.52 and the antisense strand shown in SEQ ID No.217;

(43) formed by complementation of the sense strand shown in SEQ ID No.53 and the antisense strand shown in SEQ ID No.218;

(44) formed by complementation of the sense strand shown in SEQ ID No.54 and the antisense strand shown in SEQ ID No.219;

(45) formed by complementation of the sense strand shown in SEQ ID No.55 and the antisense strand shown in SEQ ID No.220;

(46) formed by complementation of the sense strand shown in SEQ ID No.56 and the antisense strand shown in SEQ ID No.221;

(47) formed by complementation of the sense strand shown in SEQ ID No.57 and the antisense strand shown in SEQ ID No.222;

(48) complementary to the sense strand shown in SEQ ID No.58 and the antisense strand shown in SEQ ID No.223;

(49) formed by complementation of the sense strand shown in SEQ ID No.59 and the antisense strand shown in SEQ ID No.224;

(50) formed by complementation of the sense strand shown in SEQ ID No.60 and the antisense strand shown in SEQ ID No.225;

(51) formed by complementation of the sense strand shown in SEQ ID No.61 and the antisense strand shown in SEQ ID No.226;

(52) formed by complementation of the sense strand shown in SEQ ID No.62 and the antisense strand shown in SEQ ID No.227;

(53) formed by complementation of the sense strand shown in SEQ ID No.63 and the antisense strand shown in SEQ ID No.228;

(54) formed by complementation of the sense strand shown in SEQ ID No.64 and the antisense strand shown in SEQ ID No.229;

(55) complementary to the sense strand shown in SEQ ID No.65 and the antisense strand shown in SEQ ID No.230;

(56) formed by complementation of the sense strand shown in SEQ ID No.66 and the antisense strand shown in SEQ ID No.231;

(57) formed by complementation of the sense strand shown in SEQ ID No.67 and the antisense strand shown in SEQ ID No.232;

(58) complementary to the sense strand shown in SEQ ID No.68 and the antisense strand shown in SEQ ID No.233;

(59) formed by complementation of the sense strand shown in SEQ ID No.69 and the antisense strand shown in SEQ ID No.234;

(60) formed by complementation of the sense strand shown in SEQ ID No.70 and the antisense strand shown in SEQ ID No.235;

(61) formed by complementation of the sense strand shown in SEQ ID No.71 and the antisense strand shown in SEQ ID No.236;

(62) formed by complementation of the sense strand shown in SEQ ID No.72 and the antisense strand shown in SEQ ID No.237;

(63) formed by complementation of the sense strand shown in SEQ ID No.73 and the antisense strand shown in SEQ ID No.238;

(64) formed by complementation of the sense strand shown in SEQ ID No.74 and the antisense strand shown in SEQ ID No.239;

(65) formed by complementation of the sense strand shown in SEQ ID No.75 and the antisense strand shown in SEQ ID No.240;

(66) formed by complementation of the sense strand shown in SEQ ID No.76 and the antisense strand shown in SEQ ID No.241;

(67) formed by complementation of the sense strand shown in SEQ ID No.77 and the antisense strand shown in SEQ ID No.242;

(68) formed by complementation of the sense strand shown in SEQ ID No.78 and the antisense strand shown in SEQ ID No.243;

(69) formed by complementation of the sense strand shown in SEQ ID No.79 and the antisense strand shown in SEQ ID No.244;

(70) formed by complementation of the sense strand shown in SEQ ID No.80 and the antisense strand shown in SEQ ID No.245;

(71) formed by complementation of the sense strand shown in SEQ ID No.81 and the antisense strand shown in SEQ ID No.246;

(72) formed by complementation of the sense strand shown in SEQ ID No.82 and the antisense strand shown in SEQ ID No.247;

(73) complementary to the sense strand shown in SEQ ID No.83 and the antisense strand shown in SEQ ID No.248;

(74) formed by complementation of the sense strand shown in SEQ ID No.84 and the antisense strand shown in SEQ ID No.249;

(75) complementary to the sense strand shown in SEQ ID No.85 and the antisense strand shown in SEQ ID No.250;

(76) formed by complementation of the sense strand shown in SEQ ID No.86 and the antisense strand shown in SEQ ID No.251;

(77) formed by complementation of the sense strand shown in SEQ ID No.87 and the antisense strand shown in SEQ ID No.252;

(78) complementary to the sense strand shown in SEQ ID No.88 and the antisense strand shown in SEQ ID No.253;

(79) formed by complementation of the sense strand shown in SEQ ID No.89 and the antisense strand shown in SEQ ID No.254;

(80) formed by complementation of the sense strand shown in SEQ ID No.90 and the antisense strand shown in SEQ ID No.255;

(81) formed by complementation of the sense strand shown in SEQ ID No.91 and the antisense strand shown in SEQ ID No.256;

(82) formed by complementation of the sense strand shown in SEQ ID No.92 and the antisense strand shown in SEQ ID No.257;

(83) complementary to the sense strand shown in SEQ ID No.93 and the antisense strand shown in SEQ ID No.258;

(84) formed by complementation of the sense strand shown in SEQ ID No.94 and the antisense strand shown in SEQ ID No.259;

(85) formed by complementation of the sense strand shown in SEQ ID No.95 and the antisense strand shown in SEQ ID No.260;

(86) complementary to the sense strand shown in SEQ ID No.96 and the antisense strand shown in SEQ ID No.261;

(87) formed by complementation of the sense strand shown in SEQ ID No.97 and the antisense strand shown in SEQ ID No.262;

(88) formed by complementation of the sense strand shown in SEQ ID No.98 and the antisense strand shown in SEQ ID No.263;

(89) formed by complementation of the sense strand shown in SEQ ID No.99 and the antisense strand shown in SEQ ID No.264;

(90) formed by complementation of the sense strand shown in SEQ ID No.100 and the antisense strand shown in SEQ ID No.265;

(91) complementary to the sense strand shown in SEQ ID No.101 and the antisense strand shown in SEQ ID No.266;

(92) complementary to the sense strand shown in SEQ ID No.102 and the antisense strand shown in SEQ ID No.267;

(93) complementary to the sense strand shown in SEQ ID No.103 and the antisense strand shown in SEQ ID No.268;

(94) formed by complementation of the sense strand shown in SEQ ID No.104 and the antisense strand shown in SEQ ID No.269;

(95) complementary to the sense strand shown in SEQ ID No.105 and the antisense strand shown in SEQ ID No.270;

(96) complementary to the sense strand shown in SEQ ID No.106 and the antisense strand shown in SEQ ID No.271;

(97) formed by complementation of the sense strand shown in SEQ ID No.107 and the antisense strand shown in SEQ ID No.272;

(98) formed by complementation of the sense strand shown in SEQ ID No.108 and the antisense strand shown in SEQ ID No.273;

(99) formed by complementation of the sense strand shown in SEQ ID No.109 and the antisense strand shown in SEQ ID No.274;

(100) formed by complementation of the sense strand shown in SEQ ID No.110 and the antisense strand shown in SEQ ID No.275;

(101) formed by complementation of the sense strand shown in SEQ ID No.111 and the antisense strand shown in SEQ ID No.276;

(102) formed by complementation of the sense strand shown in SEQ ID No.112 and the antisense strand shown in SEQ ID No.277;

(103) formed by complementation of the sense strand shown in SEQ ID No.113 and the antisense strand shown in SEQ ID No.278;

(104) formed by complementation of the sense strand shown in SEQ ID No.114 and the antisense strand shown in SEQ ID No.279;

(105) formed by complementation of the sense strand shown in SEQ ID No.115 and the antisense strand shown in SEQ ID No.280;

(106) formed by complementation of the sense strand shown in SEQ ID No.116 and the antisense strand shown in SEQ ID No.281;

(107) formed by complementation of the sense strand shown in SEQ ID No.117 and the antisense strand shown in SEQ ID No.282;

(108) formed by complementation of the sense strand shown in SEQ ID No.118 and the antisense strand shown in SEQ ID No.283;

(109) formed by complementation of the sense strand shown in SEQ ID No. 119 and the antisense strand shown in SEQ ID No. 284;

(110) formed by complementation of the sense strand shown in SEQ ID No.120 and the antisense strand shown in SEQ ID No.285;

(111) formed by complementation of the sense strand shown in SEQ ID No.121 and the antisense strand shown in SEQ ID No.286;

(112) formed by complementation of the sense strand shown in SEQ ID No.122 and the antisense strand shown in SEQ ID No.287;

(113) formed by complementation of the sense strand shown in SEQ ID No.123 and the antisense strand shown in SEQ ID No.288;

(114) formed by complementation of the sense strand shown in SEQ ID No.124 and the antisense strand shown in SEQ ID No.289;

(115) formed by complementation of the sense strand shown in SEQ ID No.125 and the antisense strand shown in SEQ ID No.290;

(116) formed by complementation of the sense strand shown in SEQ ID No.126 and the antisense strand shown in SEQ ID No.291;

(117) formed by complementation of the sense strand shown in SEQ ID No.127 and the antisense strand shown in SEQ ID No.292;

(118) formed by complementation of the sense strand shown in SEQ ID No.128 and the antisense strand shown in SEQ ID No.293;

(119) formed by complementation of the sense strand shown in SEQ ID No.129 and the antisense strand shown in SEQ ID No.294;

(120) formed by complementation of the sense strand shown in SEQ ID No.130 and the antisense strand shown in SEQ ID No.295;

(121) complementary to the sense strand shown in SEQ ID No.131 and the antisense strand shown in SEQ ID No.296;

(122) formed by complementation of the sense strand shown in SEQ ID No.132 and the antisense strand shown in SEQ ID No.297;

(123) formed by complementation of the sense strand shown in SEQ ID No.133 and the antisense strand shown in SEQ ID No.298;

(124) complementary to the sense strand shown in SEQ ID No.134 and the antisense strand shown in SEQ ID No.299;

(125) formed by complementation of the sense strand shown in SEQ ID No.135 and the antisense strand shown in SEQ ID No.300;

(126) formed by complementation of the sense strand shown in SEQ ID No.136 and the antisense strand shown in SEQ ID No.301;

(127) formed by complementation of the sense strand shown in SEQ ID No.137 and the antisense strand shown in SEQ ID No.302;

(128) formed by complementation of the sense strand shown in SEQ ID No.138 and the antisense strand shown in SEQ ID No.303;

(129) formed by complementation of the sense strand shown in SEQ ID No.139 and the antisense strand shown in SEQ ID No.304;

(130) formed by complementation of the sense strand shown in SEQ ID No.140 and the antisense strand shown in SEQ ID No.305;

(131) formed by complementation of the sense strand shown in SEQ ID No.141 and the antisense strand shown in SEQ ID No.306;

(132) formed by complementation of the sense strand shown in SEQ ID No.142 and the antisense strand shown in SEQ ID No.307;

(133) formed by complementation of the sense strand shown in SEQ ID No.143 and the antisense strand shown in SEQ ID No.308;

(134) formed by complementation of the sense strand shown in SEQ ID No.144 and the antisense strand shown in SEQ ID No.309;

(135) formed by complementation of the sense strand shown in SEQ ID No.145 and the antisense strand shown in SEQ ID No.310;

(136) complementary to the sense strand shown in SEQ ID No.146 and the antisense strand shown in SEQ ID No.311;

(137) formed by complementation of the sense strand shown in SEQ ID No.147 and the antisense strand shown in SEQ ID No.312;

(138) formed by complementation of the sense strand shown in SEQ ID No.148 and the antisense strand shown in SEQ ID No.313;

(139) complementary to the sense strand shown in SEQ ID No.149 and the antisense strand shown in SEQ ID No.314;

(140) formed by complementation of the sense strand shown in SEQ ID No.150 and the antisense strand shown in SEQ ID No.315;

(141) formed by complementation of the sense strand shown in SEQ ID No.151 and the antisense strand shown in SEQ ID No.316;

(142) formed by complementation of the sense strand shown in SEQ ID No.152 and the antisense strand shown in SEQ ID No.317;

(143) formed by complementation of the sense strand shown in SEQ ID No.153 and the antisense strand shown in SEQ ID No.318;

(144) formed by complementation of the sense strand shown in SEQ ID No.154 and the antisense strand shown in SEQ ID No.319;

(145) formed by complementation of the sense strand shown in SEQ ID No.155 and the antisense strand shown in SEQ ID No.320;

(146) formed by complementation of the sense strand shown in SEQ ID No.156 and the antisense strand shown in SEQ ID No.321;

(147) formed by complementation of the sense strand shown in SEQ ID No.157 and the antisense strand shown in SEQ ID No.322;

(148) formed by complementation of the sense strand shown in SEQ ID No.158 and the antisense strand shown in SEQ ID No.323;

(149) formed by complementation of the sense strand shown in SEQ ID No.159 and the antisense strand shown in SEQ ID No.324;

(150) formed by complementation of the sense strand shown in SEQ ID No.160 and the antisense strand shown in SEQ ID No.325;

(151) formed by complementation of the sense strand shown in SEQ ID No.161 and the antisense strand shown in SEQ ID No.326;

(152) complementary to the sense strand shown in SEQ ID No.162 and the antisense strand shown in SEQ ID No.327;

(153) formed by complementation of the sense strand shown in SEQ ID No.163 and the antisense strand shown in SEQ ID No.328;

(154) formed by complementation of the sense strand shown in SEQ ID No.164 and the antisense strand shown in SEQ ID No.329;

(155) formed by complementation of the sense strand shown in SEQ ID No.165 and the antisense strand shown in SEQ ID No.330;

(156) formed by complementation of the sense strand shown in SEQ ID No.166 and the antisense strand shown in SEQ ID No.331;

(157) formed by complementation of the sense strand shown in SEQ ID No.167 and the antisense strand shown in SEQ ID No.332;

(158) formed by complementation of the sense strand shown in SEQ ID No.168 and the antisense strand shown in SEQ ID No.333;

(159) formed by complementation of the sense strand shown in SEQ ID No.169 and the antisense strand shown in SEQ ID No.334;

(160) formed by complementation of the sense strand shown in SEQ ID No.170 and the antisense strand shown in SEQ ID No.335;

(161) formed by complementation of the sense strand shown in SEQ ID No.171 and the antisense strand shown in SEQ ID No.336;

(162) formed by complementation of the sense strand shown in SEQ ID No.172 and the antisense strand shown in SEQ ID No.337;

(163) formed by complementation of the sense strand shown in SEQ ID No.173 and the antisense strand shown in SEQ ID No.338;

(164) formed by complementation of the sense strand shown in SEQ ID No.174 and the antisense strand shown in SEQ ID No.339;

(165) formed by complementation of the sense strand shown in SEQ ID No.175 and the antisense strand shown in SEQ ID No.340;

(166) formed by complementation of the sense strand shown in SEQ ID No.11 and the antisense strand shown in SEQ ID No.351;

(167) formed by complementation of the sense strand shown in SEQ ID No.18 and the antisense strand shown in SEQ ID No.352;

(168) formed by complementation of the sense strand shown in SEQ ID No.19 and the antisense strand shown in SEQ ID No.353;

(169) formed by complementation of the sense strand shown in SEQ ID No.20 and the antisense strand shown in SEQ ID No.354;

(170) formed by complementation of the sense strand shown in SEQ ID No.21 and the antisense strand shown in SEQ ID No.355;

(171) formed by complementation of the sense strand shown in SEQ ID No.23 and the antisense strand shown in SEQ ID No.356;

(172) formed by complementation of the sense strand shown in SEQ ID No.24 and the antisense strand shown in SEQ ID No.357;

(173) formed by complementation of the sense strand shown in SEQ ID No.25 and the antisense strand shown in SEQ ID No.358;

(174) formed by complementation of the sense strand shown in SEQ ID No.31 and the antisense strand shown in SEQ ID No.359;

(175) formed by complementation of the sense strand shown in SEQ ID No.32 and the antisense strand shown in SEQ ID No.360;

(176) formed by complementation of the sense strand shown in SEQ ID No.33 and the antisense strand shown in SEQ ID No.361;

(177) formed by complementation of the sense strand shown in SEQ ID No.34 and the antisense strand shown in SEQ ID No.362;

(178) formed by complementation of the sense strand shown in SEQ ID No.43 and the antisense strand shown in SEQ ID No.363;

(179) formed by complementation of the sense strand shown in SEQ ID No.44 and the antisense strand shown in SEQ ID No.364;

(180) formed by complementation of the sense strand shown in SEQ ID No.45 and the antisense strand shown in SEQ ID No.365;

(181) formed by complementation of the sense strand shown in SEQ ID No.46 and the antisense strand shown in SEQ ID No.366;

(182) formed by complementation of the sense strand shown in SEQ ID No.47 and the antisense strand shown in SEQ ID No.367;

(183) formed by complementation of the sense strand shown in SEQ ID No.49 and the antisense strand shown in SEQ ID No.368;

(184) formed by complementation of the sense strand shown in SEQ ID No.50 and the antisense strand shown in SEQ ID No.369;

(185) formed by complementation of the sense strand shown in SEQ ID No.51 and the antisense strand shown in SEQ ID No.370;

(186) formed by complementation of the sense strand shown in SEQ ID No.52 and the antisense strand shown in SEQ ID No.371;

(187) formed by complementation of the sense strand shown in SEQ ID No.53 and the antisense strand shown in SEQ ID No.372;

(188) formed by complementation of the sense strand shown in SEQ ID No.54 and the antisense strand shown in SEQ ID No.373;

(189) formed by complementation of the sense strand shown in SEQ ID No.56 and the antisense strand shown in SEQ ID No.374;

(190) formed by complementation of the sense strand shown in SEQ ID No.57 and the antisense strand shown in SEQ ID No.375;

(191) formed by complementation of the sense strand shown in SEQ ID No.58 and the antisense strand shown in SEQ ID No.376;

(192) formed by complementation of the sense strand shown in SEQ ID No.59 and the antisense strand shown in SEQ ID No.377;

(193) formed by complementation of the sense strand shown in SEQ ID No.60 and the antisense strand shown in SEQ ID No.378;

(194) formed by complementation of the sense strand shown in SEQ ID No.61 and the antisense strand shown in SEQ ID No.379;

(195) formed by complementation of the sense strand shown in SEQ ID No.70 and the antisense strand shown in SEQ ID No.380;

(196) formed by complementation of the sense strand shown in SEQ ID No.341 and the antisense strand shown in SEQ ID No.381;

(197) formed by complementation of the sense strand shown in SEQ ID No.342 and the antisense strand shown in SEQ ID No.382;

(198) formed by complementation of the sense strand shown in SEQ ID No.343 and the antisense strand shown in SEQ ID No.383;

(199) formed by complementation of the sense strand shown in SEQ ID No.344 and the antisense strand shown in SEQ ID No.384;

(200) formed by complementation of the sense strand shown in SEQ ID No.345 and the antisense strand shown in SEQ ID No.385;

(201) formed by complementation of the sense strand shown in SEQ ID No.346 and the antisense strand shown in SEQ ID No.386;

(202) complementary to the sense strand shown in SEQ ID No.347 and the antisense strand shown in SEQ ID No.387;

(203) formed by complementation of the sense strand shown in SEQ ID No.348 and the antisense strand shown in SEQ ID No.388;

(204) formed by complementation of the sense strand shown in SEQ ID No.349 and the antisense strand shown in SEQ ID No.389;

(205) is formed by complementation of the sense strand shown in SEQ ID No. 350 and the antisense strand shown in SEQ ID No. 390.
The siRNA according to any one of claims 1-6, wherein at least one nucleotide in the siRNA is modified;

The modification is selected from any one or more of the following: 2'-fluoro modification, 2'-O-methyl modification, 2'-fluorothymidine modification, 2'-O-methoxyethyl-5 -Methyluridine modification, 2`-O-methoxyethyladenosine modification, 2`-O-methoxyethyl-5-methylcytidine modification, 2'-methoxyethyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-deoxy modification, 2'-hydroxyl modification, phosphorothioate backbone modification, locked nucleic acid modification, fluorescent probe modification, ligand modification , or any combination thereof.
The siRNA according to any one of claims 1-7, wherein at least one nucleotide in the siRNA is modified.
The siRNA according to claim 8, wherein the modification comprises any one or more of the following: 2'-fluoro modification, 2'-O-methyl modification, 2'-fluorothymidine modification, 2`-O-methoxyethyl-5-methyluridine modification, 2`-O-methoxyethyladenosine modification, 2`-O-methoxyethyl-5-methylcytidine Modification, 2'-methoxyethyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-deoxy modification, 2'-hydroxyl modification, phosphorothioate backbone modification, Locked nucleic acid modification, fluorescent probe modification, ligand modification, or any combination thereof.
The siRNA according to claim 8 or 9, wherein the 5' or 3' overhangs at the sense strand, antisense strand or both strands of the siRNA are phosphorylated.
The siRNA according to any one of claims 8-10, wherein the modification of the siRNA is carried out according to any of the following:

(A1) The 7th and 9th positions of the sense strand are 2′-fluoro-modified nucleotides, and the 1st, 2nd, and 3rd positions are connected by a phosphorothioate bond, and the 1st, 2nd, and 3rd positions are Nucleotides at positions 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 are all 2'-O-methyl modified nucleosides acid; the 2, 4, 5, 6, 8, 10, 12, 14, 16, and 18 positions of the antisense strand are 2'-fluoro-modified nucleotides, between positions 1, 2, and 3 Connected by phosphorothioate bond, connected by phosphorothioate bond between positions 19, 20 and 21, connected at position 1, 3, 7, 9, 11, 13, 15, 17, 19, 20, 21 Nucleotides are all 2'-O-methyl modified nucleotides;

(A2) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand are 2'-OMe modified nucleotides, and positions 1, 3, 5, 7, 9-11 , 13, 15, 17, 19, and 21 are 2′-F modified nucleotides, and the 1, 2, and 3 positions are connected by a phosphorothioate bond; the 1, 3 , 5, 7, 9, 11-13, 15, 17, 19, 21, 23 are 2'-OMe modified nucleotides, 2, 4, 6, 8, 10, 14, 16, 18, 20 , The 22-position is a 2'-F modified nucleotide, the 1, 2, and 3 positions are connected by a phosphorothioate bond, and the 19, 20, and 21 positions are connected by a phosphorothioate bond;

(A3) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand are 2'-OMe modified nucleotides, and positions 1, 3, 5, 7, 9-11 , 13, 15, 17, 19, and 21 are 2′-F modified nucleotides, and the 1, 2, and 3 positions are connected by a phosphorothioate bond; the 1, 3 ,5,7,9,11-13,15,17,19,21,22 23-position 2'-OMe modified nucleotides, 2,4,6,8,10,14,16,18, The 20th position is a 2′-F modified nucleotide, and the 1st, 2nd, and 3rd positions are connected by a phosphorothioate bond, and the 19th, 20th, and 21st positions are connected by a phosphorothioate bond;

(A4) Positions 2, 4, 6, 8, 12, 14-21 of the sense strand are 2'-OMe modified nucleotides, and positions 1, 3, 5, 7, 9-11, and 13 are 2'-F modified nucleotides, connected by phosphorothioate bonds between positions 1, 2, and 3; the first, 3, 5-7, 9, 11-13, 15 of the antisense strand ,17-19,21,22,23 are 2'-OMe modified nucleotides, 2,4,8,10,14,16,20 are 2'-F modified nucleotides, the first , the 2 and 3 positions are connected by a phosphorothioate bond, and the 19th, 20, and 21 positions are connected by a phosphorothioate bond;

(A5) Positions 1-6, 8, 10-21 of the sense strand are 2'-OMe modified nucleotides, positions 7 and 9 are 2'-F modified nucleotides, and positions 1 and 2 , the 3-position is connected by a phosphorothioate bond; the 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22, 23 positions of the antisense strand are 2' -OMe modified nucleotides, 2'-F modified nucleotides at positions 2, 4, 8, 10, 14, 16, and 20, through phosphorothioate bonds between positions 1, 2, and 3 Connected, the 19th, 20th, and 21st positions are connected by phosphorothioate bonds;

(A6) Positions 1-6, 8, 10-21 of the sense strand are 2'-OMe modified nucleotides, positions 7 and 9 are 2'-F modified nucleotides, and positions 1 and 2 , the 3-position is connected by a phosphorothioate bond; the 1, 3, 7, 9, 11, 13, 15, 17, 19-23 positions of the antisense strand are 2'-OMe modified nucleosides Acid, the 2,4-6,8,10,12,14,16,18 positions are 2′-F modified nucleotides, and the 1, 2, and 3 positions are connected by a phosphorothioate bond, The 19th, 20th and 21st positions are connected by phosphorothioate bonds;

(A7) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand are 2'-OMe modified nucleotides, and positions 1, 3, 5, 7, 9, 10, 13, 15, 17, 19, and 21 are 2′-F modified nucleotides, the 11th position is LNA modified nucleotides, and the 1, 2, and 3 positions are connected by a phosphorothioate bond Linking; the 1,3,5,7,9,11-13,15,17,19,21,23 positions of the antisense strand are 2'-OMe modified nucleotides, and the 2,4,6 , 8, 10, 14, 16, 18, 20, 22 are 2'-F modified nucleotides, the 1, 2, and 3 positions are connected by a phosphorothioate bond, 19, 20, 21 The positions are connected by phosphorothioate bonds;

(A8) Positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 of the sense strand are 2'-OMe modified nucleotides, and positions 1, 3, 5, 7, 9, and 10 , 13, 15, 17, 19, 21 are 2′-F modified nucleotides, 11 is LNA modified nucleotides, and the 1, 2, and 3 positions are connected by a phosphorothioate bond ; The 1, 3, 5, 7, 9, 11-13, 15, 17, 19, 21, 22, 23 positions of the antisense strand are 2'-OMe modified nucleotides, and the 2, 4, 6, 8, 10, 14, 16, 18, 20 are 2′-F modified nucleotides, the 1st, 2nd, and 3rd positions are connected by phosphorothioate bonds, and the 19th, 20th, and 21st positions connected by phosphorothioate bonds;

(A9) Positions 2, 4, 6, 8, 12, 14-21 of the sense strand are 2'-OMe modified nucleotides, and positions 1, 3, 5, 7, 9, 10, and 13 are 2'-F modified nucleotides, the 11th position is LNA modified nucleotides, and the 1st, 2nd, and 3rd positions are connected by a phosphorothioate bond; the 1st and 3rd positions of the antisense strand are ,5-7,9,11-13,15,17-19,21,22,23 are 2'-OMe modified nucleotides, 2,4,8,10,14,16,20 are 2'-F modified nucleotides, the 1st, 2nd, and 3rd positions are connected by phosphorothioate bonds, and the 19th, 20th, and 21st positions are connected by phosphorothioate bonds;

(A10) Positions 1-6, 8, 10, 12-21 of the sense strand are 2'-OMe modified nucleotides, positions 7 and 9 are 2'-F modified nucleotides, and the 11th position The nucleotides are LNA-modified nucleotides, and the 1, 2, and 3 positions are connected by phosphorothioate bonds; the 1, 3, 5-7, 9, 11-13, 15, 17-19, 21, 22, 23 are 2'-OMe modified nucleotides, 2, 4, 8, 10, 14, 16, 20 are 2'-F modified nucleotides, 1, The 2 and 3 positions are connected by a phosphorothioate bond, and the 19th, 20, and 21 positions are connected by a phosphorothioate bond;

(A11) The 1-6, 8, 10, 12-21 positions of the sense strand are 2'-OMe modified nucleotides, the 7, 9 positions are 2'-F modified nucleotides, and the 11th position The nucleotides are modified by LNA, and the 1, 2, and 3 positions are connected by phosphorothioate bonds; the 1, 3, 7, 9, 11, 13, 15, 17 of the antisense strand ,19-23 is 2'-OMe modified nucleotide, 2,4-6,8,10,12,14,16,18 is 2'-F modified nucleotide, 1,2 , the 3-position is connected by a phosphorothioate bond, and the 19th, 20th, and 21st positions are connected by a phosphorothioate bond;

(A12) Positions 1-6, 8, 10-22 of the sense strand are 2'-OMe modified nucleotides, positions 7 and 9 are 2'-F modified nucleotides, and position 11 is Deoxyribonucleotides, linked by phosphorothioate bonds between positions 1, 2, and 3; 1, 3, 7, 9, 11, 13, 15, 17, 19-23 of the antisense strand 2'-OMe modified nucleotides, 2, 4-6, 8, 10, 12, 14, 16, 18 are 2'-F modified nucleotides, 1, 2, 3 The 19th, 20th, and 21st positions are connected by thiophosphodiester bonds.
The siRNA of claim 7, wherein the ligand is conjugated to the 3' end of the sense strand.
The siRNA according to claim 7 or 12, wherein the ligand is GalNAc, cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylglucosamine derivatives substance or the like;

Preferably, the ligand is GalNAc.
siRNA according to claim 7 or 13, is characterized in that, the structure of described ligand is as shown in formula I:
The siRNA of claim 14, wherein the ligand is conjugated to the siRNA in a manner as shown in formula II:

where X is O or S.
The siRNA according to any one of claims 7-15, wherein the siRNA is any of the following:

(1) Sense strand: CmsCmsCmGmUmGmCfGmCfAmGmGmAmGmGmAmCmGmAmGmGm; Antisense strand: UmsCfsGmUfCfCfUmCfCmUfGmCfGmCfAmCfGmGfGmsCmsGm;

(2) Sense strand: CmsCmsGmAmAmGmCfAmCfCmCmGmAmGmCmAmCmGmGmAmAm; Antisense strand: CmsCfsGmUfGfCfUmCfGmGfGmUfGmCfUmUfCmGfGmsCmsCm;

(3) Sense strand: CmsGmsAmAmGmCmAfCmCfCmGmAmGmCmAmCmGmGmAmAmCm; Antisense strand: UmsCfsCmGfUfGfCmUfCmGfGmGfUmGfCmUfUmCfGmsGmsCm;

(4) Sense strand: AmsCmsCmCmGmAmGfCmAfCmGmGmAmAmCmCmAmCmAmGmCm; Antisense strand: UmsGfsUmGfGfUfUmCfCmGfUmGfCmUfCmGfGmGfUmsGmsCm;

(5) Sense strand: CmsCmsGmAmGmCmAfCmGfGmAmAmCmCmAmCmAmGmCmCmAm; Antisense strand: GmsCfsUmGfUfGfGmUfUmCfCmGfUmGfCmUfCmGfGmsGmsUm;

(6) Sense strand: GmsAmsGmAmCmCmCfAmCfCmUmCmUmCmGmCmAmGmUmCmAm; antisense strand: AmsCfsUmGfCfGfAmGfAmGfGmUfGmGfGmUfCmUfCmsCmsUm;

(7) Sense strand: CmsUmsCmUmCmGmCfAmGfUmCmAmGmAmGmCmGmCmAmCmUm; Antisense strand: UmsGfsCmGfCfUfCmUfGmAfCmUfGmCfGmAfGmAfGmsGmsUm;

(8) Sense strand: CmsCmsCmGmCmCmGfGmGfGmAmUmAmCmCmUmCmAmCmCmAm; Antisense strand: GmsUfsGmAfGfGfUmAfUmCfCmCfCmGfGmCfGmGfGmsCmsAm;

(9) Sense strand: GmsGmsGmGmAmUmAfCmCfUmCmAmCmCmCamAmGmamUmCmCm; Antisense strand: AmsUfsCmUfUfGfGmUfGmAfGmGfUmAfUmCfCmCfCfCmsGmsGm;

(10) Sense strand: GmsGmsGmAmUmAmCfCmUfCmAmCmCmAmAmGmAmUmCmCmUm; Antisense strand: GmsAfsUmCfUfUfGmGfUmGfAmGfGmUfAmUfCmCfCmsCmsGm;

(11) Sense strand: AmsCmsCmAmAmGmAfUmCfCmUmGmCmAmUmGmUmCmUmUmCm; antisense strand: AmsGfsAmCfAfUfGmCfAmGfGmAfUmCfUmUfGmGfUmsGmsAm;

(12) Sense strand: AmsCmsGmGmAmUmGfGmCfCmAmCmAmGmCmCmGmUmCmGmCm; Antisense strand: GmsAfsCmGfGfCfUmGfUmGfGmCfCmAfUmCfCmGfUmsGmsUm;

(13) Sense strand: GmsAmsAmGmUmUmGfCmCfCmCmAmUmGmUmCmGmAmCmUmAm; antisense strand: GmsUfsCmGfAfCfAmUfGmGfGmGfCmAfAmCfUmUfCmsAmsAm;

(14) Sense strand: CmsCmsCmAmUmGmUfCmGfAmCmUmAmCmAmUmCmGmAmGmGm; Antisense strand: UmsCfsGmAfUfGfUmAfGmUfCmGfAmCfAmUfGmGfGmsGmsCm;

(15) Sense strand: AmsCmsCmGmGmGmCfGmGfAmUmGmAmAmUmAmCmCmAmGmCm; Antisense strand: UmsGfsGmUfAfUfUmCfAmUfCmCfGmCfCmCfGmGfUmsAmsCm;

(16) Sense strand: UmsGmsGmUmCmAmCfCmGfAmCmUmUmCmGmAmGmAmAmUmGm; Antisense strand: UmsUfsCmUfCfGfAmAfGmUfCmGfGmUfGmAfCmCfAmsUmsGm;

(17) Sense strand: GmsUmsCmAmCmCmGfAmCfUmUmCmGmAmGmAmAmUmGmUmGm; Antisense strand: CmsAfsUmUfCfUfCmGfAmAfGmUfCmGfGmUfGmAfCmsCmsAm;

(18) Sense strand: CmsAmsCmCmGmAmCfUmUfCmGmAmGmAmAmUmGmUmGmCmCm; Antisense strand: CmsAfsCmAfUfUfCmUfCmGfAmAfGmUfCmGfGmUfGmsAmsCm;

(19) Sense strand: AmsCmsCmGmAmCmUfUmCfGmAmGmAmAmUmGmUmGmCmCmCm; Antisense strand: GmsCfsAmCfAfUfUmCfUmCfGmAfAmGfUmCfGmGfUmsGmsAm;

(20) Sense strand: AmsCmsUmUmCmGmAfGmAfAmUmGmUmGmCmCmCmGmAmGmGm; Antisense strand: UmsCfsGmGfGfCfAmCfAmUfUmCfUmCfGmAfAmGfUmsCmsGm;

(21) Sense strand: GmsAmsCmCmAmAmCfUmUfUmGmGmCmCmGmCmUmGmUmGmUm; antisense strand: AmsCfsAmGfCfGfGmCfCmAfAmAfGmUfUmGfGmUfCmsCmsCm;

(22) Sense strand: CmsCmsAmAmCmUmUfUmGfGmCmCmGmCmUmGmUmGmUmGmGm; antisense strand: AmsCfsAmCfAfGfCmGfGmCfCmAfAmAfGmUfUmGfGmsUmsCm;

(23) Sense strand: UmsGmsGmAmCmCmUfCmUfUmUmGmCmCmCmCmAmGmGmGmGm; Antisense strand: CmsCfsUmGfGfGfGmCfAmAfAmGfAmGfGmUfCmCfAmsCmsAm;

(24) Sense strand: CmsGmsCmUmGmUmGfUmGfGmAmCmCmUmCmUmUmUmGmCmCm; Antisense strand: CmsAfsAmAfGfAfGmGfUmCfCmAfCmAfCmAfGmCfGmsGmsCm;

(25) Sense strand: CmsGmsGmAmGmCmUfCmAfCmCmCmUmGmGmCmCmGmAmGmUm; Antisense strand: UmsCfsGmGfCfCfAmGfGmGfUmGfAmGfCmUfCmCfGmsGmsCm;

(26) Sense strand: CmsUmsGmUmUmUmUfGmCfAmGmGmAmCmUmGmUmAmUmGmGm; Antisense strand: AmsUfsAmCfAfGfUmCfCmUfGmCfAmAfAmAfCmAfGmsCmsUm;

(27) Sense strand: GmsGmsAmCmUmGmUfAmUfGmGmUmCmAmGmCmAmCmAmCmUm; Antisense strand: UmsGfsUmGfCfUfGmAfCmCfAmUfAmCfAmGfUmCfCmsUmsGm;

(28) Sense strand: GmsGmsGmCmGmAmGfCmGfCmAmUmGmGmAmGmGmCmCmCmAm; Antisense strand: GmsGfsCmCfUfCfCmAfUmGfCmGfCmUfCmGfCmCfCmsCmsGm;

(29) Sense strand: CmsGmsAmGmCmGmCfAmUfGmGmAmGmGmCmCmCmAmAmGmGm; Antisense strand: UmsUfsGmGfGfCfCmUfCmCfAmUfGmCfGmCfUmCfGmsCmsCm;

(30) Sense strand: GmsGmsGmGmCmAmAfGmCfUmGmGmUmCmUmGmCmCmGmGmGm; antisense strand: CmsGfsGmCfAfGfAmCfCmAfGmCfUmUfGmCfCmCfCmsCmsUm;

(31) Sense strand: GmsGmsGmCmAmAmGfCmUfGmGmUmCmUmGmCmCmGmGmGmCm; antisense strand: CmsCfsGmGfCfAfGmAfCmCfAmGfCmUfUmGfCmCfCmsCmsCm;

(32) Sense strand: UmsGmsGmUmCmUmGfCmCfGmGmGmCmCmCmAmCmamAmCmGm; Antisense strand: UmsUfsGmUfGfGfGmCfCmCfGmGfCmAfGmAfCmCfAmsGmsCm;

(33) Sense strand: CmsAmsCmAmAmCmGfCmUfUmUmUmGmGmGmGmGmUmGmAmGm; antisense strand: CmsAfsCmCfCfCfCmAfAmAfAmGfCmGfUmUfGmUfGmsGmsGm;

(34) Sense strand: AmsCmsAmAmCmGmCfUmUfUmUmGmGmGmGmGmUmGmAmGmGm; antisense strand: UmsCfsAmCfCfCfCmCfAmAfAmAfGmCfGmUfUmGfUmsGmsGm;

(35) Sense strand: CmsAmsAmCmGmCmUfUmUfUmGmGmGmGmGmUmGmAmGmGmGm; Antisense strand: CmsUfsCmAfCfCfCmCfCmAfAmAfAmGfCmGfUmUfGmsUmsGm;

(36) Sense strand: GmsUmsGmAmGmGmGfUmGfUmCmUmAmCmGmCmCmAmUmUmGm; Antisense strand: AmsUfsGmGfCfGfUmAfGmAfCmAfCmCfCmUfCmAfCmsCmsCm;

(37) Sense strand: UmsGmsAmGmGmGmUfGmUfCmUmAmCmGmCmCmAmUmUmGmCm; antisense strand: AmsAfsUmGfGfCfGmUfAmGfAmCfAmCfCmCfUmCfAmsCmsCm;

(38) Sense strand: GmsAmsGmGmGmUmGfUmCfUmAmCmGmCmCmAmUmUmGmCmCm; antisense strand: CmsAfsAmUfGfGfCmGfUmAfGmAfCmAfCmCfCmUfCmsAmsCm;

(39) Sense strand: GmsGmsGmUmGmUmCfUmAfCmGmCmCmAmUmUmGmCmCmAmGm; antisense strand: GmsGfsCmAfAfUfGmGfCmGfUmAfGmAfCmAfCmCfCmsUmsCm;

(40) Sense strand: GmsGmsUmGmUmCmUfAmCfGmCmCmAmUmUmGmCmCmAmGmGm; antisense strand: UmsGfsGmCfAfAfUmGfGmCfGmUfAmGfAmCfAmCfCmsCmsUm;

(41) Sense strand: GmsUmsGmUmCmUmAfCmGfCmCmAmUmUmGmCmCmAmGmGmUm; Antisense strand: CmsUfsGmGfCfAfAmUfGmGfCmGfUmAfGmAfCmAfCmsCmsCm;

(42) Sense strand: UmsGmsUmCmUmAmCfGmCfCmAmUmUmGmCmCmAmGmGmUmGm; Antisense strand: CmsCfsUmGfGfCfAmAfUmGfGmCfGmUfAmGfAmCfAmsCmsCm;

(43) Sense strand: CmsUmsAmCmGmCmCfAmUfUmGmCmCmAmGmGmUmGmCmUmGm; antisense strand: GmsCfsAmCfCfUfGmGfCmAfAmUfGmGfCmGfUmAfGmsAmsCm;

(44) Sense strand: UmsAmsCmGmCmCmAfUmUfGmCmCmAmGmGmUmGmCmUmGmCm; antisense strand: AmsGfsCmAfCfCfUmGfGmCfAmAfUmGfGmCfGmUfAmsGmsAm;

(45) Sense strand: GmsAmsCmCmCmGmUfGmUfCmCmAmCmUmGmCmCmAmCmCmAm; antisense strand: GmsUfsGmGfCfAfGmUfGmGfAmCfAmCfGmGfGmUfCmsCmsCm;

(46) Sense strand: CmsCmsUmUmGmGmCfAmCfCmCmAmCmAmAmGmCmCmGmCmCm; Antisense strand: CmsGfsGmCfUfUfGmUfGmGfGmUfGmCfCmAfAmGfGmsUmsCm;

(47) Sense strand: CmsAmsCmCmCmAmCfAmAfGmCmCmGmCmCmUmGmUmGmCmUm; antisense strand: CmsAfsCmAfGfGfCmGfGmCfUmUfGmUfGmGfGmUfGmsCmsCm;

(48) Sense strand: CmsCmsCmAmCmAmAfGmCfCmGmCmCmUmGmUmGmCmUmGmAm; Antisense strand: AmsGfsCmAfCfAfGmGfCmGfGmCfUmUfGmUfGmGfGmsUmsGm;

(49) Sense strand: CmsCmsAmCmAmAmGfCmCfGmCmCmUmGmUmGmCmUmGmAmGm; Antisense strand: CmsAfsGmCfAfCfAmGfGmCfGmGfCmUfUmGfUmGfGmsGmsUm;

(50) Sense strand: CmsCmsAmCmGmAmGfGmUfCmAmGmCmCmCmAmAmCmCmAmGm; Antisense strand: GmsGfsUmUfGfGfGmCfUmGfAmCfCmUfCmGfUmGfGmsCmsCm;

(51) Sense strand: CmsAmsCmGmAmGmGfUmCfAmGmCmCmCmAmAmCmCmAmGmUm; Antisense strand: UmsGfsGmUfUfGfGmGfCmUfGmAfCmCfUmCfGmUfGmsGmsCm;

(52) Sense strand: CmsGmsAmGmGmUmCfAmGfCmCmCmAmAmCmCmAmGmUmGmCm; Antisense strand: AmsCfsUmGfGfUfUmGfGmGfCmUfGmAfCmCfUmCfGmsUmsGm;

(53) Sense strand: GmsAmsGmGmUmCmAfGmCfCmCmAmAmCmCmAmGmUmGmCmGm; Antisense strand: CmsAfsCmUfGfGfUmUfGmGfGmCfUmGfAmCfCmUfCmsGmsUm;

(54) Sense strand: CmsCmsAmAmCmCmAfGmUfGmCmGmUmGmGmGmCmCmAmCmAm; antisense strand: UmsGfsGmCfCfCfAmCfGmCfAmCfUmGfGmUfUmGfGmsGmsCm;

(55) Sense strand: AmsGmsUmGmCmGmUfGmGfGmCmCmAmCmAmGmGmGmAmGmGm; antisense strand: UmsCfsCmCfUfGfUmGfGmCfCmCfAmCfGmCfAmCfUmsGmsGm;

(56) Sense strand: AmsCmsGmCmCmGmUfAmGfAmCmAmAmCmAmCmGmUmGmUmGm; Antisense strand: CmsAfsCmGfUfGfUmUfGmUfCmUfAmCfGmGfCmGfUmsAmsGm;

(57) Sense strand: CmsCmsGmUmAmGmAfCmAfAmCmAmCmGmUmGmUmGmUmAmGm; Antisense strand: AmsCfsAmCfAfCfGmUfGmUfUmGfUmCfUmAfCmGfGmsCmsGm;

(58) Sense strand: CmsGmsUmAmGmAmCfAmAfCmAmCmGmUmGmUmGmUmAmGmUm; Antisense strand: UmsAfsCmAfCfAfCmGfUmGfUmUfGmUfCmUfAmCfGmsGmsCm;

(59) Sense strand: GmsUmsAmGmAmCmAfAmCfAmCmGmUmGmUmGmUmAmGmUmCm; Antisense strand: CmsUfsAmCfAfCfAmCfGmUfGmUfUmGfUmCfUmAfCmsGmsGm;

(60) Sense strand: GmsUmsCmAmGmGmAfGmCfCmGmGmGmamCmGmUmCmAmGmCm; antisense strand: UmsGfsAmCfGfUfCmCfCmGfGmCfUmCfCmUfGmAfCmsUmsAm;

(61) Sense strand: GmsGmsCmUmGmGmGfGmCfUmGmAmGmCmUmUmUmAmAmAm; Antisense strand: CmsAfsUmUfUfUfAmAfAmGfCmUfCmAfGmCfCmCfCmsAmsGm;

(62) Sense strand: UmsGmsGmGmGmCmUfGmAfGmCmUmUmUmAmAmAmUmGmGm; antisense strand: AmsAfsCmCfAfUfUmUfUmAfAmAfGmCfUmCfAmGfCmsCmsCm;

(63) Sense strand: GmsGmsGmCmUmGmAfGmCfUmUmUmAmAmAmUmGmGmUmUm; Antisense strand: GmsGfsAmAfCfCfAmUfUmUfUmAfAmAfGmCfUmCfAmsGmsCm;

(64) Sense strand: UmsGmsAmGmCmUmUfUmAfAmAmAmUmGmGmUmUmCmCmGmAm; Antisense strand: AmsGfsUmCfGfGfAmAfCmCfAmUfUmUfUmAfAmAfGmsCmsUm;

(65) Sense strand: UmsUmsAmAmAmAmUfGmGfUmUmCmCmGmAmCmUmUmGmUmCm; Antisense strand: GmsGfsGmAfCfAfAmGfUmCfGmGfAmAfCmCfAmUfUmsUmsUm;

(66) Sense strand: AmsAmsAmUmGmGmUfUmCfCmGmAmCmUmUmGmUmCmCmCmUm; antisense strand: AmsGfsAmGfGfGfAmCfAmAfGmUfCmGfGmAfAmCfCmsAmsUm;

(67) Sense strand: AmsUmsGmGmUmUmCfCmGfAmCmUmUmGmUmCmCmCmUmCmUm; antisense strand: AmsGfsAmGfAfGfGmGfAmCfAmAfGmUfCmGfGmAfAmsCmsCm;

(68) Sense strand: GmsUmsUmCmCmGmAfCmUfUmGmUmCmCmCmUmCmUmCmUmCm; antisense strand: CmsUfsGmAfGfAfGmAfGmGfGmAfCmAfAmGfUmCfGmsGmsAm;

(69) Sense strand: GmsCmsCmCmUmCmCfAmUfGmGmCmCmUmGmGmCmAmCmGmAm; Antisense strand: CmsCfsUmCfGfUfGmCfCmAfGmGfCmCfAmUfGmGfAmsGmsGm;

(70) Sense strand: GmsGmsCmCmUmGmGfCmAfCmGmAmGmGmGmGmAmUmGmGmGm; Antisense strand: UmsCfsCmCfCfAfUmCfCmCfCmUfCmGfUmGfCmCfAmsGmsGm;

(71) Sense strand: AmsGmsGmGmGmAmUfGmGfGmGmAmUmGmCmUmUmCmCmGmCm; Antisense strand: AmsGfsGmCfGfGfAmAfGmCfAmUfCmCfCmCfAmUfCmsCmsCm;

(72) Sense strand: GmsGmsGmAmUmGmGfGmGfAmUmGmCmUmUmCmCmGmCmCmUm; Antisense strand: AmsAfsAmGfGfCfGmGfAmAfGmCfAmUfCmCfCmCfAmsUmsCm;

(73) Sense strand: GmsGmsGmGmAmUmGfCmUfUmCmCmGmCmCmUmUmUmCmCmGm; antisense strand: CmsCfsCmGfGfAfAmAfGmGfCmGfGmAfAmGfCmAfUmsCmsCm;

(74) Sense strand: AmsUmsGmCmUmUmCfCmGfCmCmUmUmUmCmCmGmGmGmGmCm; antisense strand: CmsAfsGmCfCfCfCmGfGmAfAmAfGmGfCmGfGmAfAmsGmsCm;

(75) Sense strand: UmsUmsCmCmGmCmCfUmUfUmCmCmGmGmGmGmCmUmGmCmUm; antisense strand: CmsCfsAmGfCfAfGmCfCmCfCmGfGmAfAmAfGmGfCmsGmsGm;

(76) Sense strand: UmsCmsCmGmCmCmUfUmUfCmCmGmGmGmGmCmUmGmCmUmGm; antisense strand: GmsCfsCmAfGfCfAmGfCmCfCmCfGmGfAmAfAmGfGmsCmsGm;

(77) Sense strand: GmsGmsCmCmUmGmGfCmCfCmUmUmGmamGmUmGmGmGmGmCm; antisense strand: CmsUfsGmCfCfCfCmAfCmUfCmAfAmGfGmGfCmCfAmsGmsGm;

(78) Sense strand: CmsCmsUmCmCmUmUfGmCfCmUmGmGmAmAmCmUmCmAmCmUm; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmsGmsAm;

(79) Sense strand: CmsUmsCmCmUmUmGfCmCfUmGmGmAmAmCmUmCmAmCmUmCm; Antisense strand: GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmsGmsGm;

(80) Sense strand: CmsCmsUmUmGmCmCfUmGfGmAmAmCmUmCmAmCmUmCmAmCm; Antisense strand: GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmsAmsAm;

(81) Sense strand: CmsUmsUmGmCmCmUfGmGfAmAmCmUmCmAmCmUmCmAmCmUm; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmsCmsAm;

(82) Sense strand: UmsUmsGmCmCmUmGfGmAfAmCmUmCmAmCmUmCmAmCmUmCm; Antisense strand: CmsAfsGmAfGfUfGmAfGmUfGmAfGmUfUmCfCmAfGmsGmsCm;

(83) Sense strand: UmsGmsCmCmUmGmGfAmAfCmUmCmAmCmUmCmAmCmUmCmUm; Antisense strand: CmsCfsAmGfAfGfUmGfAmGfUmGfAmGfUmUfCmCfAmsGmsGm;

(84) Sense strand: GmsUmsGmGmAmGmGfUmGfCmCmAmGmGmAmAmGmCmUmCmCm; Antisense strand: AmsGfsGmGfAfGfCmUfUmCfCmUfGmGfCmAfCmCfUmsCmsCm;

(85) Sense strand: UmsGmsGmAmGmGmUfGmCfCmAmGmGmAmAmGmCmUmCmCmCm; Antisense strand: GmsAfsGmGfGfAfGmCfUmUfCmCfUmGfGmCfAmCfCmsUmsCm;

(86) Sense strand: CmsCmsCmUmCmAmCfUmGfUmGmGmGmGmCmAmUmUmUmCmAm; Antisense strand: GmsGfsUmGfAfAfAmUfGmCfCmCfCmAfCmAfGmUfGmsAmsGm;

(87) Sense strand: AmsCmsUmGmUmGmGfGmGfCmAmUmUmUmCmAmCmCmAmUmUm; Antisense strand: UmsGfsAmAfUfGfGmUfGmAfAmAfUmGfCmCfCmCfAmsCmsAm;

(88) Sense strand: CmsUmsGmUmGmGmGfGmCfAmUmUmUmCmAmCmCmAmUmUmCm; Antisense strand: UmsUfsGmAfAfUfGmGfUmGfAmAfAmUfGmCfCmCfCmsAmsCm;

(89) Sense strand: UmsGmsUmGmGmGmGfCmAfUmUmUmCmAmCmCmAmUmUmCmAm; Antisense strand: UmsUfsUmGfAfAfUmGfGmUfGmAfAmAfUmGfCmCfCmsCmsAm;

(90) Sense strand: GmsUmsGmGmGmGmCfAmUfUmUmCmAmCmCmAmUmUmCmAmAm; Antisense strand: GmsUfsUmUfGfAfAmUfGmGfUmGfAmAfAmUfGmCfCmsCmsCm;

(91) Sense strand: UmsGmsGmGmGmCmAfUmUfUmCmAmCmCmAmUmUmCmAmAmm; Antisense strand: UmsGfsUmUfUfGfAmAfUmGfGmUfGmAfAmAfUmGfCmsCmsCm;

(92) Sense strand: GmsGmsGmGmCmAmUfUmUfCmAmCmCmAmUmUmCmAmAmCm; Antisense strand: CmsUfsGmUfUfUfGmAfAmUfGmGfUmGfAmAfAmUfGmsCmsCm;

(93) Sense strand: GmsGmsGmCmAmUmUfUmCfAmCmCmCmAmUmUmCmAmAmAmCmAm; Antisense strand: CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmsGmsCm;

(94) Sense strand: GmsGmsCmAmUmUmUfCmAfCmCmAmUmUmCmAmAmAmCmAmGm; Antisense strand: AmsCfsCmUfGfUfUmUfGmAfAmUfGmGfUmGfAmAfAmsUmsGm;

(95) Sense strand: GmsCmsAmUmUmUmCfAmCfCmAmUmUmCmAmAmAmCmAmGmGm; Antisense strand: GmsAfsCmCfUfGfUmUfUmGfAmAfUmGfGmUfGmAfAmsAmsUm;

(96) Sense strand: CmsAmsUmUmUmCmAfCmCfAmUmUmCmAmAmAmCmAmGmGmUm; Antisense strand: CmsGfsAmCfCfUfGmUfUmUfGmAfAmUfGmGfUmGfAmsAmsAm;

(97) Sense strand: AmsUmsUmUmCmAmCfCmAfUmUmCmAmAmAmCmAmGmGmUmCm; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmsAmsAm;

(98) Sense strand: UmsCmsAmCmCmAmUfUmCfAmAmAmCmAmGmGmUmCmGmAmGm; Antisense strand: AmsGfsCmUfCfGfAmCfCmUfGmUfUmUfGmAfAmUfGmsGmsUm;

(99) Sense strand: CmsAmsCmCmAmUmUfCmAfAmAmCmAmGmGmUmCmGmAmGmCm; Antisense strand: CmsAfsGmCfUfCfGmAfCmCfUmGfUmUfUmGfAmAfUmsGmsGm;

(100) Sense strand: CmsUmsGmCmCmAmGfCmUfGmCmUmCmCmCmAmAmUmGmUmGm; Antisense strand: GmsGfsCmAfCfAfUmUfGmGfGmAfGmCfAmGfCmUfGmsGmsCm;

(101) Sense strand: GmsCmsCmAmGmCmUfGmCfUmCmCmCmAmAmUmGmUmGmCmCm; Antisense strand: UmsCfsGmGfCfAfCmAfUmUfGmGfGmAfGmCfAmGfCmsUmsGm;

(102) Sense strand: GmsCmsUmGmCmUmCfCmCfAmAmUmGmUmGmCmCmGmamUmGm; antisense strand: GmsAfsCmAfUfCfGmGfCmAfCmAfUmUfGmGfGmAfGmsCmsAm;

(103) Sense strand: CmsUmsGmCmUmCmCfCmAfAmUmGmUmGmCmCmGmAmUmGmUm; Antisense strand: GmsGfsAmCfAfUfCmGfGmCfAmCfAmUfUmGfGmGfAmsGmsCm;

(104) Sense strand: GmsCmsUmCmCmCmAfAmUfGmUmGmCmCmGmAmUmGmUmCmCm; Antisense strand: AmsCfsGmGfAfCfAmUfCmGfGmCfAmCfAmUfUmGfGmsGmsAm;

(105) Sense strand: CmsCmsAmAmUmGmUfGmCfCmGmAmUmGmUmCmCmGmUmGmGm; antisense strand: GmsCfsCmCfAfCfGmGfAmCfAmUfCmGfGmCfAmCfAmsUmsUm;

(106) Sense strand: CmsAmsAmUmGmUmGfCmCfGmAmUmGmUmCmCmGmUmGmGmGm; antisense strand: UmsGfsCmCfCfAfCmGfGmAfCmAfUmCfGmGfCmAfCmsAmsUm;

(107) Sense strand: UmsGmsCmCmGmAmUfGmUfCmCmGmUmGmGmGmCmAmGmAmAm; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmsGmsGm;

(108) Sense strand: CmsGmsAmUmGmUmCfCmGfUmGmGmGmCmAmGmAmAmUmGmAm; Antisense strand: AmsGfsUmCfAfUfUmCfUmGfCmCfCmAfCmGfGmAfCmsAmsUm;

(109) Sense strand: GmsAmsUmGmUmCmCfGmUfGmGmGmCmAmGmAmAmUmGmAmCm; Antisense strand: AmsAfsGmUfCfAfUmUfCmUfGmCfCmCfAmCfGmGfAmsCmsAm;

(110) Sense strand: AmsUmsGmUmCmCmGfUmGfGmGmCmAmGmAmAmUmGmamCmUm; Antisense strand: AmsAfsAmGfUfCfAmUfUmCfUmGfCmCfCmAfCmGfGmsAmsCm;

(111) Sense strand: UmsGmsUmCmCmGmUfGmGfGmCmAmGmAmAmUmGmAmCmUmUm; Antisense strand: AmsAfsAmAfGfUfCmAfUmUfCmUfGmCfCmCfAmCfGmsGmsAm;

(112) Sense strand: GmsUmsCmCmGmUmGfGmGfCmAmGmAmAmUmGmAmCmUmUmUm; Antisense strand: UmsAfsAmAfAfGfUmCfAmUfUmCfUmGfCmCfCmAfCmsGmsGm;

(113) Sense strand: AmsGmsAmAmUmGmAfCmUfUmUmUmUmUmUmGmAmGmCmUmCm; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmsUmsUm;

(114) Sense strand: UmsUmsUmAmUmUmGfAmGfCmUmCmUmUmGmUmUmCmCmGmUm; Antisense strand: GmsCfsAmCfGfGfAmAfCmAfAmGfAmGfCmUfCmAfAmsUmsAm;

(115) Sense strand: UmsUmsAmUmUmGmAfGmCfUmCmUmUmGmUmUmCmCmGmUmGm; antisense strand: GmsGfsCmAfCfGfGmAfAmCfAmAfGmAfGmCfUmCfAmsAmsUm;

(116) Sense strand: GmsCmsUmCmUmUmGfUmUfCmCmGmUmGmCmCmAmGmGmCmAm; Antisense strand: AmsAfsUmGfCfCfUmGfGmCfAmCfGmGfAmAfCmAfAmsGmsAm;

(117) Sense strand: UmsCmsCmGmUmGmCfCmAfGmGmCmAmUmUmCmAmAmUmCmCm; Antisense strand: GmsAfsGmGfAfUfUmGfAmAfUmGfCmCfUmGfGmCfAmsCmsGm;

(118) Sense strand: GmsGmsCmAmGmGmAfUmUfCmUmUmCmCmCmAmUmGmGmamUm; Antisense strand: CmsUfsAmUfCfCfAmUfGmGfGmAfAmGfAmAfUmCfCmsUmsGm;

(119) Sense strand: AmsUmsGmGmCmCmCfUmCfAmUmCmUmCmCmAmGmCmUmAmAm; Antisense strand: AmsGfsUmUfAfGfCmUfGmGfAmGfAmUfGmAfGmGfGmsCmsCm;

(120) Sense strand: GmsCmsUmUmUmCmUfGmGfAmUmGmGmCmAmUmCmUmAmGmCm; Antisense strand: UmsGfsGmCfUfAfGmAfUmGfCmCfAmUfCmCfAmGfAmsAmsAm;

(121) Sense strand: UmsGmsGmCmAmUmCfUmAfGmCmCmAmGmAmGmGmCmUmGmGm; Antisense strand: CmsUfsCmCfAfGfCmCfUmCfUmGfGmCfUmAfGmAfUmsGmsCm;

(122) Sense strand: UmsGmsGmAmGmAmCfAmGfGmUmGmCmGmCmCmCmCmUmGmGm; antisense strand: CmsAfsCmCfAfGfGmGfGmCfGmCfAmCfCmUfGmUfCmsUmsCm;

(123) Sense strand: GmsGmsAmGmAmCmAfGmGfUmGmCmGmCmCmCmCmUmGmGmUm; antisense strand: CmsCfsAmCfCfAfGmGfGmGfCmGfCmAfCmCfUmGfUmsCmsUm;

(124) Sense strand: GmsAmsGmAmCmAmGfGmUfGmCmGmCmCmCmCmUmGmGmUmGm; Antisense strand: AmsCfsCmAfCfCfAmGfGmGfGmCfGmCfAmCfCmUfGmsUmsCm;

(125) Sense strand: AmsGmsAmCmAmGmGfUmGfCmGmCmCmCmCmUmGmGmUmGmGm; antisense strand: GmsAfsCmCfAfCfCmAfGmGfGmGfCmGfCmAfCmCfUmsGmsUm;

(126) Sense strand: AmsGmsGmUmGmCmGfCmCfCmCmUmGmGmUmGmGmUmCmAmCm; Antisense strand: CmsUfsGmUfGfAfCmCfAmCfCmAfGmGfGmGfCmGfCmsAmsCm;

(127) Sense strand: UmsUmsUmCmCmUmGfAmGfCmCmAmCmCmUmUmUmAmCmUmCm; Antisense strand: CmsAfsGmAfGfUfAmAfAmGfGmUfGmGfCmUfCmAfGmsGmsAm;

(128) Sense strand: GmsGmsCmCmUmGmGfCmGfGmAmGmAmUmGmCmUmUmCmUmAm; Antisense strand: CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmsGmsGm;

(129) Sense strand: GmsCmsUmUmUmUmGfUmAfAmCmUmUmGmAmAmGmAmUmAmUm; Antisense strand: AmsAfsAmUfAfUfCmUfUmCfAmAfGmUfUmAfCmAfAmsAmsAm;

(130) Sense strand: UfsUmsGfCmCfUmGfGmAfAfCfUmCfAmCfUmCfAmCfUmCf-GALNAC; Antisense strand: GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGfsGm;

(131) Sense strand: UfsUmsGfCmCfUmGfGmAfAfCfUmCfAmCfUmCfAmCfUmCf-GALNAC; Antisense strand: GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGmsGm;

(132) Sense strand: UfsUmsGfCmCfUmGfGmAfAfCfUmCfAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;

(133) Sense strand: UmsUmsGmCmCmUmGfGmAfAmCmUmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;

(134) Sense strand: UmsUmsGmCmCmUmGfGmAfAmCmUmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmAmAmsGmsGm;

(135) Sense strand: UfsUmsGfCmCfUmGfGmAfAfC(LNA)UmCfAmCfUmCfAmCfUmCf-GALNAC; Antisense strand: GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGfsGm;

(136) Sense strand: UfsUmsGfCmCfUmGfGmAfAfC(LNA)UmCfAmCfUmCfAmCfUmCf-GALNAC; Antisense strand: GmsAfsGmUfGmAfGmUfGmAfGmUmUmCfCmAfGmGfCmAfAmsGmsGm;

(137) Sense strand: UfsUmsGfCmCfUmGfGmAfAfC(LNA)UmCfAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;

(138) Sense strand: UmsUmsGmCmCmUmGfGmAfAmC(LNA) UmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGmAmGmUfGmAfGmUmUmCfCmAfGmGmCmAfAmsGmsGm;

(139) Sense strand: UmsUmsGmCmCmUmGfGmAfAmC(LNA) UmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmAmAmsGmsGm;

(140) Sense strand: UmsUmsGmCmCmUmGfGmAfAmC(d) UmCmAmCmUmCmAmCmUmCm-GALNAC; Antisense strand: GmsAfsGmUfGfAfGmUfGmAfGmUfUmCfCmAfGmGfCmAmAmsGmsGm;

(141) Sense strand: UfsUfsGfCCUGGAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAGUGAGUUCCAGGCAAfsGfsGf;

(142) Sense strand: CHO-UfsUfsGfCCUGGAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAGUGAGUUCCAGGCAAfsGfsGf;

(143) Sense strand: UfsUfsGfCCUG(LNA)GAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAGUGAGUUCCAGGCAAfsGfsGf;

(144) Sense strand: UfsUfsGfCCUGGAACUCACUCACfsUfsCf-GALNAC; Antisense strand: GfsAfsGfUGAG(LNA)UGAGUUCCAGGCAAfsGfsGf;

(145) Sense strand: UmsUmsGmCCUGGAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAGUGAGUUCCAGGCAAmsGmsGm;

(146) Sense strand: CHO-UmsUmsGmCCUGGAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAGUGAGUUCCAGGCAAmsGmsGm;

(147) Sense strand: UmsUmsGmCCUG(LNA)GAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAGUGAGUUCCAGGCAAmsGmsGm;

(148) Sense strand: UmsUmsGmCCUGGAACUCACUCACmsUmsCm-GALNAC; Antisense strand: GmsAmsGmUGAG(LNA)UGAGUUCCAGGCAAmsGmsGm;

(149) Sense strand: GfsCmsAfUmUfUmCfAmCfCfAfUmUfCmAfAmAfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCfsCm;

(150) Sense strand: GfsCmsAfUmUfUmCfAmCfCfAfUmUfCmAfAmAfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCmsCm;

(151) Sense strand: GfsCmsAfUmUfUmCfAmCfCfAfUmUfCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCmsCm;

(152) Sense strand: GmsCmsAmUmUmUmCfAmCfCmAmUmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCmsCm;

(153) Sense strand: GmsCmsAmUmUmUmCfAmCfCmAmUmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmGmCmsCmsCm;

(154) Sense strand: GfsCmsAfUmUfUmCfAmCfCfA(LNA)UmUfCmAfAmAfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCfsCm;

(155) Sense strand: GfsCmsAfUmUfUmCfAmCfCfA(LNA)UmUfCmAfAmAfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfUmUfUmGfAmAfUmGmGmUfGmAfAmAfUmGfCmsCmsCm;

(156) Sense strand: GfsCmsAfUmUfUmCfAmCfCfA(LNA)UmUfCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCmsCm;

(157) Sense strand: GmsCmsAmUmUmUmCfAmCfCmA(LNA)UmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUmUmUmGfAmAfUmGmGmUfGmAfAmAmUmGfCmsCmsCm;

(158) Sense strand: GmsCmsAmUmUmUmCfAmCfCmA(LNA)UmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmGmCmsCmsCm;

(159) Sense strand: GmsCmsAmUmUmUmCfAmCfCmA(d)UmUmCmAmAmAmCmAmGmGm-GALNAC; Antisense strand: CmsCfsUmGfUfUfUmGfAmAfUmGfGmUfGmAfAmAfUmGmCmsCmsCm;

(160) Sense strand: GfsCfsAfUUUCACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUUGAAUGGUGAAAUGCfsCfsCf;

(161) Sense strand: CHO-GfsCfsAfUUUCACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUUGAAUGGUGAAAUGCfsCfsCf;

(162) Sense strand: GfsCfsAfUUUC(LNA)ACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUUGAAUGGUGAAAUGCfsCfsCf;

(163) Sense strand: GfsCfsAfUUUCACCAUUCAAACAfsGfsGf-GALNAC; Antisense strand: CfsCfsUfGUUU(LNA)GAAUGGUGAAAUGCfsCfsCf;

(164) Sense strand: GmsCmsAmUUUCACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUUGAAUGGUGAAAUGCmsCmsCm;

(165) Sense strand: CHO-GmsCmsAmUUUCACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUUGAAUGGUGAAAUGCmsCmsCm;

(166) Sense strand: GmsCmsAmUUUC(LNA)ACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUUGAAUGGUGAAAUGCmsCmsCm;

(167) Sense strand: GmsCmsAmUUUCACCAUUCAAACAmsGmsGm-GALNAC; Antisense strand: CmsCmsUmGUUU(LNA)GAAUGGUGAAAUGCmsCmsCm;

(168) Sense strand: CfsCmsGfAmUfGmUfCmCfGfUfGmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCfsAm;

(169) Sense strand: CfsCmsGfAmUfGmUfCmCfGfUfGmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCmsAm;

(170) Sense strand: CfsCmsGfAmUfGmUfCmCfGfUfGmGfGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;

(171) Sense strand: CmsCmsGmAmUmGmUfCmCfGmUmGmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;

(172) Sense strand: CmsCmsGmAmUmGmUfCmCfGmUmGmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmGmGmsCmsAm;

(173) Sense strand: CfsCmsGfAmUfGmUfCmCfGfU(LNA)GmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCfsAm;

(174) Sense strand: CfsCmsGfAmUfGmUfCmCfGfU(LNA)GmGfGmCfAmGfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfCmUfGmCfCmCfAmCmGmGfAmCfAmUfCmGfGmsCmsAm;

(175) Sense strand: CfsCmsGfAmUfGmUfCmCfGfU(LNA)GmGfGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;

(176) Sense strand: CmsCmsGmAmUmGmUfCmCfGmU(LNA)GmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCmUmGmCfCmCfAmCmGmGfAmCfAmUmCmGfGmsCmsAm;

(177) Sense strand: CmsCmsGmAmUmGmUfCmCfGmU(LNA)GmGmGmCmAmGmAmamUmGm-GALNAC; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmGmGmsCmsAm;

(178) Sense strand: CmsCmsGmAmUmGmUfCmCfGmU(d)GmGmGmCmAmGmAmAmUmGm-GALNAC; Antisense strand: CmsAfsUmUfCfUfGmCfCmCfAmCfGmGfAmCfAmUfCmGmGmsCmsAm;

(179) Sense strand: CfsCfsGfAUGUCCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUGCCCACGGACAUCGGfsCfsAf;

(180) Sense strand: CHO-CfsCfsGfAUGUCCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUGCCCACGGACAUCGGfsCfsAf;

(181) Sense strand: CfsCfsGfAUGU(LNA)CCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUGCCCACGGACAUCGGfsCfsAf;

(182) Sense strand: CfsCfsGfAUGUCCGUGGGCAGAAfsUfsGf-GALNAC; Antisense strand: CfsAfsUfUCUG(LNA)CCCACGGACAUCGGfsCfsAf;

(183) Sense strand: CmsCmsGmAUGUCCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUGCCCACGGACAUCGGmsCmsAm;

(184) Sense strand: CHO-CmsCmsGmAUGUCCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUGCCCACGGACAUCGGmsCmsAm;

(185) Sense strand: CmsCmsGmAUGU(LNA)CCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUGCCCACGGACAUCGGmsCmsAm;

(186) Sense strand: CmsCmsGmAUGUCCGUGGGCAGAAmsUmsGm-GALNAC; Antisense strand: CmsAmsUmUCUG(LNA)CCCACGGACAUCGGmsCmsAm;

(187) Sense strand: AfsAmsUfGmAfCmUfUmUfUfAfUmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCfsUm;

(188) Sense strand: AfsAmsUfGmAfCmUfUmUfUfAfUmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCmsUm;

(189) Sense strand: AfsAmsUfGmAfCmUfUmUfUfAfUmUfGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;

(190) Sense strand: AmsAmsUmGmAmCmUfUmUfUmAmUmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;

(191) Sense strand: AmsAmsUmGmAmCmUfUmUfUmAmUmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmUmUmsCmsUm;

(192) Sense strand: AfsAmsUfGmAfCmUfUmUfUfA(LNA)UmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCfsUm;

(193) Sense strand: AfsAmsUfGmAfCmUfUmUfUfA(LNA)UmUfGmAfGmCfUmCfUmUf-GALNAC; Antisense strand: AmsAfsGmAfGmCfUmCfAmAfUmAmAmAfAmGfUmCfAmUfUmsCmsUm;

(194) Sense strand: AfsAmsUfGmAfCmUfUmUfUfA(LNA)UmUfGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;

(195) Sense strand: AmsAmsUmGmAmCmUfUmUfUmA(LNA)UmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGmCmUmCfAmAfUmAmAmAfAmGfUmCmAmUfUmsCmsUm;

(196) Sense strand: AmsAmsUmGmAmCmUfUmUfUmA(LNA)UmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmUmUmsCmsUm;

(197) Sense strand: AmsAmsUmGmAmCmUfUmUfUmA(d)UmUmGmAmGmCmUmCmUmUm-GALNAC; Antisense strand: AmsAfsGmAfGfCfUmCfAmAfUmAfAmAfAmGfUmCfAmUmUmsCmsUm;

(198) Sense strand: AfsAfsUfGACUUUUAUUGAGCUCfsUfsUf-GALNAC; Antisense strand: AfsAfsGfAGCUCAAUAAAAGUCAUUfsCfsUf;

(199) Sense strand: CHO-AfsAfsUfGACUUUUAUUGAGCUCfsUfsUf-GALNAC; Antisense strand: AfsAfsGfAGCUCAAUAAAAGUCAUUfsCfsUf;

(200) Sense strand: AfsAfsUfGACU(LNA)UUUAUUGAGCUCfsUfsUf-GALNAC; Antisense strand: AfsAfsGfAGCUCAAUAAAAGUCAUUfsCfsUf;

(201) Sense strand: AfsAfsUfGACUUUUAUUGAGCUCfsUfsUf-GALNAC; Antisense strand: AfsAfsGfAGCU(LNA)CAAUAAAAGUCAUUfsCfsUf;

(202) Sense strand: AmsAmsUmGACUUUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCUCAAUAAAAGUCAUUmsCmsUm;

(203) Sense strand: CHO-AmsAmsUmGACUUUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCUCAAUAAAAGUCAUUmsCmsUm;

(204) Sense strand: AmsAmsUmGACU(LNA)UUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCUCAAUAAAAGUCAUUmsCmsUm;

(205) Sense strand: AmsAmsUmGACUUUUAUUGAGCUCmsUmsUm-GALNAC; Antisense strand: AmsAmsGmAGCU(LNA)CAAUAAAAGUCAUUmsCmsUm;

(206) Sense strand: CfsCmsUfGmGfCmGfGmAfGfAfUmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAfsGm;

(207) Sense strand: CfsCmsUfGmGfCmGfGmAfGfAfUmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAmsGm;

(208) Sense strand: CfsCmsUfGmGfCmGfGmAfGfAfUmGfCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;

(209) Sense strand: CmsCmsUmGmGmCmGfGmAfGmAmUmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;

(210) Sense strand: CmsCmsUmGmGmCmGfGmAfGmAmUmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmGmGmsAmsGm;

(211) Sense strand: CfsCmsUfGmGfCmGfGmAfGfA(LNA)UmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAfsGm;

(212) Sense strand: CfsCmsUfGmGfCmGfGmAfGfA(LNA)UmGfCmUfUmCfUmAfAmGf-GALNAC; Antisense strand: CmsUfsUmAfGmAfAmGfCmAfUmCmUmCfCmGfCmCfAmGfGmsAmsGm;

(213) Sense strand: CfsCmsUfGmGfCmGfGmAfGfA(LNA)UmGfCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;

(214) Sense strand: CmsCmsUmGmGmCmGfGmAfGmA(LNA)UmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGmamAmGfCmAfUmCmUmCfCmGfCmCmAmGfGmsAmsGm;

(215) Sense strand: CmsCmsUmGmGmCmGfGmAfGmA(LNA)UmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmGmGmsAmsGm;

(216) Sense strand: CmsCmsUmGmGmCmGfGmAfGmA(d) UmGmCmUmUmCmUmAmAmGm-GALNAC; Antisense strand: CmsUfsUmAfGfAfAmGfCmAfUmCfUmCfCmGfCmCfAmGmGmsAmsGm;

(217) Sense strand: CfsCfsUfGGCGGAGAUGCUUCUAfsAfsGf-GALNAC; Antisense strand: CfsUfsUfAGAAGCAUCUCCGCCAGGfsAfsGf;

(218) Sense strand: CHO-CfsCfsUfGGCGGAGAUGCUUCUAfsAfsGf-GALNAC; Antisense strand: CfsUfsUfAGAAGCAUCUCCGCCAGGfsAfsGf;

(219) Sense strand: CfsCfsUfGGCG(LNA)GAGAUGCUUCUAfsAfsGf-GALNAC; Antisense strand: CfsUfsUfAGAAGCAUCUCCGCCAGGfsAfsGf;

(220) Sense strand: CfsCfsUfGGCGGAGAUGCUUCUAfsAfsGf-GALNAC; Antisense strand: CfsUfsUfAGAA(LNA)GCAUCUCCGCCAGGfsAfsGf;

(221) Sense strand: CmsCmsUmGGCGGAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAAGCAUCUCCGCCAGGmsAmsGm;

(222) Sense strand: CHO-CmsCmsUmGGCGGAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAAGCAUCUCCGCCAGGmsAmsGm;

(223) Sense strand: CmsCmsUmGGCG(LNA)GAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAAGCAUCUCCGCCAGGmsAmsGm;

(224) Sense strand: CmsCmsUmGGCGGAGAUGCUUCUAmsAmsGm-GALNAC; Antisense strand: CmsUmsUmAGAA(LNA)GCAUCUCCGCCAGGmsAmsGm;

(225) Sense strand: UfsCmsCfUmUfGmCfCmUfGfGfAmAfCmUfCmAfCmUfCmAf-GALNAC; Antisense strand: UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCfsUm;

(226) Sense strand: UfsCmsCfUmUfGmCfCmUfGfGfAmAfCmUfCmAfCmUfCmAf-GALNAC; Antisense strand: UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCmsUm;

(227) Sense strand: UfsCmsCfUmUfGmCfCmUfGfGfAmAfCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;

(228) Sense strand: UmsCmsCmUmUmGmCfCmUfGmGmAmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;

(229) Sense strand: UmsCmsCmUmUmGmCfCmUfGmGmAmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmGmAmsCmsUm;

(230) Sense strand: UfsCmsCfUmUfGmCfCmUfGfG(LNA)AmAfCmUfCmAfCmUfCmAf-GALNAC; Antisense strand: UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCfsUm;

(231) Sense strand: UfsCmsCfUmUfGmCfCmUfGfG(LNA)AmAfCmUfCmAfCmUfCmAf-GALNAC; Antisense strand: UmsGfsAmGfUmGfAmGfUmUfCmCmAmGfGmCfAmAfGmGfAmsCmsUm;

(232) Sense strand: UfsCmsCfUmUfGmCfCmUfGfG(LNA)AmAfCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;

(233) Sense strand: UmsCmsCmUmUmGmCfCmUfGmG(LNA)AmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUmGmAmGfUmUfCmCmAmGfGmCfAmAmGmGfAmsCmsUm;

(234) Sense strand: UmsCmsCmUmUmGmCfCmUfGmG(LNA)AmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmGmAmsCmsUm;

(235) Sense strand: UmsCmsCmUmUmGmCfCmUfGmG(d)AmAmCmUmCmAmCmUmCmAm-GALNAC; Antisense strand: UmsGfsAmGfUfGfAmGfUmUfCmCfAmGfGmCfAmAfGmGmAmsCmsUm;

(236) Sense strand: UfsCfsCfUUGCCUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGAGUUCCAGGCAAGGAfsCfsUf;

(237) Sense strand: CHO-UfsCfsCfUUGCCUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGAGUUCCAGGCAAGGAfsCfsUf;

(238) Sense strand: UfsCfsCfUUGC(LNA)CUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGAGUUCCAGGCAAGGAfsCfsUf;

(239) Sense strand: UfsCfsCfUUGCCUGGAACUCACUfsCfsAf-GALNAC; Antisense strand: UfsGfsAfGUGA(LNA)GUUCCAGGCAAGGAfsCfsUf;

(240) Sense strand: UmsCmsCmUUGCCUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGAGUUCCAGGCAAGGAmsCmsUm;

(241) Sense strand: CHO-UmsCmsCmUUGCCUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGAGUUCCAGGCAAGGAmsCmsUm;

(242) Sense strand: UmsCmsCmUUGC(LNA)CUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGAGUUCCAGGCAAGGAmsCmsUm;

(243) Sense strand: UmsCmsCmUUGCCUGGAACUCACUmsCmsAm-GALNAC; Antisense strand: UmsGmsAmGUGA(LNA)GUUCCAGGCAAGGAmsCmsUm;

(244) Sense strand: CfsCmsUfUmGfCmCfUmGfGfAfAmCfUmCfAmCfUmCfAmCf-GALNAC; Antisense strand: GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAfsGm;

(245) Sense strand: CfsCmsUfUmGfCmCfUmGfGfAfAmCfUmCfAmCfUmCfAmCf-GALNAC; Antisense strand: GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAmsGm;

(246) Sense strand: CfsCmsUfUmGfCmCfUmGfGfAfAmCfUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;

(247) Sense strand: CmsCmsUmUmGmCmCfUmGfGmAmAmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;

(248) Sense strand: CmsCmsUmUmGmCmCfUmGfGmAmAmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmGmGmsAmsGm;

(249) Sense strand: CfsCmsUfUmGfCmCfUmGfGfA(LNA)AmCfUmCfAmCfUmCfAmCf-GALNAC; Antisense strand: GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAfsGm;

(250) Sense strand: CfsCmsUfUmGfCmCfUmGfGfA(LNA)AmCfUmCfAmCfUmCfAmCf-GALNAC; Antisense strand: GmsUfsGmAfGmUfGmAfGmUfUmCmCmAfGmGfCmAfAmGfGmsAmsGm;

(251) Sense strand: CfsCmsUfUmGfCmCfUmGfGfA(LNA)AmCfUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;

(252) Sense strand: CmsCmsUmUmGmCmCfUmGfGmA(LNA)AmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGmUmGmAfGmUfUmCmCmAfGmGfCmAmAmGfGmsAmsGm;

(253) Sense strand: CmsCmsUmUmGmCmCfUmGfGmA(LNA)AmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmGmGmsAmsGm;

(254) Sense strand: CmsCmsUmUmGmCmCfUmGfGmA(d) AmCmUmCmAmCmUmCmAmCm-GALNAC; Antisense strand: GmsUfsGmAfGfUfGmAfGmUfUmCfCmAfGmGfCmAfAmGmGmsAmsGm;

(255) Sense strand: CfsCfsUfUGCCUGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUGAGUUCCAGGCAAGGfsAfsGf;

(256) Sense strand: CHO-CfsCfsUfUGCCUGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUGAGUUCCAGGCAAGGfsAfsGf;

(257) Sense strand: CfsCfsUfUGCC(LNA)UGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUGAGUUCCAGGCAAGGfsAfsGf;

(258) Sense strand: CfsCfsUfUGCCUGGAACUCACUCfsAfsCf-GALNAC; Antisense strand: GfsUfsGfAGUG(LNA)AGUUCCAGGCAAGGfsAfsGf;

(259) Sense strand: CmsCmsUmUGCCUGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUGAGUUCCAGGCAAGGmsAmsGm;

(260) Sense strand: CHO-CmsCmsUmUGCCUGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUGAGUUCCAGGCAAGGmsAmsGm;

(261) Sense strand: CmsCmsUmUGCC(LNA)UGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUGAGUUCCAGGCAAGGmsAmsGm;

(262) Sense strand: CmsCmsUmUGCCUGGAACUCACUCmsAmsCm-GALNAC; Antisense strand: GmsUmsGmAGUG(LNA)AGUUCCAGGCAAGGmsAmsGm;

(263) Sense strand: UfsGmsCfCmUfGmGfAmAfCfUfCmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAfsGm;

(264) Sense strand: UfsGmsCfCmUfGmGfAmAfCfUfCmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAmsGm;

(265) Sense strand: UfsGmsCfCmUfGmGfAmAfCfUfCmAfCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsAmsGm;

(266) Sense strand: UmsGmsCmCmUmGmGfAmAfCmUmCmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsAmsGm;

(267) Sense strand: UmsGmsCmCmUmGmGfAmAfCmUmCmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmCmAmsAmsGm;

(268) Sense strand: UfsGmsCfCmUfGmGfAmAfCfU(LNA)CmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAfsGm;

(269) Sense strand: UfsGmsCfCmUfGmGfAmAfCfU(LNA)CmAfCmUfCmAfCmUfCmUf-GALNAC; Antisense strand: AmsGfsAmGfUmGfAmGfUmGfAmGmUmUfCmCfAmGfGmCfAmsAmsGm;

(270) Sense strand: UfsGmsCfCmUfGmGfAmAfCfU(LNA)CmAfCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsAmsGm;

(271) Sense strand: UmsGmsCmCmUmGmGfAmAfCmU(LNA)CmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUmGmAmGfUmGfAmGmUmUfCmCfAmGmGmCfAmsAmsGm;

(272) Sense strand: UmsGmsCmCmUmGmGfAmAfCmU(LNA)CmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmCmAmsAmsGm;

(273) Sense strand: UmsGmsCmCmUmGmGfAmAfCmU(d)CmAmCmUmCmAmCmUmCmUm-GALNAC; Antisense strand: AmsGfsAmGfUfGfAmGfUmGfAmGfUmUfCmCfAmGfGmCmAmsAmsGm;

(274) Sense strand: UfsGfsCfCUGGAACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGAGUGAGUUCCAGGCAfsAfsGf;

(275) Sense strand: CHO-UfsGfsCfCUGGAACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGAGUGAGUUCCAGGCAfsAfsGf;

(276) Sense strand: UfsGfsCfCUGG(LNA)AACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGAGUGAGUUCCAGGCAfsAfsGf;

(277) Sense strand: UfsGfsCfCUGGAACUCACUCACUfsCfsUf-GALNAC; Antisense strand: AfsGfsAfGUGA(LNA)GUGAGUUCCAGGCAfsAfsGf;

(278) Sense strand: UmsGmsCmCUGGAACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGAGUGAGUUCCAGGCAmsAmsGm;

(279) Sense strand: CHO-UmsGmsCmCUGGAACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGAGUGAGUUCCAGGCAmsAmsGm;

(280) Sense strand: UmsGmsCmCUGG(LNA)AACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGAGUGAGUUCCAGGCAmsAmsGm;

(281) Sense strand: UmsGmsCmCUGGAACUCACUCACUmsCmsUm-GALNAC; Antisense strand: AmsGmsAmGUGA(LNA)GUGAGUUCCAGGCAmsAmsGm;

(282) Sense strand: UfsUmsCfAmCfCmAfUmUfCfAfAfAfCmAfGmGfUmCfGmAf-GALNAC; Antisense strand: UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAfsUm;

(283) Sense strand: UfsUmsCfAmCfCmAfUmUfCfAfAfAfCmAfGmGfUmCfGmAf-GALNAC; Antisense strand: UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAmsUm;

(284) Sense strand: UfsUmsCfAmCfCmAfUmUfCfAfAmAfCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;

(285) Sense strand: UmsUmsCmAmCmCmAfUmUfCmAmAmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;

(286) Sense strand: UmsUmsCmAmCmCmAfUmUfCmAmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmAmAmsAmsUm;

(287) Sense strand: UfsUmsCfAmCfCmAfUmUfCfA(LNA)AmAfCmAfGmGfUmCfGmAf-GALNAC; Antisense strand: UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAfsUm;

(288) Sense strand: UfsUmsCfAmCfCmAfUmUfCfA(LNA)AmAfCmAfGmGfUmCfGmAf-GALNAC; Antisense strand: UmsCfsGmAfCmCfUmGfUmUfUmGmAmAfUmGfGmUfGmAfAmsAmsUm;

(289) Sense strand: UfsUmsCfAmCfCmAfUmUfCfA(LNA)AmAfCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;

(290) Sense strand: UmsUmsCmAmCmCmAfUmUfCmA(LNA)AmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCmCmUmGfUmUfUmGmAmAfUmGfGmUmGmAfAmsAmsUm;

(291) Sense strand: UmsUmsCmAmCmCmAfUmUfCmA(LNA)AmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmAmAmsAmsUm;

(292) Sense strand: UmsUmsCmAmCmCmAfUmUfCmA(d)AmAmCmAmGmGmUmCmGmAm-GALNAC; Antisense strand: UmsCfsGmAfCfCfUmGfUmUfUmGfAmAfUmGfGmUfGmAmAmsAmsUm;

(293) Sense strand: UfsUfsCfACCAUUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCUGUUUGAAUGGUGAAfsAfsUf;

(294) Sense strand: CHO-UfsUfsCfACCAUUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCUGUUUGAAUGGUGAAfsAfsUf;

(295) Sense strand: UfsUfsCfACCA(LNA)UUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCUGUUUGAAUGGUGAAfsAfsUf;

(296) Sense strand: UfsUfsCfACCAUUCAAACAGGUCfsGfsAf-GALNAC; Antisense strand: UfsCfsGfACCU(LNA)GUUUGAAUGGUGAAfsAfsUf;

(297) Sense strand: UmsUmsCmACCAUUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCUGUUUGAAUGGUGAAmsAmsUm;

(298) Sense strand: CHO-UmsUmsCmACCAUUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCUGUUUGAAUGGUGAAmsAmsUm;

(299) Sense strand: UmsUmsCmACCA(LNA)UUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCUGUUUGAAUGGUGAAmsAmsUm;

(300) Sense strand: UmsUmsCmACCAUUCAAACAGGUCmsGmsAm-GALNAC; Antisense strand: UmsCmsGmACCU(LNA)GUUUGAAUGGUGAAmsAmsUm;

(301) Sense strand: CfsCmsCfGmUfGmCfGmCfAfGfGmAfGmGfAmCfGmAfGmGf-GALNAC; Antisense strand: CmsCfsUmCfGmUfCmCfUmCfCmUmGmCfGmCfAmCfGmGfGmsCmsGm;

(302) Sense strand: CfsCmsCfGmCfCmGfGmGfGfAfUmAfCmCfUmCfAmCfCmAf-GALNAC; Antisense strand: UmsGfsGmUfGmAfGmGfUmAfUmCmCmCfCmGfGmCfGmGfGmsCmsAm;

(303) Sense strand: GfsGmsGfGmAfUmAfCmCfUfCfAmCfCmAfAmGfAmUfCmCf-GALNAC; Antisense strand: GmsGfsAmUfCmUfUmGfGmUfGmAmGmGfUmAfUmCfCmCfCmsGmsGm;

(304) Sense strand: GfsGmsGfAmUfAmCfCmUfCfAfCmCfAmAfGmAfUmCfCmUf-GALNAC; Antisense strand: AmsGfsGmAfUmCfUmUfGmGfUmGmAmGfGmUfAmUfCmCfCmsCmsGm;

(305) Sense strand: AfsCmsCfAmAfGmAfUmCfCfUfGmCfAmUfGmUfCmUfUmCf-GALNAC; Antisense strand: GmsAfsAmGfAmCfAmUfGmCfAmGmGmAfUmCfUmUfGmGfUmsGmsAm;

(306) Sense strand: GfsAmsAfGmUfUmGfCmCfCfCfAmUfGmUfCmGfAmCfUmAf-GALNAC; Antisense strand: UmsAfsGmUfCmGfAmCfAmUfGmGmGmGfCmAfAmCfUmUfCmsAmsAm;

(307) Sense strand: CfsCmsCfAmUfGmUfCmGfAfCfUmAfCmAfUmCfGmAfGmGf-GALNAC; Antisense strand: CmsCfsUmCfGmAfUmGfUmAfGmUmCmGfAmCfAmUfGmGfGmsGmsCm;

(308) Sense strand: AfsCmsCfGmGfGmCfGmGfAfUfGmAfAmUfAmCfCmAfGmCf-GALNAC; Antisense strand: GmsCfsUmGfGmUfAmUfUmCfAmUmCmCfGmCfCmCfGmGfUmsAmsCm;

(309) Sense strand: GfsAmsCfCmAfAmCfUmUfUfGfGmCfCmGfCmUfGmUfGmUf-GALNAC; Antisense strand: AmsCfsAmCfAmGfCmGfGmCfCmAmAmAfGmUfUmGfGmUfCmsCmsCm;

(310) Sense strand: CfsCmsAfAmCfUmUfUmGfGfCfCmGfCmUfGmUfGmUfGmGf-GALNAC; Antisense strand: CmsCfsAmCfAmCfAmGfCmGfGmCmCmAfAmAfGmUfUmGfGmsUmsCm;

(311) Sense strand: GfsCmsCfGmCfUmGfUmGfUfGfGmAfCmCfUmCfUmUfUmGf-GALNAC; Antisense strand: CmsAfsAmAfGmAfGmGfUmCfCmAmCmAfCmAfGmCfGmGfCmsCmsAm;

(312) Sense strand: CfsGmsCfUmGfUmGfUmGfGfAfCmCfUmCfUmUfUmGfCmCf-GALNAC; Antisense strand: GmsGfsCmAfAmAfGmAfGmGfUmCmCmAfCmAfCmAfGmCfGmsGmsCm;

(313) Sense strand: CfsAmsCfAmAfCmGfCmUfUfUfUmGfGmGfGmGfUmGfAmGf-GALNAC; Antisense strand: CmsUfsCmAfCmCfCmCfCmAfAmAmAmGfCmGfUmUfGmUfGmsGmsGm;

(314) Sense strand: AfsCmsAfAmCfGmCfUmUfUfUfGmGfGmGfGmUfGmAfGmGf-GALNAC; Antisense strand: CmsCfsUmCfAmCfCmCfCmCfAmAmAmAfGmCfGmUfUmGfUmsGmsGm;

(315) Sense strand: CfsAmsAfCmGfCmUfUmUfUfGfGmGfGmGfUmGfAmGfGmGf-GALNAC; Antisense strand: CmsCfsCmUfCmAfCmCfCmCfCmAmAmAfAmGfCmGfUmUfGmsUmsGm;

(316) Sense strand: GfsUmsGfAmGfGmGfUmGfUfCfUmAfCmGfCmCfAmUfUmGf-GALNAC; Antisense strand: CmsAfsAmUfGmGfCmGfUmAfGmAmCmAfCmCfCmUfCmAfCmsCmsCm;

(317) Sense strand: UfsGmsAfGmGfGmUfGmUfCfUfAmCfGmCfCmAfUmUfGmCf-GALNAC; Antisense strand: GmsCfsAmAfUmGfGmCfGmUfAmGmAmCfAmCfCmCfUmCfAmsCmsCm;

(318) Sense strand: GfsGmsGfUmGfUmCfUmAfCfGfCmCfAmUfUmGfCmCfAmGf-GALNAC; Antisense strand: CmsUfsGmGfCmAfAmUfGmGfCmGmUmAfGmAfCmAfCmCfCfCmsUmsCm;

(319) Sense strand: GfsGmsUfGmUfCmUfAmCfGfCfCmAfUmUfGmCfCmAfGmGf-GALNAC; Antisense strand: CmsCfsUmGfGmCfAmAfUmGfGmCmGmUfAmGfAmCfAmCfCmsCmsUm;

(320) Sense strand: GfsUmsGfUmCfUmAfCmGfCfCfAmUfUmGfCmCfAmGfGmUf-GALNAC; Antisense strand: AmsCfsCmUfGmGfCmAfAmUfGmGmCmGfUmAfGmAfCmAfCmsCmsCm;

(321) Sense strand: UfsGmsUfCmUfAmCfGmCfCfAfUmUfGmCfCmAfGmGfUmGf-GALNAC; Antisense strand: CmsAfsCmCfUmGfGmCfAmAfUmGmGmCfGmUfAmGfAmCfAmsCmsCm;

(322) Sense strand: CfsUmsAfCmGfCmCfAmUfUfGfCmCfAmGfGmUfGmCfUmGf-GALNAC; Antisense strand: CmsAfsGmCfAmCfCmUfGmGfCmAmAmUfGmGfCmGfUmAfGmsAmsCm;

(323) Sense strand: UfsAmsCfGmCfCmAfUmUfGfCfCmAfGmGfUmGfCmUfGmCf-GALNAC; Antisense strand: GmsCfsAmGfCmAfCmCfUmGfGmCmAmAfUmGfGmCfGmUfAmsGmsAm;

(324) Sense strand: CfsCmsUfUmGfGmCfAmCfCfCfAmCfAmAfGmCfCmGfCmCf-GALNAC; Antisense strand: GmsGfsCmGfGmCfUmUfGmUfGmGmGmUfGmCfCmAfAmGfGmsUmsCm;

(325) Sense strand: CfsAmsCfCmCfAmCfAmAfGfCfCmGfCmCfUmGfUmGfCmUf-GALNAC; Antisense strand: AmsGfsCmAfCmAfGmGfCmGfGmCmUmUfGmUfGmGfGmUfGmsCmsCm;

(326) Sense strand: CfsCmsCfAmCfAmAfGmCfCfGfCmCfUmGfUmGfCmUfGmAf-GALNAC; Antisense strand: UmsCfsAmGfCmAfCmAfGmGfCmGmGmCfUmUfGmUfGmGfGmsUmsGm;

(327) Sense strand: CfsCmsAfCmAfAmGfCmCfGfCfCmUfGmUfGmCfUmGfAmGf-GALNAC; Antisense strand: CmsUfsCmAfGmCfAmCfAmGfGmCmGmGfCmUfUmGfUmGfGmsGmsUm;

(328) Sense strand: CfsCmsAfCmGfAmGfGmUfCfAfGmCfCmCfAmAfCmCfAmGf-GALNAC; Antisense strand: CmsUfsGmGfUmUfGmGfGmCfUmGmAmCfCmUfCmGfUmGfGmsCmsCm;

(329) Sense strand: CfsAmsCfGmAfGmGfUmCfAfGfCmCfCmAfAmCfCmAfGmUf-GALNAC; Antisense strand: AmsCfsUmGfGmUfUmGfGmGfCmUmGmAfCmCfUmCfGmUfGmsGmsCm;

(330) Sense strand: GfsUmsCfAmGfGmAfGmCfCfGfGmGfAmCfGmUfCmAfGmCf-GALNAC; Antisense strand: GmsCfsUmGfAmCfGmUfCmCfCmGmGmCfUmCfCmUfGmAfCmsUmsAm;

(331) Sense strand: CfsUmsGfGmGfGmCfUmGfAfGfCmUfUmUfAmAfAmAfUmGf-GALNAC; Antisense strand: CmsAfsUmUfUmUfAmAfAmGfCmUmCmAfGmCfCmCfCmAfGmsCmsCm;

(332) Sense strand: GfsGmsGfCmUfGmAfGmCfUfUfUmAfAmAfAmUfGmGfUmUf-GALNAC; Antisense strand: AmsAfsCmCfAmUfUmUfUmAfAmAmGmCfUmCfAmGfCmCfCmsCmsAm;

(333) Sense strand: GfsCmsUfGmAfGmCfUmUfUfAfAmAfAmUfGmGfUmUfCmCf-GALNAC; Antisense strand: GmsGfsAmAfCmCfAmUfUmUfUmAmAmAfGmCfUmCfAmGfCmsCmsCm;

(334) Sense strand: CfsCmsUfGmGfCmCfCmUfUfGfAmGfUmGfGmGfGmCfAmGf-GALNAC; Antisense strand: CmsUfsGmCfCmCfCmAfCmUfCmAmAmGfGmGfCmCfAmGfGmsCmsCm;

(335) Sense strand: GfsGmsAfGmGfUmGfCmCfAfGfGmAfAmGfCmUfCmCfCmUf-GALNAC; Antisense strand: AmsGfsGmGfAmGfCmUfUmCfCmUmGmGfCmAfCmCfUmCfCmsAmsCm;

(336) Sense strand: GfsAmsGfGmUfGmCfCmAfGfGfAmAfGmCfUmCfCmCfUmCf-GALNAC; Antisense strand: GmsAfsGmGfGmAfGmCfUmUfCmCmUmGfGmCfAmCfCmUfCmsCmsAm;

(337) Sense strand: CfsUmsCfAmCfUmGfUmGfGfGfGmCfAmUfUmUfCmAfCmCf-GALNAC; Antisense strand: GmsGfsUmGfAmAfAmUfGmCfCmCmCmAfCmAfGmUfGmAfGmsGmsGm;

(338) Sense strand: UfsGmsUfGmGfGmGfCmAfUfUfUmCfAmCfCmAfUmUfCmAf-GALNAC; Antisense strand: UmsGfsAmAfUmGfGmUfGmAfAmAmUmGfCmCfCmCfAmCfAmsGmsUm;

(339) Sense strand: GfsCmsAfUmCfUmAfGmCfCfAfGmAfGmGfCmUfGmGfAmGf-GALNAC; Antisense strand: CmsUfsCmCfAmGfCmCfUmCfUmGmGmCfUmAfGmAfUmGfCmsCmsAm;

(340) Sense strand: UfsUmsUfUmGfUmAfAmCfUfUfGmAfAmGfAmUfAmUfUmUf-GALNAC; Antisense strand: AmsAfsAmUfAmUfCmUfUmCfAmAmGmUfUmAfCmAfAmAfAmsGmsCm;

A, C, G, and U on the left of m represent the pentose group in the nucleotide residue is 2'-methoxyribosyl, Af, Cf, Gf, Uf represent the pentose group in the nucleotide residue is 2'-Fluorine modified ribose group, s represents that the phosphate group between the left and right ribonucleotide residues is a phosphorothioate group; (LNA) represents locked nucleic acid modification; (d) represents deoxyribonucleoside acid; CHO means cholesterol; GALNAC means GalNAc ligand.
A DNA molecule capable of producing the siRNA of any of claims 1-16.
A vector capable of expressing the siRNA of any one of claims 1-16.
A reagent or kit comprising the siRNA according to any one of claims 1-16 or the DNA molecule according to claim 17 or the vector according to claim 18 .
A pharmaceutical composition, consisting of the siRNA molecule described in any one of claims 1-16 and other pharmaceutically acceptable components or pharmaceutically acceptable carriers.
The pharmaceutical composition according to claim 20, wherein the pharmaceutically acceptable other components are water, saline, pH buffer, protective agent, osmotic pressure regulator, excipient, diluent, disintegrating agent disintegrants, binders, lubricants, sweeteners, preservatives or combinations thereof;

The pharmaceutically acceptable carriers are magnetic nanoparticles, carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethyleneimine, polyamidoamine dendrimer, polylysine, chitosan, 1 , 2-dioleoyl-3-trimethylammonium propane, poly-D or L-type lactic acid/glycolic acid copolymer, poly(aminoethylethylene phosphate), or poly(N,N-dimethylmethacrylate) aminoethyl ester).
The pharmaceutical composition according to claim 20 or 21, wherein the dosage form of the pharmaceutical composition is a liquid preparation or a freeze-dried powder injection.
The pharmaceutical composition according to claim 22, characterized in that: the freeze-dried powder for injection is mixed with liquid excipients during administration to prepare a liquid preparation.
The pharmaceutical composition according to claim 22 or 23, wherein the liquid preparation is administered by subcutaneous, intramuscular or intravenous injection, or administered to the lungs by spraying, or administered to other organs by spraying through the lungs tissue, such as the liver.
The siRNA of any one of claims 1-16 or the DNA molecule of claim 17 or the vector of claim 18 or the reagent or kit of claim 19 or any of claims 20-24 Application of the pharmaceutical composition in inhibiting the expression of PCSK9 gene, or preparing a product for inhibiting the expression of PCSK9 gene.
The siRNA of any one of claims 1-16 or the DNA molecule of claim 17 or the vector of claim 18 or the reagent or kit of claim 19 or any of claims 20-24 Application of the described pharmaceutical composition in reducing the concentration of low-density lipoprotein and/or low-density lipoprotein cholesterol in serum, or preparing a product for reducing the concentration of low-density lipoprotein and/or low-density lipoprotein cholesterol in serum.
The siRNA of any one of claims 1-16 or the DNA molecule of claim 17 or the vector of claim 18 or the reagent or kit of claim 19 or any of claims 20-24 The application of the pharmaceutical composition in the prevention and/or treatment of diseases mediated by PCSK9 gene, or the preparation of products for the prevention and/or treatment of diseases mediated by PCSK9 gene;
The siRNA of any one of claims 1-16 or the DNA molecule of claim 17 or the vector of claim 18 or the reagent or kit of claim 19 or any of claims 20-24 Application of the pharmaceutical composition in relieving symptoms of diseases mediated by PCSK9 gene, or preparing a product for relieving symptoms of diseases mediated by PCSK9 gene.
The use according to claim 27 or 28, wherein: the diseases mediated by PCSK9 gene include cardiovascular diseases or tumor diseases; the cardiovascular diseases such as mammalian hyperlipidemia, hypercholesterolemia disease, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia or heterozygous familial hypercholesterolemia; the neoplastic diseases such as Melanoma or metastatic liver cancer associated with PCSK9.
A method for inhibiting or reducing the expression level of cell PCSK9 gene in vivo or in vitro, comprising introducing into a cell the siRNA described in any one of claims 1-16 or the DNA molecule described in claim 17 or the vector described in claim 18 or The agent of claim 19 or the pharmaceutical composition of any one of claims 20-24, such that PCSK9 gene expression level is inhibited or reduced by at least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, at least 5%.
The method according to claim 30, wherein the in vitro cells are mammalian cells expressing PCSK9, preferably primate cells, such as human cells; the in vivo cells are in primates, such as humans;

Further, the in vitro cells are derived from brain, salivary gland, heart, spleen, lung, liver, intestinal tract or tumor, preferably liver cancer cells or cervical cancer cells, more preferably Hela cells or HEP3B cells or 293T cells.
The method according to claim 30 or 31, wherein in the in vitro method, the working concentration of the siRNA molecule is 0.1-1000 nM, preferably 0.1-50 nM or 10-50 mM.
A method of alleviating or treating a disease or condition mediated by a PCSK gene in a subject, comprising administering to the subject an effective amount of the siRNA of any one of claims 1-16.
The method of claim 33, wherein the disease or symptom comprises cardiovascular disease, dyslipidemia;

The cardiovascular disease includes atherosclerotic cardiovascular disease; the dyslipidemia includes elevated serum cholesterol and/or triglyceride levels, elevated low-density lipoprotein cholesterol or elevated apolipoprotein B;

Preferably, the disease or symptom is hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia , or heterozygous familial hypercholesterolemia.
The method of claim 33 or 34, wherein the subject is a mammal, preferably a human.
A method of combined therapy, comprising: co-co-combining one or more of the siRNAs described in any one of claims 1-16 or the pharmaceutical composition of any one of claims 20-24 with one or more other therapeutic agents administered or used in conjunction with other treatments.
The method of claim 36, wherein the other therapeutic agent comprises an agent known to prevent, alleviate or treat lipid disorders, analgesic, anti-inflammatory or antineoplastic;

Such other treatment methods include radiation therapy, immunotherapy, hormonal therapy or surgery.