KR20160147674A - STAT3 gene-specific siRNA, double-stranded oligo RNA molecules comprising the siRNA, composition comprising the same and use thereof - Google Patents

Abstract

The present invention relates to breast cancer-related gene-specific siRNA, a high efficiency double-stranded oligo RNA structure including the same, and a pharmaceutical composition including the same for preventing or treating cancer. More specifically, the present invention relates to STAT3 gene-specific siRNA; a double-stranded oligo RNA structure including the same, and having a structure in which a hydrophilic material and a hydrophobic material are combined by using a simple covalent bond or a linker-mediated covalent bond in both ends of double helix RNA (siRNA) to be effective transferred into cells; a nano-particle capable of being produced by hydrophobic interaction of the double helix oligo RNA structure in a solution; a method for producing the double helix oligo RNA structure; and a pharmaceutical composition including the double helix oligo RNA structure for preventing or treating cancer, specifically, breast cancer, skin diseases, or inflammatory diseases. The STAT3 gene-specific siRNA and the composition including a double helix oligo RNA structure including the same for treating cancer, skin diseases, or inflammatory diseases inhibits the expression of STAT3 at high efficiency without causing side effects, so an effect in treating cancer, specifically, breast cancer, skin diseases including psoriasis, or inflammatory diseases can be ensured. Accordingly, the STAT3 gene-specific siRNA and the composition can be useful in treating breast cancer, skin disease, or inflammatory diseases which are currently difficult to be treated because there is not a suitable treating agent.

Description

STAT3 gene-specific siRNA, a double-stranded oligo RNA construct comprising such siRNA, a composition comprising the same, and a use thereof, including a STAT3 gene-specific siRNA, a double stranded oligo RNA molecule comprising the siRNA,

The present invention relates to a STAT3 gene-specific siRNA, a high-efficiency double-stranded oligo RNA construct comprising the same, a pharmaceutical composition comprising the same, and more particularly to a STAT3 gene-specific siRNA, A double-stranded oligo RNA structure having a structure in which a hydrophilic substance and a hydrophobic substance are bonded at both ends of a double-stranded RNA (siRNA) using a simple covalent bond or a linker-mediated covalent bond, Lt; RTI ID = 0.0 > oligosaccharide < / RTI > structures.

The present invention also relates to a method for preparing the double-stranded oligo RNA construct and a pharmaceutical composition comprising the double-stranded oligo RNA construct and the use thereof.

Techniques to inhibit the expression of genes are important tools in the development of therapeutic agents for the treatment of disease and in the target validation. Among these techniques, RNA interference (hereinafter referred to as 'RNAi') has been found to act on sequence-specific mRNAs in a wide variety of mammalian cells since its discovery (see Silence of the transcripts: RNA interference in medicine. J Mol Med (2005) 83: 764-773). When a double strand of RNA of a long chain is transferred to a cell, the double strand of the transferred RNA is inserted into a short interfering RNA (short interfering RNA) processed with 21-23 base pairs (bp) by endonuclease Dicer RNA (hereinafter referred to as "siRNA"), siRNA is bound to an RNA-induced silencing complex (RISC), and a guide (antisense) strand recognizes and degrades a target mRNA, (NUCLEIC-ACID THERAPEUTICS: BASIC PRINCIPLES AND RECENT APPLICATIONS, Nature Reviews Drug Discovery, 2002. 1, 503-514).

According to the Bertrand researchers, siRNAs against the same target gene are superior to the antisense oligonucleotide (ASO) in inhibiting mRNA expression in vivo / in vitro (in vitro and in vivo) (Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo. Biochem. Biophys. Res. Commun. 2002. 296: 1000-1004). In addition, since the action mechanism of siRNA binds complementarily to the target mRNA and regulates the expression of the target gene in a sequence-specific manner, the target that can be applied compared to the conventional antibody-based drug or chemical (small molecule drug) (Progress Towards in Vivo Use of siRNAs. MOLECULAR THERAPY 2006 13 (4): 664-670).

Despite the excellent effects of siRNA and its various uses, in order for siRNA to be developed as a therapeutic agent, the stability of siRNA in the body and the improvement of cell delivery efficiency are required to effectively transfer siRNA to target cells (Harnessing in vivo siRNA delivery for drug discovery and therapeutic development. Drug Discov Today. 2006 Jan; 11 (1-2): 67-73).

In order to solve the above problem, in order to improve the stability of the body, some nucleotides or backbone of siRNA may be modified to have a nucleolytic enzyme resistance, viral vector, liposome or nanoparticle And the use of the carrier of the present invention have been actively studied.

Delivery systems using viral vectors such as adenoviruses and retroviruses have high transfection efficiency but high immunogenicity and oncogenicity. On the other hand, the non-viral delivery system containing nanoparticles has a lower cell delivery efficiency than the viral delivery system, but has higher safety in vivo, And it has an advantage that it has high cytotoxicity and immune stimulation as well as an improved delivery effect such as uptake and internalization of RNAi oligonucleotides contained in cells or tissues (J Clin Invest 2007 December 3; 117 (12): 3623-3632). In addition, viral delivery of synthetic siRNAs in vivo has been evaluated as a promising delivery method compared to viral delivery systems.

In the non-viral delivery system, nanocarriers are used to form nanoparticles by using various polymers such as liposomes and cationic polymer complexes, and to form siRNAs into nanoparticles, that is, nanocarriers And then transferred to cells. Among the methods using nano-carriers, polymeric nanoparticles, polymer micelles, lipoplex, etc. are mainly used. Among them, lipoflex method is composed of cationic lipids, 15: 93 (21): 11493-8, < / RTI > which interacts with the anionic lipids of the endosome of the endosome, 1996).

In addition, it is possible to induce high efficiency in vivo by linking chemicals to the end portions of the siRNA passenger sense strand to have enhanced pharmacokinetics characteristics (Nature 11; 432 (7014): 173-8, 2004). At this time, the stability of the siRNA depends on the nature of the chemical attached to the end of the siRNA sense (passenger) or antisense (guide) strand. For example, a siRNA in the form of a conjugated polymer such as polyethylene glycol (PEG) interacts with an anionic phosphate group of a siRNA in the presence of a cationic material to form a complex, thereby improving siRNA stability (J Control Release 129 (2): 107-16, 2008). In particular, micelles composed of polymer complexes have a very small distribution and are formed spontaneously with a very small size compared with other systems used as drug delivery carriers, such as microspheres or nanoparticles It is easy to secure the quality control and reproducibility of the preparation.

In order to improve the intracellular delivery efficiency of the siRNA, a hydrophilic substance (for example, polyethylene glycol (PEG)), which is a biocompatible polymer, is attached to the siRNA by a simple covalent bond or a linker-mediated covalent bond , A technique for securing stability of siRNA and effective cell membrane permeability has been developed (Korean Patent No. 883471). However, the chemical modification of siRNA and the conjugation of polyethylene glycol (PEG) alone still have disadvantages in that the stability in vivo and delivery to the target organ is not smooth. To overcome this disadvantage, a double-stranded oligo RNA structure in which a hydrophilic and a hydrophobic substance are bonded to a double-stranded oligo RNA such as an oligonucleotide, in particular siRNA, has been developed. The structure has a self assembled micelle (SAMiRNATM inhibitory RNA) (see Korean Patent No. 1224828). SAMiRNATM technology is capable of obtaining homogenous nanoparticles with a very small size compared to conventional delivery techniques .

On the other hand, in Korea, one in four people die from cancer (the first cause of death), and the number is growing year by year due to the development of diagnostic methods and data collection methods, population aging and environmental changes. In addition, global cancer and cancer-related deaths are on the rise, and preventive, diagnostic and therapeutic technologies for cancer reduction are urgent issues common to all human beings (BT technology trend report, new drug development trends by major diseases, , 2007, Volume 72).

Cancer is one of the most deadly diseases worldwide, and the development of innovative cancer treatments can create high added value while reducing the cost of medical care. The treatment of cancer is divided into surgery, radiotherapy, chemotherapy, and biological treatment. Among them, chemotherapy is a chemical substance that suppresses or kills the cancer cell proliferation. Since the toxicity caused by the anticancer drug appears in the normal cells, , And it is necessary to develop an anticancer agent that selectively acts on cancer cells and does not develop resistance because the anticancer agent exhibits the effect that the effect is lost after a certain period of use even if the anticancer agent is effective (Biowave 2004, 6 (19)). Recently, a new anticancer drug targeting the molecular characteristics of cancer has been developed through the securing of molecular genetic information on cancer, and anticancer drugs aiming at characteristic molecular targets possessed only by cancer cells have been developed, There is also a report that does not occur. Therefore, it is possible to develop a therapeutic agent which is more effective than conventional anticancer drugs and has less side effects through the development of gene therapy agents targeting characteristic molecular targets having only cancer cells.

Psoriasis is a chronic autoimmune inflammatory skin disorder characterized by epidermal hyperplasia of keratinocytes and endothelial cells, and inflammatory cell accumulation (such as activated T cells) (Griffiths CE, J. Eur. Acad. Dermatol. 17 Suppl 2: 1-5; Creamer JD, et al., Clin. Exp Dermatol 1995, 20 (1): 6-9). (NK) and NK T cells in the pathogenesis of psoriasis because they produce interferon-gamma (IFN-γ), which has been shown to play a role in psoriatic keratinocyte proliferation Bos JD, et al., Br J. Dermatol 2005, 152 (6): 1098-107). Recently, interleukin-23, interleukin 17 and STAT3 genes have been reported to be crucially involved in the development of psoriasis (Role of IL-23 in the immunopathogenesis of psoriasis, F1000 Biol. Rep. Vol. -17 in psoriasis and psoriatic arthritis, Clin. Rev. Allergy Immunol. 2013. 44 (2) pp. 183-193; Stat3 links activated keratinocytes and immunocytes required for development of psoriasis in a novel transgenic mouse model, Nature Medicine. Vol. 11, 2005. Pp. 43-49; Stat3 as a therapeutic target for the treatment of psoriasis: a clinical feasibility study with STA-21, a stat3 inhibitor, J. Invest. Dermatol. 117). Clinically, the main symptom of psoriasis is a gray or silver flaky patch on the skin that is red and inflamed below. (IL-23, IL-17 axis, no STAT3 and psoriasis)

Psoriasis is a chronic autoimmune inflammatory skin disorder characterized by epidermal hyperplasia of keratinocytes and endothelial cells, and inflammatory cell accumulation (such as activated T cells) (Griffiths CE, J. Eur. Acad. Dermatol. 17 Suppl 2: 1-5; Creamer JD, et al., Clin. Exp Dermatol 1995, 20 (1): 6-9). Psoriasis is characterized by abnormal and rapid growth of the epidermal layer of the skin. This abnormal production of skin cells generally causes the skin cells to be produced every 28 to 30 days, whereas psoriasis is replaced every 3 to 5 days. These changes appear to be mainly due to the proliferation of immature keratinocytes by the increase of endothelial cells in immune cells including dendritic cells, macrophages and T cells, These immune cells, which have been transferred from the cells to the epithelial cells, are called TNF-α, interleukin-1β, IL-1β, interleukin-6, interleukin- 36) and interleukin-22 (IL-22), and these cytokines have been reported to stimulate the proliferation of keratinocytes (Nestle FO et al., N Engl J Med. 2009; 361 (5): 496-509; Baliwag, Jaymie et al., Cytokine, 2015; 73 (2): 342-350). In particular, dendritic cells connect the innate immune system to the adaptive immune system, and T cells that induce psoriasis migrate to the epithelial cells and produce interleukin-17 (IL-17) and interferon-gamma (IFN-γ) IL-22 stimulates production of interleukin-22 (IL-22) and interleukin-17 (IL-17), and interleukin-23 (IL- 17) and can exacerbate psoriasis by stimulating keratinocytes (Ouyang W., Cytokine Growth Factor Rev. 2010; 21 (6): 435-41; Mudigonda P et al., Dermatol Online J. 2012; 18 (10): 1) .

Recently, it has been reported that the STAT3 gene is crucially involved in the development of psoriasis (Stat3 links activated keratinocytes and immunocytes required for development of a novel transgenic mouse model, Nature Medicine. Vol. ; Stat3 as a therapeutic target for the treatment of psoriasis: a clinical feasibility study with STA-21, a stat3 inhibitor, J. Invest. Dermatol., Vol.131, 2011. pp. 108-117). Clinically, the main symptom of psoriasis is a gray or silver flaky patch on the skin that is red and inflamed below.

Common treatments for psoriasis include topical, phototherapy, and underwear medication. Topical treatments are treatments that include steroids, coal tar, anthralin, vitamin D3 and its analogs, retinoids, sunburn, etc. These topical treatments have side effects of skin thinning, stretch marks, burns, irritation and photosensitivity.

The medication used for medication is to treat psoriasis through immunosuppression or inhibition of inflammation. Many psoriasis treatments developed so far do not fundamentally treat psoriasis and only provide a temporary relief of symptoms, In the case of using the drug for a long period of time, the immune function of the human body may be lowered because of suppressing the immunity of the human body, which may cause various infectious diseases including cancer and tuberculosis.

The term atopy is a term with the meaning of "strange" or "inappropriate" in its etymology. Atopic dermatitis is a relatively common chronic inflammatory skin disease that occurs in infancy and childhood and recurs and resolves. It can be diagnosed by three characteristics of atopic individual or family history, severe itching, and eczema. Infection, mental stress, It can be aggravated by seasonal and climate change, irritation and allergies. The pathogenesis of atopic dermatitis has not yet been elucidated. However, according to the present study, it has been reported that the IgE antibody is increased by a hyperactivation reaction, or a functional defect due to the fracture differentiation of T lymphocyte, And blocking the adrenergic receptors present in the skin. Therefore, atopic dermatitis is thought to be a genetic disorder involving immunological abnormalities. Recently, the STAT3 gene has been reported to affect the development of atopic dermatitis (STAT3 mutations reveal a role for STAT3 signaling in mast cell degranulation, J. Allergy and Clinical Immunology, Vol. Pp. 1388-1396).

For the treatment and management of atopic dermatitis, it is common to prescribe a steroid hormone, that is, a topical corticosteroid preparation, at the same time in order to improve the inflammatory reaction, together with a moisturizing agent that maintains the moisture of the skin surface in most dermatological treatments. However, the use of topical corticosteroids for a long period of time causes various skin side effects such as skin atrophy, vasodilation, pigment desalination, and swelling ancestry. In addition, patients with severe atopic dermatitis may be treated with appropriate light therapy such as ultraviolet light therapy, interferon gamma, immunosuppressants such as cyclosporin, and intravenous immunoglobulin. Therefore, there is a constant need for the development of atopic treatment raw materials and pharmaceuticals having anti-inflammatory effects without exhibiting such side effects.

Allergic dermatitis is a recurrent eczema lesion with a strong itching that is chronic. Rashes are more likely to appear on the face, neck, flexion areas of the elbows or knees, and may spread throughout the body when the deterioration becomes worse. The number of patients with allergic dermatitis is increasing year after year due to changes in dietary habits and an increase in various allergens, and the symptoms thereof are also becoming severe. Treatment of allergic dermatitis is mainly drug therapy, such as adrenocortical steroids, immunosuppressants, and antihistamines. With these drugs, the symptoms are relieved or the inflammation is irritated, but it is only temporary. In addition, adrenocortical steroids and immunosuppressants are known to have side effects of infection or poisoning.

Therefore, the present therapeutic agent for allergic dermatitis is not sufficiently satisfactory in terms of the effect and the side effect reduction.

In addition, rheumatoid arthritis, degenerative arthritis (Korean Publication No. 10-2014-0032925), osteoporosis, hyperimmunoglobulinemia, anemia, nephritis, chronic thyroiditis, Crohn's disease, pancreatitis, etc. (Korean Publication No. 10-1416149) And the like can be objects of prevention and treatment according to the present invention.

Since it is known that RNA interference can be used to inhibit gene expression with high specificity and efficiency, siRNAs targeting various genes have been studied as therapeutic agents against cancer. These genes include oncogenes, anti-apoptotic molecules, telomerase, growth factor receptor genes, signaling molecules, and the like. (RNA interference in cancer. Biomolecular Engineering. 2006; 23: 17-34). It is important to inhibit the expression of genes necessary for survival and to induce apoptosis.

STAT3 (signal transducer and activator of transcription 3) is a transcription factor that promotes transcription by transferring various growth factors and cytokine signals outside the cell to the nucleus. In this state, the tyrosine residue of the transactivation domain is phosphorylated and activated and enters the nucleus (STAT3 inhibitors for cancer therapy: Have all roads been explored? Jak-Stat. 2013; 1; 2 (1): e22882). The phosphorylated STAT3 (p-STAT3) binds to nuclear DNA to induce the expression of a wide range of target genes related to tumorigenesis such as proliferation and differentiation of cells, (Role of STAT3 in cancer metastasis and translational advances. BioMed research international. 2013; 2013: 421821).

However, transcription factors such as STAT3 have been regarded as undruggable in the field of traditional synthetic drug development because they have difficulty finding targets that could impair their activity on the tertiary structure of the protein (Transcription Factor STAT3 as a Molecular Target for Cancer Prevention. Cancers, 2014; 16; 6 (2): 926-57). Therefore, the market demand for siRNA therapeutic agent and its delivery technology which can inhibit the expression of STAT3 is very high.

Accordingly, the present inventors have made intensive efforts to solve the above-mentioned problems. As a result, the present inventors have found that siRNA specific to STAT3 gene can specifically inhibit the activity of STAT3 gene, and a double helix oligo RNA structure containing the same, The present inventors have completed the present invention by confirming that the anticancer effect, the skin disease and the inflammatory disease treatment effect are excellent .

DISCLOSURE OF THE INVENTION An object of the present invention is to provide a novel siRNA capable of inhibiting its expression at a very high efficiency which is specific to STAT3 and a double helix oligo RNA structure comprising the same, And a method for producing the same.

It is another object of the present invention to provide a pharmaceutical composition comprising the STAT3-specific siRNA or a double-stranded oligo RNA construct comprising such siRNA as an active ingredient.

It is another object of the present invention to provide a method for preventing or treating cancer, skin disease or inflammatory disease using STAT3-specific siRNA or double-stranded oligo RNA construct comprising such siRNA.

In order to achieve the above object, the present invention provides a STAT3-specific siRNA comprising a sense strand comprising any one of the sequences selected from SEQ ID NO: 1 to SEQ ID NO: 200 and an antisense strand comprising the complementary sequence to provide.

&Quot; STAT3 specific siRNA " in the present invention means siRNA specific to the gene encoding the STAT3 protein.

Also, as long as the specificity for STAT3 is retained, the sense strand comprising the sequence according to SEQ ID NO: 1 to SEQ ID NO: 200 to SEQ ID NO: 200, or the complementary antisense strand thereof, comprises a sequence in which one or more bases are substituted, deleted, It will be apparent to those skilled in the art that STAT3 specific siRNAs including sense and antisense strands are also included in the scope of the present invention.

SEQ ID NO: 1 to SEQ ID NO: 200 are sense strand sequences of STAT3 specific siRNA.

In the present invention, if the sense strand or the antisense strand of the siRNA can function as an siRNA, the number of nucleotides is not limited, but is preferably 19 to 31 nucleotides.

In the present invention, the siRNA preferably comprises a sense strand of STAT3-specific siRNA according to SEQ ID NOs: 12, 17, 42, 101, 108, 114, 119, 137, 141, 166, 170, And more preferably a sense strand of the STAT3 specific siRNA according to SEQ ID NOS: 17, 42, 101, 119, 137, and most preferably, , And sense strand of STAT3-specific siRNA according to SEQ ID NO: 137.

The STAT3-specific siRNA provided in the present invention has a nucleotide sequence designed to be complementary to mRNA encoding the gene, and thus can effectively suppress the expression of the gene. Also, it may comprise an overhang which is a structure comprising one or more unpaired nucleotides at the 3 'end of the siRNA.

In the present invention, the siRNA may include various modifications for enhancing nucleic acid degradation resistance and non-specific immune responses for improving the in vivo stability. The modification of the siRNA is such that, at the 2'carbon position of the sugar structure in one or more nucleotides, the -OH group is replaced by -CH ₃ (methyl), -OCH ₃ (methoxy), -NH ₂ , -F (fluorine) Propyl, -O-2-methylthioethyl, -O-3-aminopropyl, -O-3-dimethylaminopropyl, -ON-methylacetamido or -O- Deformation by substitution with dimethylamidooxyethyl; A modification in which the oxygen in the sugar structure in the nucleotide is replaced by sulfur; Or a nucleotide bond, phosphorothioate or boranophosphate, or a modification with a methyl phosphonate bond, may be used in combination, and PNA (peptide nucleic acid), PNA Modifications to LNA (locked nucleic acid) or UNA (unlocked nucleic acid) forms are also possible (Ann. Rev. Med., 55, 61-65 2004; US 5,660,985; US 5,958,691; US 6,531,584; US 5,808,023; US 6,326,358 Nucleic Acid Res. 31: 589-595, 2003; Nucleic Acids Research, 38 (17) (2003); U.S. Patent No. 6,175,001; Bioorg. Med. Chem. Lett. 14: 1139-1143, 2003; Nucleic Acids Research, 39 (5) 1823-1832, 2011).

STAT3 specific siRNA provided by the present invention not only inhibits the expression of the gene but also significantly inhibits expression of the protein. In addition, it is known to enhance the sensitivity of radiation or chemotherapy, which is a typical combination therapy with cancer-specific RNAi used in the treatment of cancer (The Potential RNAi-based Combination Therapeutics. Arch Pharm Res 34 ): 1-2, 2011), it will be apparent to those skilled in the art that the STAT3-specific siRNA of the present invention can be used in combination with conventional radiation or chemotherapy.

In another aspect of the present invention, there is provided a conjugate in which a hydrophilic substance and a hydrophobic substance are conjugated at both ends of siRNA for efficient delivery and stability of breast cancer-associated gene, particularly STAT3-specific siRNA, in vivo.

In the case of an siRNA conjugate in which a hydrophilic substance and a hydrophobic substance are bonded to siRNA, self-assembled nanoparticles are formed by hydrophobic interaction of the hydrophobic substance (refer to Korean Patent Registration No. 1224828) And it has an advantage that the manufacturing process as a drug is simple (see WO2015002511) because it is extremely excellent in stability in the body, and the particle size is very uniform through improvement of the structure, and QC (Quality control) is easy.

In one preferred embodiment, the double-stranded oligo RNA construct comprising the STAT3-specific siRNA according to the present invention preferably has a structure as shown in the following structural formula (1).

(A _m -J) _n -XRYB ????? (1)

Wherein A is a hydrophilic monomer, B is a hydrophobic substance, J is a hydrophilic monomer or m hydrophilic monomer and m is a linker connecting oligonucleotides to each other, n is a hydrophilic monomer, m is a hydrophilic monomer, m X and Y are each independently a simple covalent bond or a linker mediated covalent bond, R is a STAT3 specific siRNA, and m is an integer of 1 to 10, 6, n is an integer of 1 to 10, preferably 4.

As long as the STAT3 specificity is maintained, the STAT3-specific siRNA can be used not only when the antisense strand of the siRNA is perfectly complementary to the binding site of the STAT3 gene, i.e., a perfect match, (Mismatch) is included. Such siRNA is preferably 70% or more, more preferably 80% or more, still more preferably 90% or more, still more preferably 95% or more, and most preferably 100% or more, of the mRNA sequence of the STAT3 gene. Of the nucleotide sequence of SEQ ID NO: 1.

Such siRNAs can be duplexes and can also include single-molecule polynucleotides, but are not limited to antisense oligonucleotides or microRNAs (miRNAs).

More preferably, the double-stranded oligo RNA construct comprising STAT3-specific siRNA according to the present invention has the structure of structure (2) below.

(A _m -J) _n -XSYB ????? (2)

         AS

Wherein S is the sense strand of the STAT3 specific siRNA, AS is the antisense of the STAT3 specific siRNA, and A is the same as defined in the above formula (1) Strand.

More preferably, the double-stranded oligo RNA construct comprising STAT3-specific siRNA has the structure of structure (3) below.

(A _m -J) _n -X-5 'S 3'-YB Structural formula (3)

3 'AS 5'-PO ₄

One to three phosphate groups may be bonded to the 5 'terminal of the antisense strand of the double-stranded oligo RNA construct comprising the STAT3-specific siRNA in the structural formulas (1) to (3) It will be apparent to those skilled in the art that shRNA may be used instead of siRNA.

The hydrophilic monomer (A) in the structural formulas (1) to (3) can be used in any of the monomers of the nonionic hydrophilic polymer as long as it meets the object of the present invention. Monomers selected from the compounds (1) to (3) described above, more preferably monomers of the compound (1) can be used and in the compound (1) G is preferably selected from CH ₂ , O, S and NH And more preferably O is used.

The preferred hydrophilic material monomer structure Compound (1) The compound (2) Compound (3)

G는 CH₂, O, S 또는 NH

G is CH ₂ , O, S or NH

A, which is a hydrophilic monomer contained in each hydrophilic substance block, and J which is a linker may be the same or different between the respective hydrophilic substance blocks. That is, when three hydrophilic material blocks are used (n = 3), the hydrophilic monomer according to the compound (1), the hydrophilic monomer according to the compound (2) Any hydrophilic substance monomer may be used for each hydrophilic substance block depending on the block of the hydrophilic substance according to the compound (3), or any hydrophilic substance monomer selected from the hydrophilic substance monomers according to the compounds (1) to (3) One hydrophilic material monomer may be used equally. Likewise, the linker that mediates the bonding of the hydrophilic material monomer may also use the same linker for each hydrophilic material block, or a different linker for each hydrophilic material block may be used.

The hydrophobic substance (B) in the structural formulas (1) to (3) plays a role of forming nanoparticles composed of the oligonucleotide structure according to the structural formula (1) through hydrophobic interaction.

In the present invention, the hydrophobic material is preferably a molecular weight of 250 to 1,000, steroids (steroid) derivatives, glycerides (glyceride) derivatives, glycerol ethers (glycerol ether), polypropylene glycol (polypropylene glycol), C ₁₂ to It includes C ₅₀ unsaturated or saturated hydrocarbon (hydrocarbon), the diacyl phosphatidylcholine (diacylphosphatidylcholine), fatty acid (fatty acid), phospholipid (phospholipid), lipoic polyamine (lipopolyamine) may be used, but not limited to, an object of the present invention It is obvious to those skilled in the art that any hydrophobic material can be used as long as it conforms to the present invention.

In the present invention, the steroid derivative may be selected from the group consisting of cholesterol, cholestanol, cholic acid, cholestearyl formate, cortestanyl formate and cholestanyl amine, Mono-, di- and tri-glycerides, wherein the fatty acid of the glyceride is preferably a C ₁₂ to C ₅₀ unsaturated or saturated fatty acid.

Particularly, among the above-mentioned hydrophobic substances, saturated or unsaturated hydrocarbons and cholesterol are preferable in that they have an advantage that they can be easily bonded in the synthesis step of the oligonucleotide structure according to the present invention.

The hydrophobic substance is bound to the distal end of the hydrophilic substance and may be bonded to any position of the sense strand or the antisense strand of the siRNA.

The STAT3-specific siRNA and the hydrophilic substance or the hydrophobic substance in the structural formulas (1) to (3) according to the present invention are bound by a simple covalent bond or a linker-mediated covalent bond (X or Y). The linker that mediates the covalent bond is not particularly limited as long as it is covalently bonded at the terminal of a hydrophilic substance or a hydrophobic substance to the end of a STAT3 specific siRNA, and if necessary, can be decomposed in a specific environment. Thus, the linker may be any compound that binds to activate the STAT3 specific siRNA and / or hydrophilic material (or hydrophobic material) during the manufacture of the double helix oligo RNA construct according to the present invention.

In the present invention, the covalent bond may be either a non-degradable bond or a decomposable bond. Examples of the non-degradable bond include an amide bond or a phosphorylated bond, and the decomposable bond includes a disulfide bond, an acid-decomposable bond, an ester bond, an anhydride bond, a biodegradable bond, or an enzyme degradable bond. .

STAT3-specific siRNAs represented by R (or S and AS) in the above structural formulas (1) to (3) can be used without limitation as long as they are capable of specifically binding to STAT3, Preferably, the present invention is characterized by comprising a sense strand comprising any one of the sequences selected from SEQ ID NO: 1 to SEQ ID NO: 200 and an antisense strand comprising a complementary sequence thereto.

In the present invention, the siRNA preferably comprises a sense strand of the STAT3-specific siRNA according to SEQ ID NOs: 12, 17, 42, 101, 108, 114, 119, 137, 141, 166, 170, More preferably a sense strand of the STAT3 specific siRNA according to SEQ ID NOS: 17, 42, 101, 119 and 137, most preferably a sense strand of the STAT3 specific siRNA according to SEQ ID NOS: 42, 101 and 137 And may be characterized by comprising:

On the other hand, the tumor tissue is very solid and has diffusion-limitation as compared with normal tissues. Such diffusion restriction adversely affects the movement of waste matter such as nutrients, oxygen and carbon dioxide necessary for tumor growth, It overcomes the diffusion limitation by forming blood vessels around by angiogenesis. The blood vessels in the tumor tissue formed through angiogenesis have leaky and defective blood vessels with a gap of about 100 nm to 2 [mu] m, depending on the type of tumor. Therefore, the nanoparticles pass through the capillary endothelium of the cancer tissue including the loose vascular structure in comparison with the capillary blood vessels of the normal tissue, so that the access to the tumor interstitium is facilitated during circulation in the blood , And lymphatic drainage in the tumor tissue, which is called the enhanced permeation and retention (EPR) effect. The nanoparticles are referred to as passive targeting in which the tumor tissue-specific delivery of nanoparticles is effected by this effect (Nanoparticles for drug delivery in cancer treatment. Urol. Oncol. 2008 Jan-Feb; 26 (1): 57-64 ). Active targeting refers to the case where the targeting moiety is bound to nanoparticles and the nanoparticles are either preferential accumulation in the target tissue or internalization in which the nanoparticles are transferred into the target cell ) Have been reported to improve the localization of tumor necrosis factor (a targeting ligand influenced by nanoparticle tumor localization or uptake Trends Biotechnol 2008 Oct; 26 (10): 552-8. Active targeting uses a targeting moiety (targeting moiety) capable of binding to carbohydrates, receptors, and antigens that are specific or over-expressed on the target cell surface (Nanotechnology in cancer Therapeutics: bioconjugated nanoparticles for drug delivery. Mol Cancer Ther 2006; 5 (8): 1909-1917).

Therefore, if the double-stranded oligo RNA construct comprising the STAT3-specific siRNA according to the present invention and the targeting moiety are provided in the nanoparticles formed therefrom, the delivery to the target cell can be efficiently promoted, It can be transferred to target cells to exhibit high target gene expression control function and prevent the transfer of nonspecific STAT3 specific siRNA to other organs and cells.

Accordingly, the present invention relates to receptors for promoting internalization of target cells via ligands (L), particularly receptor-mediated endocytosis (RME), to structures according to structural formulas (1) to (3) A double helix oligo RNA structure in which a ligand having a specific binding characteristic is additionally bound, and a ligand conjugated to a double helix RNA structure according to the structural formula (1) Have the same structure.

(Li-Z) - (A _m -J) _n -XRYB ????? (4)

Wherein L, A, B, J, m, n, X and Y are the same as defined in Structural Formulas (1) to (3), and receptor- mediated endocytosis RME), i means an integer of 1 to 5, preferably an integer of 1 to 3, and Z is an integer of 1 to 5, A simple covalent bond or a linker that mediates the coupling of a hydrophilic monomer and a ligand in a hydrophilic block of material.

The ligand in the above formula (4) is preferably a target receptor-specific antibody or aptamer having the property of receptor-mediated endocytosis (RME) that promotes cellular internalization specifically to the target cell , Peptides; Or folate (generally, folate and folic acid are crossing each other, and folic acid in the present invention means folate which is in a natural state or in a state activated in the human body), N-acetyl Galactosamine (NAG But are not limited to, hexose, hexose, glucose, mannose, and other chemical substances such as carbohydrate, but are preferably glucose.

In another aspect of the present invention, the present invention provides a method for producing a double-stranded oligo RNA construct comprising the STAT3-specific siRNA.

The process for preparing a double-stranded oligo RNA construct comprising a STAT3-specific siRNA according to the present invention can be performed, for example,

(1) binding a hydrophilic material based on a solid support;

(2) synthesizing a single strand of RNA based on the solid support to which the hydrophilic substance is bound;

(3) covalently bonding a hydrophobic substance to the 5 'end of the RNA single strand;

(4) synthesizing a single strand of RNA having a sequence complementary to the sequence of the single strand of RNA;

(5) separating and purifying the single-stranded RNA-polymer structure and RNA from the solid support upon completion of synthesis;

(6) preparing a double-stranded oligo RNA structure through annealing of a single strand of RNA having a sequence complementary to the prepared RNA-polymer structure;

. ≪ / RTI >

The solid support in the present invention is preferably a controlled pore glass (CPG), but it is not limited thereto, and in the case of CPG, the diameter is preferably 40 to 180 탆, preferably 500 Å to 3000 Å Do. After the step (5), when the preparation is completed, the purified single strand of the RNA-polymer structure and the single strand of RNA can be checked by MALDI-TOF mass spectrometry to determine whether the desired single-stranded RNA polymer structure and RNA are produced. The step (4) of synthesizing a single strand of RNA having a sequence complementary to that of the single strand of RNA synthesized in the above-mentioned step (2) may be performed before (1) or (1) It can be done in one step.

In addition, a single strand of the RNA containing the single strand and the complementary sequence synthesized in the step (2) may be used in the form that a phosphate group is bonded to the 5 'terminus.

The present invention also provides a method for preparing a double-stranded oligo RNA construct in which a ligand is further bound to a double-stranded oligo RNA structure comprising a STAT3-specific siRNA.

Methods for preparing oligo RNA constructs comprising STAT3 specific siRNAs with ligand binding are described, for example,

(One) Binding a hydrophilic material to a solid support to which a functional group is attached;

(2) Synthesizing a single strand of RNA based on a solid support to which a functional group-hydrophilic substance is bound;

(3) A step of covalently bonding a hydrophobic substance to the 5 'end of the single strand of RNA;

(4) Synthesizing an RNA single strand of a sequence complementary to the sequence of the RNA single strand;

(5) Separating the functional single-stranded RNA of the functional group-RNA-polymer structure and the complementary sequence from the solid support upon completion of the synthesis;

(6) Preparing a ligand-RNA-polymer structure single strand by binding a ligand to the hydrophilic substance end using the functional group;

(7) Preparing a ligand-double helix oligo RNA structure through annealing of a single strand of RNA complementary to the ligand-RNA-polymer structure thus prepared;

. ≪ / RTI >

After the step (6), when the preparation is completed, a single strand of the RNA of the ligand-RNA-polymer structure and complementary sequence is separated and purified and the molecular weight is measured by a MALDI-TOF mass spectrometer to obtain the desired ligand- It is possible to confirm whether or not an RNA is produced. The ligand-double helix oligo RNA structure can be prepared through annealing of a single strand of RNA of sequence complementary to the ligand-RNA-polymer structure produced. The step (4) of synthesizing a single strand of RNA having a sequence complementary to that of the single strand of RNA synthesized in the above-mentioned step (3) is an independent synthesis step, which is performed before (1) or (1) 6). ≪ / RTI >

In another embodiment of the present invention, there is provided a nanoparticle comprising a double stranded oligo RNA construct comprising a STAT3 specific siRNA.

As already mentioned above, the double-stranded oligo RNA construct containing the STAT3-specific siRNA is amphipathic, including both hydrophobic and hydrophilic materials, and the hydrophilic part is formed by interaction with water molecules in the body such as hydrogen bonding Affinity and outward, and hydrophobic materials are directed inward through hydrophobic interactions between them to form thermodynamically stable nanoparticles. That is, a hydrophobic substance is positioned at the center of the nanoparticle, and a hydrophilic substance is positioned outside the STAT3-specific siRNA to form a nanoparticle that protects the STAT3-specific siRNA. The nanoparticles thus formed improve the intracellular delivery of STAT3-specific siRNAs and improve siRNA efficacy.

The nanoparticles according to the present invention may be formed of a double stranded oligo RNA structure containing siRNA having the same sequence or a double stranded oligo RNA structure including siRNA having different sequences , The siRNA comprising the different sequences in the present invention may be another target gene, for example STAT3 specific siRNA, or may have the same target gene specificity and different sequence.

In addition, a double-stranded oligo RNA structure including other cancer-specific target gene-specific siRNA other than the STAT3-specific siRNA may be included in the nanoparticles according to the present invention.

In another aspect, the present invention provides a method for preventing or treating a cancer, a skin disease, or an inflammatory disease comprising a STAT3 specific siRNA, a double helix oligo RNA structure comprising the same, and / or a nanoparticle composed of the double helix oligo RNA structure ≪ / RTI >

The STAT3-specific siRNA according to the present invention, the double-stranded oligo RNA structure containing the STAT3-specific siRNA, and / or the nanoparticle composed of the double-stranded oligo RNA structure as an active ingredient may induce cancer cell proliferation and cancer cell death, Induced cell proliferation and death and induces the activity of the abnormal immune cells, thereby exhibiting the preventive or therapeutic effect of cancer, skin disease or inflammatory disease. Therefore, the STAT3-specific siRNA according to the present invention and the composition containing the same can be used for various types of cancer including breast cancer, breast cancer, lung cancer, pancreatic cancer, colon cancer, liver cancer, prostate cancer, ovarian cancer, It is effective for prevention or treatment of skin diseases and inflammatory diseases including cancer or psoriasis.

Particularly, in the present invention, the composition for preventing or treating cancer comprising the double-stranded oligo RNA construct may comprise any one of the sequences selected from SEQ ID NOS: 1 to 200, preferably SEQ ID NOS: 12, 17, 42, The sequences according to SEQ ID NOS: 17, 42, 101, 119, 137, and most preferably, the sequences according to SEQ ID NOS: 108, 114, 119, 137, 141, 166, 170, A double stranded oligo RNA construct comprising a STAT3 specific siRNA comprising a sense strand comprising a sequence according to SEQ ID NOs: 42, 101, 137 and an antisense strand comprising a sequence complementary thereto .

In addition, an siRNA specific to a cancer, skin disease or inflammatory disease-specific target gene other than STAT3, or a double-stranded oligo RNA structure comprising the siRNA may be further included in the composition according to the present invention.

As described above, a double-stranded oligo RNA construct comprising STAT3-specific siRNA, together with a double-stranded oligo RNA construct comprising siRNA specific to a cancer, skin disease or inflammatory disease-specific target gene other than STAT3 , A skin disease or a composition for the prophylaxis or treatment of an inflammatory disease can be synergistically effected, such as a combination therapy commonly used for the treatment of cancer, a skin disease or an inflammatory disease.

The cancer that can be prevented or treated by the composition according to the present invention can be exemplified by breast cancer, stomach cancer, colon cancer, pancreatic cancer, prostate cancer, liver cancer, ovarian cancer, kidney cancer and lung cancer, Psoriasis, atopic dermatitis, ringworm and allergic skin disease. Examples of inflammatory diseases include rheumatoid arthritis, degenerative arthritis, hyperimmunoglobulinemia, chronic thyroiditis, Crohn's disease and pancreatitis, But is not limited thereto.

The composition of the present invention may further comprise at least one pharmaceutically acceptable carrier in addition to the above-mentioned effective ingredients. Pharmaceutically acceptable carriers should be compatible with the active ingredients of the present invention and may be formulated with one or more of the following ingredients: saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, And if necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, a diluent, a dispersant, a surfactant, a binder, and a lubricant may be additionally added to prepare a formulation for injection, such as an aqueous solution, a suspension or an emulsion. In particular, it is preferable to formulate the composition in a lyophilized form. For the preparation of the lyophilized formulation, a method commonly known in the art may be used, and a stabilizer for lyophilization may be added. Furthermore, it can be advantageously formulated according to each disease or component according to the appropriate method in the art or using the method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.

The content and the manner of administration of the active ingredient and the like contained in the composition of the present invention can be determined by a general practitioner in the art based on the symptom of the ordinary patient and the severity of the disease. It may also be formulated into various forms such as powders, tablets, capsules, liquids, injections, ointments, syrups and the like, and may be provided in unit-dose or multi-dose containers such as sealed ampoules and bottles.

The composition of the present invention can be administered orally or parenterally. The route of administration of the composition according to the present invention may be, but is not limited to, for example, in the form of a parenteral, oral, intravenous, intramuscular, intraarterial, intramedullary, epidural, intracardiac, transdermal, subcutaneous, , Sublingually or topically. The dosage of the composition according to the present invention may vary depending on the patient's body weight, age, sex, health condition, diet, administration time, method, excretion rate or severity of disease, . In addition, for clinical administration, the compositions of the present invention may be formulated into suitable formulations using known techniques.

In the present invention, the STAT3-specific siRNA according to the present invention, the double-stranded oligosaccharide RNA structure comprising the siRNA, the composition comprising the same, or the nanoparticle is used for the preparation of a medicament for the prevention or treatment of cancer, skin diseases or inflammatory diseases Lt; / RTI >

The present invention also relates to a method for the prophylaxis and treatment of cancer, skin diseases or inflammatory diseases, which comprises administration to a patient in need of prevention or treatment of a double helix oligo RNA construct according to the present invention, to provide.

INDUSTRIAL APPLICABILITY The STAT3-specific siRNA according to the present invention, the cancer including the double-stranded oligo RNA structure comprising the STAT3-specific siRNA, the skin disease or the composition for treating an inflammatory disease can inhibit the expression of STAT3 with high efficiency without side effects, Skin diseases or inflammatory diseases, so that they can be very usefully used for the treatment of breast cancer, skin diseases or inflammatory diseases which do not currently have appropriate therapeutic agents.

1 is a schematic diagram of nanoparticles composed of a double helix oligo RNA structure according to the present invention.
Figure 2 is a double-stranded oligo RNA structure comprising siRNA comprising the sequence of SEQ ID NOS: 12, 17, 42, 101, 108, 114, 116, 119, 137, 141, 170 or 171 according to the present invention as a sense strand (Size) and PDI (polydispersity index) of the prepared nanoparticles.
FIG. 3 is a graph showing the inhibition amount of target gene expressed after transforming MCF-7 cell line with siRNA at a concentration of 5 nM having the sequence of SEQ ID NOS: 1 to 200 of the present invention as a sense strand.
FIG. 4 is a graph showing the inhibition amount of target gene expressed by transforming MCF-7 cell line with siRNA at a concentration of 1 nM having the sequence of SEQ ID NOS. 1 to 200 of the present invention as a sense strand.
Figure 5 shows the sequence of SEQ ID NOS: 12, 17, 42, 55, 91, 95, 101, 108, 111, 114, 116, 119, 137, 139, 141, 152, 166, 168, 170 or 171 of the present invention The siRNA of the sense strand was transformed into the MDA-MB-231 cell line at a concentration of 0.2 nM, 1 nM or 5 nM, and then the target gene expression inhibition amount was confirmed.
FIG. 6 is a graph showing the relationship between the siRNAs having the sequence of SEQ ID NOs: 12, 17, 42, 101, 108, 114, 116, 119, 137, 141, 170, or 171 of the present invention as the sense strands at 1.6 pM, 8 pM, The target gene expression inhibition amount was determined after transformation into MCF-7 cell line at a concentration of 200 pM, 1 nM, or 5 nM.
FIG. 7 is a graph showing the relationship between the siRNAs having the sequence of SEQ ID NOs: 12, 17, 42, 101, 108, 114, 116, 119, 137, 141, 170 or 171 of the present invention as a sense strand at 1.6 pM, 8 pM, 40 pM, MB-231 cell line at a concentration of 200 pM, 1 nM, or 5 nM.
8 shows the IC 50 (inhibition concentration 50%) of the siRNA having the sequence of SEQ ID NOs: 12, 17, 42, 101, 108, 114, 116, 119, 137, 141, 170 or 171 of the present invention as a sense strand As a graph, A is the MCF-7 cell line and B is the MDA-MB-231 cell line.
FIG. 9 is a graph showing the results obtained by transforming siRNA of SEQ ID NOs: 17, 42, 101, 119 and 137 of the present invention into the MDA-MB-231 cell line at a concentration of 5 nM or 50 nM, As a graph showing the inhibition amount and thus the cell viability reduction amount, A is a target gene expression inhibiting amount and B is a cell viability decreasing amount.
10 shows a double-stranded RNA construct comprising an siRNA having the sequence of SEQ ID NOS: 12, 17, 42, 101, 108, 114, 116, 119, 137, 141, 170 or 171 of the present invention as a sense strand Is a graph showing the expression inhibition amount of a target gene when MDA-MB-231 cell line is treated with a concentration of 100 nM or 200 nM.
FIG. 11 is a graph showing the effect of the ligand (100 nM, 200 nM, or 500 nM) on the nanoparticles composed of the double-stranded oligo RNA structure including all the siRNAs containing the sequences of SEQ ID NOS: 42, Glucose) in the MDA-MB-231 cell line.
FIG. 12 is a graph showing the results obtained by using the same nanoparticle (SAMiRNA-STAT3-Combo) composed of a double-stranded oligo RNA structure including siRNAs containing SEQ ID NOS: 42, 101 and 137 according to the present invention as a sense strand (Size) and PDI (polydispersity index) of glucose-containing nanoparticles (Glucose-SAMiRNA-STAT3-Combo).
FIG. 13 is a graph showing the effect of siRNA-STAT3-Combo (siRNA-STAT3-Combo) containing double-stranded RNA constructs containing siRNA having SEQ ID NOS: 42, 101 and 137 of the present invention as a sense strand in a mouse breast cancer xenograft model In order to confirm the tumor growth inhibitory effect according to the present invention. PBS, PBS (vehicle) control group; SAMiRNA-CONT, a 5 mg / kg body weight nanoparticle containing siRNA having the sequence of SEQ ID NO: 201 as sense strand control group; (SAMiRNA-CONT-Combo) containing siRNA having the sequence of SAMiRNA-STAT3, SEQ ID NO: 42, 101 and 137 as the sense strand was administered at 1 mg / kg body weight or 5 mg / it means. Two-way ANOVA with Bonferroni postests method was used with GraphPad PRISM5 software (La Jolla, CA) to determine statistical significance, and p <0.05 was considered significant difference between the experimental groups. #, p < 0.05 versus PBS; ###, p < 0.001 versus PBS; *, p < 0.05 versus SAMiRNA-CONT (5 mpk); **, p < 0.01 versus SAMiRNA-CONT (5 mpk); ***, p < 0.001 versus SAMiRNA-CONT (5 mpk)
FIG. 14 is a graph showing the results of measurement of the binding activity of glucose-containing nanoparticles (Glucose-SAMiRNA-STAT3-Combo) as a ligand, including all double-stranded RNA constructs comprising siRNA having SEQ ID NOS: 42, 101, In order to confirm the tumor growth inhibitory effect by the intravenous administration of the mouse breast cancer xenograft model. PBS, PBS (vehicle) control group; Glucose-SAMiRNA-CONT, a 5 mg / kg body weight nanoparticle containing siRNA having the sequence of SEQ ID NO: 201 as a sense strand control group; (Glucose-SAMiRNA-CONT-Combo) containing siRNA having the sequence of SEQ ID NOS: 42, 101 and 137 as a sense strand was added at a concentration of 1 mg / kg body weight or 5 mg / kg body weight Which means the experimental group administered. Two-way ANOVA with Bonferroni postests method was used with GraphPad PRISM5 software (La Jolla, CA) to determine statistical significance, and p <0.05 was considered significant difference between the experimental groups. ###, p < 0.001 versus PBS; ‡‡, p < 0.01 versus Glucose-SAMiRNA-CONT (5 mpk); ‡‡‡, p <0.001 versus Glucose-SAMiRNA-CONT (5 mpk)
FIG. 15 and FIG. 16 are schematic diagrams showing the same nano-particles (SAMiRNA-STAT3-Combo, FIG. 15) including all double-stranded RNA constructs containing siRNA having SEQ ID NOS: 42, To confirm the tumor growth inhibition effect of the intravenous administration of the mouse breast cancer xenograft model of the nanoparticle (Glucose-SAMiRNA-STAT3-Combo, Fig. 16) with glucose attached to the particle as a ligand as a ligand, (A in Figs. 15 and 16) and percentage of body weight to tumor weight ratio (B in Fig. 15 and Fig. 16). PBS, PBS (vehicle) control group; SAMiRNA-CONT, a 5 mg / kg body weight nanoparticle containing siRNA having the sequence of SEQ ID NO: 201 as sense strand control group; (SAMiRNA-CONT-Combo) containing 1 mg / kg body weight or 5 mg / kg body weight of siRNA including all siRNAs having SAMiRNA-STAT3, SEQ ID NOS: 42, 101 and 137 as sense strands; Glucose-SAMiRNA-CONT, a 5 mg / kg body weight nanoparticle containing siRNA having the sequence of SEQ ID NO: 201 as a sense strand control group; (Glucose-SAMiRNA-CONT-Combo) containing siRNA having the sequence of SEQ ID NOS: 42, 101 and 137 as a sense strand was added at a concentration of 1 mg / kg body weight or 5 mg / kg body weight Which means the experimental group administered. One-way ANOVA and Dunnett's multiple comparison test were used with GraphPad PRISM5 software (La Jolla, CA) to determine statistical significance. P <0.05 was considered significant difference between the experimental groups. ##, p < 0.01 versus PBS; *, p < 0.05 versus SAMiRNA-CONT (5 mpk); **, p < 0.01 versus SAMiRNA-CONT (5 mpk); ‡, p < 0.05 versus Glucose-SAMiRNA-CONT (5 mpk).
FIG. 17 is a graph showing the expression of an identified target gene in a HaCaT cell line at a concentration of 50, 100, 200, 500 nM or 1 μM siRNA having the sequence of SEQ ID NO: 42 of the present invention as a sense strand Inhibition graph.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited by these embodiments.

Example  One. Of STAT3  Target sequence design and siRNA  Produce

200 kinds of target nucleotide sequences (sense strands) capable of binding to the mRNA sequence of STAT3 gene (NM_213662) were designed and siRNA of antisense strand, which is a complementary sequence of the target nucleotide sequence, was prepared. First, using a gene design program developed by Bioneer Co. (Turbo si-Designer), a target base sequence capable of binding siRNA in the mRNA sequence of the genes was designed. The siRNA for the STAT3 gene of the present invention is a double stranded structure composed of a sense strand composed of 19 nucleotides and an antisense strand complementary thereto. SiCONT (SEQ ID NO: 201), an siRNA of the sequence not inhibiting the expression of any gene, was prepared. The siRNA was prepared by ligating phosphodiester bonds forming RNA skeletal structure using? -Cyanoethyl phosphoramidite (Nucleic Acids Research, 12: 4539-4557, 1984). Specifically, using a RNA synthesizer (384 Synthesizer, BIONEER, Korea), a series of processes consisting of deblocking, coupling, oxidation and capping on a nucleotide-attached solid support Was repeated to obtain a reaction product containing the desired length of RNA. The reaction product was isolated and purified by HPLC LC918 (Japan Analytical Industry, Japan) equipped with a Daisogel C18 (Daiso, Japan) column, and the RNA was purified using a MALDI-TOF mass spectrometer (Shimadzu, Japan) Respectively. Then, the desired double-stranded siRNA (SEQ ID NOS: 1 to 201) was prepared by binding the sense and antisense RNA strands (see Table 2).

The sense strand sequence of the siRNA according to the invention SEQ ID NO. Target Gene Sequence One STAT3 TGTTCTCTGAGACCCATGA 2 STAT3 TGAGACTTGGGCTTACCAT 3 STAT3 CCGAGCCAATTGTGATGCT 4 STAT3 CTATCTAAGCCCTAGGTTT 5 STAT3 GTGTCTAAAGGTCCCTCAT 6 STAT3 CGTGTCTAAAGGTCCCTCA 7 STAT3 GAATCCCGTGGGTTGCTTA 8 STAT3 CTCAGAGGATCCCGGAAAT 9 STAT3 GGAGGCATTCGGAAAGTAT 10 STAT3 TCACTACTAAAGTCAGGTT 11 STAT3 CTCAAGAGTCAAGGAGACA 12 STAT3 GAGTCAAGGAGACATGCAA 13 STAT3 CTACTAAAGTCAGGTTGCT 14 STAT3 ACGTGTCTGGTTGAGCTCA 15 STAT3 CAGATCATCTGAAACTACT 16 STAT3 CTACTTTAACTTCCAGAAA 17 STAT3 CTTCAGACCCGTCAACAAA 18 STAT3 GGCCCAATGGAATCAGCTA 19 STAT3 GGGAAGAATCACGCCTTCT 20 STAT3 GCTGGAACAGATGCTCACT 21 STAT3 GTGCGTATGGGAACACCTA 22 STAT3 CCAGCAACACTCTTCAGTA 23 STAT3 CAGGCCACCTATAGCTACA 24 STAT3 CCTTAAGACATCTGAAGCT 25 STAT3 CATGCAGGGCAAAGGCTTA 26 STAT3 GCTTACCTACCTATAAGGT 27 STAT3 GACCAAGTTTATCTGTGTG 28 STAT3 CACCTTGCCTCAGCTGATC 29 STAT3 GAGAAACAGGATGGCCCAA 30 STAT3 GAATCTCCAGGATGACTTT 31 STAT3 TTGTAATGGCGTCTTCATT 32 STAT3 TCTCCAACATCTGTCAGAT 33 STAT3 GAGTCAAGATTGGGCATAT 34 STAT3 GAGAGTGCAGGATCTAGAA 35 STAT3 GGATCCCGGAAATTTAACA 36 STAT3 CGAGCCAATTGTGATGCTT 37 STAT3 GACCGAGGTGTATCACCAA 38 STAT3 GACCAACAATCCCAAGAAT 39 STAT3 TGGGCTATAAGATCATGGA 40 STAT3 AGCAGCTTGACACACGGTA 41 STAT3 CACATGCCACTTTGGTGTT 42 STAT3 CGATGGAGTACGTGCAGAA 43 STAT3 GAAAACTGGATAACGTCAT 44 STAT3 GGAGGCGTCACTTTCACTT 45 STAT3 CTATAAGATCATGGATGCT 46 STAT3 GAGACTTGGGCTTACCATT 47 STAT3 TGGGAGAGATTGACCAGCA 48 STAT3 TCTACAGACTGCAGCCACT 49 STAT3 CCTTGCTGACATCCAAATA 50 STAT3 TCATGCAGGGCAAAGGCTT 51 STAT3 CAAATTCCAATGTGTACTT 52 STAT3 CTCAACTTCAGACCCGTCA 53 STAT3 GAGAAGGACATCAGCGGTA 54 STAT3 GCTGCAGAAAGATACGACT 55 STAT3 GCCACTTTGGTGTTTCATA 56 STAT3 GGTGTCTCCACTGGTCTAT 57 STAT3 CTTCCTTCAGGCTGGTAAT 58 STAT3 GCCAGTTTCTTGGTGATAT 59 STAT3 CCGGATTTGGCAACTCAAA 60 STAT3 GGGCTTACCATTGGGTTTA 61 STAT3 GGTTGCTTACCTACCTATA 62 STAT3 AGCTTGACACACGGTACCT 63 STAT3 AGTTACAGGTTGGACATGA 64 STAT3 ACTTGTAATGGCGTCTTCA 65 STAT3 GTATCTACTTTAACTTCCA 66 STAT3 GATGGAGTACGTGCAGAAA 67 STAT3 CTACATACTCCTGGCATTG 68 STAT3 CTCCTTGCGTGTCTAAAGG 69 STAT3 GACTTGGGCTTACCATTGG 70 STAT3 GGTAGAGAATCTCCAGGAT 71 STAT3 CTTCCCTGATTGTGACTGA 72 STAT3 GGGCTATAAGATCATGGAT 73 STAT3 GGCTTACTGATAAACTTGA 74 STAT3 CTTGAGTCTGCCCTCGTAT 75 STAT3 GCCTCAGCTGATCAGAGTT 76 STAT3 GCAGATATTGTCAAGTTCA 77 STAT3 CTTAACTCTGATTGTAGCA 78 STAT3 AGCCTCCTTGGTGCTTTAA 79 STAT3 GCATGCCCATGCATCCTGA 80 STAT3 GTCCGTGGAACCATACACA 81 STAT3 CTTGAGAAGCCAATGGAGA 82 STAT3 CCCTCAAGAGTCAAGGAGA 83 STAT3 CTTGAGCACTAAGCCTCCA 84 STAT3 CCAAATAGAAGATAGGACT 85 STAT3 GGTAGCATGTATCTGGTCT 86 STAT3 TGTTCTCTATCAGCACAAT 87 STAT3 ACGAAGAATCAAGCAGTTT 88 STAT3 CCTATAGCTACATACTCCT 89 STAT3 CAGCACAATCTACGAAGAA 90 STAT3 CGGAAAGTATTGTCGGCCA 91 STAT3 CTCTATCAGCACAATCTAC 92 STAT3 CAACAGATTGCCTGCATTG 93 STAT3 GAAGATAGGACTATCTAAG 94 STAT3 CAGCAACACTCTTCAGTAC 95 STAT3 AGTCGAATGTTCTCTATCA 96 STAT3 AGGAGGAGGCATTCGGAAA 97 STAT3 TACTAACTTTGTGGTTCCA 98 STAT3 GCGGTAAGACCCAGATCCA 99 STAT3 GGATGGCCCCATGGAATCA 100 STAT3 CTGACCAACAATCCCAAGA 101 STAT3 CCGTGGAACCATACACAAA 102 STAT3 GTTTGAGTCCCTCACCTTT 103 STAT3 GTGAGGCAGAACAGCTAGA 104 STAT3 CCTCAGCTGATCAGAGTTT 105 STAT3 GTCATGCAGAGCTCTTACT 106 STAT3 GGTGTTTCATAATCTCCTG 107 STAT3 GACATCTGAAGCTGCAACC 108 STAT3 AGAGAGTGCAGGATCTAGA 109 STAT3 TCTCTGAGACCCATGATCA 110 STAT3 GCTGAGAACGGAAGCTGCA 111 STAT3 TGGATTGAGAGTCAAGATT 112 STAT3 GTAATGTATTGGCCTTTTA 113 STAT3 CACTCTTCAGTACATAATA 114 STAT3 CGGCCAGCAAAGAATCACA 115 STAT3 GTGGGAAGAATCACGCCTT 116 STAT3 CAGTTCACTACTAAAGTCA 117 STAT3 GCTCAGGGAATATGGTTCT 118 STAT3 GAGGATCCCGGAAATTTAA 119 STAT3 GGTACATCATGGGCTTTAT 120 STAT3 CCTTCAGGCTGGTAATTTA 121 STAT3 GGCCTTTGGTGTTGAAATA 122 STAT3 GGCTTACCATTGGGTTTAA 123 STAT3 GCTTACCATTGGGTTTAAA 124 STAT3 AAGAATCACATGCCACTTT 125 STAT3 AAGAAGGAGGCGTCACTTT 126 STAT3 TAAGCCCTAGGTTTCTTTT 127 STAT3 AAGGTCCCTCATCCTGTTT 128 STAT3 GGAGAAGGACATCAGCGGT 129 STAT3 TAACCTTGCTGACATCCAA 130 STAT3 TTAAGCATTCAGCTTCCTT 131 STAT3 TGGGTTGCTTACCTACCTA 132 STAT3 GTTGAAATAGGAAGGTTTA 133 STAT3 GACGTTGCAGCTCTCAGAG 134 STAT3 TTGTAATGTATTGGCCTTT 135 STAT3 TCCCGTGGGTTGCTTACCT 136 STAT3 GGAAGAATCACGCCTTCTA 137 STAT3 GCAGGATCTAGAACAGAAA 138 STAT3 GGAGTACGTGCAGAAAACT 139 STAT3 GGCGTCCAGTTCACTACTA 140 STAT3 GAAGGAGGCGTCACTTTCA 141 STAT3 CTACTTCTGCTATCTTTGA 142 STAT3 GGCCACCTATAGCTACATA 143 STAT3 CTAAGCCCTAGGTTTCTTT 144 STAT3 CTGGCCTTTGGTGTTGAAA 145 STAT3 GGCTGGGATACTTCTGATT 146 STAT3 GTCTCCTTGCGTGTCTAAA 147 STAT3 GGGCAAAGGCTTACTGATA 148 STAT3 CGGATTTGGCAACTCAAAA 149 STAT3 GGCCTTAGGTAGCATGTAT 150 STAT3 CATGTATCTGGTCTTAACT 151 STAT3 CTGGCCACTGCATTCAAAT 152 STAT3 CCACTGGTCTATCTCTATC 153 STAT3 TGGATGCTACCAATATCCT 154 STAT3 AGTTTGAGTCCCTCACCTT 155 STAT3 TCCTTGCGTGTCTAAAGGT 156 STAT3 ATGGGAACACCTAGCACGT 157 STAT3 CGGCGTCCAGTTCACTACT 158 STAT3 CATAGCCTTTCTGTATTTA 159 STAT3 CTTACCATTGGGTTTAAAT 160 STAT3 GAAGAATCCAACAACGGCA 161 STAT3 AGATCATCTGAAACTACTA 162 STAT3 CCCAATGGAATCAGCTACA 163 STAT3 GGAAGAGAGTGCAGGATCT 164 STAT3 GGAGAAGCATCGTGAGTGA 165 STAT3 GCAACAGATTGCCTGCATT 166 STAT3 GTCATTAGCAGAATCTCAA 167 STAT3 GCAGAATCTCAACTTCAGA 168 STAT3 GGTACAACATGCTGACCAA 169 STAT3 GTCTATCTCTATCCTGACA 170 STAT3 CAAGTTTATCTGTGTGACA 171 STAT3 CCATGTGAGGAGCTGAGAA 172 STAT3 GCCTGTTTCTGTAAGCAAA 173 STAT3 GCTACATACTCCTGGCATT 174 STAT3 CCTTGGTGCTTTAAGCATT 175 STAT3 GCTTCAGGTCAAACCCTTA 176 STAT3 CCTTATCAGGGCTGGGATA 177 STAT3 GTGATATCCAGTGGCACTT 178 STAT3 GCACTTGTAATGGCGTCTT 179 STAT3 GGCGTCTTCATTCAGTTCA 180 STAT3 GGCAACTCAAAACCACCTT 181 STAT3 GGGTTGCTTACCTACCTAT 182 STAT3 CTCTACAGTGACAGCTTCC 183 STAT3 GAAACTACTAACTTTGTGG 184 STAT3 GTGCTTACAACCTTGACTC 185 STAT3 TGGTAGAGAATCTCCAGGA 186 STAT3 TGGTACAACATGCTGACCA 187 STAT3 ACTGTATCAGCATAGCCTT 188 STAT3 TGGCAACTCAAAACCACCT 189 STAT3 TAGCATGTATCTGGTCTTA 190 STAT3 AGAGGATCCCGGAAATTTA 191 STAT3 CTCTCAGAGGATCCCGGAA 192 STAT3 CTCCATCAGCTCTACAGTG 193 STAT3 GAGAGTCAAGATTGGGCAT 194 STAT3 CATCTGCCTAGATCGGCTA 195 STAT3 CCAATTGTGATGCTTCCCT 196 STAT3 CCCTGATTGTGACTGAGGA 197 STAT3 CTTCAGTTAACAGCCTCCT 198 STAT3 GGCTTCAGGTCAAACCCTT 199 STAT3 GGTGATATCCAGTGGCACT 200 STAT3 GGCACTTGTAATGGCGTCT 201 Non-targeting sequence
(CONT) CUUACGCUGAGUACUUCGA

Example  2. Synthesis of Double Helical Oligo RNA Structure

The double helix oligo RNA structure prepared in the present invention has a structure as shown in the following structural formula (5).

Glucose - (ethylene glycol _6- PO ₃ ^- ) ₄ -5 'S 3'-C ₂₄ Structural formula (5)

3 'AS 5'-PO ₄

In the above structural formula (5), S is a sense strand of siRNA, AS is an antisense strand of siRNA, PO ₄ is a phosphate group, and ethylene glycol is a hydrophilic monomer, and A, hydrophilic monomer m is 6 and hexaethylene glycol is bonded through a phosphate group (PO ₃ ^- ) as a linker (J), 4 as a repetition number of hydrophilic block (n), and C ₂₄ as a hydrophobic substance Tetradocosane with a disulfide bond, and 5 'and 3' means the terminal direction of a double stranded oligo RNA, and glucose is a ligand that promotes receptor mediated cell division (RME).

The sense strand of the siRNA in the above structural formula (5) was synthesized by using DMT-hexaethyleneglycol-CPG prepared according to the method described in Example 1 of the existing patent (WO2015002511) as a support and? -Cyanoethyl A oligo-RNA-hydrophilic material structure containing a sense strand having hexaethylene glycol at the 3'-terminal region was synthesized through a method of linking a phosphodiester bond forming a RNA skeletal structure using phosphoamidite, The sense strand of the desired RNA-polymer structure was prepared by binding tetradodecanoic acid containing a disulfide bond to the 5 'end. In the case of the antisense strand to be annealed with the strand, an antisense strand of the sequence complementary to the sense strand was prepared through the aforementioned reaction.

After the synthesis, the RNA single strand and the RNA-polymer structure were removed from the CPG by treatment with 28% (v / v) ammonia in a water bath at 60 ° C, deprotection, The protecting moiety was removed through the reaction. The RNA single strand and the RNA-polymer structure from which the protecting residues were removed were reacted in an oven at 70 캜 with N-methylpyrrolidone, triethylamine and triethylaminetrihydrofluoride in a volume ratio 10: 3: 4 to remove 2'TBDMS (tert-butyldimethylsilyl).

The reaction product was isolated and purified by HPLC LC918 (Japan Analytical Industry, Japan) equipped with a Daisogel C18 (Daiso, Japan) column, and the RNA was purified using a MALDI-TOF mass spectrometer (Shimadzu, Japan) Respectively. Then, to prepare each double-stranded oligo RNA construct, the sense strand and the antisense strand were mixed in an equal volume and immersed in 1X annealing buffer (30 mM HEPES, 100 mM potassium acetate, 2 mM magnesium acetate, pH 7.0 The reaction was carried out in a constant temperature water bath at 90 占 폚 for 3 minutes and then reacted at 37 占 폚 to obtain a solution containing the compound of SEQ ID NOs: 12, 17, 42, 101, 108, 114, 116, 119, 137, 141, SiRNA-STAT3 # 12, 17, 42, 101, 108, 114, 116, 119, 137, 141, 170, 171 and SAMiRNA- CONT) were respectively prepared. The double - stranded oligo - RNA structure was annealed through electrophoresis.

Example  3. Nanoparticles composed of double-stranded oligo RNA construct ( SAMiRNA ) &Lt; / RTI &gt; Polydispersity index  Measure

The double helix oligo RNA structure synthesized in Example 2 forms a micelle which is a nanoparticle due to the hydrophobic interaction between the hydrophobic substances bound to the ends of the double helical oligo RNA (see FIG. 1).

(Diameter, d. Nm) and polydispersity index (PDI) of SAMiRNA-STAT3 and SAMiRNA-CONT nanoparticles.

Example  3-1. cell Experimental  Manufacture of nanoparticles

SAMiRNA-CONT was inoculated into 1.5 ml PBS (Phosphate Buffered Saline) in a concentration of 50 μg / ml in the same manner as in Example 2 except that the SAMiRNA-STAT3 # 12, 17, 42, 101, 108, 114, 116, 119, 137, 141, / Ml. The nanoparticle powder was prepared by freeze-drying at -75 ° C and 5 mTorr for 48 hours, and then homogenized nanoparticles were prepared by dissolving in 1.5 ml of PBS.

Example  3-2. animal Experimental  Manufacture of nanoparticles

The SAMiRNA-CONT prepared in Example 2 was dissolved in 1 ml of PBS (Phosphate Buffered Saline) at a concentration of 250 μg / ml, and the nanoparticle powder was prepared by freeze-drying for 6 days at -75 ° C. and 5 mTorr , And dissolved in 0.2 ml of PBS as a solvent to prepare homogenized nanoparticles.

The same amounts of SAMiRNA-STAT3 # 42, # 101 and # 137 synthesized in Example 2 were mixed and dissolved in 1 ml of PBS (Phosphate Buffered Saline) at a concentration of 250 μg / ml. After 6 days of lyophilization, nanoparticle powder was prepared and homogenized nanoparticles were prepared by dissolving in 0.2 ml of PBS.

The prepared SAMiRNA-CONT homogenate and SAMiRNA-STAT3 homogenized solution were diluted 1/25 in PBS and used for the experiment for confirming the cell transformation of the animal experimental nanoparticles at a concentration of 50 μg / ml.

Example  3-3. The size of nanoparticles and PDI  Measure

The size and the degree of dispersion of the nanoparticles were measured by a dynamic light-scattering method. The size and the degree of dispersion of the homogenized nanoparticles prepared in Examples 3-1 and 3-2 were measured with a dynamic light scattering meter (Nano-ZS, MALVERN, UK). The refractive index for the material was 1.459, (Absorption index) was 0.000, and the temperature of PBS as a solvent was 25 ° C, and the viscosity was 1.0200 and the refractive index was 1.335. One measurement consisted of a size measurement consisting of 15 repetitions, which was repeated 6 times.

As a result of the measurement, the average value of 98.7 ± 26.4 (mean ± SD, n = 6) d.nm and the polydispersity index of 0.289 ± 0.064 (mean ± SD, n = 6) ), An average of 79.4 ± 6.3 (mean ± SD, n = 6) d.nm for animal experimental nanoparticles and a polydispersity index value of 0.265 ± 0.007 (mean ± SD, n = 6) ).

As the value of the polydispersity index was lower, it was found that the nanoparticles of the present invention were formed in a very uniform size.

Example  4. Human breast cancer cell line, MCF At -7 siRNA  Used target  Confirming gene expression inhibition

The human breast cancer cell line, MCF-7, was transformed with siRNA having the sense strand of SEQ ID NOS: 1 to 201 prepared in Example 1, and the expression pattern of the target gene was analyzed in the transformed cell line.

Example  4-1. Human breast cancer cell line, MCF -7 culture

MCF-7, a human breast cancer cell line obtained from the American Type Culture Collection (ATCC), was cultured in RPMI 1640 (Roswell Park Memorial Institute 1640) culture medium (GIBCO / Invitrogen, USA, 10% , 100 units / ml of penicillin and 100 占 퐂 / ml of streptomycin) at 37 ° C and 5% (v / v) CO ₂ .

Example  4-2. Human breast cancer cell line, MCF At -7 STAT3 siRNA  Transfection &lt; / RTI &gt;

The MCF-7 cell line cultured in Example 4-1 was cultured in a 12-well plate at 37 ° C in 5% (v / v) CO ₂ in RPMI 1640 culture medium for 18 hours at a cell number of 1 × 10 ⁵ cells per well . After the medium was removed, 500 μl of Opti-MEM medium (GIBCO, USA) was dispensed per well.

2 μl of Lipofectamine ™ RNAi Max (Invitrogen, USA) and 248 μl of Opti-MEM medium were mixed to prepare a mixed solution. After reacting at room temperature for 5 minutes, each of the sequences prepared in Example 1 1 μl or 5 μl of siRNA (No. 1 pmole / μl concentration) having No. 1 to No. 201 sense strand was added to Opti-MEM medium to prepare a siRNA solution having a concentration of 4 nM or 20 nM in the final amount of 250 μl . The lipofectamine (RNAi Max) mixed solution and the siRNA solution were mixed and reacted at room temperature for 15 minutes to prepare a solution for transfection.

Tumor cell lines in Opti-MEM-dispensed 12-well plates 500 μl of the transfection solution was inoculated per well and cultured for 6 hours. Opti-MEM medium was removed and 1 ml of RPMI 1640 culture medium per well was added Followed by incubation at 37 &lt; 0 &gt; C, 5% (v / v) CO ₂ for the next 24 hours.

Example  4-3. target  gene mRNA  Quantitative analysis

Total RNA was extracted from the transfected cell line in Example 4-2 to prepare cDNA, and the amount of mRNA expression of the target gene was quantitatively determined using real-time PCR.

Example  4-3-1. RNA isolation and cDNA preparation from transfected cells

Total RNA was extracted from the cell line transfected in Example 4-2 using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), and the extracted RNA was purified using an RNA reverse transcriptase (AccuPower RocketScript Cycle RT Premix / dT20, Bioneer, Korea), cDNA was prepared as follows. Specifically, 1 μg of RNA extracted per tube was added to AccuPower RocketScript Cycle RT Premix / dT20 (Bioneer, Korea) in a 0.25 ml eppendorf tube and subjected to DEPC (diethyl pyrocarbonate) treatment so as to have a total volume of 20 μl Distilled water was added. RNA and primers were hybridized with MyGenie 96 Gradient Thermal Block (BIONEER, Korea) at 37 ° C for 30 seconds, cDNA was synthesized at 48 ° C for 4 minutes (cDNA synthesis), and PCR was carried out at 55 ° C The denaturation for 30 seconds was repeated 12 times and the enzyme was inactivated at 95 ° C for 5 minutes to terminate the amplification reaction.

Example  4-3- 2. Target  gene mRNA  Relative quantitative analysis

Using the cDNA prepared in Example 4-3-1 as a template, the relative amount of the STAT3 gene mRNA was quantitated by real-time PCR as follows. The cDNA prepared in Example 4-3-1 was diluted 5-fold with distilled water, and 3 μl of the diluted cDNA and 25 μl of 2 × GreenStar ™ PCR master mix (BIONEER, Korea), 16 μl of distilled water, 14 μl of STAT3 qPCR primer , And 10 pmole / μl of each of R, BIONEER, Korea, and Table 3) was added to a 96-well PCR plate. On the other hand, GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), which is a housekeeping gene (HK gene), was used as a standard gene to compare the expression amount of the target gene mRNA. The 96-well plate containing the above mixed solution was subjected to the following reaction using an Exicycler 96 Real-Time Quantitative Thermal Block (BIONEER, Korea). After denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, extension at 30 ° C for 30 seconds, extension of the SYBR Four cycles of SYBR green scan were repeated 42 times and the final extension was carried out at 72 DEG C for 3 minutes. Then, the temperature was maintained at 55 DEG C for 1 minute and the melting curve was changed from 55 DEG C to 95 DEG C curve. After completion of the PCR, the Ct (threshold cycle) value of each of the obtained target genes was obtained by determining the Ct value of the target gene corrected through the GAPDH gene and then the siRNA (siCONT) of the control sequence not causing the gene expression inhibition was treated The experimental group was used as a control group to obtain the difference of ΔCt values. The expression amount of the target gene of STAT3-specific siRNA-treated cells was relatively quantitated using the ΔCt value and the equation 2 (-ΔCt) × 100 (see FIG. 3, treatment with 5 nM siRNA; see FIG. 4, 1 nM Concentration siRNA treatment). In order to select high-efficiency siRNAs, 20 siRNAs whose mRNA expression levels in the target gene were commonly decreased at a treatment concentration of 1 nM and 5 nM were selected (SEQ ID NOS: 12, 17, 42, 55, 91, 95, 108, 111, 114, 116, 119, 137, 139, 141, 152, 166, 168, 170, 171 as sense strands).

qPCR  (F, Forward primer, R, Reverse primer) name Sequence SEQ ID NO. GAPDH-F GGTGAAGGTCGGAGTCAACG 202 GAPDH-R ACCATGTAGTTGAGGTCAATGAAGG 203 STAT3-F ATCACGCCTTCTACAGACTGC 204 STAT3-R CATCCTGGAGATTCTCTACCACT 205

Example  5. Human breast cancer cell line, MDA In-MB-231 siRNA  Used target  Confirmation of gene expression inhibition.

Were prepared in Example 1 and selected from SEQ ID NOs: 12, 17, 42, 55, 91, 95, 101, 108, 111, 114, 116, 119, 137, 139, 141, 152 , 166, 168, 170, and 171 as the sense strand was used to transform another human breast cancer cell line, MDA-MB-231, and the expression pattern of the target gene was analyzed in the transformed cell line.

Example  5-1. Human breast cancer cell line, MDA Culture of MB-231

MDA-MB-231, a human breast cancer cell line obtained from the American Type Culture Collection (ATCC), was cultured under the same conditions as in Example 4-1.

Example  5-2. Human breast cancer cell line, MDA In-MB-231 STAT3 siRNA  Transfection &lt; / RTI &gt;

The MDA-MB-231 cell line cultured in Example 5-1 was cultured in a 12-well plate at a cell number of 0.8 × 10 ⁵ cells per well in RPMI 1640 culture medium for 18 hours at 37 ° C. in 5% (v / v) CO ₂ , the medium was removed, and 500 μl of Opti-MEM medium (GIBCO, USA) was dispensed per well.

2 μl of Lipofectamine ™ RNAi Max (Invitrogen, USA) and 248 μl of Opti-MEM medium were mixed to prepare a mixed solution. The mixture was reacted at room temperature for 5 minutes and then prepared in Example 1, 16, 168, 170 and 171 selected in SEQ ID NOS: 12, 17, 42, 55, 91, 95, 101, 108, 111, 114, 116, 119, 137, 139, 141, 152, 0.2 μl, 1 μl, or 5 μl of the siRNA (1 pmole / μl concentration) as a sense strand was added to Opti-MEM medium to prepare an siRNA solution having a concentration of 0.8 nM, 4 nM or 20 nM in the final amount of 250 μl . The lipofectamine (RNAi Max) mixed solution and the siRNA solution were mixed and reacted at room temperature for 15 minutes to prepare a solution for transfection.

500 μl of the transfection solution for each tumor cell line in each well of Opti-MEM-dispensed 12-well plate was dispensed and cultured for 6 hours. Opti-MEM medium was removed and 1 ml of RPMI 1640 culture medium per well was dispensed Followed by incubation at 37 &lt; 0 &gt; C, 5% (v / v) CO ₂ for the next 24 hours.

Example  5-3. target  gene mRNA  Quantitative analysis

Quantitative analysis was carried out in the same manner as in Example 4-3 (see Fig. 5). 12, 17, 42, 101, 108, 114, 116, 119, 137, 141, and 141, respectively, which showed high efficiency at all siRNA concentrations of 0.2 nM, 1 nM and 5 nM, 170, and 171 in the sense strand).

Example  6. Human breast cancer cell line ( MCF -7, MDA -MB- 231)  IC ₅₀ (inhibition concentration 50%)

Using siRNA having the sense strand sequence of SEQ ID NOS: 12, 17, 42, 101, 108, 114, 116, 119, 137, 141, 170 and 171 selected in Example 1 and selected in Example 5-3 (MCF-7, MDA-MB-231), and the expression level of the target gene in the transformed cell line was analyzed to determine the IC ₅₀ value.

Example  6-1. Human breast cancer cell line ( MCF -7, MDA -MB- 231)  culture

The human breast cancer cell line (MCF-7, MDA-MB-231) obtained from the American Type Culture Collection (ATCC) was cultured under the same conditions as in Example 4-1.

Example  6-2. Human breast cancer cell line ( MCF -7, MDA -MB- 231)  goal siRNA  Transfection &lt; / RTI &gt;

The MCF-7 cell line and the MDA-MB-231 cell line cultured in Examples 4-1 and 5-1 were cultured in a 12-well plate at 37 ° C and 5% (v / v) CO ₂ for 18 hours in RPMI 1640 After culturing in a culture medium, the medium was removed and 500 μl of Opti-MEM medium (GIBCO, USA) was dispensed per well.

2 μl of Lipofectamine ™ RNAi Max (Invitrogen, USA) and 248 μl of Opti-MEM medium were mixed to prepare a mixed solution. The mixture was reacted at room temperature for 5 minutes and then prepared in Example 1, , 0.008 μl, 0.04 μl, 0.2 μl, 1 μl of the siRNA having the sense strand selected from SEQ ID NOs: 12, 17, 42, 101, 108, 114, 116, 119, 137, 141, Mu] l or 5 [mu] l was added to the Opti-MEM medium to prepare siRNA solutions at concentrations of 6.4 pM, 32 pM, 0.16 nM, 0.8 nM, 4 nM or 20 nM in the final amount of 250 [mu] l. The lipofectamine (RNAi Max) mixed solution and the siRNA solution were mixed and reacted at room temperature for 15 minutes to prepare a solution for transfection

Then, 500 μl each of the transfection solution was added to each well of the Opti-MEM tumor cell line and cultured for 6 hours. Opti-MEM medium was removed, 1 ml of RPMI 1640 culture medium was added, and then 24 during time 37 ℃, 5% (v / v) and incubated under the conditions of CO _2.

Example  6- 3. Target  gene mRNA  Quantitative analysis

Total RNA was extracted from the transfected cell line in Example 6-2 to prepare cDNA, and the amount of mRNA expression of the target gene was measured using real-time PCR in the same manner as in Example 4-3 (See FIG. 6, MCF-7 cell line; see FIG. 7, MDA-MB-231 cell line).

Example  6-4. IC ₅₀  analysis

Based on the results identified in Example 6-3, a SoftMax Pro program (Molecular Devices, USA) was used to determine IC ₅₀ values. The percentage of expression of the target gene was converted to the% inhibition rate by siRNA and plotted against the logarithm of the treatment concentration of the siRNA. The result was substituted into the 4-parameter logistics model, It confirmed the IC ₅₀ values (see Fig. 8) through. The efficacy of each siRNA was clearly confirmed by IC ₅₀ values in two types of breast cancer cells (see Table 4, SEQ ID NOS: 17, 42, 101, 119, and 137, 5 sequences were selected.

In human breast cancer cell lines STAT3 siRNA By sequence IC ₅₀ value siRNA # IC50, pM MDA-231 MCF-7 119 15 211 101 17 78 137 28 461 42 34 130 17 36 151 12 36 339 171 39 144 114 42 156 141 48 91 108 62 305 170 136 249 116 193 210

Example  7. STAT3  Specific To siRNA  by target  Inhibition of gene expression and inhibition of cell growth

SiRNA having the sequence of SEQ ID NOS: 17, 42, 101, 119 and 137 as the high-efficiency siRNA selected in Example 6-4 was transfected into a breast cancer cell line, MDA-MB-231 at a concentration of 5, And the degree of inhibition of the expression of the target gene and the degree of cell growth inhibition were confirmed.

Example  7-1. Goal from human liver cancer cell line siRNA  &Lt; / RTI &gt; transfection )

The MDA-MB-231 cell line cultured in Example 5-1 was cultured in a 12-well plate at 37 ° C in the presence of 5% (v / v) CO ₂ at a cell number of 0.6 × 10 ⁵ cells per well for 18 hours in RPMI -1640 culture medium, and after removing the medium, 500 μl of Opti-MEM medium (GIBCO, USA) was dispensed per well. 2 μl of Lipofectamine ™ RNAi Max (Invitrogen, USA) and 248 μl of Opti-MEM medium were mixed to prepare a mixed solution. After reacting at room temperature for 5 minutes, 5 μl or 50 μl of the siRNA (1 pmole / μl) having the sense strand of SEQ ID NOS: 17, 42, 101, 119 and 137 selected in Example 6-3 was added to Opti-MEM medium to a total amount of 250 μl, SiRNA solutions with concentrations of 20 nM or 200 nM, respectively, were prepared. The lipofectamine (RNAi Max) mixed solution and the siRNA solution were mixed and reacted at room temperature for 15 minutes to prepare a solution for transfection.

Then, each well of the tumor cell line in which Opti-MEM was dispensed was dispensed at 500 μl each for the transfection solution and cultured for 6 hours, and Opti-MEM medium was removed. 1 ml of RPMI 1640 culture medium was added thereto, followed by incubation for 72 hours at 37 ° C under 5% (v / v) CO ₂ .

Example  7-2. target  gene mRNA  Quantitative analysis

Quantitative analysis was carried out in the same manner as in Example 4-3 (see Fig. 9, A).

Example  7-3. Confirm cell growth inhibition

The cells transformed in Example 7-1 were washed twice with 500 μl of DPBS per well and then 500 μl of TrypLE ^™ Express with phenol red (1X, Gibco, USA) / v) CO ₂ for 2 minutes to suspend the cells. After stopping the reaction by adding RPMI 1640 culture medium of 500 ㎕ per well, take 10 ㎕ after the 100 ㎕ of them mixed with an equal volume of 2x trypan blue solution (Trypan Blue Solution) LUNA ^TM Automated Cell Counter (Logos Biosystems, USA) was used to measure the number of cells. The measurement was carried out three times (see Fig. 9, B).

As a result of confirming the cell proliferation inhibitory effect by confirming the cell number, it was confirmed that the cell viability was decreased in a concentration dependent manner. In particular, the siRNA having the sense strand of SEQ ID NOS: 42, 101 and 137 was treated with 50 nM Of the test group had an inhibitory potency of about 40% in vitro .

Example  8. Human breast cancer cell line, MDA In-MB-231 STAT3  Specific siRNA  And a nanoparticle composed of a double-stranded oligo RNA structure SAMiRNA - STAT3 ) To confirm the inhibition of the expression of the target gene

SiRNA having SEQ ID NOs: 12, 17, 42, 101, 108, 114, 119, 137, 141, 166, 170 and 171 selected in Example 3-1 and having sense strands selected in Examples 5-3 MB-231) using the nanoparticles (SAMiRNA-STAT3 # 12, 17, 42, 101, 108, 114, 119, 137, 141, 166, 170, Expression patterns were analyzed.

Example  8-1. Human breast cancer cell line, MDA Culture of MB-231

MDA-MB-231, a human breast cancer cell line obtained from the American Type Culture Collection (ATCC), was cultured under the same conditions as in Example 5-1.

Example  8-2. Human breast cancer cell line, MDA In-MB-231 SAMiRNA - Of STAT3  Treatment

Example 5-1 In the MDA-MB-231 cell lines cultured in 12-well number of 0.6 × 10 ⁵ cells per well of a plate for 18 hours in a culture medium RPMI 1640 37 ℃, 5% (v / v) CO ₂ &lt; / RTI &gt;

To prepare SAMiRNA treatment solution, 26.6 mu l or 53.2 mu l each of each 973.4 mu l or 946.8 mu l OPTI-MEM medium was prepared in the above Example 3-1, and 50 mu g selected in Example 5-3 SAMiRNA-STAT3 # 12, 17, 42, 101, 108, 114, 119, 137, 141, 166, 170, 171 or SAMiRNA-CONT were mixed with a concentration of 100 nM or 200 nM Lt; / RTI &gt;

After the medium was removed, 1 ml of the 100 nM or 200 nM SAMiRNA treatment solution per well was treated twice a day for two days and cultured at 37 ° C under 5% (v / v) CO ₂ .

Example  8-3. target  gene mRNA  Quantitative analysis

Quantitative analysis was carried out in the same manner as in Example 4-3 (see Fig. 10).

Example  9. Human breast cancer cell line, MDA - Animals from MB-231 Experimental STAT3  Nanoparticles composed of double-stranded oligo RNA constructs containing both specific siRNAs ( SAMiRNA -STAT3-Combo) with or without Glucose Ligand target  Comparison of inhibition of gene expression

(SAMiRNA-STAT3-Combo), which was prepared in Example 3-2 and contains siRNA having SEQ ID NOS: 42, 101 and 137 as sense strands selected in Example 7-3, The inhibition of target gene expression by glucose-containing nanoparticles (Glucose-SAMiRNA-STAT3-Combo) as a ligand in the particles was compared and analyzed in human breast cancer cell line, MDA-MB-231.

Example  9-1. Human breast cancer cell line, MDA Culture of MB-231

MDA-MB-231, a human breast cancer cell line obtained from the American Type Culture Collection (ATCC), was cultured under the same conditions as in Example 5-1.

Example  9-2. Human breast cancer cell line, MDA Treatment of nanoparticles in MB-231

Example 5-1 In the MDA-MB-231 cell lines cultured in 12-well number of 0.6 × 10 ⁵ cells per well of a plate for 18 hours in a culture medium RPMI 1640 37 ℃, 5% (v / v) CO ₂ &lt; / RTI &gt;

In order to prepare a SAMiRNA treatment solution, each of 973.4 μl, 946.8 μl or 867.0 μl of OPTI-MEM medium was added with 26.6 μl, 53.2 μl or 133.0 μl of each of 50 μg of the diluted solution prepared in Example 3-2 / ML (13.3 uM) of SAMiRNA-STAT3-Combo or Glucose-SAMiRNA-STAT3-Combo were mixed to prepare a SAMiRNA treatment solution of 100 nM, 200 nM or 500 nM.

After removing the medium, 1 ml of the 100 nM, 200 nM or 500 nM SAMiRNA treatment solution per well was treated twice a day for two days and cultured at 37 ° C under 5% (v / v) CO ₂ .

Example  9-3. target  gene mRNA  Quantitative analysis

Quantitative analysis was carried out in the same manner as in Example 4-3 (see Fig. 11). After confirming that the amount of inhibition of target gene expression was divided into two groups by F-test, the t-test was applied to two groups with equal distribution. As a result, p <0.05 at 500 nM treatment concentration Significantly, we found that Glucose-SAMiRNA-STAT3-Combo nanoparticles inhibit the expression of target genes more strongly than SAMiRNA-STAT3-Combo.

Example  10. In animal tumor models STAT3  Specific siRNA  Confirmation of tumor growth inhibition effect of nanoparticles composed of double helix oligo RNA constructs

(SAMiRNA-STAT3-Combo), which was prepared in Example 3-2 and contained siRNA having SEQ ID NO: 42, SEQ ID NO: 101, and SEQ ID NO: 137 selected in Example 7-3 We confirmed the inhibitory effect of nanoparticles (Glucose-SAMiRNA-STAT3-Combo) having glucose as a ligand in nanoparticles on tumor growth in a mouse breast cancer xenograft model.

Example  10-1. Mouse breast cancer xenograft  model)

The human breast cancer cell line MDA-MB-231 and 3 × 10 ⁶ cells cultured in Example 5-1 were subcutaneously injected into the left flank of female nude mice (Balb / c nude mice) , The tumor size was measured at intervals of 2 days, and the model was constructed by confirming the engraftment and growth of the tumor cells.

Example  10-2. STAT3  Specific siRNA  Determination of body weight change by nanoparticles composed of double helix oligo RNA constructs

(SAMiRNA-STAT3-Combo) containing the siRNA having the sense strand of SEQ ID NO: 42, 101 and 137 prepared in Example 3-2 and the nano-particle having the glucose as the ligand in the same nanoparticle Animal models of particles (Glucose-SAMiRNA-STAT3-Combo) Body weight was measured at 2-day intervals to determine body weight changes in experimental animals by intravenous administration (see Table 5, SAMiRNA-STAT3- , Glucose-SAMiRNA-STAT3-Combo treated group). As a result, there were no significant weight gain or weight loss phenomenon, which means that there were no external factors that could affect the interpretation of the results.

Table 5 shows the body weight measurements of the SAMiRNA-STAT3-Combo administration experimental group.

Table 6 shows the body weight measurements of Glucose-SAMiRNA-STAT3-Combo administration group.

Example  10-3. STAT3  Specific siRNA  Confirmation of tumor growth inhibition by nanoparticles composed of double helix oligo RNA constructs

(SAMiRNA-STAT3-Combo), which was prepared in Example 3-2 and contains siRNA having SEQ ID NOS: 42, 101 and 137 as sense strands selected in Example 7-3, (Glucose-SAMiRNA-STAT3-Combo) inhibited tumor growth in a mouse breast cancer xenograft model.

Example  10-3-1. Mouse breast cancer xenograft model Experimental group  Configuration

When the tumor size of the mouse breast cancer model prepared in Example 8-1 was 140 평균, the experimental group was divided into 6 groups according to tumor size.

Example  10-3-2. STAT3  Specific siRNA  Administration of nanoparticles composed of double helix oligo RNA constructs

(SAMiRNA-STAT3-Combo), which was prepared in Example 3-2 and contains siRNA having SEQ ID NOS: 42, 101 and 137 as sense strands selected in Example 7-3, (Glucose-SAMiRNA-STAT3-Combo) having a glucose as a ligand in a particle was added to a 100 μl dose in a 1 ml syringe (0.25 mm x 8 mm, 31 Gauges) at a concentration of 1 mg / kg body weight or 5 mg / , BD328820, USA) for 1 week for 2 weeks, 14 consecutive times in total. The animals were divided into four groups according to the blind (Blind ).

Administration group: PBS, PBS (vehicle) administration control group; SAMiRNA-CONT, a 5 mg / kg body weight nanoparticle containing siRNA having the sequence of SEQ ID NO: 201 as sense strand control group; (SAMiRNA-CONT-Combo) containing 1 mg / kg body weight or 5 mg / kg body weight of siRNA including all siRNAs having SAMiRNA-STAT3, SEQ ID NOS: 42, 101 and 137 as sense strands; Glucose-SAMiRNA-CONT, a 5 mg / kg body weight nanoparticle containing siRNA having the sequence of SEQ ID NO: 201 as a sense strand control group; 1 mg / kg body weight or 5 mg / kg body weight of the nanoparticles (Glucose-SAMiRNA-CONT-Combo) containing all of siRNA having the sequence of SEQ ID NO: 42, 101 and 137 as the sense strand Experimental group

Example  10-3-3. Determining the effect of tumor size measurement

The size of the tumor was measured on days 2, 4, 6, 8, 10, 12 and 14 after 14 consecutive days of administration in Example 10-3-2 (see FIGS. 13 and 14). SAMiRNA-STAT3 (1 mg / kg body weight) was 30% and SAMiRNA-STAT3 (5 mg / kg body weight) inhibited 37% tumor growth compared to the excipient control PBS on the 14th day of the last administration , SAMiRNA-STAT3 (1 mg / kg body weight) and SAMiRNA-STAT3 (5 mg / kg body weight) were significantly inhibited by 24% and 31%, respectively, as compared to the negative control group, SAMiRNA-CONT. In addition, Glucose-SAMiRNA-STAT3 (1 mg / kg body weight), Glucose-SAMiRNA-STAT3 (5 mg / kg body weight) and the negative control group Glucose-SAMiRNA-CONT In contrast, Glucose-SAMiRNA-STAT3 (1 mg / kg body weight) and Glucose-SAMiRNA-STAT3 (5 mg / kg body weight) . However, Glucose-SAMiRNA-STAT3 (5 mg / kg body weight) significantly inhibited tumor growth.

Example  10-3-4. Tumor weight measurement

At the end of the last administration (day 14), 24 hours after administration, the animals were sacrificed to determine tumor weight and tumor weight ratio (%) (see FIGS. 15 and 16). SAMiRNA-STAT3 (1 mg / kg body weight) and SAMiRNA-STAT3 (5 mg / kg body weight) were significantly inhibited by 30% and 27% SAMiRNA-STAT3 (1 mg / kg body weight) and SAMiRNA-STAT3 (32 mg / kg body weight) were significantly inhibited by 45% and 46%, respectively. In addition, Glucose-SAMiRNA-STAT3 (1 mg / kg body weight) was -10%, -18% and Glucose-SAMiRNA-STAT3 (5 mg / kg body weight) was 40% and 39% compared to the excipient control PBS There was no anticancer effect due to Glucose-SAMiRNA-STAT3 (1 mg / kg body weight) but significant anticancer effect was observed in Glucose-SAMiRNA-STAT3 (5 mg / kg body weight). Glucose-SAMiRNA-CONT SAMiRNA-STAT3 (1 mg / kg body weight) was 30% and -40%, and Glucose-SAMiRNA-STAT3 (5 mg / kg body weight) was 30% and 28% (1 mg / kg body weight) did not show any tumor growth inhibitory effect, however, Glucose-SAMiRNA-STAT3 (5 mg / kg body weight)

Example  10-4. Regulation of handling, management and treatment of experimental animals

All methods for handling, administering and treating animals were carried out in accordance with the approval and regulation of the Bioneer Animal Research Institute at Bioneer Corporation, AEC-20081229-0004. The experimental animals were observed daily for their health, such as activity and fecundity, and their dietary intakes and body weight changes were observed.

Example  11. Human epidermal keratin-forming cell line (keratinocyte cell line), From HaCaT  STAT3 specific siRNA  (SAMiRNA-STAT3) consisting of a double-stranded oligo RNA structure target  Confirming gene expression inhibition

(SAMiRNA-STAT3 # 42) containing siRNA having the sense strand as SEQ ID NO: 42 selected in Example 3-1 was used to construct a human keratin-forming cell line, a target in HaCaT The expression pattern of the gene was analyzed.

Example  11-1. Human epidermal keratin-forming cell line (keratinocyte cell line), Of HaCaT  culture

Human keratin-forming cell line, HaCaT, obtained from the American Type Culture Collection (ATCC) was cultured in DMEM (Dulbecco's modified Eagle's medium) culture medium (GIBCO / Invitrogen, USA, 10% (v / v) fetal bovine serum, Penicillin 100 units / ml and streptomycin 100 占 퐂 / ml) at 37 占 폚 and 5% (v / v) CO ₂ .

Example  11-2. Human epidermal keratin-forming cell line (keratinocyte cell line), From HaCaT  Treatment of SAMiRNA-STAT3

Example 37 ℃ in DMEM culture medium for 18 hours, the 11-1 cell line HaCaT in culture with the 0.6 × 10 ⁵ per well in 12-well plate cell, 5% (v / v) and incubated under the conditions of CO ₂ .

5.8, 5.6, 11.2, 28.1 μl or 56.1 μl each in 997, 994, 989, 972 μl or 944 μl of OPTI-MEM medium to produce a SAMiRNA treatment solution SAMiRNA-STAT3 # 42 or SAMiRNA-CONT at a concentration of 250 μg / ml (17.8 μM) selected in Example 5-3 was mixed to prepare a SAMiRNA treatment solution of 50, 100, 200, 500 nM or 1 μM.

After the medium was removed, 1 ml of 50, 100, 200, 500 nM or 1 μM SAMiRNA treatment solution per well was treated twice a day for two days and cultured at 37 ° C. under 5% (v / v) CO ₂ .

Example  11-3. target  gene mRNA  Quantitative analysis

Quantitative analysis was carried out in the same manner as in Example 4-3.

As a result, it was confirmed that the expression level of the target gene in the human epidermal keratin-forming cell line decreased with the siRNA concentration (Fig. 17).

                         SEQUENCE LISTING <110> BIONEER CORPORATION   <120> Breast cancer related genes-specific siRNA, double-stranded oligo         RNA molecule comprising the siRNA, and composition for the        prevention or treatment of cancer <130> P15-B165 <160> 205 <170> PatentIn version 3.5 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 1 tgttctctga gacccatga 19 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 2 tgagacttgg gcttaccat 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 3 ccgagccaat tgtgatgct 19 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 4 ctatctaagc cctaggttt 19 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 5 gtgtctaaag gtccctcat 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 6 cgtgtctaaa ggtccctca 19 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 7 gaatcccgtg ggttgctta 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 8 ctcagaggat cccggaaat 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 9 ggaggcattc ggaaagtat 19 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 10 tcactactaa agtcaggtt 19 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 11 ctcaagagtc aaggagaca 19 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 12 gagtcaagga gacatgcaa 19 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 13 ctactaaagt caggttgct 19 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 14 acgtgtctgg ttgagctca 19 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 15 cagatcatct gaaactact 19 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 16 ctactttaac ttccagaaa 19 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 17 cttcagaccc gtcaacaaa 19 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 18 ggcccaatgg aatcagcta 19 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 19 gggaagaatc acgccttct 19 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 20 gctggaacag atgctcact 19 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 21 gtgcgtatgg gaacaccta 19 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 22 ccagcaacac tcttcagta 19 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 23 caggccacct atagctaca 19 <210> 24 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 24 ccttaagaca tctgaagct 19 <210> 25 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 25 catgcagggc aaaggctta 19 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 26 gcttacctac ctataaggt 19 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 27 gaccaagttt atctgtgtg 19 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 28 caccttgcct cagctgatc 19 <210> 29 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 29 gagaaacagg atggcccaa 19 <210> 30 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 30 gaatctccag gatgacttt 19 <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 31 ttgtaatggc gtcttcatt 19 <210> 32 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 32 tctccaacat ctgtcagat 19 <210> 33 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 33 gagtcaagat tgggcatat 19 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 34 gagagtgcag gatctagaa 19 <210> 35 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 35 ggatcccgga aatttaaca 19 <210> 36 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 36 cgagccaatt gtgatgctt 19 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 37 gaccgaggtg tatcaccaa 19 <210> 38 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 38 gaccaacaat cccaagaat 19 <210> 39 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 39 tgggctataa gatcatgga 19 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 40 agcagcttga cacacggta 19 <210> 41 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 41 cacatgccac tttggtgtt 19 <210> 42 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 42 cgatggagta cgtgcagaa 19 <210> 43 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 43 gaaaactgga taacgtcat 19 <210> 44 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 44 ggaggcgtca ctttcactt 19 <210> 45 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 45 ctataagatc atggatgct 19 <210> 46 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 46 gagacttggg cttaccatt 19 <210> 47 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 47 tgggagagat tgaccagca 19 <210> 48 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 48 tctacagact gcagccact 19 <210> 49 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 49 ccttgctgac atccaaata 19 <210> 50 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 50 tcatgcaggg caaaggctt 19 <210> 51 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 51 caaattccaa tgtgtactt 19 <210> 52 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 52 ctcaacttca gacccgtca 19 <210> 53 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 53 gagaaggaca tcagcggta 19 <210> 54 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 54 gctgcagaaa gatacgact 19 <210> 55 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 55 gccactttgg tgtttcata 19 <210> 56 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 56 ggtgtctcca ctggtctat 19 <210> 57 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 57 cttccttcag gctggtaat 19 <210> 58 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 58 gccagtttct tggtgatat 19 <210> 59 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 59 ccggatttgg caactcaaa 19 <210> 60 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 60 gggcttacca ttgggttta 19 <210> 61 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 61 ggttgcttac ctacctata 19 <210> 62 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 62 agcttgacac acggtacct 19 <210> 63 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 63 agttacaggt tggacatga 19 <210> 64 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 64 acttgtaatg gcgtcttca 19 <210> 65 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 65 gtatctactt taacttcca 19 <210> 66 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 66 gatggagtac gtgcagaaa 19 <210> 67 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 67 ctacatactc ctggcattg 19 <210> 68 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 68 ctccttgcgt gtctaaagg 19 <210> 69 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 69 gacttgggct taccattgg 19 <210> 70 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 70 ggtagagaat ctccaggat 19 <210> 71 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 71 cttccctgat tgtgactga 19 <210> 72 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 72 gggctataag atcatggat 19 <210> 73 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 73 ggcttactga taaacttga 19 <210> 74 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 74 cttgagtctg ccctcgtat 19 <210> 75 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 75 gcctcagctg atcagagtt 19 <210> 76 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 76 gcagatattg tcaagttca 19 <210> 77 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 77 cttaactctg attgtagca 19 <210> 78 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 78 agcctccttg gtgctttaa 19 <210> 79 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 79 gcatgcccat gcatcctga 19 <210> 80 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 80 gtccgtggaa ccatacaca 19 <210> 81 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 81 cttgagaagc caatggaga 19 <210> 82 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 82 ccctcaagag tcaaggaga 19 <210> 83 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 83 cttgagcact aagcctcca 19 <210> 84 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 84 ccaaatagaa gataggact 19 <210> 85 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 85 ggtagcatgt atctggtct 19 <210> 86 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 86 tgttctctat cagcacaat 19 <210> 87 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 87 acgaagaatc aagcagttt 19 <210> 88 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 88 cctatagcta catactcct 19 <210> 89 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 89 cagcacaatc tacgaagaa 19 <210> 90 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 90 cggaaagtat tgtcggcca 19 <210> 91 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 91 ctctatcagc acaatctac 19 <210> 92 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 92 caacagattg cctgcattg 19 <210> 93 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 93 gaagatagga ctatctaag 19 <210> 94 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 94 cagcaacact cttcagtac 19 <210> 95 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 95 agtcgaatgt tctctatca 19 <210> 96 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 96 aggaggaggc attcggaaa 19 <210> 97 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 97 tactaacttt gtggttcca 19 <210> 98 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 98 gcggtaagac ccagatcca 19 <210> 99 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 99 ggatggccca atggaatca 19 <210> 100 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 100 ctgaccaaca atcccaaga 19 <210> 101 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 101 ccgtggaacc atacacaaa 19 <210> 102 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 102 gtttgagtcc ctcaccttt 19 <210> 103 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 103 gtgaggcaga acagctaga 19 <210> 104 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 104 cctcagctga tcagagttt 19 <210> 105 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 105 gtcatgcaga gctcttact 19 <210> 106 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 106 ggtgtttcat aatctcctg 19 <210> 107 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 107 gacatctgaa gctgcaacc 19 <210> 108 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 108 agagagtgca ggatctaga 19 <210> 109 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 109 tctctgagac ccatgatca 19 <210> 110 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 110 gctgagaacg gaagctgca 19 <210> 111 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 111 tggattgaga gtcaagatt 19 <210> 112 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 112 gtaatgtatt ggcctttta 19 <210> 113 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 113 cactcttcag tacataata 19 <210> 114 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 114 cggccagcaa agaatcaca 19 <210> 115 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 115 gtgggaagaa tcacgcctt 19 <210> 116 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 116 cagttcacta ctaaagtca 19 <210> 117 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 117 gctcagggaa tatggttct 19 <210> 118 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 118 gaggatcccg gaaatttaa 19 <210> 119 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 119 ggtacatcat gggctttat 19 <210> 120 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 120 ccttcaggct ggtaattta 19 <210> 121 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 121 ggcctttggt gttgaaata 19 <210> 122 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 122 ggcttaccat tgggtttaa 19 <210> 123 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 123 gcttaccatt gggtttaaa 19 <210> 124 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 124 aagaatcaca tgccacttt 19 <210> 125 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 125 aagaaggagg cgtcacttt 19 <210> 126 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 126 taagccctag gtttctttt 19 <210> 127 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 127 aaggtccctc atcctgttt 19 <210> 128 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 128 ggagaaggac atcagcggt 19 <210> 129 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 129 taaccttgct gacatccaa 19 <210> 130 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 130 ttaagcattc agcttcctt 19 <210> 131 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 131 tgggttgctt acctaccta 19 <210> 132 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 132 gttgaaatag gaaggttta 19 <210> 133 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 133 gacgttgcag ctctcagag 19 <210> 134 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 134 ttgtaatgta ttggccttt 19 <210> 135 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 135 tcccgtgggt tgcttacct 19 <210> 136 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 136 ggaagaatca cgccttcta 19 <210> 137 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 137 gcaggatcta gaacagaaa 19 <210> 138 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 138 ggagtacgtg cagaaaact 19 <210> 139 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 139 ggcgtccagt tcactacta 19 <210> 140 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 140 gaaggaggcg tcactttca 19 <210> 141 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 141 ctacttctgc tatctttga 19 <210> 142 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 142 ggccacctat agctacata 19 <210> 143 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 143 ctaagcccta ggtttcttt 19 <210> 144 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 144 ctggcctttg gtgttgaaa 19 <210> 145 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 145 ggctgggata cttctgatt 19 <210> 146 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 146 gtctccttgc gtgtctaaa 19 <210> 147 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 147 gggcaaaggc ttactgata 19 <210> 148 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 148 cggatttggc aactcaaaa 19 <210> 149 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 149 ggccttaggt agcatgtat 19 <210> 150 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 150 catgtatctg gtcttaact 19 <210> 151 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 151 ctggccactg cattcaaat 19 <210> 152 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 152 ccactggtct atctctatc 19 <210> 153 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 153 tggatgctac caatatcct 19 <210> 154 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 154 agtttgagtc cctcacctt 19 <210> 155 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 155 tccttgcgtg tctaaaggt 19 <210> 156 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 156 atgggaacac ctagcacgt 19 <210> 157 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 157 cggcgtccag ttcactact 19 <210> 158 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 158 catagccttt ctgtattta 19 <210> 159 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 159 cttaccattg ggtttaaat 19 <210> 160 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 160 gaagaatcca acaacggca 19 <210> 161 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 161 agatcatctg aaactacta 19 <210> 162 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 162 cccaatggaa tcagctaca 19 <210> 163 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 163 ggaagagagt gcaggatct 19 <210> 164 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 164 ggagaagcat cgtgagtga 19 <210> 165 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 165 gcaacagatt gcctgcatt 19 <210> 166 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 166 gtcattagca gaatctcaa 19 <210> 167 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 167 gcagaatctc aacttcaga 19 <210> 168 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 168 ggtacaacat gctgaccaa 19 <210> 169 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 169 gtctatctct atcctgaca 19 <210> 170 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 170 caagtttatc tgtgtgaca 19 <210> 171 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 171 ccatgtgagg agctgagaa 19 <210> 172 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 172 gcctgtttct gtaagcaaa 19 <210> 173 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 173 gctacatact cctggcatt 19 <210> 174 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 174 ccttggtgct ttaagcatt 19 <210> 175 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 175 gcttcaggtc aaaccctta 19 <210> 176 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 176 ccttatcagg gctgggata 19 <210> 177 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 177 gtgatatcca gtggcactt 19 <210> 178 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 178 gcacttgtaa tggcgtctt 19 <210> 179 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 179 ggcgtcttca ttcagttca 19 <210> 180 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 180 ggcaactcaa aaccacctt 19 <210> 181 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 181 gggttgctta cctacctat 19 <210> 182 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 182 ctctacagtg acagcttcc 19 <210> 183 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 183 gaaactacta actttgtgg 19 <210> 184 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 184 gtgcttacaa ccttgactc 19 <210> 185 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 185 tggtagagaa tctccagga 19 <210> 186 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 186 tggtacaaca tgctgacca 19 <210> 187 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 187 actgtatcag catagcctt 19 <210> 188 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 188 tggcaactca aaaccacct 19 <210> 189 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 189 tagcatgtat ctggtctta 19 <210> 190 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 190 agaggatccc ggaaattta 19 <210> 191 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 191 ctctcagagg atcccggaa 19 <210> 192 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 192 ctccatcagc tctacagtg 19 <210> 193 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 193 gagagtcaag attgggcat 19 <210> 194 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 194 catctgccta gatcggcta 19 <210> 195 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 195 ccaattgtga tgcttccct 19 <210> 196 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 196 ccctgattgt gactgagga 19 <210> 197 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 197 cttcagttaa cagcctcct 19 <210> 198 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 198 ggcttcaggt caaaccctt 19 <210> 199 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 199 ggtgatatcc agtggcact 19 <210> 200 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 200 ggcacttgta atggcgtct 19 <210> 201 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 201 cuuacgcuga guacuucga 19 <210> 202 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 202 ggtgaaggtc ggagtcaacg 20 <210> 203 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 203 accatgtagt tgaggtcaat gaagg 25 <210> 204 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 204 atcacgcctt ctacagactg c 21 <210> 205 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 205 catcctggag attctctacc act 23

Claims (35)

A STAT3-specific siRNA comprising a sense strand comprising any one of the sequences selected from SEQ ID NO: 1 to SEQ ID NO: 200 and an antisense strand comprising the complementary sequence.
The method according to claim 1,
Wherein the sense strand or antisense strand of the siRNA is comprised of 19 to 31 nucleotides.
The method according to claim 1,
The siRNA comprises a sense strand comprising any one of the sequences selected from the group consisting of SEQ ID NOS: 12, 17, 42, 101, 108, 114, 119, 137, 141, 166, 170 and 171, STAT3 specific siRNA comprising an antisense strand.
The method according to claim 1,
Wherein the sense strand or antisense strand of the siRNA comprises one or more chemical modifications.
5. The method of claim 4,
The chemical modification
The -OH group in the 2'carbon position of the sugar structure in the nucleotide is CH ₃ (methyl), -OCH ₃ (methoxy), -NH ₂ , -F (fluorine), -O-2-methoxyethyl-O- Substituted with -O-2-methylthioethyl, -O-3-aminopropyl, -O-3-dimethylaminopropyl, -ON-methylacetamido or -O-dimethylamidooxyethyl ;
A modification in which the oxygen in the sugar structure in the nucleotide is replaced by sulfur;
Nucleotide bond phosphorothioate or boranophosphate, modification to methyl phosphonate bond;
PNA (peptide nucleic acid), LNA (locked nucleic acid) or UNA (unlocked nucleic acid);
&Lt; / RTI &gt; wherein said STAT3-specific siRNA is at least one variant selected from the group consisting of: &lt; RTI ID = 0.0 &gt;
The method according to claim 1,
Wherein at least one phosphate group is bonded to the 5 'end of the antisense strand of said siRNA.
A double stranded oligo RNA construct comprising the structure of structure (1) below.
(A _m -J) _n -XRYB ????? (1)
Wherein A is a hydrophilic monomer, B is a hydrophobic substance, J is a hydrophilic monomer or m hydrophilic monomer and m is a linker connecting oligonucleotides to each other, n is a hydrophilic monomer, m is a hydrophilic monomer, m X and Y are each independently a simple covalent bond or a linker mediated covalent bond, R is a STAT3 specific siRNA, m is an integer of 1 to 10, n is 1 Lt; / RTI &gt;
8. The method of claim 7,
Wherein the R comprises a sense strand and an antisense strand of the siRNA according to claim 7.
9. The method of claim 8,
Wherein the 5 'end of the sense strand and the antisense strand are linked to X and the 3' end is linked to Y.
8. The method of claim 7,
Wherein said STAT3 specific siRNA is an siRNA according to any one of claims 1 to 6.
8. The method of claim 7,
Wherein the hydrophilic monomer is selected from the group consisting of ethylene glycol (EG), polyvinylpyrrolidone, and polyoxazoline.
8. The method of claim 7,
Wherein the hydrophobic substance has a molecular weight of 250 to 1,000.
13. The method of claim 12,
The hydrophobic material may be selected from the group consisting of steroid derivatives, glyceride derivatives, glycerol ether, polypropylene glycol, C ₁₂ to C ₅₀ unsaturated or saturated hydrocarbons, diacyl phosphatidyl choline diacylphosphatidylcholine, fatty acid, phospholipid and lipopolyamine. &lt; RTI ID = 0.0 &gt; 18. &lt; / RTI &gt;
14. The method of claim 13,
Wherein said steroid derivative is selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesteryl formate, cortestanyl formate, and cholestanyl amine.
14. The method of claim 13,
Wherein the glyceride derivative is selected from mono-, di-, and tri-glycerides.
8. The method of claim 7,
Wherein the covalent bond represented by X and Y is a non-degradable or degradable bond.
17. The method of claim 16,
Wherein the non-degradable bond is an amide bond or a phosphorylated bond.
17. The method of claim 16,
Wherein the degradable linkage is a disulfide bond, an acid degradable bond, an ester bond, an anhydride bond, a biodegradable bond, or an enzyme degradable bond.
8. The method of claim 7,
The RNA construct may further comprise a ligand having a property of specifically binding to a receptor that promotes internalization of the target cell through receptor-mediated endocytosis (RME) to the hydrophilic substance Characterized by a double helixed RNA structure.
20. The method of claim 19,
The ligand may be selected from the group consisting of a target receptor-specific antibody, an aptamer, a peptide, a folate, N-acetyl Galactosamine (NAG), glucose and mannose Characterized by a double helixed RNA structure.
20. A method for producing a double stranded oligo RNA construct according to any one of claims 7 to 20, comprising the steps of:
(1) binding a hydrophilic material based on a solid support;
(2) synthesizing a single strand of RNA based on the solid support to which the hydrophilic substance is bound;
(3) covalently bonding a hydrophobic substance to the 5 'end of the RNA single strand;
(4) synthesizing a single strand of RNA having a sequence complementary to the sequence of the single strand of RNA;
(5) separating and purifying the single-stranded RNA-polymer structure and RNA from the solid support upon completion of synthesis; And
(6) preparing a double-stranded oligo RNA structure through annealing of a single strand of RNA having a sequence complementary to the prepared RNA-polymer structure.
22. The method of claim 21, wherein the solid support is CPG (Controlled Pore Glass).
22. The method according to claim 21, wherein the RNA single strand and the RNA single strand including the complementary sequence are in the form of a phosphate group bonded at the 5 'end.
22. The method of claim 21, wherein the solid support is further combined with a functional group.
20. A nanoparticle comprising a double helix oligo RNA construct according to any one of claims 7 to 20.
26. The method of claim 25,
Wherein the nanoparticles are composed of a mixture of double-stranded oligo RNA constructs comprising siRNA comprising different sequences.
A pharmaceutical composition for preventing or treating cancer, skin disease or inflammatory disease comprising the siRNA of claim 1, the double-stranded oligo RNA construct of claim 7, or the nanoparticle of claim 25 as an active ingredient.
28. The method of claim 27,
Wherein said cancer is selected from the group consisting of breast cancer, liver cancer, gastric cancer, colon cancer, pancreatic cancer, prostate cancer, breast cancer, ovarian cancer, kidney cancer and lung cancer.
28. The method of claim 27,
Wherein the skin disease is selected from the group consisting of psoriasis, atopic psoriasis and allergic skin diseases.
28. The method of claim 27,
Wherein said inflammatory disease is selected from the group consisting of rheumatoid arthritis, degenerative arthritis, osteoporosis, hyperimmunoglobulinemia, nephritis, chronic thyroiditis, Crohn's disease and pancreatitis.
27. A lyophilized form of formulation comprising the pharmaceutical composition of claim 27.
A siRNA according to any one of claims 1 to 6, a double stranded oligo RNA construct according to any one of claims 7 to 20, a nanoparticle according to any one of claims 25 to 26, Or a composition or formulation according to any one of claims 27 to 31 is administered to a subject in need of prevention or treatment.
33. The method of claim 32,
Wherein said cancer is selected from the group consisting of breast cancer, liver cancer, stomach cancer, colon cancer, pancreatic cancer, prostate cancer, ovarian cancer, kidney cancer and lung cancer.
32. The method of claim 31,
Wherein the skin disease is selected from the group consisting of psoriasis, atopic psoriasis and allergic skin diseases.
33. The method of claim 32,
Wherein said inflammatory disease is selected from the group consisting of rheumatoid arthritis, degenerative arthritis, osteoporosis, hyperimmunoglobulinemia, nephritis, chronic thyroiditis, Crohn's disease and pancreatitis.

Images