RU2810514C1 - Composition for prevention or treatment of disease associated with obesity, containing amphiregulin-specific double-chain oligonucleotide structure - Google Patents

Abstract

FIELD: pharmaceuticals.

SUBSTANCE: invention relates to a composition for the treatment or prevention of obesity. The use of a pharmaceutical composition containing an amphiregulin-specific double-stranded oligonucleotide, a double-stranded oligo-RNA that contains hydrophilic and hydrophobic compounds connected to an amphiregulin-specific double-stranded oligonucleotide, or nanoparticles containing a double-stranded oligo-RNA is proposed. The amphiregulin-specific double-stranded oligonucleotide contains a sequence selected from SEQ ID NO: 10, 11 and 12, and an antisense strand complementary to the sequence of the sense strand.

EFFECT: invention provides weight loss, a decrease in the nutritional efficiency coefficient, a decrease in subcutaneous fat, a decrease in visceral fat, a decrease in the area of adipocytes and inhibition of liver adipogenesis.

24 cl, 28 dwg, 10 tbl, 10 ex

Description

Field of technology to which the invention relates

The present invention relates to a composition for the prevention or treatment of diseases associated with obesity, containing an amphiregulin-specific double-stranded oligonucleotide structure and, in particular, to a double-stranded oligonucleotide capable of inhibiting the expression of amphiregulin in a very specific and highly effective manner, and to a composition for the prevention or treatment of diseases, associated with obesity, containing a double-stranded oligonucleotide structure containing a double-stranded oligonucleotide, and nanoparticles.

Information about the prior art

In 1995, Guo and Kemphues reported that not only sense RNA but also antisense RNA is effective in inhibiting gene expression in C. elegans, and since then studies have been carried out to identify the reason for this. In 1998, Fire et al. For the first time, the phenomenon was described in which the injection of double-stranded RNA (dsRNA) inhibits gene expression by specifically degrading its corresponding mRNA. This phenomenon was called RNA interference (RNAi). RNAi, a process that is used to inhibit gene expression, can demonstrate a distinct effect of inhibiting gene expression in a simple and inexpensive manner, and thus the range of applications of this technology has expanded.

Since this gene expression inhibition technology can regulate the expression of a specific gene, it can delete a specific gene associated with cancer, genetic disease or the like. at the mRNA level, and can be used as an important tool for the development of therapeutic agents for disease treatment and target validation. Methods for introducing a transgene for the target gene are disclosed as conventional methods for inhibiting the expression of target genes. These methods include a method of introducing a transgene in an antisense direction relative to a promoter and a method of introducing a transgene in an antisense direction relative to a promoter.

Such RNA-targeted RNA therapy is a method of removing the function of a gene of interest using oligonucleotides against the target RNA, and can be considered different from conventional methods in which therapeutic agents such as antibodies and small molecules primarily target proteins. RNA targeting approaches can be broadly divided into two types: double-stranded RNA-mediated RNAi and antisense oligonucleotides (ASOs). Clinical trials are currently underway by targeting RNA in various diseases.

An antisense oligonucleotide (hereinafter referred to as "ASO") is a short synthetic DNA designed to bind to a target gene according to Watson-Crick base pairing and can specifically inhibit the expression of a specific nucleotide sequence of a gene. Thus, antisense oligonucleotide is used to study the role of genes and to develop therapeutic agents that can treat diseases such as cancer at the molecular level. These ASOs have the advantage of being easy to obtain by establishing various targets for inhibiting gene expression, and studies have been conducted on the use of ASOs to inhibit oncogene expression and cancer cell growth. The process of inhibiting the expression of a particular gene by an ASO is accomplished either by binding the ASO to a complementary sequence of the mRNA to induce RNase H activity and remove the mRNA, or by interfering with the formation and development of the ribosomal complex for protein translation. Additionally, ASO has been reported to bind to genomic DNA to form a triple helix structure, thereby inhibiting gene transcription. ASO has the potential as described above, but for the use of ASO in clinical practice, it is required that the stability of ASO against nucleases be improved, and that ASO be efficiently delivered to target tissues or cells, thereby specifically binding to the nucleotide sequence of the target gene. In addition, the secondary and tertiary structures of genetic mRNA are important factors for the specific binding of ASO, and the region in which the formation of secondary structure of mRNA is reduced is highly advantageous for ASO access. Thus, efforts have been made to effectively achieve gene-specific inhibition not only in vitro but also in vivo by systematically analyzing the region in which mRNA secondary structure formation is reduced prior to ASO synthesis. These ASOs are more stable than siRNA, a type of RNA, and have the advantage of being readily soluble in water and saline. To date, the Federal Drug Administration (FDA) has approved three ASOs (Jessica, C., J Postdoc Res, 4:35-50, 2016).

Following the identification of the role of RNA interference (hereinafter referred to as “RNAi”), RNAi was found to act on sequence-specific mRNAs in various mammalian cell types (Barik, S., J Mol. Med. (2005) 83: 764 -773). When a long strand of double-stranded RNA is delivered into a cell, the delivered double-stranded RNA is converted into small interfering RNA (hereinafter referred to as “siRNA”), cleaved to 21-23 base pairs (bp) by the Dicer endonuclease. siRNA binds to the RNA-induced silencing complex (RISC) and inhibits target gene expression in a sequence-specific manner through a process in which the guide (antisense) strand recognizes and cleaves the target mRNA. Gene expression inhibition technology using siRNA is used to inhibit the expression of a target gene in target cells and observe the resulting change, and is also effectively used in research to identify the function of the target gene in target cells. In particular, inhibition of target gene function in infecting viruses or cancer cells can be effectively used to develop a treatment for a disease of interest. Through in vitro studies and in vivo studies using experimental animals, it has been reported that it is possible to inhibit the expression of a target gene using siRNA.

Bertrand et al. found that siRNA has a better inhibitory effect on mRNA expression in vitro and in vivo compared with an antisense oligonucleotide (ASO) against the same target gene, and that this effect is longer lasting. Moreover, regarding the mechanism of action, siRNA regulates the expression of the target gene in a sequence-specific manner by complementary binding to the target mRNA. Thus, siRNA has an advantage over conventional antibody-based drugs or chemical drugs (small molecule drugs) in that the range of subjects to which siRNA can be used can be significantly expanded.

siRNA has excellent effects and can be used in a wide range of applications, but to develop siRNA as a therapeutic agent, it is necessary to improve the in vivo stability of siRNA and its delivery efficiency into cells so that siRNA can be efficiently delivered to target cells. To improve in vivo stability and overcome the problems associated with siRNA stimulation of nonspecific innate immunity, intensive research has been carried out to modify certain nucleotides of the siRNA or its backbone to provide resistance to nucleases, or using viral vectors, liposomes or nanoparticles.

Delivery systems containing a viral vector, such as adenovirus or retrovirus, have high transfection efficiency but also strong immunogenicity and tumorigenicity. On the other hand, non-viral delivery systems containing nanoparticles have lower cellular delivery efficiency than viral delivery systems, but have advantages including high in vivo safety, target-specific delivery, efficient uptake and internalization of RNAi oligonucleotides into cells or tissues, and low cytotoxicity and immunostimulation. Thus, non-viral delivery systems are currently considered a more promising delivery method than viral delivery systems.

Among the non-viral delivery systems, nanocarrier methods are methods in which nanoparticles are formed using various polymers, such as liposomes and cationic polymer complexes, and in which siRNA is applied to such nanoparticles (i.e., nanocarriers) and delivered to cells. Among the methods using nanocarriers, frequently used methods include methods using polymer nanoparticles, polymer micelles, lipoplexes and the like. In particular, lipoplexes are composed of cationic lipids and function by interacting with anionic lipids of cellular endosomes to induce endosome destabilization, thereby enabling intracellular delivery of exosomes.

In addition, it is known that the effectiveness of siRNA in vivo can be increased by conjugating a chemical compound or the like to the terminal portion of the passenger (sense) strand of the siRNA, thereby providing it with improved pharmacokinetic properties (J. Soutschek, Nature 11; 432 (7014) :173-8, 2004). In this case, the stability of the siRNA varies depending on the properties of the chemical compound conjugated to the end of the sense (passenger) or antisense (guide) strand of the siRNA. For example, siRNA conjugated to a polymeric compound such as polyethylene glycol (PEG) reacts with the anionic phosphate group of the siRNA in the presence of a cationic compound to form a complex, thereby providing a carrier having improved siRNA stability. In particular, micelles composed of a polymer complex have a very small size and a very uniform size distribution compared to other drug delivery systems such as microspheres or nanoparticles, and form spontaneously. Thus, these micelles have the advantages that the quality of the micellar composition is easily controlled and reproducible.

To improve the efficiency of intracellular delivery of siRNA, a technology has been developed to ensure siRNA stability and increase the permeability of cell membranes to siRNA using an siRNA conjugate prepared by conjugating a hydrophilic compound (e.g., polyethylene glycol (PEG)), which is a biocompatible polymer, to the siRNA through a simple covalent bond. or linker-mediated covalent bond (Korean Patent No. 883471). However, even when siRNA is chemically modified and conjugated to polyethylene glycol (PEG) (PEGylation), it still has low stability in vivo and the disadvantage that it is not easy to deliver to the target organ. To overcome these disadvantages, a double-stranded oligo-RNA structure has been developed that contains hydrophilic and hydrophobic compounds linked to an oligonucleotide, in particular a double-stranded oligo-RNA such as siRNA. This structure forms self-assembled nanoparticles called SAMiRNA™ (Self Assembled Micelle Inhibitory RNA) through hydrophobic interaction of a hydrophobic compound (Korean Patent No. 1224828). SAMiRNA™ technology has advantages over traditional delivery technologies in that homogeneous nanoparticles that are very small in size can be obtained.

In particular, SAMiRNA™ technology uses PEG (polyethylene glycol) or HEG (hexaethylene glycol) as a hydrophilic compound. PEG, a synthetic polymer, is commonly used to increase the solubility of drugs, especially proteins, and to regulate the pharmacokinetic properties of drugs. PEG is a polydisperse material, and the polymer in one batch consists of the sum of varying numbers of monomers and thus shows a molecular weight distributed along a Gaussian curve. In addition, the homogeneity of the material is expressed as the polydispersity index (Mw/Mn). In other words, when PEG has a low molecular weight (3-5 kDa), it has a polydispersity index of about 1.01, and when PEG has a high molecular weight (20 kDa), it has a high polydispersity index of about 1.2, indicating that the uniformity of PEG decreases as its molecular weight increases. Thus, when PEG is conjugated to a pharmaceutical drug, there is a disadvantage that the polydispersity index of PEG is reflected on the conjugate, and therefore it is difficult to perform verification of one material. Because of this disadvantage, methods for the synthesis and purification of PEG have been improved to produce materials having a low polydispersity index. However, when PEG is conjugated to a compound having a low molecular weight, problems arise with respect to the polydispersity properties of the compound, including difficulties associated with confirming the conjugation.

Accordingly, in recent years, SAMiRNA™ technology (i.e., self-assembled nanoparticles) has been improved by forming a hydrophilic combination of double-stranded RNA structure (component of SAMiRNA™) into blocks of basic units, each containing from 1 to 15 monomers having the same molecular weight, and, if necessary, a linker, and if necessary, an appropriate number of such blocks is used. Thus, new types of delivery system technologies have been developed that are small in size and have significantly improved polydispersity compared to existing SAMiRNA™. It is already known that when siRNA is administered, siRNA is quickly degraded by various enzymes present in the blood, and therefore the efficiency of its delivery to target cells or tissues is low. Thus, variation in the stability and degree of expression inhibition depending on the target genes was also evident in the improved SAMiRNA™. Accordingly, in order to more stably and effectively inhibit the expression of a target gene using SAMiRNA™, which consists of advanced self-assembled nanoparticles, the present inventors attempted to enhance the expression inhibitory effect of SAMiRNA™ on the target gene and the stability of SAMiRNA™ by using a double-stranded oligonucleotide containing an ASO DNA sequence as the guide (sense) strand and the RNA sequence as the passenger (antisense) sequence.

Meanwhile, obesity is an important health problem worldwide and can lead to an increase in complications such as heart disease, type 2 diabetes and some types of cancer.

One of the main causes of obesity is excessive accumulation of visceral fat in the body [Carr DB, Diabetes. 2004 Aug;53(8):2087-94; Bouchard C, Int J Obes Relat Metab Disord 1996;20:420-7]. Visceral fat refers to the fat surrounding the internal organs, and visceral fat is mainly caused by genetic factors [Rosenberg B, Panminerva Med 2005; 47:229-44], race, physical activity, lifestyle and inflammatory factors [Deurenberg P, Int J Obes Relat Metab Disord 1998;22:1164-71]. In addition, it is known that the accumulation of visceral fat is highly expressed in Asians among representatives of various races [WHO Expert Consultation. Lancet 2004;363:157-63; Hu FB, N Engl J Med 2001;345:790-7], and overeating or drinking, less physical activity [Wannathee SG, Am J Clin Nutr 2003; 77:1312-7; Komiya H, Tohoku J Exp Med 2006;208:123-32], and smoking further increases the amount of visceral fat [Upadhyaya S, Adipocyte, 2014; 3(1): 39-45]. With the accumulation of visceral fat, the secretion of pro-inflammatory factors such as interleukin-6, tumor necrosis factor-alpha and monocyte chemoattractant protein-1 from visceral fat cells increases, causing various complications [Despres JP. Ann Med 2001;33:534-41]. Visceral fat causes metabolic disorders and cardiovascular diseases [Matsuzawa Y, Obes Res 1995;3 Suppl 5:645-7]. Increased accumulation of visceral fat leads to increased insulin resistance, and if visceral fat outweighs subcutaneous fat, cardiac function decreases and hypertension and circulatory diseases occur [Schaffler, Nat Clin Pract Gastroenterol Hepatol 005;2:273-80]. Visceral fat also causes digestive disorders and is known to cause fatty liver disease and non-alcoholic steatohepatitis [Busetto L, Diabetes Obes Metab 2005; 7:301-6]. Due to these factors, anti-inflammatory mechanisms are degraded as adiponectin levels decrease and promote the formation of fatty liver, causing non-alcoholic fatty liver disease. Visceral fat also causes many problems in respiratory diseases [Schapira DV, Cancer 1994; 74:632-9]. It is seen that as visceral fat outweighs subcutaneous fat, expiratory reserve volume decreases, causing restrictive pulmonary ventilation dysfunction. Visceral fat is also known to increase the incidence of breast cancer. Visceral fat is also known to be associated with an increased incidence of prostate cancer [Hsing AW, J Natl Cancer Inst 2001; 93:783-9] and colorectal cancer [Manson JE, N Engl J Med 1995; 333:677-85].

Treatment of visceral fat mainly consists of dietary restrictions, exercise and medication, but their effect is still insufficient [Diamantis T, Surg Obes Relat Dis, 2014; 10(1): 177-83; Kelley GA, J Obes, 2013; 2013783103 ; Rhines SD, S D Med, 2013; 66(11): 471, 73; Sharma M, Adolesc Health Med Ther, 2010; 19-19]. Therefore, reducing visceral fat can reduce the incidence of cardiovascular disease, metabolic disorders, diabetes and other diseases, thereby preventing complications and improving quality of life.

Accordingly, the inventors of the present invention conducted studies on the treatment of obesity by reducing visceral fat and as a result found that the use of a structure containing an amphiregulin-specific double-stranded oligonucleotide that specifically inhibits amphiregulin can significantly reduce visceral fat, including subcutaneous fat, in diabetic animal models.

In addition, the present inventors have found that the expression level of amphiregulin in epididymal fat is significantly high in an animal model of high-fat diet-induced obesity, and when the expression level of amphiregulin in an obese animal model is reduced using a structure containing amphiregulin- The specific double-stranded oligonucleotide according to the present invention can significantly reduce body weight, subcutaneous fat mass and visceral fat mass, suppress the increase in adipose tissue cell size, reduce the expression of amphiregulin in adipose tissue and inhibit the accumulation of fat in the liver, thereby completing the present invention related to for use against obesity of a structure containing an amphiregulin-specific double-stranded oligonucleotide.

Brief description of the invention

The object of the present invention is to provide a new pharmaceutical composition for the treatment or prevention of obesity.

To achieve the above object, the present invention provides a pharmaceutical composition for the treatment or prevention of obesity containing any component selected from the group consisting of:

(i) an amphiregulin-specific double-stranded oligonucleotide containing a sense strand that contains any sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12, and an antisense strand containing a sequence complementary to the sequence of the sense strand;

(ii) an amphiregulin-specific double-stranded oligonucleotide structure containing the structure represented by the following structural formula (1):

Structural formula (1)

A-X-R-Y-B,

wherein A is a hydrophilic compound, B is a hydrophobic compound, X and Y are each independently a single covalent bond or a linker-mediated covalent bond, and R is an amphiregulin-specific double-stranded oligonucleotide (i); And

(iii) nanoparticles containing an amphiregulin-specific double-stranded oligonucleotide structure (ii).

The present invention also provides a lyophilized formulation containing a pharmaceutical composition.

The present invention also provides a method for preventing or treating obesity, comprising the step of administering to a subject in need of preventing or treating obesity any component selected from the group consisting of:

(i) an amphiregulin-specific double-stranded oligonucleotide containing a sense strand that contains any sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12, and an antisense strand containing a sequence complementary to the sequence of the sense strand;

(ii) an amphiregulin-specific double-stranded oligonucleotide structure containing the structure represented by the following structural formula (1):

Structural formula (1)

A-X-R-Y-B,

wherein A is a hydrophilic compound, B is a hydrophobic compound, X and Y are each independently a single covalent bond or a linker-mediated covalent bond, and R is an amphiregulin-specific double-stranded oligonucleotide (i); And

(iii) nanoparticles containing an amphiregulin-specific double-stranded oligonucleotide structure (ii).

The present invention also provides a pharmaceutical composition for use in a method of preventing or treating obesity, wherein the pharmaceutical composition contains any component selected from the group consisting of:

(i) an amphiregulin-specific double-stranded oligonucleotide containing a sense strand that contains any sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12, and an antisense strand containing a sequence complementary to the sequence of the sense strand;

(ii) an amphiregulin-specific double-stranded oligonucleotide structure containing the structure represented by the following structural formula (1):

Structural formula (1)

A-X-R-Y-B,

wherein A is a hydrophilic compound, B is a hydrophobic compound, X and Y are each independently a single covalent bond or a linker-mediated covalent bond, and R is an amphiregulin-specific double-stranded oligonucleotide (i); And

(iii) nanoparticles containing an amphiregulin-specific double-stranded oligonucleotide structure (ii).

The present invention provides the use of any of the components selected from the group consisting of:

(i) an amphiregulin-specific double-stranded oligonucleotide containing a sense strand that contains any sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12, and an antisense strand containing a sequence complementary to the sequence of the sense strand;

(ii) an amphiregulin-specific double-stranded oligonucleotide structure containing the structure represented by the following structural formula (1):

Structural formula (1)

A-X-R-Y-B,

wherein A is a hydrophilic compound, B is a hydrophobic compound, X and Y are each independently a single covalent bond or a linker-mediated covalent bond, and R is an amphiregulin-specific double-stranded oligonucleotide (i); And

(iii) nanoparticles containing an amphiregulin-specific double-stranded oligonucleotide structure (ii) in the manufacture of a medicament for the prevention or treatment of obesity.

Brief description of drawings

In fig. Figure 1 shows the results of a screen for 1257 SAMiRNAs targeting human amphiregulin.

In fig. Figure 2 shows the nanoparticle size distribution of double-stranded oligo DNA/RNA hybrids containing the selected amphiregulin-specific double-stranded oligonucleotide. (a): SAMi-AREG#10; (b): SAMi-AREG#11; and (c): SAMi-AREG#12.

In fig. 3 shows graphs showing the results of quantitative analysis of amphiregulin mRNA expression levels described in Example 4. In this case, the lung cancer cell line A549 was treated with various concentrations (200 and 600 nM) of SAMiRNA having each of the sequences of SEQ ID NO: 1-14 herein invention as the sense strand, and the relative expression levels of amphiregulin mRNA (%) in cells were analyzed.

In fig. 4 shows graphs showing the results of quantitative analysis of amphiregulin mRNA expression levels described in Example 5. In this case, the lung cancer cell line A549 was treated with various concentrations (12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM, 600 nM and 1200 nM) SAMiRNA having the sequence SEQ ID NO: 10 of the present invention as the sense strand, the relative expression levels of amphiregulin mRNA (%) in cells were analyzed (Fig. 4a), and the IC ₅₀ value of SAMiRNA was determined (Fig. 4b).

In fig. 5 shows graphs showing the results of quantitative analysis of amphiregulin mRNA expression levels described in Example 5. In this case, the lung cancer cell line A549 was treated with various concentrations (12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM, 600 nM and 1200 nM) SAMiRNA having the sequence SEQ ID NO: 11 of the present invention as the sense strand, the relative expression levels of amphiregulin mRNA (%) in cells were analyzed (Fig. 5a), and the IC ₅₀ value of SAMiRNA was determined (Fig. 5b).

In fig. 6 shows graphs showing the results of quantitative analysis of amphiregulin mRNA expression levels described in Example 5. In this case, the lung cancer cell line A549 was treated with various concentrations (12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM, 600 nM and 1200 nM) SAMiRNA having the sequence SEQ ID NO: 12 of the present invention as the sense strand, the relative expression levels of amphiregulin mRNA (%) in cells were analyzed (Fig. 6a), and the IC ₅₀ value of SAMiRNA was determined (Fig. 6b).

In fig. 7 are graphs showing the results of the innate immune response test against amphiregulin candidate sequences described in Example 6. In this case, peripheral blood mononuclear cells (PBMCs) were treated with 2.5 μM amphiregulin-specific SAMiRNA having each of the sequences SEQ ID NO: 10 (AR-1), 11 (AR-2) and 12 (AR3) of the present invention as the sense strand, analyzed the relative increase in the mRNA expression levels of innate immunity-related cytokines caused by amphiregulin-specific SAMiRNA, and assessed the in vitro cytotoxicity with using human peripheral blood mononuclear cells. (a): DNA/RNA hybrid SAMiRNA and (b): RNA/RNA hybrid SAMiRNA.

In fig. 8 is a graph showing the results of a quantitative analysis of the amphiregulin mRNA expression levels described in Example 7. This case presents a comparative analysis of the relative mRNA expression levels (%) of amphiregulin in a double-stranded oligo-DNA/RNA hybrid and an RNA/RNA hybrid, each of which contains selected amphiregulin-specific SAMiRNAs. Specifically, the lung cancer cell line A549 was treated with various concentrations (200 nM, 600 nM and 1200 nM) of SAMiRNA having each of SEQ ID NOs: 10 (AR-1), 11 (AR-2) and 12 (AR-3 ) of the present invention as the sense strand, and comparative analysis of the relative expression levels of amphiregulin mRNA (%) was carried out.

In fig. Figure 9 shows the results of a screen for 237 SAMiRNAs targeting murine amphiregulin and 9 candidate sequences selected from them.

In fig. 10A are graphs showing the results of quantitative analysis of amphiregulin mRNA expression levels described in Example 8. In this case, the mouse lung fibroblast cell line MLg was treated with various concentrations (200 and 500 nM) of SAMiRNA having each of the sequences SEQ ID NOs: 19, 20 and 21 of the present invention as the sense strand, and the relative expression levels of amphiregulin mRNA (%) in the cells were analyzed.

In fig. 10B are graphs showing the results of quantitative analysis of amphiregulin mRNA expression levels described in Example 7. In this case, the mouse lung epithelial cell line LA-4 was treated with various concentrations (200 and 500 nM) of SAMiRNA having each of the sequences SEQ ID NOs: 19. 20 and 21 of the present invention as the sense strand, and the relative expression levels of amphiregulin mRNA (%) in the cells were analyzed.

In fig. 11 is a graph showing changes in body weight of the control group and the experimental groups in the mouse animal model experiment according to the present invention.

In fig. 12 is a graph showing changes in food intake of the control group and the experimental groups in the mouse animal model experiment according to the present invention.

In fig. 13 is a graph showing changes in water consumption of the control group and the experimental groups in the mouse animal model experiment according to the present invention.

In fig. 14 shows the results of measuring the proportion of subcutaneous fat in each of the control group and experimental groups in the mouse animal model experiment according to the present invention.

In fig. 15 shows the results of measuring the proportion of visceral fat in the control group and experimental groups in the mouse animal model experiment in accordance with the present invention.

In fig. 16 are photographs showing the effect of the structure of the present invention on reducing visceral fat in a mouse animal model of the present invention.

In fig. 17 shows the results of fasting blood glucose measurements in whole blood 8 weeks before sacrifice of the control group and experimental groups in a mouse animal model experiment according to the present invention.

In fig. 18 shows the results of measuring serum glucose levels 8 weeks before sacrifice of the control group and experimental groups in a mouse animal model experiment in accordance with the present invention.

In fig. 19 is a graph showing the results of analysis of the expression level of amphiregulin in epididymal fat after killing the control group and the experimental group after 12 weeks of high-fat diet feeding in a mouse model of high-fat diet-induced obesity according to the present invention.

In fig. 20 is a graph showing changes in body weight of the control group and the experimental group in the high-fat diet-fed obese mouse model experiment of the present invention.

In fig. 21a is a graph showing the average food intake of each of the control group and the experimental group in the high-fat diet-induced obesity mouse model experiment of the present invention.

In fig. 21b is a graph showing the average water consumption of each of the control group and the experimental group in the high-fat diet-induced obesity mouse model experiment of the present invention.

In fig. 22 is a graph showing the nutritional efficiency ratio (%) of each of the control group and the experimental group in the high-fat diet-induced obesity mouse model experiment of the present invention.

In fig. 23a shows the measurement results of the weight of the subcutaneous fat pad (SFP), epididymal fat pad (EFP), perirenal fat pad (PFP), mesenteric fat pad (MFP), subcutaneous fat pad (SFP), epididymal fat pad (EFP), perirenal fat pad (PFP) and mesenteric fat pad (MFP) each of the control group and the experimental group in the high-fat diet-induced obesity mouse model experiment of the present invention.

In fig. 23a shows the ratios (%) obtained by dividing the weight of the subcutaneous fat pad (SFP), epididymal fat pad (EFP), perirenal fat pad (PFP), mesenteric fat pad (MFP), subcutaneous fat pad (SFP), epididymal fat pad ( EFP), perirenal fat pad (PFP) and mesenteric fat pad (MFP) of each of the control group and the experimental group on body weight in a high-fat diet-induced obesity mouse model experiment according to the present invention.

In fig. 24b shows the results of measuring the ratio of each of subcutaneous fat and visceral fat to the total weight of a mouse in each of the control group and the experimental group in the high-fat diet-induced obesity mouse model experiment of the present invention.

In fig. 25 shows micro-CT images comparing the effect of reducing subcutaneous fat and visceral fat between the control group and the experimental group in the high-fat diet-induced obesity mouse model experiment of the present invention, and presents graphs showing the volume of each subcutaneous fat and visceral fat.

In fig. 26 shows histological images comparing the reduction effect of subcutaneous fat pad (SFP), epididymal fat pad (EFP), perirenal fat pad (PFP) and mesenteric fat pad (MFP) between the control group and the experimental group in an experiment in a mouse model of obesity-induced obesity. high fat diet according to the present invention, and graphs showing the area of adipocytes in each group are presented.

In fig. 27a shows images comparing the effect of reducing fat accumulation in liver tissue between the control group and the experimental group in the high-fat diet-induced obesity mouse model experiment of the present invention.

In fig. 27b is a quantitative graph showing the effect of reducing fat accumulation in liver tissue between the control group and the experimental group in the high-fat diet-induced obesity mouse model experiment of the present invention.

In fig. 28 shows graphs comparing the effect of reducing amphiregulin mRNA levels in the subcutaneous fat pad (SFP), epididymal fat pad (EFP), and perinephric fat pad (PFP) between the control group and the experimental group in a mouse model of high diet-induced obesity. fats in accordance with the present invention.

Detailed Description and Preferred Embodiments of the Invention

Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this disclosure pertains. In general, the nomenclature used in the present description is well known and widely used in the art.

In the present invention, it has been found that when the amphiregulin-specific double-stranded oligonucleotide structure is administered to an animal model of type 2 diabetes, it exhibits the effect of significantly reducing subcutaneous fat and visceral fat, which indicates that the amphiregulin-specific double-stranded oligonucleotide structure can be used as a composition for prevention or treatment of obesity.

Moreover, in the present invention, it has been found that when the amphiregulin-specific double-stranded oligonucleotide structure is administered to an induced obesity animal model, it exhibits the effects of weight loss, reduction of nutritional efficiency ratio, reduction of subcutaneous fat, reduction of visceral fat, reduction of adipocyte area and inhibition of liver adipogenesis. .

Thus, in one aspect, the present invention is directed to a pharmaceutical composition for the treatment or prevention of obesity, comprising any component selected from the group consisting of:

(i) an amphiregulin-specific double-stranded oligonucleotide containing a sense strand that contains any sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12, and an antisense strand containing a sequence complementary to the sequence of the sense strand;

(ii) an amphiregulin-specific double-stranded oligonucleotide structure containing the structure represented by the following structural formula (1):

Structural formula (1)

A-X-R-Y-B,

wherein A is a hydrophilic compound, B is a hydrophobic compound, X and Y are each independently a single covalent bond or a linker-mediated covalent bond, and R is an amphiregulin-specific double-stranded oligonucleotide (i); And

(iii) nanoparticles containing an amphiregulin-specific double-stranded oligonucleotide structure (ii).

The sequences of SEQ ID NOs: 10, 11 and 12, each contained in the preferred double-stranded oligonucleotide provided in accordance with the present invention, are as follows:

5'-CACCTACTCTGGGAAGCGT-3' (SEQ ID NO: 10),

5'-ACCTACTCTGGGAAGCGTG-3' (SEQ ID NO: 11),

5'-CTGGGAAGCGTGAACCATT-3' (SEQ ID NO: 12).

As used herein, the term “double-stranded oligonucleotide” includes all materials having general RNAi (RNA interference) activity, and those skilled in the art will appreciate that an mRNA-specific double-stranded oligonucleotide that encodes an amphiregulin protein also includes an amphiregulin-specific shRNA and so on. That is, the oligonucleotide may be siRNA, shRNA or miRNA.

In addition, those skilled in the art will appreciate that an amphiregulin-specific siRNA that contains a sense strand and an antisense strand, or an antisense oligonucleotide, each containing a sequence resulting from the substitution, deletion or insertion of one or more nucleotides in the sense strand containing any a sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12, or its complementary antisense strand, is also included within the scope of the present invention, provided that its specificity for amphiregulin is maintained.

In the present invention, the sense or antisense strand may independently be DNA or RNA. In addition, the sense and antisense strands may be in the form of a hybrid, in which the sense strand is DNA and the antisense strand is RNA, or the sense strand is RNA and the antisense strand is DNA.

In the present invention, SEQ ID NOs: 10, 11 and 12 are in DNA form, but when RNA form is used, SEQ ID NOs: 10, 11 and 12 may be their corresponding RNA sequences, that is, sequences in which T is replaced by U.

In addition, the double-stranded oligonucleotide according to the present invention includes not only the case where the sense strand of the sequence is completely complementary (completely identical to) the binding site(s) of the amphiregulin gene, but also the case where the sense strand is partially complementary (not identical to ) binding site(s), as long as specificity for amphiregulin is maintained.

A double-stranded oligonucleotide in accordance with the present invention may contain at the 3' end of one or both strands an overhang containing one or more unpaired nucleotides.

In the present invention, the sense strand or antisense strand preferably consists of 19 to 31 nucleotides, but is not limited to.

In the present invention, a double-stranded oligonucleotide containing a sense strand that contains any sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12, and an antisense strand containing a sequence complementary thereto, may be specific for amphiregulin, but the present invention it is not limited to this.

In the present invention, the sense strand or antisense strand of a double-stranded oligonucleotide may contain various chemical modifications to increase its stability in vivo or impart nuclease resistance and reduce nonspecific immune responses. The chemical modification may be one or more modifications selected, but not limited to, from the group consisting of the following chemical modifications: a modification in which the OH group at the 2' carbon position in the sugar structure of one or more nucleotides is replaced by any group , selected from the group consisting of a methyl group (-CH ₃ ), a methoxy group (-OCH ₃ ), an amino group (-NH ₂ ), fluorine (-F), -O-2-methoxyethyl group, -O-propyl group, - O-2-methylthioethyl group, -O-3-aminopropyl group, -O-3-dimethylaminopropyl group, -ON-methylacetamido group and -O-dimethylamidooxyethyl group; modification in which oxygen in the sugar structure of nucleotides is replaced by sulfur; modifying the nucleotide bonds to any bond selected from the group consisting of a phosphorothioate bond, a boranophosphate bond and a methylphosphonate bond; modification to PNA (peptide nucleic acid), LNA (locked nucleic acid) or UNA (unlocked nucleic acid); and modification of the DNA-RNA hybrid (Ann. Rev. Med. 55, 61-65 2004; US 5.660.985; US 5,958,691; US 6.531.584; US 5,808,023; US 6.326.358; US 6.175.001; Bioorg. Med. Chem. 39- 1143, 2003; RNA, 9:1034-1048, 2003; Nucleic Acid Res. 31:589-595, 2003; Nucleic Acids Research, 38(17) 5761-773, 2010; Nucleic Acids Research, 39(5):1823 -1832, 2011).

In the present invention, one or more phosphate groups, preferably one to three phosphate groups, may be associated with the 5' end of the antisense strand of the double-stranded oligonucleotide.

In another aspect, the present invention is directed to a double-stranded oligonucleotide structure having the structure represented by the following structural formula (1), wherein A is a hydrophilic compound, B is a hydrophobic compound, X and Y are each independently a single covalent bond or a linker-mediated covalent bond bond, and R is a double-stranded oligonucleotide.

In a preferred embodiment, the double-stranded oligonucleotide structure containing the amphiregulin-specific sequence according to the present invention preferably has the structure represented by the following structural formula (1):

Structural formula (1)

A-X-R-Y-B,

wherein A is a hydrophilic compound, B is a hydrophobic compound, X and Y are each independently a single covalent bond or a linker-mediated covalent bond, and R is an amphiregulin-specific double-stranded oligonucleotide.

The double-stranded oligonucleotide of the present invention is preferably in the form of a DNA-RNA hybrid, siRNA, shRNA, or miRNA, but is not limited to, and may also include a single-stranded miRNA inhibitor that may act as antagonist against miRNA.

The double-stranded oligonucleotide of the present invention will now be described with emphasis on RNA, but those skilled in the art will appreciate that the present invention may also be applied to other double-stranded oligonucleotides having the same characteristics as the double-stranded oligonucleotide of the present invention.

More preferably, the double-stranded oligonucleotide structure containing the amphiregulin-specific double-stranded oligonucleotide of the present invention has a structure represented by the following structural formula (2):

Structural formula (2)

where A, B, X and Y have the meanings given above in structural formula (1), S represents the sense strand of an amphiregulin-specific double-stranded oligonucleotide, and AS represents the antisense strand of an amphiregulin-specific double-stranded oligonucleotide.

More preferably, the double-stranded oligonucleotide structure containing the amphiregulin-specific double-stranded oligonucleotide has a structure represented by the following structural formula (3) or (4):

Structural formula (3)

Structural formula (4)

where A, B, S, AS, X and Y are as defined in structural formula (2) above, and 5' and 3' represent the 5' end and 3' end, respectively, of the sense strand of the amphiregulin-specific double-stranded oligonucleotide.

The hydrophilic compound may be selected from the group consisting of, but is not limited to, polyethylene glycol (PEG), polyvinylpyrrolidone and polyoxazoline.

It will be appreciated by those skilled in the art that one to three phosphate groups may be associated with the 5' end of the antisense strand of a double-stranded RNA oligonucleotide structure containing the amphiregulin-specific siRNA shown in structural formula (1) to (4), and that shRNA can be used instead of RNA.

The hydrophilic compound in structural formula (1) to structural formula (4) above is preferably a polymer compound with a molecular weight of 200 to 10,000, more preferably a polymer compound with a molecular weight of 1000 to 2000. For example, it is preferable to use a nonionic a hydrophilic polymer compound such as polyethylene glycol, polyvinylpyrrolidone or polyoxazoline, without needing to be limited.

Particularly, the hydrophilic compound (A) with structural formula (1) - structural formula (4) can be used in the form of hydrophilic blocks, as shown in the following structural formulas (5) or (6), and a suitable amount (n in structural formula (5) or (6)) such hydrophilic blocks can be used as needed, thereby overcoming the problems associated with polydisperse properties that can arise when using conventional synthetic polymer compounds:

Structural formula (5)

(A' _m -J) _n

Structural formula (6)

(JA' _m ) _n

where A' is a hydrophilic monomer, J is a linker that joins m hydrophilic monomers together or connects m hydrophilic monomers to a double-stranded oligonucleotide, m is an integer ranging from 1 to 15, n is an integer ranging from 1 to 10, and the repeat unit represented by (A' _m -J) or (JA _m ') corresponds to the main unit of the hydrophilic block.

When the hydrophilic block shown in structural formula (5) or (6) above is used, the double-stranded oligonucleotide structure containing the amphiregulin-specific oligonucleotide according to the present invention may have the structure represented by the following structural formula (7) or (8):

Structural formula (7)

(A' _m -J) _n -XRYB,

Structural formula (8)

(J-A' _m ) _n -XRYB,

where X, R, Y and B have the meanings defined in structural formula (1) above, and A', J, m and n have the meanings defined in structural formulas (5) and (6) above.

As the hydrophilic monomer (A') in structural formulas (5) and (6) above, one of the nonionic hydrophilic polymers can be used without limitation as long as it is compatible with the purpose of the present invention. Preferably, a monomer selected from compounds (1) to (3) presented in Table 1 below can be used. More preferably, a monomer of compound (1) can be used. In compound (1), G may preferably be selected from O, S and NH.

Particularly among hydrophilic monomers, the monomer represented by compound (1) is very suitable for obtaining the structure according to the present invention because the monomer has the advantages that various functional groups can be introduced into the monomer, and the monomer induces a small immune response due to good affinity in vivo and excellent biocompatibility, can improve the in vivo stability of the double-stranded oligonucleotide contained in the structure represented by structural formula (7) or (8), and can increase the delivery efficiency of the double-stranded oligonucleotide.

Table 1. Structure of hydrophilic monomers used in the present invention Connection (1) Connection (2) Connection (3) G represents O, S or NH

The total molecular weight of the hydrophilic compound in structural formulas (5) to (8) is preferably in the range from 1000 to 2000. For example, when the compound (1) in structural formula (7) and structural formula (8) is hexaethylene glycol, then there is a compound in which G is O and m is 6, the number of repeats (n) is preferably 3-5 since the hexaethylene glycol spacer has a molecular weight of 344. In particular, the present invention is characterized in that a suitable number (denoted n) of repeats hydrophilic group units (hydrophilic blocks) represented by (A' _m -J) or (J-A' _m ) _n in structural formula (5) and structural formula (6) can be used as required. The hydrophilic monomer J and linker J contained in each hydrophilic block may be the same or different in the hydrophilic blocks. In other words, when using 3 hydrophilic blocks (n = 3), the hydrophilic monomer of compound (1), the hydrophilic monomer of compound (2) and the hydrophilic monomer of compound (3) can be used in the first, second and third blocks, respectively, assuming that in All hydrophilic blocks can use different monomers. Alternatively, any hydrophilic monomer selected from the hydrophilic monomers of compounds (1)-(3) can also be used in all hydrophilic blocks. Likewise, the same linker can be used as the linker that mediates the binding of the hydrophilic monomer in the hydrophilic blocks, or different linkers can be used in the hydrophilic blocks. In addition, m, which represents the amount of hydrophilic monomers, may also be the same or different between hydrophilic blocks. In other words, the first hydrophilic block has three hydrophilic monomers connected (m=3), the second hydrophilic block has five hydrophilic monomers connected (m=5), and the third hydrophilic block has four hydrophilic monomers connected (m=4), assuming that in hydrophilic blocks can use different amounts of hydrophilic monomers. Alternatively, the same amount of hydrophilic monomers can also be used in all hydrophilic blocks.

Moreover, in the present invention, the linker (J) is preferably selected from the group consisting of -PO ₃ -, -SO ₃ - and -CO ₂ -, but is not limited to. Those skilled in the art will appreciate that any linker selected based on the hydrophilic monomer used can be used as long as it is compatible with the purpose of the present invention.

The hydrophobic compound (B) in structural formulas (1) - (4), structural formula (7) and structural formula (8) functions to form nanoparticles consisting of the oligonucleotide structure shown in structural formulas (1) - (4), structural formula (7) and structural formula (8) through hydrophobic interactions. The hydrophobic compound preferably has a molecular weight of from 250 to 1000 and may be any compound selected from the group consisting of a steroid derivative, a glyceride derivative, a glycerol ether, a polypropylene glycol, an unsaturated or saturated C ₁₂ -C ₅₀ hydrocarbon, a diacylphosphatidylcholine, a fatty acid, phospholipid, lipopolyamine, lipid, tocopherol and tocotrienol, but not limited to. Those skilled in the art will appreciate that any hydrophobic compound can be used as long as it is compatible with the purpose of the present invention.

The steroid derivative may be selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesteryl formate, cholestanyl formate and cholesterolylamine, and the glyceride derivative may be selected from mono-, di- and triglycerides. and so on. Herein, the glyceride fatty acid is preferably a C ₁₂ -C ₅₀ unsaturated or saturated fatty acid.

In particular, among the hydrophobic compounds, saturated or unsaturated hydrocarbon or cholesterol is preferably used since they can be easily linked in the step of synthesizing the double-stranded oligonucleotide structure according to the present invention. Most preferably, a C ₂₄ hydrocarbon is used, especially a hydrophobic hydrocarbon containing a disulfide bond.

The hydrophobic compound may be associated with the distal end of the hydrophilic compound and may be associated with any position on the sense or antisense strand of the double-stranded oligonucleotide.

The hydrophilic compound or hydrophobic compound in structural formulas (1) to (4), (7) and (8) in accordance with the present invention is linked to the amphiregulin-specific oligonucleotide by a single covalent bond or a linker-mediated covalent bond (X or Y). The linker that mediates the covalent bond is covalently coupled to a hydrophilic or hydrophobic compound at the end of the amphiregulin-specific oligonucleotide and is not particularly limited as long as it provides a cleavable bond in a particular environment if desired. Thus, the linker used in the present invention can be any compound that is attached to activate an amphiregulin-specific double-stranded oligonucleotide and/or a hydrophilic (or hydrophobic) compound in the process of preparing the double-stranded oligonucleotide structure in accordance with the present invention. A covalent bond can be either a non-cleavable bond or a cleavable bond. As used herein, examples of a non-cleavable bond include, but are not limited to, an amide bond and a phosphate bond, and examples of a cleavable bond include, but are not limited to, a disulfide bond, an acid-cleavable bond, an ester bond, an anhydride bond, a biodegradable bond, and an enzymatically cleavable bond.

In addition, as the amphiregulin-specific double-stranded oligonucleotide represented by R (or S and AS) in structural formulas (1)-(4), (7) and (8), any double-stranded oligonucleotide capable of specifically binding to with amphiregulin mRNA. Preferably, the amphiregulin-specific double-stranded oligonucleotide of the present invention contains a sense strand containing any sequence selected from SEQ ID NOs: 10, 11 and 12, and an antisense strand containing a sequence complementary to the sequence of the sense strand.

In addition, in the double-stranded oligonucleotide structure containing the amphiregulin-specific double-stranded oligonucleotide in accordance with the present invention, an amino group or a polyhistidine group can be further introduced at the terminal portion of the hydrophilic compound associated with the oligonucleotide in the structure.

This facilitates the intracellular uptake and endosomal exit of the carrier containing the double-stranded oligonucleotide structure containing the amphiregulin-specific double-stranded oligonucleotide in accordance with the present invention, and it has already been reported that the introduction of an amino group and a polyhistidine group can be used to facilitate the intracellular uptake and endosomal exit of the carriers, such as quantum dots, dendrimers or liposomes.

In particular, it is known that a primary amino group introduced at the end or outside of the carrier is protonated at biological pH, thereby forming a conjugate due to interaction with a negatively charged gene, and that exit from endosomes is facilitated by an internal tertiary amine, which has a buffering effect at low temperatures. pH after intracellular uptake, whereby the carrier can be protected from lysosomal degradation (Gene Delivery and Expression Inhibition Using Polymer-Based Hybrid Material, Polymer Sci. Technol., Vol. 23, No. 3, pp 254-259).

In addition, the essential amino acid histidine is known to have an imidazole ring (pKa = 6.04) on the (-R) residue and thus effectively increases the buffering capacity in endosomes and lysosomes, and thus modification with histidine can be used to improve exit efficiency from endosomes in non-viral gene carriers, including liposomes (Novel histidine-conjugated galactosylated cationic liposomes for efficient hepatocyte selective gene transfer in human hepatoma HepG2 cells. J. Controlled Release 118, pp. 262-270).

The amino group or polyhistidine group can be connected to a hydrophilic compound or hydrophilic block through one or more linkers.

By introducing an amino group or a polyhistidine group into the hydrophilic compound of the double-stranded oligonucleotide structure represented by structural formula (1) in accordance with the present invention, the RNA structure may have the structure shown in the following structural formula (9):

Structural formula (9)

PJ ₁ -J ₂ -AXRYB,

where A, B, R, X and Y have the meanings given above in structural formula (1), P represents an amino group or a polyhistidine group, and J1 and J2 represent linkers, each of which can be independently selected from a single covalent bond, PO ₃ ^- , SO ₃ , CO ₂ , C _2-12 alkyl, alkenyl and alkynyl, but not limited to. Those skilled in the art will appreciate that any linkers selected to suit the hydrophilic compound used herein may be used as J ₁ and J ₂ as long as they are compatible with the purpose of the present invention.

When introducing an amino group, preferably J ₂ is a single covalent bond or PO ₃ ^- and J ₁ is C ₆ alkyl, but is not limited to.

In addition, when introducing a polyhistidine group, preferably J ₂ in structural formula (9) is a single covalent bond or PO ₃ ^- and J ₁ is compound (4), but is not limited to.

Connection (4)

In addition, when the hydrophilic compound of the double-stranded oligonucleotide structure shown in structural formula (9) is a hydrophilic block represented by structural formula (5) or (6), and when an amino group or a polyhistidine group is introduced therein, the double-stranded oligonucleotide structure can have the structure , represented by the following structural formula (10) or (11):

Structural formula (10)

PJ ₁ -J ₂ - (A' _m -J) _n -XRYB,

Structural formula (11)

PJ ₁ -J ₂ - (J-A' _m ) _n -XRYB,

where X, R, Y, B, A', J, m and n have the meanings defined above in structural formula (5) or (6), and P, J ₁ and J ₂ have the meanings defined above in structural formula ( 9).

In particular, the hydrophilic compound in structural formula (10) and structural formula (11) is preferably linked to the 3' end of the sense strand of the amphiregulin-specific double-stranded oligonucleotide. In this case, structural formulas (9)-(11) can correspond to the following structural formulas (12)-(14):

Structural formula (12)

Structural formula (13)

Structural formula (14)

where X, R, Y, B, A, A' J, m, n, P, J ₁ and J ₂ have the meanings defined above in structural formulas (9)-(11), and 5' and 3' mean 5 '-end and 3'-end of the sense strand of an amphiregulin-specific double-stranded oligonucleotide.

The amino group that can be introduced in the present invention may be a primary, secondary or tertiary amino group. In particular, a primary amino group is preferably used. The introduced amino group may be present as an amine salt. For example, the salt of the primary amino group may be present in the form of NH ₃ ⁺ .

Moreover, the polyhistidine group that can be introduced in the present invention preferably contains 3 to 10 histidines, more preferably 5 to 8 histidines, and most preferably 6 histidines. In addition to histidine, one or more cysteines may be included.

Meanwhile, when the targeting moiety is provided in a double-stranded oligonucleotide structure containing the amphiregulin-specific oligonucleotide according to the present invention and nanoparticles formed therefrom, it can facilitate efficient delivery of the structure or nanoparticles to target cells, such that the structure or nanoparticles can be delivered to target cells even at relatively low concentrations, where they will exert a strong effect on regulating the expression of target genes. In addition, the targeting moiety may prevent nonspecific delivery of the amphiregulin-specific double-stranded oligonucleotide to other organs and cells.

Accordingly, the present invention provides a double-stranded oligo-RNA structure in which a ligand (L), in particular a ligand having the property of specifically binding to a receptor that enhances internalization into target cells through receptor-mediated endocytosis (RME), is further associated with the structure, represented by any of the structural formulas (1)-(4), (7) and (8). For example, the structure in which the ligand is bound to the double-stranded oligo-RNA structure represented by structural formula (1) is the structure shown in the following structural formula (15):

Structural formula (15)

(L _i -Z)-AXRYB,

where A, B, X and Y have the meanings defined above in structural formula (1), L is a ligand having the property of specifically binding to a receptor enhancing internalization into the target cell by receptor-mediated endocytosis (RME), and "i" is an integer ranging from 1 to 5, preferably from 1 to 3.

The ligand in structural formula (15) may preferably be selected from: target receptor-specific antibodies, aptamers and peptides having the property of RME to enhance internalization into the target cell; folate (the term “folate” is generally used interchangeably with folic acid, and the term “folate” as used herein means folate that is naturally occurring or in an activated state in the human body); and chemical compounds including, but not limited to, hexosamines such as N-acetylgalactosamine (NAG) and sugars or carbohydrates such as glucose and mannose.

In addition, the hydrophilic compound (A) in structural formula (15) above can be used in the form of a hydrophilic block represented by structural formula (5) or (6).

In yet another aspect, the present invention provides a method for preparing a double-stranded oligonucleotide structure comprising an amphiregulin-specific double-stranded oligonucleotide.

For example, a method for producing a double-stranded oligonucleotide structure containing an amphiregulin-specific double-stranded oligonucleotide in accordance with the present invention may include the following steps:

(1) binding the hydrophilic compound to the solid support;

(2) synthesis of a single strand of oligonucleotide on a solid support associated with a hydrophilic compound;

(3) covalent binding of a hydrophobic compound to the 5' end of a single strand of the oligonucleotide;

(4) synthesizing a single strand oligonucleotide having a sequence complementary to the sequence of the single strand oligonucleotide obtained in step (2);

(5) separating and purifying the oligonucleotide-polymer structure and the single strand of the oligonucleotide from the solid support after completion of the synthesis; And

(6) annealing the resulting oligonucleotide-polymer structure with a single oligonucleotide strand having a complementary sequence, thereby obtaining a double-stranded oligonucleotide structure.

The solid support used in the present invention is preferably controlled pore glass (CPG) and polystyrene (PS), polymethyl methacrylate (PMMA), silica gel, cellulose paper or the like, but is not limited to. If CPG is used, it preferably has a diameter of 40 to 180 mm and a pore size of 500 to 3000 Å. After step (5), the molecular weights of the resulting and purified RNA-polymer structure and oligonucleotide single strand can be measured using a MALDI-TOF mass spectrometer to confirm that the desired oligonucleotide-polymer structure and oligonucleotide single strand have been obtained. In the above-described production method, step (4) of synthesizing a single strand of oligonucleotide having a sequence complementary to the sequence of the single strand of oligonucleotide synthesized in step (2) may be carried out before step (1) or during any step of steps (1) to (5). ).

In addition, a single strand oligonucleotide having a sequence complementary to the sequence of the single strand oligonucleotide synthesized in step (2) can be used in a state in which a phosphate group is linked to the 5' end of the single strand oligonucleotide.

Meanwhile, the present invention provides a method for producing a double-stranded oligonucleotide structure, wherein a ligand is further linked to a double-stranded oligonucleotide structure containing an amphiregulin-specific double-stranded oligonucleotide.

For example, a method for producing a ligand-linked double-stranded oligonucleotide structure containing an amphiregulin-specific double-stranded oligonucleotide may include the following steps:

(1) binding a hydrophilic compound to a solid support having a functional group associated therewith;

(2) synthesis of a single strand of oligonucleotide on a solid support having an associated functional group and a hydrophilic compound;

(3) covalent binding of a hydrophobic compound to the 5' end of a single strand of the oligonucleotide;

(4) synthesizing a single strand oligonucleotide having a sequence complementary to the sequence of the single strand oligonucleotide synthesized in step (2);

(5) separating the functional group-oligonucleotide-polymer structure and the single strand of the oligonucleotide having a complementary sequence from the solid support after completion of the synthesis;

(6) linking a ligand to the end of a hydrophilic compound using a functional group to produce a single strand ligand-oligonucleotide-polymer structure; And

(7) annealing the resulting ligand-oligonucleotide-polymer structure with a single oligonucleotide strand having a complementary sequence, thereby obtaining a ligand/double-strand oligonucleotide structure.

After step (6), the resulting ligand-oligonucleotide-polymer structure and the oligonucleotide single strand having a complementary sequence can be separated and purified, and then their molecular weights can be measured using a MALDI-TOF mass spectrometer to confirm that the desired ligand-nucleotide structure has been obtained. An RNA polymer and a desired single strand of RNA having a complementary sequence. By annealing the resulting ligand/RNA oligonucleotide structure with a single oligonucleotide strand having a complementary sequence, a ligand/double strand oligonucleotide structure can be obtained. In the above-described production method, step (4) of synthesizing a single strand of oligonucleotide having a sequence complementary to the sequence of the single strand of oligonucleotide synthesized in step (3) may be carried out before step (1) or during any step of steps (1) to (6). ).

In another aspect, the present invention is directed to nanoparticles containing a double-stranded oligonucleotide structure in accordance with the present invention. The double-stranded oligonucleotide according to the present invention forms self-assembled nanoparticles through hydrophobic interaction of a hydrophobic compound (Korean Patent No. 1224828). These nanoparticles have excellent in vivo delivery efficiency and in vivo stability. In addition, the high size uniformity of nanoparticles simplifies quality control (QC), and thus the process of manufacturing these nanoparticles as a drug is simplified.

In the present invention, the nanoparticle may also consist of a mixture of double-stranded oligonucleotide structures containing double-stranded structures containing different sequences. For example, the nanoparticle may contain one type of amphiregulin-specific double-stranded oligonucleotide containing a sense strand that contains any sequence selected from SEQ ID NO: 10-12, and an antisense strand containing its complementary sequence; however, in another embodiment, the nanoparticle may contain various types of amphiregulin-specific double-stranded oligonucleotides, each of which contains a sense strand that contains any sequence selected from SEQ ID NO: 10-12, and an antisense strand containing its complementary sequence, and may also contain an amphiregulin-specific double-stranded oligonucleotide, which is not disclosed in the present invention.

For administration, the composition of the present invention may further contain one or more pharmaceutically acceptable carriers in addition to the active ingredient described above. Pharmaceutically acceptable carriers must be compatible with the active ingredient, and may be selected from saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and mixtures of two or more of these. If necessary, the composition may contain other conventional additives such as an antioxidant, buffer or bacteriostatic agent. In addition, a diluent, dispersant, surfactant, binder and lubricant may be further added to the composition to prepare injection formulations such as aqueous solution, suspension and emulsion. In particular, the composition is preferably presented in the form of a lyophilized formulation. To prepare the lyophilized composition, a conventional method known in the field to which the present invention relates can be used, and a lyophilization stabilizer can also be added. In addition, the composition may preferably be formulated depending on each disease or component using a suitable method known in the art, or using a method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.

The dosage of the composition of the present invention can be determined by one skilled in the art based on the patient's condition and the severity of the disease. In addition, the composition may be formulated in a variety of dosage forms, including powders, tablets, capsules, liquids, injections, ointments and syrup formulations, and may be supplied in single-dose or multi-dose containers, such as sealed ampoules or vials.

The composition of the present invention can be administered orally or parenterally. The composition of the present invention can be administered, for example, orally, by inhalation, intravenously, intramuscularly, intraarterially, intramedullary, intradurally, intracardially, transdermally, subcutaneously, intraperitoneally, intrarectally, sublingually or topically, without limitation. The dosage of the composition in accordance with the present invention may vary depending on the body weight, age, gender, health and diet of the patient, duration of administration, route of administration, rate of elimination, severity of the disease, etc., and can be easily determined by those skilled in the art. areas. Moreover, for clinical administration, the composition of the present invention can be formulated into a suitable formulation using a known method.

In yet another aspect, the present invention is directed to a lyophilized formulation containing a pharmaceutical composition.

In another aspect, the present invention is directed to a method for preventing or treating obesity, comprising the step of administering to a subject in need of preventing or treating obesity any component selected from the group consisting of:

(i) an amphiregulin-specific double-stranded oligonucleotide containing a sense strand that contains any sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12, and an antisense strand containing a sequence complementary to the sequence of the sense strand;

(ii) an amphiregulin-specific double-stranded oligonucleotide structure, which is the structure represented by the following structural formula (1):

Structural formula (1)

A-X-R-Y-B,

wherein A is a hydrophilic compound, B is a hydrophobic compound, X and Y are each independently a single covalent bond or a linker-mediated covalent bond, and R is an amphiregulin-specific double-stranded oligonucleotide (i); And

(iii) nanoparticles containing an amphiregulin-specific double-stranded oligonucleotide structure (ii).

In another further aspect, the present invention is directed to a pharmaceutical composition for use in a method of preventing or treating obesity, wherein the pharmaceutical composition contains any component selected from the group consisting of:

(i) an amphiregulin-specific double-stranded oligonucleotide containing a sense strand that contains any sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12, and an antisense strand containing a sequence complementary to the sense strand;

(ii) an amphiregulin-specific double-stranded oligonucleotide structure, which is the structure represented by the following structural formula (1):

Structural formula (1)

A-X-R-Y-B,

wherein A is a hydrophilic compound, B is a hydrophobic compound, X and Y are each independently a single covalent bond or a linker-mediated covalent bond, and R is an amphiregulin-specific double-stranded oligonucleotide (i); And

(iii) nanoparticles containing an amphiregulin-specific double-stranded oligonucleotide structure (ii).

In yet another further aspect, the present invention is directed to the use of any component selected from the group consisting of:

(i) an amphiregulin-specific double-stranded oligonucleotide containing a sense strand that contains any sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12, and an antisense strand containing a sequence complementary to the sequence of the sense strand;

(ii) an amphiregulin-specific double-stranded oligonucleotide structure, which is the structure represented by the following structural formula (1):

Structural formula (1)

A-X-R-Y-B,

wherein A is a hydrophilic compound, B is a hydrophobic compound, X and Y are each independently a single covalent bond or a linker-mediated covalent bond, and R is an amphiregulin-specific double-stranded oligonucleotide (i); And

(iii) nanoparticles containing an amphiregulin-specific double-stranded oligonucleotide structure (ii) in the manufacture of a medicament for the prevention or treatment of obesity.

In the present invention, obesity may be visceral obesity caused by diabetes, but the present invention is not limited to this.

In the present invention, the amphiregulin-specific double-stranded oligonucleotide structure according to the present invention may exhibit one or more of the following effects, but the present invention is not limited thereto:

(i) loss of body weight,

(ii) reduction in nutritional efficiency coefficient,

(iii) reduction of subcutaneous fat,

(iv) reduction of visceral fat,

(v) reduction in adipocyte area and

(vi) inhibition of liver adipogenesis.

In the present invention, the effect may be exerted by inhibiting the expression of amphiregulin in adipose tissue, but the mechanism by which this effect is exerted is not limited.

Hereinafter, the present invention will be described in more detail with reference to examples. These examples are intended to illustrate the present invention only, and those skilled in the art will appreciate that the scope of the present invention should not be construed as limited by these examples.

In the present invention, three specific sequences capable of inhibiting the expression of amphiregulin have been identified, and it has been confirmed that these sequences can complementarily bind to the mRNA encoding amphiregulin and effectively inhibit the expression of amphiregulin, thereby effectively treating obesity-related diseases.

Example 1: Algorithm for Screening SAMiRNAs Targeting Amphiregulin and Selection of Candidate Sequences

SAMiRNA-based high-throughput drug screening is a method in which all possible candidate sequences are generated by applying a 1- or 2-base sliding window algorithm to the total mRNA, unnecessary candidate sequences are removed by performing homology filtering, and grades are determined to in which the expression of the gene of interest is inhibited by all finally selected SAMiRNAs.

First, the process of generating SAMiRNA candidate sequences against amphiregulin is performed. Specifically, 1257 candidate SAMiRNA sequences, each consisting of 19 nucleotides, were selected by applying a 1-base sliding window algorithm to human amphiregulin mRNA NM_001657.3 (1290 bp), and an experiment was performed to determine the extent of amphiregulin inhibition .

Example 2. Synthesis of double-stranded oligo-RNA structure

The double-stranded oligo-RNA structure (SAMiRNA) obtained in the present invention is represented by the following structural formula:

C ₂₄ -5' S 3'-(hexaethylene glycol-PO ₃ ^- ) ₃ -hexaethylene glycol AS 5'-PO ₄

To synthesize the sense strand of the double-stranded oligo structure monoSAMiRNA (n=4), 3,4,6-triacetyl-1-hexa(ethylene glycol)-N-acetylgalactosamine-CPG was used as a support, and tridemethoxytrityl (DMT) hexaethylene glycol phosphoramidate was used as hydrophilic monomers were continuously bound to the support through the reaction. Next, RNA or DNA was synthesized, and then hydrophobic _C24 ( _C6 -SS- _C18 ) containing a disulfide bond was linked to the 5'-terminal region, thereby synthesizing the sense strand of monoSAMiRNA (n=4), in which NAG- hexaethylene glycol-(-PO ₃ ^- hexaethylene glycol) ₃ is linked to the 3' end, and C ₂₄ (C ₆ -SSC ₁₈ ) is linked to the 5' end.

After completion of the synthesis, the synthesized single strand RNA and oligo(DNA or RNA) polymer structure were separated from the CPG by treating with 28% (v/v) ammonia in a water bath at 60°C, and then the protecting residues were removed by deprotection reaction. After removal of the protecting residues, the single strand RNA and oligo(DNA or RNA) polymer construct were treated with N-methylpyrrolidone, trimethylamine and triethylamine trihydrofluoride in a volume ratio of 10:3:4 in an oven at 70°C to remove 2'-TBDMS (tert-butyldimethylsilyl ). Single-strand RNA, oligo(DNA or RNA)-polymer structure, and ligand-bound oligo(DNA or RNA)-polymer structure were separated from the reaction products by high-performance liquid chromatography (HPLC), and their molecular weights were measured using a MALDI-TOF mass spectrophotometer (MALDI TOF-MS, SHIMADZU, Japan) to confirm their correspondence to the nucleotide sequence and polymer structure to be synthesized. To obtain each double-stranded oligo structure, the sense strand and antisense strand were then mixed, placed in 1X annealing buffer (30 mM HEPES, 100 mM potassium acetate, 2 mM magnesium acetate, pH 7.0 to 7.5), and allowed to proceed. reaction for 3 minutes in a water bath at 90°C, and then left to react at 37°C, thereby obtaining the desired SAMiRNA. Annealing of the resulting double-stranded oligo-RNA structures was confirmed by electrophoresis.

Example 3: High Throughput Screening (HTS) of SAMiRNA Nanoparticles that Target Human Amphiregulin and Induce RNAi

3-1. Preparation of SAMiRNA nanoparticles

1257 SAMiRNAs targeting amphiregulin sequences synthesized in Example 2 were dissolved in 1X Dulbecco's phosphate-buffered saline (DPBS) (WELGENE, KR) and lyophilized in a lyophilizer (LGJ-100F, CN) for 5 days. Lyophilized nanoparticle powders were dissolved and homogenized in 1.429 ml of deionized distilled water (Bioneer, KR) and used in the experiment of the present invention.

3-2. Treatment of cells with SAMiRNA nanoparticles

The human lung cancer line A549 was used to identify SAMiRNA that inhibits amphiregulin expression. The A549 cell line was cultured in Gibco™ Ham's F-12K (Kaighn's) medium (Thermo, US) containing 10% fetal bovine serum (Hyclone, USA) and 1% penicillin-streptomycin (Hyclone, US), at 37°C and 5 % CO ₂ . Using the same medium as above, the A549 cell line was seeded in a 96-well plate (Costar, US) at a density of 2 x 10 ⁴ cells/well. The next day, SAMiRNA homogenized with deionized distilled water in Example 3.1 above was diluted with 1X DPBS, and cells were treated with a dilution of 500 nM or 1000 nM SAMiRNA concentration. SAMiRNA treatment was performed a total of four times (once every 12 hours) and cells were cultured at 37°C and 5% CO ₂ .

3-3. Screening for SAMiRNA by Inhibition of Human Amphiregulin mRNA Expression Assay

Total RNA was extracted from the cell line treated with SAMiRNA in Example 3-2 and used for cDNA synthesis, and then the relative expression level of amphiregulin gene mRNA was quantified by real-time PCR. To analyze the level of mRNA expression of the amphiregulin gene, 300 nM forward primer AREG, 300 nM reverse primer AREG, 300 nM AREG probe, 300 nM forward primer RPL13A, 300 nM reverse primer RPL13A, 300 nM probe RPL13A, 400 nM forward primer TBP, 400 nM TBP reverse primer and 300 nM TBP probe were added to each well of the AccuPower® Dual-HotStart qRT-PCR kit (Bioneer, Korea) and dried (Table 2 below shows the sequences of the primers and digestible probes used in the high-throughput screening (HTS) experiment). To evaluate the efficiency of the prepared kit, a calibration curve was constructed using total RNA from A549 cells and the efficiency of PCR amplification was determined (Table 3). qRT-PCR was performed using the following conditions: 95°C for 5 min, followed by 45 cycles, each consisting of 95°C for 5 sec and 58°C for 15 sec. A protocol was used in which the fluorescence value was determined in each cycle.

A 96-well plate (Costar, US) treated with SAMiRNA was subjected to total RNA extraction, and one-step qRT-PCR was performed according to an automated program using the ExiStation HT™ Korea automated system and a separately prepared AccuPower® Dual-HotStart qRT-PCR kit (Bioneer, Korea), containing primers and probes for amphiregulin analysis.

Based on the Ct values of the two genes obtained after massive qPCR, the relative expression level of amphiregulin mRNA in the test group compared with that in the control group was analyzed by the 2(-Delta Delta C(T)) method [Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. Dec; 25(4):4 02-8].

Table 2. Sequences of primers and digestible probes used in the high-throughput screening (HTS) experiment. AREG forward primer CAGTGCTGATGGATTTGAGGT (SEQ ID NO: 26) AREG reverse primer ATAGCCAGGTATTTGTGGTTCG (SEQ ID NO: 27) AREG probe 5'FAM - TGAACCGTCCTCGGGAGCCGACT - 3'EBQ (SEQ ID NO: 28) Forward primer RPL13A GTGTTTGACGGCATCCCACC (SEQ ID NO: 29) Reverse primer RPL13A TAGGCTTCAGACGCACGACC (SEQ ID NO: 30) Probe RPL13A 5'TAMRA-AAGCGGATGGTGGTTCCTGCT - 3'EBQ (SEQ ID NO: 31) TBP forward primer CACCACAGCTCTTCCACTC (SEQ ID NO: 32) Reverse Primer TBP ATCCCAGAACTCTCCGAAGC (SEQ ID NO: 33) TBP probe 5'TEXASRED - ACCCTTGCCGGGCACCACTC - 3'EBQ (SEQ ID NO: 34)

Table 3. Efficiency of 3-plex amplification using qRT-PCR Slope factor R ² Efficiency AREG Y=-0.2778X+12.3894 0.9998 90% RPL13A Y=-0.2863X+10.5964 0.9999 93% TBP Y=-0.2892X+13.0351 0.9946 95%

To select a highly efficient SAMiRNA, 14 SAMiRNAs were selected that had each of the sequences of SEQ ID NO: 1-14 as the sense strand. At the same time, the selected SAMiRNAs showed the highest efficiency, in which the level of amphiregulin mRNA expression at a final concentration of 500 nM or 1000 nM decreased compared to the control.

As shown in FIG. 1 , 14 SAMiRNAs that most effectively inhibit amphiregulin gene expression were finally selected from 1257 SAMiRNAs targeting amphiregulin. Sequence information selected by SAMiRNA is shown in Table 4 below.

Table 4. Candidate amphiregulin-specific SAMiRNA sequences selected by 1-base sliding window screening and high-throughput screening (HTS) SEQ ID NO Access number Position Sequence (DNA/RNA) 1 NM_001657.3 8-26 Semantic CCTATAAAGCGGCAGGTGC 35 Antisense GCACCUGCCGCUUUAUAGG 2 NM_001657.3 130-148 Semantic GAGCGGGCGCACACTCCCGG 36 Antisense CCGGGAGUGUGCGCCG CUC 3 NM_001657.3 195-213 Semantic GTCCCAGAGACCGAGTTGC 37 Antisense GCAACUCGGUCUCUGG GAC 4 NM_001657.3 224-242 Semantic GAGACGCCGCCGCTGCGAA 38 Antisense UUCGCAGCGGCGGCGU CUC 5 NM_001657.3 270-288 Semantic CCGGCGCCGGTGGTGCTGT 39 Antisense ACAGCACCACCGGCGC CGG 6 NM_001657.3 278-296 Semantic GGTGGTGCTGTCGCCTCTTG 40 Antisense CAAGAGCGACAGCACC ACC 7 NM_001657.3 289-307 Semantic CGCTCTTGATACTCGGCTC 41 Antisense GAGCCGAGUAUCAAGA GCG 8 NM_001657.3 292-310 Semantic TCTTGATACTCGGCTCAGG 42 Antisense CCUGAGCCGAGUAUCA AGA 9 NM_001657.3 329-347 Semantic GGACCTCAATGACACCTAC 43 Antisense GUAGGUGUCAUGAGG UCC 10 NM_001657.3 341-359 Semantic CACCTACTCTGGGAAGCGT 44 Antisense ACGCUUCCCAGAGUAG GUG eleven NM_001657.3 342-360 Semantic ACCTACTCTGGGAAGCGTG 45 Antisense CACGCUUCCCAGAGUA GGU 12 NM_001657.3 349-367 Semantic CTGGGAAGCGTGAACCATT 46 Antisense AAUGGUUCACGCUUCC CAG 13 NM_001657.3 353-371 Semantic GAAGCGTGAACCATTTTCT 47 Antisense AGAAAAUGGUUCACGC UUC 14 NM_001657.3 368-386 Semantic TTCTGGGGACCACAGTGCT 48 Antisense AGCACUGUGGUCCCCA GAA

Example 4 Screening for SAMiRNA Nanoparticles that Target Human Amphiregulin and Induce RNAi

The lung cancer cell line A549 was treated with SAMiRNA (selected in Example 3) having each of the sequences of SEQ ID NO: 1-14 as the sense strand, and the expression pattern of amphiregulin mRNA in the cell line was analyzed.

4-1. Treatment of cells with SAMiRNA nanoparticles

The human lung cancer line A549 was used to identify SAMiRNA that inhibits amphiregulin expression. The A549 cell line was cultured in Gibco™ Ham's F-12K (Kaighn's) medium (Thermo, US) containing 10% fetal bovine serum (Hyclone, US) and 1% penicillin-streptomycin (Hyclone, US), at 37°C and 5 % CO ₂ . Using the same medium as above, the A549 cell line was seeded in a 12-well plate (Costar, US) at a density of 8×10 ⁴ cells/well. The next day, SAMiRNA homogenized with deionized distilled water in Example 3.1 above was diluted with 1X DPBS, and cells were treated with dilution to a SAMiRNA concentration of 200 nM or 600 nM. SAMiRNA treatment was performed a total of four times (once every 12 hours) and cells were cultured at 37°C and 5% CO ₂ .

4-2. SAMiRNA Screening by Inhibition Assay of Human Amphiregulin mRNA Expression

Total RNA was extracted from the cell line treated with SAMiRNA in Example 4-1 and used to synthesize cDNA, and then the relative expression level of amphiregulin gene mRNA was analyzed by real-time PCR.

4-2-1. Isolation of RNA from SAMiRNA-treated cells and cDNA synthesis

Using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), total RNA was extracted from the cell line treated with SAMiRNA in Example 4-1 above. The extracted RNA was used for cDNA synthesis as follows using RNA reverse transcriptase (AccuPower® RocketScript™Cycle RT Premix Reagent Kit with Oligo (dT)20 Primer, Bioneer, Korea). Specifically, 1 μg of extracted RNA was added to the AccuPower® RocketScript™Cycle RT Premix Reagent Kit with oligo (dT)20 primer (Bioneer, Korea) in each 0.25 ml Eppendorf tube, and DEPC (diethyl pyrocarbonate) treated distilled water. was added to a total volume of 20 µl. In the gene amplification system (MyGenie™96 Gradient Thermal Block, BIONEER, Korea), the process of RNA hybridization with primers at 37°C for 30 seconds and the cDNA synthesis process at 48°C for 4 minutes were repeated 12 times. The amplification reaction was then stopped by deactivating the enzyme at 95°C for 5 minutes.

4-2-2. Quantitative analysis of the relative expression level of human amphiregulin mRNA

Using the cDNA synthesized in Example 4-2-1 as a template, qRT-PCR was performed using SYBR Green, and the relative expression level of amphiregulin mRNA compared to the SAMiRNA control sample was analyzed as follows. The cDNA synthesized in example 4-2-1 above was diluted 5 times with distilled water, and to analyze the expression level of amphiregulin mRNA, 3 µl of diluted cDNA, 25 µl AccuPower® 2X GreenStar™ qPCR MasterMix (BIONEER, Korea), 19 µl of distilled water and 3 μl of amphiregulin qPCR primers (SEQ ID NO: 17 and 18 (Table 5); 10 pmol/μl of each primer, BIONEER, Korea) were added to each well of a 96-well plate to prepare the mixture. Meanwhile, GAPDH (glyceraldehyde 3-phosphate dehydrogenase), a housekeeping gene (hereinafter referred to as HK gene), was used as a standard gene to normalize the expression level of amphiregulin mRNA. The 96-well plate containing the mixture was subjected to the following reaction using Exicycler™ Real-Time Quantitative Thermal Block (BIONEER, Korea). Specifically, the mixture was allowed to react at 95°C for 15 minutes to activate the enzyme and remove secondary structure of the cDNA, and then the mixture was subjected to 42 cycles, each consisting of denaturation at 94°C for 30 seconds, annealing at 58 °C for 30 seconds, extension at 72°C for 30 seconds, scanning on SYBR Green and final extension at 72°C for 3 minutes. Next, the mixture was maintained at 55°C for 1 minute and the melting curve was analyzed from 55°C to 95°C.

After completion of PCR, the Ct (cycle threshold) value of the target gene was adjusted to the GAPDH gene, and then the ΔCt value was calculated using a control treated with a SAMiRNA control sequence (SAMiCONT), which does not induce inhibition of gene expression. The relative expression level of the target gene in cells treated with amphiregulin-specific SAMiRNA was quantified using the ΔCt value and the equation 2(-ΔCt)×100.

To select high-performing SAMiRNAs, three SAMiRNAs were selected that had each of SEQ ID NOs: 10, 11 and 12 as the sense strand. Moreover, the selected SAMiRNAs showed the highest efficiency when the level of amphiregulin mRNA expression at a final concentration of 200 nM or 600 nM decreased compared to the control.

As shown in FIG. 3, the three SAMiRNAs that most effectively inhibit amphiregulin gene expression were ultimately selected from the 14 SAMiRNAs targeting amphiregulin. Sequence information of the selected SAMiRNAs is shown in Table 6 below.

Table 5. qPCR primer sequence information Primer Subsequence SEQ ID NO hGAPDH-F GGTGAAGGTCGGAGTCAACG 15 hGAPDH-R ACCATGTAGTTGAGGTCAATGAAGG 16 hAREG-F ACACCTACTCTGGGAAGCGT 17 hAREG-R GCCAGGTATTTGTGGTTCGT 18

(F stands for forward primer and R stands for reverse primer)

Table 6. SAMiRNA sequences that effectively inhibit amphiregulin expression SEQ ID NO Code name Position Sequence of the semantic chain 10 SAMi-AREG#10 341-359 CACCTACTCTGGGAAGCGT eleven SAMi-AREG#11 342-360 ACCTACTCTGGGAAGCGTG 12 SAMi-AREG#12 349-367 CTGGGAAGCGTGAACCATT

Example 5: Inhibition of Human Amphiregulin Expression in a Lung Cancer Cell Line (A549) Using Selected SAMiRNAs

The lung cancer cell line A549 was treated with SAMiRNA (selected in Example 4) having each of SEQ ID NOs: 10, 11 and 12 as the sense strand, and the expression pattern of amphiregulin mRNA in the cell line was analyzed to determine the IC ₅₀ value of SAMiRNA.

5-1. Preparation and particle size analysis of SAMiRNA nanoparticles

Each of the three SAMiRNAs targeting the amphiregulin sequence synthesized in Example 2 was dissolved in 1X Dulbecco's phosphate-buffered saline (DPBS) (WELGENE, KR) and lyophilized in a lyophilizer (LGJ-100F, CN) for 5 days. Lyophilized nanoparticle powders were dissolved and homogenized in 2 ml of deionized distilled water (Bioneer, KR) and used in the experiment for the present invention. To analyze the particle size of the resulting SAMiRNA nanoparticles, the size and polydispersity index of SAMiRNA were measured using a Zetasizer Nano ZS (Malvern, UK). The measurement results of the size and polydispersity index of SAMiRNA nanoparticles are shown in Table 7 below and graphically presented in FIG. 2.

Table 7. Size and polydispersity index of amphiregulin-specific SAMiRNA nanoparticles Code name Size PDI SAMi-AREG#10 103.9±3.8 0.406±0.065 SAMi-AREG#11 99.9±4.0 0.501±0.005 SAMi-AREG#12 170.1±7.5 0.457±0.084

5-2. Treatment of cells with SAMiRNA nanoparticles

The human lung cancer cell line A549 was used to evaluate the effect of selected SAMiRNAs that inhibit amphiregulin expression. The A549 cell line was cultured in Gibco™ Ham's F-12K (Kaighn's) medium (Thermo, US) containing 10% fetal bovine serum (Hyclone, US) and 1% penicillin-streptomycin (Hyclone, US), at 37°C and 5 % CO ₂ . Using the same medium as above, the A549 cell line was seeded in a 12-well plate (Costar, US) at a density (Costar, USA) of 8×10 ⁴ cells/well. The next day, SAMiRNAs homogenized with deionized distilled water as described in Example 5.1 above were diluted with 1X DPBS, and cells were treated with dilutions to SAMiRNA concentrations of 12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM, 600 nM. nM or 1200 nM. Treatment of cells with SAMiRNA was performed a total of four times (once every 12 hours), and cells were cultured at 37°C and 5% CO ₂ .

5-3. Determination of SAMiRNA IC ₅₀ by human amphiregulin mRNA expression inhibition assay

Total RNA was extracted from the cell line treated with SAMiRNA in Example 5-2 and used to synthesize cDNA, and then the relative expression level of amphiregulin gene mRNA was determined by real-time PCR.

5-3-1. Isolation of RNA from SAMiRNA-treated cells and cDNA synthesis

Using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), total RNA was extracted from the cell line treated with SAMiRNA in Example 5-2 above. The extracted RNA was used for cDNA synthesis as follows using RNA reverse transcriptase (AccuPower® RocketScript™Cycle RT Premix Reagent Kit with oligo (dT)20 primer, Bioneer, Korea). Specifically, 1 μg of extracted RNA was added to the AccuPower® RocketScript™Cycle RT Premix Reagent Kit with oligo (dT)20 primer (Bioneer, Korea) in each 0.25 ml Eppendorf tube and added distilled water treated with DEPC (diethyl pyrocarbonate). ), to a total volume of 20 µl. In the gene amplification system (MyGenie™96 Gradient Thermal Block, BIONEER, Korea), the process of RNA hybridization with primers at 37°C for 30 seconds and the cDNA synthesis process at 48°C for 4 minutes were repeated 12 times. The amplification reaction was then stopped by deactivating the enzyme at 95°C for 5 minutes.

5-3-2. Quantitative analysis of the relative expression level of human amphiregulin mRNA

Using the cDNA synthesized in Example 5-3-1 as a template, qRT-PCR was performed using SYBR Green, and the relative expression level of amphiregulin mRNA compared to the SAMiRNA control sample was analyzed as follows. The cDNA synthesized in example 5-3-1 above was diluted 5 times with distilled water, and to analyze the expression level of amphiregulin mRNA, 3 µl of diluted cDNA, 25 µl AccuPower® 2X GreenStar™ qPCR MasterMix (BIONEER, Korea), 19 µl of distilled water and 3 μl of amphiregulin qPCR primers (SEQ ID NO: 17 and 18 (Table 5); 10 pmol/μl for each primer, BIONEER, Korea) were added to each well of a 96-well plate to obtain a mixture. Meanwhile, GAPDH (glyceraldehyde 3-phosphate dehydrogenase), a housekeeping gene (hereinafter referred to as HK gene), was used as a standard gene to normalize the expression level of amphiregulin mRNA. The 96-well plate containing the mixture was subjected to the following reaction using Exicycler™ Real-Time Quantitative Thermal Block (BIONEER, Korea). Specifically, the mixture was allowed to react at 95°C for 15 minutes to activate the enzyme and remove secondary structure of the cDNA, and then the mixture was subjected to 42 cycles, each consisting of denaturation at 94°C for 30 seconds, annealing at 58 °C for 30 seconds, extension at 72°C for 30 seconds, scanning using SYBR Green and final extension at 72°C for 3 minutes. Next, the mixture was maintained at 55°C for 1 minute and the melting curve was analyzed from 55°C to 95°C.

After completion of PCR, the Ct (cycle threshold) value of the target gene was adjusted to the GAPDH gene, and then the ΔCt value was calculated using a control treated with a SAMiRNA control sequence (SAMiCONT), which does not induce inhibition of gene expression. The relative expression level of the target gene in cells treated with amphiregulin-specific SAMiRNA was quantified using the ΔCt value and the equation 2(-ΔCt) x 100.

As a result, it was confirmed that all amphiregulin-specific SAMiRNAs having each of SEQ ID NO: 10, 11 and 12 as the sense strand showed a decrease in the expression level of amphiregulin mRNA by 50% or more even at a low concentration of 100 nM, indicating that amphiregulin-specific SAMiRNAs exhibit the effect of inhibiting amphiregulin expression with high efficiency. The IC ₅₀ values were confirmed to be 28.75 nM as shown in FIG. 4, for amphiregulin-specific SAMiRNA having the sequence SEQ ID NO: 10 as the sense strand, 26.04 nM, as shown in FIG. 5, for amphiregulin-specific SAMiRNA having the sequence SEQ ID NO: 11 as the sense strand, and 12.07 nM, as shown in FIG. 6, for an amphiregulin-specific SAMiRNA having the sequence SEQ ID NO: 12 as the sense strand. In particular, it was confirmed that amphiregulin-specific SAMiRNA having the sequence SEQ ID NO: 12 as the sense strand showed a decrease in the expression level of amphiregulin mRNA by 50% or more even at a low concentration of 25 nM, as shown in FIG. 6, based on which it can be assumed that it exhibited the effect of inhibiting the expression of the amphiregulin gene most effectively among the three selected sequences.

Example 6 In Vitro Cytotoxicity Assessment Using Human Peripheral Blood Mononuclear Cells (PBMCs)

To examine whether mRNA expression levels of innate immune-related cytokines are increased by SAMi-hAREG, cryopreserved human PBMCs ePBMC® (human peripheral monocular cells, Cellular Technology Limited, USA) were seeded at a density of 5 x 10 ⁵ cells per well in 12 -well plate (Costar® USA) with RPMI1640 medium (Hyclone™) containing 10% FBS (fetal bovine serum; Hyclone™). Cells were cultured in a 5% CO ₂ incubator at 37°C for 1 hour to stabilize, and then seeded PBMCs were treated with 2.5 μM each of SAMiCON (DNA/RNA), SAMi-hAREG#10 (DNA/RNA), SAMi -hAREG#11 (DNA/RNA), SAMi-hAREG#12 (DNA/RNA), SAMiCON (RNA/RNA), SAMi-hAREG#10 (RNA/RNA), SAMi-hAREG#11 (RNA/RNA) and SAMi-hAREG#12 (RNA/RNA), and cultured in a 5% CO ₂ incubator at 37°C for 6 hours. 20 μg/ml concanavalin A (Sigma Aldrich, USA) was used as a positive control.

All cells were then collected and total RNA was extracted using the RNeasy Mini Kit (Qiagen, Germany) and the RNase-Free DNase Set (Qiagen, Germany) according to the manufacturer's protocols.

200 ng of extracted RNA was mixed with deionized sterile DW (Bioneer, Korea) and RNA reverse transcriptase (AccuPower® RocketScript™Cycle RT Premix reagent kit with oligo (dT)20 primer, Bioneer, Korea), and the mixture was allowed to react using the system gene amplification (MyGenie™96 Gradient Thermal Block, BIONEER, Korea) under conditions of 12 cycles, each of which consisted of 37°C for 30 seconds, 48°C for 4 minutes and 55°C for 30 seconds and then 95 °C for 5 min, thus synthesizing only 20 μl of cDNA.

The synthesized cDNA was mixed with qPCR primers for each of the genes RPL13A, IL1B, IL6, IFNG, TNF and IL12B, and then amplified using Exicycler™96 Real-Time Quantitative Thermal Block (Bioneer, Korea) under the following conditions: 95°C for 5 min and then 45 cycles, each consisting of 95°C for 5 sec and 58°C for 15 sec.

Based on the Ct values of the two genes obtained after bulk qPCR, the relative mRNA expression level (%) in the test group compared with that in the control group was analyzed by the 2(-Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. Dec; 25(4):4 02-8].

As a result, as shown in FIG. 7, it was confirmed that the expression of innate immune-related cytokines in human peripheral blood mononuclear cells (PBMCs) induced by each of the amphiregulin-specific SAMiRNA #10, SAMiRNA #11 and SAMiRNA #12 was not observed.

Example 7: Comparative Analysis of Inhibition of Human Amphiregulin Expression by SAMiRNA Containing a DNA/RNA Hybrid and an RNA/RNA Hybrid Containing Each of the Selected Sequences of SEQ ID NOs: 10, 11 and 12 as the Sense Strand

The A549 lung cancer cell line was treated with each of the double-stranded DNA/RNA hybrid and RNA/RNA hybrid amphiregulin-specific SAMiRNAs (selected in Example 4) having each of SEQ ID NOs: 10, 11 and 12 as the sense strand, and carried out a comparative analysis of the relative levels of mRNA expression (%) of amphiregulin in the cell line.

7-1. Treatment of cells with SAMiRNA nanoparticles

The human lung cancer line A549 was used to identify SAMiRNA that inhibits amphiregulin expression. The A549 cell line was cultured in Gibco™ Ham's F-12K (Kaighn's) medium (Thermo, US) containing 10% fetal bovine serum (Hyclone, US) and 1% penicillin-streptomycin (Hyclone, US), at 37°C and 5 % CO ₂ . Using the same medium as above, the A549 cell line was seeded in a 12-well plate (Costar, US) at a density of 8×10 ⁴ cells/well. The next day, SAMiRNA homogenized with deionized distilled water in Example 3.1 above was diluted with 1X DPBS, and cells were treated with dilution to SAMiRNA concentrations of 200 nM, 600 nM, or 1200 nM. Treatment of cells with SAMiRNA was performed a total of four times (once every 12 hours), and cells were cultured at 37°C and 5% CO ₂ .

7-2. SAMiRNA Screening by Inhibition Assay of Human Amphiregulin mRNA Expression

Total RNA was extracted from the cell line treated with SAMiRNA in Example 7-1 and used to synthesize cDNA, and then the relative expression level of amphiregulin gene mRNA was determined by real-time PCR.

7-2-1. Isolation of RNA from SAMiRNA-treated cells and cDNA synthesis

Using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), total RNA was extracted from the cell line treated with SAMiRNA in Example 7-1 above. The extracted RNA was used for cDNA synthesis as follows using RNA reverse transcriptase (AccuPower® RocketScript™Cycle RT Premix Reagent Kit with oligo (dT)20 primer, Bioneer, Korea). Specifically, 1 μg of extracted RNA was added to the AccuPower® RocketScript™Cycle RT Premix Reagent Kit with oligo (dT)20 primer (Bioneer, Korea) in each 0.25 μl Eppendorf tube, and DEPC-treated distilled water was added ( diethylpyrocarbonate), to a total volume of 20 µl. In a gene amplification system (MyGenie™96 Gradient Thermal Block, BIONEER, Korea), the process of RNA hybridization with primers at 37°C for 30 seconds and the cDNA synthesis process at 48°C for 4 minutes were repeated 12 times. The amplification reaction was then stopped by deactivating the enzyme at 95°C for 5 minutes.

7-2-2. Quantitative analysis of the relative expression level of human amphiregulin mRNA

Using the cDNA synthesized in Example 7-2-1 as a template, qRT-PCR was performed using SYBR Green and the relative expression level of amphiregulin mRNA compared to the SAMiRNA control sample was analyzed as follows. The cDNA synthesized in example 7-2-1 above was diluted 5 times with distilled water and to analyze the level of expression of amphiregulin mRNA, 3 μl of diluted cDNA, 25 μl of AccuPower® 2X GreenStar™ qPCR MasterMix were added to each well of a 96-well plate to prepare the mixture (BIONEER, Korea), 19 μl of distilled water and 3 μl of amphiregulin qPCR primers (SEQ ID NO: 17 and 18 (Table 5); 10 pmol/ml of each primer, BIONEER, Korea). Meanwhile, GAPDH (glyceraldehyde 3-phosphate dehydrogenase), a housekeeping gene (hereinafter referred to as HK gene), was used as a standard gene to normalize the expression level of amphiregulin mRNA. The 96-well plate containing the mixture was subjected to the following reaction using Exicycler™ Real-Time Quantitative Thermal Block (BIONEER, Korea). Specifically, the mixture was allowed to react at 95°C for 15 minutes to activate the enzyme and remove secondary structure of the cDNA, and then the mixture was subjected to 42 cycles, each consisting of denaturation at 94°C for 30 seconds, annealing at 58 °C for 30 seconds, extension at 72°C for 30 seconds, scan using SYBR Green and final extension at 72°C for 3 minutes. Next, the mixture was maintained at 55°C for 1 minute and the melting curve was analyzed from 55°C to 95°C.

After completion of PCR, the Ct (cycle threshold) value of the target gene was adjusted to the GAPDH gene, and then the ΔCt value was calculated using a control treated with a SAMiRNA control sequence (SAMiCONT), which does not induce inhibition of gene expression. The relative expression level of the target gene was quantified using the ΔCt value and the equation 2(−ΔCt)×100.

To select highly efficient SAMiRNA from the double-stranded DNA/RNA hybrid and RNA/RNA hybrids, SAMiRNA containing the DNA/RNA hybrid having the sequence SEQ ID NO: 12 as the sense strand was finally selected. At the same time, the selected SAMiRNA sequence containing a DNA/RNA hybrid (inhibition of gene expression by 90% or more) showed the highest efficiency, in which the level of amphiregulin mRNA expression at a final concentration of 200 nM, 600 nM or 1200 nM decreased compared to the control.

As shown in FIG. 8, SAMiRNA 12, containing a DNA/RNA hybrid that most effectively inhibits amphiregulin gene expression, was ultimately selected from DNA-RNA and RNA-RNA hybrids containing three selected amphiregulin-specific SAMiRNAs, respectively.

Example 8: High Throughput Screening (HTS) of SAMiRNA Nanoparticles Targeting Murine Amphiregulin and Inducing RNAi

In the case of siRNA therapeutic agents, it is difficult to identify the optimal sequence applicable to different strains. In this case, the US Food and Drug Administration (FDA) recommendation applies, which requires a DNA sequence (surrogate sequence; mouse gene-specific siRNA) specific to the animal model to analyze therapeutic effects (in vivo efficacy test). ), is designed to demonstrate pharmacological activity resulting from inhibition of expression of the gene of interest and toxicity resulting from inhibition of expression of the gene of interest (presentation by Robert T. Dorsam Ph.D. Pharmacology/Toxicology Reviewer, FDA/CDER).

The previously developed screen was modified using a siRNA program based on an existing algorithm (Turbo-si-designer, owned by the applicant's company), and high-throughput screening of siRNA sequences based on SAMiRNA was performed. A 1-base sliding window scan was performed (the same method as the human amphiregulin target screen described above) of 19-mer siRNA against the entire target gene, and a total of 1190 candidate siRNA sequences were generated against the possible complete transcript sequence of the mouse amphiregulin gene (NM_009704. 4). Homology sequence blast filtering was performed to remove unnecessary candidate sequences that influence the expression of other genes, and 237 ultimately selected SAMiRNAs were synthesized. The murine NIH3T3 cell line was treated with each selected SAMiRNA at a concentration of 1 μM in cell culture medium containing 10% FBS, and the expression inhibition effects of SAMiRNA in vitro were first screened using the primers shown in Table 8 (qPCR primer sequence information ) (Fig. 9).

The murine lung fibroblast cell line MLg was then treated with each of two sequences (SEQ ID NO: 19 and 20) selected from the NIH3T3 cell line and the murine SAMiRNA amphiregulin sequence SEQ ID NO: 21 discovered in previous interim studies, in treatment concentrations of 200 nM and 500 nM in cell culture medium containing 10% FBS, and additional screening was performed. As a result, it was confirmed that SEQ ID NO: 20 exhibits the best expression inhibition effect (Fig. 10a).

In addition, the mouse lung epithelial cell line LA-4 (ATCC® CCL-196™, Manassas, VA, USA) was treated with each of the two selected sequences (SEQ ID NOs: 19 and 20), and the mouse SAMiRNA amphiregulin with the sequence SEQ ID NO:21, detected in previous interim studies, at treatment concentrations of 200 nM, 500 nM and 1000 nM in cell culture medium containing 10% FBS, and the effects of expression inhibition were further assessed. As a result, it was again confirmed that SEQ ID NO: 20 exhibits the best expression inhibition effect (Fig. 10b).

As shown in FIG. 10, two SAMiRNAs that most effectively inhibit amphiregulin gene expression were ultimately selected from 237 SAMiRNAs targeting murine amphiregulin, and the sequence information of the selected SAMiRNAs is shown below in Table 9.

Table 8. qPCR primer sequence information Primer Subsequence mGAPDH-F AGGTCGGTGTGAACGGA TTTG (SEQ ID NO: 22) mGAPDH-R TGTAGACCATGTAGTTGAGGTCA (SEQ ID NO: 23) mAREG-F GAGGCTTCGACAAGAAAACG (SEQ ID NO: 24) mAREG-R ACCAATGTCATTTCCGGTGT (SEQ ID NO: 25)

(F stands for forward primer and R stands for reverse primer)

Table 9. SAMiRNA sequences that effectively inhibit mouse amphiregulin expression SEQ ID NO Code name Position Sequence of the semantic chain 19 SAMi-mAREG#19 936-954 AACGGGACTGTGCATGCCA 20 SAMi-mAREG#20 937-955 ACGGGACTGTGCATGCCAT 21 SAMi-mAREG#21 1071-1089 CAGTTGTCACTTTTTATGA

9-1. Animal testing method

5-week-old BKS.Cg- ^m +/+ Lepr ^db / mice were purchased (KRIBB; Korea Institute of Bioscience and Biotechnology) and experiments were performed using these mice. Purchased obese diabetic mice (db/db mice) were acclimated for 3 weeks and then fed rodent chow (2918C, Harlan, USA) for 8 weeks, and experiments were performed using mice under the following conditions. For comparison, 5-week-old normal non-obese mice (C57BL/6 mice) were purchased from Nara Biotech Co., Ltd. (Korea) and experiments were performed using these mice. These mice were also acclimated for 3 weeks and fed rodent chow. Each group of mice used in the experiments consisted of 6 animals.

100 μL PBS (C-9011, Bioneer, Korea) was administered to the normal control group, and obese diabetic mice were divided into three groups, which were administered 100 μL PBS, 100 μL SAMiRNA-Cont (5 mg/kg), and 100 μL SAMiRNA-AREG (5 mg/kg), respectively, by subcutaneous injection three times a week. During the experiment, mice were kept in a constant environment at a temperature of 21 ± 2°C, humidity 55 ± 5%, 15-17/h, illumination of 150-300 lux and a 12-hour light/12-hour dark cycle (switch on: 06:00, shutdown: 18:00). After 8 weeks of drug administration, mice were fasted for 16 hours and sacrificed.

9-2. Measuring body weight, food and water intake

Body weight, food and water intake were measured at specified time points twice a week.

9-2-1. Changes in body weight

The body weight (g) of each mouse was measured at a given time point twice a week. Body weight in the normal control group tended to gradually increase over time and was 32.5 ± 1.64 g at the time of sacrifice of mice. The three obese diabetic groups showed mean body weights of 28.9±2.35 g (PBS administration), 27.4±3.93 g (SAMiRNA-Cont administration) and 29.7±4.12 g (SAMiRNA-AREG administration ), respectively (Fig. 11).

At week 8 body weight monitoring, there was no statistically significant difference in body weight between groups, but all groups of obese diabetic mice showed little weight loss compared to normal control mice, and there was no statistically significant difference in body weight between groups of obese diabetic mice and a group with obesity and diabetes.

9-2-2. Changes in food and water intake

By measuring the food intake of the mice, it was confirmed that the average daily food intake was about 4 g in the normal control group and about 8 g in all diabetic obese groups, indicating that food intake more than doubled in diabetic mice with obesity. obesity (Fig. 12). In addition, water intake was about 5 ml/day in normal control mice, but 20-35 ml/day in diabetic obese mice, which is significantly higher (Fig. 13).

9-3. Changes in fat mass

To measure fat mass, subcutaneous and visceral fat was removed from sacrificed mice, their mass was measured, and the ratio of fat mass to mouse mass was assessed.

The ratio for subcutaneous fat was 1.56 ± 0.36 in normal control mice, 4.32 ± 0.73 in PBS-treated obese diabetic mice, 3.63 ± 1.80 in SAMiRNA-Cont-treated obese diabetic mice , and 3.15 ± 0.58 in obese diabetic mice treated with SAMiRNA-AREG. Thus, it can be confirmed that in obese diabetic mice, subcutaneous fat mass was significantly reduced by reducing the expression level of amphiregulin in accordance with the present invention (Fig. 14).

The ratio for visceral fat was 1.28±0.31 in normal control mice, 1.97±0.25 in PBS-treated obese diabetic mice, 1.59±0.38 in SAMiRNA-Cont-treated obese diabetic mice , and 0.76±0.12 in obese diabetic mice treated with SAMiRNA-AREG. Thus, it can be confirmed that in obese diabetic mice, visceral fat mass was significantly reduced by reducing the expression level of amphiregulin in accordance with the present invention (Figs. 15 and 16).

9-4. Fasting blood glucose and serum glucose measurements

Fasting blood glucose levels (mg/dL) were measured using a simple glucometer (Accu-ChekTM Active, Roche, Germany) one week before mice were sacrificed, and serum glucose levels were measured by KP&T Co., Ltd.

Blood glucose levels averaged 153.2±12.07 in normal control mice, average 551.8±53.73 in PBS-fed obese diabetic mice, average 577.3±40.25 in obese diabetic mice, treated with SAMiRNA-Cont, and 555.7 ± 49.15 on average in the obese diabetic group treated with SAMiRNA-AREG (Fig. 17).

Serum glucose levels (mg/dL) were 149.6±20.4 in normal control mice, 689.1±185.4 on average in PBS-fed obese diabetic mice, 755.5±89.4 in diabetic SAMiRNA-Cont-treated obese group and 874.3 ± 119.4 on average in the SAMiRNA-AREG-treated obese diabetic group (Fig. 18).

Thus, it was confirmed that reducing the expression level of amphiregulin in obese diabetic mice in accordance with the present invention had no significant effect on the control of fasting blood glucose levels or serum glucose levels in animal models of diabetes.

Example 10: Evaluation of Anti-Obesity Effect Using a High-Fat Diet-Induced Obesity Model

To evaluate the anti-obesity effect of amphiregulin expression inhibitor, amphiregulin expression inhibitor SAMiRNA-AREG (SAMi-mAREG#20) was administered to a high-fat diet-induced obesity model and its fat-reducing effect was observed. After the introduction of a high-fat diet, the drug was administered 3 times a week for 5 weeks, and then various indicators were analyzed.

10-1. Analysis of the expression level of amphiregulin after administration of a high-fat diet

5-week-old C57BL/6 mice were purchased (Nara Biotech Co., Ltd.), and experiments were performed using these mice. Purchased mice were acclimatized for 1 week and then fed a 60% kcal fat diet (D12492, Research Diets, Inc.) for 6 weeks. Epididymal fat was then extracted and its mRNA levels were measured.

Extraction of total RNA from adipose tissue was performed using a combination of QIAzol lysis reagent (QIAZEN., GER) and the RNeasy Mini Kit (QIAZEN., GER). 100 mg of adipose tissue was added to 1 ml of QIAzol lysis reagent, homogenized and then incubated for 5 minutes at room temperature. After centrifugation at 12000 g at 4°C for 10 minutes, the lower sample was collected, excluding the upper fat monolayer. 200 μl of chloroform (Sigma-Aldrich, USA) was added to the sample, mixed well, and kept at room temperature for 3 minutes, followed by centrifugation at 12,000 g at 4°C for 30 minutes. From the three separated phases, the uppermost layer was collected, 70% EtOH was added to it and mixed well at a ratio of lysate:70% EtOH = 1:1, and then loaded into an RNeasy spin column from the RNeasy Mini Kit. The subsequent process was carried out according to the manufacturer's protocol. Extracted RNA was quantified using a spectrophotometer and its purity assessed.

Table 9. Primer sequence information for qPCR Name F primer R primer Probe Areg AGTAGTAGCTGTCACTATCTTTGTC (SEQ ID NO: 51) CCCGTTTTCTTGTCGAAGC (SEQ ID NO: 52) CCTCCGCAGCTATTGGCATCGGCA
(SEQ ID NO: 53) Tfrc AAACTTGCCCAAGTATTCTCAG (SEQ ID NO: 54) ATGAAAGGTATCCCTCCAACC (SEQ ID NO: 55) TGCCAGCTGGACTGCAGGCGACT (SEQ ID NO: 56)

(F stands for forward primer and R stands for reverse primer)

As a result, it was confirmed that the expression level of amphiregulin increased 12-fold compared with the normal control group after administration of a high-fat diet (Fig. 19).

10-2. Animal testing method

C57BL/6 mice aged 5 weeks were purchased (Nara Biotech Co., Ltd.), and experiments were performed using these mice. Purchased mice were acclimatized for 1 week and then fed a 60% kcal fat diet (D12492, Research Diets, Inc.) for 1 week, and then experiments were performed using these mice under the following conditions. For comparison, normal nonobese mice were fed rodent chow (2918C, Harlan, USA) under the same conditions, and experiments were performed using mice under the following conditions. For the experiments, mice were divided into a normal control group (ND+PBS) and a test substance-administered group (high-fat diet+SAMi-AREG), each group consisting of 6 animals, and a negative control group (high-fat diet fat content + PBS), consisting of 5 animals.

100 μL of PBS (LB 001-02, WELGENE, Korea) was administered to the normal control group (ND+PBS) and negative control group (high fat diet+PBS), and 100 μL of SAMiRNA-AREG (5 mg/kg) was administered to the group , receiving the test substance (high fat diet + SAMi-AREG) by subcutaneous injection three times a week.

During the experimental period, mice were kept in a constant environment at a temperature of 21 ± 2°C, humidity 55 ± 5%, 15-17/h, illumination of 150-300 lux and a 12-hour light/12-hour dark cycle (switch on: 06:00 , off: 18:00). After 8 weeks of drug administration, mice were fasted for 16 hours and sacrificed.

10-3. Measuring body weight, food and water intake

Body weight, food and water intake were measured at specified time points twice a week.

10-3-1. Changes in body weight

The body weight (g) of each mouse was measured at a given time point twice a week. The body weight of the negative control group tended to increase due to the high-fat diet over time after PBS administration and was 37.3 ± 1.20 g at the time of sacrifice of mice. Body weight (g) averaged 26.57 ± 0.36 in the PBS-treated normal control group and averaged 33.21 ± 1.16 in the SAMiRNA-AREG-treated group. As a result of observing body weight at weeks 4 and 5, there was a statistically significant difference in body weight between the test substance group and the negative control group.

Compared with the body weight of normal control mice, the body weight of mice in the negative control group fed a high-fat diet increased significantly, while the body weight of mice in the test substance-treated group decreased, which was statistically significant (Figure 20). .

10-3-2. Changes in food and water intake

By measuring the food intake of mice, it was confirmed that the average daily food intake was 3.69±0.15 g in the normal control group, 2.76±0.06 g in the negative control group and 2.55±0.08 g in the receiving the test substance, indicating that the food intake of the high-fat diet group was less than that of the negative control group, and there was no significant difference in food intake between the negative control group and the test substance group (Fig. 21a).

By measuring the water intake of mice (ml), it was confirmed that the average daily water intake was 3.27±0.10 in the normal control group, 4.00±0.12 in the negative control group and 4.22±0.24 in the receiving the test substance, indicating that the water consumption of the high-fat diet group was greater than that of the negative control group, and there was no significant difference in water consumption between the negative control group and the test substance group (Fig. 21b).

10-4. Nutritional Efficiency Ratio (%)

By measuring the nutritional efficiency ratio by dividing the weight gain (g/day) of each mouse by food intake (g/day), it was confirmed that the nutritional efficiency ratio was 0.02 ± 0.001 in the normal control group, 0.12 ± 0.007 in the negative control and 0.08 ± 0.011 in the test substance-treated group, indicating that although the nutritional efficiency ratio of both the negative control group and the test substance-treated group increased compared with the normal control group, the ratio nutritional efficiency in the group receiving the test substance was significantly lower than in the negative control group (Fig. 22).

10-5. Changes in fat mass

To measure fat mass, the subcutaneous fat pad, epididymal fat pad, perirenal fat pad, and mesenteric fat pad were removed from sacrificed mice, their mass was measured, and the ratio of fat mass to mouse mass was determined.

Mouse subcutaneous fat pad weight (g) was 0.38 ± 0.02 in the normal control group, 1.74 ± 0.12 in the negative control group and 1.05 ± 0.14 in the test substance-treated group, and epididymal weight fat body (g) was 0.52±0.03 in the normal control group, 2.32±0.09 in the negative control group and 1.79±0.16 in the test substance-treated group. In addition, the perirenal fat pad weight (g) was 0.20±0.02 in the normal control group, 0.86±0.04 in the negative control group and 0.67±0.08 in the test substance-treated group, and Mesenteric fat pad mass (g) was 0.25±0.01 in the normal control group, 0.66±0.09 in the negative control group and 0.45±0.04 in the test substance-treated group (Fig. 23a) .

The ratio (%) of mouse subcutaneous fat pad was 1.39±0.08 in the normal control group, 4.65±0.23 in the negative control group and 3.11±0.35 in the test substance-treated group, and the ratio ( %) of epididymal fat pad mass was 1.91±0.10 in the normal control group, 6.23±0.09 in the negative control group, and 5.36±0.29 in the test substance-treated group. In addition, the ratio (%) of perirenal fat pad mass was 0.73±0.06 in the normal control group, 2.33±0.13 in the negative control group and 2.01±0.17 in the test substance-treated group. and the ratio (%) of mesenteric fat pad mass was 0.91±0.02 in the normal control group, 1.76±0.19 in the negative control group, and 1.35±0.07 in the test substance-treated group (Fig. 23b).

Mouse fat was divided into subcutaneous fat and visceral fat (epididymal fat, perirenal fat and mesenteric fat), and the weight (g) and mass fraction (%) were measured.

For mouse subcutaneous fat, the mass was 0.38±0.02 in the normal control group, 1.74±0.12 in the negative control group and 1.05±0.14 in the test substance-treated group, and the mass fraction was 1. 39±0.08 in the normal control group, 4.65±0.23 in the negative control group and 3.11±0.35 in the test substance treated group.

For visceral fat, the mass was 0.97±0.06 in the normal control group, 3.85±0.18 in the negative control group and 2.92±0.27 in the test substance group, and the mass fraction was 3.56 ±0.17 in the normal control group, 10.34±0.16 in the normal control group and 8.73±0.50 in the test substance group.

As a result, it was confirmed that the weight and mass fraction of subcutaneous fat and the weight and mass fraction of visceral fat were significantly increased in the negative control group compared with the normal control group, and this increase in weight and mass fraction in the negative control group was significantly decreased in the group receiving test substance (Figs. 24a and 24b).

10-6. Micro-CT Analysis

For micro-CT analysis of mouse fat (Korea Basic Science Institute, Gwangju Center), two animals with average body weight were selected from each group. Selected mice were photographed and the volumes of subcutaneous fat and visceral fat were plotted.

The volume (mm ³ ) of subcutaneous fat was 1661 ± 289.5 in the normal control group, 6356 ± 217 in the negative control group and 4040 ± 284.5 in the test substance group, and the volume (mm ³ ) of visceral fat was 1069 ± 90 in the normal control group, 3782±7 in the negative control group and 2623±166 in the test substance group.

As a result, it was possible to confirm that the volumes of subcutaneous fat and visceral fat increased in the negative control group compared with the normal control group and decreased in the test substance-treated group compared with the negative control group (Fig. 25).

10-7. Histopathological examination of adipose tissue

Subcutaneous fat pad, epididymal fat pad, perirenal fat pad and mesenteric fat pad were removed from mice, fixed in 10% neutral buffered formalin (Sigma, HT50-1-640) for 24 hours or more, dehydrated with ethanol, and then cleared with xylene tri times. The tissue samples were then soaked and embedded in liquid paraffin, thus preparing paraffin blocks. Subsequently, 5-μm-thick tissue sections were deparaffinized and rehydrated, and the nuclei were stained with Harris hematoxylin solution for 5 min, followed by counterstaining with eosin solution. After staining, mounting medium was dropped onto tissue sections, which were then covered with a coverslip and allowed to harden. Tissue sections cured with the preservation solution were photographed at 200× magnification using an inverted microscope (Nikon Eclipse TS2), and the adipocyte area was calculated.

For subcutaneous fat pad, adipocyte area ( ^mm2 ) was 913.8 ± 129.9 in the normal control group, 3575.0 ± 346.7 in the negative control group and 1337.0 ± 211.1 in the test substance-treated group, and for epididymal fat pad, adipocytes (mm ² ) were 950.6 ± 73.2 in the normal control group, 1598.0 ± 99.6 in the negative control group and 1347.0 ± 100.1 in the test substance group. For the perirenal fat pad, the adipocyte area (mm ² ) was 1734.0±158.8 in the normal control group, 5365.0±190.4 in the negative control group and 2516.0±288.3 in the test substance-treated group, and for the mesenteric fat pad, the adipocyte area (mm ² ) was 1552.0 ± 680.3 in the normal control group, 3495.0 ± 425.3 in the negative control group, and 1436.0 ± 163.3 in the test substance-treated group.

As a result, it could be confirmed that the adipocyte area increased in the negative control group compared with the normal control group, and decreased in the test substance-treated group compared with the negative control group (FIG. 26).

10-8. Histopathological examination of liver tissue

Livers were removed from mice, fixed in 10% neutral buffered formalin (Sigma, HT50-1-640) for over 24 hours, and subjected to H&E staining and Oil red O testing, followed by examination.

10-8-1. H&E staining

H&E (hematoxylin and eosin) staining was performed to examine the overall morphology of the liver tissue obtained after fixation in neutral buffered formalin and the extent of lipid accumulation in the liver tissue. Tissue samples were prepared by paraffin infiltration. After ethanol dehydration, tissue samples were cleared with xylene three times. Tissue blocks were cut into 5-μm-thick sections using a microtome, and the sections were dried in a glass slide oven for 1 hour, dewaxed with xylene, treated with ethanol, and then hydrated. Nuclei were first stained with Harris hematoxylin staining solution for 5 minutes and then counterstained with eosin. After staining, mounting medium was dropped onto tissue sections, which were then covered with a coverslip and allowed to set. Tissue sections cured with a preservative solution were examined under a microscope.

10-8-2. Oil Red O staining

Liver tissues obtained after fixation in neutral buffered formalin were infiltrated in a 30% sucrose solution. After washing with PBS solution, the tissues were dehydrated and fixed in Optimal Cutting Temperature (O.C.T) Compound (SAKURA, USA), a frozen tissue embedding agent, to obtain frozen tissue blocks. Fixed tissues were cut into 14-μm thick sections using a Cryostat CM3050 S (Leica) to obtain tissue samples. The inhibitory effect of AREG on lipid accumulation was assessed using Oil Red O staining, a special staining method that can determine the extent of lipid accumulation by specifically and sensitively reacting with the lipid component and displaying a red color. After fixation in 10% neutral buffered formalin (Sigma, HT50-1-640), the fixative was removed, the samples were washed with 100% propylene glycol and stained with Oil red O, which specifically reacts with intracellular lipid droplets. After staining, mounting medium was dropped onto tissue sections, which were then covered with a coverslip and allowed to harden. Tissue sections cured with a preservative solution were examined under a microscope.

10-8-3. Changes in liver fat

As a result of quantitative analysis performed after the Oil Red O assay, it was confirmed that adipogenesis increased 6.6 times in the negative control group compared to the normal control group, and increased 2.8 times in the test substance group compared to the normal group. control group. Thus, it can be seen that adipogenesis was inhibited in the group receiving the test substance (Fig. 27).

10-9. Gene Expression Analysis

Amphiregulin expression levels in the subcutaneous fat pad, epididymal fat pad, and peripheral fat pad were measured in mice. Extraction of total RNA from adipose tissue was performed using a combination of TRI Reagent (MRC Inc., USA) and a universal RNA extraction kit (BIONEER, Korea). 100 mg of adipose tissue was added to 1 ml of TRI Reagent, homogenized and then incubated for 5 minutes at room temperature. After centrifugation at 12000g and 4°C for 10 minutes, the bottom sample was collected, excluding the top monolayer of fat. 200 μl of chloroform (Sigma-Aldrich, USA) was added to the sample, mixed well and kept at room temperature for 3 minutes, followed by centrifugation at 12,000 g at 4°C for 30 minutes. From the three separated phases, the uppermost layer was collected, isopropanol was added to it and mixed well at a lysate:isopropanol ratio of 400:300, and then loaded onto the AccuPrep®-III Universal RNA Isolation Kit binding column. Subsequent processes were carried out according to the manufacturer's protocol. Extracted RNA was quantified using a spectrophotometer, its purity was assessed, and its degree of degradation was determined using RNA gel electrophoresis.

Table 10. qPCR primer sequence information Name F primer R primer Areg GAGGCTTCGACAAGAAAACG (SEQ ID NO: 57) ACCAATGTCATTTCCGGTGT (SEQ ID NO: 58) Gapdh AGGGTGGAGCCAAAAGGGTC (SEQ ID NO: 59) GGCTAAGCAGTTGGTGGTGC (SEQ ID NO: 60)

(F stands for forward primer and R stands for reverse primer)

10-9-1. Amphiregulin mRNA levels in adipose tissue

The level of amphiregulin mRNA in the subcutaneous fat of mice increased 1.8-fold in the negative control group compared with the normal control group, but decreased 1.6-fold in the test substance-treated group compared with the negative control group.

The level of amphiregulin mRNA in the epididymal fat pad increased 3.2-fold in the negative control group compared with the normal control group, but decreased 1.3-fold in the test substance-treated group compared with the negative control group.

The level of amphiregulin mRNA in the perirenal fat body increased 3.7-fold in the negative control group compared with the normal control group, but decreased 1.5-fold in the test substance-treated group compared with the negative control group (Fig. 28).

Although the present invention has been described in detail with reference to specific features, it will be apparent to those skilled in the art that this description relates only to its preferred embodiment and does not limit the scope of the present invention. Thus, the essential scope of the present invention will be determined by the appended claims and their equivalents.

Industrial applicability

The pharmaceutical composition of the present invention has an excellent effect of reducing visceral fat as well as subcutaneous fat and thus can be effectively used for the treatment and prevention of cardiovascular diseases, metabolic disorders, diabetes and various other diseases. in which complications caused by visceral fat become a problem.

--->

LIST OF SEQUENCES

<110> BIONEER CORPORATION

SIRNAGEN THERAPEUTICS CORPORATION

<120> COMPOSITION FOR PREVENTING OR TREATING OBESITY-RELATED DISEASE

CONTAINING AMPHIREGULIN-SPECIFIC DOUBLE-STRANDED

OLIGONUCLEOTIDE

STRUCTURE

<130>PF-B2851

<140> PCT/IB2021/054077

<141> 2021-05-13

<150> 10-2020-0057879

<151> 2020-05-14

<160> 60

<170> Patent In version 3.5

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 1

cctataaagc ggcaggtgc

19

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 2

gagcggcgca cactcccgg

19

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 3

gtcccagaga ccgagttgc

19

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 4

gagacgccgc cgctgcgaa

19

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 5

ccggcgccgg tggtgctgt

19

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 6

ggtggtgctg tcgctcttg

19

<210> 7

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 7

cgctcttgat actcggctc

19

<210> 8

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 8

tcttgatact cggctcagg

19

<210> 9

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 9

ggacctcaat gacacctac

19

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 10

cacctactct gggaagcgt

19

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 11

acctactctg ggaagcgtg

19

<210> 12

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 12

ctgggaagcg tgaaccatt

19

<210> 13

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 13

gaagcgtgaa ccattttct

19

<210> 14

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA sense

<400> 14

ttctggggac cacagtgct

19

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> hGAPDH-F primer

<400> 15

ggtgaaggtc ggagtcaacg

20

<210> 16

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> hGAPDH-R primer

<400> 16

accatgtagt tgaggtcaat gaagg

25

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> hAREG F primer

<400> 17

acacctactc tgggaagcgt

20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> hAREG R primer

<400> 18

gccaggtatt tgtggttcgt

20

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> mAmphiregulin siRNA sense strand

<400> 19

aacgggactg tgcatgcca

19

<210> 20

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> mAmphiregulin siRNA sense strand

<400> 20

acgggactgt gcatgccat

19

<210> 21

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> mAmphiregulin siRNA sense strand(control)

<400> 21

cagttgtcac tttttatga

19

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> mGAPDH-F primer

<400> 22

aggtcggtgt gaacggattt g

21

<210> 23

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> mGAPDH-R primer

<400> 23

tgtagaccat gtagttgagg tca

23

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> mAREG-F primer

<400> 24

gaggcttcga caagaaaacg

20

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> mAREG-R primer

<400> 25

accaatgtca tttccggtgt

20

<210> 26

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> AREG Forward primer

<400> 26

cagtgctgat ggatttgagg t

21

<210> 27

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> AREG Reverse primer

<400> 27

atagccaggt atttgtggtt cg

22

<210> 28

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> AREG probe

<400> 28

tgaaccgtcc tcggggagccg act

23

<210> 29

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> RPL13A Forward primer

<400> 29

gtgtttgacg gcatcccacc

20

<210> 30

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> RPL13A Reverse primer

<400> 30

taggcttcag acgcacgacc

20

<210> 31

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> RPL13A probe

<400> 31

aagcggatgg tggttcctgc t

21

<210> 32

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> TBP Forward primer

<400> 32

caccacagct cttccactc

19

<210> 33

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> TBP Reverse primer

<400> 33

atcccagaac tctccgaagc

20

<210> 34

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> TBP probe

<400> 34

acccttgccg ggcaccactc

20

<210> 35

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 35

gcaccugccg cuuuauagg

19

<210> 36

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 36

ccgggagugu gcgccgcuc

19

<210> 37

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 37

gcaacucggu cucugggac

19

<210> 38

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 38

uucgcagcgg cggcgucuc

19

<210> 39

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 39

acagcaccac cggcgccgg

19

<210> 40

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 40

caagagcgac agcaccacc

19

<210> 41

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 41

gagccgagua ucaagagcg

19

<210> 42

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 42

ccugagccga guaucaaga

19

<210> 43

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 43

guagguguca uugaggucc

19

<210> 44

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 44

acgcuuccca gaguaggug

19

<210> 45

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 45

cacgcuuccc agaguaggu

19

<210> 46

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 46

aaugguucac gcuucccag

19

<210> 47

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 47

agaaaauggu ucacgcuuc

19

<210> 48

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> Amphiregulin siRNA antisense

<400> 48

agcacugugg uccccagaa

19

<210> 49

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> SAMiRNA-Control(human) Sense

<400> 49

cttacgctga gtacttcga

19

<210> 50

<211> 19

<212>RNA

<213> Artificial Sequence

<220>

<223> SAMiRNA-Control(human) Antisense

<400> 50

ucgaaguacu cagcguaag

19

<210> 51

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Areg Forward primer

<400> 51

agtagtagct gtcactatct ttgtc

25

<210> 52

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Areg Reverse primer

<400> 52

cccgttttct tgtcgaagc

19

<210> 53

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Areg probe

<400> 53

cctcgcagct attggcatcg gca

23

<210> 54

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Tfrc Forward primer

<400> 54

aaacttgccc aagtattctc ag

22

<210> 55

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Tfrc Reverse primer

<400> 55

atgaaaggta tccctccaac c

21

<210> 56

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Tfrc probe

<400> 56

tgccagctgg actgcaggcg act

23

<210> 57

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Areg Forward primer

<400> 57

gaggcttcga caagaaaacg

20

<210> 58

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Areg Reverse primer

<400> 58

accaatgtca tttccggtgt

20

<210> 59

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Gapdh Forward primer

<400> 59

agggtggagc caaaagggtc

20

<210> 60

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Gapdh Reverse primer

<400> 60

ggctaagcag ttggtggtgc

20

<---

Claims (65)

1. The use of a pharmaceutical composition for the treatment or prevention of obesity, where the pharmaceutical composition contains any component selected from the group consisting of: (i) an amphiregulin-specific double-stranded oligonucleotide that contains any sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12, and an antisense strand containing a sequence complementary to the sequence of the sense strand; (ii) an amphiregulin-specific double-stranded oligonucleotide structure containing the structure represented by the following structural formula (1): structural formula (1) A-X-R-Y-B, wherein A is a hydrophilic compound, B is a hydrophobic compound, X and Y are each independently a single covalent bond or a linker-mediated covalent bond, and R is an amphiregulin-specific double-stranded oligonucleotide (i); And (iii) nanoparticles containing an amphiregulin-specific double-stranded oligonucleotide structure (ii). 2. Use according to claim 1, in which the sense strand or antisense strand consists of 19-31 nucleotides. 3. Use according to claim 1, wherein the oligonucleotide is siRNA, shRNA or miRNA. 4. Use according to claim 1, wherein the sense strand or antisense strand is independently DNA or RNA. 5. Use according to claim 1, wherein the sense strand or antisense strand of the double-stranded oligonucleotide contains a chemical modification. 6. Use according to claim 5, where the chemical modification is any one or more modifications selected from the group consisting of: modification in which the OH group at the 2' carbon position of the sugar structure in one or more nucleotides is replaced by any group selected from the group consisting of a methyl group (-CH ₃ ), a methoxy group (-OCH ₃ ), an amino group (-NH ₂ ) , fluorine (-F), -O-2-methoxyethyl group, -O-propyl group, -O-2-methylthioethyl group, -O-3-aminopropyl group, -O-3-dimethylaminopropyl group, -ON-methylacetamido group and -O-dimethylamidooxyethyl group; modification in which oxygen in the sugar structure in nucleotides is replaced by sulfur; modifying the bond between nucleotides into any bond selected from the group consisting of a phosphorothioate bond, a boranophosphate bond and a methylphosphonate bond; modifications to PNA (peptide nucleic acid), LNA (locked nucleic acid) or UNA (unlocked nucleic acid); And modifications into a DNA-RNA hybrid. 7. Use according to claim 1, wherein at least one phosphate group is linked to the 5' end of the antisense strand of the double-stranded oligonucleotide. 8. Use according to claim 1, wherein the amphiregulin-specific double-stranded oligonucleotide structure contains the structure represented by the following structural formula (2): structural formula (2) where S and AS, respectively, represent the sense strand and the antisense strand of the double-stranded oligonucleotide according to claim 1, and A, B, X and Y are as defined in claim 1. 9. Use according to claim 8, wherein the amphiregulin-specific double-stranded oligonucleotide structure contains a structure represented by the following structural formula (3) or (4): structural formula (3) structural formula (4) wherein A, B, X, Y, S and AS are the same as defined in claim 8, and 5' and 3', respectively, represent the 5' end and 3' end of the sense strand of the double-stranded oligonucleotide. 10. Use according to claim 1, wherein the hydrophilic compound is selected from the group consisting of polyethylene glycol (PEG), polyvinylpyrrolidone and polyoxazoline. 11. Use according to claim 1, wherein the hydrophilic compound has a structure represented by the following structural formula (5) or (6): structural formula (5) (A' _m -J) _n , structural formula (6) (J-A' _m ) _n , where A' is a hydrophilic monomer, J is a linker that joins m hydrophilic monomers together or connects m hydrophilic monomers to a double-stranded oligonucleotide, m is an integer ranging from 1 to 15, n is an integer ranging from 1 to 10, the hydrophilic monomer (A') is any compound selected from the following compounds (1) to (3), and the linker (J) is selected from the group consisting of -PO₃ ^–-, -SO₃- and - CO₂-: connection (1) , where G is selected from the group consisting of O, S and NH; connection (2) , connection (3) . 12. Use according to claim 11, wherein the amphiregulin-specific double-stranded oligonucleotide structure has the structure represented by the following structural formula (7) or structural formula (8): structural formula (7) (A' _m -J) _n -XRYB, structural formula (8) (J-A' _m ) _n -XRYB. 13. Use according to claim 1, wherein the hydrophilic compound has a molecular weight of from 200 to 10,000. 14. Use according to claim 1, wherein the hydrophobic compound has a molecular weight of from 250 to 1000. 15. Use according to claim 14, wherein the hydrophobic compound is any compound selected from the group consisting of a steroid derivative, a glyceride derivative, a glycerol ether, a polypropylene glycol, an unsaturated or saturated C ₁₂ -C ₅₀ hydrocarbon, a diacylphosphatidylcholine, a fatty acid, a phospholipid , lipopolyamine, lipid, tocopherol and tocotrienol. 16. Use according to claim 15, wherein the steroid derivative is any derivative selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesteryl formate, cholestanyl formate and cholestanylamine. 17. Use according to claim 15, wherein the glyceride derivative is any derivative selected from the group consisting of a monoglyceride, a diglyceride and a triglyceride. 18. Use according to claim 1, wherein the covalent bond represented by each of X and Y is a non-cleavable bond or a cleavable bond. 19. Use according to claim 18, wherein the non-cleavable bond is an amide bond or a phosphate bond. 20. The use of claim 18, wherein the cleavable bond is any bond selected from the group consisting of a disulfide bond, an acid-cleavable bond, an ester bond, an anhydride bond, a biodegradable bond, and an enzymatically cleavable bond. 21. Use according to claim 1, wherein the nanoparticle consists of a mixture of double-stranded oligonucleotide structures containing double-stranded oligonucleotides containing different sequences. 22. Use according to claim 1, wherein the obesity is visceral obesity caused by diabetes. 23. Use according to claim 1, wherein the pharmaceutical composition exhibits one or more of the following effects: (i) loss of body weight, (ii) reduction in nutritional efficiency coefficient, (iii) reduction of subcutaneous fat, (iv) reduction of visceral fat, (v) reduction in adipocyte area, and (vi) inhibition of liver adipogenesis. 24. Use according to claim 1, wherein the pharmaceutical composition exhibits the effect of preventing or treating obesity by inhibiting the expression of amphiregulin in adipose tissue.