WO2022067091A1 - Systems and methods for expressing biomolecules in a subject - Google Patents

Systems and methods for expressing biomolecules in a subject Download PDF

Info

Publication number
WO2022067091A1
WO2022067091A1 PCT/US2021/052040 US2021052040W WO2022067091A1 WO 2022067091 A1 WO2022067091 A1 WO 2022067091A1 US 2021052040 W US2021052040 W US 2021052040W WO 2022067091 A1 WO2022067091 A1 WO 2022067091A1
Authority
WO
WIPO (PCT)
Prior art keywords
sars
composition
subject
antigen
cov
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/052040
Other languages
English (en)
French (fr)
Inventor
Robert Debs
Chakkrapong HANDUMRONGKUL
Timothy Heath
Alice YE
Marissa MACK
Stephen CHMURA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DNARx
Original Assignee
DNARx
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by DNARx filed Critical DNARx
Priority to EP21873552.0A priority Critical patent/EP4216935A1/en
Priority to JP2023518359A priority patent/JP2023545924A/ja
Priority to CN202180078551.8A priority patent/CN116615233A/zh
Priority to KR1020237009206A priority patent/KR20230086663A/ko
Priority to CA3192229A priority patent/CA3192229A1/en
Priority to AU2021350020A priority patent/AU2021350020A1/en
Priority to IL300776A priority patent/IL300776A/en
Publication of WO2022067091A1 publication Critical patent/WO2022067091A1/en
Priority to US18/166,962 priority patent/US20240156960A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1271Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
    • A61K9/1272Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers comprising non-phosphatidyl surfactants as bilayer-forming substances, e.g. cationic lipids or non-phosphatidyl liposomes coated or grafted with polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/53Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with three nitrogens as the only ring hetero atoms, e.g. chlorazanil, melamine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A61K31/573Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0012Lipids; Lipoproteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/42Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum viral
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1271Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • C07K16/102Coronaviridae (F)
    • C07K16/104Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53DNA (RNA) vaccination
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • the subject is first administered a composition comprising polycationic structures that is free, or essentially free, of nucleic acid molecules, and then (e.g., 1-30 minutes later) is administered a composition comprising a plurality of one or more non-viral expression vectors that encode at least one therapeutic protein (e.g., at least one anti-SARS-CoV-2 antibody, multiple different antibodies, one anti-SARS-CoV-2 recombinant ACE2 protein, at least one cytokine, or human growth hormone) or a biologically active nucleic acid molecule.
  • BACKGROUND The simplest non-viral gene delivery system uses naked expression vector DNA.
  • the present invention provides compositions, systems, kits, and methods for expressing at least one therapeutic protein or biologically active nucleic acid molecule in a subject.
  • the subject is first administered a composition comprising polycationic structures that is free, or essentially free, of nucleic acid molecules, and then (e.g., 1-30 minutes later) is administered a composition comprising a plurality of one or more non-viral expression vectors that encode at least one therapeutic protein (e.g., at least one anti-SARS-CoV-2 antibody, multiple different antibodies, or human growth hormone) or a biologically active nucleic acid molecule.
  • an agent is further administered (e.g., EPA or DHA) that increases the level and/or length of expression in a subject.
  • the first and/or second composition is administered via the subject's airway.
  • methods comprising: a) administering a first composition to a subject, wherein the first composition comprises polycationic structures, and wherein the first composition is free, or essentially free, of nucleic acid molecules; and b) administering a second composition to the subject after administering the first composition, wherein the second composition comprises a plurality of one or more non-viral expression vectors that encode at least one anti-SARS-CoV-2 antibody or antigen-binding portion thereof, and/or recombinant ACE2, and wherein, as a result of the administering the first and second compositions, the at least one anti-SARS-CoV-2 antibody, or antigen-binding portion thereof, and/or said recombinant ACE2, is expressed in the subject.
  • systems comprising: a) a first container; b) a first composition inside the first container and comprising polycationic structures, wherein the first composition is free, or essentially free, of nucleic acid molecules; c) a second container; and d) a second composition inside the second container and comprising a plurality of one or more non-viral expression vectors that encode at least one anti-SARS-CoV-2 antibody or antigen- binding portion thereof, or an ACE2 protein.
  • the systems further comprise an Agent that: i) increases the level of expression of the at least one anti-SARS-CoV-2 antibody or antigen-binding portion thereof, or the ACE2 protein, when administered to a subject, and/or ii) and/or the length of time of the expression; as compared to when the agent is not administered to the subject.
  • the Agent is present in the first composition and/or the second composition.
  • the systems further comprise: a third container, and wherein the agent is present in the third container.
  • the systems further comprise an anti-viral agent (e.g., Remdesivir or a protein comprising at least part of the ACE2 receptor) and/or an anti-inflammatory and/or anticoagulant.
  • the subject is infected with the SARS-CoV-2 virus, and wherein the at least one anti-SARS-CoV-2 antibody, or antigen-binding portion thereof, or recombinant ACE2 is expressed in the subject at an expression level sufficient to reduce: i) the SARS-CoV-2 viral load in the subject, and/or ii) at least one symptom in the subject caused by the SARS-CoV-2 infection; or B) the subject is not infected with the SARS-CoV-2 virus, and wherein the at least one anti-SARS-CoV-2 antibody, or antigen-binding portion thereof, or recombinant ACE2 is expressed in the subject at an expression level sufficient to prevent the subject from being infected by the SARS-CoV-2 virus.
  • the expression level is maintained in the subject for at least two weeks without: i) any further, or only one, two, or three further repeat, of steps a) and b), and ii) any further administration of vectors encoding the at least one anti-SARS-CoV-2 antibody or antigen-binding portion thereof.
  • the expression level is maintained in the subject for at least one month without: i) any further, or only one, two, or three further repeat, of steps a) and b), and ii) any further administration of vectors encoding the at least one anti-SARS- CoV-2 antibody or antigen-binding portion thereof.
  • the expression level is maintained in the subject for at least one year, or two years, or for the lifetime of the subject, without: i) any further, or only one, two, or three further repeat, of steps a) and b), and ii) any further administration of vectors encoding the at least one anti-SARS-CoV-2 antibody or antigen- binding portion thereof.
  • the at least one anti-SARS-CoV-2 antibody, or antigen-binding portion thereof is expressed in the subject at a level of: i) between 500ng/ml and 50ug/ml, or 10-20ug/ml, for at least 25 days, or ii) at least 250 ng/ml for at least 25 days.
  • provided herein are methods of simultaneously expressing at least three different antibodies, or antigen binding portions thereof, in a subject comprising: a) administering a first composition to a subject, wherein the first composition comprises polycationic structures, and wherein the first composition is free, or essentially free, of nucleic acid molecules; and b) administering a second composition to the subject after administering the first composition, wherein the second composition comprises a plurality of one or more non-viral expression vectors that encode at least three different antibodies or antigen-binding portions thereof, and wherein, as a result of the administering the first and second compositions, the at least three different antibodies, or antigen-binding portions thereof, are simultaneously expressed in the subject.
  • the at least three different antibodies, or antigen binding portions thereof are specific for SARS-CoV-2 and/or influenza A, and/or influenza B. In some embodiments, the at least three different antibodies, or antigen-binding portions thereof, are each fully or substantially neutralizing for SARS-CoV-2. In other embodiments, the at least three different antibodies, or antigen-binding portions thereof, are each fully or substantially neutralizing for a virus selected from the group consisting of: HIV, influenza A, influenza B, and malaria.
  • systems comprising: a) a first container; b) a first composition inside the first container and comprising polycationic structures, wherein the first composition is free, or essentially free, of nucleic acid molecules; c) a second container; and d) a second composition inside the second container and comprising a plurality of one or more non- viral expression vectors that encode at least three different antibodies or antigen-binding portions thereof.
  • the systems further comprise: an agent that: i) increases the level of expression of at least one of the at least three different antibodies or antigen-binding portions thereof when administered to a subject, and/or ii) and/or the length of time of the expression, as compared to when the agent is not administered to the subject.
  • the agent is present in the first composition and/or the second composition.
  • the systems further comprise a third container, and wherein the agent is present in the third container.
  • the at least three different antibodies or antigen-binding portions thereof are each expressed in the subject at a level of at least 100 ng/ml (e.g., at least 100...500... 900 ng/ml).
  • the at least three different antibodies or antigen-binding portions thereof are each expressed in the subject at a level of at least 100 ng/ml for at least 25 days. In other embodiments, the at least three different antibodies or antigen-binding portions thereof, are expressed in the subject at a level of at least 200 ng/ml. In further embodiments, the at least three different antibodies or antigen-binding portions thereof, are expressed in the subject at a level of at least 200 ng/ml for at least 25 days.
  • the expression level is maintained in the subject for at least two weeks, or at least 3 weeks, without: i) any further, or only one or two further, repeats of steps a) and b), and ii) any further administration of vectors encoding the at least three different antibodies or antigen binding portions thereof.
  • the one or more non-viral expression vectors comprise three non- viral expression vectors.
  • each of the three non-viral expression vector encodes a different antibody or antigen binding fragment thereof.
  • the one or more non-viral expression vectors comprise six non-viral expression vectors.
  • each of the six non-viral expression vectors encodes a different antibody light chain variable region, or heavy chain variable region.
  • the one or more non-viral expression vectors comprise first, second, and third nucleic acid sequences each encoding an antibody light chain variable region, and fourth, fifth, and sixth nucleic acid sequences each encoding an antibody heavy chain variable region.
  • the antigen-binding portions thereof are selected from the group consisting of: a Fab', F(ab)2, Fab, and a minibody.
  • at least one of the at least three different antibodies or antigen- binding portions thereof is an anti-SARS-CoV-2 antibody or antigen binding portion thereof.
  • the at least one of the at least three different antibodies or antigen-binding portions thereof is an antibody or antigen binding portion thereof selected from Table 4 and/or Table 7.
  • the at least three different antibodies or antigen-binding portions thereof comprise at least four, five, six, seven, or eight different antibodies or antigen-binding portions thereof.
  • the administering comprises intravenous administering.
  • methods comprising: a) administering a first composition to a subject, wherein the first composition comprises polycationic structures, and wherein the first composition is free, or essentially free, of nucleic acid molecules; and b) administering a second composition to the subject after administering the first composition, wherein the second composition comprises a plurality of non-viral expression vectors that encode human growth hormone (hGH) and/or hGH linked to a half-life extending peptide (hGH-ext), and wherein, as a result of the administering the first and second compositions, the hGH is expressed in the subject.
  • hGH human growth hormone
  • hGH-ext half-life extending peptide
  • the hGH and/or hGH-ext is expressed in the subject at a serum expression level of at least 1 ng/ml (e.g., at least 1...10...100...500 ng/ml).
  • the expression level is maintained in the subject for at least two weeks without: i) any further, or only one further repeat, of steps a) and b), and ii) any further administration of vectors encoding the hGH or hGH-ext.
  • the expression level is maintained in the subject for at least one month without: i) any further, or only one further repeat, of steps a) and b), and ii) any further administration of vectors encoding the hGH or hGH-ext.
  • the expression level is maintained in the subject for at least one year without: i) any further, or only one further repeat, of steps a) and b), and ii) any further administration of vectors encoding the hGH or hGH-ext.
  • the plurality of non-viral expression vectors encode the hGH-ext, and wherein the half-life extending peptide is selected from the group consisting of: an Fc region peptide, serum albumin, carboxy terminal peptide of human chorionic gonadotropin b-subunit (CTP), and XTEN (see, Schellenberger et al., Nat Biotechnol.2009 Dec;27(12):1186-90).
  • the methods further comprise: c) administering an agent, in the first and/or second composition, or present in a third composition, wherein the agent: i) increases the level of expression of the hGH and/or hGH-ext, and/or ii) and/or the length of time of the expression compared to when the agent is not administered to the subject.
  • systems comprising: a) a first container; b) a first composition inside the first container and comprising polycationic structures, wherein the first composition is free, or essentially free, of nucleic acid molecules; c) a second container; and d) a second composition inside the second container and comprising a plurality of non-viral expression vectors that encode human growth hormone (hGH) and/or hGH linked to a half-life extending peptide (hGH-ext).
  • hGH human growth hormone
  • hGH-ext half-life extending peptide
  • systems further comprise: an Agent that: i) increases the level of expression of the hGH and/or the hGH-ext when administered to a subject, and/or ii) and/or the length of time of the expression; as compared to when the agent is not administered to the subject.
  • the agent is present in the first composition and/or the second composition.
  • the systems further comprise: a third container, and wherein the agent is present in the third container.
  • methods comprising: a) administering a first composition to a subject, wherein the first composition comprises polycationic structures, and wherein the first composition is free, or essentially free, of nucleic acid molecules; b) administering a second composition to the subject after administering the first composition, wherein the second composition comprises a plurality of expression vectors that each comprise a first nucleic acid sequence encoding a first protein and/or a first biologically active nucleic acid molecule; and c) administering an agent, in the first and/or second composition, or present in a third composition, wherein the agent: i) increases the level of expression of the first protein or the first biologically active nucleic acid molecule, and/or ii) and/or the length of time of the expression; and/or iii) decreases toxicity as measured by alanine aminotransferase (ALT) levels; all as compared to when the agent is not administered to the subject; wherein the agent is selected from the group consist
  • the first protein or the first biologically active nucleic acid molecule is expressed in the subject at a serum expression level of at least 10 ng/ml or at least 100 ng/ml.
  • the expression level is maintained in the subject for at least two weeks without: i) any further, or only one further repeat, of steps a), b) and c), and ii) any further administration of vectors encoding the first protein or the first biologically active nucleic acid molecule.
  • the expression level is maintained in the subject for at least one month without: i) any further, or only one further repeat, of steps a), b) and c), and ii) any further administration of vectors encoding the first protein or the first biologically active nucleic acid molecule.
  • the expression level is maintained in the subject for at least one year without: i) any further, or only one further repeat, of steps a), b), and c), and ii) any further administration of vectors encoding the first protein or the first biologically active nucleic acid molecule.
  • the first nucleic acid sequence provides the first protein or the first biologically active nucleic acid molecule, wherein the first biologically active nucleic acid molecule comprises a sequence selected from: an siRNA or shRNA sequence, a miRNA sequence, an antisense sequence, a CRISPR multimerized single guide, and a CRISPR single guide RNA sequence (sgRNA).
  • each of the expression vectors further comprises a second nucleic acid sequence encoding: i) a second therapeutic protein, and/or ii) a second biologically active nucleic acid molecule.
  • the agent is present in the first composition.
  • the agent is present in the third composition, and is administered at least one hour prior to the first composition.
  • the agent comprises docosahexaenoic Acid (DHA). In further embodiments, the agent comprises eicosapenaenoic Acid (EPA).
  • DHA docosahexaenoic Acid
  • EPA eicosapenaenoic Acid
  • systems comprising: a) a first container; b) a first composition inside the first container and comprising polycationic structures, wherein the first composition is free, or essentially free, of nucleic acid molecules; c) a second container; and d) a second composition inside the second container and comprising a plurality of expression vectors that each comprise a first nucleic acid sequence encoding a first protein and/or a first biologically active nucleic acid molecule; and e) an agent in the first and/or second composition, or present in a third composition in a third container, wherein the agent is selected from the group consisting of: docosahexaenoic acid (DHA), eicosapenaenoic
  • the agent when administered to a subject with the first and second compositions: i) increases the level of expression of the first protein or the first biologically active nucleic acid molecule, and/or ii) and/or the length of time of the expression; and/or iii) decreases toxicity as measured by alanine aminotransferase (ALT) levels; all as compared to when the agent is not administered to the subject.
  • the agent is present in the first composition and/or the second composition.
  • the systems further comprise said third container, and wherein the agent is present in the third container.
  • methods comprising: a) administering a first composition to a subject via the subject's airway, wherein the first composition comprises polycationic structures, and wherein the first composition is free, or essentially free, of nucleic acid molecules; and b) administering a second composition to the subject after administering the first composition, wherein the administering is via the subject's airway, and wherein the second composition comprises a plurality of expression vectors that each comprise a first nucleic acid sequence encoding a first protein and/or a first biologically active nucleic acid molecule; and wherein, as a result of the administering the first and second compositions to the subject, the first protein or the first biologically active nucleic acid molecule is expressed in the subject.
  • the first protein or the first biologically active nucleic acid molecule is expressed in the subject's lungs.
  • the first composition is an aqueous composition or a freeze-dried composition.
  • the second composition is an aqueous composition or a freeze-dried composition.
  • the polycationic structure comprise lipids selected from the group consisting of: 1,2-dioleoyl-3- trimethylammonium-propane (DOTAP); 1,2-Dimyristoyl-sn-glycero-3-phosphocholine (DMPC); 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS); and 1-stearoyl-2-oleoyl-sn-glycero-3- phospho-L-serine.
  • DOTAP 1,2-dioleoyl-3- trimethylammonium-propane
  • DMPC 1,2-Dimyristoyl-sn-glycero-3-phosphocholine
  • DOPS 1,2-dioleoyl-sn-glycero-3-phospho-L-serine
  • 1-stearoyl-2-oleoyl-sn-glycero-3- phospho-L-serine 1-stearoyl-2-oleoyl-
  • systems comprising: a) a first container; b) a first composition inside the first container and comprising polycationic structures, wherein the first composition is free, or essentially free, of nucleic acid molecules, and wherein the polycationic structure comprise lipids selected from the group consisting of: 1,2-dioleoyl-sn- glycero-3-phospho-L-serine (DOPS); and 1-stearoyl-2-oleoyl-sn-glycero-3-phospho-L-serine; c) a second container; and d) a second composition inside the second container and comprising a plurality of expression vectors that each comprise a first nucleic acid sequence encoding a first protein and/or a first biologically active nucleic acid molecule.
  • DOPS 1,2-dioleoyl-sn- glycero-3-phospho-L-serine
  • systems comprising: a) a first container; b) a first composition inside the first container and comprising polycationic structures, wherein the first composition is free, or essentially free, of nucleic acid molecules; c) a second container; and d) a second composition inside the second container and comprising a plurality of expression vectors that each comprise a first nucleic acid sequence encoding a first protein and/or a first biologically active nucleic acid molecule, wherein the first and/or second composition is a freeze-dried composition.
  • kits for treating a subject comprising: administering a composition to a subject, wherein the composition comprises: i) an emulsion and/or plurality of liposomes, and ii) an Agent, wherein the subject has: inflammation, an autoimmune disease, an immune-deficiency disease, SARS-CoV-2 infection, and/or is receiving a checkpoint inhibitor, and wherein the Agent selected from the group consisting of: dexamethasone, dexamethasone palmitate, a dexamethasone fatty acid ester, docosahexaenoic Acid (DHA), eicosapenaenoic Acid (EPA), alpha Linolenic Acid (ALA), lipoxin A4 (LA4), 15- deoxy-12,14-Prostaglandin J2 (15d), arachidonic acid (AA), docosapentaenoic acid (DPA), retinoic Acid (RA), diallyl disulfide (DADS), o
  • the administration comprises airway administration. In other embodiments, the administration comprises systemic administration. In other embodiments, the composition comprises the liposomes, and wherein Agent is incorporated into the liposomes. In other embodiments, the composition further comprises one or more of the Agents not in the liposomes. In additional embodiments, the composition is free, or essentially free, or nucleic acid molecules. In other embodiments, the subject is infected with SARS-CoV-2, and the method further comprises administering an anti-viral agent to the subject. In further embodiments, the anti-viral agent comprises Remdesivir or a protein comprising at least part of the ACE2 receptor. In other embodiments, the methods further comprise: administering an anti-inflammatory and/or anticoagulant to the subject.
  • the composition is an aqueous composition or a freeze-dried composition.
  • the liposomes comprise lipids selected from the group consisting of: 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP); 1,2- Dimyristoyl-sn-glycero-3-phosphocholine (DMPC); 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS); and 1-stearoyl-2-oleoyl-sn-glycero-3-phospho-L-serine.
  • DOTAP 1,2-dioleoyl-3-trimethylammonium-propane
  • DMPC 1,2- Dimyristoyl-sn-glycero-3-phosphocholine
  • DOPS 1,2-dioleoyl-sn-glycero-3-phospho-L-serine
  • methods comprising: a) administering a first composition to an animal model, wherein the first composition comprises polycationic structures, and wherein the first composition is free, or essentially free, of nucleic acid molecules, and wherein the animal model is infected with SARS-CoV-2; and b) administering a second composition to the animal model after administering the first composition, wherein the second composition comprises a plurality of one or more non-viral expression vectors that encode first and second anti-SARS-CoV-2 antibodies or antigen-binding portion thereof, and wherein, as a result of the administering the first and second compositions, the first and second candidate anti- SARS-CoV-2 antibodies or antigen-binding portions thereof, are expressed in the animal model; and c) determining the extent to which the expression of the first and second candidate anti-SARS- CoV-2 antibodies, or antigen-binding portions thereof, i) reduce the SARS-CoV-2 viral load in the animal model, and/or ii) reduce at
  • the plurality of one or more non-viral expression vectors further encode third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, or eleventh candidate anti-SARS-CoV-2 antibodies or antigen-binding fragments thereof.
  • the animal model is selected from a: mouse, rat, hamster, Guinee pig, primate, monkey, chimpanzee, or rabbit.
  • first and anti- SARS-CoV2 antibodies, or antigen binding portions thereof are from Table 7 or Table 5.
  • the first and second anti- SARS-CoV2 antibodies, or antigen binding portions thereof are selected from the group consisting of: REGN10933, REGN10987; VIR-7831; LY-CoV1404; LY3853113; Zost 2355K; CV07-209K; C121L; Zost 2504L; CV38-183L; COVA215K; RBD215; CV07-250L; C 1 44L; COVA118L; C135K; and B38.
  • the first and second anti- SARS-CoV2 antibodies, or antigen binding portions thereof are REGN10933 and REGN10987.
  • the polycationic structures comprise cationic lipids.
  • first composition comprises a plurality of liposomes, wherein at least some of said liposomes comprises said cationic lipids. In other embodiments, at least some of said liposomes comprise neutral lipids. In further embodiments, the ratio of said cationic lipids to said neutral lipids in said liposomes is 95:05 - 80:20 or about 1:1.
  • the cationic and neutral lipids are selected from the group consisting of: distearoyl phosphatidyl choline (DSPC); hydrogenated or non-hydrogenated soya phosphatidylcholine (HSPC); distearoylphosphatidylethanolamine (DSPE); egg phosphatidylcholine (EPC); 1,2-Distearoyl-sn- glycero-3-phospho-rac-glycerol (DSPG); dimyristoyl phosphatidylcholine (DMPC); 1,2- Dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG); 1,2-Dipalmitoyl-sn-glycero-3-phosphate (DPPA); trimethylammonium propane lipids; DOTIM (1-[2-9(2)-octadecenoylloxy)ethyl]-2-(8(2)- heptadecenyl)-3-(2-hydroxyethyl) mid
  • the one or more non-viral expression vectors comprise plasmids, wherein the plasmids are not attached to, or encapsulated in, any delivery agent.
  • the one or more non-viral expression vectors comprise a first nucleic acid sequence encoding an antibody light chain variable region, and a second nucleic acid sequence encoding an antibody heavy chain variable region, and optionally, a third nucleic acid sequence encoding an antibody light chain variable region, and a fourth nucleic acid sequence encoding an antibody heavy chain variable region.
  • the antigen-binding portion thereof is selected from the group consisting of: a Fab', F(ab)2, Fab, and a minibody, and/or B) the wherein the at least one anti-SARS-CoV-2 antibody, or antigen-binding portion thereof, is bi- specific for different SARS-CoV-2 antigens.
  • the anti-SARS-CoV-2 antibody is monoclonal antibody selected from the group consisting of: REGN10933, REGN10987; VIR-7831; LY-CoV1404; LY3853113; Zost 2355K; CV07-209K; C121L; Zost 2504L; CV38-183L; COVA215K; RBD215; CV07-250L; C144L; COVA118L; C135K; and B38.
  • the anti-SARS-CoV-2 antibody, or antigen-binding portion thereof comprises at least two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, or more of any combination of the following: REGN10933, REGN10987; VIR-7831; LY-CoV1404; LY3853113; Zost 2355K; CV07-209K; C121L; Zost 2504L; CV38- 183L; COVA215K; RBD215; CV07-250L; C144L; COVA118L; C135K; and B38 (or any of those shown in Table 7 or Table 5).
  • the anti-SARS-CoV-2 antibody, or antigen binding portion thereof is as described in Table 7.
  • the at least one anti-SARS-CoV-2 antibody, or antigen-binding portion thereof comprises at least two anti-SARS-CoV-2 antibodies, and/or antigen-binding portions thereof, which are expressed in the subject at an expression level sufficient to reduce: i) the SARS-CoV-2 viral load in the subject, and/or ii) at least one symptom in the subject caused by the SARS-CoV-2 infection.
  • the at least one anti-SARS-CoV-2 antibody, or antigen-binding portion thereof comprises at least four, or at least eight, or at least eleven, anti- SARS-CoV-2 antibodies and/or antigen-binding portions thereof.
  • the at least one anti-SARS-CoV-2 antibody, or antigen-binding portion thereof comprises at least four, or at least eight, or at least 11, anti-SARS-CoV-2 antibodies and/or antigen-binding portions thereof, and which are expressed in the subject at an expression level sufficient to reduce: i) the SARS-CoV-2 viral load in the subject, and/or ii) at least one symptom in the subject caused by the SARS-CoV-2 infection.
  • the administering comprises intravenous administering.
  • the second composition is administered: i) between 0.5 and 80 minutes after the first composition, or between about 1 and 20 minutes after the first composition.
  • the methods further comprise: c) administering an agent, in the first and/or second composition, or present in a third composition, wherein the agent: i) increases the level of expression of the at least one anti-SARS-CoV-2 antibody or antigen-binding portion thereof, and/or ii) and/or the length of time of the expression compared to when the agent is not administered to the subject.
  • the agent is present in the first composition.
  • the agent is present in the third composition, and is administered at least one hour prior to the first composition.
  • the agent is selected from the group consisting of: dexamethasone, dexamethasone palmitate, a dexamethasone fatty acid ester, Docosahexaenoic Acid (DHA), Eicosapenaenoic Acid (EPA), Alpha Linolenic Acid (ALA), Lipoxin A4 (LA4), 15-deoxy-12,14-Prostaglandin J2 (15d), Arachidonic Acid (AA), Docosapentaenoic Acid (DPA), Retinoic Acid (RA), Diallyl Disulfide (DADS), Oleic Acid (OA), Alpha Tocopherol (AT), Sphingosine-1-Phosphate (S-1-P), Palmitoyl Sphingomyelin (SPH), an anti-TNFa antibody or antigen binding fragment thereof, a heparinoid, and N-
  • the dexamethasone fatty acid ester has the following Formula: wherein R 1 is C 5 -C 23 alkyl or C 5 -C 23 alkenyl.
  • the agent e.g., water soluble dexamethasone, aka dexamethasone cyclodextrin inclusion complex; see Sigma Sku D2915
  • the subject has lung, cardiovascular, and/or multi-organ inflammation.
  • the subject is on a ventilator.
  • the first and/or second compositions further comprise a physiologically tolerable buffer or intravenous solution.
  • the first and/or second compositions further comprise lactated Ringer's solution or saline solution.
  • the first compositions comprise liposomes comprising the polycationic structures, wherein the liposomes further comprising one or more macrophage targeting moieties selected from the group consisting of: mannose moieties, maleimide moieties, a folate receptor ligand, folate, folate receptor antibody or fragment thereof, formyl peptide receptor ligands, N-formyl-Met-Leu-Phe, tetrapeptide Thr-Lys-Pro-Arg, galactose, and lactobionic acid.
  • the plurality of one or more non-viral expression vectors are not attached to, or encapsulated in, any delivery agent.
  • the subject is a human.
  • the polycationic structures comprise cationic liposomes which are present at a concentration of 0.5-100 mM in the first composition.
  • the subject is a human, wherein: i) an amount of the first composition is administered such that the human receives a dosage of 2-50 mg/kg of the polycationic structures; and/or ii) an amount of the second composition is administered such that the human receives a dosage of 0.05-60 mg/kg of the expression vectors.
  • the polycationic structures comprise cationic liposomes, wherein the cationic liposomes further comprise a lipid bi-layer integrating peptide and/or a target peptide.
  • the lipid bi-layer integrating peptide is selected from the group consisting of: surfactant protein D (SPD), surfactant protein C (SPC), surfactant protein B (SPB), and surfactant protein A (SPA), and ii) the target peptide is selected from the group consisting of: microtubule-associated sequence (MTAS), nuclear localization signal (NLS), ER secretion peptide, ER retention peptide, and peroxisome peptide.
  • MTAS microtubule-associated sequence
  • NLS nuclear localization signal
  • ER secretion peptide ER retention peptide
  • peroxisome peptide peroxisome peptide
  • steps a) and b) are repeated between 1 and 60 days after the initial step b).
  • each of the non-viral expression vectors comprise between 5,500 and 30,000 nucleic acid base pairs.
  • the methods further comprise: administering an anti-viral agent to the subject.
  • the anti-viral agent comprises Remdesivir or a protein comprising at least part of the ACE2 receptor.
  • the methods further comprise: administering an anti-inflammatory and/or anticoagulant to the subject.
  • the one or more non-viral expression vectors are CPG-free or CPG-reduced.
  • the Agent herein comprises a dexamethasone fatty acid ester (e.g., as shown in Formula I).
  • dexamethasone palmitate has the following formula (Formula I): .
  • Other fatty acid esters of dexamethasone can also be used, with another fatty acid ester replacing the palmitate group.
  • the fatty acid ester is a C 6 -C 24 fatty acid ester, such as hexanoate (caproate), heptanoate (enanthate), octanoate (caprylate), nonanoate (pelargonate), decanoate (caprate), undecanoate, dodecanoate (laurate), tetradecanoate (myristate), octadecenoate (stearate), icosanoate (arachidate), docosanoate (behenate), and tetracosanoate (lignocerate).
  • hexanoate caproate
  • heptanoate enanthate
  • octanoate caprylate
  • nonanoate pelargonate
  • decanoate caprate
  • undecanoate dodecanoate
  • dodecanoate laaurate
  • tetradecanoate myristate
  • the compound is selected from dexamethasone caproate, dexamethasone enanthate, dexamethasone caprylate, dexamethasone pelargonate, dexamethasone caprate, dexamethasone undecanoate, dexamethasone laurate, dexamethasone myristate, dexamethasone palmitate, dexamethasone stearate, dexamethasone arachidate, dexamethasone behenate, and dexamethasone lignocerate.
  • the agent is said dexamethasone fatty acid ester of Formula I, and wherein R 1 is a C 5 -C 23 alkyl. In other embodiments, the agent is said dexamethasone fatty acid ester of Formula I, and wherein R 1 is a C 5 -C 23 straight chain alkyl. In other embodiments, the agent is said dexamethasone fatty acid ester of Formula I, and wherein R 1 is a C 15 alkyl.
  • Figure 1 shows results from Example 1, showing expression levels over 36 days for four different antibodies or antibody fragments (anti-IL5; 5J8 anti-flu; anti- SARS-CoV-2; and anti- CD20).
  • Figure 2 shows results from Example 2, showing expression levels over 43 days for anti- SARS-CoV-2 antibody, as well as expression data for anti-IL5, 5J8 anti-flu, and anti-Sars-Cov2.
  • Figure 3A shows results from Example 3, which shows expression levels of multiple unique monoclonal antibodies.
  • Figure 3B shows results from Example 3, which shows expression levels of the antibodies at various time points over 29 days after initial injection.
  • Figure 4 shows results from Example 4, which shows expression levels of antibodies at certain days after injection.
  • Figure 5A shows results from Example 5, which shows expression levels of various proteins over 15 days.
  • Figure 5B shows the results of Example 5, which shows expression levels of various proteins over 22 days.
  • Figure 6 shows results from Example 6, which shows expression levels of various antibodies over 22 days.
  • Figure 7 shows results from Example 7, which shows expression levels of various proteins.
  • Figures 8A and 8B show results from Example 8, which shows expression levels of cDNA- encoded recombinant ACE2 proteins over 9 days.
  • Figure 9 shows results from Example 9 which shows expression levels of human ACE2 and a variant thereof.
  • Figure 10 shows the nucleic acid sequence for plasmid 070120 # 1 : B38-Lambda-BV3 (SEQ ID NO:10).
  • Figure 11 shows the nucleic acid sequence for plasmid 070120 # 11 : B38H-B38L-BV3 : Dual (SEQ ID NO:11).
  • Figure 12 shows the nucleic acid sequence for plasmid 070320 # 4 : B38-Kappa-BV3 (SEQ ID NO:12).
  • Figure 13 shows the nucleic acid sequence for plasmid 071320 # 3 : H4-Kappa-BV3 (SEQ ID NO:13).
  • Figure 14 shows the nucleic acid sequence for plasmid 080920 # 6 : H4-H4-Kappa-BV3 (SEQ ID NO:14).
  • Figure 15 shows the nucleic acid sequence for plasmid 072620 # 5A : 4A8- BV3 (SEQ ID NO:15).
  • Figure 16 shows the nucleic acid sequence for plasmid 081820 # 2 : 4A8- 4A8-BV3 (SEQ ID NO:16).
  • Figure 17 shows the nucleic acid sequence for plasmid 081820 # 3 : 4A8- B38Kappa-BV3 (SEQ ID NO:17).
  • Figure 18 shows the nucleic acid sequence for plasmid 081820 # 4 : 4A8- H4-BV3 (SEQ ID NO:18).
  • Figure 19 shows the nucleic acid sequence for plasmid 081820 # 5 : 4A8- shACE2-BV3 (SEQ ID NO:19).
  • Figure 20 shows the nucleic acid sequence for plasmid 080420 # 3 : shACE2- BV3 (SEQ ID NO:20).
  • Figure 21 shows the nucleic acid sequence for plasmid 082020 # 1 : shACE2 TYLTNY- BV3 (SEQ ID NO:21).
  • Figure 22 shows the nucleic acid sequence for plasmid 081320 # 2A : shACE2-1xL-Fc- BV3 (SEQ ID NO:22).
  • Figure 23 shows the nucleic acid sequence for plasmid 081320 # 4A : shACE2-1xL- FcLALA- BV3 (SEQ ID NO:23).
  • Figure 24 shows the nucleic acid sequence for plasmid 082620 # 5A : shACE2 TYLTNY- 1xL-FcLALA- BV3 (SEQ ID NO:24).
  • Figure 25 shows the nucleic acid sequence for plasmid 080420 # 4 : shACE2- shACE2- BV3 (SEQ ID NO:25).
  • Figure 26 shows the nucleic acid sequence for plasmid 081120 # 1 : B38Kappa- shACE2- BV3 (SEQ ID NO:26).
  • Figure 27 shows the nucleic acid sequence for plasmid 081120 # 4 : shACE2-B38Kappa - BV3 (SEQ ID NO:27).
  • Figure 28 shows the nucleic acid sequence for plasmid 081120 # 2 : H4- shACE2-BV3 (SEQ ID NO:28).
  • Figure 29 shows the nucleic acid sequence of plasmid 081120 # 5 : shACE2-H4 -BV3 (SEQ ID NO:29).
  • Figure 30 shows the nucleic acid sequence of plasmid 072320 # 2 : H4-aCD20-aIL5-5J8- BV2 (SEQ ID NO:30).
  • Figure 31 shows the nucleic acid sequence of plasmid 070620 # 2 : B38 Lambda- aCD20(Cys)-BV3 (SEQ ID NO:31).
  • Figure 32 shows the nucleic acid sequence of plasmid 120717 # 1 : aCD20-aIL5-5J8-BV2 (SEQ ID NO:32).
  • Figure 33 shows the nucleic acid sequence of plasmid 122019 # 2A: GLA-1xL-hyFc (SEQ ID NO:33).
  • Figure 34 shows the nucleic acid sequence of plasmid 011215 # 7 : hGCSF-BV3 (SEQ ID NO:34).
  • Figures 35 shows the nucleic acid sequence of plasmid 071816# 1: (SEQ ID NO:35).
  • Figure 36 shows the nucleic acid sequence of plasmid 072520 # 4: aCD20-aCD20 (SEQ ID NO:36).
  • Figure 37 shows the nucleic acid sequence of plasmid 111517 # 1 : 5J8-5J8: Double 2A (SEQ ID NO:37).
  • Figure 38 shows the nucleic acid sequence of plasmid 111517 # 3 : aIL5-aIL5 : Double 2A (SEQ ID NO:38).
  • Figure 39 shows the nucleic acid sequence of plasmid 111517 # 19A : 5J8-aIL5 : Daul 2A (SEQ ID NO:39).
  • Figure 40 shows the nucleic acid sequences of: A) Codon Optimized Human Growth Hormone (hGH1) cDNA (SEQ ID NO:40); B) hGH1-Fc (SEQ ID NO:41); C) Linker GGGGS (SEQ ID NO:42), 1xLinker: GGTGGAGGAGGTAGT (SEQ ID NO:43), 2xLinker: GGTGGAGGAGGTAGTGGGGGTGGAGGTTCA (SEQ ID NO:44), and 3xLinker: GGAGGAGGTGGATCAGGTGGAGGAGGTAGTGGGGGTGGAGGTTCA (SEQ ID NO:45); D) Fc (SEQ ID NO:46); E) Fc chainA (SEQ ID NO:47); and F) Fc chainB (SEQ ID NO:48).
  • hGH1 Codon Optimized Human Growth Hormone
  • Figure 41 shows the nucleic acid sequences of: A) Fc chainAB (SEQ ID NO:49); B) Fc- IgG4 (SEQ ID NO:50); C) hyFc (SEQ ID NO:51); D) mFc (SEQ ID NO:52); E) GAALIE (SEQ ID NO:53); and F) GAALIE-LS (SEQ ID NO:54).
  • Figure 42 shows the nucleic acid sequences of: A) hGH1-HSA (SEQ ID NO:55); and B) HSA-K753P-Linker-GH1: (SEQ ID NO:56).
  • Figure 43 shows the nucleic acid sequences of: A) hGH1-CTP (SEQ ID NO:57); B) CTP- hGH1-CTP (SEQ ID NO:58); C) CTP-hGH1 (SEQ ID NO:59); and D) XTEN1-hGH1 (SEQ ID NO:60).
  • Figure 44 shows the nucleic acid sequences of: A) XTEN1-hGH1-XTEN2 (SEQ ID NO:61); and B) hGH1-XTEN2 (SEQ ID NO:62).
  • Figure 45A shows that expression of the wild type hGH cDNA fused to a protein half-life extending DNA sequence, including Fc, serum albumin or Xten can significantly increase serum hGH levels over time in immunocompetent mice.
  • Figure 45B shows that the cDNA-encoded hGH protein produced is fully bioactive, as it appropriately increases the levels of the hGH-regulated, endogenous mouse, IGF-1 protein.
  • Figure 45C shows one injection of a DNA vector in the procedure of Example 10 procedure drives the wild type hGH cDNA but lacking any protein half- life extending DNA sequence can produce durable production of therapeutic hGH serum levels in immunocompetent mice.
  • Figure 46 shows that the procedures of Example 11 can be used to express wild type hGH cDNA fused to a protein half-life extending DNA sequence, including Fc, serum albumin or Xten to significantly increase serum hGH levels over time in immunocompetent mice.
  • Figure 47 shows that, using the procedure of Example 12, one re-injection of a DNA vector driving the wild type hGH cDNA into fully immunocompetent mice can significantly and durably further increase serum hGH levels produced by the initial HEDGES hGH DNA vector injection.
  • Figure 48 show expression levels of hGH fused to an Fc region protein extends the half-life of hGH out to a least 225 days and after a single DNA injection in mice.
  • Figure 49 shows expression levels of hGH fused to an Fc region protein out 64 days from treatment.
  • Figure 50A shows that selective site-directed mutagenesis of the Fc region of an DNA vector driving the wild type hGH cDNA fused to an Fc protein half-life extending DNA sequence can selectively either increase or decrease serum hGH levels produced in immunocompetent mice.
  • Figure 50B shows that selective site-directed mutagenesis of the Fc region of a DNA vector driving the wild type hGH cDNA fused to an Fc protein half-life extending DNA sequence can selectively increase serum hGH levels produced over time in immunocompetent mice.
  • Figure 51 shows that incorporating an optimized molar percentage of dexamethasone palmitate (DexPalm) into cationic liposomes can both further increase gene expression and further decrease toxicity.
  • Figure 52 shows that incorporating an optimized molar percentage of dexamethasone palmitate into cationic liposomes can both further increase gene expression and further decrease toxicity.
  • Figure 53 shows that pre-injecting an optimized molar percentage of dexamethasone palmitate in liposomes prior to injecting cationic liposomes can both further increase gene expression and further decrease toxicity.
  • Figure 54 shows that injecting some AILs incorporated into cationic liposomes can both further increase gene expression and further decrease toxicity (ALT levels).
  • Figure 55 shows that injecting certain AILs incorporated into cationic liposomes can both further increase gene expression and further decrease toxicity (ALT levels).
  • Figure 56 shows that incorporating an optimized molar percentage of dexamethasone palmitate into cationic liposomes can further increase peak levels of gene expression following an otherwise ineffective hG-CSF-DNA dose.
  • Figure 57 shows that by selectively modifying the lipid composition of liposomes administered intranasally, that these liposomes can be selectively targeted to intrapulmonary monocytes and macrophages to different extents, thus selectively immune-modulating the lung.
  • Figure 58 shows that by selectively modifying a parenteral aqueous soluble pre-dose, and/or the molar percentage of dexamethasone palmitate incorporated into subsequently administered liposomes, that the level of T lymphocyte activation both in lung and in the blood can be selectively immuno-modulated.
  • Figure 59 shows that by selectively modifying a parenteral aqueous soluble pre-dose, and/or the molar percentage of dexamethasone palmitate incorporated into subsequently administered liposomes, that the level of T lymphocyte activation both in lung and in the blood can be selectively immuno-modulated.
  • Figure 60 shows that pre-administration of an anti-TNF monoclonal antibody, can both further increase gene expression while further reducing its toxicity.
  • Figure 61 which shows that either pre- or post-administration of NSH can reduce toxicity.
  • Figure 62 shows that either pre- or post-administration of NSH can reduce toxicity.
  • Figure 63 shows that either pre-administration of NSH can both further increase gene expression while further reducing its toxicity.
  • Figure 64 shows that administration of various formulations of liposomes containing dexamethasone palmitate decreases lymphocyte counts in blood compared to systemic administration of dexamethasone alone.
  • Figure 65 shows that administration of various formulations of liposomes containing dexamethasone palmitate decreases monocyte counts in blood compared to systemic administration of dexamethasone alone.
  • Figure 66 shows results of Example 22, which shows that one injection of different single DNA expression plasmids each encoding one of five different SARS-CoV2-specific mAb (C135, C 2 15, COV2-2355, CV07-209, and C121) produces fully neutralizing serum levels of each SARS- CoV2-specific mAb for the full experimental course of at least 134 days following administration, and that these ongoing serum mAb levels functionally and continuously block SARS-CoV2 spike – human ACE2 binding for at least 120 days.
  • SARS-CoV2-specific mAb C135, C 2 15, COV2-2355, CV07-209, and C121
  • Figure 67 shows results from Example 23, which shows that a single injection results in expression of two SARS-CoV2-specific mAbs from a single plasmid for the course of at least 134 days following this procedure, and that these serum-expressed mAbs sera are functionally capable of blocking SARS-CoV2 spike – human ACE2 interactions for at least 134 days.
  • Figure 68 shows results from Example 24 where three different approaches were successfully employed to express simultaneously express two anti-SARS-CoV2 mAbs simultaneously by the three approaches tried. All three approaches successfully allow for the expression of two mAbs in serum of animals at levels ( Figure 68B shows expression levels) that allow for neutralization of SARS-CoV2 / ACE2 interactions ( Figure 68b shows neutralization ability).
  • Figure 69 shows results from Example 25, which shows that two weekly injections of one or two DNA expression plasmids encoding a total of three different individual SARS-CoV2- specific mAbs produces fully neutralizing serum levels of three different SARS-CoV2-specific mAbs for the course of at least 70 days following administration, and that these ongoing serum mAbs levels functionally and continuously block SARS-CoV2 spike – human ACE2 for at least 70 days.
  • Figure 70 shows the results from Example 26, which shows the expression levels and neutralizing ability of four anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 71 shows the results from Example 27, which shows the expression levels and neutralizing ability of four anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 72 shows the results from Example 28, which shows the expression levels and neutralizing ability of four anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 73 shows the results from Example 29, which shows the expression levels and neutralizing ability of four anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 74 shows the results from Example 30, which shows the expression levels and neutralizing ability of four anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 75 shows the results from Example 31, which shows the expression levels and neutralizing ability of five anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 76 shows the results from Example 32, which shows the expression levels and neutralizing ability of six anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 77 shows the results from Example 33, which shows the expression levels and neutralizing ability of six anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 78 shows the results from Example 34, which shows the expression levels and neutralizing ability of six anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 79 shows the results from Example 35, which shows the expression levels and neutralizing ability of eight anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 80 shows the results from Example 36, which shows the expression levels and neutralizing ability of eight anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 81 shows the results from Example 37, which shows the expression levels and neutralizing ability of eight anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 82 shows the results from Example 38, which shows the expression levels and neutralizing ability of eight anti-SARS-CoV-2 antibodies expressed in mice.
  • Figure 83 shows the results from Example 39, which shows the expression levels and neutralizing ability of 10 anti-SARS-CoV-2 antibodies, as well as expression levels of other non- Sars-CoV-2 antibodies and various therapeutic proteins, expressed in mice.
  • Figure 84 shows the results from Example 40, which shows the expression levels and neutralizing ability of 11 anti-SARS-CoV-2 antibodies, as well as expression levels of other non- Sars-CoV-2 antibodies and various therapeutic proteins, expressed in mice.
  • Figure 85 shows the results from Example 41, which shows the expression levels and neutralizing ability of 10 anti-SARS-CoV-2 antibodies, as well as expression levels of other non- Sars-CoV-2 antibodies, expressed in mice.
  • Figure 86A shows the results from Example 42, which shows expression levels of the indicated mAbs over 1-48 hours.
  • Figures 86B shows neutralizing ability of the indicated mAbs over a period of 1-48 hours.
  • Figure 87 shows the results from Example 43, which describes the simultaneous expression of six different mAb and genes using a single injection.
  • Figure 88 shows the results from Example 44, which describes the use of various eukaryotic promoters to express a target gene (human growth hormone) over 120 days.
  • Figure 89 shows the results from Example 45, which describes simultaneously testing 11 different hGLA DNA vectors, showing that they produce a spectrum of serum levels over time.
  • Figure 90 shows the results from Example 46, which shows Fc-modified GLA can be expressed in heart tissue at therapeutic levels 104 days after injection of vector.
  • Figure 91 shows the results from Example 47, which compares the expression of various mutated Fc regions for GLA-Fc expression.
  • Figure 92 shows the results of Example 48, which describes the use of low dose dexamethasone pretreatment does not interfere with the durability of protein expression durability (and acute expression may be augmented).
  • CpG-reduced refers to a nucleic acid sequence or expression vector that has less CpG di-nucleotides than present in the wild-type versions of the sequence or vector.
  • CpG-free means the subject nucleic acid sequence or vector does not have any CpG di- nucleotides.
  • An initial sequence, that contains CpG dinucleotides e.g., wild-type version of an anti-SARS-CoV-2 antibody
  • Such CpG di-nucleotides can be suitably reduced or eliminated not just in a coding sequence, but also in the non-coding sequences, including, e.g., 5′ and 3′ untranslated regions (UTRs), promoter, enhancer, polyA, ITRs, introns, and any other sequences present in the nucleic acid molecule or vector.
  • the nucleic acid sequences employed herein are CpG-reduced or CpG-free.
  • empty liposomes refers to liposomes that do not contain nucleic acid molecules but that may contain other bioactive molecules (e.g., liposomes that are only composed of the lipid molecules themselves, or only lipid molecules and a small molecule drug). In certain embodiments, empty liposomes are used with any of the methods or compositions disclosed herein.
  • empty cationic micelles refers to cationic micelles that do not contain nucleic acid molecules but that may contain other bioactive molecules (e.g., micelles that are only composed of lipid and surfactant molecules themselves, or only lipid and surfactant molecules and a small molecule drug).
  • empty cationic micelles are used with any of the methods or compositions disclosed herein.
  • empty cationic emulsions refers to cationic emulsions or micro- emulsions that do not contain nucleic acid molecules but that may contain other bioactive molecules. In certain embodiments, empty cationic emulsions are used with any of the methods or compositions disclosed herein.
  • alkyl means a straight or branched saturated hydrocarbon chain containing from 1 to 30 carbon atoms, for example 1 to 16 carbon atoms (C 1 -C 16 alkyl), 1 to 14 carbon atoms (C 1 -C 14 alkyl), 1 to 12 carbon atoms (C 1 -C 12 alkyl), 1 to 10 carbon atoms (C 1 -C 10 alkyl), 1 to 8 carbon atoms (C 1 -C 8 alkyl), 1 to 6 carbon atoms (C 1 -C 6 alkyl), 1 to 4 carbon atoms (C 1 -C 4 alkyl), or 5 to 23 carbon atoms (C 5 -C 23 alkyl).
  • alkyl include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, 3-methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylpentyl, n- heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl, and n-dodecyl.
  • alkenyl refers to a straight or branched hydrocarbon chain containing from 2 to 30 carbon atoms and containing at least one carbon-carbon double bond, for example 2 to 16 carbon atoms (C 2 -C 16 alkyl), 2 to 14 carbon atoms (C 2 -C 14 alkyl), 2 to 12 carbon atoms (C 2 -C 12 alkyl), 2 to 10 carbon atoms (C 2 -C 10 alkyl), 2 to 8 carbon atoms (C 2 -C 8 alkyl), 2 to 6 carbon atoms (C 2 -C 6 alkyl), 2 to 4 carbon atoms (C 2 -C 4 alkyl), or 5 to 23 carbon atoms (C 5 -C 23 alkyl).
  • alkenyl include, but are not limited to, ethenyl, 2-propenyl, 2- methyl-2-propenyl, 3-butenyl, 4-pentenyl, 5-hexenyl, 2-heptenyl, 2-methyl-1-heptenyl, and 3- decenyl.
  • subject and patient refer to any animal, such as a mammal like a dog, cat, bird, livestock, and preferably a human.
  • administration refers to the act of giving a composition as described herein to a subject.
  • Exemplary routes of administration to the human body can be through the mouth (oral), skin (transdermal, topical), nose (nasal), lungs (inhalant), oral mucosa (buccal), by injection (e.g., intravenously, subcutaneously, intratumorally, intraocular, intraperitoneally, etc.), and the like.
  • injection e.g., intravenously, subcutaneously, intratumorally, intraocular, intraperitoneally, etc.
  • the present invention provides compositions, systems, kits, and methods for expressing at least one therapeutic protein or biologically active nucleic acid molecule in a subject.
  • the subject is first administered a composition comprising polycationic structures that is free, or essentially free, of nucleic acid molecules, and then (e.g., 1-30 minutes later) is administered a composition comprising a plurality of one or more non-viral expression vectors that encode at least one therapeutic protein (e.g., at least one anti-SARS-CoV-2 antibody, multiple different antibodies, at least one recombinant ACE2, or human growth hormone) or a biologically active nucleic acid molecule.
  • an agent is further administered (e.g., EPA or DHA) that increases the level and/or length of expression in a subject.
  • the first and/or second composition is administered via the subject's airway.
  • the present disclosure provides methods, systems, and compositions, that allow a single injection (e.g., intravenous injection) of cationic liposomes, followed shortly thereafter by injection (e.g., intravenous injection) of vectors encoding at least one protein or biologically active nucleic acid molecule, to produce circulating protein levels many times (e.g., 2-20 times higher) than with other approaches (e.g., allowing for expression for a prolonged period, such at 190 days or over 500 days).
  • the present disclosure employs polycationic structures (e.g., empty cationic liposomes, empty cationic micelles, or empty cationic emulsions) not containing vector DNA, which are administered to a subject prior to vector administration.
  • the polycationic structures are cationic lipids and/or are provided as an emulsion.
  • the present disclosure is not limited to the cationic lipids employed, which can be composed, in some embodiments, of one or more of the following: DDAB, dimethyldioctadecyl ammonium bromide; DPTAP (1,2-dipalmitoyl 3-trimethylammonium propane); DHA; prostaglandin, N-[1-(2,3- Dioloyloxy)propyl]-N,N,N-- trimethylammonium methylsulfate; 1,2-diacyl-3- trimethylammonium-propanes, (including but not limited to, dioleoyl (DOTAP), dimyristoyl, dipalmitoyl, disearoyl); 1,2-diacyl-3-dimethylammonium-propanes, (including but not limited to, dioleoyl, dimyristoyl, dipalmitoyl, disearoy
  • 2,3-dialkyloxypropyl quaternary ammonium compound derivates, containing a hydroxyalkyl moiety on the quaternary amine, such as 1,2-dioleoyl-3-dimethyl-hydroxyethyl ammonium bromide (DORI); 1,2-dioleyloxypropyl-3- dimethyl-hydroxyethyl ammonium bromide (DORIE); 1,2-dioleyloxypropyl-3-dimethyl- hydroxypropyl ammonium bromide (DORIE-HP), 1,2-dioleyloxypropyl-3-dimethyl-hydroxybutyl ammonium bromide (DORIE-HB); 1,2-dioleyloxypropyl-3-dimethyl-hydroxypentyl ammonium bromide (DORIE-HPe); 1,2-dimyristyloxypropyl-3-dimethyl-hydroxylethyl ammonium
  • DORI 1,2-dioleoyl-3-dimethyl-hydroxy
  • the neutral lipids employed with the methods, compositions, systems, and kits includes diacylglycerophosphorylcholine wherein the acyl chains are generally at least 12 carbons in length (e.g., 12 ... 14 ... 20 ... 24 ... or more carbons in length), and may contain one or more cis or trans double bonds.
  • Examples of said compounds include, but are not limited to, distearoyl phosphatidyl choline (DSPC), dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), palmitoyl oleoyl phosphatidylcholine (POPC), palmitoyl stearoyl phosphatidylcholine (PSPC), egg phosphatidylcholine (EPC), hydrogenated or non- hydrogenated soya phosphatidylcholine (HSPC), or sunflower phosphatidylcholine.
  • DSPC distearoyl phosphatidyl choline
  • DMPC dimyristoyl phosphatidylcholine
  • DPPC dipalmitoyl phosphatidylcholine
  • POPC palmitoyl oleoyl phosphatidylcholine
  • PSPC palmitoyl stearoyl phosphatidy
  • the neutral lipids include, for example, up to 70 mol diacylglycerophosphorylethanolamine/100 mol phospholipid (e.g., 10/100 mol ... 25/100 mol ... 50/100 ... 70/100 mol).
  • the diacylglycerophosphorylethanolamine has acyl chains that are generally at least 12 carbons in length (e.g., 12 ... 14 ... 20 ... 24 ... or more carbons in length), and may contain one or more cis or trans double bonds.
  • Examples of such compounds include, but are not limited to distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), palmitoyloleoylphosphatidylethanolamine (POPE), egg phosphatidylethanolamine (EPE), and transphosphatidylated phosphatidylethanolamine (t-EPE), which can be generated from various natural or semisynthetic phosphatidylcholines using phospholipase D.
  • DSPE distearoylphosphatidylethanolamine
  • DMPE dimyristoylphosphatidylethanolamine
  • DPPE dipalmitoylphosphatidylethanolamine
  • POPE palmitoyloleoylphosphatidylethanolamine
  • EPE egg phosphatidylethanolamine
  • t-EPE transphosphatidylated phosphatidylethanolamine
  • An initial sequence that contains CpG dinucleotides may be modified to remove CpG dinucleotides by altering the nucleic acid sequence.
  • CpG di-nucleotides can be suitably reduced or eliminated not just in a coding sequence, but also in the non-coding sequences, including, e.g., 5′ and 3′ untranslated regions (UTRs), promoter, enhancer, polyA, ITRs, introns, and any other sequences present in the nucleic acid molecule or vector.
  • CpG di-nucleotides may be located within a codon triplet for a selected amino acid.
  • amino acids there are five amino acids (serine, proline, threonine, alanine, and arginine) that have one or more codon triplets that contain a CpG di-nucleotide. All five of these amino acids have alternative codons not containing a CpG di-nucleotide that can be changed to, to avoid the CpG but still code for the same amino acid as shown in Table 1 below. Therefore, the CpG di- nucleotides allocated within a codon triplet for a selected amino acid may be changed to a codon triplet for the same amino acid lacking a CpG di-nucleotide. T ABLE 1 In addition, within the coding region, the interface between triplets should be taken into consideration.
  • an amino acid triplet ends in a C-nucleotide which is then followed by an amino acid triplet which can start only with a G-nucleotide (e.g., Valine, Glycine, Glutamic Acid, Alanine, Aspartic Acid), then the triplet for the first amino acid triplet is changed to one which does not end in a C-nucleotide.
  • G-nucleotide e.g., Valine, Glycine, Glutamic Acid, Alanine, Aspartic Acid
  • a commercial service provided by ThermoScientific produces CpG free nucleotide.
  • Table 2 exemplary promoters and enhancers that may be used in the vectors described herein. Such promoters, and other promoters known in the art, may be used alone or with any of the enhancers, or enhancers, known in the art. Additionally, when multiple proteins or biologically active nucleic acid molecules (e.g., two, three, four, or more) are expressed from the same vector, the same or different promoters may be used in conjunction with the subject nucleic acid sequence.
  • a promoter selected from the following list is employed to control the expression levels of the protein or nucleic acid: FerL, FerH, Grp78, hREG1B, and cBOX1.
  • Such promoter can be used, for example, to control production of a protein (e.g., HGH) protein production over a broad temporal range (e.g., without the use of any other modifications including Gene switches).
  • a protein e.g., HGH
  • compositions and systems herein are provided and/or administered in doses selected to elicit a therapeutic and/or prophylactic effect in an appropriate subject (e.g., mouse, human, etc.).
  • a therapeutic dose is provided.
  • a prophylactic dose is provided.
  • Dosing and administration regimes are tailored by the clinician, or others skilled in the pharmacological arts, based upon well-known pharmacological and therapeutic/prophylactic considerations including, but not limited to, the desired level of pharmacologic effect, the practical level of pharmacologic effect obtainable, toxicity. Generally, it is advisable to follow well-known pharmacological principles for administrating pharmaceutical agents (e.g., it is generally advisable to not change dosages by more than 50% at time and no more than every 3-4 agent half-lives). For compositions that have relatively little or no dose-related toxicity considerations, and where maximum efficacy is desired, doses in excess of the average required dose are not uncommon. This approach to dosing is commonly referred to as the “maximal dose” strategy.
  • a dose is about 0.01 mg/kg to about 200 mg/kg (e.g., 0.01 mg/kg, 0.02 mg/kg, 0.05 mg/kg, 0.1 mg/kg, 0.2 mg/kg, 0.5 mg/kg, 1.0 mg/kg, 2.0 mg/kg, 5.0 mg/kg, 10 mg/kg, 20 mg/kg, 50 mg/kg, 100 mg/kg , 200 mg/kg, or any ranges therebetween (e.g., 5.0 mg/kg to 100 mg/kg)).
  • a subject is between 0.1 kg (e.g., mouse) and 150 kg (e.g., human), for example, 0.1 kg, 0.2 kg, 0.5 kg, 1.0 kg, 2.0 kg, 5.0 kg, 10 kg, 20 kg, 50 kg, 100 kg, 200 kg, or any ranges therebetween (e.g., 40-125 kg).
  • a dose comprises between 0.001 mg and 40,000 mg (e.g., 0.001 mg, 0.002 mg, 0.005 mg, 0.01 mg, 0.02 mg, 0.05 mg, 0.1 kg, 0.2 mg, 0.5 mg, 1.0 mg, 2.0 mg, 5.0 mg, 10 mg, 20 mg, 50 mg, 100 mg, 200 mg, 500 mg, 1,000 mg, 2,000 mg, 5,000 mg, 10,000 mg, 20,000 mg, 40,000 mg, or ragnes therebetween.
  • a target peptide is used with the cationic or neutral liposomes in the compositions herein. Exemplary target peptides are shown in Table 3 below.
  • one or more are expressed with the systems and methods herein.
  • this includes the therapeutic monoclonal antibodies (mAbs), Fabs, F(ab)2s, and scFv's that are shown in Table 4 below, as well as the anti-SARS-CoV2 antibodies and antigen bindings provided at Table 5 and Table 7, which is herein incorporated by reference.
  • an agent such as an anti-inflammatory agent or bioactive lipid
  • an agent is used to increase the expression level and/or duration of any the therapeutic protein (or biologically active nucleic acid molecules) expressed from the non-viral vectors in the methods herein.
  • the anti-inflammatory agents AILs
  • bioactive lipids in Table 6 below were tested, and the ones in black were found to be successful agents.
  • the dexamethasone is water-soluble dexamethasone which contains dexamethasone complexed to cyclodextrin to make it soluble.
  • the dexamethasone palmitate is dexamethasone 21-palmitate.
  • EXAMPLE 1 Multiple-MAb Expression This Example describes in vivo expression of multiple unique monoclonal antibodies following serial treatments in mice over a 4 week treatment course.
  • Experimental Methods On day 0, three mice per group were given IP injections of dexamethasone (40 mg/kg) two hours prior to sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero- 3-phosphocholine) neutral lipid with 5mol% dexamethasone palmitate), followed two hours later by 75mg of a single plasmid DNA (pDNA) containing 5J8 and anti-IL5 cDNAs (“5J8-IL5”).
  • pDNA plasmid DNA
  • mice were again re-treated on days 7, 14, and 21 with IP dexamethasone and IV lipid and sequential pDNA as before, however with pDNA(s) containing the following cDNAs at indicated doses: Day 7: 88mg B38-lambda anti-CoV2 “B38 Lambda”, Day 14: 44mg B38-lambda anti- CoV2, and 44mg of a single pDNA containing two copies of anti-IL5 cDNA (IL5-IL5), Day 21: 44mg rituximab (aCD20 dual), and 44mg H4 anti-CoV2 (“H4”). Serum levels of mAb proteins were measured by ELISA 24 hours after each treatment and every 2-3 weeks thereafter.
  • mice were similarly re-treated on days 7, 14, with IP dexamethasone and IV lipid and sequential pDNA as before, however with pDNA(s) containing the following cDNAs at indicated doses: Day 7: 75mg of the anti-Sars-Cov-2 monoclonal antibody B38 Kappa cDNA (“B38-Kappa”), Day 14: 44mg of a single pDNA containing two copies of rituximab cDNA (“aCD20-aCD20”), and 44mg of a single pDNA containing two copies of 5J8 (“5J8-5J8”). Serum levels of mAb proteins were measured by ELISA 24 hours one day following the second treatment (day 8) and every 1-2 weeks thereafter.
  • Serum levels of anti-CoV2 mAb proteins were measured by ELISA 24 hours after the initial treatment, and are displayed as group mean +/- SEM.
  • Figure 3B These same mice were similarly treated on days 7 and 14 with IP dexamethasone and IV lipid and sequential pDNA as before, however with pDNA(s) containing the following cDNAs at indicated doses: Day 7: 44mg anti-IL5 (“aIL5”) and 44mg 5J8 (“5J8”). Day 14: 88mg rituximab (“aCD20 Dual”). Serum levels of anti-CoV2 mAb proteins were measured by ELISA 24 hours after the initial treatment and weekly thereafter.
  • Serum levels of anti-IL5, 5J8, and rituximab were determined on days 22 and 29, and are displayed as group mean +/- SEM.
  • the indicated time points in Figures 3A and 3B are all relative to the initial injection of pDNAs-containing anti-IL5 and 5J8 cDNAs at Day 0.
  • EXAMPLE 4 Multiple-MAb Expression This Example describes in vivo expression of multiple unique monoclonal antibodies following serial treatments in mice over a 3 week Treatment Course. Experimental methods: On day 0, three groups of mice each containing three mice per group, were similarly given IP injections of dexamethasone (40 mg/kg) two hours prior to sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine) neutral lipid) with 5mol% dexamethasone palmitate, followed by the following pDNA(s) containing the following cDNAs at indicated doses: 44mg of a single pDNA containing two copies of 5J8 cDNA (“5J8-5J8”), and 44mg of a single pDNA containing two copies of anti-IL5 cDNA (“aIL5-aIL5”).
  • lipids 1000nmol DOTAP SUV with 2.5mol%
  • mice were treated on days 7, 14, with IP dexamethasone and IV lipid and sequential pDNA as before, however with pDNA(s) containing the following cDNAs at indicated doses: Group 1: Day 7 - 44mg of rituximab cDNA (“aCD20-dual”) and 44mg of the B38 anti-SARS CoV2 cDNAs (“B38-Tag”), Day 14 - 88mg of the anti-Sars-Cov-2 monoclonal antibody (“H4”).
  • aCD20-dual Day 7 - 44mg of rituximab cDNA
  • B38-Tag B38 anti-SARS CoV2 cDNAs
  • H4 anti-Sars-Cov-2 monoclonal antibody
  • Group 2 Day 7 - 44mg of a single pDNA containing two copies of rituximab cDNAs (“aCD20- aCD20”) and 44mg of the anti-Sars-Cov-2 monoclonal antibody B38 Kappa cDNA (“B38- Kappa”) cDNAs (“B38-Tag”), Day 14 - 88mg of the anti-Sars-Cov-2 monoclonal antibody H4 cDNA (“H4”).
  • Group 3 Day 7 - 44mg of rituximab cDNA (“aCD20-dual”) and 44mg of the B38 anti-SARS CoV2 cDNAs (“B38-Tag”), Day 14 – No Treatment.
  • Serum levels of mAb proteins were measured by ELISA on days 1, 8, and 15. The indicated time points are all relative to the initial injection of pDNAs containing 5J8 and aIL5 cDNAs. Results are shown in Figure 4, which show that serial injection of different DNA mAb vectors on a weekly basis can produce significant ongoing serum levels of four different intact monoclonal antibodies in individual mice.
  • EXAMPLE 5 Multiple Protein Expression This Example describes in vivo expression of multiple unique monoclonal antibodies following serial treatments in Mice over a 3 week Treatment.
  • mice were re-treated on days 7 and/or day 14, with IP dexamethasone and IV lipid and sequential pDNA as before, however with pDNA(s) containing the following cDNAs at indicated doses: Group 1: Day 7 - 44mg rituximab (“aCD20-dual”) and 44mg of a single pDNA containing anti-SARS-CoV2 mAb H4, Day 14 – No Treatment. Group 2: Day 7 – No Treatment, Day 14 – No Treatment.
  • Groups 3, 4 Day 7 - 44mg rituximab (“aCD20-dual”) and 44mg of a single pDNA containing two copies of 5J8 cDNAs (“5J8-5J8”), Day 14 - 44mg human G-CSF (“GCSF”) and 44mg human alpha-glactosidase A (“GLA”) (“hGLA-hyFc”), Day 21 - 44mg human Ace2 (“hACE2”) and 44mg human growth hormone (“hGH”) (“hGH-Fc”).
  • Groups 5 Day 7 - 44mg rituximab (“aCD20-dual”) and 44mg of a single pDNA containing two copies of anti-IL5 cDNAs (“aIL5-aIL5”), Day 14 - 44mg GCSF (“GCSF”) and 44mg GLA (“GLA”).
  • Groups 6 and 8 Day 7 - 44mg rituximab (“aCD20-dual”) and 44mg of a single pDNA containing two copies of 5J8 cDNAs (“5J8-5J8”), Day 14 – No Treatment.
  • Group 7 Day 7 - 44mg rituximab (“aCD20-dual”) and 44mg of a single pDNA containing two copies of anti-IL5 cDNAs (“aIL5-aIL5”), Day 14 – No Treatment. Serum levels of anti-CoV2 mAb proteins were measured by ELISA 24 hours after the initial treatment and weekly thereafter. The indicated time points are all relative to the initial injection of pDNAs. Group mean +/- SEM expression levels are indicated on the graph.
  • EXAMPLE 6 Multiple-MAb Expression This Example describes the production of three different monoclonal antibody proteins following a single treatment in Mice.
  • Experimental methods On day 0, eight groups of mice, each containing three mice per group, were given IP injections of dexamethasone (40 mg/kg) two hours prior to sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid with 5mol% dexamethasone palmitate), followed by the following pDNA(s) containing the following cDNAs at indicated doses: Group 1: 88mg of a single pDNA encoding anti-SARS-CoV2 B38 kappa and anti- IL5 (“mB38-haIL5”); Group 2: 88mg of a single pDNA encoding anti-SARS-CoV2 B38 kappa and anti-IL5 (“m
  • Serum levels of expressed mAb proteins were measured by ELISA 1, 14 and 22 days after the initial treatment. Group mean +/- SEM expression levels are indicated in Figure 6. These results, shown in Figure 6, demonstrate that one dose (e.g., using cationic and neutral lipids) of DNA-encoded mAb vectors, in the form of a single pDNA or composed of multiple pDNAs, can produce sustained expression of a two separate mAbs in mice, and that the structure and composition of the pDNA or pDNAs contribute to mAb expression levels.
  • EXAMPLE 7 Anti-Sars-CoV2 Protein Expression This Example describes production of multiple different anti-SARS CoV2 therapeutic proteins separately and in combination following a single treatment in mice.
  • mice On day 0, eight groups of mice, each containing three mice per group, were given IP injections of dexamethasone (40 mg/kg) two hours prior to sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid with 5mol% dexamethasone palmitate), followed by injection of 88mg of a single pDNA encoding the following cDNAs: Group 1: soluble human ACE2 (“hACE2-BV3”), Group 2: two copies of soluble human ACE2 (“hACE2-hACE2”), Group 3: anti-SARS-CoV2 mAb B38 Kappa (“B38Kp”), Group 4: two copies of anti-SARS-CoV2 mAb H4 (“H4-H4”), Group 5: anti-SARS- CoV2 mAb B38 Kappa and soluble human ACE2 (“
  • Serum expression levels of anti-SARS-CoV2 mAbs were measured by an anti-RBD ELISA using recombinant purified H4 or B38 kappa as standards, or by a non-antigen-specific human IgG or human kappa light chain ELISA.
  • Serum expression levels of soluble human ACE2 were determined by commercial ELISA. Group mean +/- SEM expression levels are indicated in Figure 7. The results, in Figure 7, demonstrate anti-SARS-CoV2 therapeutics (either soluble human ACE2 protein and/or anti-SARS-CoV-2 mAbs reactive to SARS-CoV2 spike protein alone, or in combination) can be produced in animals following a single treatment with a single pDNA vector.
  • EXAMPLE 8 Anti-Sars-CoV2 Protein Expression This Example describes production of Multiple anti-SARS CoV2 therapeutics separately and in combination following liposome and dexamethasone treatment in mice.
  • Experimental methods On day 0, four groups of mice, each containing three mice per group, were given IP injections of dexamethasone (40 mg/kg) two hours prior to sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid with 5mol% dexamethasone palmitate), followed by injection of 88mg of a single pDNA encoding the following cDNAs: Group 1: soluble human ACE2-Fc fusion (“shACE2-Fc”), Group 2: soluble human ACE2-Fc fusion LALA variant (“shACE2-Fc-LALA”) Group 3: anti-SARS-CoV2 mAb 4A8
  • FIG 8A serum expression levels of soluble human ACE2-containing proteins were determined by a SARS-CoV2 RBD-based ELISA on days 1 and 9 following treatment. Group mean +/- SEM expression levels are indicated on the graph.
  • Figure 8B serum expression levels of soluble human ACE2-Fc fusions were determined in groups 1 thru 3 by an Fc-specific ELISA on days 1 and 9 following treatment. Group mean +/- SEM expression levels are indicated on the graph.
  • mice On day 0, twelve groups of mice, each containing three mice per group, were given IP injections of dexamethasone (40 mg/kg) two hours prior to sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid with 5mol% dexamethasone palmitate), followed by injection of 88mg of a single pDNA encoding human ACE2 cDNA (Group 1) or a modified version of ACE2, groups 2 thru 12, as indicated.
  • lipids 1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid with 5mol% dexamethasone palmitate
  • mice Two hours later, mice were injected IV, first with liposomes followed approximately 2 minutes later with 75ug plasmid DNA encoding human GH (hGH). All liposome mixtures contained 1000nmol DOTAP SUV with 2.5% Dexamethasone 21- Palmitate as well as 1000nmol DMPC with 5% Dexamethasone 21-palmitate. Mice were bled 24 hours after injection, then weekly or every few weeks thereafter to obtain serum. Serum levels of hGH were assessed by ELISA. At day 127 after injection, serum levels of mouse IGF-1, as well as of hGH were coordinately assessed by their respective ELISAs. The results are shown in Figure 45.
  • Figure 45A shows this procedure drives expression of the wild type hGH cDNA fused to a protein half-life extending DNA sequence, including Fc, serum albumin or Xten, and can significantly increase serum hGH levels over time in immunocompetent mice when compared to hGH serum levels produced by a hGH DNA vector that lack protein half-life extending DNA sequences.
  • Figure 45B shows that the cDNA-encoded hGH protein produced is fully bioactive, as it appropriately increases the levels of the hGH- regulated, endogenous mouse, IGF-1 protein.
  • Figure 45C shows one injection of a DNA vector in this procedure drives the wild type hGH cDNA but lacking any protein half-life extending DNA sequence can produce durable production of therapeutic hGH serum levels in immunocompetent mice.
  • All liposome mixtures contained 1000nmol DOTAP SUV with 2.5% Dexamethasone 21-Palmitate as well as 1000nmol DMPC with 5% Dexamethasone 21-palmitate. Mice were bled 24 hours after injection and every 7-21 days thereafter to isolate serum, and serum expression assessed by ELISA. The results are shown in Figure 46, which demonstrate that this procedure with vectors driving the wild type hGH cDNA fused to a protein half-life extending DNA sequence, including Fc, serum albumin or Xten, can significantly increase serum hGH levels over time in immunocompetent mice when compared to hGH serum levels produced by a hGH DNA vector that lack protein half-life extending DNA sequences.
  • EXAMPLE 12 Expression of Human Growth Hormone with Reinjection of Plasmid
  • hGH human growth hormone
  • Methods Groups of 4 CD-1 mice each were injected with 40mg/kg water-soluble dexamethasone IP. Two hours later, mice were injected IV, first with liposomes followed approximately 2 minutes later with 75ug plasmid DNA encoding human GH. All liposome mixtures contained 1000nmol DOTAP SUV with 2.5% Dexamethasone 21-Palmitate as well as 1000nmol DMPC with 5% Dexamethasone 21-palmitate. Mice were bled weekly to assess expression.
  • mice were given the same treatment as the initial injection. Mice were bled 24 hours after re- injection to isolate serum and every 7-21 days thereafter, and serum expression assessed by ELISA. These results are shown in Figure 47 and demonstrate that, using this procedure, one re- injection of a DNA vector driving the wild type hGH cDNA into fully immunocompetent mice can significantly and durably further increase serum hGH levels produced by the initial hGH DNA vector injection.
  • EXAMPLE 13 Expression of Human Growth Hormone Fused to Half-Life Extending Peptide This Example describes the in vivo expression of human growth hormone (hGH) fused to a half-life extending peptide.
  • mice Groups of 5 CD-1 mice were used. Mice were injected with 40mg/kg water- soluble dexamethasone IP. Two hours later, mice were injected IV, first with liposomes followed approximately 2 minutes later with 75ug plasmid DNA encoding human GH. All liposome mixtures contained 1000nmol DOTAP SUV with 2.5% Dexamethasone 21-Palmitate as well as 1000nmol DMPC with 5% Dexamethasone 21-palmitate. Mice were bled 24 hours after injection and every 7-28 days thereafter to isolate serum, and serum expression assessed by ELISA. The results are shown in Figure 48.
  • mice Two hours later, mice were injected IV, first with liposomes followed approximately 2 minutes later with 75ug plasmid DNA encoding human GH. All liposome mixtures contained 1000nmol DOTAP SUV with 2.5% Dexamethasone 21-Palmitate as well as 1000nmol DMPC with 5% Dexamethasone 21-palmitate. Mice were bled 24 hours after injection and every 7-21 days thereafter to isolate serum, and serum expression assessed by ELISA. The results are shown in Figure 49.
  • FIG. 50 shows the results.
  • Figure 50A shows that selective site-directed mutagenesis of the Fc region of an DNA vector driving the wild type hGH cDNA fused to an Fc protein half-life extending DNA sequence including CTP can selectively either increase or decrease serum hGH levels produced in immunocompetent mice.
  • FIG. 50B shows that selective site-directed mutagenesis of the Fc region of a DNA vector driving the wild type hGH cDNA fused to an Fc protein half-life extending DNA sequence can selectively increase serum hGH levels produced over time in immunocompetent mice.
  • EXAMPLE 16 Immuno-modulation Agents This Example describes the testing of various immuno-modulating agents. Part 1 Methods: Groups of 3 CD-1 mice each were injected with 900nmol DOTAP SUV, with or without Dexamethasone 21-palmitate or Cholesteryl palmitate in molar percentages as shown in Figure 51. Two minutes after liposome injection, mice were injected with 70ug plasmid DNA encoding hG-CSF.
  • mice were first injected with 900nmol DOTAP SUV, with or without Dexamethasone 21-palmitate or Cholesteryl palmitate in molar percentages as shown in Figure 52. Two minutes after liposome injection, mice were injected with 70ug plasmid DNA encoding hG-CSF.
  • mice were first injected with 900nmol DOTAP SUV with 2.5% Dexamethasone 21-palmitate in the liposomes. Two minutes after liposome injection, mice were injected with 70ug plasmid DNA encoding hG-CSF. Mice were bled the following day and serum levels of hG-CSF protein was assessed by ELISA. ALT levels were assessed in sera.
  • Figure 53 shows the results, which show that pre-injecting an optimized molar percentage of dexamethasone palmitate in liposomes prior to injecting cationic liposomes can both further increase gene expression and further decrease toxicity.
  • AILs endogenous, anti-inflammatory lipids
  • mice were anesthetized and administered via intranasal route 200nmol of the indicated liposome formulations each containing 1mol% fluorescent phosphatidyl- ethanolamine to track uptake of liposomes or lactated ringers control.
  • lungs were harvested, digested to single cell suspensions and surface stained with fluorescent antibodies to detect mouse CD45, CD11b and F4/80 markers prior to analysis by flow cytometry.
  • DOPS 1,2- dioleoyl-sn-glycero-3-phospho-L-serine
  • mixPS 1-stearoyl-2-oleoyl-sn-glycero-3-phospho-L- serine.
  • mice On day 0, six groups of mice, each containing three mice per group, were given the following treatments: Group 1 - IP injection of dexamethasone (40 mg/kg) two hours prior to sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid) with 5mol% dexamethasone palmitate), followed by a single pDNA encoding anti-SARS CoV2 H4 kappa mAb, anti-CD20, anti-influenza A 5J8, and anti-human IL-5.
  • lipids 1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid
  • DMPC 1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid
  • Group 2 Sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid) with 5mol% dexamethasone palmitate), followed by a single pDNA encoding anti- SARS CoV2 H4 kappa mAb, anti-CD20, anti-influenza A 5J8, and anti-human IL-5.
  • Group 3 Sequential IV injection of lipids (1000nmol DOTAP SUV and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid) with 5mol% dexamethasone palmitate), followed by a single pDNA encoding anti-SARS CoV2 H4 kappa mAb, anti-CD20, anti-influenza A 5J8, and anti-human IL-5.
  • Group 4 Sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid), followed by a single pDNA encoding anti-SARS CoV2 H4 kappa mAb, anti-CD20, anti-influenza A 5J8, and anti-human IL-5.
  • Group 5 Sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid) with 5mol% dexamethasone palmitate), followed by a single pDNA encoding anti- SARS CoV2 H4 kappa mAb, anti-CD20, anti-influenza A 5J8, and anti-human IL-5.
  • Group 6 – No Treatment Figure 58 shows the results and shows that by selectively modifying a parenteral aqueous soluble predose, and/or the molar percentage of dexamethasone palmitate incorporated into subsequently administered liposomes, that the level of T lymphocyte activation both in lung and in the blood can be selectively immuno-modulated.
  • EXAMPLE 19 Differential T Cell Activation This Example describes differential T cell activation resulting from administration of liposome formulations.
  • mice On day 0, eight groups of mice, each containing three mice per group, were treated as follows: Group 1 – Untreated Group 2 - IP injection of dexamethasone (40 mg/kg) two hours prior to sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid) with 5mol% dexamethasone palmitate), followed by a single pDNA encoding human PECAM-1.
  • Group 8 Two IP injections of 2.5mol% dexamethasone palmitate in DOTAP:cholesterol 2:1 MLV 24 hours and two hours prior to sequential IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero- 3-phosphocholine neutral lipid) with 5mol% dexamethasone palmitate), followed by a single pDNA encoding human PECAM-1.
  • lipids 1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero- 3-phosphocholine neutral lipid
  • DMPC 1,2-Dimyristoyl-SN-glycero- 3-phosphocholine neutral lipid
  • Figure 59 shows the results, which show that by selectively modifying a parenteral aqueous soluble pre-dose, and/or the molar percentage of dexamethasone palmitate incorporated into subsequently administered liposomes, that the level of T lymphocyte activation both in lung and in the blood can be selectively immuno-modulated.
  • EXAMPLE 20 Anti-TNFa and Heparinoid Agents This Example describes the use of anti-TNFa monoclonal antibodies and Heparinoid Agents for increasing expressing in in vivo expression methods.
  • PART 1 - anti-TNFa Monoclonal antibody Methods Groups of 3 mice were used.
  • mice were given NSH (N-Acetyl-De-O-Sulfated Heparin) IP at .25 or 1mg per mouse either 2 hours pre or 2 hours post lipid and DNA injection. Mice were then injected IV with 900nmol DOTAP SUV, followed 2 minutes later by 70ug plasmid DNA encoding hG-CSF. Mice were bled 24 hours after injection, and hG-CSF expression in the sera assessed by ELISA. Serum ALT/AST levels were measured. Results are shown in Figure 61, which shows that either pre- or post-administration of a NSH can reduce toxicity.
  • NSH N-Acetyl-De-O-Sulfated Heparin
  • mice Heparinoid-treated mice were given NSH (N- Acetyl-De-O-Sulfated Heparin) IP at .25 or 1mg per mouse either 2 hours pre or 2 hours post lipid and DNA injection. Mice were then injected IV with 900nmol DOTAP SUV, followed 2 minutes later by 70ug plasmid DNA encoding hG-CSF. Mice were bled 24 hours after injection, and hG- CSF expression in the sera assessed by ELISA. Tocopherol-treated mice were given 900nmol DOTAP SUV containing alpha-tocopherol, followed by 70ug plasmid DNA encoding hG-CSF. Serum ALT/AST levels were measured.
  • NSH N- Acetyl-De-O-Sulfated Heparin
  • PART 4 - NSH Methods Groups of 3 mice were used. Heparinoid-treated mice were given NSH (N- Acetyl-De-O-Sulfated Heparin) IP 2 hours prior to lipid and DNA injection. Mice were then injected IV with 900nmol DOTAP SUV, followed 2 minutes later by 70ug plasmid DNA encoding hG-CSF. Mice were bled 24 hours after injection, and hG-CSF expression in the sera assessed by ELISA.
  • NSH N- Acetyl-De-O-Sulfated Heparin
  • mice On day 0, eight groups of mice, were given the following treatments: Group 1 - IP injection of water-soluble dexamethasone (40 mg/kg) only. Group 2 - IP injection of dexamethasone (40 mg/kg) two hours prior to IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2- Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid) with 5mol% dexamethasone palmitate).
  • lipids 1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2- Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid
  • Group 3 - IV injection of lipids 1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid) with 5mol% dexamethasone palmitate).
  • Group 7 IP injection of 1000nmol DMPC (1,2-Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid) with 5mol% dexamethasone palmitate) SUV two hours prior to IV injection of lipids (1000nmol DOTAP SUV with 2.5mol% dexamethasone palmitate and 1000nmol DMPC (1,2- Dimyristoyl-SN-glycero-3-phosphocholine neutral lipid) MLV with 5mol% dexamethasone palmitate containing MTAS-NLS-SPD peptide.
  • Figure 64 shows that administration of various formulations of liposomes containing dexamethasone palmitate decreases lymphocyte counts in blood compared to systemic administration of dexamethasone alone.
  • Figure 65 shows that administration of various formulations of liposomes containing dexamethasone palmitate decreases monocyte counts in blood compared to systemic administration of dexamethasone alone.
  • EXAMPLE 22 Production of ongoing fully SARS-CoV-2 neutralizing levels of a single anti-SARS-CoV2 mAb following a single HEDGES DNA vector administration This example describes expression of single SARS-CoV-2 antibodies in mice produces fully neutralizing levels of mAb using the following injection protocol.
  • mice The five different SARS- CoV-2 antibodies individually expressed in mice were: C135, C215, COV2-2355, CV07-209, and C121 (see Table 7 for sequence information).
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1100nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV.
  • mice were dosed i.v. with about 80ug of a single plasmid DNA containing one expression cassette for one of the five SARS-CoV2- specific mAbs.
  • mice were bled at days 1, 8, 22, 30, 36, 50, 78, 92, 106, and 120 after treatment and serum mAb protein levels were determined by a human IgG ELISA assay. Results are shown in Figure 66 (left axis, pink bar graphs represent mean + or – SEM shown in ascending order from day 1 to day 120 for each mAb).
  • SARS-CoV2-specific mAb containing sera to inhibit SARS-CoV2 spike – human ACE2 protein interactions was determined by a commercially-available in vitro SARS-CoV2 spike / ACE2 blocking assay (cPASS, right axis, green dots represent mean + or – SEM shown in ascending order from day 1 to day 120 for each mAb clone, Genscript).
  • EXAMPLE 23 Expression of two anti-SARS-CoV2 mAb from a Single Plasmid
  • This example describes expression of two SARS-CoV-2 antibodies from a single plasmid (4 different plasmids) in mice produces neutralizing levels of mAb using the following injection protocol.
  • the expressed SARS-CoV-2 antibodies were as follows: first plasmid (C135 + CV07- 209); second plasmid (RBD215 LALA + CV07-209); third plasmid (C121 + CV07-209); and fourth plasmid (CV07-209 + Zost-2355) (see Table 7 for sequence information).
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p.
  • mice were dosed i.v. with about 80ug of a single plasmid DNA containing two expression cassettes for SARS- CoV2-specific mAbs. Mice were bled at days 1, 8, 22, 30, 36, 50, 78, 92, 106, 120, and 134 after treatment and serum mAb protein levels were determined by a human IgG ELISA assay.
  • EXAMPLE 24 Expression of Two anti-SARS-CoV2 mAbs by three approaches This example describes expression of two anti-SARS-CoV2 mAbs simultaneously by three different approaches: 1) Single injection of a single expression plasmid coding two unique mAbs; 2) Single injection of two unique plasmids simultaneously as a mixture (co-injection); and 3) Two injections of single mAb expression plasmids separated by an amount of time, here 7 days (reinj). The various anti-SARS-CoV2 mAbs expressed are shown in Figure 68 (see Table 7 for sequences). On day 0, groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v.
  • mice were dosed i.v. with either 75ug of a single plasmid DNA containing one or two expression cassettes for SARS-CoV2-specific mAbs, or 38ug each of two plasmids each containing cassettes for one or two mAb clones (co-inject – “coinj”).
  • mice Under day 7, some of these groups of mice underwent an additional injection (re-injection – “reinj”) of dexamethasone retreatment, liposomes dosing, and plasmid DNA as on day 0, and were similarly treated with either 75ug of a single plasmid DNA containing two expression cassettes for SARS-CoV2-specific mAbs. Mice were bled at day 1, 8, and 15, 22 and serum expression of mAbs was analyzed by a human IgG ELISA assay. Results are shown in Figure 68a, where each series of bar graphs indicates mean +/- SEM mAb expression or inhibition amount at days 1, 8, 15, and 22 in order from left to right.
  • Figure 68b shows the functional capacity of the SARS-CoV2-specific mAb containing sera to inhibit SARS-CoV2 spike – human ACE2 protein interactions determined by a commercially- available in vitro SARS-CoV2 spike / ACE2 blocking assay (cPASS, Genscript).
  • cPASS in vitro SARS-CoV2 spike / ACE2 blocking assay
  • EXAMPLE 25 Expression of three anti-SARS-CoV2 mAbs This example describes expression of three different anti-SARS-CoV2 mAbs from one or two plasmids based on two weekly injections of the plasmids. This was performed with three different collections of mAbs, as shown in Figure 69 (sequences in Table 7). At day 0, groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV.
  • mice were dosed i.v. with 80ug of a single plasmid DNA containing one expression cassette for SARS-CoV2-specific mAbs.
  • these groups of mice underwent an additional injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0.
  • These groups were treated with 80ug of a single plasmid DNA containing two expression cassettes for SARS-CoV2-specific mAbs.
  • Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, 92, 106, 120 following their first treatment, and serum expression levels of mAbs were analyzed by a human IgG ELISA assay.
  • Each series of bar graphs indicates mean +/- SEM mAb inhibition (right y-axis) at days 1, 8, 15, 21, 36, 50, 78, 92, 106, 120.
  • These examples demonstrate that two weekly injections of one or two DNA expression plasmids encoding a total of three different individual SARS-CoV2-specific mAbs produces fully neutralizing serum levels of three different SARS-CoV2-specific mAbs for the course of at least 70 days following administration, and that these ongoing serum mAbs levels functionally and continuously block SARS-CoV2 spike – human ACE2 for at least 70 days, which is the human equivalent of greater than 10 years.
  • mice were dosed i.v. with 40ug each of two plasmids each containing two mAb expression cassettes. Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, 92 and 106 following their first treatment, and serum expression levels of mAbs were analyzed by a human IgG ELISA assay.
  • Results are shown in Figure 70, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, 92, and 106 in order from left to right.
  • functional capacities of SARS-CoV2-specific mAb containing sera to inhibit SARS- CoV2 spike – human ACE2 protein interactions were determined by a commercially-available in vitro SARS-CoV2 spike / ACE2 blocking assay across the timecourse (cPASS, Genscript).
  • Each series of bar graphs indicates mean +/- SEM mAb inhibition (right y-axis) at days 1, 8, 15, 21, 36, 50, 78, 92 and 106.
  • EXAMPLE 27 Expression of four anti-SARS-CoV2 mAbs with one injection
  • This example describes expression of four anti-SARS-CoV2 mAbs shown in Figure 71 (see Table 7 for sequence information) using the following protocol.
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV.
  • mice were dosed i.v. with 40ug each of two plasmids each containing two mAb expression cassettes.
  • mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 following their first treatment, and serum expression levels of SARS-CoV2 mAbs were analyzed by a human IgG ELISA assay. Results are shown in Figure 71, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 in order from left to right.
  • mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV.
  • mice were dosed i.v. with 45ug each of two plasmids each containing two mAb expression cassettes.
  • Mice were bled at days 1, 8, 22, 36, 50, 64, 78, 99 following their first treatment, and serum expression levels of mAbs were analyzed by a human IgG ELISA assay.
  • Results are shown in Figure 72, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 22, 36, 50, 64, 78, 99 in order from left to right.
  • functional capacities of SARS-CoV2-specific mAb containing sera to inhibit SARS-CoV2 spike – human ACE2 protein interactions were determined by a commercially-available in vitro SARS-CoV2 spike / ACE2 blocking assay across the timecourse (cPASS, Genscript).
  • cPASS in vitro SARS-CoV2 spike / ACE2 blocking assay across the timecourse
  • EXAMPLE 29 Expression of four anti-SARS-CoV2 mAbs with two injections
  • This example describes expression of four anti-SARS-CoV2 mAbs shown in Figure 73 (see Table 7 for sequence information) using the following protocol.
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV. After two minutes, mice were dosed i.v.
  • mice underwent an additional injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0 (indicated by hashed bar).
  • Mice were treated with 80ug of a single plasmid DNA containing two expression cassettes for SARS-CoV2-specific mAbs.
  • Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, 92, 106, 120 following their first treatment, and serum expression levels of mAbs were analyzed by a human IgG ELISA assay.
  • Results are shown in Figure 73, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, 92, 106, 120 in order from left to right.
  • functional capacities of SARS-CoV2-specific mAb containing sera to inhibit SARS- CoV2 spike – human ACE2 protein interactions were determined by a commercially-available in vitro SARS-CoV2 spike / ACE2 blocking assay across the timecourse (cPASS, Genscript).
  • Each series of bar graphs (in green in Figure 73) indicates mean +/- SEM mAb inhibition (right y-axis) at days 1, 8, 15, 21, 36, 50, 78, 92, 106, 120.
  • EXAMPLE 30 Expression of four anti-SARS-CoV2 mAbs with two injections
  • This example describes expression of four anti-SARS-CoV2 mAbs shown in Figure 74 (see Table 7 for sequence information) using the following protocol.
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV. After two minutes, mice were dosed i.v.
  • mice underwent a second round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0 (indicated by dot fill pattern). These groups were treated with 40ug each of two plasmids each containing two mAb expression cassettes. Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 following their first treatment, and serum expression levels of SARS-CoV2 mAbs were analyzed by a human IgG ELISA assay.
  • Results are shown in Figure 74, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 in order from left to right.
  • functional capacities of SARS-CoV2-specific mAb containing sera to inhibit SARS-CoV2 spike – human ACE2 protein interactions were determined by a commercially- available in vitro SARS-CoV2 spike / ACE2 blocking assay across the timecourse (cPASS, Genscript).
  • Each series of bar graphs indicates mean +/- SEM mAb inhibition (right y- axis) at days 1, 8, 15, 21, 36, 50, 64, 78 and 92 in order from left to right.
  • serial, weekly co-injection of two different single DNA expression plasmids each encoding two different individual SARS-CoV2-specific mAbs (together the serial co-injection produces a total of four different individual SARS-CoV2-specific mAbs) produce fully neutralizing serum levels of four different SARS-CoV2-specific mAbs for the course of at least 70 days following administration, and that these ongoing serum mAb levels functionally and continuously blocked SARS-CoV2 spike – human ACE2 binding for at least 70 days, which is the human equivalent of greater than 10 years.
  • EXAMPLE 31 Expression of five anti-SARS-CoV2 mAbs with two injections
  • This example describes expression of five anti-SARS-CoV2 mAbs shown in Figure 75 (see Table 7 for sequence information) using the following protocol.
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV. After two minutes, mice were dosed i.v.
  • mice underwent an additional injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0. Some groups were treated with 40ug each of two plasmids each containing two mAb expression cassettes. Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, 92, 106, 120 following their first treatment, and serum expression levels of mAbs were analyzed by a human IgG ELISA assay.
  • Results are shown in Figure 75, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, 92, 106, 120 in order from left to right.
  • functional capacities of SARS-CoV2-specific mAb containing sera to inhibit SARS- CoV2 spike – human ACE2 protein interactions were determined by a commercially-available in vitro SARS-CoV2 spike / ACE2 blocking assay across the timecourse (cPASS, Genscript).
  • Each series of bar graphs (shown in green in Figure 75) indicates mean +/- SEM mAb inhibition (right y-axis) at days 1, 8, 15, 21, 36, 50, 78, 92, 106, 120.
  • EXAMPLE 32 Expression of six anti-SARS-CoV2 mAbs with single injection
  • This example describes expression of six anti-SARS-CoV2 mAbs shown in Figure 76 (see Table 7 for sequence information) using the following protocol.
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV.
  • mice were dosed i.v. with 30ug each of three plasmids each containing two mAb expression cassettes.
  • mice were bled at days 1, 8, 22, 36, 50, 64, 78, 99 following their first treatment, and serum expression levels of mAbs were analyzed by a human IgG ELISA assay. Results are shown in Figure 76, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 22, 36, 50, 64, 78, 99 in order from left to right.
  • functional capacities of SARS-CoV2-specific mAb containing sera to inhibit SARS-CoV2 spike – human ACE2 protein interactions were determined by a commercially-available in vitro SARS-CoV2 spike / ACE2 blocking assay across the time course (cPASS, Genscript).
  • Each series of bar graphs indicates mean +/- SEM mAb inhibition (right y-axis) at days 1, 8, 22, 36, 50, 64, 78, 99.
  • EXAMPLE 33 Expression of six anti-SARS-CoV2 mAbs with two injections This example describes expression of six anti-SARS-CoV2 mAbs shown in Figure 77 (see Table 7 for sequence information) using the following protocol. At day 0, groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v.
  • mice were dosed i.v. with either 80ug of a single plasmid DNA containing two expression cassettes for SARS-CoV2-specific mAbs, or 40ug each of two plasmids each containing one or two mAb expression cassettes. On day 7, these groups of mice underwent an additional injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0.
  • mice were treated with either 80ug of a single plasmid DNA containing two expression cassettes for SARS-CoV2-specific mAbs, or 40ug each of two plasmids each containing two mAb expression cassettes.
  • Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, 92, 106, 120 following their first treatment, and serum expression levels of mAbs were analyzed by a human IgG ELISA assay. Results are shown in Figure 77, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, 92, 106, 120 in order from left to right.
  • mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV.
  • mice were dosed i.v. with either 80ug of a single plasmid DNA containing two expression cassettes for SARS-CoV2-specific mAb, or 40ug each of two plasmids each containing one or two mAb expression cassettes.
  • mice underwent a second round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0 (indicated by dot fill pattern). These groups were treated 40ug each of two plasmids each containing two mAb expression cassettes. On day 14, some of these groups of mice underwent a third round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0. These groups were treated with 80ug of a single plasmid DNA containing two expression cassettes for SARS- CoV2-specific mAb.
  • mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 following their first treatment, and serum expression levels of SARS-CoV2 mAbs were analyzed by a human IgG ELISA assay. Results are shown in Figure 78, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 in order from left to right.
  • serial co-injection of three different single DNA expression plasmids each encoding two different individual SARS-CoV2-specific mAbs (together the serial injections produce a total of six different individual SARS-CoV2-specific mAbs) each produce fully neutralizing serum levels of six different SARS-CoV2-specific mAbs for the course of at least 90 days following administration, and that these ongoing serum mAbs levels produced functionally block SARS-CoV2 spike – human ACE2 binding and that these functionally and continuously blocked SARS-CoV2 spike – human ACE2 binding for at least 90 days, which is the human equivalent of greater than 15 years.
  • EXAMPLE 35 Expression of eight anti-SARS-CoV2 mAbs with two injections
  • This example describes expression of eight anti-SARS-CoV2 mAbs shown in Figure 79 (see Table 7 for sequence information) using the following protocol.
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV.
  • mice were dosed i.v. with 40ug each of two plasmids each containing two mAb expression cassettes.
  • mice underwent an additional injection of dexamethasone pretreatment, liposome dosing, and plasmid DNA as on day 0.
  • Mice were treated with 40ug each of two plasmids each containing two mAb expression cassettes. Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, 92, 106, 120 following their first treatment, and serum expression levels of mAbs were analyzed by a human IgG ELISA assay. Results are shown in Figure 79, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, 92, 106, 120 in order from left to right.
  • mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV.
  • mice were dosed i.v. with 40ug each of two plasmids each containing two mAb expression cassettes.
  • mice underwent a second round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0.
  • mice were treated with 40ug each of two plasmids each containing two mAb expression cassettes. Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 following their first treatment, and serum expression levels of SARS-CoV2 mAbs were analyzed by a human IgG ELISA assay. Results are shown in Figure 80, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 in order from left to right.
  • mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV.
  • mice were dosed i.v. with 40ug each of two plasmids each containing two mAb expression cassettes.
  • mice underwent a second round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0.
  • mice were treated with 80ug of a single plasmid DNA containing two expression cassettes for SARS-CoV2-specific mAbs.
  • mice underwent a third round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0 (indicated by hashed bar).
  • These groups were treated with 80ug each of a single plasmid containing two mAb expression cassettes.
  • Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 following their first treatment, and serum expression levels of SARS-CoV2 mAbs were analyzed by a human IgG ELISA assay.
  • Results are shown in Figure 81, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 in order from left to right.
  • functional capacities of SARS-CoV2-specific mAb containing sera to inhibit SARS- CoV2 spike – human ACE2 protein interactions were determined by a commercially-available in vitro SARS-CoV2 spike / ACE2 blocking assay across the time course (cPASS, Genscript).
  • Each series of bar graphs (green in Figure 81) indicates mean +/- SEM mAb inhibition (right y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78 and 92 in order from left to right.
  • EXAMPLE 38 Expression of eight anti-SARS-CoV2 mAbs
  • This example describes expression of eight anti-SARS-CoV2 mAbs shown in Figure 82 (see Table 7 for sequence information) using the following protocol.
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV.
  • mice were dosed i.v. with 40ug each of two plasmids each containing one or two mAb expression cassettes.
  • mice underwent a second round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0. These groups were treated with either 80ug of a single plasmid DNA containing two expression cassettes for SARS-CoV2-specific mAb, or 40ug each of two plasmids each containing two mAb expression cassettes.
  • some of these groups of mice underwent a third round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0 (indicated by hashed bar).
  • EXAMPLE 39 Expression of 10 anti-SARS-CoV2 mAbs with other protein and mAbs
  • This example describes expression of ten anti-SARS-CoV2 mAbs shown in Figure 83 (see Table 7 for sequence information), and other proteins and mAbs, using the following protocol.
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV. After two minutes, mice were dosed i.v.
  • mice underwent a second round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0 (indicated by dot fill pattern). These groups were treated with 40ug each of two plasmids each containing two mAb expression cassettes. On day 14, these groups of mice underwent a third round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0. These groups were treated with 80ug of a single plasmid DNA containing two expression cassettes for SARS-CoV2-specific mAb clones.
  • mice Under day 21, some of these groups of mice underwent a fourth round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0. These groups were treated with 80ug of a single plasmid DNA containing two expression cassettes for non- SARS-CoV2-related proteins. These non-SARS-CoV2-related proteins included mepoluzimab (aIL5), and anti-influenza A hemagglutinin H1 (5J8). Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 following their first treatment, and serum expression levels of SARS-CoV2 mAbs were analyzed by a human IgG ELISA assay.
  • aIL5 mepoluzimab
  • anti-influenza A hemagglutinin H1 5J8.
  • Results are shown in Figure 83, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 in order from left to right.
  • functional capacities of SARS-CoV2-specific mAb containing sera to inhibit SARS-CoV2 spike – human ACE2 protein interactions were determined by a commercially-available in vitro SARS-CoV2 spike / ACE2 blocking assay across the time course (cPASS, Genscript).
  • Each series of bar graphs (green in Figure 83) indicates mean +/- SEM mAb inhibition (right y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78 and 92 in order from left to right.
  • EXAMPLE 40 Expression of 11 anti-SARS-CoV2 mAbs with other protein and mAbs
  • This example describes expression of eleven anti-SARS-CoV2 mAbs shown in Figure 84 (see Table 7 for sequence information), and other proteins and mAbs, using the following protocol.
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV. After two minutes, mice were dosed i.v.
  • mice underwent a second round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0. These groups were treated with 40ug each of two plasmids each containing two mAb expression cassettes. On day 14, these groups of mice underwent a third round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0. These groups were treated with 40ug each of two plasmids each containing two mAb expression cassettes.
  • mice Under day 21, these groups of mice underwent a fourth round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0. These groups were treated with either 80ug of a single plasmid DNA containing two or more expression cassettes for non-SARS- CoV2-related proteins, 40ug each of two plasmids each containing two non-SARS-CoV2-related proteins, or 25ug each of three plasmids each containing two non-SARS-CoV2-specific protein expression cassettes.
  • Non-SARS-CoV2-related proteins included human growth hormone (GH), galactosidase alpha (GLA), G-CSF, and mAbs rituximab (aCD20), mepoluzimab (aIL5), and anti-influenza A hemagglutinin H1 (5J8).
  • Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 following their first treatment, and serum expression levels of SARS-CoV2 mAbs were analyzed by a human IgG ELISA assay.
  • Results are shown in Figure 84, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 in order from left to right.
  • functional capacities of SARS-CoV2-specific mAb containing sera to inhibit SARS- CoV2 spike – human ACE2 protein interactions were determined by a commercially-available in vitro SARS-CoV2 spike / ACE2 blocking assay across the time course (cPASS, Genscript).
  • Each series of bar graphs (green in Figure 84) indicates mean +/- SEM mAb inhibition (right y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78 and 92 in order from left to right.
  • EXAMPLE 41 Expression of 10 anti-SARS-CoV2 mAbs with other protein and mAbs
  • This example describes expression of ten anti-SARS-CoV-2 mAbs shown in Figure 85 (see Table 7 for sequence information), and other non-Sars-CoV-2 mAbs, using the following protocol.
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV. After two minutes, mice were dosed i.v.
  • mice underwent a fourth round of injection of dexamethasone pretreatment, liposomes dosing, and plasmid DNA as on day 0. These groups were treated with 80ug of a single plasmid DNA containing two expression cassettes for non-SARS-CoV2-related proteins. These non-SARS-CoV2-related proteins included mepoluzimab biosimilar (aIL5), and anti-influenza A hemagglutinin H1 (5J8). Mice were bled at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 following their first treatment, and serum expression levels of SARS-CoV2 mAbs were analyzed by a human IgG ELISA assay.
  • aIL5 mepoluzimab biosimilar
  • 5J8 anti-influenza A hemagglutinin H1
  • Results are shown in Figure 85, where each series of bar graphs indicates mean +/- SEM mAb expression (left y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78, and 92 in order from left to right.
  • functional capacities of SARS-CoV2-specific mAb containing sera to inhibit SARS-CoV2 spike – human ACE2 protein interactions were determined by a commercially-available in vitro SARS-CoV2 spike / ACE2 blocking assay across the time course (cPASS, Genscript).
  • Each series of bar graphs indicates (green in Figure 85) mean +/- SEM mAb inhibition (right y-axis) at days 1, 8, 15, 21, 36, 50, 64, 78 and 92 in order from left to right.
  • This example demonstrates that serial co-injection of a total of 6 different single DNA expression plasmids, 5 of which encode two different individual SARS-CoV2-specific mAbs and the sixth encodes the heavy and light chains cDNAs of mAb 5J8, which is directed against the 1918 pandemic influenza virus. Together these serial injections produced neutralizing levels of a total of 10 different individual SARS-CoV2-specific serum mAb proteins together with one 1918 pandemic influenza specific serum mAb protein.
  • EXAMPLE 42 SARS-CoV2 Inhibition by 14 hours post-treatment.
  • This example describes inhibition of SARS-CoV2 by 14 hours post-treatment with the anti- SARS-CoV-2 mAbs shown in Figure 86 (see Table 7 for sequence information).
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1000nmol each of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV. After two minutes, mice were dosed i.v.
  • This example uses assaying a time course of the ability of anti-SARS-CoV-2 mAb serum levels produced over time between one and 24 hours after a single anti-SARS-CoV-2 DNA vector administration encoding either one or two anti-SARS-CoV-2 mAb heavy and light chain cDNAs to functionally block SARS-CoV2 spike – human ACE2 binding.
  • the results demonstrate that SARS-CoV2 spike – human ACE2 binding is efficiently blocked within 8 hours of one IV hedges DNA vector injection encoding either one or two anti-SARS-CoV-2 mAbs.
  • neutralizing protection following two different anti-SARS-CoV-2 vaccine administration generally requires five weeks.
  • EXAMPLE 43 Simultaneous expression of multiple different mAb and genes This example describes the simultaneous expression of six different mAb and genes using a single injection.
  • Four mice per group were injected IP with 40mg/kg water-soluble dexamethasone.
  • mice were injected i.v. with cationic liposomes containing 2.5% dexamethasone 21-palmitate, at doses shown in Figure 87, as well as 1000nmol DMPC liposomes containing 5% dex palmitate.
  • mice were injected with 25 ug each, 30ug each, or 34ug each of three DNA plasmids: one encoding anti-IL5 and 5J8, one encoding hGH and hGCSF, and one encoding an anti-SARS-CoV2 and GLA.
  • Mice were bled the following day and sera analyzed for expression of target genes. Expression results are shown in Figure 87.
  • This example demonstrates that a single co-injection of three different DNA vectors, each vector encoding either two or three different human genes, produces significant serum levels of all six different human proteins.
  • EXAMPLE 44 Controlled Gene Expression with Various Eukaryotic Promoters This example describes the use of various eukaryotic promoters to express a target gene (human growth hormone).
  • mice were pretreated with 40mg/kg water-soluble dexamethasone i.p. two hours prior to dosing i.v. with liposomes composing 1100nmol ea of DOTAP / 2.5mol% dexamethasone palmitate / SUV and DMPC / 5mol% dexamethasone palmitate / MLV.
  • mice were dosed i.v. with 75ug of various single plasmid DNA construct each containing an expression cassette for human growth hormone-Fc fusion driven by the promoters of heterologous genes, shown in Figure 88.
  • mice were bled at days 1, 8, 22, 29, 43, 50, 84 and 120 after treatment and serum mAb protein levels were determined by a human IgG ELISA assay. Bar graphs shown for each promoter in Figure 88 are in ascending order from day 1 to day 120 for each. Mean hGH-FC expression and SEM are displayed. This data shows that selected changes in the identity and composition of the DNA vector promoter element within the DNA vector expression cassette allows for longitudinal control over the magnitude of protein expression and bioactivity without the use of gene switches or any other additional modification.
  • EXAMPLE 45 Testing of 11 Different hGLA DNA Vectors This example describes simultaneously testing 11 different hGLA DNA vectors, showing that they produce a spectrum of serum levels over time.
  • Fc-Modified Protein Expression Figure 89a shows that multiple different FC modified human GLA cDNA-encoded hedges DNA vectors produce therapeutic serum hGLA levels (>1ng/ml) at day one after administration. However by day eight ( Figure 89b), only the HyFc, and particularly the Hy-Fc 1xL-containing the hGLA DNA vectors remain within the GLA therapeutic range. All other 9, Fc modified DNA vectors have dropped below therapeutic levels by day eight. These results show that optimizing the Fc portion of Fc hybrid DNA vectors can greatly improve serum half-life of modified Fc containing DNA vectors.
  • Figure 90 demonstrates that this Fc modifications is of clinical importance, as the use of this hyFc hGLA containing DNA vector significantly increases hGLA tissue levels in heart 104 days after a single hedges DNA vector administration.
  • Heart is one of the most damaged target organs in GLA deficient Fabry’s patients.
  • Fc-modified GLA can be expressed in heart tissue at therapeutic levels 104 days after injection of vector: on day 0, groups of mice were pretreated with 40mg/kg water-soluble dexamethasone IP two hours prior to i.v. injection. Liposome injection i.v.
  • EXAMPLE 47 Various Fc protein mutations affect expression This example compares the expression of various mutated Fc regions (shown in Figure 91) for GLA-Fc expression.
  • groups of mice were pretreated with 40mg/kg water-soluble dexamethasone IP two hours prior to i.v. injection.
  • Liposome injection i.v. contained 1000nmol each of DOTAP SUV with 2.5mol% dexamethasone 21-palmitate and DMPC MLV with 5mol% dexamethasone 21-palmitate. Two minutes later, 75ug DNA was injected i.v., with constructs encoding GLA with point mutations as shown in Figure 91.
  • rituximab-biosimilar expression DNA plasmid was injected i.v. Mice were bled the following day and at day 8, 15, and 22. Serum expression of rituximab-biosimilar were determined by commercial ELISA, and shown as mean +/- SEM.
  • Results are shown in Figure 92, which shows that free dexamethasone, when pre-dosed in the range of 1 to 40mg/kg dose, each maintains IV DNA vectors already high level, long term protein production, as well as their ability to limit critical toxicity markers at or closely approximating background control levels.
  • a number of the lowest free dexamethasone doses statistically significantly increased rituximab serum protein levels at day 1 following i.v. treatment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Dispersion Chemistry (AREA)
  • Plant Pathology (AREA)
  • Dermatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2021/052040 2020-09-25 2021-09-24 Systems and methods for expressing biomolecules in a subject Ceased WO2022067091A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP21873552.0A EP4216935A1 (en) 2020-09-25 2021-09-24 Systems and methods for expressing biomolecules in a subject
JP2023518359A JP2023545924A (ja) 2020-09-25 2021-09-24 対象における生体分子を発現するためのシステム及び方法
CN202180078551.8A CN116615233A (zh) 2020-09-25 2021-09-24 用于使生物分子在受试者中表达的系统和方法
KR1020237009206A KR20230086663A (ko) 2020-09-25 2021-09-24 대상체에서 생체분자를 발현하기 위한 시스템 및 방법
CA3192229A CA3192229A1 (en) 2020-09-25 2021-09-24 Systems and methods for expressing biomolecules in a subject
AU2021350020A AU2021350020A1 (en) 2020-09-25 2021-09-24 Systems and methods for expressing biomolecules in a subject
IL300776A IL300776A (en) 2020-09-25 2021-09-24 Systems and methods for expressing biomolecules on the subject
US18/166,962 US20240156960A1 (en) 2020-09-25 2023-02-09 Systems and methods for expressing biomolecules in a subject

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063083625P 2020-09-25 2020-09-25
US63/083,625 2020-09-25

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/166,962 Continuation US20240156960A1 (en) 2020-09-25 2023-02-09 Systems and methods for expressing biomolecules in a subject

Publications (1)

Publication Number Publication Date
WO2022067091A1 true WO2022067091A1 (en) 2022-03-31

Family

ID=80845864

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/052040 Ceased WO2022067091A1 (en) 2020-09-25 2021-09-24 Systems and methods for expressing biomolecules in a subject

Country Status (9)

Country Link
US (1) US20240156960A1 (cg-RX-API-DMAC7.html)
EP (1) EP4216935A1 (cg-RX-API-DMAC7.html)
JP (1) JP2023545924A (cg-RX-API-DMAC7.html)
KR (1) KR20230086663A (cg-RX-API-DMAC7.html)
CN (1) CN116615233A (cg-RX-API-DMAC7.html)
AU (1) AU2021350020A1 (cg-RX-API-DMAC7.html)
CA (1) CA3192229A1 (cg-RX-API-DMAC7.html)
IL (1) IL300776A (cg-RX-API-DMAC7.html)
WO (1) WO2022067091A1 (cg-RX-API-DMAC7.html)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11541130B2 (en) 2017-03-23 2023-01-03 DNARx Systems and methods for nucleic acid expression in vivo
RU2798508C1 (ru) * 2022-12-20 2023-06-23 Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФБУН ГНЦ ВБ "Вектор" Роспотребнадзора) Плазмидная генетическая конструкция pET21_Ab_CoV-2_1.3, обеспечивающая экспрессию рекомбинантного белка AB_COV-2_1.3 в прокариотической системе E. coli, и рекомбинантный белок AB_COV-2_1.3, обладающий свойствами однодоменного наноантитела против SARS-CoV-2
EP4146272A4 (en) * 2020-05-06 2024-10-23 International AIDS Vaccine Initiative, Inc. ANTI-COVID-19 ANTIBODIES AND THEIR USES
WO2025049908A1 (en) * 2023-09-01 2025-03-06 Normunity, Inc. Anti-pla2g10 antibodies and methods of use
WO2025054427A1 (en) * 2023-09-07 2025-03-13 Quantum-Si Incorporated Quenchbody development

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170143631A1 (en) * 2009-06-10 2017-05-25 Arbutus Biopharma Corporation Lipid formulation
US20180280539A1 (en) * 2017-03-23 2018-10-04 DNARx Systems and methods for nucleic acid expression in vivo
CN111647077A (zh) * 2020-06-02 2020-09-11 深圳市因诺赛生物科技有限公司 新型冠状病毒(sars-cov-2)刺突蛋白结合分子及其应用

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170143631A1 (en) * 2009-06-10 2017-05-25 Arbutus Biopharma Corporation Lipid formulation
US20180280539A1 (en) * 2017-03-23 2018-10-04 DNARx Systems and methods for nucleic acid expression in vivo
CN111647077A (zh) * 2020-06-02 2020-09-11 深圳市因诺赛生物科技有限公司 新型冠状病毒(sars-cov-2)刺突蛋白结合分子及其应用

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BAUM ALINA, AJITHDOSS DHARANI, COPIN RICHARD, ZHOU ANBO, LANZA KATHRYN, NEGRON NICOLE, NI MIN, WEI YI, MOHAMMADI KUSHA, MUSSER BRE: "REGN-COV2 antibodies prevent and treat SARS-CoV-2 infection in rhesus macaques and hamsters", SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 370, no. 6520, 27 November 2020 (2020-11-27), US , pages 1110 - 1115, XP055848621, ISSN: 0036-8075, DOI: 10.1126/science.abe2402 *
HASSAN AHMED O.; CASE JAMES BRETT; WINKLER EMMA S.; THACKRAY LARISSA B.; KAFAI NATASHA M.; BAILEY ADAM L.; MCCUNE BROC T.; FOX JUL: "A SARS-CoV-2 Infection Model in Mice Demonstrates Protection by Neutralizing Antibodies", CELL, ELSEVIER, AMSTERDAM NL, vol. 182, no. 3, 10 June 2020 (2020-06-10), Amsterdam NL , pages 744, XP086239953, ISSN: 0092-8674, DOI: 10.1016/j.cell.2020.06.011 *
PIERO LUIGI RUGGENENTI, A.O. OSPEDALE PAPA GIOVANNI XXIII: "Convalescent Antibodies Infusion in Critically Ill COVID 19 Patients", CLINICALTRIALS.GOV, pages 1 - 5, XP009536721, Retrieved from the Internet <URL:https://clinicaltrials.gov/ct2/show/NCT04346589> [retrieved on 20220110] *
WILLIAMSON ET AL.: "Clinical benefit of remdesivir in rhesus macaques infected with SARS-CoV-2", NATURE, vol. 585, 9 June 2020 (2020-06-09), pages 273 - 276, XP037241501, DOI: 10.1038/s41586-020-2423-5 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11541130B2 (en) 2017-03-23 2023-01-03 DNARx Systems and methods for nucleic acid expression in vivo
EP4146272A4 (en) * 2020-05-06 2024-10-23 International AIDS Vaccine Initiative, Inc. ANTI-COVID-19 ANTIBODIES AND THEIR USES
RU2798508C1 (ru) * 2022-12-20 2023-06-23 Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФБУН ГНЦ ВБ "Вектор" Роспотребнадзора) Плазмидная генетическая конструкция pET21_Ab_CoV-2_1.3, обеспечивающая экспрессию рекомбинантного белка AB_COV-2_1.3 в прокариотической системе E. coli, и рекомбинантный белок AB_COV-2_1.3, обладающий свойствами однодоменного наноантитела против SARS-CoV-2
WO2025049908A1 (en) * 2023-09-01 2025-03-06 Normunity, Inc. Anti-pla2g10 antibodies and methods of use
WO2025054427A1 (en) * 2023-09-07 2025-03-13 Quantum-Si Incorporated Quenchbody development

Also Published As

Publication number Publication date
CN116615233A (zh) 2023-08-18
EP4216935A1 (en) 2023-08-02
AU2021350020A1 (en) 2023-04-27
JP2023545924A (ja) 2023-11-01
IL300776A (en) 2023-04-01
US20240156960A1 (en) 2024-05-16
AU2021350020A9 (en) 2025-03-13
CA3192229A1 (en) 2022-03-31
KR20230086663A (ko) 2023-06-15

Similar Documents

Publication Publication Date Title
WO2022067091A1 (en) Systems and methods for expressing biomolecules in a subject
US20240350662A1 (en) Systems and methods for nucleic acid expression in vivo
JP4551464B2 (ja) インビボ送達に有効な、脂質−核酸複合体の安定な製剤の調製
JP2020511521A (ja) in vivoでの核酸発現のためのシステム及び方法
EP3562510A1 (en) Branched peg molecules and related compositions and methods
CA3168696A1 (en) Lipid nanoparticles
AU2019387219A1 (en) Optimized mRNA encoding CAS9 for use in LNPs
KR20240006456A (ko) 핵산 전달을 위한 국소 전달용 양이온성 콜레스테롤사용 지질나노입자
WO2023122535A2 (en) Nucleic acid expression using subcutaneous administration
JP2025501905A (ja) イオン化脂質、脂質ナノ粒子、及びこれらの使用
TW202530174A (zh) 用於遞送的脂質化合物及脂質奈米顆粒
CN120615011A (zh) 脂质组合物及用于递送到免疫细胞的方法
KR20240017937A (ko) 치료제의 표적화된 전달을 위한 조성물 및 방법
CN117460537A (zh) 核酸递送
US20260048023A1 (en) Lipid nanoparticle comprising a dna-binding protein
Betker et al. Utilizing cholesterol nanodomains for nucleic acid delivery
WO2026085319A1 (en) Degradable ionizable lipid compounds, lipid nanoparticles (lnps) comprising same, and methods of use thereof
WO2025101842A1 (en) Compositions and methods for targeted delivery of therapeutic agents
AU2024377696A1 (en) Compositions and methods for targeted delivery of therapeutic agents
JP2023542341A (ja) 標的化された抗原送達システム及びその使用
HK40127068A (zh) 脂质纳米颗粒

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21873552

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3192229

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: AU2021350020

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2023518359

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021350020

Country of ref document: AU

Date of ref document: 20210924

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2021873552

Country of ref document: EP

Effective date: 20230425

WWE Wipo information: entry into national phase

Ref document number: 202180078551.8

Country of ref document: CN