WO2022040560A1 - Fgfr3 antibodies and methods of use - Google Patents

Fgfr3 antibodies and methods of use Download PDF

Info

Publication number
WO2022040560A1
WO2022040560A1 PCT/US2021/046958 US2021046958W WO2022040560A1 WO 2022040560 A1 WO2022040560 A1 WO 2022040560A1 US 2021046958 W US2021046958 W US 2021046958W WO 2022040560 A1 WO2022040560 A1 WO 2022040560A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
acid sequence
sequence
antigen
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/046958
Other languages
English (en)
French (fr)
Inventor
Yves SABBAGH
Yangde Chen
William Brondyk
Huawei Qiu
Sunghae PARK
Ronnie WEI
Yu Qiu
Yanfeng ZHOU
Cendrine Lemoine
Hyunsuk Cho
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genzyme Corp
Original Assignee
Genzyme Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN202180051281.1A priority Critical patent/CN116323666A/zh
Priority to IL300623A priority patent/IL300623A/en
Priority to EP21770357.8A priority patent/EP4200019A1/en
Priority to KR1020237009493A priority patent/KR20230052963A/ko
Priority to CA3189470A priority patent/CA3189470A1/en
Priority to MX2023002106A priority patent/MX2023002106A/es
Priority to JP2023512280A priority patent/JP2023538098A/ja
Priority to BR112023002455A priority patent/BR112023002455A2/pt
Priority to AU2021327387A priority patent/AU2021327387A1/en
Application filed by Genzyme Corp filed Critical Genzyme Corp
Publication of WO2022040560A1 publication Critical patent/WO2022040560A1/en
Priority to CONC2023/0001559A priority patent/CO2023001559A2/es
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This disclosure relates to compositions of anti-fibroblast growth factor receptor 3 (anti-FGFR3) antigen-binding proteins or antigen-binding fragments thereof, such as antibodies and fragments thereof, and methods of using the same.
  • anti-FGFR3 anti-fibroblast growth factor receptor 3
  • Fibroblast growth factor receptor 3 is a protein involved, in part, in the negative regulation of bone development, being highly expressed in growth plate chondrocytes (Sarabipour et al. Biochim Biophys Acta. 1858(7 Pt A): 1436-1442. 2016).
  • FGFR3 is a single-pass membrane receptor tyrosine kinase with 3 Ig-like domains (Dl- D3). Binding of FGFR3 to an FGFR3-ligand, such as FGF18, triggers ligand-dependent receptor dimerization which leads to tyrosine kinase activation and downstream signal transduction. This signaling cascade regulates, among other things, chondrocyte proliferation and differentiation.
  • FGFR3 is a member of the fibroblast growth factor receptor family, which also includes FGFR1, FGFR2, and FGFR4.
  • Each member of the receptor family is a single-pass membrane receptor tyrosine kinase and shares the feature of 3 Ig-like domains.
  • each member of the receptor family possesses a high degree of homology with the other members.
  • Strategies to develop FGFR3-specific inhibitors have proven challenging for this reason. Nonetheless, it is important to develop FGFR3 -specific inhibitors that do not cross-react with other fibroblast growth factor receptor family members to avoid unwanted side effects in the treatment of an FGFR3 -mediate disease or disorder.
  • antigen-binding proteins or antigen-binding fragments thereof that achieve effective inhibition of FGFR3 activity.
  • Such antigen-binding proteins or antigen-binding fragments thereof may be useful in the treatment of FGFR3 -mediated diseases and disorders.
  • anti-FGFR3 antigen-binding proteins or antigenbinding fragments thereof such as antibodies and antigen-binding fragments thereof.
  • the antigen-binding proteins or antigen-binding fragments thereof, such as anti-FGFR3 antibodies and antigen-binding fragments thereof of the disclosure are suitable for treating FGFR3-mediated diseases and disorders.
  • the disclosure provides an antigen-binding protein or antigen-binding fragment thereof that specifically binds to fibroblast growth factor receptor 3 (FGFR3), comprising an antibody heavy chain variable (VH) domain and an antibody light chain variable (VL) domain, wherein: (a) the VH domain comprises a CDR- H1 sequence comprising the amino acid sequence of GX 1 TFTDX 2 E (SEQ ID NO: 157), wherein X 1 comprises or consists of Y or D and X 2 comprises or consists of F or Y; a CDR-H2 sequence comprising the amino acid sequence of IDPETGX 3 T (SEQ ID NO: 158), wherein X 3 comprises or consists of G or S; or CDR-H2 sequence comprising the amino acid sequence of INPNNGX 4 T (SEQ ID NO: 159), wherein X 4 comprises or consists of G or V; or CDR-H2 sequence comprising the amino acid sequence of VX 5 PETGGT (SEQ ID NO: 160),
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GYTFTDYN (SEQ ID NOs: 76 and 82); a CDR-H2 sequence comprising the amino acid sequence of INPNNGGT (SEQ ID NOs: 77 and 83); a CDR-H3 sequence comprising the amino acid sequence of ARERDYDGSMDF (SEQ ID NO: 84); and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QDINKF (SEQ ID NOs: 79 and 85); a CDR-L2 sequence comprising the amino acid sequence of YTS (SEQ ID NOs: 80 and 86); a CDR-L3 sequence comprising the amino acid sequence of LQYDNLLWT (SEQ ID NOs: 81 and 87); (d) the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GYTVTDYY (SEQ ID NO:
  • the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QDVSTG (SEQ ID NO: 91); a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NOs: 74, 92, 98 and 104); a CDR-L3 sequence comprising the amino acid sequence of QQHYSTPLT (SEQ ID NO: 93); (e) the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GSTFSDFE (SEQ ID NO: 94); a CDR-H2 sequence comprising the amino acid sequence of IDPETGGT (SEQ ID NOs: 71, 95, and 101); a CDR-H3 sequence comprising the amino acid sequence of TRNYDGYSQTX 17
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GDTFTDFE (SEQ ID NO: 70), GDTFTDYE (SEQ ID NO: 295), or GYTFTDFE (SEQ ID NO: 296); a CDR-H2 sequence comprising the amino acid sequence of IDPETGGT (SEQ ID NOs: 71, 95, and 101), VDPETGGT (SEQ ID NO: 297), IDPETGST (SEQ ID NO: 298), or VEPETGGT (SEQ ID NO: 299); a CDR-H3 sequence comprising the amino acid sequence of TRTYDGYPYAMDY (SEQ ID NO: 72), TRTYEGYPYAMDY (SEQ ID NO: 300), or TRTYDGYPYAFDY (SEQ ID NO: 301); and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSLLYSNNQKNY (SEQ ID NO: 73), QSV
  • the VH domain comprises the amino acid sequence selected from the group consisting of: SEQ ID NO: 6, SEQ ID NO: 18, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 10, SEQ ID NO: 110, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 57, and SEQ ID NO: 58; and the VL domain comprises the amino acid sequence selected from the group consisting of: SEQ ID NO: 7, SEQ ID NO: 19, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO
  • the antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 63 or 65
  • the antibody light chain comprises the amino acid sequence of SEQ ID NO: 67 or 69.
  • the VH domain is at least about 90% identical or at least about 95% identical to the amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 8,
  • SEQ ID NO: 20 SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 28,
  • VL domain is at least about 90% identical or at least about 95% identical to the amino acid sequence of SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, S
  • the antigen binding protein or fragment thereof of comprises an antibody heavy chain at least about 90% identical or at least about 95% identical to the amino acid sequence of SEQ ID NO: 63 or 65, and an antibody light chain at least about 90% identical or at least about 95% identical to the amino acid sequence of SEQ ID NO: 67 or 69.
  • the VH domain comprises a CDR-H1 sequence comprising the ammo acid sequence of GDTFTDFE (SEQ ID NO: 70), a CDR- H2 sequence comprising the amino acid sequence of IDPETGGT (SEQ ID NO: 71), and a CDR-H3 sequence comprising the amino acid sequence of TRTYDGYPYAMDY (SEQ ID NO: 72); and (b) the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSLLYSNNQKNY (SEQ ID NO: 73), a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NO: 74), and a CDR-L3 sequence comprising the amino acid sequence of QQYYSYRT (SEQ ID NO: 75).
  • the VH domain comprises the amino acid sequence of SEQ ID NO: 6, and the VL domain comprises the amino acid sequence of SEQ ID NO: 7.
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GYTFTDYN (SEQ ID NO: 76), a CDR- H2 sequence comprising the ammo acid sequence of INPNNGGT (SEQ ID NO: 77), and a CDR-H3 sequence comprising the amino acid sequence of ARERDYDGAMDY (SEQ ID NO: 78); and
  • the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QDINKF (SEQ ID NO: 79), a CDR-L2 sequence comprising the amino acid sequence of YTS (SEQ ID NO: 80), and a CDR-L3 sequence comprising the amino acid sequence of LQYDNLLWT (SEQ ID NO: 81).
  • the VH domain comprises the amino acid sequence of SEQ ID NO: 8
  • the VL domain comprises the amino acid sequence of SEQ ID NO: 9.
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GYTFTDYN (SEQ ID NO: 82), a CDR- H2 sequence comprising the amino acid sequence of INPNNGGT (SEQ ID NO: 83), and a CDR-H3 sequence comprising the amino acid sequence of ARERDYDGSMDF (SEQ ID NO: 84); and
  • the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QDINKF (SEQ ID NO: 85), a CDR-L2 sequence comprising the amino acid sequence of YTS (SEQ ID NO: 86), and a CDR-L3 sequence comprising the amino acid sequence of LQYDNLLWT (SEQ ID NO: 87).
  • the VH domain comprises the amino acid sequence of SEQ ID NO: 10
  • the VL domain comprises the amino acid sequence of SEQ ID NO: 11.
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GYTVTDYY (SEQ ID NO: 88), a CDR- H2 sequence comprising the ammo acid sequence of INPNNGVT (SEQ ID NO: 89), and a CDR-H3 sequence comprising the amino acid sequence of AREEDFDGFDY (SEQ ID NO: 90); and
  • the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QDVSTG (SEQ ID NO: 91), a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NO: 92), and a CDR-L3 sequence comprising the amino acid sequence of QQHYSTPLT (SEQ ID NO: 93).
  • the VH domain comprises the amino acid sequence of SEQ ID NO: 12
  • the VL domain comprises the amino acid sequence of SEQ ID NO: 13.
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GSTFSDFE (SEQ ID NO: 94), a CDR- H2 sequence comprising the amino acid sequence of IDPETGGT (SEQ ID NO: 95), and a CDR-H3 sequence comprising the amino acid sequence of TRNYDGYSQTMDY (SEQ ID NO: 96); and
  • the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSVLYSSNQKNY (SEQ ID NO: 97), a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NO: 98), and a CDR-L3 sequence comprising the amino acid sequence of HQYLSSYT (SEQ ID NO: 99).
  • the VH domain comprises the amino acid sequence of SEQ ID NO: 14
  • the VL domain comprises the amino acid sequence of SEQ ID NO: 15.
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GSTFTDFE (SEQ ID NO: 100), a CDR- H2 sequence comprising the amino acid sequence of IDPETGGT (SEQ ID NO: 101), and a CDR-H3 sequence comprising the amino acid sequence of TRNYDGYSRTMDY (SEQ ID NO: 102); and
  • the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSVLYSSNQKNY (SEQ ID NO: 103), a CDR-L2 sequence compnsing the amino acid sequence of WAS (SEQ ID NO: 104), and a CDR-L3 sequence comprising the amino acid sequence of HQYLSSYT (SEQ ID NO: 105).
  • the VH domain comprises the amino acid sequence of SEQ ID NO: 16
  • the VL domain comprises the amino acid sequence of SEQ ID NO: 17.
  • the VH domain comprises a CDR-H1 sequence comprising the ammo acid sequence of GDTFTDFE (SEQ ID NO: 70), a CDR- H2 sequence comprising the amino acid sequence of VDPETGGT (SEQ ID NO: 297), and a CDR-H3 sequence comprising the amino acid sequence of TRTYDGYPYAFDY (SEQ ID NO: 301); and
  • the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSVLYSNNNKNY (SEQ ID NO: 302), a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NOs: 74, 92, 98, 104), and a CDR- L3 sequence comprising the amino acid sequence of QQYYSYRT (SEQ ID NO: 75).
  • the VH domain comprises the amino acid sequence of SEQ ID NO: 57
  • the VL domain comprises the amino acid sequence of SEQ ID NO: 19 or 59.
  • the antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 63
  • the antibody light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the VH domain comprises a CDR-H1 sequence comprising the ammo acid sequence of GDTFTDFE (SEQ ID NO: 70), a CDR- H2 sequence comprising the amino acid sequence of VDPETGGT (SEQ ID NO: 297), and a CDR-H3 sequence comprising the amino acid sequence of TRTYDGYPYAFDY (SEQ ID NO: 301); and (b) the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSVLYSDNQKNY (SEQ ID NO: 306), a CDR-L2 sequence comprising the amino acid sequence of FAS (SEQ ID NO: 304), and a CDR-L3 sequence comprising the ammo acid sequence of QQYYSYRT (SEQ ID NO: 75).
  • the VH domain comprises the amino acid sequence of SEQ ID NO: 57
  • the VL domain comprises the amino acid sequence of SEQ ID NO: 61.
  • the antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 65
  • the antibody light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the antigen binding protein or antigen-binding binding fragment thereof binds a human FGFR3 polypeptide comprising the amino acid sequence of SEQ ID NO: 133.
  • the antigen binding protein or antigen-binding fragment thereof binds a human FGFR3 polypeptide comprising the amino acid sequence of SEQ ID NO: 134.
  • the antigen binding protein or antigen-binding fragment thereof binds a region of human FGFR3 polypeptide comprising the amino acids D143 through L163 of SEQ ID NO: 133.
  • the antigen binding protein or antigen-binding fragment thereof binds a region of human FGFR3 polypeptide comprising the amino acids D143 through N170 of SEQ ID NO: 133.
  • the antigen binding protein or antigen-binding fragment thereof binds a region of human FGFR3 polypeptide comprising the amino acids D143 through D160 and G197 through L213 of SEQ ID NO: 133.
  • the antigen binding protein or antigen-binding binding fragment thereof is a chimeric or humanized antibody or antigen-binding binding fragment thereof.
  • the antigen binding protein or antigen-binding binding fragment thereof is a human antibody or antigen-binding binding fragment thereof.
  • the antigen binding protein or antigen-binding binding fragment thereof is a monoclonal antibody or antigen-binding binding fragment thereof.
  • the antigen binding protein or antigen-binding binding fragment thereof comprises one or more full-length antibody heavy chains comprising an Fc region.
  • the Fc region is a human IgGl Fc region.
  • the antigen binding protein or antigen-binding binding fragment thereof comprises an antibody F(ab), F(ab')2, Fab'-SH, Fv, or scFv fragment.
  • the antigen binding protein or antigen-binding binding fragment thereof comprises an antibody F(ab) fragment.
  • the antibody F(ab) fragment comprises SEQ ID NO: 56 and the first about 100 amino acids of SEQ ID NO: 54.
  • the antibody F(ab) fragment comprises SEQ ID NO: 57 and the first about 100 amino acids of SEQ ID NO: 54.
  • the antibody F(ab) fragment comprises SEQ ID NO: 58 and the first about 100 amino acids of SEQ ID NO: 54.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 141 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 142.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 143 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 144.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 145 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 146.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 147 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 148.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 149 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 150.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 151 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 152.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 153 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 153 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 154.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 153 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 69.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 155 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 155 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 154.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 155 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 69.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 156 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 156 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 154.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 156 and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 69.
  • the antigen binding protein or antigen-binding binding fragment thereof comprises cross-reactivity to mouse and cynomolgus FGFR3.
  • the antigen binding or antigen-binding binding fragment thereof protein does not bind to one or more of FGFR1, FGFR2, and FGFR4.
  • the antigen binding protein or antigen-binding binding fragment thereof does not bind to each of FGFR1, FGFR2, and FGFR4.
  • the antigen binding protein or antigen-binding binding fragment thereof binds to each of FGFR1, FGFR2, and FGFR4 with an affinity of 100 pM or greater. [063] In certain embodiments, the antigen binding protein or antigen-binding binding fragment thereof binds human FGFR3 with an equilibrium dissociation constant (KD) of 10 nM or less.
  • KD equilibrium dissociation constant
  • the antigen binding protein or antigen-binding binding fragment thereof binds human FGFR3 with an off rate (Kd) of 10 4 or greater.
  • the antigen binding protein or antigen-binding binding fragment thereof inhibits ligand-induced FGFR3 dimerization with IC50 of 5 pg/ml or less.
  • the antigen binding protein or antigen-binding binding fragment thereof inhibits FGFR3 receptor activation and downstream signaling with IC50 of 5 pg/ml or less.
  • the antigen binding protein or antigen-binding binding fragment thereof inhibits the activity of an FGFR3 G380R mutant.
  • the antigen binding protein or antigen-binding fragment thereof is capable of penetrating a bone growth plate.
  • the antigen binding protein or antigen-binding fragment thereof is capable of decreasing binding of FGFR3 and its ligand in a bone growth plate.
  • the disclosure provides a pharmaceutical composition
  • a pharmaceutical composition comprising the antigen binding protein or antigen-binding fragment thereof recited above, and a pharmaceutically acceptable carrier.
  • the disclosure provides an isolated nucleic acid molecule encoding the antigen binding protein or antigen-binding fragment thereof recited above.
  • the disclosure provides an expression vector comprising the nucleic acid molecule recited above.
  • the disclosure provides a host cell comprising the expression vector recited above.
  • the disclosure provides a method for treating a FGFR3- mediated disease or disorder in a subject, comprising administering to a subject in need thereof the antigen binding protein or antigen-binding fragment thereof recited above.
  • the FGFR3 -mediated disease or disorder is achondroplasia.
  • the achondroplasia is FGFR3 G380R+ achondroplasia.
  • the subject suffering from achondroplasia comprises one or more symptoms selected from the group consisting of shortened proximal limbs, brachydactyly, large head with prominent forehead frontal bossing, small midface with a flattened nasal bridge, spinal kyphosis, spinal lordosis, varus, valgus, ear infections, sleep apnea, and hydrocephalus.
  • the FGFR3 -mediated disease or disorder is cancer.
  • the cancer is bladder cancer melanoma, urothelial cancer, and endometrial cancer.
  • the disclosure provides a method for treating achondroplasia in a subject, comprising administering to a subject in need thereof an antigen-binding protein fragment that specifically binds to FGFR3, wherein the antigen binding protein fragment does not bind to one or more of FGFR1, FGFR2, and FGFR4.
  • the disclosure provides a method for inhibiting one or both of FGFR3 activity and expression in a bone growth plate of a subject, comprising administering to a subject an antigen-binding protein fragment that specifically binds to FGFR3, wherein the antigen binding protein fragment does not bind to one or more of FGFR1, FGFR2, and FGFR4.
  • the disclosure provides an antigen-binding protein or antigen-binding fragment thereof that specifically binds to fibroblast growth factor receptor 3 (FGFR3), comprising an antibody heavy chain variable (VH) domain and an antibody light chain variable (VL) domain, wherein the antigen binding protein binds a human FGFR3 polypeptide comprising the amino acid sequence of SEQ ID NO: 134.
  • FGFR3 fibroblast growth factor receptor 3
  • the antigen binding protein binds a region of human FGFR3 polypeptide comprising the amino acids DI 43 through LI 63 of SEQ ID NO: 133.
  • the antigen binding protein or antigen-binding binding fragment thereof binds a region of human FGFR3 polypeptide comprising the amino acids D143 through N170 of SEQ ID NO: 133. [085] In certain embodiments, the antigen binding protein or antigen-binding binding fragment thereof binds a region of human FGFR3 polypeptide comprising the amino acids DI 43 through DI 60 and G197 through L213 of SEQ ID NO: 133.
  • the disclosure provides an antigen-binding protein or antigen-binding fragment thereof with binding specificity to a fibroblast growth factor receptor 3 (FGFR3) epitope, comprising an antibody heavy chain variable (VH) domain and an antibody light chain variable (VL) domain, wherein the antigen binding protein or antigen-binding binding fragment thereof competes for binding to FGFR3 with an antibody comprising VH I VL domain ammo acid sequence pairs selected from the group consisting of: SEQ ID NO: 6 / SEQ ID NO: 7, SEQ ID NO: 8 I SEQ ID NO: 9, SEQ ID NO: 10 / SEQ ID NO: 11, SEQ ID NO: 12 / SEQ ID NO: 13, SEQ ID NO: 14 / SEQ ID NO: 15, and SEQ ID NO: 16 1 SEQ ID NO: 17.
  • FGFR3 fibroblast growth factor receptor 3
  • the antigen binding protein or antigen-binding binding fragment thereof is a chimeric or humanized antibody or antigen-binding binding fragment thereof.
  • the antigen binding protein or antigen-binding binding fragment thereof is a human antibody or antigen-binding binding fragment thereof.
  • the antigen binding protein or antigen-binding binding fragment thereof is a monoclonal antibody or antigen-binding binding fragment thereof.
  • the antigen binding protein or antigen-binding binding fragment thereof comprises one or more full-length antibody heavy chains comprising an Fc region.
  • the Fc region is a human IgGl Fc region.
  • the antigen binding protein or antigen-binding binding fragment thereof comprises an antibody F(ab), F(ab')2, Fab'-SH, Fv, or scFv fragment.
  • the antigen binding protein or antigen-binding binding fragment thereof comprises an antibody F(ab) fragment.
  • the antibody F(ab) fragment comprises SEQ ID NO: 56 and the first about 100 amino acids of SEQ ID NO: 54.
  • the antibody F(ab) fragment comprises a heavy chain comprising SEQ ID NO: 57 and the first about 100 amino acids of SEQ ID NO: 54.
  • the antibody F(ab) fragment comprises a heavy chain comprising SEQ ID NO: 58 and the first about 100 amino acids of SEQ ID NO: 54.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 141, 164, 173, 182, 191, 200, 209,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 142.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 143, 165, 174, 183, 192, 201, 210,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 144.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 145, 166, 175, 184, 193, 202, 211,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 146.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 147, 167, 176, 185, 194, 203, 212,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 148.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 149, 168, 177, 186, 195, 204, 213,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 150.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 151, 169, 178, 187, 196, 205, 214,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 152.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 153, 170, 179, 188, 197, 206, 215, 224, 233, 242, 251, 260, 269, 278, or 287, and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 153, 170, 179, 188, 197, 206, 215, 224, 233, 242, 251, 260, 269, 278, or 287
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 154.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 153, 170, 179, 188, 197, 206, 215,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 69.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 155, 171, 180, 189, 198, 207, 216,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 155, 171, 180, 189, 198, 207, 216, 225, 234, 243, 252, 261, 270, 279, or 288, and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 154.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 155, 171, 180, 189, 198, 207, 216,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 69.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 156, 172, 181, 190, 199, 208, 217,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 156, 172, 181, 190, 199, 208, 217, 226, 235, 244, 253, 262, 271, 280, or 289
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 154.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 156, 172, 181, 190, 199, 208, 217, 226, 235, 244, 253, 262, 271, 280, or 289
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 69.
  • the antigen binding protein or antigen-binding binding fragment thereof comprises has cross-reactivity to mouse and cynomolgus FGFR3.
  • the antigen binding or antigen-binding binding fragment thereof protein does not bind to one or more of FGFR1, FGFR2, and FGFR4.
  • the antigen binding protein or antigen-binding binding fragment thereof does not bind to each of FGFR1, FGFR2, and FGFR4.
  • the antigen binding protein or antigen-binding binding fragment thereof binds to each of FGFR1, FGFR2, and FGFR4 with an affinity equilibrium dissociation constant (KD) of 100 pM or greater.
  • KD affinity equilibrium dissociation constant
  • the antigen binding protein or antigen-binding binding fragment thereof binds human FGFR3 with an equilibrium dissociation constant (KD) of 10 nM or less.
  • the antigen binding protein or antigen-binding binding fragment thereof binds human FGFR3 with an off rate (Kd) of 10 4 or greater.
  • the antigen binding protein or antigen-binding binding fragment thereof inhibits ligand-induced FGFR3 dimerization with IC50 of 5 pg/ml or less.
  • the antigen binding protein or antigen-binding binding fragment thereof inhibits FGFR3 receptor activation and downstream signaling with IC50 of 5 pg/ml or less.
  • the antigen binding protein or antigen-binding binding fragment thereof inhibits the activity of an FGFR3 G380R mutant.
  • the antigen binding protein or antigen-binding binding fragment thereof is capable of penetrating a bone growth plate.
  • the antigen binding protein or antigen-binding binding fragment thereof is capable of decreasing the binding of FGFR3 with its ligand in a bone growth plate. In certain embodiments, the antigen binding protein or antigenbinding binding fragment thereof is capable of decreasing the kinase activity of FGFR3 in a bone growth plate.
  • composition comprising the antigen binding protein or antigen-binding fragment thereof as described herein.
  • pharmaceutical composition comprises a pharmaceutically acceptable earner.
  • nucleic acid molecule encoding the antigen binding protein or antigen-binding fragment thereof as described herein.
  • an expression cassette comprising said nucleic acid molecule.
  • an expression vector comprising the isolated nucleic acid molecule.
  • a host cell comprising the expression vector, the expression cassette or the nucleic acid molecule.
  • a method for treating a FGFR3-mediated disease or disorder in a subject comprises administering to a subject in need thereof the antigen binding protein or antigen-binding fragment thereof as described herein.
  • the FGFR3-mediated disease or disorder is achondroplasia.
  • the achondroplasia is FGFR3 G380R+ achondroplasia.
  • the FGFR3 -mediated disease or disorder is cancer.
  • the cancer is bladder cancer melanoma, urothelial cancer, and endometrial cancer.
  • the method comprises administering to a subject in need thereof an antigen-binding protein fragment that specifically binds to FGFR3, wherein the antigen binding protein fragment does not bind to one or more of FGFR1, FGFR2, and FGFR4.
  • a method for inhibiting one or both of FGFR3 activity and expression in a bone growth plate of a subject comprises administering to a subject an antigen-binding protein fragment that specifically binds to FGFR3, wherein the antigen binding protein fragment does not bind to one or more of FGFR1, FGFR2, and FGFR4.
  • the subject is a child.
  • the child is an infant.
  • the infant is a newborn.
  • the method comprises administering to the subject an antigen-binding protein or an antigen-binding protein fragment thereof that specifically binds to FGFR3, wherein the antigen binding protein fragment does not bind to one or more of FGFR1, FGFR2, and FGFR4.
  • FIG. 1 schematically depicts fibroblast growth factor receptor 3 (FGFR3) isoform IIIc.
  • Fig. 2 depicts heat maps generated with hydrogen deuterium exchange (HDX) mass spectrometry used to determine the epitopes on FGFR3 for select antibodies by measuring the amide hydrogen deuterium exchange on FGFR3.
  • HDX hydrogen deuterium exchange
  • Fig. 3 depicts fluorescent images from internalization assays to detect internalization of anti-FGFR3 antibodies in KMS-11 cells.
  • Fig. 4 graphically depicts the average amount of anti-FGFR3 antibody internalization relative to the total amount of antibody.
  • Fig. 5A - Fig. 5C graphically depict inhibition of FGFR3 dimenzation by anti-FGFR3 antibody KC18 (Fig. 5A).
  • KE58 Fig. 5B KE94 (Fig. 5C). Inhibition was evaluated by a chemiluminescent assay in U2OS cells co-expressing fusion protein of P-galactosidase-prolink (PK) and FGFR3 (FGFR3-PK) and P-galactosidase-enzyme acceptor (EA) and FGFR3 (FGFR3-EA).
  • PK P-galactosidase-prolink
  • FGFR3 FGFR3
  • EA P-galactosidase-enzyme acceptor
  • FIG. 6 depicts an alignment of anti-FGFR3 antibodies KC18, KE63, and KE94.
  • Fig. 7 depicts an alignment of anti-FGFR3 antibody KC18_Hul8 with variants. Mutations of Hui 8 residues are highlighted green or red.
  • Fig. 8A - Fig. 8C depict graphs demonstrating IC50 values for the inhibition of Erk phosphorylation by humanized anti-FGFR3 antibodies Hul8 (Fig. 8A), Hu44 Fig. 8B). and Hu46 (Fig. 8C ⁇ Inhibition of Erk phosphorylation was determined by a homogenous time-resolved fluorescence (HTRF) assay.
  • HTRF time-resolved fluorescence
  • Fig. 9A - Fig. 9B graphically depict relative Erk phosphorylation inhibition by anti-FGFR3 antibodies KC18 (Fig. 94). KE63 (Fig. 9B). and KE94 (Fig. 9B) and their corresponding Fab fragments.
  • Fig. 10A - Fig. 10C graphically depict relative Erk phosphorylation inhibition by anti-FGFR3 antibody KC18 in different formats.
  • Fig. 10A depicts inhibition effect of KC 18 as a full-length antibody (KC18), aFab fragment (Kcl8 Fab), a one-armed, monovalent antibody (MetMab), and a PEGylated Fab fragment (PEG) in WT cells.
  • Fig. 10B depicts inhibition effect of KC18 as a full-length antibody (IgG), a Fab fragment, a one-armed, monovalent antibody (MetMab), and a PEGylated Fab fragment (PEG) in Ach cells.
  • Fig. 10A depicts inhibition effect of KC 18 as a full-length antibody (KC18), aFab fragment (Kcl8 Fab), a one-armed, monovalent antibody (MetMab), and a PEGylated Fab fragment (PEG) in Ach cells.
  • IgG
  • IOC depicts KC18 fab fragments with half-life extension moi eties using a human albumin nanobody conjugate (KC18 Fab-HLE), with and without human serum albumin (HSA) or mouse serum albumin (MSA). Erk phosphorylation was measured in an HTRF assay and compared to an isotype control (Iso).
  • Fig. 11 graphically depicts inhibition of Erk phosphorylation by humanized anti-FGFR3 antibodies Hui 8, Hu44, and Hu46. Inhibition of Erk phosphorylation was determined using an HTRF assay.
  • Fig. 12 A - Fig. 12B graphically depict femur (Fig. 12 A) and tibia (Fig. 12B) length in an achondroplasia mouse model (Ach), which is a transgenic mouse that overexpresses the mouse FGFR3 protein with the G380R mutation under the collagen II promoter. Mice were administered the KC18 fab fragment subcutaneously from 3 days of age to 20 days of age.
  • Fig. 13A - Fig. 13B graphically depict vertebrae Fig. I3A) and skull (Fig. 13B) length in the Ach mouse model.
  • NL nasal length
  • FL frontal length
  • PL parietal length.
  • Fig. 14 graphically depicts brain volume in the WT and Ach mouse model treated by saline or KC18 fab fragment.
  • Fig. 15A graphically depicts Kyphosis Index in the WT and Ach mouse model treated by saline or KC18 fab fragment.
  • Fig. 15B depicts the calculation of Kyphotic Index using a mouse model.
  • FIG. 16A graphically depicts femur growth plate (GP) volume in Ach mouse model treated by vehicle or KC18 fab fragment.
  • Fig. 16B depicts femur diameter in Ach mouse model treated by vehicle or KC18 fab fragment.
  • Fig. 17 graphically depicts increased secondary ossification center in tibia in Ach mouse model compared to those treated with vehicle.
  • Antigen-binding proteins or antigen-binding fragments thereof are provided. Methods of inhibiting one or more FGFR3 activities, and methods of treating FGFR3-mediated diseases and disorders are also provided.
  • FGFR3 refers to the FGFR3 protein encoded by the FGFR3 gene.
  • FGFR3 belongs to a family of fibroblast growth factor receptors that also includes FGFR1, FGFR2, and FGFR4.
  • FGFR3 is a single-pass membrane receptor tyrosine kinase with 3 Ig-like domains (DI, D2, and D3). Ligand dependent receptor dimerization leads to tyrosine kinase activation and downstream signal transduction.
  • FGFR3 undergoes alternative splicing leading to several isoforms, including isoform Illb and isoform IIIc.
  • Illb and IIIc arise from alternative splicing of exons 8 and 9.
  • Illb and IIIc have identical Igl (DI) and Ig2 (D2) domains, but vary in the Ig3 (D3) domain.
  • FGFR3 IIIc is the major FGFR3 isoform in chondrocytes and mediates the anabolic effects of the FGFR3 ligand, FGF18, in articular cartilage.
  • the structure and function of FGFR3 is described in further detail in Olsen et al. (PNAS. 101(4): 935-940. 2004), incorporated herein by reference in its entirety for all purposes.
  • FGFR3 G380R A G380R mutation in the transmembrane domain of FGFR3 is associated with 98% of all achondroplasia cases.
  • FGFR3 with a G380R mutation can be referred to as FGFR3 G380R , and the sequence of the human FGFR3 G380R isoform IIIc is recited below.
  • antibody or “antigen-binding protein” refers to an immunoglobulin molecule that specifically binds to, or is immunologically reactive with an antigen or epitope (e.g., a FGFR3 antigen or epitope), and includes both polyclonal and monoclonal antibodies, as well as functional antibody fragments thereof, including but not limited to fragment antigen-binding (Fab) fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rlgG) fragments, single chain vanable fragments (scFv) and single domain antibodies (e.g., sdAb, sdFv, nanobody) fragments.
  • Fab fragment antigen-binding
  • antibody includes genetically engineered or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, meditope-enabled antibodies, heteroconjugate antibodies (e.g., bispecific antibodies, diabodies, triabodies, tetrabodies, tandem di-scFv, tandem tri-scFv) and the like. Unless otherwise stated, the term “antibody” should be understood to encompass functional antibody fragments thereof. As used herein, the term “functional antibody fragment” refers to an antibody fragment having at least 80%, at least 85%, at least 90%, or at least 95% affinity as the antibody of interest from which the fragment is derived from.
  • CDR complementarity determining region
  • CDR-H1, CDR-H2, CDR-H3 three CDRs in each heavy chain variable region
  • CDR-L1, CDR-L2, CDR-L3 three CDRs in each light chain variable region
  • FR Framework regions
  • FR-H1, FR- H2, FR-H3, and FR-H4 there are four FRs in each heavy chain variable region (FR-H1, FR- H2, FR-H3, and FR-H4), and four FRs in each light chain variable region (FR-L1, FR-L2, FR-L3, and FR-L4).
  • the boundaries of a given CDR or FR may vary depending on the scheme used for identification.
  • the Rabat scheme is based structural alignments
  • the Chothia scheme is based on structural information. Numbering for both the Rabat and Chothia schemes is based upon the most common antibody region sequence lengths, with insertions accommodated by insertion letters, for example, “30a,” and deletions appearing in some antibodies. The two schemes place certain insertions and deletions (“indels ”) at different positions, resulting in differential numbering.
  • the Contact scheme is based on analysis of complex crystal structures and is similar in many respects to the Chothia numbering scheme.
  • a “CDR” or “complementary determining region,” or individual specified CDRs (e.g., “CDR-H1,” “CDR-H2,” “CDR-H3”), of a given antibody or region thereof, such as a variable region thereof, should be understood to encompass a (or the specific) complementary determining region as defined by any of the known schemes.
  • an “FR” or “framework region,” or individual specified FRs (e.g., “FR-H1,” “FR-H2”) of a given antibody or region thereof, such as a variable region thereof, should be understood to encompass a (or the specific) framework region as defined by any of the known schemes.
  • the scheme for identification of a particular CDR or FR is specified, such as the CDR as defined by the IMGT, Rabat, Chothia, AbM, or Contact method.
  • the particular amino acid sequence of a CDR or FR is given.
  • all particular CDR amino acid sequences mentioned in the disclosure are IMGT CDRs.
  • alternative CDRs defined by other schemes are also encompassed by the present disclosure, such as those determined by abYsis Rey Annotation (Website: abysis.org/abysis/sequence_input/key_annotation/key_annotation •cgi).
  • the term “specifically binds,” “specifically binding,” “binding specificity” or “specifically recognized” refers that an antigen binding protein or antigen-binding fragment thereof that exhibits appreciable affinity for an antigen (e.g., an FGFR3 antigen) and does not exhibit significant cross reactivity to a target that is not an FGFR3 protein.
  • affinity refers to the strength of the interaction between an antigen binding protein or antigen-binding fragment thereof antigen binding site and the epitope to which it binds.
  • an antigen binding protein affinity may be reported as a dissociation constant (KD) in molarity (M).
  • the antigen binding protein or antigen-binding fragment thereof of the disclosure have KD values in the range of about 10' 6 M to about IO 2 M (i.e., low micromolar to picomolar range), about 10' 7 M to 10 41 M, about 10' 8 M to about 10 40 M, about 10' 9 M.
  • the antigen binding protein or antigen-binding fragment thereof has a binding affinity of about IO -6 M, 10' 7 M, 10' 8 M, 10' 9 M, 10 40 M, 10 41 M, or 10 2 M.
  • the antigen binding protein or antigenbinding fragment thereof has a binding affinity of about 1 O' 7 M to about 10' 9 M (nanomolar range).
  • Specific binding can be determined according to any art-recognized means for determining such binding.
  • specific binding is determined by competitive binding assays (e.g. ELISA) or Biacore assays.
  • the assay is conducted at about 20°C, 25°C, 30°C, or 37°C.
  • the disclosure provides antigen binding proteins and antigen-binding fragments thereof with binding specificity to FGFR3.
  • Exemplary anti-FGFR3 antigen binding protein and antigen-binding fragment thereof CDRs are recited below in Table 1 and Table 4.
  • Exemplary anti-FGFR3 antigen binding protein and antigen-binding fragment thereof variable heavy (VH) and variable light (VL) domains are recited below in Table 3, Table 8, Table 9, and Table 13.
  • Exemplary anti-FGFR3 antigen binding protein full length heavy and light chains are recited below in Table 14.
  • the anti-FGFR3 antigen binding proteins and antigen-binding fragments thereof comprise an antibody heavy chain variable (VH) domain comprising a CDR-H1 sequence, a CDR-H2 sequence, and a CDR-H3 sequence.
  • VH antibody heavy chain variable
  • the CDR-H1 sequence comprises the amino acid sequence of GX 1 TFTDX 2 E (SEQ ID NO: 157), wherein X 1 comprises Y or D and X 2 comprises F or Y; the CDR-H2 sequence comprises the amino acid sequence of IDPETGX 3 T (SEQ ID NO: 158), wherein X 3 comprises G or S; or CDR-H2 sequence comprising the amino acid sequence of INPNNGX 4 T (SEQ ID NO: 159), wherein X 4 comprises G or V; or CDR-H2 sequence comprising the amino acid sequence of VX 5 PETGGT (SEQ ID NO: 160), wherein X 5 comprises D or E; and the CDR-H3 sequence comprises the amino acid sequence of TRX 6 YX 7 GYX 8 X 9 X 10 X n DY (SEQ ID NO: 161), wherein X 6 comprises T or N, X 7 comprises D or E, X 8 comprises S or P, X 9 comprises Q, R, or Y, X 10 comprises
  • the anti-FGFR3 antigen binding proteins and antigen-binding fragments thereof comprise an antibody light chain variable (VL) domain comprising a CDR-L1 sequence, a CDR-L2 sequence, and a CDR-L3 sequence.
  • VL antibody light chain variable
  • the CDR-L1 sequence comprises the amino acid sequence of QS X 12 LYS X 13 N X 14 KNY (SEQ ID NO: 162), wherein X 12 comprises L or V, X 13 comprises N, D, or S, and X 14 comprises Q or N;
  • the CDR-L2 sequence comprises the amino acid sequence of X 15 AS (SEQ ID NO: 163), wherein X 15 comprises W, Y, or F;
  • the CDR-L3 sequence comprises the amino acid sequence of QQYYSYRT (SEQ ID NO: 75), LQYDNLLWT (SEQ ID NO: 81), or HQYLSX 16 YT (SEQ ID NO: 290), wherein X 16 compnses P or S.
  • the disclosure provides an antigen-binding protein or fragment thereof that specifically binds to fibroblast growth factor receptor 3 (FGFR3), comprising an antibody heavy chain variable (VH) domain and an antibody light chain variable (VL) domain, wherein:
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GX'TFTDX 2 E (SEQ ID NO: 157), wherein X 1 comprises Y or D and X 2 comprises F or Y; a CDR-H2 sequence comprising the amino acid sequence of IDPETGX 3 T (SEQ ID NO: 158), wherein X 3 comprises G or S; or CDR-H2 sequence comprising the amino acid sequence of INPNNGX 4 T (SEQ ID NO: 159), wherein X 4 comprises G or V; or CDR-H2 sequence comprising the amino acid sequence of VX 5 PETGGT (SEQ ID NO: 160), wherein X 5 comprises D or E; a CDR-H3 sequence comprising the amino acid sequence of TRX 6 YX 7 GYX 8 X 9 X 10 X n DY (SEQ ID NO: 161), wherein X 6 comprises T or N, X 7 comprises D or E, X 8 comprises S or P,
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GYTFTDYN (SEQ ID NOs: 76 and 82); a CDR-H2 sequence comprising the amino acid sequence of INPNNGGT (SEQ ID NOs: 77 and 83); a CDR-H3 sequence comprising the amino acid sequence of ARERDYDGAMDY (SEQ ID NO: 78); and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QDINKF (SEQ ID NOs: 79 and 85); a CDR-L2 sequence comprising the amino acid sequence of YTS (SEQ ID NOs: 80 and 86); a CDR-L3 sequence comprising the amino acid sequence of LQYDNLLWT (SEQ ID NOs: 81 and 87);
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GYTFTDYN (SEQ ID NOs: 76 and 82); a CDR-H2 sequence comprising the amino acid sequence of INPNNGGT (SEQ ID NOs: 77 and 83); a CDR-H3 sequence comprising the amino acid sequence of ARERDYDGSMDF (SEQ ID NO: 84); and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QDINKF (SEQ ID NOs: 79 and 85); a CDR-L2 sequence comprising the amino acid sequence of YTS (SEQ ID NOs: 80 and 86); a CDR-L3 sequence comprising the amino acid sequence of LQYDNLLWT (SEQ ID NOs: 81 and 87);
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GYTVTDYY (SEQ ID NO: 88); a CDR-H2 sequence comprising the amino acid sequence of INPNNGVT (SEQ ID NO: 89); a CDR-H3 sequence comprising the ammo acid sequence of AREEDFDGFDY (SEQ ID NO: 90); and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QDVSTG (SEQ ID NO: 91); a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NOs: 74, 92, 98, and 104); a CDR-L3 sequence comprising the amino acid sequence of QQHYSTPLT (SEQ ID NO: 93);
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GSTFSDFE (SEQ ID NO: 94); a CDR-H2 sequence comprising the amino acid sequence of IDPETGGT (SEQ ID NOs: 71, 95, and 101); a CDR-H3 sequence comprising the amino acid sequence of TRNYDGYSQTX 17 DY (SEQ ID NO: 308), wherein X 17 comprises M or F; and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSVLYSX 18 NQKNY (SEQ ID NO: 309), wherein X 18 comprises S or D; a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NOs: 74, 92, 98, and 104); a CDR-L3 sequence comprising the amino acid sequence of or HQYLSSYT (SEQ ID NOs: 99 and 105); or
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GSTFTDFE (SEQ ID NO: 100); a CDR-H2 sequence comprising the amino acid sequence of IDPETGGT (SEQ ID NOs: 71, 95, and 101); a CDR-H3 sequence comprising the amino acid sequence of TRNYDGYSQTX 17 DY (SEQ ID NO: 308), wherein X 17 comprises M or F; and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSVLYSX 18 NQKNY (SEQ ID NO: 309), wherein X 18 comprises S or D; a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NOs: 74, 92, 98, and 104); a CDR-L3 sequence comprising the amino acid sequence of HQYLSSYT (SEQ ID NOs: 99 and 105).
  • the antigen binding protein or fragment thereof comprises a VH domain and a VL domain, wherein:
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GDTFTDFE (SEQ ID NO: 70), GDTFTDYE (SEQ ID NO: 295), or GYTFTDFE (SEQ ID NO: 296); a CDR-H2 sequence comprising the amino acid sequence of IDPETGGT (SEQ ID NOs: 71, 95, and 101), VDPETGGT (SEQ ID NO: 297), IDPETGST (SEQ ID NO: 298), or VEPETGGT (SEQ ID NO: 299); a CDR-H3 sequence comprising the amino acid sequence of TRTYDGYPYAMDY (SEQ ID NO: 72), TRTYEGYPYAMDY (SEQ ID NO: 300), or TRTYDGYPYAFDY (SEQ ID NO:
  • VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSLLYSNNQKNY (SEQ ID NO: 73), QSVLYSNNNKNY (SEQ ID NO:
  • QSVLYSDNQKNY SEQ ID NO: 306
  • a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NOs: 74, 92, 98, and 104), YAS (SEQ ID NO: 303), or FAS (SEQ ID NO: 304)
  • a CDR-L3 sequence comprising the amino acid sequence of QQYYSYRT (SEQ ID NO: 75);
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GYTFTDYN (SEQ ID NOs: 76 and 82); a CDR-H2 sequence comprising the amino acid sequence of INPNNGGT (SEQ ID NOs: 77 and 83); a CDR-H3 sequence comprising the amino acid sequence of ARERDYDGAMDY (SEQ ID NO: 78); and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QDINKF (SEQ ID NOs: 79 and 85); a CDR-L2 sequence comprising the amino acid sequence of YTS (SEQ ID NOs: 80 and 86); a CDR-L3 sequence comprising the amino acid sequence of LQYDNLLWT (SEQ ID NOs: 81 and 87);
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GYTFTDYN (SEQ ID NOs: 76 and 82); a CDR-H2 sequence compnsing the amino acid sequence of INPNNGGT (SEQ ID NOs: 77 and 83); a CDR-H3 sequence comprising the amino acid sequence of ARERDYDGSMDF (SEQ ID NO: 84); and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QDINKF (SEQ ID NOs: 79 and 85); a CDR-L2 sequence comprising the amino acid sequence of YTS (SEQ ID NOs: 80 and 86); a CDR-L3 sequence comprising the amino acid sequence of LQYDNLLWT (SEQ ID NOs: 81 and 87);
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GYTVTDYY (SEQ ID NO: 88); a CDR-H2 sequence comprising the amino acid sequence of INPNNGVT (SEQ ID NO: 89); a CDR-H3 sequence compnsing the ammo acid sequence of AREEDFDGFDY (SEQ ID NO: 90); and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QDVSTG (SEQ ID NO: 91); a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NOs: 74, 92, 98, 104); a CDR-L3 sequence comprising the amino acid sequence of QQHYSTPLT (SEQ ID NO: 93);
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GSTFSDFE (SEQ ID NO: 94); a CDR-H2 sequence comprising the amino acid sequence of IDPETGGT (SEQ ID NOs: 71, 95, and 101); a CDR-H3 sequence comprising the amino acid sequence of TRNYDGYSQTMDY (SEQ ID NO: 96) or TRNYDGYSQTFDY (SEQ ID NO: 305); and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSVLYSSNQKNY(SEQ ID NOs: 97 and 103) or QSVLYSDNQKNY (SEQ ID NO: 306); a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NOs: 74, 92, 98, and 104); a CDR-L3 sequence comprising the amino acid sequence of or HQYLSSYT (SEQ ID NOs: 99 and 105);
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GSTFTDFE (SEQ ID NO: 100); a CDR-H2 sequence comprising the amino acid sequence of IDPETGGT (SEQ ID NOs: 71, 95, and 101); a CDR-H3 sequence comprising the amino acid sequence of TRNYDGYSRTMDY (SEQ ID NO: 102) or TRNYDGYSRTFDY (SEQ ID NO: 307); and the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSVLYSSNQKNY(SEQ ID NOs: 97 and 103) or QSVLYSDNQKNY (SEQ ID NO: 306); a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NOs: 74, 92, 98, 104); a CDR-L3 sequence comprising the amino acid sequence of or HQYLSSYT (SEQ ID NOs: 99 and 105).
  • the FGFR3 antigen binding proteins and antigenbinding fragments thereof comprise one VH domain and one VL domain recited in Table 3, 8, 9, or 13.
  • exemplary antigen-binding proteins or antigenbinding fragments thereof are provided:
  • the anti-FGFR3 antigen binding protein or fragment thereof comprises a pair of heavy chain and light chain of Table 1.1 above.
  • the anti-FGFR3 antigen binding protein or fragment thereof comprises a VH domain and a VL domain, wherein:
  • the VH domain comprises the amino acid sequence selected from the group consisting of: SEQ ID NO: 6, SEQ ID NO: 18, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, and SEQ ID NO: 122,; and the VL domain comprises the amino acid sequence selected from the group consisting of: SEQ ID NO: 7, SEQ ID NO: 19, SEQ ID NO: 60, SEQ ID NO: 61SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126,
  • VH domain comprises the amino acid sequence of SEQ ID NO: 8; and the VL domain comprises the amino acid sequence of SEQ ID NO: 9;
  • VH domain comprises the amino acid sequence of SEQ ID NO: 10; and the VL domain comprises the amino acid sequence of SEQ ID NO: 11;
  • the VH domain comprises the amino acid sequence of SEQ ID NO: 12; and the VL domain comprises the amino acid sequence of SEQ ID NO: 13;
  • the VH domain comprises the amino acid sequence selected from the group consisting of: SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and SEQ ID NO: 23; and the VL domain comprises the amino acid sequence selected from the group consisting of: SEQ ID NO: 15, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27;
  • the VH domain comprises the amino acid sequence selected from the group consisting of: SEQ ID NO: 16, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31 ;
  • the VL domain comprises the amino acid sequence selected from the group consisting of: SEQ ID NO: 17, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, and SEQ ID NO: 35.
  • the antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 63 or 65
  • the antibody light chain comprises the amino acid sequence of SEQ ID NO: 67 or 69.
  • the VH domain of a variant is at least about 80%, at least at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90% identical, at least about 91% identical, at least about 92% identical, at least about 93% identical, at least about 94% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, or at least about 99% identical to the amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 57, SEQ ID NO:
  • the anti-FGFR3 antigen binding protein or fragment thereof comprises an antibody heavy chain at least about 80%, at least at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90% identical, at least about 91% identical, at least about 92% identical, at least about 93% identical, at least about 94% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, or at least about 99% identical to the amino acid sequence of SEQ ID NO: 63 or 65, and an antibody light chain at least about 80%, at least at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90% identical, at least about 91% identical, at
  • the anti-FGFR3 antigen binding protein or fragment thereof comprises a VH domain and a VL domain, wherein: (a) the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GDTFTDFE (SEQ ID NO: 70), a CDR-H2 sequence comprising the amino acid sequence of VDPETGGT (SEQ ID NO: 297), and a CDR-H3 sequence comprising the amino acid sequence of TRTYDGYPYAFDY (SEQ ID NO: 301); and (b) the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSVLYSNNNKNY (SEQ ID NO: 302), a CDR-L2 sequence comprising the amino acid sequence of WAS (SEQ ID NOs: 74, 92, 98, and 104), and a CDR-L3 sequence comprising the amino acid sequence of QQYYSYRT (SEQ ID NO: 75).
  • the VH domain comprises a CDR-H1 sequence comprising the amino
  • the VH domain comprises the amino acid sequence of SEQ ID NO: 57
  • the VL domain comprises the amino acid sequence of SEQ ID NO: 19 or 59.
  • the antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 63, and the antibody light chain comprises the amino acid sequence of SEQ ID NO: 67. In certain embodiments, the antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 65, and the antibody light chain comprises the amino acid sequence of SEQ ID NO: 69.
  • the anti-FGFR3 antigen binding protein or fragment thereof comprises a VH domain and a VL domain, wherein: (a) the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GDTFTDFE (SEQ ID NO: 70), a CDR-H2 sequence comprising the amino acid sequence of VDPETGGT (SEQ ID NO: 297), and a CDR-H3 sequence comprising the amino acid sequence of TRTYDGYPYAFDY (SEQ ID NO: 301); and (b) the VL domain comprises a CDR-L1 sequence comprising the amino acid sequence of QSVLYSDNQKNY (SEQ ID NO: 306), a CDR-L2 sequence comprising the amino acid sequence of FAS (SEQ ID NO: 304), and a CDR-L3 sequence comprising the amino acid sequence of QQYYSYRT (SEQ ID NO: 75).
  • the VH domain comprises a CDR-H1 sequence comprising the amino acid sequence of GDTFTDFE (S
  • the VH domain comprises the amino acid sequence of SEQ ID NO: 57
  • the VL domain comprises the amino acid sequence of SEQ ID NO: 61.
  • the antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 65
  • the antibody light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the anti-FGFR3 antigen binding proteins and antigen-binding fragments thereof of the disclosure comprise one or more sequences with at least about 80%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any of the sequences of Table 1, Table 3, Table 4, Table 8, Table 13, or Table 14, or protein sequences encoded by the nucleic acid sequences in Table 9.
  • human framework regions for anti-FGFR3 antigen binding proteins and antigen-binding fragments thereof are provided below.
  • the anti-FGFR3 antigen binding proteins and antigen-binding fragments comprise three heavy chain CDRs that bind to FGFR3, such as the three heavy chain CDRs of mouse antibody KC18, KE35, KE42, KE58, KE63, or KE94, and a human heavy chain variable region framework.
  • the anti-FGFR3 antigen binding proteins and antigen-binding fragments further comprise three light chain CDRs that bind to FGFR3, such as the three light chain CDRs of mouse antibody KC18, KE35, KE42, KE58, KE63, or KE94, and a human light chain variable region framework.
  • the human heavy chain variable region framework comprises any one of SEQ ID NOs: 318 to 328.
  • the human light chain variable region framework comprises any one of SEQ ID NOs: 329 to 339.
  • the human heavy chain variable region framework comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identity to any one of SEQ ID NOs: 318 to 328.
  • the human light chain vanable region framework comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identity to any one of SEQ ID NOs: 329 to 339.
  • such anti-FGFR3 antigen binding proteins and antigen-binding fragments bind human FGFR3 with an equilibrium dissociation constant (KD) of about 100 nM or less, about 90 nM or less, about 80 nM or less, about 70 nM or less, about 60 nM or less, about 50 nM or less, about 40 nM or less, about 30 nM or less, about 20 nM or less, about 10 nM or less, about 9 nM or less, about 8 nM or less, about 7 nM or less, about 6 nM or less, about 5 nM or less, about 4 nM or less, about 3 nM or less, about 2.89 nM or less, about 2 nM or less, about 1.5 or less, about 1.4 or less, about 1.23 or less, about 1.2 or less, or about 1 nM or less, about 0.8 or less, or about 0.6 or less.
  • KD equilibrium dissociation constant
  • X nM or less therein includes the embodiment “less than X nM”. “Less” therein can mean e.g. to about 2.8 nM, to about 1.3 nM, to about 1.1 nM, to about 0.7 nM or to about 0.5 nM.
  • nM values are as obtained by a Surface Plasmon Resonance assay, such as the Biacore assay.
  • the anti-FGFR3 antigen binding proteins and antigen-binding fragments thereof of the disclosure are chimeric or humanized antibodies.
  • the antigen binding protein is a humanized antibody.
  • the antigen binding protein is a monoclonal antibody.
  • the antigen binding protein comprises one or more full-length antibody heavy chains comprising an Fc region.
  • the Fc region is a human IgGl Fc region. In certain embodiments, the Fc region is a human IgG4 Fc region.
  • the antibody Fc region comprises one or more mutations that reduces Fc effector function.
  • the one or more mutations reduces one or more of antibody dependent cellular cytotoxicity (ADCC), antibody dependent cellular phagocytosis (ADCP), or complement dependent cytotoxicity (CDC).
  • ADCC antibody dependent cellular cytotoxicity
  • ADCP antibody dependent cellular phagocytosis
  • CDC complement dependent cytotoxicity
  • the human IgGl Fc region comprises a L234A and L235A mutation.
  • the human IgG4 Fc region comprises a F234A and L235A mutation.
  • the human IgG4 Fc region comprises one or more stabilizing mutations, including, but limited to, mutations in the IgG4 hinge that reduce or prevent the formation of disulfide bonds and in vivo fab arm exchange (FAE).
  • the human IgG4 Fc region comprises a S228P mutation.
  • the IgG4 hinge mutation is described in further detail in Angal et al. (Mol. Immunol. 1993; 30:105-108).
  • the human IgG4 Fc region comprises a S228P mutation and a L235A mutation.
  • the human IgGl Fc region comprises one or more mutations that alters antibody glycosylation.
  • the human IgGl Fc region comprises one or more of a S298N mutation, a T299A mutation, and a Y300S mutation. In certain embodiments, the human IgGl Fc region comprises a S298N mutation, a T299A mutation, and a Y300S mutation.
  • the Fc region amino acid positions referred to herein are based on EU antibody numbering.
  • the anti-FGFR3 antigen binding protein fragments of the disclosure comprise or consists of an antibody F(ab), F(ab')2, Fab'-SH, Fv, or scFv fragment.
  • the antigen binding protein fragment comprises an antibody F(ab) fragment.
  • the antibody F(ab) fragment can be modified with one or more serum half-life extending moieties.
  • the antibody F(ab) fragment is conjugated to an antigen binding protein with binding specificity to serum albumin.
  • the antigen binding protein with binding specificity to serum albumin is a nanobody.
  • the serum albumin is human serum albumin or mouse serum albumin.
  • the antibody F(ab) fragment comprises a heavy chain and a light chain.
  • the heavy chain of the F(ab) fragment comprises a heavy chain variable region disclosed herewith, and a light chain variable region disclosed herewith.
  • the heavy chain variable region comprises or consists of any one of SEQ ID NOs: 6, 8, 10, 12, 14, 16, 18, 20, 21, 22, 23, 28, 29, 30, 31, 56, 57, 58, 106, 107, 108, 109, 110, 111, 115, 116, 117, 118, 119, 120, 121, or 112, or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity to any of SEQ ID NOs: 6, 8, 10, 12, 14, 16, 18, 20, 21, 22, 23, 28, 29, 30, 31, 56, 57, 58, 106, 107, 108, 109, 110, 111, 115, 116, 117, 118, 119, 120, 121, or
  • the light chain variable region comprises or consists of any one of SEQ ID NOs: 7, 9, 11, 13, 15, 17, 19, 24, 25, 26, 27, 32, 33, 34, 35, 59, 60, 61, 112,
  • the heavy chain of the F(ab) fragment comprises or consists of a heavy chain variable region disclosed herewith and a heavy chain constant region.
  • the heavy chain constant region is derived from a human IgGl Fc region, a human IgG2 Fc region, a human IgG3 Fc region, a human IgG4 Fc region, or a combination thereof.
  • the heavy chain constant region is a fragment of a human IgGl Fc region, a human IgG2 Fc region, a human IgG3 Fc region, a human IgG4 Fc region, or a combination thereof.
  • the heavy chain constant region comprises or consists of the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 5, 36, 37, 38, 39, 40, 41, 44, 45, 46, 7, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115,
  • the light chain of the F(ab) fragment comprises or consists of a light chain variable region disclosed herewith, and a light chain constant region.
  • the light chain constant region is derived from a human kappa (K) chain, a human lambda (X) chain, or a combination thereof.
  • the light chain constant region comprises or consists of a part of IgGl light constant region.
  • the part of the IgGl light constant region comprises or consists of the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 5, 36, 37, 38, 39, 40, 41, 44, 45, 46, 7, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, or 107 ammo acids of SEQ ID NO: 55.
  • the F(ab) fragment comprises one or more point mutations in the C-terminus to reduce anti-Fab antibody binding.
  • the antigen binding protein comprises crossreactivity to one or both of mouse and cynomolgus FGFR3.
  • the cynomolgus FGFR3 is encoded by SEQ ID NO: 136: ATGGGCGCCCCTGCCTGCGCCCTCGCGCTCTGCGTGGCAGTGGCCATCGTGG CCGGCCTCCTCGGAGTCCTTGGGGACGGAGCAGCGCGTCGTGGGGCGAG TGGCAGAAGTGTCCGGCCCGGAGCCCAGCCAGCAGGAGCAGTTGGTCTTCG GCAGCGGGGACGCTGTGGAGCTGAGCTGTCCCCCGCCCGGGGGTGGTCCCA TGGGGCCCACTGTCTGGGTCAAGGATGGCGCAGGGCTGGTGCCCTCGGAGC GTGTCCTGGTGGGGCCCCAGCGGCTGCAGGTGCTGAATGCCTCCCACGAGGA CTCTGGGGCCTACAGCTGCCGGCAGCGGCTCACACAGCTCGTACTGTGCCAC TTCAGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
  • the cynomolgus FGFR3 is the IIIc isoform, comprising SEQ ID NO: 138, or its mutated version comprising the G380R mutation (SEQ ID NO: 139):
  • the antigen binding protein comprises binding specificity for FGFR3 isoform Illb and/or isoform IIIc.
  • the antigen binding protein specifically binds to FGFR3, and does not bind to one or more of FGFR1, FGFR2, and FGFR4, or does not have detectable binding to one or more of FGFR1, FGFR2, and FGFR4. In certain embodiments, the antigen binding protein does not bind to each of FGFR1, FGFR2, and FGFR4, or does not have detectable binding to each of FGFR1, FGFR2, and FGFR4. In certain embodiments, the antigen binding protein binds to each of FGFR1, FGFR2, and FGFR4 with an affinity of about 100 pM, 500 pM, 1000 pM, or greater. In certain embodiments, the antigen binding protein does not bind to one or more of FGFR1, FGFR2, and FGFR4 over a background measurement, as determined by a Biacore affinity analysis.
  • the antigen binding protein binds human F GFR3 with an equilibrium dissociation constant (KD) of about 100 nM or less, about 90 nM or less, about 80 nM or less, about 70 nM or less, about 60 nM or less, about 50 nM or less, about 40 nM or less, about 30 nM or less, about 20 nM or less, about 10 nM or less, about 9 nM or less, about 8 nM or less, about 7 nM or less, about 6 nM or less, about 5 nM or less, about 4 nM or less, about 3 nM or less, about 2.89 nM or less, about 2 nM or less, about 1.5 or less, about 1.4 or less, about 1.23 or less, about 1.2 or less, or about 1 nM or less, about 0.8 or less, or about 0.6 or less.
  • KD equilibrium dissociation constant
  • X nM or less therein includes the embodiment “less than X nM”. “Less” therein can mean e.g. to about 2.8 nM, to about 1.3 nM, to about 1.1 nM, to about 0.7 nM or to about 0.5 nM.
  • the nM values are as obtained by a Surface Plasmon Resonance assay, such as the Biacore assay.
  • the Biacore assay is carried out at about 4°C, 10°C, 15°C, 20°C, 25°C, 30°C, or 37°C.
  • the antigen binding protein binds human F GFR3 with an off rate (Kd) of aboutlO' 2 s' 1 or less, about 5x10' 3 s or less, about 2x1 O' 3 s or less, about 10' 3 s' 1 or less, about 9xl0 4 s' 1 or less, about 8xl0 4 s' 1 or less, about 7xl0 4 s' 1 or less, about 6xl0 4 s' 1 or less, about 5xl0 4 s or less, about 4xl0 s' 1 or less, or about 3.5xl0 4 s or less.
  • Kd off rate
  • “Less” therein can mean e.g. to about 3 xlO 4 s 4 .
  • “About X” therein can mean e.g. “X ⁇ 10%”, “X ⁇ 5%”, “X ⁇ 4%”, “X ⁇ 4%”, “X ⁇ 3%”, “X ⁇ 2%”, “X ⁇ l%” or “X ⁇ 0.5%”.
  • the antigen binding protein inhibits ligand- induced FGFR3 dimerization with IC50 of about 5 pg/ml or less, about 4 pg/ml or less, about 3 pg/ml or less, about 2 pg/ml or less, about 1 pg/ml or less, about 0.9 pg/ml or less, about 0.8 pg/ml or less, about 0.7 pg/ml or less, about 0.6 pg/ml or less, about 0.5 pg/ml or less, about 0.4 pg/ml or less, or about 0.3 pg/ml or less.
  • “Less” therein can mean e.g.
  • nM values are as obtained by a Homogenous Time-Resolved Fluorescence (HTRF) assay at about 4°C, 10°C, 15°C, 20°C, 25°C, 30°C, or 37°C.
  • HTRF Homogenous Time-Resolved Fluorescence
  • the antigen binding protein inhibits FGFR3 receptor activation and downstream signaling with IC50 of about 5 pg/ml or less, about 4 pg/ml or less, about 3 pg/ml or less, about 2 pg/ml or less, about 1 pg/ml or less, about 0.9 pg/ml or less, about 0.8 pg/ml or less, about 0.7 pg/ml or less, about 0.6 pg/ml or less, about 0.5 pg/ml or less, about 0.4 pg/ml or less, or about 0.3 pg/ml or less.
  • “Less” therein can mean e.g.
  • nM values are as obtained by a homogenous time-resolved fluorescence (HTRF) assay.
  • Inhibition of FGFR3 receptor activation and downstream signaling can be determined by any means known in the art. In certain embodiments, inhibition of FGFR3 receptor activation and downstream signaling is measured by determining Erk phosphorylation. A decrease in Erk phosphorylation indicates inhibition of FGFR3 activation. Erk phosphorylation can be determined using a homogenous time-resolved fluorescence (HTRF) assay. In certain embodiments, the assay is performed in chondrocytes. In certain embodiments, the assay is performed in mouse primary rib chondrocytes. [0223] In certain embodiments, the antigen binding protein inhibits the activity of an FGFR3 G380R mutant.
  • HTRF homogenous time-resolved fluorescence
  • the antigen binding protein inhibits the activity of a human FGFR3 G380R mutant, a mouse FGFR3 G380R mutant, and/or a cynomolgus FGFR3 G380R mutant.
  • the human FGFR3 G380R mutant is represented by the amino acid sequence set forth in SEQ ID NO: 133.
  • the antigen binding protein or fragment thereof is capable of penetrating a bone grow th plate.
  • the antigen binding protein or fragment thereof is capable of decreasing the binding of FGFR3 with its ligand in a bone growth plate.
  • the disclosure provides an antigen-binding protein or fragment thereof with binding specificity to a fibroblast growth factor receptor 3 (FGFR3) epitope, comprising an antibody heavy chain variable (VH) domain and an antibody light chain variable (VL) domain, wherein the antigen binding protein binds a human FGFR3 polypeptide comprising the amino acid sequence of SEQ ID NO: 134, recited below.
  • FGFR3 fibroblast growth factor receptor 3
  • the anti-FGFR3 antigen binding proteins and antigen-binding fragments thereof of the disclosure bind a human FGFR3 polypeptide comprising the ammo acid sequence of SEQ ID NO: 134, recited above.
  • the amino acid sequence recited above corresponds to the D2D3 region of FGFR3 isoform IIIc, specifically to amino acid D143 to E365 of FGFR3 isoform IIIc.
  • the anti-FGFR3 antigen binding proteins and antigen-binding fragments thereof of the disclosure bind an epitope of human FGFR3 polypeptide comprising the N-terminus of the D2 region (amino acids D143 to L163) of SEQ ID NO: 133, shown above.
  • the anti-FGFR3 antigen binding proteins and antigen-binding fragments thereof of the disclosure bind an epitope of human FGFR3 polypeptide comprising the N-terminus of the D2 region (amino acids D143 to N170) of SEQ ID NO: 133, shown above.
  • the anti-FGFR3 antigen binding proteins and antigen-binding fragments thereof of the disclosure bind an epitope of human FGFR3 polypeptide comprising the N-terminus and middle of the D2 region (amino acids D143 to D160 and G197 to L213) of SEQ ID NO: 133, shown above.
  • the one or more epitopes of the anti-FGFR3 antigen binding proteins and antigen-binding fragments thereof of the disclosure are determined by hydrogen deuterium exchange (HDX) mass spectrometry.
  • HDX is performed by measuring the amide hydrogen deuterium exchange on FGFR3 over time.
  • HDX mass spectrometry is described in further detail in Pradzinska et al. (Amino Acids. 48: 2809-2820. 2016).
  • the anti-FGFR3 antigen binding proteins and antigen-binding fragments thereof of the disclosure compete with a reference binding protein for binding to the human FGFR3 polypeptide D2 region.
  • the disclosure provides an antigen-binding protein or fragment thereof with binding specificity to a fibroblast growth factor receptor 3 (FGFR3) epitope, comprising an antibody heavy chain variable (VH) domain and an antibody light chain variable (VL) domain, wherein the antigen binding protein competes for binding to FGFR3 with an antibody comprising VH I VL domain amino acid sequence pairs selected from the group consisting of: SEQ ID NO: 6 I SEQ ID NO: 7, SEQ ID NO: 8 I SEQ ID NO: 9, SEQ ID NO: 10 / SEQ ID NO: 11, SEQ ID NO: 12 / SEQ ID NO: 13, SEQ ID NO: 14 1 SEQ ID NO: 15, and SEQ ID NO: 16 / SEQ ID NO: 17.
  • FGFR3 fibroblast growth factor receptor 3
  • binding proteins e.g., antigen-binding proteins and antigen-binding fragments thereof.
  • Methods of making binding proteins comprising expressing these polynucleotides are also provided.
  • Polynucleotides encoding the binding proteins disclosed herein are typically inserted in an expression vector for introduction into host cells that may be used to produce the desired quantity of the binding proteins. Accordingly, in certain aspects, the disclosure provides expression vectors comprising polynucleotides disclosed herein and host cells comprising these vectors and polynucleotides.
  • vectors used in accordance with the present disclosure as a vehicle for introducing into and expressing a desired gene in a cell.
  • vectors may readily be selected from the group consisting of plasmids, phages, viruses and retroviruses.
  • vectors compatible with the disclosure will comprise a selection marker, appropriate restriction sites to facilitate cloning of the desired gene and the ability to enter and/or replicate in eukaryotic or prokaryotic cells.
  • one class of vector utilizes DNA elements which are derived from animal viruses such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV or MOMLV), or SV40 vims.
  • animal viruses such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV or MOMLV), or SV40 vims.
  • Others involve the use of polycistronic systems with internal ribosome binding sites.
  • cells which have integrated the DNA into their chromosomes may be selected by introducing one or more markers which allow selection of transfected host cells.
  • the marker may provide for prototrophy to an auxotrophic host, biocide resistance (e.g., antibiotics) or resistance to heavy metals such as copper.
  • the selectable marker gene can either be directly linked to the DNA sequences to be expressed, or introduced into the same cell by co-transformation. Additional elements may also be needed for optimal synthesis of mRNA. These elements may include signal sequences, splice signals, as well as transcriptional promoters, enhancers, and termination signals.
  • the cloned variable region genes are inserted into an expression vector along with the heavy and light chain constant region genes (e.g., human constant region genes) synthesized as discussed above.
  • the binding proteins may be expressed using polycistronic constructs.
  • multiple gene products of interest such as heavy and light chains of antibodies may be produced from a single polycistronic construct.
  • IRES internal ribosome entry site
  • Compatible IRES sequences are disclosed in U.S. Pat. No. 6,193,980, which is incorporated by reference herein in its entrety for all purposes. Those skilled in the art will appreciate that such expression systems may be used to effectively produce the full range of polypeptides disclosed in the instant application.
  • the expression vector may be introduced into an appropriate host cell. That is, the host cells may be transformed.
  • Introduction of the plasmid into the host cell can be accomplished by various techniques well known to those of skill in the art. These include, but are not limited to, transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, cell fusion with enveloped DNA, microinjection, and infection with intact virus. See, Ridgway, A. A. G. “Mammalian Expression Vectors” Chapter 24.2, pp. 470- 472 Vectors, Rodriguez and Denhardt, Eds.
  • Plasmid introduction into the host can be by electroporation.
  • the transformed cells are grown under conditions appropriate to the production of the light chains and heavy chains, and assayed for heavy and/or light chain protein synthesis.
  • Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or fluorescence-activated cell sorter analysis (FACS), immunohistochemistry and the like.
  • transformation shall be used in a broad sense to refer to the introduction of DNA into a recipient host cell that changes the genotype.
  • host cells refers to cells that have been transformed with vectors constructed using recombinant DNA techniques and encoding at least one heterologous gene.
  • the terms “cell” and “cell culture” are used interchangeably to denote the source of antibody unless it is clearly specified otherwise.
  • recovery of polypeptide from the “cells” may mean either from spun down whole cells, from supernatant of lysed cells culture, or from the cell culture containing both the medium and the suspended cells.
  • a host cell line used for antibody expression is of mammalian origin. Those skilled in the art can determine particular host cell lines which are best suited for the desired gene product to be expressed therein. Exemplary host cell lines include, but are not limited to, DG44 and DUXB11 (Chinese Hamster Ovary lines, DHFR minus), HELA (human cervical carcinoma), CV-1 (monkey kidney line), COS (a derivative of CV-1 with SV40 T antigen), R1610 (Chinese hamster fibroblast) BALBC/3T3 (mouse fibroblast), HEK (human kidney line), SP2/0 (mouse myeloma), BFA-lclBPT (bovine endothelial cells), RAJI (human lymphocyte), 293 (human kidney).
  • DG44 and DUXB11 Choinese Hamster Ovary lines, DHFR minus
  • HELA human cervical carcinoma
  • CV-1 monkey kidney line
  • COS a derivative of CV-1 with SV
  • the cell line provides for altered glycosylation, e.g., afucosylation, of the antibody expressed therefrom (e.g., PER.C6® (Crucell) or FUT8-knock-out CHO cell lines (POTELLIGENT® cells) (Biowa, Princeton, N.J.)).
  • PER.C6® Crucell
  • FUT8-knock-out CHO cell lines POTELLIGENT® cells
  • NSO cells may be used.
  • CHO cells are particularly useful. Host cell lines are typically available from commercial services, e.g., the American Tissue Culture Collection, or from authors of published literature.
  • Genes encoding the binding proteins featured in the disclosure can also be expressed in non-mammalian cells such as bacteria or yeast or plant cells.
  • non-mammalian cells such as bacteria or yeast or plant cells.
  • various unicellular non-mammalian microorganisms such as bacteria can also be transformed, i.e., those capable of being grown in cultures or fermentation.
  • Bacteria which are susceptible to transformation, include members of the enterobacteriaceae, such as strains of Escherichia coli or Salmonella, Bacillaceae, such as Bacillus subtilis; Pneumococcus,' Streptococcus, and Haemophilus influenzae. It will further be appreciated that, when expressed in bacteria, the binding proteins can become part of inclusion bodies.
  • the binding proteins are then isolated, purified and assembled into functional molecules.
  • the binding proteins of the disclosure are expressed in a bacterial host cell.
  • the bacterial host cell is transformed with an expression vector comprising a nucleic acid molecule encoding a binding protein of the disclosure.
  • eukaryotic microbes may also be used. Saccharomyces cerevisiae, or common baker’s yeast, is the most commonly used among eukaryotic microbes, although a number of other strains are commonly available.
  • Saccharomyces cerevisiae or common baker’s yeast
  • yeast is the most commonly used among eukaryotic microbes, although a number of other strains are commonly available.
  • the plasmid YRp7 for example (Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al., Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980)), is commonly used.
  • This plasmid already contains the TRP1 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics, 85:12 (1977)).
  • the presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
  • binding proteins e.g., antigenbinding proteins and antigen-binding fragments thereof disclosed herein
  • the route of administration of the antigen binding proteins and antigenbinding fragments thereof of the current disclosure may be oral, parenteral, by inhalation or topical.
  • parenteral as used herein includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal or vaginal administration. While all these forms of administration are clearly contemplated as being within the scope of the current disclosure, a form for administration would be a solution for injection, e.g. for intravenous or intraarterial injection or drip.
  • a suitable pharmaceutical composition for injection may comprise a buffer, a surfactant, optionally a stabilizer agent, etc.
  • the modified antibodies can be delivered directly to the site of the adverse cellular population thereby increasing the exposure of the diseased tissue to the therapeutic agent.
  • Preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions, and emulsions.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Other common parenteral vehicles include sodium phosphate solutions, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers, such as those based on Ringer’s dextrose, and the like.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the composition must be sterile and should be fluid to the extent that syringability for injection exists. It should be stable under the conditions of manufacture and storage, and should also be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium. The proper fluidity can be maintained, for example, by the use of a coating, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents.
  • Isotonic agents for example, sugars, polyalcohols, may also be included in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • sterile injectable solutions can be prepared by incorporating an active compound (e.g., a modified binding protein by itself or in combination with other active agents) in a required amount in an appropriate solvent with one or a combination of ingredients enumerated, followed by filtered sterilization.
  • an active compound e.g., a modified binding protein by itself or in combination with other active agents
  • dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and any required other ingredients.
  • methods of preparation typically include vacuum drying and freeze-drying, which yield a powder of an active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the preparations for injections are processed, filled into containers such as ampoules, bags, bottles, syringes or vials, and sealed under aseptic conditions according to methods known in the art. Further, the preparations may be packaged and sold in the form of a kit.
  • Effective doses of the compositions of the present disclosure, for the treatment of a disease or disorder vary depending upon many different factors, including means of administration, target site, physiological state of the subject, whether the subject is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic.
  • the patient is a human, but non-human mammals including transgenic mammals can also be treated. Treatment dosages may be titrated to optimize safety and efficacy.
  • Binding proteins described herein can be administered on multiple occasions. Intervals between single dosages can be weekly, monthly or yearly. Intervals can also be irregular as indicated by measuring levels of binding protein or antigen in the subject. Alternatively, binding proteins can be administered as a sustained release formulation, in which case less frequent administration is required.
  • dosage and frequency vary depending on the half-life of the antibody in the patient. In general, humanized antibodies show the longest half-life, followed by chimeric antibodies and nonhuman antibodies.
  • the dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic.
  • compositions containing the present binding protein are administered to a subject not already in the disease state to enhance the subject's resistance.
  • a prophylactic treatment is understood as a method of preventing or alleviating one or more symptoms of the disorder.
  • a prophylactic treatment is understood as a method of preventing the happening of cancer, or alleviating one or more symptoms of the cancer.
  • Such an amount is defined to be a “prophylactic effective dose.”
  • the precise amounts again depend upon the subject's state of health and general immunity.
  • a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, or until the patient shows partial or complete amelioration of disease symptoms. Thereafter, the patient can be administered a prophylactic regime.
  • Binding proteins described herein can optionally be administered in combination with other agents that are effective in treating the disorder or condition in need of treatment (e.g., prophylactic or therapeutic).
  • binding proteins may be administered as described immediately above, it must be emphasized that in other embodiments binding proteins may be administered to otherwise healthy subjects as a first line therapy. In such embodiments the binding proteins may be administered to subjects that have not, and are not, undergoing one or more other therapies, or subjects that have, or are undergoing one or more other therapies.
  • the administration of binding proteins, e.g. antibodies or fragments thereof, in conjunction or combination with an adjunct therapy means the sequential, simultaneous, coextensive, concurrent, concomitant, or contemporaneous administration or application of the therapy and the disclosed binding proteins.
  • the administration or application of the various components of the combined therapeutic regimen may be timed to enhance the overall effectiveness of the treatment.
  • the binding proteins of the present disclosure may be administered in a pharmaceutically effective amount for the in vivo treatment of mammalian disorders.
  • compositions in accordance with the present disclosure typically include a pharmaceutically acceptable, non-toxic, sterile carrier such as physiological saline, buffers, preservatives and the like.
  • a pharmaceutically effective amount of the binding protein that, shall be held to mean an amount sufficient to achieve effective binding to an antigen and to achieve a benefit, e.g., to ameliorate symptoms of a disease or disorder.
  • the pharmaceutical compositions of the present disclosure may be administered in single or multiple doses to provide for a pharmaceutically effective amount of the antigen-binding protein or antigen-binding fragment thereof.
  • the antigen-binding protein or antigen-binding fragment thereof may be administered to a human or other animal in accordance with the methods of treatment herein in an amount sufficient to produce a therapeutic or prophylactic effect.
  • the binding proteins of the disclosure can be administered to such human or other animal in a conventional dosage form prepared by combining the binding protein with a conventional pharmaceutically acceptable earner or diluent according to known techniques.
  • the form and character of the pharmaceutically acceptable carrier or diluent is dictated by the amount of active ingredient with which it is to be combined, the route of administration and other well-known variables.
  • a cocktail comprising one or more species of binding proteins described in the cunent disclosure may prove to be particularly effective.
  • FGFR3-mediated diseases or disorders refers to any disease or disorder that is the result of aberrant FGFR3 activity.
  • the disease or disorder is caused by FGFR3 over activity or over expression.
  • Non-limiting examples of FGFR3-mediated diseases or disorders include achondroplasia, hypochondroplasia, and cancer.
  • the anti-FGFR3 antigen binding proteins or fragments thereof are useful for the reduction of FGFR3 activity.
  • an “FGFR3 activity” refers to any signaling event associated with the dimerization of FGFR3 on the surface of a cell.
  • the FGFR3 activity can be one or both of an extracellular activity and an intracellular activity.
  • FGFR3 activities include, but are not limited to, FGFR3 dimerization, extracellular signal- regulated kinase (Erk) phosphorylation, mitogen-activated protein kinase kinase (MKK, MEK, or MAP2K) phosphorylation, FGFR3 cytoplasmic tyrosine kinase domain activity, and FGF ligand binding activity (e.g., FGF18 binding to FGFR3).
  • Erk extracellular signal- regulated kinase
  • MKK mitogen-activated protein kinase kinase
  • MEK mitogen-activated protein kinase kinase
  • MAP2K MAP2K
  • achondroplasia refers to a genetic disorder caused by mutations in the FGFR3 gene that make the resulting protein overactive.
  • the anti-FGFR3 antigen binding proteins or fragments thereof are useful for the reduction of one or more symptoms of achondroplasia.
  • Achondroplasia symptoms include, but are not limited to, shortening of the proximal limbs, brachydactyly (i.e., short fingers and toes with trident hands), large head with prominent forehead frontal bossing, small midface with a flattened nasal bridge, spinal kyphosis (convex curvature) or lordosis (concave curvature), varus (i.e., bowleg) or valgus (i.e., knock knee, ear infections (due to Eustachian tube blockages)), sleep apnea (central or obstructive), and hydrocephalus.
  • Achondroplasia may be diagnosed through the measurement of one or more of proximal limb length (e.g., femur and tibia length), finger and toe length, head circumference (e.g., skull length), and lumbar vertebrae length, although other anatomical measurements can be employed.
  • proximal limb length e.g., femur and tibia length
  • finger and toe length e.g., finger and toe length
  • head circumference e.g., skull length
  • lumbar vertebrae length e.g., lumbar vertebrae length
  • the disclosure provides a method for treating a FGFR3- mediated disease or disorder in a subject, comprising administering to a subject in need thereof the antigen binding protein or fragment thereof described herein.
  • the term “subject,” “patient,” or “individual” refers to a human or non-human animal.
  • the term “non-human animal” includes, but is not limited to, vertebrates such as non-human primates, sheep, dogs, cats, rabbits, ferrets, rodents such as mice, rats and guinea pigs, avian species (e.g., chickens), amphibians, and reptiles.
  • the subject is a mammal such as a non-human primate, sheep, dog, cat, rabbit, ferret or rodent.
  • the subject is a cynomolgus monkey.
  • the subject is a human.
  • the subject is a child.
  • the subject is an adolescent.
  • the FGFR3 -mediated disease or disorder is achondroplasia.
  • the achondroplasia is FGFR3 G380R+ achondroplasia, meaning the subject to be treated contains the G380R mutation in its FGFR3 gene, either homozygous or heterozygous.
  • a subject diagnosed as having achondroplasia or risk of achondroplasia is treated with a binding protein disclosed herewith.
  • the treatment leads to one or more effects selected from the group consisting of increased bone length (e.g., femur length and/or tibia length), increased bone diameter (e.g., femur diameter), increased growth plate volume (e.g., femur growth plate volume), increased vertebrae length, increased skull length, increased bone volume, increased skull volume, corrected vertebral abnormalities (e.g., increased Kyphosis Index), and improved bone age (e.g., more developed secondary ossification center), as compared to a control subject not receiving the treatment that is of the same development stage.
  • increased bone length e.g., femur length and/or tibia length
  • increased bone diameter e.g., femur diameter
  • increased growth plate volume e.g., femur growth plate volume
  • corrected vertebral abnormalities e.g.
  • a method of improving one or more bone features in a subject comprises administrating a binding protein or an antigen-binding fragment thereof disclosed herewith to a subject in need.
  • the improved bone feature is selected from the group consisting of bone length (e.g., femur length or tibia length), bone diameter (e.g., femur diameter), growth plate volume, vertebrae length, skull length, bone volume, skull volume, Kyphosis Index, and improved bone age.
  • the FGFR3 -mediated disease or disorder is cancer.
  • the cancer is selected from the group consisting of bladder cancer, melanoma, urothelial cancer, and endometrial cancer.
  • the disclosure provides a method for treating achondroplasia in a subject, comprising administering to a subject in need thereof an antigen binding protein or an antigen-binding fragment thereof with binding specificity to an FGFR3 epitope, wherein the antigen binding protein or the antigen binding fragment thereof does not bind to one or more of FGFR1, FGFR2, and FGFR4.
  • the disclosure provides a method for inhibiting one or both of FGFR3 activity and expression in a bone growth plate of a subject, comprising administering to a subject an antigen binding protein or an antigen binding fragment thereof with binding specificity to an FGFR3 epitope, wherein the antigen binding protein fragment does not bind to one or more of FGFR1, FGFR2, and FGFR4.
  • an FGFR3 antibody as described herewith is used.
  • the disclosure provides therapeutic uses of its binding proteins or an antigen binding protein fragment thereof with binding specificity to an FGFR3 epitope, wherein the antigen binding protein fragment does not bind to one or more of FGFR1, FGFR2, and FGFR4) corresponding to the methods of treatment disclosed above.
  • the disclosure provides a binding protein or the antigen binding protein fragment thereof as described herein for use in medicine.
  • it provides a binding protein, or an antigen binding protein fragment thereof as described herein for use as an FGFR3 -activity inhibiting medicament.
  • it provides a binding protein, or an antigen binding protein fragment thereof as described herein for use in treating an FGFR3 -mediated disorder. Examples of such disorders are given herein.
  • it provides a binding protein, or antigen binding protein fragment thereof as described herein for use in preventing one or more symptoms of achondroplasia, as exemplified above. In some embodiments, it provides a binding protein, or antigen binding protein fragment thereof as described herein for use in preventing cancer, as exemplified above.
  • a binding protein, or antigen binding protein fragment thereof as described herein for use in preventing cancer as exemplified above.
  • Embodiments described herein regarding methods of treatment, administration, subjects and all other aspects relevant to therapy and prevention also apply to these uses of binding proteins.
  • Anti-FGFR3 monoclonal antibodies were developed using 300.19 pre-B lymphoblast cells (ATCC, Manassas, VA) transformed with DNA encoding full-length human FGFR3 (see Fig. 1, GenBank ID NP 000133.1, FGFR3 isoform IIIc) with the mutation G380R (SEQ ID NO: 133) which was expressed on the cell surface (FGFR3 G380R -300.19 cell).
  • the FGFR3 G380R open reading frame was subcloned into the pXL-MCS vector and transfected into 300.19 cells (Immunogen 1).
  • DNA encoding the human FGFR3 extra cellular domain (ECD) protein (Immunogen 2) was subcloned into the pTT5 vector (Invitrogen), and was prepared using Expi293 cells (Invitrogen).
  • FGFR3 extra cellular domain (ECD) protein (Immunogen 2):
  • FGFR3 expression on FGFR3 G380R - 300.19 cells was monitored and quantified by FACS analysis using the comparator antibody, GT184.6. 1, described further in Yin et al. (Mol. Cancer Ther. 14(10): 2270-8. 2015).
  • Anti-FGFRl (MAB765), anti- FGFR2 (MAB6843), anti-FGFR3 (MAB766), and anti-FGFR4 (MAB6852) antibodies were used as negative controls (R&D Systems, Minneapolis, MN).
  • the FGFR3 ECD protein was quantified using an enzyme-linked immunosorbent assay (ELISA) with the antibodies described further below.
  • the cells expressing FGFR3 were maintained at 37 °C under 5% CO2 in RPMI (Gibco) supplemented with heat inactivated fetal bovine serum (FBS) (Hyclone).
  • FBS heat inactivated fetal bovine serum
  • Cells were prepared for injection by substituting the above culture medium with phosphate buffered (Ca-Mg free) saline (CMF-PBS) supplemented with 5 mM EDTA and harvesting the cells in that buffer.
  • the harvested cells were pelleted by centrifugation at 500 x g for 5 minutes, washed once by resuspending the pellet in CMF-PBS and centrifuging as before, counted and adjusted to the appropriate volume (such as 5 x 10 6 cells in 0.2 ml) for injection by resuspending the cell pellet in CMF-PBS.
  • the FGFR3 ECD protein was used to boost antibody titers in animals before sacrificing the mouse.
  • mice Six eight-week old female FGFR3 KO (C57BL/6 mFGFR3 ‘) mice from the Jackson Laboratory (Bar Harbor, ME) were immunized with the FGFR3-transfected cells (Immunogen 1). Separately, wild-type Balb/c mice were immunized with the FGFR3 ECD protein described above (Immunogen 2). A group of mice were primed intraperitoneally on day 0 with FGFR3 -expressing cells, FGFR3 G380R - 300.19 cells, in PBS without adjuvants, administrated on days 14, 28, 42 and 56, followed by an intraperitoneal boost on day 77 with the FGFR3 ECD protein in PBS without adjuvants.
  • Each injection was administrated with approximately 5 x 10 6 cells in a volume of 200 pl and 50 pg protein in a volume of 100 pl PBS. Immunizations were performed in two- week intervals and the IgG titer was evaluated by ELISA with FGFR3 ECD protein to assess immune response.
  • mice were sacrificed for harvesting the spleen and placed in approximately 10 ml of pre-warmed serum-free DMEM (Hyclone) at 37 °C in a petri dish.
  • the splenocytes were teased out of the capsule using forceps and transferred to a 15-ml conical tube.
  • the cells were then washed three times with pre-warmed serum-free IMDM (Hyclone) and cells from multiple mice were pooled.
  • F0 B lymphoblasts ATCC, Manassas, VA
  • HAT hypoxanthine/aminopterin/thymidine
  • IgG IgG non-secreting myeloma cell line.
  • F0 B lymphoblasts Prior to the fusion, F0 B lymphoblasts were maintained in IMDM medium supplemented with 10% FBS (37 °C, 7% CO2) ensuring that the cells were in logarithmic growth phase on the day of the fusion.
  • the fusion protocol was derived from Lemer (Yale J Biol Med, 1981, 54 (5) 387-402) and Gefter et al. (Somatic Cell Genet, 1977, 3 (2) 231-236). Before the fusion, the spleen cells and the logarithmic phase myeloma cells were washed three times with serum-free IMDM and counted. For each fusion, 1-1.5 x 10 8 spleen cells were mixed with 2-3 x 10 7 myeloma cells in a 50-ml conical polypropylene tube and cells were washed once with serum-free IMDM. The ratio of spleen cells to myeloma cells was 5:1.
  • the tubes w ere centrifuged at 500 x g for 10 minutes to pellet the cells. After aspiration of the supernatant, the pellets were gently resuspended by tapping the bottom of the tubes. The tubes were then placed in a beaker of 37 °C water. All subsequent fusion steps were earned out in the beaker of 37 °C water.
  • the pellet was resuspended in 200 ml of filtered complete hybridoma production media, IMDM (Hyclone) supplemented with 10% FBS (Hyclone), lx non-essential amino acid (Gibco), 1 mM sodium pyruvate (Gibco), lx pen-strep (Gibco) and IX HAT (Sigma).
  • IMDM Hyclone
  • FBS Hyclone
  • lx non-essential amino acid Gibco
  • 1 mM sodium pyruvate Gibco
  • lx pen-strep Gibco
  • IX HAT IX HAT
  • a primary hybridoma screen was designed to select hybridoma clones producing antibodies which recognized native FGFR3 epitopes.
  • Antibody binding was detected by FACS using a fluorescently labeled goat anti -mouse secondary antibody.
  • Clones were considered positive if labeled supernatant samples were greater than 10-fold over background in the FACS analysis. Selected positive clones were transferred to 24- well flat bottom plates and expanded for a second screen to confirm selection.
  • FGFR family member proteins human FGFRla Illb, FGFRla IIIc, FGFRip Illb, FGFRip IIIc, FGFR2a IIIc, FGFR2P Illb, FGFR3 Illb, FGFR3 IIIc, FGFR4; mouse FGFR3; and cynomolgus FGFR3 recombinant proteins
  • R&D Systems Meapolis, MN
  • cDNA encoding the following proteins were all subcloned into the pTT5 vector (Invitrogen): partial ECD and chimeric ECD proteins of FGFR3; human D2D3 (hD2D3) and D3 (hD3) of human FGFR3; mouse D2D3 (mD2D3) and D3 (mD3) of mouse FGFR3; cynomolgus D2D3 (cyD2D3) and D3 (cyD3) of cynomolgus FGFR3; and hDl-cyD2D3 and hDl-mD2D3 recombinant proteins.
  • Proteins were prepared by transient transfection using Lipofectamine 2000 (Invitrogen) in Expi293 cells (Invitrogen). Supernatants from the selected clones were incubated in 96-well plates coated with the recombinant FGFR proteins and detected with goat anti-mouse IgG horseradish peroxidase (Jackson Immunoresearch, West Grove, PA) followed by chemiluminescent detection.
  • Cell based-binding assays for anti-FGFR3 antibodies [0286] Cell based-binding assays for anti-FGFR3 antibodies [0287] A cell-based binding assay was used to charactenze the anti-FGFR3 antibodies generated above. Full-length human, mouse, and cynomolgus FGFR3 cDNAs were subcloned into different pcDNA 3.1 (Invitrogen) vectors and transfected into 300.19 cells (ATCC). The cDNA of FGFR3 Ig domains D2D3 was subcloned into pcDNA 3.1 and transfected into CHO (D2D3-CHO) (ATCC) cells.
  • FGFR3 G380R , mouse FGFR3, and cynomolgus FGFR3 G380R CDNAS were also subcloned into different pcDNA 3.1 vectors.
  • Stable cell lines expressing FGFR3 were generated by transfection of human FGFR3 G380R , mouse FGFR3, and cynomolgus FGFR3 G380R CDNA plasmid constructs into CHO (hFGFR3 G380R - CHO and cyFGFR3 G380R - CHO) and human embryonic kidney (HEK, mFGFR3-HEK) (ATCC) cells using the Lipofectamine 2000 kit (Invitrogen).
  • the N-terminal ECD proteins of FGFR3 from human and mouse were produced with a terminal avidin tag and used in a forward format Biacore assay where proteins were immobilized on a Biacore chip and then the kinetics of antibody interaction with the proteins on the chip were determined.
  • the proteins were immobilized on a Biacore chip for approximately 10,000 response units (RU).
  • the antibodies were exposed to the chip for kinetic measurements, following the manufacturer’s recommendations (GE Healthcare).
  • Sensorgrams were fit to a 1: 1 binding model and analyzed using double-reference subtraction by T200 Evaluation software (GE Healthcare). Affinities of the tested antibodies are shown in Table 2.
  • the isotype of each clone was determined using the IsoStrip Mouse Monoclonal Antibody Isotyping Kit (Roche Applied Science, Indianapolis, IN).
  • the heavy (VH) and light (VL) chain variable regions of clones were sequenced using 5 ’RACE (Rapid Amplification of cDNA Ends) Kit (Clontech, Mountain View, CA) as per the manufacturer’s instruction.
  • Total RNA was extracted from each hybridoma clone using the RNeasy Miniprep kit according to the manufacturer’s instructions (Qiagen, Germantown, MD).
  • VH and VL genes were amplified by TA cloning kit (Invitrogen) with primers, 5’primer (5’RACE kit, Clontech), and 3’ primer of IgG isotype specific heavy chain and 3 ’primer of kappa light chain.
  • IgG2b 3’ Primer: 5’- GTTAGGAGCTGGGCATTTGTGACACTCC - 3’ (SEQ ID NO: 2)
  • IgG3 3’ Primer: 5 - GTTTGGTGGGCATGAAGAACCCGGGG - 3’ (SEQ ID NO: 4)
  • the amplified cDNAs were cloned into pCR2.1 vectors (Invitrogen) and transformed using a TOPO-TA cloning kit (Invitrogen) as per the manufacturer’s instructions. Plasmids were isolated from 2 ml of an LB culture, inoculated from a single colony and grown overnight, using QIAprep spin miniprep kit (Qiagen) and sequenced using Ml 3 Forward and Ml 3 Reverse primers included in the TOPO-TA cloning kit (Invitrogen). The VH and VL gene sequences were analyzed using the IMGT V-Quest web server to identify and confirm variable region sequences. VH and VL sequences of each antibody are provided below in Table 3:
  • an FGF1 ligand blocking assay was conducted.
  • human FGFR3 cells, FGFR3-300.19 and FGFR3 G38 ° R -300.19 were preincubated with various concentration of anti-FGFR3 antibodies and isotype controls, prior to addition of human FGF1 ligand (R&D Systems).
  • Binding of hFGFl to FGFR3 expressed on the cells was determined by FACS assay using biotinylated anti-FGFl antibody followed by incubation with a streptavidin-fluorescent secondary antibody.
  • the anti-FGFR3 antibodies which bound to the EC domain including KC18, KE35, KE42, KE58, KE63, and KE94, all blocked binding of FGF1 to FGFR3 on these cells.
  • the Abl surface was regenerated between cycles using 10 mM glycine-HCl (pH 2.0) at 50 pl/min for 1 minutes. Sensorgrams were fit to a 1 : 1 binding model and analyzed using double-reference subtraction by BiaEvaluation software (GE Healthcare). It was determined that anti-FGFR3 antibodies KC18, KE35, KE42, KE58, KE63, and KE94 competed for the same region on FGFR3 around the D2 domain.
  • HDX mass spectrometry was also used to determine the epitopes on FGFR3 for these antibodies by measuring the amide hydrogen deuterium exchange on FGFR3.
  • HDX mass spectrometry measured amide hydrogen deuterium exchange over time and quenched at 0 °C and pH 2.5 along with protease digestion. Briefly, the antibody to be tested and antigen were mixed such that about 90% of the antibody is bound to the antigen at room temperature. Deuterium exchange was performed with a 10-fold dilution into DzO at neutral pH. Quenching was then performed by holding the reaction mixture for 1 minute at about 0 to 1 °C to reduce disulfide bonds.
  • KE35 and KE58 bind to the N-terminus of the D2 region (D143 to L163); KE42 binds to N-terminus of the D2 region (D143 to N170); while KC18, KE94, and KE63 bind to N-terminus and middle of the D2 region (D143 to D160 and G197 to L213).
  • KMS-11 cells JCRB cell bank, Japan.
  • the KMS-11 cells were incubated with each antibody at a final concentration of 2 pg/ml for 30 minutes, 1, 2, 5, and 24 hours, then placed at 4 °C before washing the cells with PBS (Ca 2+ and Mg 2+ ).
  • PBS Ca 2+ and Mg 2+
  • a subset of samples was washed with glycine-HCl buffer (pH 4) and fixed with 4% paraformaldehyde (Sigma).
  • Another subset of samples was permeabilized with Triton X-100 (Sigma).
  • the cells were pre-incubated with anti-FGFR3 antibodies at vanous concentrations before addition of FGF18 ligand to induce dimerization of FGFR3 proteins, then incubated at 37 °C overnight.
  • the substrate was added to the cells and chemiluminescent signal was measured by EnVision (PerkinElmer). Blocking of FGFR3 dimerization by anti-FGFR3 antibodies was observed (Fig. 5A - Fig. 5C).
  • Heavy chain of KC18_Hrwl-3 and _HV1.69rw2-4, and light chain of KC18_Lrwl-3 were designed by the method described above. Further analysis to introduce back-mutations, stabilizing mutations and to eliminate other unwanted motifs, additional heavy and light chains of KC18 variants were identified KC18 VH1, VHlb-c, VH2-3, VH3b-c and VH4, and KC18 VL1, VLlb-d, VL2, VL3, VL3b, VL4, VL5 and VL6, respectively. Heavy chains KE63 VH1-6 and light chains KE63_VLl-4 were designed.
  • KE63_VH1 and KE63_VL1 humanized constructs were designed, then further modifications to the heavy and light chain were designed (KE63 VH2-6 and KE63 VL2-4) to introduce back-mutations, stabilizing mutations and to eliminate other unwanted motifs. Similar methods were also used to design KE94 humanized constructs KE94_VHl-6. Notably, KE63 and KE94 share the same set of VL designs, namely KE63_VLl-4 here. Tables 5, 6, and 7 indicate the strategy used to pair the heavy and light chain variants for KC18, KE63 and KE94, respectively, including the human and mouse germline identify percentage.
  • Humanized antibodies KC 18_Hu42 to KC 18_49 were designed based on the sequence of KC_Hul8 to further remove liability sites, such as oxidation sites in FRWH3 and CDRH3, a deamidation site in CDRL1, and an oxidation site in CDRL2 (Table 11).
  • two additional variants each for VH and VL were designed, which resulted in 8 more variants (KC18_Hu42-49) in addition to KC18_Hul8 (Table 12).
  • an anti-FGFR3 F(ab) fragment of the present application comprises a heavy chain of Table 15, and a light chain in Table 16.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 141, 164, 173, 182, 191, 200, 209, 218, 227, 236, 245, 254, 263, 272, or 281, and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 142.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 143, 165, 174, 183, 192, 201, 210,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 144.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 145, 166, 175, 184, 193, 202, 211,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 146.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 147, 167, 176, 185, 194, 203, 212,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 148.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 149, 168, 177, 186, 195, 204, 213,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 150.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 151, 169, 178, 187, 196, 205, 214,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 152.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 153, 170, 179, 188, 197, 206, 215,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 153, 170, 179, 188, 197, 206, 215, 224, 233, 242, 251, 260, 269, 278, or 287, and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 154.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 153, 170, 179, 188, 197, 206, 215,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 69.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 155, 171, 180, 189, 198, 207, 216,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 155, 171, 180, 189, 198, 207, 216, 225, 234, 243, 252, 261, 270, 279, or 288, and the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 154.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 155, 171, 180, 189, 198, 207, 216,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 69.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 156, 172, 181, 190, 199, 208, 217,
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 67.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 156, 172, 181, 190, 199, 208, 217, 226, 235, 244, 253, 262, 271, 280, or 289
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 154.
  • the antibody F(ab) fragment heavy chain comprises the amino acid sequence of SEQ ID NO: 156, 172, 181, 190, 199, 208, 217, 226, 235, 244, 253, 262, 271, 280, or 289
  • the antibody F(ab) fragment light chain comprises the amino acid sequence of SEQ ID NO: 69.
  • Antibodies were screened for binding and specificity to FGFR3. Activity was assessed using a Homogenous Time-Resolved Fluorescence (HTRF) assay to evaluate the level of inhibition on Erk phosphorylation using mouse primary rib chondrocytes. Briefly, primary mouse rib chondrocyte cells isolated from the achondroplasia mouse model were pretreated for 2 hours with anti-FGFR3 antibodies with a concentration ranging from 0.016 pg/ml to 100 pg/ml. Cells were then stimulated with FGF18 for 5 minutes.
  • HTRF Homogenous Time-Resolved Fluorescence
  • KC18 mouse antibody in various formats including full-length antibody (IgG), Fab, a one-armed, monovalent antibody (MetMab), and pegylated (PEG) Fab fragment were tested in the HTRF assay and compared to isotype control (Iso). Also, KC18 Fab with half-life extension using a human albumin nanobody (KC18 Fab-HLE) was tested, with and without human serum albumin (HSA) or mouse serum albumin (MSA).
  • the full-length KC 18 mouse antibody has a heavy chain of SEQ ID NO: 291 (with mIgG2a Fc sequence), and a light chain of SEQ ID NO: 292.
  • the KC18 mouse Fab antibody has a heavy chain of SEQ ID NO: 293, and a light chain of SEQ ID NO: 294.
  • Humanized FGFR3 antibodies including Hui 8, Hu44, and Hu46, were also tested in the HTRF assay, and found to inhibit Erk phosphorylation (Fig. 11). The IC50S of these humanized antibodies were determined, as well (Fig. 8A to Fig. 8C, respectively).
  • achondroplasia mouse model (Ach) was used.
  • the achondroplasia mouse is a transgenic mouse that overexpresses the mouse FGFR3 protein having the G380R mutation under control of the collagen II promoter (Shazeeb et al., (2016) Sci Rep 8, 469).
  • the mice were genotyped at 1 day of age, and randomized to either a control (i.e., saline) group or an antibody dosed group.
  • Achondroplasia mice (G380R) received a daily dose subcutaneously (SC) from 3 days of age to 20 days of age. The mice were then euthanized, and bones were collected at 21 days of age for microCT analysis.
  • SC subcutaneously
  • Ach mice treated with KC18 Fab also had several improved bone parameters, including femur growth plate volume, and femur diameter (Fig. 16A and Fig. 16B). Ach mice treated with KC18 Fab also had improved bone age as shown by more developed secondary ossification center in tibia (Fig. 17) compared to those treated with vehicle.
  • achondroplasia is the most common form of dwarfism due to activating mutations in the FGFR3 gene.
  • FGFR3 protein is expressed in the growth plate and its function is to regulate proper growth.
  • the activating mutations lead to excessive inhibition of chondrocyte proliferation and differentiation which is the main cause for the short stature and other skeletal deformities.
  • the antibodies generated herein are specific to FGFR3 and inhibit FGFR3 activity.
  • the mechanism of action of the antibody is to inhibit ligand binding and prevent activation of the receptor.
  • the antibodies described herein can block ligand activation and subsequently inhibit downstream signaling measured by the decrease in Erk phosphorylation. This translates into inhibition of receptor activity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Physical Education & Sports Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Rheumatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US2021/046958 2020-08-21 2021-08-20 Fgfr3 antibodies and methods of use Ceased WO2022040560A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
BR112023002455A BR112023002455A2 (pt) 2020-08-21 2021-08-20 Anticorpos fgfr3 e métodos de uso
IL300623A IL300623A (en) 2020-08-21 2021-08-20 Anti-FGFR3 antibodies and methods of use
EP21770357.8A EP4200019A1 (en) 2020-08-21 2021-08-20 Fgfr3 antibodies and methods of use
KR1020237009493A KR20230052963A (ko) 2020-08-21 2021-08-20 Fgfr3 항체 및 사용 방법
CA3189470A CA3189470A1 (en) 2020-08-21 2021-08-20 Fgfr3 antibodies and methods of use
CN202180051281.1A CN116323666A (zh) 2020-08-21 2021-08-20 Fgfr3抗体和使用方法
JP2023512280A JP2023538098A (ja) 2020-08-21 2021-08-20 Fgfr3抗体および使用の方法
MX2023002106A MX2023002106A (es) 2020-08-21 2021-08-20 Anticuerpos fgfr3 y metodos de uso.
AU2021327387A AU2021327387A1 (en) 2020-08-21 2021-08-20 Fgfr3 antibodies and methods of use
CONC2023/0001559A CO2023001559A2 (es) 2020-08-21 2023-02-14 Anticuerpos fgfr3 y métodos de uso

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063068575P 2020-08-21 2020-08-21
US63/068,575 2020-08-21

Publications (1)

Publication Number Publication Date
WO2022040560A1 true WO2022040560A1 (en) 2022-02-24

Family

ID=77774991

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/046958 Ceased WO2022040560A1 (en) 2020-08-21 2021-08-20 Fgfr3 antibodies and methods of use

Country Status (14)

Country Link
US (2) US11505611B2 (enExample)
EP (1) EP4200019A1 (enExample)
JP (1) JP2023538098A (enExample)
KR (1) KR20230052963A (enExample)
CN (1) CN116323666A (enExample)
AR (1) AR123306A1 (enExample)
AU (1) AU2021327387A1 (enExample)
BR (1) BR112023002455A2 (enExample)
CA (1) CA3189470A1 (enExample)
CO (1) CO2023001559A2 (enExample)
IL (1) IL300623A (enExample)
MX (1) MX2023002106A (enExample)
TW (1) TW202229343A (enExample)
WO (1) WO2022040560A1 (enExample)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024104922A1 (en) 2022-11-14 2024-05-23 Ascendis Pharma Growth Disorders A/S Method of improving skeletal muscle function
WO2024107759A3 (en) * 2022-11-14 2024-06-27 Regeneron Pharmaceuticals, Inc. Anti-fgfr3 antibodies and antigen-binding fragments and methods of use thereof
WO2024152014A1 (en) 2023-01-13 2024-07-18 Regeneron Pharmaceuticals, Inc. Fgfr3 binding molecules and methods of use thereof
WO2024194300A1 (en) 2023-03-20 2024-09-26 Ascendis Pharma Growth Disorders A/S Method of treatment of a thoracolumbar deformity in a human subject with achondroplasia
WO2025240335A1 (en) 2024-05-13 2025-11-20 Regeneron Pharmaceuticals, Inc. Fgfr3 binding molecules and methods of use thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025207944A1 (en) * 2024-03-29 2025-10-02 Sidewinder Therapeutics, Inc. Fgfr3-iiib-binding antibodies

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6193980B1 (en) 1995-12-06 2001-02-27 Cambridge University Technical Services, Limited Replication defective herpes simplex virus comprising heterologous inserts
EP1423428A2 (en) * 2001-06-20 2004-06-02 ProChon Biotech Ltd. Antibodies that block receptor protein tyrosine kinase activation, methods of screening for and uses thereof
US20100003258A1 (en) * 2008-07-01 2010-01-07 Zhigang Weng Fibroblast growth factor receptor 3 (fgfr3) binding proteins
EP2679600A1 (en) * 2009-03-25 2014-01-01 Genentech, Inc. Anti-FGFR3 antibodies and methods using same

Family Cites Families (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
HU215581B (hu) 1989-07-06 1999-01-28 Regents Of The University Of California Eljárás fibroblaszt növekedési faktor receptorok előállítására és terápiás alkalmazására
WO1994000599A2 (en) 1992-06-18 1994-01-06 Whittier Institute For Diabetes And Endocrinology Process for detection of neoplastic disease
AU6446194A (en) 1993-03-17 1994-10-11 Whittier Institute For Diabetes And Endocrinology, The Monoclonal antibodies specific for fibroblast growth factor receptors, immunotoxins, and use thereof
US6517872B1 (en) 1995-06-12 2003-02-11 Yeda Research And Development Co., Ltd. FGFR3 as a marker for mesenchymal skeletal progenitor cells
ZA200007412B (en) 1998-05-15 2002-03-12 Imclone Systems Inc Treatment of human tumors with radiation and inhibitors of growth factor receptor tyrosine kinases.
US20030143676A1 (en) 1999-03-25 2003-07-31 Genesis Research And Development Corporation Limited Fibroblast growth factor receptors and methods for their use
US7135311B1 (en) 1999-05-05 2006-11-14 Institut Curie Means for detecting and treating pathologies linked to FGFR3
AU5214500A (en) 1999-05-05 2000-11-21 Centre National De La Recherche Scientifique (C.N.R.S.) Means for detecting and treating pathologies linked to fgfr3
DE20023659U1 (de) 1999-10-06 2005-07-07 Tigenix N.V. Molekulare Marker zum Testen der phänotypischen Stabilität von Zellpopulationen und Zellpopulationen für die autologe Transplantation
EP1469878B1 (en) 2002-01-31 2011-03-23 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Fgfr agonists
WO2004003179A1 (en) 2002-06-27 2004-01-08 The University Of Queensland Differentiation modulating agents and uses therefor
WO2004022095A1 (en) 2002-09-04 2004-03-18 Abtech Anti-idiotypic antibodies as vegf or fgf agonists for bone therapy
JP2007524566A (ja) 2002-12-20 2007-08-30 エンカム ファーマシューティカルズ アクティーゼルスカブ レセプターとリガンドの間の相互作用の調節の方法
WO2004074506A2 (en) 2003-02-13 2004-09-02 Mergen Ltd Polynucleotide sequences and corresponding encoded polypeptides of particular secreted and membrane-bound proteins overexpressed in certain cancers
EP1611252B1 (en) 2003-03-26 2009-07-29 Progenika Biopharma, S.A. In vitro method to detect bladder transitional cell carcinoma
IL156495A0 (en) 2003-06-17 2004-01-04 Prochon Biotech Ltd Use of fgfr3 antagonists for treating t cell mediated diseases
EP1544213B1 (en) 2003-12-19 2008-02-20 Charité - Universitätsmedizin Berlin Use of ligands of the antigen cd52 for the treatment of solid tumours and bone-related cancerous diseases
EP1697420A2 (en) 2003-12-19 2006-09-06 Five Prime Therapeutics, Inc. Fibroblast growth factor receptors 1, 2, 3, and 4 as targets for therapeutic intervention
ES2374822T3 (es) 2004-02-24 2012-02-22 Allergan, Inc. Ensayo de selección de toxinas botul�?nicas.
WO2005115363A2 (en) 2004-05-25 2005-12-08 Yale University Method for treating skeletal disorders resulting from fgfr malfunction
AU2005302083A1 (en) 2004-11-04 2006-05-11 Fibron Limited Treatment of B-cell malignancies
EP1659175A1 (en) 2004-11-18 2006-05-24 Institut Curie Alterations in seborrheic keratoses and their applications
EP1699826B1 (en) 2005-01-05 2009-03-11 f-star Biotechnologische Forschungs- und Entwicklungsges.m.b.H. Synthetic immunoglobulin domains with binding properties engineered in regions of the molecule different from the complementarity determining regions
AU2006227816B2 (en) 2005-03-15 2012-04-05 Allergan, Inc. Modified clostridial toxins with enhanced targeting capabilities for endogenous clostridial toxin receptor systems
EP2083081A1 (en) 2005-07-22 2009-07-29 Five Prime Therapeutics, Inc. Compositions and methods of treating disease with FGFR fusion proteins
US7612181B2 (en) 2005-08-19 2009-11-03 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
JP2009511613A (ja) 2005-10-17 2009-03-19 エンカム ファーマシューティカルズ アクティーゼルスカブ 神経細胞接着分子l1のペプチド断片を含む新規fgf受容体結合化合物
KR20080080525A (ko) 2005-12-08 2008-09-04 노파르티스 아게 유전자 전사에 대한 fgfr3의 억제제의 효과
US8101721B2 (en) 2006-06-15 2012-01-24 Fibron Ltd. Antibodies blocking fibroblast growth factor receptor activation and methods of use thereof
WO2008127707A1 (en) 2007-04-13 2008-10-23 Dana Farber Cancer Institute, Inc. Receptor tyrosine kinase profiling
US20090304719A1 (en) 2007-08-22 2009-12-10 Patrick Daugherty Activatable binding polypeptides and methods of identification and use thereof
AU2009219437B2 (en) 2008-02-25 2014-10-16 Nestec S.A. Drug selection for breast cancer therapy using antibody-based arrays
WO2009146033A2 (en) 2008-03-31 2009-12-03 Sma Foundation Compositions and methods for modulating smn activity
KR101590495B1 (ko) 2008-05-29 2016-02-01 갤럭시 바이오테크, 엘엘씨 염기성 섬유모세포 성장 인자에 대한 모노클로날 항체
AR073770A1 (es) 2008-10-20 2010-12-01 Imclone Llc Anticuerpo aislado que se enlaza especificamente con, e induce la degradacion del receptor-3 del factor de crecimiento del fibroblasto humano (fgfr-3), fragmento de enlace fgfr-3 humano del mismo, composicion farmaceutica y producto que lo comprenden
RU2012134637A (ru) 2010-01-14 2014-02-20 Йейл Юниверсити Ингибиторы рецепторных тирозинкиназ (rtk) и способы их применения
TWI452136B (zh) * 2010-11-17 2014-09-11 中外製藥股份有限公司 A multiple specific antigen-binding molecule that replaces the function of Factor VIII in blood coagulation
US8790651B2 (en) * 2011-07-21 2014-07-29 Zoetis Llc Interleukin-31 monoclonal antibody
WO2013088191A1 (en) 2011-12-12 2013-06-20 Institut National De La Sante Et De La Recherche Medicale (Inserm) Antagonist of the fibroblast growth factor receptor 3 (fgfr3) for use in the treatment or the prevention of skeletal disorders linked with abnormal activation of fgfr3
PL2824181T3 (pl) 2012-03-08 2019-02-28 Astellas Pharma Inc. Nowa fuzja fgfr3
UY35148A (es) 2012-11-21 2014-05-30 Amgen Inc Immunoglobulinas heterodiméricas
US20150292030A1 (en) 2012-11-27 2015-10-15 Board Of Regents, The University Of Texas System Methods of characterizing and treating molecular subset of muscle-invasive bladder cancer
WO2014161075A1 (en) 2013-04-05 2014-10-09 University Health Network Methods and compositions for generating chondrocyte lineage cells and/or cartilage like tissue
TWI541022B (zh) 2013-12-18 2016-07-11 應克隆公司 針對纖維母細胞生長因子受體-3(fgfr3)之化合物及治療方法
BR112017017700A2 (pt) 2015-02-19 2018-07-31 Bioclin Therapeutics Inc métodos, composições e kits para tratamento do câncer
SG11201906249PA (en) 2017-02-06 2019-08-27 Rainier Therapeutics Inc Methods, compositions, and kits for treatment of cancer

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6193980B1 (en) 1995-12-06 2001-02-27 Cambridge University Technical Services, Limited Replication defective herpes simplex virus comprising heterologous inserts
EP1423428A2 (en) * 2001-06-20 2004-06-02 ProChon Biotech Ltd. Antibodies that block receptor protein tyrosine kinase activation, methods of screening for and uses thereof
US20100003258A1 (en) * 2008-07-01 2010-01-07 Zhigang Weng Fibroblast growth factor receptor 3 (fgfr3) binding proteins
EP2679600A1 (en) * 2009-03-25 2014-01-01 Genentech, Inc. Anti-FGFR3 antibodies and methods using same

Non-Patent Citations (22)

* Cited by examiner, † Cited by third party
Title
"Antibody-antigen interactions: Contact analysis and binding site topography", J. MOL. BIOL., vol. 262, pages 732 - 745
"GenBank", Database accession no. NP 000133.1
AL-LAZIKANI ET AL., JMB, vol. 273, 1997, pages 927 - 948
ANGAL ET AL., MOL. IMMUNOL., vol. 30, 1993, pages 105 - 108
GEFTER ET AL., SOMATIC CELL GENET, vol. 3, no. 2, 1977, pages 231 - 236
HONEGGER APLUCKTHUN A: "Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool", J MOL BIOL, vol. 309, no. 3, 8 June 2001 (2001-06-08), pages 657 - 70, XP004626893, DOI: 10.1006/jmbi.2001.4662
JONES, GENETICS, vol. 85, 1977, pages 12
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, PUBLIC HEALTH SERVICE
KINGSMAN ET AL., GENE, vol. 7, 1979, pages 141
LEFRANC M P ET AL.: "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains", DEV COMP IMMUNOL, vol. 27, no. 1, January 2003 (2003-01-01), pages 55 - 77, XP055585227, DOI: 10.1016/S0145-305X(02)00039-3
LERNER, YALE J BIOL MED, vol. 54, no. 5, 1981, pages 387 - 402
MACCALLUM ET AL., J. MOL. BIOL., vol. 262, 1996, pages 732 - 745
MERCHANT ET AL., PNAS, vol. 110, no. 32, 2013, pages E2987 - E2996
OLSEN ET AL., PNAS, vol. 101, no. 4, 2004, pages 935 - 940
PRADZINSKA ET AL., AMINO ACIDS, vol. 48, 2016, pages 2809 - 2820
RIDGWAY, A. A. G., MAMMALIAN EXPRESSION VECTORS, pages 470 - 472
SARABIPOUR ET AL., BIOCHIM BIOPHYS ACTA, vol. 1858, no. 7, 2016, pages 1436 - 1442
SHAZEEB ET AL., SCI REP, vol. 8, 2018, pages 469
STINCHCOMB ET AL., NATURE, vol. 282, 1979, pages 39
TSCHEMPER ET AL., GENE, vol. 10, 1980, pages 157
XU ET AL., CELL IMMUNOL., vol. 200, 2000, pages 16 - 26
YIN ET AL., MOL. CANCER THER., vol. 14, no. 10, 2015, pages 2270 - 8

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024104922A1 (en) 2022-11-14 2024-05-23 Ascendis Pharma Growth Disorders A/S Method of improving skeletal muscle function
WO2024107759A3 (en) * 2022-11-14 2024-06-27 Regeneron Pharmaceuticals, Inc. Anti-fgfr3 antibodies and antigen-binding fragments and methods of use thereof
WO2024152014A1 (en) 2023-01-13 2024-07-18 Regeneron Pharmaceuticals, Inc. Fgfr3 binding molecules and methods of use thereof
WO2024194300A1 (en) 2023-03-20 2024-09-26 Ascendis Pharma Growth Disorders A/S Method of treatment of a thoracolumbar deformity in a human subject with achondroplasia
WO2025240335A1 (en) 2024-05-13 2025-11-20 Regeneron Pharmaceuticals, Inc. Fgfr3 binding molecules and methods of use thereof

Also Published As

Publication number Publication date
US20230303704A1 (en) 2023-09-28
BR112023002455A2 (pt) 2023-03-28
EP4200019A1 (en) 2023-06-28
IL300623A (en) 2023-04-01
AR123306A1 (es) 2022-11-16
AU2021327387A1 (en) 2023-05-04
MX2023002106A (es) 2023-03-15
US20220056142A1 (en) 2022-02-24
CO2023001559A2 (es) 2023-02-16
AU2021327387A9 (en) 2023-07-06
TW202229343A (zh) 2022-08-01
KR20230052963A (ko) 2023-04-20
CN116323666A (zh) 2023-06-23
US11505611B2 (en) 2022-11-22
JP2023538098A (ja) 2023-09-06
CA3189470A1 (en) 2022-02-24

Similar Documents

Publication Publication Date Title
JP7610302B2 (ja) Ccr8抗体及びその用途
US11505611B2 (en) FGFR3 antibodies and methods of use
US20230192835A1 (en) Optimized anti-tl1a antibodies
WO2019062832A1 (zh) Tigit抗体、其抗原结合片段及医药用途
US20120244152A1 (en) Novel antagonist antibodies and their fab fragments against gpvi and uses thereof
US12590149B2 (en) Antibody and bispecific antibody targeting LAG-3 and use thereof
US11845791B2 (en) Antibodies directed against GDF-15
US20240294622A1 (en) Novel anti-gremlin1 antibodies
US20230071422A1 (en) ANTI-CD3 and ANTI-CD123 Bispecific Antibody and Use Thereof
US20250145705A1 (en) Gprc5d antibody and application thereof
CN116323664A (zh) 抗β细胞素抗体、其片段和多特异性结合分子
WO2022228183A1 (zh) 抗siglec15抗体及其制备方法和用途
CN112243443B (zh) 抗trop-2抗体、其抗原结合片段及其医药用途
US20240425605A1 (en) TrkA ANTIBODY AND APPLICATION THEREOF
TW201922798A (zh) 靶向rankl的治療性抗體
TW202334220A (zh) 人類腫瘤壞死因子α抗體
CN114269788A (zh) 一种能够与人4-1bb结合的分子及其应用
TW202035457A (zh) 靶向cd137的抗體及其使用方法
US20260109754A1 (en) Sars-cov-2 antibodies and methods of using the same
US20250215100A1 (en) Antigen binding protein targeting cd40, and preparation therefor and use thereof
US20250277038A1 (en) Anti-pd-l1 antibody and use thereof
US11655292B2 (en) Anti-human NGF antibodies and methods using same
TW202313698A (zh) 抗masp-2抗體及其用途
JP2026506623A (ja) 抗cdh6抗体及びその使用
JP2024544386A (ja) Pd-l1抗原結合タンパク質及びその使用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21770357

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3189470

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: NC2023/0001559

Country of ref document: CO

WWP Wipo information: published in national office

Ref document number: NC2023/0001559

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 2023512280

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023002455

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 202317012593

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: DZP2023000240

Country of ref document: DZ

ENP Entry into the national phase

Ref document number: 20237009493

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: AU2021327387

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021770357

Country of ref document: EP

Effective date: 20230321

ENP Entry into the national phase

Ref document number: 112023002455

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230209

ENP Entry into the national phase

Ref document number: 2021327387

Country of ref document: AU

Date of ref document: 20210820

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 523442618

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 523442618

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 523442618

Country of ref document: SA