WO2021260022A1 - Production de composés carbonylés à l'aide de la présentation d'oxydases à la surface des cellules - Google Patents

Production de composés carbonylés à l'aide de la présentation d'oxydases à la surface des cellules Download PDF

Info

Publication number
WO2021260022A1
WO2021260022A1 PCT/EP2021/067180 EP2021067180W WO2021260022A1 WO 2021260022 A1 WO2021260022 A1 WO 2021260022A1 EP 2021067180 W EP2021067180 W EP 2021067180W WO 2021260022 A1 WO2021260022 A1 WO 2021260022A1
Authority
WO
WIPO (PCT)
Prior art keywords
oxidase
seq
yeast cells
sequence identity
group
Prior art date
Application number
PCT/EP2021/067180
Other languages
English (en)
Inventor
Marita PREIMS
Roman Kittl
Christian Anton LEITNER
Roland Ludwig
Peter Herzog
Original Assignee
Universität Für Bodenkultur Wien
Directsens Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universität Für Bodenkultur Wien, Directsens Gmbh filed Critical Universität Für Bodenkultur Wien
Publication of WO2021260022A1 publication Critical patent/WO2021260022A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N11/00—Carrier-bound or immobilised enzymes; Carrier-bound or immobilised microbial cells; Preparation thereof
    • C12N11/16—Enzymes or microbial cells immobilised on or in a biological cell
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C12N9/0022—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
    • C12N9/0024—D-Amino acid oxidase (1.4.3.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/12—Disaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/03—Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
    • C12Y101/03004—Glucose oxidase (1.1.3.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/99—Oxidoreductases acting on the CH-OH group of donors (1.1) with other acceptors (1.1.99)
    • C12Y101/99018—Cellobiose oxidase (1.1.99.18)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/03—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
    • C12Y104/03003—D-Amino-acid oxidase (1.4.3.3)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/035—Fusion polypeptide containing a localisation/targetting motif containing a signal for targeting to the external surface of a cell, e.g. to the outer membrane of Gram negative bacteria, GPI- anchored eukaryote proteins

Definitions

  • the present invention relates to the field of enzymatic production of a compound comprising a carbonyl group.
  • the invention specifically relates to the oxidation of substrates comprising a hydroxyl group using yeast cells displaying immobilized enzyme, specifically oxidase.
  • Oxidases have been used for the oxidation of primary alcohols, but these enzymes are destabilized by the hydrogen peroxide formed by the reaction. Therefore, hydrogen peroxide must be constantly degraded during a process. This is done, if allowed, by adding catalase resulting in very high costs for production. Furthermore, catalase is on the list of substances prohibited in cosmetic products according to EU Regulation No. 1223/2009 and therefore must not be present in cosmetic products.
  • catalase is essential to prevent inhibition and deactivation of the oxidase by hydrogen peroxide (Nordkvist et al., 2007).
  • US20070105200A1 describes enzymatic conversion of lactose to lactobionic acid using a carbohydrate oxidase, wherein catalase is added to the reaction to degrade hydrogen peroxide that is produced during the reaction. Addition of catalase converts the produced H2O2 to oxygen.
  • US8183030B2 describes the production of gluconic acid using novel catalyst supports, such as e.g. yeast cells comprising immobilized avidin on their surface.
  • novel catalyst supports such as e.g. yeast cells comprising immobilized avidin on their surface.
  • Biotinylated glucose oxidase is added to the yeast cells to produce the gluconic acid.
  • Catalase is added to the reaction to degrade the hydrogen peroxide produced during the reaction.
  • Gal et al. (2016) discloses two dehydrogenases, cellobiose dehydrogenase from Corynascus thermophilus and pyranose dehydrogenase from Agaricus meleagris, displayed on the surface of Saccharomyces cerevisiae using the yeast surface display system.
  • the surface displayed dehydrogenases were used in a microbial fuel cell using lactose and xylose, respectively, as fuel.
  • Blazic et al. (2019) disclose directed evolution of cellobiose dehydrogenase on the surface of yeast cells to generate a CDH with higher activity for resazurin.
  • the present invention discloses a genetically modified yeast cell, which can be used as a whole cell biocatalyst for the production of oxidized compounds.
  • a method for the production of a compound comprising a carbonyl group using yeast cells expressing a fusion protein comprising a cell surface anchor linked to an oxidase, which is displayed on the yeast cells’ surface comprising the steps of: i. providing a substrate comprising a hydroxyl group; ii. providing the yeast cells; and iii.
  • the method of the invention is performed without the addition of catalase to the reaction.
  • the yeast cells are capable of degrading the unwanted side product hydrogen peroxide, without the addition of any extra catalase.
  • the substrate comprising the hydroxyl group is provided in an aqueous solution, and the yeast cells are added to the aqueous solution comprising the substrate.
  • the displayed oxidase is cellobiose dehydrogenase (cellobiose oxidase), carbohydrate oxidase, glucose oxidase, pyranose oxidase, galactose oxidase, aryl-alcohol oxidase, alcohol oxidase, or a functionally active variant thereof.
  • the functionally active variant includes a flavodehydrogenase domain (FAD domain) or a flavin adenine dinucleotide-binding domain (FAD-binding domain).
  • the oxidase described herein can comprise the amino acid sequence of the homologous wild-type oxidase of several different species, or functionally active variants thereof.
  • the yeast cells used in the methods described herein may display more than one oxidase.
  • the yeast cells described herein may display two or more oxidases, for example selected from the group consisting of cellobiose dehydrogenase, carbohydrate oxidase, glucose oxidase, pyranose oxidase, galactose oxidase, aryl-alcohol oxidase and alcohol oxidase.
  • the fusion protein described herein may comprise cellobiose oxidase activity and glucose oxidase activity.
  • the fusion protein described herein may comprise cellobiose dehydrogenase, carbohydrate oxidase, glucose oxidase, pyranose oxidase, galactose oxidase, aryl-alcohol oxidase and/or alcohol oxidase activity.
  • the yeast cells may express two or more different fusion proteins.
  • the yeast cells may express a fusion protein as described herein comprising cellobiose dehydrogenase activity and a fusion protein as described herein comprising glucose oxidase activity.
  • the displayed oxidase is a functional variant of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at the position 769 of the Myriococcum thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position functionally equivalent to 769 of SEQ ID NO:1.
  • CDH cellobiose dehydrogenase
  • the amino acid substitution at position N769 of the Myriococcum thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position functionally equivalent to 769 of SEQ ID NO:1 increases the oxygen reactivity of the CDH, compared to a CDH not comprising said amino acid substitution.
  • said amino acid substitution increases the oxygen reactivity by at least about 10, 20, 30, 40, 50, 60, 70,
  • amino acid substitution at position 769 of SEQ ID NO:1, or at a position functionally equivalent to said position is to a glycine (G, Gly).
  • the displayed oxidase is a functionally active variant of cellobiose dehydrogenase homologues from other species, such as Crassicarpon thermophilum, Phanerochaete chrysosporium, Neurospora crassa, or Trametes versicolor, comprising an amino acid substitution of the amino acid at the position functionally equivalent to the position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1.
  • the displayed oxidase is a functional variant of the CDH of M. thermophilum comprising at least 60% sequence identity to SEQ ID NO:1 , of Crassicarpon thermophilum comprising at least 60% sequence identity to SEQ ID NO:3, of Phanerochaete chrysosporium comprising at least 60% sequence identity to SEQ ID NO:5, of Neurospora crassa comprising at least 60% sequence identity to SEQ ID NO:7, or of Trametes versicolor comprising at least 60% sequence identity to SEQ ID NO:9, or its functional flavodehydrogenase domain.
  • the functional variant of the CDH of M. thermophilum comprises at least about 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80,
  • the functional variant of the CDH comprises at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:1.
  • the displayed oxidase is the flavodehydrogenase domain of cellobiose dehydrogenase (CDH), or a functional variant thereof.
  • the displayed oxidase is the flavodehydrogenase domain of cellobiose dehydrogenase (CDH) of M. thermophilum, Crassicarpon thermophilum, Phanerochaete chrysosporium, Neurospora crassa or Trametes versicolor, or a functional variant thereof.
  • the flavodehydrogenase domain displayed on the surface of the yeast cell by fusion to the cell surface anchor comprising SEQ ID NO:2, 4, 6, 8, or 10, or comprising at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:2, 4, 6, 8, or 10.
  • the functional variant of the CDH of Crassicarpon thermophilum comprises at least about 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:3.
  • the functional variant of the CDH comprises at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:3.
  • the displayed oxidase is the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) of Crassicarpon thermophilum, or a functional variant thereof.
  • the functional variant of the CDH of Phanerochaete chrysosporium comprises at least about 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:5.
  • the functional variant of the CDH comprises at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:5.
  • the displayed oxidase is the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) of Phanerochaete chrysosporium, or a functional variant thereof.
  • FAD domain flavodehydrogenase domain
  • CDH cellobiose dehydrogenase
  • the functional variant of the CDH of Neurospora crassa comprises at least about 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:7.
  • the functional variant of the CDH comprises at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:7.
  • the displayed oxidase is the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) of Neurospora crassa, or a functional variant thereof.
  • FAD domain flavodehydrogenase domain
  • CDH cellobiose dehydrogenase
  • the functional variant of the CDH of Trametes versicolor comprises at least about 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:9.
  • the functional variant of the CDH comprises at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:9.
  • the displayed oxidase is the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) of Trametes versicolor, or a functional variant thereof.
  • FAD domain flavodehydrogenase domain
  • CDH cellobiose dehydrogenase
  • the displayed oxidase is a functional variant of the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:2.
  • FAD domain flavodehydrogenase domain of cellobiose dehydrogenase
  • the functional variant of the displayed FAD domain of CDH comprises at least about 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:2.
  • the displayed oxidase is glucose oxidase comprising SEQ ID NO:11, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:11.
  • the functional variant of the displayed glucose oxidase comprises at least about 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,
  • the oxidase is aryl-alcohol oxidase comprising SEQ ID NO:12, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO: 12.
  • the functional variant of the displayed aryl-alcohol oxidase comprises at least about 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:12.
  • the oxidase is carbohydrate oxidase comprising SEQ ID NO:13, ora functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO: 13.
  • the functional variant of the displayed carbohydrate oxidase comprises at least about 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:13.
  • the oxidase is pyranose oxidase comprising SEQ ID NO:14, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO: 14.
  • the functional variant of the displayed pyranose oxidase comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80,
  • the oxidase is galactose oxidase comprising SEQ ID NO:15, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO: 15.
  • the functional variant of the displayed galactose oxidase comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:15.
  • the oxidase is alcohol oxidase comprising SEQ ID NO:16, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO: 16.
  • the functional variant of the displayed alcohol oxidase comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:16.
  • the substrate used in the method provided herein is a saccharide or an alcohol.
  • the substrate is selected from the group consisting of saccharides, specifically cello-saccharides and lacto-saccharides, oligosaccharides, specifically cello- oligosaccharides and lacto-oligosaccharides, glucose, galactose, cellobiose, lactose, maltose, and alcohols, specifically primary alcohols and aryl alcohols.
  • the substrate is lactose and the aqueous solution is whey.
  • lactobionic acid is produced in whey using the surface-displayed oxidase as described herein.
  • the yeast cells may be extracted from the solution after production of the lactobionic acid.
  • the whey enriched in lactobionic acid may be used in cosmetic preparations.
  • the lactobionic acid may be isolated from the whey, and used in cosmetic preparations.
  • the cosmetic preparation may be produced by formulating the whey enriched in lactobionic acid with a cosmetically acceptable carrier.
  • the substrates described herein are oxidized using the yeast cells displaying an oxidase as described herein, thereby producing a significant amount of a compound comprising a carbonyl group.
  • the significant amount is any of at least about 10, 15, 20, 25, 30, 35, 40, 45, or 50g/L, or 100g/L or more, and any ranges between these values.
  • the compound produced by the method provided herein is an oxidized saccharide, or an oxidized alcohol.
  • said compound is selected from the group consisting of cello-oligonic acids, lacto-oligonic acids, cello-oligobionic acids, lacto-oligobionic acids, gluconic acid, galactonic acid, cellobionic acid, lactobionic acid, maltobionic acid, aldehydes, carboxylic acids, 2-oxo acids, keto aldoses or 1 ,6-dialdoses.
  • yeast cells displaying a fusion protein comprising an enzyme comprising cellobiose oxidase activity are used to produce at least 10g/L of cellobionic acid, preferably at least 20 or 30g/L, wherein oxidation of the hydroxyl group of glucose is catalyzed by the immobilized enzyme comprising cellobiose oxidase activity.
  • the hydroxyl group at the C1 position of glucose is oxidized by the immobilized oxidase.
  • yeast cells displaying a fusion protein comprising an enzyme comprising cellobiose oxidase activity are used to produce at least 10g/L of lactobionic acid, preferably at least 20 or 30g/L, wherein oxidation of the hydroxyl group of lactose is catalyzed by the immobilized enzyme comprising cellobiose oxidase activity.
  • yeast cells displaying a fusion protein comprising an enzyme comprising glucose oxidase activity are used to produce at least 10g/L of gluconic acid, preferably at least 20 or 30 g/L, wherein oxidation of the hydroxyl group of glucose is catalyzed by the immobilized enzyme comprising glucose oxidase activity.
  • the method provided herein provides for an industrially scalable process for the production of the compound comprising a carbonyl group as described herein.
  • the process includes culturing recombinant yeast host cells displaying the immobilized oxidase on their surface in defined culture media at a temperature suitable for growth of the recombinant yeast cells.
  • the culture medium preferably has a pH ranging from 4 to 7.5 and temperature is preferably maintained between about 15°C to 30°C or 32°C.
  • the host cells are contacted with an aqueous solution comprising about 1% to 50%, preferably about 1% to 10% or about 5% to 20% of the substrate comprising the hydroxyl group.
  • the final product, specifically the compound comprising the carbonyl group is either harvested from the solution, or the product remains in the solution and the yeast cells are filtered from the solution.
  • At least 40% of product is formed in less than 6 hours. Even more specifically, using the method described herein, up to 50% of product are formed in about 5 hours.
  • the cell surface displayed oxidase is stable and retains more than 40%, preferably 50%, of its activity for up to 24 hours (hrs) during the oxidation process, when compared to native enzyme which is added to the substrate in free form without catalase.
  • the yeast cells are removed from the solution, following cultivation with the substrate for a time sufficient to form the carbonyl compound.
  • the host cells are cultivated with the substrate for a time, which is sufficient for the production of a significant amount of said compound.
  • yeast host cells are cultivated in a cell culture, specifically in a bioreactor, under suitable conditions as further described herein to produce the carbonyl compound on an industrial scale.
  • the yeast cells are removed from the solution by filtration, preferably by microfiltration or ultrafiltration, or centrifugation.
  • the method comprises the additional step of isolating the compound comprising the carbonyl group.
  • the cell surface anchor of the fusion protein is Aga2, or a functionally active variant thereof comprising at least 80% sequence identity to SEQ ID NO:19.
  • the yeast cells used in the method provided herein are methylotrophic yeast cells selected from the group consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia lipolytica, Arxula adeninivorans, Zygosaccharomyces bailii, Pichia stipites, Klyveromyces marxianus, Saccharomyces occidentalis, Zygosaccharomyces rouxii, preferably the yeast cells are Saccharomyces cerevisiae or Pichia pastoris cells.
  • the invention provides for a fusion protein, which was constructed by fusing a cell surface anchor protein, such as the cell surface anchor protein Aga2 of S. cerevisiae, in-frame with the N- terminus of an oxidase, or a functionally active variant of an oxidase, such as the flavodehydrogenase domain of cellobiose dehydrogenase.
  • a cell surface anchor protein such as the cell surface anchor protein Aga2 of S. cerevisiae
  • a functionally active variant of an oxidase such as the flavodehydrogenase domain of cellobiose dehydrogenase.
  • a fusion protein comprising the following structure from N- to C-terminus: i. Aga2, or a functionally active variant thereof comprising at least 80% sequence identity to SEQ ID NO:19; ii. optionally, a linker; and iii. a functional variant of the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at the position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.
  • FAD domain flavodehydrogenase domain
  • CDH cellobiose dehydrogenase
  • the fusion protein is represented by SEQ ID NO:21.
  • the present invention provides a modified expression cassette comprising a promoter, a modified open reading frame encoding for the flavodehydrogenase domain of cellobiose dehydrogenase fused to the C-terminus of an anchor protein and a terminator sequence.
  • the promoter chosen may either be for constitutive expression or for inducible expression.
  • the modified expression cassette can express a functionally active oxidase on the surface of a wide range of host organisms, such as, but not limited to Saccharomyces cerevisiae.
  • the variant of the FAD domain of said fusion protein comprises a glycine at the position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.
  • the functional variant of the FAD domain comprises SEQ ID NO:2, or at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:2.
  • the functional variant of the FAD domain comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:2.
  • the functional variant of the FAD domain comprises any one of SEQ ID NO:4, 6, 8, or 10, or at least 60%, preferably at least 70% at least 80%, more preferably at least 90% sequence identity to any one of SEQ ID NO:4, 6, 8, or 10.
  • the functional variant of the FAD domain comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to any one of SEQ ID NO:4, 6, 8, or 10.
  • nucleotide sequence encoding the fusion protein described herein.
  • an expression cassette comprising the isolated nucleotide sequence described herein operably linked to regulatory elements.
  • a host cell or a host cell line expressing the fusion protein described herein wherein the host cells are selected from the group consisting of yeast cells, bacterial cells, insect cells and mammalian cells.
  • the host cells are yeast cells selected from the group of methylotrophic yeasts consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia lipolytica, Arxula adeninivorans, Zygosaccharomyces bailii, Pichia stipites, Klyveromyces marxianus, Saccharomyces occidentalis, Zygosaccharomyces rouxii.
  • yeast cells selected from the group of methylotrophic yeasts consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia
  • yeast cell displaying an immobilized functional variant of the flavodehydrogenase domain of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.
  • CDH cellobiose dehydrogenase
  • yeast cell displaying the fusion protein described herein on its surface. Further provided herein is the use of the yeast cells displaying the fusion protein described herein on its surface for the production of a compound comprising a carbonyl group.
  • a method for the production of a compound comprising a carbonyl group using yeast cells expressing a fusion protein comprising a cell surface anchor linked to a D-amino acid oxidase, which is displayed on the yeast cells’ surface comprising the steps of: i. providing a substrate comprising an amino group; ii. providing the yeast cells; and iii.
  • the substrate comprising an amino group is oxidized using the yeast cells displaying a D-amino acid oxidase as described herein, whereby a significant amount of a compound comprising a carbonyl group is produced.
  • the significant amount is any of at least about 10, 15, 20, 25, 30, 35, 40, 45, or 50g/L, or 100g/L or more, and any ranges between these values.
  • at least 20 g/L of the compound comprising the carbonyl group are produced using the yeast cells displaying a D-amino acid oxidase as described herein.
  • the substrate comprising an amino group is a D-amino acid, preferably cephalosporin C.
  • the compound comprising a carbonyl group is a-Ketoadipyl-7 ACA.
  • the oxidase is D-amino acid oxidase comprising SEQ ID NO:17 or 18, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:17 or 18.
  • the functional variant of the D-amino acid oxidase comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:17 or 18.
  • the method using a D-amino acid oxidase comprises a further step of adding Glutaryl-7-ACA-Acylase (glutaryl acylase) to the reaction to produce 7-aminocephalosporanic acid from the carbonyl compound a- Ketoadipyl-7 ACA.
  • Glutaryl acylase converts a-Ketoadipyl-7 ACA to 7- aminocephalosporanic acid (7-ACA).
  • Glutaryl acylase may be added to the reaction in free form or may be immobilized on a carrier such as yeast cells.
  • glutaryl acylase may be added as a fusion protein displayed on yeast cells’ surface, wherein glutaryl acylase ora functionally active variant thereof is linked to a yeast cell surface protein, such as but not limited to Aga2.
  • the cell surface anchor of the fusion protein comprising a D-amino acid oxidase, or a functional variant thereof as described herein is Aga2, or a functionally active variant thereof comprising at least 80% sequence identity to SEQ ID NO: 19.
  • the functionally active variant of Aga2 comprises at least about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO: 19.
  • the functionally active variant of Aga2 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 point mutations, amino acid substitutions, additions or deletions or the like.
  • a functional variant of Aga2 is functional to immobilize the fusion protein on the yeast sell surface.
  • the yeast cells are removed from the solution following incubation with the substrate for a sufficient time to form the compound comprising a carbonyl group, or after the final product, e.g. 7-aminocephalosporanic acid, has been formed.
  • the yeast cells are removed by filtration, preferably microfiltration or ultrafiltration, or centrifugation.
  • the yeast cells used in the method using a D-amino acid oxidase as described herein are methylotrophic yeast cells selected from the group consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia lipolytica, Arxula adeninivorans, Zygosaccharomyces bailii, Pichia stipites, Klyveromyces marxianus, Saccharomyces occidentalis, Zygosaccharomyces rouxii, preferably the yeast cells are Saccharomyces cerevisiae or Pichia pastoris cells.
  • Figure 2. Enzyme activity of immobilised enzyme during the reaction.
  • Figure 3. Conversion of lactose to lactobionic acid, lactose from whey to lactobionic acid, and cellobiose into cellobionic acid during the reaction.
  • amino acids refer to twenty naturally occurring amino acids encoded by sixty-one triplet codons. These 20 amino acids can be split into those that have neutral charges, positive charges, and negative charges:
  • Alanine (Ala, A) nonpolar, neutral;
  • Asparagine (Asn, N) polar, neutral
  • Cysteine (Cys, C) nonpolar, neutral
  • Glutamine (Gin, Q) polar, neutral
  • Glycine (Gly, G) nonpolar, neutral
  • Leucine (Leu, L) nonpolar, neutral
  • Methionine (Met, M) nonpolar, neutral
  • Phenylalanine (Phe, F) nonpolar, neutral;
  • Proline (Pro, P) nonpolar, neutral
  • Serine (Ser, S) polar, neutral
  • Threonine (Thr, T) polar, neutral
  • Tryptophan (Trp, W) nonpolar, neutral;
  • Tyrosine (Tyr, Y) polar, neutral
  • Valine (Val, V) nonpolar, neutral
  • Histidine (His, H) polar, positive (10%) neutral (90%).
  • the “positively” charged amino acids are:
  • Arginine (Arg, R) polar, positive
  • Lysine (Lys, K) polar, positive.
  • the “negatively” charged amino acids are:
  • Aspartic acid (Asp, D) polar, negative; and Glutamic acid: (Glu, E) polar, negative.
  • the invention provides a multidimensional approach for achieving a high rate of bioconversion of a substrate comprising a hydroxyl group to a compound comprising a carbonyl group using a whole cell biocatalyst.
  • the present invention discloses novel whole cell biocatalysts for production of oxidized compounds, such as e.g. cellobionic acid and lactobionic acid, from substrates comprising a hydroxyl group, such as alcohols or sugars. Further, the invention also refers to nucleic acids which encode oxidase enzyme fused to a cell surface anchor protein, and to fusion proteins expressed from such nucleic acids.
  • Organic molecules are carbon-based and also may contain oxygen, hydrogen, nitrogen, sulfur, and/or phosphorus. Structurally, these molecules are composed of two main parts.
  • the first part is the carbon backbone, in which the carbon atoms are bonded together forming a carbon backbone.
  • the second part are the functional groups, which are small groups of atoms, such as hydrogen and oxygen, that are bonded to the carbon backbone. Functional groups are so named because they function as the chemically reactive area of the molecule.
  • hydroxyl group is one example of a functional group.
  • a “hydroxyl group” is a functional group composed of one hydrogen atom bonded to one oxygen atom. Its chemical formula is written as either -OH or HO-. The represents the carbon to which the hydroxyl group is bonded.
  • substrate is used herein to refer to compounds comprising a hydroxyl group, specifically sugars and alcohols.
  • alcohols When hydroxyl groups are the primary functional group bonded to carbon backbones, the resulting molecules are alcohols. Examples of alcohols containing the hydroxyl group are methanol, isopropyl alcohol, and propanol.
  • substrates comprising hydroxyl groups are carbohydrate molecules, also called saccharides or sugars.
  • substrate is used herein to refer to a compound comprising an amino group.
  • the amino group is one of several nitrogen-containing functional groups found in organic molecules. What distinguishes the amino group is that the nitrogen atom is connected by single bonds to either hydrogen or carbon.
  • a compound comprising an amino group is also referred to as “amine”.
  • Amines are formally derivatives of ammonia, wherein one or more hydrogen atoms have been replaced by a substituent such as an alkyl or aryl group, which may respectively be called alkylamines and arylamines; amines in which both types of substituent are attached to one nitrogen atom may be called alkylarylamines.
  • Specific examples of amines include amino acids, specifically D- amino acids, biogenic amines, trimethylamines, and aniline.
  • the whole cell biocatalyst described herein is used to convert the substrates described herein, i.e. a compound comprising a hydroxyl and/or an amino group, into a carbonyl compound.
  • the “compound comprising a carbonyl group” as described herein is also referred to as a “carbonyl compound”.
  • enzyme in accordance with the invention means any substance composed wholly or largely of protein or polypeptides that catalyzes or promotes, more or less specifically, one or more chemical or biochemical reactions. Specifically, the term “enzyme” is used herein to refer to a protein or polypeptide comprising oxidase activity.
  • activity as used herein e.g., in the context of an enzyme activity, shall refer to a functionally active molecule.
  • a functional enzyme is specifically characterized by a catalytic center recognizing the enzyme substrate and catalysing the conversion of the substrate to a conversion product.
  • Enzyme variants are considered functional upon determining their enzymatic activity in a standard test system, e.g. wherein the enzymatic activity is at least 50% of the activity of the parent (not modified or wild-type enzyme), or at least any of 60%, 70%, 80%, 90%, 100%, or even more than 100%.
  • Oxidases refers to an entity such as a protein or polypeptide having enzymatic activity, which is functional to catalyze the biochemical reaction forming an oxygenated or oxidized compound or product from the substrates described herein.
  • Oxidases are enzymes that catalyze an oxidation reaction, by transferring hydrogen from a source or donor, specifically the substrates described herein, to oxygen, thereby forming hydrogen peroxide as a by-product. These enzymes belong to the group of oxidoreductases or redox enzymes, which also encompass oxygenases, hydrogenases or reductases, oxidases and peroxidases.
  • oxidation reaction means in general terms a biochemical reaction wherein an oxygenated or oxidized compound or product is formed.
  • An oxidation reaction is typically accompanied by a reduction reaction (hence the term “redox” reaction, for oxidation and reduction).
  • redox reaction for oxidation and reduction.
  • glucose oxidase typically catalyzes the oxidation of a primary alcohol group to a lactone.
  • the enzymatic conversion of sugar into acids involves an oxidation/reduction reaction, catalyzed by carbohydrate oxidases, in which oxygen serves as an electron acceptor.
  • the oxygen is reduced to hydrogen peroxide (H2O2): sugar + O2 + H2O ® sugar acids + H2O2.
  • the enzyme catalase in turn catalyzes the reaction: H2q2 ® H2O + 1 ⁇ 2 02.
  • oxygen as electron acceptor is cheap, does not require an additional purification step of the produced carbonyl group and is generally regarded as not harmful.
  • hydrogen peroxide is produced as a side product by the regeneration reaction of CDH.
  • oxidase activity describes the enzymatic activity of an enzyme to catalyze oxidation of a hydroxyl group to a carbonyl group.
  • oxidase activity describes the enzymatic activity of e.g. the glucose oxidase to catalyze oxidation of glucose to generate gluconolactone utilizing oxygen as an electron acceptor.
  • the "activity" of an oxidase, such as the glucose oxidase may be directed to a measure of its ability to catalyze the oxidation reaction D-glucose + O2 ® gluconolactone + H2O2 and may be expressed as the rate at which the product of the reaction is produced.
  • glucose oxidase activity can be represented as the amount of product (gluconolactone and/or H2O2) produced per unit of time, or per unit (e.g. concentration or weight) of glucose oxidase.
  • oxidase also comprises functional variants of wildtype oxidases known in the field as further described herein. Said functional variants comprise oxidase activity.
  • Functional variants of the oxidases described herein may be full-length oxidases comprising one or multiple point mutations, or fragments of the full- length oxidase comprising catalytical activity, such as e.g. the flavodehydrogenase domain of cellobiose dehydrogenase.
  • Carbohydrate oxidases are oxidases that are capable of catalyzing the conversion of sugars or alcohols into acids. Any carbohydrate oxidase can be used in the method of the invention. Specific examples comprise cellobiose dehydrogenase, glucose oxidase, alcohol oxidase, aryl-alcohol oxidase, pyranose oxidase and galactose oxidase.
  • Cellobiose oxidase (EC 1.1.99.18) is a carbohydrate oxidase capable of oxidizing several saccharides including cellobiose, soluble cellooligosaccharides, lactose, xylobiose and maltose.
  • Cellobiose dehydrogenase (CDH) was first discovered in 1974 in the extracellular enzyme system of Phanerochaete chrysosporium and later on in several other basidiomycetous fungi.
  • a special characteristic of this enzyme is its composition: the combination of a catalytically active flavodehydrogenase domain (also called “flavin domain”), hosting a non-covalently bound FAD, and a haem domain, with a haem b as a cofactor. Both domains are connected by a linker. By its catalytic activity the natural substrate cellobiose is oxidised in a reaction which reduces the FAD of the flavin domain.
  • flavin domain also called “flavin domain”
  • CDH or its flavodehydrogenase domain (also referred to as flavin domain) oxidises carbohydrates like its natural substrates cellobiose and cello-oligosaccharides and others like lactose and maltose. CDHs have been discovered and shown previously to be capable of converting glucose efficiently.
  • the flavin domain even without the haem domain, is sufficient for catalytical activity.
  • the domain is therefore referred to as "functional domain” as it has the function of oxidizing lactose with a suitable electron acceptor.
  • the activity is exerted by either the whole enzyme cellobiose dehydrogenase or the catalytically active flavodehydrogenase domain.
  • Glucose oxidase (b-D-glucose!oxygen 1-oxidoreductase; EC 1.1. 3.4) catalyzes the oxidation of b-D-glucose to gluconic acid, by utilizing molecular oxygen as an electron acceptor with the simultaneous production of hydrogen peroxide.
  • Microbial glucose oxidase is currently receiving much attention due to its diverse applications in the chemical, pharmaceutical, food, beverage, clinical chemistry, biotechnology and other industries.
  • Glucose oxidase or "GOx" specifies a protein that catalyzes the oxidation of beta-D-glucose into D-glucono-1 , 5-lactone (D-glucose + 02® gluconolactone + H2O2), which then may hydrolyze to gluconic acid.
  • Hexose oxidase (EC 1.1.3.5) is a carbohydrate oxidase capable of oxidizing several saccharides including glucose, galactose, maltose, cellobiose and lactose.
  • Alcohol oxidase is an enzyme that catalyzes the following chemical reaction: a primary alcohol + O2 - an aldehyde + H2O2
  • This enzyme class is alcohol oxidoreductase. This enzyme is also called ethanol oxidase.
  • Aryl alcohol oxidase is an enzyme that catalyzes the following chemical reaction: an aromatic primary alcohol + O2 - an aromatic aldehyde + H2O2
  • This enzyme class is aryl- alcohol: oxygen oxidoreductase.
  • Other names in common use include veratryl alcohol oxidase, and aromatic alcohol oxidase.
  • D-Amino acid oxidase is an enzyme capable of oxidizing several D-amino acid substrates, including cephalosporin C.
  • 7-Aminocephalosporanic acid (7-ACA) the core of many semi-synthetic cephalosporins, is conventionally manufactured chemically from cephalosporin C.
  • the chemical process uses chemical reagents that are highly toxic and heavily pollute the environment and the chemical process is low in conversion rate, as the process requires multiple steps of reactions. Bio-process offers an attractive alternative for the production of 7-ACA.
  • cephalosporin C is first oxidized by D-amino acid oxidase to a Ketoadipyl 7ACA and then non enzymatic with the produced H2O2 to glutaryl-7-ACA; (2) the glutaryl-7-ACA is then cleaved at the bond between the glutaryl moiety and the 7-ACA moiety by glutaryl-7ACA acylase to 7-ACA.
  • Glutaryl-7ACA acylase can process a Ketoadipyl 7ACA directly to 7-ACA, but only if the reaction mix is not contaminated with glutaryl-7-ACA which is produced by the side product H2O2.
  • the glutaryl-7ACA acylase can process a Ketoadipyl 7ACA directly to 7-ACA, as the intermediate side product glutaryl-7-ACA is not produced by free H2O2.
  • no catalase has to be added to the process to remove H2O2 and isolation of the target compound is easier since the reaction mix is not contaminated by unwanted side products.
  • Glutaryl acylase in immobilized or free form, may be added to the reaction mix together with the oxidase-displaying yeast cells to produce 7-aminocephalosporanic acid in a one-pot reaction.
  • glutaryl acylase may be added in a separate second step, after the oxidase-displaying yeast cells had been incubated with the substrate cephalosporin C for a sufficient time to produce a sufficient amount of the carbonyl compound a Ketoadipyl-7-ACA, thereby producing 7-ACA in a two-step reaction.
  • 7-ACA or the yeast cells may be isolated from the reaction mix.
  • Rhodotorula gracilis and Trigonopsis variabilis are the two major sources of D- amino acid oxidase for industrial application.
  • fusion protein refers to a polypeptide which comprises protein domains from at least two different proteins.
  • the fusion protein is an oxidase, i.e. a protein or polypeptide comprising oxidase activity, linked to the C- terminus of a cell surface anchor protein. Linkage of the oxidase to the cell surface anchor may be via direct fusion or via a linker as described herein.
  • cell surface anchor refers, inter alia, to any molecular structure connected to or attached to the external surface of a eukaryotic cell, specifically a yeast cell. Said term comprises structures known to the skilled artisan but also structures being capable of anchorage to the surface not yet known.
  • anchor refers to a (poly)peptide moiety that, on expression in a host cell, becomes attached or otherwise associated with the outer surface of the host cell.
  • An anchor (poly)peptide can be a transmembrane protein moiety, or can be a (poly)peptide moiety otherwise linked to the cell surface (e. g., via post-translational modification, such as by a phosphatidyl- inositol or disulfide bridge).
  • the term encompasses proteins native to the host cell, or exogenous proteins introduced for the purpose of anchoring to the cell surface.
  • the oxidases described herein are anchored to the surface of the host cell by covalent bonding to glycans containing phosphatidyl inositol.
  • the structures to which the anchor protein or peptide is bonded are often referred to as glycosylphosphatidylinositol or GPIs.
  • GPIs glycosylphosphatidylinositol
  • anchor proteins covalently bonded to GPIs are found on the external face of the plasma membrane of cells or on the lumenal surface of secretory vesicles.
  • the anchor protein is a GPI anchor protein, Aga2 which is fused in frame to the N-terminus of a protein comprising oxidase activity.
  • Effective anchors include portions of a cell surface protein sufficient to provide a surface anchor when fused to another polypeptide, such as a protein comprising oxidase activity as described herein.
  • a suitable anchor e.g., the yeast a-agglutinin components, Agalp and Aga2p, which form a glycan-immobilized, disulfide-linked complex on the surface of yeast cells.
  • Preferred examples of polypeptide anchors include FL01 (a protein associated with the flocculation phenotype in S. cerevisiae ), a-agglutinin, and a-agglutinin subunits (e.g., Agalp and Aga2p subunits), and functional fragments thereof.
  • Anchors further include any synthetic modification or truncation of a naturally occurring anchor, such as Aga2, that still retains the ability to be attached to the surface of a host cell.
  • Preferred anchor protein moieties are contained in, for example, cell surface proteins of a eukaryotic cell.
  • surface in the term “surface of a eukaryotic host cell” refers to any structure surrounding the cellular body of any of the known eukaryotic host cells. The skilled artisan is aware of such structures, including, for example, a plasma membrane.
  • plasma membrane in connection with the present invention is to be construed as comprising any eukaryotic membrane and specifically, the extracellular surface of any such membrane.
  • linker refers to a functional and structural connection between two or more elements, that does not interfere with the function of the elements.
  • linker typically refers to an operable connection between two or more polypeptide elements of the fusion protein described herein.
  • the linkers may be used to engineer appropriate amounts of flexibility.
  • the linkers are short, e.g., 1-20 nucleotides or amino acids or even more and are typically flexible.
  • a polypeptide can be directly linked to an anchor protein (e.g. via a peptide bond or via a peptide linker, amino acid linker), thus forming a fusion protein.
  • an anchor protein e.g. via a peptide bond or via a peptide linker, amino acid linker
  • Amino acid linkers commonly used consist of a number of glycine, serine, and optionally alanine, in any order. Such linkers usually have a length of at least any one of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 20 amino acids, as required.
  • the linker comprises 1 to 12 amino acid residues, preferably it is a short linker.
  • the linker is a GS, GGSGG, GSAGSAAGSG, (GS)n, GSG or G4S linker or any combination thereof.
  • the linker comprises one or more units, repeats or copies of a motif, such as for example GS, GSG or G4S.
  • polynucleotides encoding the polypeptide and anchor protein can be linked such that the fusion protein is transcribed and translated as a unitary RNA message.
  • polynucleotides which encode one or more elements of the fusion protein described herein for expression in the host cell display system, can be operably linked to a promoter (to facilitate transcription), or operably linked to a signal sequence or leader peptide (to facilitate cellular processing and transport to the surface).
  • promoter to facilitate transcription
  • signal sequence or leader peptide to facilitate cellular processing and transport to the surface.
  • Preferred promoters include inducible promoters.
  • promoters for eukaryotic systems
  • promoters include those useful in yeast vectors, such as pGAL1 , pGAL1-10, pGa1104, pGaMO, pPGK, pCYC1 , and pADH1.
  • signal sequences include the Aga2p signal sequence (for eukaryotic systems).
  • host cell as referred to herein is understood as any yeast cell type that is susceptible to transformation, transfection, transduction, or the like with nucleic acid constructs or expression vectors comprising polynucleotides encoding expression products described herein, or susceptible to otherwise introduce any or each of the components of the fusion protein described herein.
  • the host yeast cells are maintained under conditions allowing expression of the fusion protein and display of the fusion protein on the host cell’s surface.
  • Host yeast cells can be haploid, diploid or polyploid cells.
  • yeast host or yeast cell line which is commonly understood to be a yeast cell line ready-to-use for cultivation/culturing in a bioreactor to obtain the product of a production process, such as the compound comprising a carbonyl group as described herein.
  • the yeast host or yeast cell line as described herein is particularly understood as a recombinant yeast organism, which may be cultivated/cultured to produce the desired compound.
  • cell culture or “cultivation” (“culturing” is herein synonymously used), also termed “fermentation”, with respect to a host cell line is meant to be the maintenance of cells in an artificial, e.g., an in vitro environment, under conditions favoring growth, differentiation or continued viability, in an active or quiescent state, of the cells, specifically in a controlled bioreactor according to methods known in the industry.
  • a cell culture is brought into contact with the cell culture media in a culture vessel or with substrate under conditions suitable to support cultivation of the cell culture.
  • a culture medium as described herein is used to culture cells according to standard cell culture techniques that are well-known in the art for cultivating or growing yeast cells.
  • Cultivation of the yeast host cells may be in one or multiple phases.
  • the yeast cells are allowed to grow to a certain density in a first phase, before the carbonyl group is produced in a second or further phase.
  • Cell density used for inoculating or starting the production phase may be OD600 of about 2 or more, specifically about 2.5, 3, 4, 5, 6 or more.
  • the growth phase may be followed by an induction phase, wherein expression of the oxidase on the yeast cell surface is induced.
  • the induction phase may also be included in the growth phase or the production phase.
  • cell growth and production of the carbonyl compound may be in a single phase.
  • the medium used in the cultivation process comprises the respective substrate required for the production of the carbonyl compound from the beginning of the cultivation process.
  • the media used in the present method do not comprise heterologous catalase.
  • Cell culture media provide the nutrients necessary to maintain and grow cells in a controlled, artificial and in vitro environment. Characteristics and compositions of the cell culture media vary depending on the particular cellular requirements. Important parameters include osmolality, pH, and nutrient formulations. Feeding of nutrients may be done in a continuous or discontinuous mode according to methods known in the art.
  • Cell culture may be a batch process or a fed-batch process.
  • a batch process is a cultivation mode in which all the nutrients necessary for cultivation of the cells, and optionally including the substrates necessary for production of the carbonyl compounds described herein, are contained in the initial culture medium, without additional supply of further nutrients during fermentation.
  • a feeding phase takes place after the batch phase.
  • one or more nutrients, such as the substrate described herein are supplied to the culture by feeding.
  • the method described herein is a fed-batch process.
  • a host cell transformed with a nucleic acid construct encoding the fusion protein as described herein is cultured in a growth phase medium and transitioned to an induction phase medium in order to produce the surface displayed oxidases described herein. Subsequently, the cells are transitioned to a reaction medium comprising the substrate described herein to produce a desired amount of the carbonyl compound described herein.
  • host cells described herein are cultivated in continuous mode, e.g. a chemostat.
  • a continuous fermentation process is characterized by a defined, constant and continuous rate of feeding of fresh culture medium into the bioreactor, whereby culture broth is at the same time removed from the bioreactor at the same defined, constant and continuous removal rate. By keeping culture medium, feeding rate and removal rate at the same constant level, the cultivation parameters and conditions in the bioreactor remain constant.
  • the host cell culture comprising the fusion protein described herein is particularly advantageous for methods on an industrial manufacturing scale, e.g. with respect to both the volume and the technical system, in combination with a cultivation mode that is based on feeding of nutrients, in particular a fed-batch or batch process, or a continuous or semi-continuous process (e.g. chemostat).
  • Expression products such as polypeptides, proteins or protein domains, or RNA molecules as described herein, including e.g., the fusion proteins, as described herein may be introduced into a host cell either by introducing the respective coding polynucleotide or nucleotide sequence for expressing the expression products within the host cell, or by introducing the respective expression products which are within an expression system or isolated.
  • any of the known procedures for introducing expression cassettes, vectors or otherwise introducing (e.g., coding) nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, nucleofection, liposomes, microinjection, naked DNA, plasmid vectors, viral vectors, both episomal and integrative, and any of the other well-known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al.).
  • the invention specifically allows for the production process to be performed on a pilot or industrial scale.
  • the industrial process scale would preferably employ volumes of at least 10 L, specifically at least 50 L, preferably at least 1 m 3 , preferably at least 10 m 3 , most preferably at least 100 m 3 .
  • Production conditions in industrial scale are preferred, which refer to e.g. fed batch cultivation in reactor volumes of 100 L to 10 m 3 or larger, employing typical process times of several days, or continuous processes in fermenter volumes of approximately 50 - 1000 L or larger.
  • the suitable cultivation techniques may encompass cultivation in a bioreactor starting with a batch phase, followed by a short exponential fed batch phase at high specific growth rate, further followed by a fed batch phase at a low specific growth rate.
  • Another suitable cultivation technique may encompass a batch phase followed by a continuous cultivation phase at a low dilution rate.
  • the host cell line as described herein in a bioreactor under growth conditions to obtain a cell density of at least about 1 g/L, 5g/L or 10 g/L cell dry weight, more preferably at least 20 g/L cell dry weight, preferably at least 50 g/L cell dry weight. It is advantageous to provide for such yields of biomass production on a pilot or industrial scale.
  • a growth medium allowing the accumulation of biomass as described herein specifically a basal growth medium, typically a carbon source, a nitrogen source, a source for sulphur and a source for phosphate.
  • a basal growth medium typically a carbon source, a nitrogen source, a source for sulphur and a source for phosphate.
  • a medium comprises furthermore trace elements and vitamins, and may further comprise amino acids, peptone or yeast extract.
  • the medium used to produce the carbonyl compound according to the method provided herein comprises the substrate comprising the hydroxyl group which is oxidized by the displayed oxidase as described herein to produce the carbonyl compound as described herein.
  • the substrate comprising the hydroxyl group which is oxidized by the displayed oxidase as described herein to produce the carbonyl compound as described herein.
  • at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100g/L up to 200g/L, or more, of substrate are added to the cell culture, or comprised in the medium used in the production phase.
  • the fermentation preferably is carried out at a pH ranging from 3 to 7.5.
  • Typical fermentation times are about 24 to 120 hours with temperatures in the range of 20°C to 35°C, preferably 22-30°C.
  • the cells are cultivated under conditions suitable to produce the carbonyl compound, which can be purified from the cells or culture medium.
  • the carbonyl compound is preferably produced employing conditions yielding at least about 1 mg/L or 10 mg/L, preferably at least 100 mg/L, most preferred at least 1,
  • aqueous solution refers to a liquid preparation that contains one or more chemical substances dissolved, i.e., molecularly dispersed, in a suitable solvent or mixture of mutually miscible solvents, wherein the predominant solvent is water.
  • the aqueous solution used in the methods described herein may be any solution which is suitable for enzymatic oxidation reactions employing a whole cell biocatalyst as described herein.
  • Specific examples of aqueous solutions are cell culture media as described herein. Even more specific examples of aqueous solutions include whey, wood hydrolysate, cellulose hydrolysate, plant hydrolysate, starch hydrolysate, fungal hydrolysate, chitin hydrolysate, and fungal fermentation broth.
  • heterologous refers to a compound which is either foreign to a given host cell, i.e. “exogenous”, such as not found in nature in said host cell; or that is naturally found in a given host cell, e.g., is “endogenous”, however, in the context of a heterologous construct or integrated in such heterologous construct, e.g., employing a heterologous nucleic acid fused or in conjunction with an endogenous nucleic acid, thereby rendering the construct heterologous.
  • heterologous refers to a catalase compound which is foreign to the host cell used in the method described herein, i.e. it is exogenous to the host cell and not naturally produced by such host cell. Catalases disproportionate hydrogen peroxide to water and dioxygen (/ccat/Km 10 6 -10 7 M 1 s 1 ). Catalase is endogenously produced by yeast host cells at low levels to preserve the intracellular reducing environment by metabolizing hydrogen peroxide. In the method of the present invention no exogenous catalase is added to the cell culture, therefore, the method is performed in the absence of any additional catalase, except for the catalase that is endogenously produced by the host cells.
  • expression as used herein regarding expressing a polynucleotide or nucleotide sequence, is meant to encompass at least one step selected from the group consisting of DNA transcription into mRNA, mRNA processing, non-coding mRNA maturation, mRNA export, translation, protein folding and/or protein transport.
  • Nucleic acid molecules containing a desired nucleotide sequence may be used for producing an expression product encoded by such nucleotide sequence e.g., proteins or transcription products such as RNA molecules, in particular fusion proteins as described herein.
  • an expression system is conveniently used, which can be an in vitro or in vivo expression system, as necessary to express a certain nucleotide sequence by a host cell or host cell line.
  • host cells are transfected or transformed with an expression system comprising an expression cassette that comprises the desired nucleotide sequence and a promoter operably linked thereto optionally together with further expression control sequences or other regulatory sequences.
  • Specific expression systems employ expression constructs such as vectors comprising one or more expression cassettes.
  • expression construct means the vehicle, e.g. vectors or plasmids, by which a DNA sequence is introduced into a host cell so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence.
  • Expression construct includes both, autonomously replicating nucleotide sequences as well as genome integrating nucleotide sequences.
  • vector means the vehicle by which a DNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence.
  • Vector as used herein includes both, autonomously replicating nucleotide sequences as well as genome integrating nucleotide sequences, such as artificial chromosomes. Plasmids are preferred vectors of the invention.
  • an expression vector may contain more than one expression cassettes, each comprising at least one coding sequence and a promoter in operable linkage.
  • a "cassette” refers to a DNA coding sequence or segment of DNA that codes for an expression product that can be inserted into a vector at defined restriction sites.
  • the cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame.
  • An “expression cassette” as used herein refers to nucleic acid molecules containing a desired coding sequence and control sequences in operable linkage, so that an expression system can use such expression cassette to produce the respective expression products, including e.g., encoded proteins or other expression products.
  • Certain expression systems employ host cells or host cell lines which are transformed or transfected with an expression cassette, which host cells are then capable of producing expression products in vivo.
  • an expression cassette may be conveniently included in a vector, which is introduced into a host cell; however, the relevant DNA may also be integrated into a host chromosome.
  • a coding sequence is typically a coding DNA or coding DNA sequence which encodes a particular amino acid sequence of a particular polypeptide or protein, or which encodes any other expression product.
  • expression vector means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.
  • Vectors typically comprise DNA sequences that are required for the transcription of cloned recombinant nucleotide sequences, i.e. of recombinant genes and the translation of their mRNA in a suitable host organism.
  • a coding DNA sequence or segment of DNA molecule coding for an expression product can be conveniently inserted into a vector at defined restriction sites.
  • heterologous foreign DNA can be inserted at one or more restriction sites of a vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA.
  • a vector comprises an expression system, e.g. one or more expression cassettes. Expression cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame.
  • a sequence encoding a desired expression product is typically cloned into an expression vector that contains a promoter to direct transcription.
  • Appropriate expression vectors typically comprise regulatory sequences suitable for expressing coding DNA. Examples of regulatory sequences include promoter, operators, enhancers, ribosomal binding sites, and sequences that control transcription and translation initiation and termination. The regulatory sequences are typically operably linked to the DNA sequence to be expressed.
  • a promoter is herein understood as a DNA sequence which initiates, regulates, or otherwise mediates or controls the expression of the coding DNA.
  • Promoter DNA and coding DNA may be from the same gene or from different genes, and may be from the same or different organisms.
  • Recombinant cloning vectors often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g., antibiotic resistance, one or more nuclear localization signals (NLS) and one or more expression cassettes.
  • a mutation has its ordinary meaning in the art.
  • a mutation may comprise a point mutation, or refer to areas of sequences, in particular changing contiguous or non-contiguous amino acid sequences.
  • a mutation is a point mutation, which is herein understood as a mutation to alter one or more (but only a few) contiguous amino acids, e.g. 1, or 2, or 3 amino acids are substituted, inserted or deleted at one position in an amino acid sequence.
  • Amino acid substitutions may be conservative amino acid substitutions or non-conservative amino acid substitutions.
  • Conservative substitutions, as opposed to non-conservative substitutions comprise substitutions of amino acids belonging to the same set or sub set, such as hydrophobic, polar, etc.
  • allelic variant or “functionally active variant” also includes naturally occurring allelic variants, as well as mutants or any other non-naturally occurring variants.
  • an allelic variant is an alternate form of a nucleic acid or peptide that is characterized as having a substitution, deletion, or addition of one or nucleotides or more amino acids that does essentially not alter the biological function of the nucleic acid or polypeptide.
  • Functional variants may be obtained by sequence alterations in the polypeptide or the nucleotide sequence, e.g. by one or more point mutations, wherein the sequence alterations retain or improve a function of the unaltered polypeptide or the nucleotide sequence, when used in combination of the invention.
  • sequence alterations can include, but are not limited to, (conservative) substitutions, additions, deletions, mutations and insertions.
  • Conservative substitutions are those that take place within a family of amino acids that are related in their side chains and chemical properties. Examples of such families are amino acids with basic side chains, with acidic side chains, with non-polar aliphatic side chains, with non-polar aromatic side chains, with uncharged polar side chains, with small side chains, with large side chains etc.
  • a point mutation is particularly understood as the engineering of a poly-nucleotide that results in the expression of an amino acid sequence that differs from the non-engineered amino acid sequence in the substitution or exchange, deletion or insertion of one or more single (non-consecutive) or doublets of amino acids for different amino acids.
  • sequence identity as used herein is understood as the relatedness between two amino acid sequences or between two nucleotide sequences and described by the degree of sequence identity or sequence complementarity. The sequence identity of a variant, homologue or orthologue as compared to a parent nucleotide or amino acid sequence indicates the degree of identity of two or more sequences.
  • Two or more amino acid sequences may have the same or conserved amino acid residues at a corresponding position, to a certain degree, up to 100%.
  • Two or more nucleotide sequences may have the same or conserved base pairs at a corresponding position, to a certain degree, up to 100%.
  • Sequence similarity searching is an effective and reliable strategy for identifying homologs with excess (e.g., at least 50%) sequence identity. Sequence similarity search tools frequently used are e.g., BLAST, FASTA, and HMMER.
  • Sequence similarity searches can identify such homologous proteins or polynucleotides by detecting excess similarity, and statistically significant similarity that reflects common ancestry.
  • Homologues may encompass orthologues, which are herein understood as the same protein in different organisms, e.g., variants of such protein in different different organisms or species.
  • one of the two sequences needs to be converted to its complementary sequence before the % complementarity can then be calculated as the % identity between the first sequence and the second converted sequences using the above-mentioned algorithm.
  • Percent (%) identity with respect to an amino acid sequence, homologs and orthologues described herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific polypeptide sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. In case of percentages determined for sequence identities, it is possible that arithmetical decimal places may result which are not possible with regard to full nucleotides or amino acids. In this case, the percentages shall be rounded up to whole nucleotides or amino acids.
  • sequence identity between two amino acid sequences is determined using the NCBI BLAST program version 2.2.29 (Jan-06-2014) with blastp set at the following exemplary parameters: Program: blastp, Word size: 6, Expect value: 10, Hitlist size: 100, Gapcosts: 11.1 , Matrix: BLOSUM62, Filter string: F, Genetic Code: 1 , Window Size: 40, Threshold: 21 , Composition-based stats: 2.
  • Percent (%) identity with respect to a nucleotide sequence e.g., of a nucleic acid molecule or a part thereof, in particular a coding DNA sequence, is defined as the percentage of nucleotides in a candidate DNA sequence that is identical with the nucleotides in the DNA sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent nucleotide sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at novocraft.com), ELAND (lllumina, San Diego, CA), SOAP (available at soap.genomies.org.cn), and Maq (available at maq.sourceforge.net).
  • Burrows-Wheeler Transform e.g., the Burrows Wheeler Aligner
  • ClustalW Clustal X
  • BLAT Novoalign
  • ELAND lllumina, San Diego, CA
  • SOAP available at soap.genomies.org.cn
  • Maq available at maq.sourceforge.net.
  • a method for the production of a compound comprising a carbonyl group using yeast cells expressing a fusion protein comprising a cell surface anchor linked to an oxidase, which is displayed on the yeast cells’ surface comprising the steps of: i. providing a substrate comprising a hydroxyl group; ii. providing the yeast cells; and iii.
  • oxidase is cellobiose dehydrogenase (cellobiose oxidase), carbohydrate oxidase, glucose oxidase, pyranose oxidase, galactose oxidase, aryl-alcohol oxidase, alcohol oxidase, or a functionally active variant thereof.
  • cellobiose dehydrogenase cellobiose dehydrogenase
  • carbohydrate oxidase carbohydrate oxidase
  • glucose oxidase pyranose oxidase
  • galactose oxidase galactose oxidase
  • aryl-alcohol oxidase aryl-alcohol oxidase
  • alcohol oxidase or a functionally active variant thereof.
  • oxidase is a functional variant of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at the position 769 of the Myriococum thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.
  • CDH cellobiose dehydrogenase
  • thermophilum comprising at least 60% sequence identity to SEQ ID NO:1
  • Crassicarpon thermophilum comprising at least 60% sequence identity to SEQ ID NO:3
  • Phanerochaete chrysosporium comprising at least 60% sequence identity to SEQ ID NO:5
  • Neurospora crassa comprising at least 60% sequence identity to SEQ ID NO:7
  • Trametes versicolor comprising at least 60% sequence identity to SEQ ID NO:9, or its functional flavodehydrogenase domain.
  • oxidase is a functional variant of the flavodehydrogenase domain of cellobiose dehydrogenase (CDH) comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:2.
  • CDH cellobiose dehydrogenase
  • oxidase is glucose oxidase comprising SEQ ID NO:11 , or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:11.
  • oxidase is aryl-alcohol oxidase comprising SEQ ID NO:12, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:12.
  • oxidase is carbohydrate oxidase comprising SEQ ID NO:13, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:13.
  • oxidase is pyranose oxidase comprising SEQ ID NO:14, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:14.
  • oxidase is galactose oxidase comprising SEQ ID NO:15, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:15.
  • oxidase is alcohol oxidase comprising SEQ ID NO:16, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:16.
  • the substrate is selected from the group consisting of oligosaccharides, cello-saccharides, lacto-saccharides, glucose, galactose, cellobiose, lactose, maltose, primary alcohols and aryl alcohols.
  • the compound comprising a carbonyl group is selected from the group consisting of cello-oligonic acids, lacto-oligonic acids, gluconic acid, galactonic acid, cellobionic acid, lactobionic acid, maltobionic acid, aldehydes, carboxylic acids, 2-oxo acids, keto aldoses or 1,6-dialdoses. 16. The method of any one of items 1 to 15, wherein the yeast cells are removed from the solution following incubation with the substrate for a sufficient time to form the compound comprising a carbonyl group.
  • yeast cells are removed by filtration, preferably microfiltration or ultrafiltration, or centrifugation.
  • yeast cells are methylotrophic yeast cells selected from the group consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia lipolytica, Arxula adeninivorans, Zygosaccharomyces bailii, Pichia stipites, Klyveromyces marxianus, Saccharomyces occidentalis, Zygosaccharomyces rouxii, preferably the yeast cells are Saccharomyces cerevisiae or Pichia pastoris cells.
  • a fusion protein comprising the following structure from N- to C-terminus: i. Aga2, or a functionally active variant thereof comprising at least 80% sequence identity to SEQ ID NO:19; ii. optionally, a linker; and iii. a functional variant of the flavodehydrogenase domain of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at the position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.
  • CDH cellobiose dehydrogenase
  • the fusion protein of item 21 or 22, wherein the functional variant of the flavodehydrogenase domain comprises SEQ ID NO:2, or at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:2.
  • the functional variant of the flavodehydrogenase domain comprises any one of SEQ ID NO:4, 6, 8, or 10, or at least 60%, preferably at least 70% at least 80%, more preferably at least 90% sequence identity to any one of SEQ ID NO:4, 6, 8 or 10.
  • An expression cassette comprising the isolated nucleotide sequence of item 25 operably linked to regulatory elements.
  • yeast cells selected from the group of methylotrophic yeasts consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyverom
  • a yeast cell displaying an immobilized functional variant of the flavodehydrogenase domain of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.
  • CDH cellobiose dehydrogenase
  • a yeast cell displaying the fusion protein of any one of items 21 to 24 on its surface.
  • yeast cells of item 29 or 30 for the production of a compound comprising a carbonyl group.
  • a method for the production of a compound comprising a carbonyl group using yeast cells expressing a fusion protein comprising a cell surface anchor linked to a D-amino acid oxidase, which is displayed on the yeast cells’ surface comprising the steps of: i. providing a substrate comprising an amino group; ii. providing the yeast cells; and iii.
  • oxidase is D-amino acid oxidase comprising SEQ ID NO: 17 or 18, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:17 or 18.
  • yeast cells are methylotrophic yeast cells selected from the group consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia lipolytica, Arxula adeninivorans, Zygosaccharomyces bailii, Pichia stipites, Klyveromyces marxianus, Saccharomyces occidentalis, Zygosaccharomyces rouxii, preferably the yeast cells are Saccharomyces cerevisiae or Pichia pastoris cells.
  • Example 1 Display of cellobiose dehydrogenase on the surface of S. cerevisiae
  • Transformed cells were plated on SD- CAA selection plates and positive clones were expressed in SD-CAA liquid culture for 20 h at 30°C prior to media change and induction in SG(R)-CAA medium supplemented with 1% w/w raffinose at 20°C for 30 h (Angelini et al., 2015; Puri et al., 2013).
  • the amino acid sequence of the displayed Aga2-CDH-F fusion protein is shown in SEQ ID NO:22.
  • the amino acid sequence of the displayed Aga2-CDH-F+ fusion protein, comprising the N769G mutation, is shown in SEQ ID NO:21.
  • thermophilum (synonymously Crassicarpon hotsonii) cellobiose dehydrogenase flavin domain wt (CDH-F) and the oxygen reactive variant N769G (CDH- F+) were efficiently displayed on the surface of S. cerevisiae cells as a fusion to Aga2. Display levels and enzyme activity were well-correlated and highest specific activities were obtained between 24 - 38 h induction at 20 °C. For CDH-F+ apparent oxidase activities of 1.7 - 2.8 mU OD ml_ 1 were reached, where one mU ODmL 1 is defined as the formation of 1 nmol of H2O2 per minute per ml_ of cell suspension of an O ⁇ boo 1.0. For CDH-F and the empty vector control (EVC), no peroxide formation above the background was detected. Both CDH variants are displayed on the cell surface at near identical levels.
  • Example 2 Production of Aldobionic acids catalyzed by cellobiose dehydrogenase displayed as fusion protein on the surface of S. cerevisiae
  • cellobiose dehydrogenase immobilized on the cell surface of living Saccharomyces cerevisiae (SD CDH) is used to produce cellobionic acid from cellobiose and lactobionic acid from lactose and lactobionic acid from lactose in whey.
  • the produced aldobionic acids can be separated from the reaction mixture and purified to produce the pure acids. Alternatively, only the cells can be removed producing a product enriched with aldobionic acid.
  • Biotin 500x (0.2 g/l): 2 ml
  • yeast cells expressing CDH on the surface were produced in shaking flasks.
  • One vial, containing 100 pl_ cell suspension, from the master cell bank were thawed and used to inoculate a 1000 ml Erlenmeyer flask containing 100 ml grow medium. After incubating the culture at 30°C and 120 rpm in a rotary shaker for 48 hours the cells were harvested by centrifugation (15 min, 6000 g). To induce protein expression the cell pellet was suspended in induction medium and diluted to an OD of 1 and incubated in a 1000 ml baffled flask.
  • surface-display (SD) CDH can be used for converting pure lactose (or lactose in whey) to lactobionic acid and cellobiose to cellobionic acid.
  • the reaction was performed in 50 ml Erlenmeyer flasks containing 10 ml 50 mM sodium phosphate buffer pH 7.0. To each of three flasks 50 mg of lactose or cellobiose or 71 mg of whey powder was added. 0.5 U SD CDH was added to the flasks containing lactose and whey powder and 1 U SD CDH was added to the flask with cellobiose.
  • the reaction mixture was incubated at 30°C and 140 rpm and sealed with Parafilm. Samples are taken and enzyme activity, H2O2, and lactobionic acid and cellobionic acid concentration were measured.
  • the pH of the conversion can be from 3.0 to 11.0. In this experiment pH 7.0 was used.
  • Enzyme activity was measured in 96 well plates with lactose as electron donor and DCIP as electron acceptor. 20 mI_ of sample suspension was used and the reaction started by adding 180 mI_ of reagent solution. The decline of the absorption of DCIP at 520 nm was measured and used to calculate the activity. One Unit of SD CDH was defined as the amount of enzyme necessary to oxidase one mM of lactose and therefore reducing one mM of DCIP in one minute under these conditions.
  • the reagent solution contained 0.35 mM DCIP and 47 mM lactose in 50 mM sodium phosphate buffer at pH 7.0. 5. Determination of H2O2 concentration:
  • H2O2 concentration was measured in 96 well plates. Yeast cells were removed from the sample by centrifugation (2.5 min at 20000 g). To inactivate traces of enzyme the samples were incubated at 95°C for 5 min, cool on ice and centrifuge for 10 min at 20 000 g. 20 pl_ of the clear supernatant were taken, 180 mI_ reagent were added, the mixture was incubated at room temperature for 10 min and the absorbance was measured at 415. A standard curve with H2O2 concentration from 10 mM to 2 mM was made and treated the same way as the samples. The reagent solution contained 0.3 mM ABTS and 120 U/ml horse radish peroxidase in 50 mM sodium phosphate buffer at pH 7.0.
  • Samples were prepared as described in the determination of H2O2 concentration.
  • a Dionex IC-5000 system was used with a CarboPac PA100250x4 mm column. Detection was done with a PAD gold cell with a pH electrode as referenced. As mobile phase was 150 mM NaOH and 0.5 M sodium acetate/150 mM NaOH (gradient: 0% B to 36% B in 18 min).
  • Lactobionic acid was produced in the lactose and whey batch. The conversion was 37% in the lactose batch and 23% in the whey batch. In the cellobiose/CBA (cellobionic acid) batch, twice the enzyme concentration was used, resulting in a higher conversion rate. 69% of cellobiose was converted to CBA. No other product was seen in the HPLC chromatograms. The sum of substrate and product in the reaction did not decline over time, therefore no substrate was lost due to yeast metabolism (see Figures 2 and 3).
  • H2O2 concentrations as little as 0.02 mM are detectable with the used test. It seems H2O2 is efficiently destroyed by the cells.
  • the produced lactobionic acid can either stay in the reaction mixture or it can be purified by known methods, e.g. with ion exchange resins, and added to whey.
  • the lactobionic acid enriched whey can be used as cosmetic ingredient since it does not contain catalase.
  • Example 3 Production of lactobionic acid from lactose in 250 ml scale
  • the reaction was performed in an Infors HT Multifors 400 ml flat bottom glass reactor with metal lid.
  • the reactor was equipped with a heating mantle, a temperature probe for temperature measurement and control, a magnetic coupled stirrer with one Rushton 6-blade impeller for mixing, three steel baffles for better mixing, one pH electrode for measuring and controlling the pH (via addition of base), p02 electrode for measuring and controlling the oxygen concentration (via 02 flow), one gas inlet with ring sparger near the bottom of the reactor direct below the stirrer, a sampling tube connected to a 5 ml syringe (ending near the bottom of the reactor), one tube inlet connected to the base reservoir (ends above the liquid surface), an air outlet with water cooled condenser and one open port for filling the reactor (is closed during the reaction).
  • the reactor was operated under nonsterile conditions.
  • Process parameter were controlled by the Infors HT Multifors control unit and recorded on a computer by the Iris V5 software.
  • the temperature was held constant at 30°C and the reactor was fed with pure oxygen via the ring sparger to a p02 of 21%. Stirring speed was 300 rpm. 1 M Na2C03 was added via a pump for neutralizing the formed lactobionic acid and keeping the pH at 7.0.
  • the solution volume was 250ml_ (200 ml water and 50 ml cell suspension). 200 ml of water, 13.16 g of lactose, and 0.16 g sodium dihydrogen phosphate were added to the reactor. After the temperature had stabilized at 30°C and the pH at 7.0, the reaction was started by adding the 50 ml of cell suspension with an activity of 83 U CDH. The final concentration in the reactor were 146 mM lactose and 4.2 mM phosphate buffer. Samples were taken and enzyme activity, H2O2, lactose and lactobionic acid concentration were measured.
  • the space-time-yield was calculated and was 5.23 g LBA/L * h for the SD CDH batch and 5.28 g LBA/L * h for the batch with soluble enzyme.
  • the volume of added base over time was recorded for the SD CDH batch. After 5 h 9.1 ml of base was used equals a 51 .8% conversion. This fits nicely to the found LBA concentration in the batch after this time.
  • the SD CDH enzyme was continuedly inactivated over time. After 26h, 57% of the enzyme is still active in the SD CDH batch. To recover the cells the reaction mixture was centrifuged at 6000 g for 15 min. The cell pellet was suspended in PBS and stored at 4°C. 28 U, or 33% of the starting activity, was recovered. The so recovered enzyme did not lose any activity after storing for one week at 4°C.
  • Example 4 Production of gluconic acid catalyzed by glucose oxidase displayed as fusion protein on the surface of S. cerevisiae
  • the native glucose oxidase from Aspergillus niger immobilized on the cell surface of living Saccharomyces cerevisiae (SD GOX) was used to produce gluconic acid from glucose (SEQ ID NO:25).
  • Enzyme activity was measured in 96 well plates with glucose as electron donor and oxygen as electron acceptor. 20 pl_ of sample suspension was used and the reaction started by adding 180 mI_ of reagent solution. The increase of the absorption of the ABTS radical at 415 nm was measured and used to calculate the activity.
  • One Unit of SD GOX was defined as the amount of enzyme necessary to oxidase one mM of glucose and therefore reducing one mM of oxygen to H2O2 in one minute under these conditions.
  • the reagent solution contained 0.5 mM ABTS, 40 mM glucose, and 120 U/ml peroxidase from horse radish in 50 mM sodium citrate buffer pH 5.5.
  • Example 5 Display of D-Amino acid oxidase on the surface of S. cerevisiae
  • the D-Amino acid oxidase from the yeast Trigonopsis variabilis can be expressed in a display format using the established yeast surface display format for S. cerevisiae (Boder and Wittrup, 1997; Angelini et al., 2015). Copy the 356-residue long protein sequence encoding the wild type TvDAAO (Gonzalez et al., 1997) as is available in the UniProtKB database (UniProtKB: Q99042, SEQ ID NO:18) and order a commercial gene synthesis service such as Twist Bioscience (adapter-free gene fragments) to reverse-translate into a nucleotide sequence whilst codon optimize for S.
  • Twist Bioscience adapter-free gene fragments
  • flanking sequences of 50 nucleotides reflecting the pCTCON2 cloning site to each side of the sequence to allow homologous recombination upon transformation in the S. cerevisiae host: 5’ GTGGAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCGGCTAGC (SEQ ID NO:32)
  • the recombinant TvDAAO can be cloned into the pCTCON2 vector by transformation of 50 ng of vector backbone and 100 ng of synthesized TvDAAO gene during the transformation into competent S. cerevisiae EBY100 using the Frozen-EZ Yeast Transformation II Kit (Zymo Research, Germany).
  • Vector and expression strain can be requested from the owner Prof. Dane Wittrup (457 MIT, USA) and found on plasmid repositories such as Addgene (https://www.addgene.org/41843/).
  • Plate Transformed cells onto SD-CAA selection plates pick clones for expression in SD-CAA liquid culture for 20 h at 30°C prior to media change and induction in SG(R)-CAA medium supplemented with 1% w/w raffinose at 20°C for 30 h (Angelini et al., 2015; Puri et al., 2013).
  • the amino acid sequence of the displayed Aga2-TvDAAO fusion protein is shown in SEQ ID NO:31.
  • Example 6 Conversion of cephalosporin C to 7-aminocephalosporanic acid (7-ACA) in the absence of hydrogen peroxide catalyzed by D-Amino acid oxidase displayed as fusion protein on the surface of S. cerevisiae
  • D-Amino acid oxidase immobilized on the cell surface of living S. cerevisiae is used for the production of a Ketoadipyl 7ACA, which is further converted to 7-Aminocephalosporanic acid by Glutaryl-7ACA acylase.
  • the produced 7- Aminocephalosporanic acid can be separated from the reaction mixture and purified. Alternatively, only the cells can be removed producing a product enriched with 7- Aminocephalosporanic acid.
  • Biotin 500x (0.2 g/l): 2 ml
  • the S. cerevisiae cells expressing D-Amino acid oxidase on the surface are produced in shaking flasks. Use 100 pl_ cell suspension to inoculate a 1000 ml Erlenmeyer flask containing 100 ml grow medium. Incubate the culture at 30°C and 120 rpm in a rotary shaker for 48 hours. Harvest the cells by centrifugation (15 min, 6000 g). To induce protein expression, suspend the cell pellet in induction medium, dilute to an OD of 1 and incubate in a 1000 ml baffled flask. Harvest the cells after four days by centrifugation (15 min, 6000 g), wash once with PBS and store the cells suspended in PBS at 4°C. One liter of induction medium produces roughly 16 g wet cell mass.
  • D-Amino acid oxidase activity by measuring the formation of keto acid. Incubate the D-Amino acid oxidase displaying cells in 5 ml of 50 mM d-Ala-containing pyrophosphate buffer (pH 8.5) for 30 min at 37 °C. Terminate the reaction by adding 3 ml of trichloroacetic acid (10%). Dilute a total of 0.1 ml of the reaction mixture 10 times and add 0.4 ml of 2,4-dinitrophenylhydrazine saturated (0.2%) in 2 M HCI for 10 min. Add 1.5 ml of 3 M NaOH and measure the absorbance at 550 nm after 15 min. One unit of DAAO activity corresponds to the formation of 1 pmol min 1 of pyruvate at 37°C (Yu et al. 2002)
  • Substrate and product concentrations can be measured by HPLC with a reverse phase XDB C-18 column (Zorbax, 4.6 9 150 mm). Prepare the eluent (25 mM sodium phosphate, pH 3.5, 8% acetonitrile, v/v) and et the flow rate to 1 ml_ min 1 . Analytes can be detected at 254 nm. The retention times of the compounds are: 2.1 min for cephalosporin C, 3.2 min for a Ketoadipyl 7ACA, 8.7 min for Glutaryl-7ACA and 1.7 min for 7-ACA (Tan et al. 2010)
  • Boder ET Wittrup KD. Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 1997, 15(6):553-557.
  • TvDAOI Molecular cloning of TvDAOI , a gene encoding ad-amino acid oxidase from Trigonopsis variabilis and its expression in Saccharomyces cerevisiae and Kluyveromyces lactis.” Yeast 13.15 (1997): 1399-1408.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

1. Procédé pour la production d'un composé comprenant un groupe carbonyle en utilisant des cellules de levure exprimant une protéine de fusion comprenant une ancre de surface cellulaire liée à une oxydase, qui est présentée sur la surface des cellules de levure, comprenant les étapes suivantes : i. fourniture d'un substrat comprenant un groupe hydroxyle ; ii. fourniture des cellules de levure ; et iii. incubation des cellules de levure avec le substrat dans une solution aqueuse en présence de O2 pour produire au moins 10g/L du composé comprenant le groupe carbonyle, dans lequel l'oxydation du groupe hydroxyle du substrat en groupe carbonyle est catalysée par l'oxydase affichée en utilisant O2 comme accepteur d'électrons pour la régénération de l'oxydase ; et dans lequel le procédé est réalisé en l'absence de catalase hétérologue.
PCT/EP2021/067180 2020-06-23 2021-06-23 Production de composés carbonylés à l'aide de la présentation d'oxydases à la surface des cellules WO2021260022A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP20181688 2020-06-23
EP20181688.1 2020-06-23

Publications (1)

Publication Number Publication Date
WO2021260022A1 true WO2021260022A1 (fr) 2021-12-30

Family

ID=71138561

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2021/067180 WO2021260022A1 (fr) 2020-06-23 2021-06-23 Production de composés carbonylés à l'aide de la présentation d'oxydases à la surface des cellules

Country Status (1)

Country Link
WO (1) WO2021260022A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070105200A1 (en) 2004-05-03 2007-05-10 Chr-Hansen A/S Enzymatic process for obtaining increased yield of lactobionic acid
US8183030B2 (en) 2006-10-13 2012-05-22 Archer Daniels Midland Company Use of cell surface displays in yeast cell catalyst supports

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070105200A1 (en) 2004-05-03 2007-05-10 Chr-Hansen A/S Enzymatic process for obtaining increased yield of lactobionic acid
US8183030B2 (en) 2006-10-13 2012-05-22 Archer Daniels Midland Company Use of cell surface displays in yeast cell catalyst supports

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
ANGELINI ACHEN TFDE PICCIOTTO SYANG NJTZENG ASANTOS MS ET AL.: "Protein Engineering and Selection Using Yeast Surface Display", METHODS IN MOLECULAR BIOLOGY (CLIFTON, NJ, 2015, pages 3 - 36, XP009513202, DOI: 10.1007/978-1-4939-2748-7_1
BLAZIC M. ET AL.: "Directed Evolution of Cellobiose Dehydrogenase on the Surface of Yeast Cells Using Resazurin-Based Fluorescent Assay", APPLIED SCIENCES, vol. 9, no. 7, 2019, pages 1413, XP055749803, DOI: 10.3390/app9071413
BODER ETWITTRUP KD: "Yeast surface display for screening combinatorial polypeptide libraries", NAT BIOTECHNOL, vol. 15, no. 6, 1997, pages 553 - 557, XP002945515, DOI: 10.1038/nbt0697-553
DANIEL KRACHER ET AL: "Polysaccharide oxidation by lytic polysaccharide monooxygenase is enhanced by engineered cellobiose dehydrogenase", FEBS JOURNAL, vol. 287, no. 5, 18 September 2019 (2019-09-18), GB, pages 897 - 908, XP055749695, ISSN: 1742-464X, DOI: 10.1111/febs.15067 *
GAL I: "Yeast surface display of dehydrogenases in microbial fuel-cells", BIOELECTROCHEMISTRY, vol. 112, 2016, pages 53 - 60, XP029707154, DOI: 10.1016/j.bioelechem.2016.07.006
GAL IDAN ET AL: "Yeast surface display of dehydrogenases in microbial fuel-cells", BIOELECTROCHEMISTRY, ELESEVIER, AMSTERDAM, NL, vol. 112, 19 July 2016 (2016-07-19), pages 53 - 60, XP029707154, ISSN: 1567-5394, DOI: 10.1016/J.BIOELECHEM.2016.07.006 *
GONZALEZ, FRANCISCO J. ET AL.: "Molecular cloning of TvDAOl, a gene encoding ad-amino acid oxidase from Trigonopsis variabilis and its expression in Saccharomyces cerevisiae and Kluyveromyces lactis", YEAST, vol. 13.15, 1997, pages 1399 - 1408
KRACHER DFORSBERG ZBISSARO BGANGL SPREIMS MSYGMUND C ET AL.: "Polysaccharide oxidation by lytic polysaccharide monooxygenase is enhanced by engineered cellobiose dehydrogenase", FEBS J, 2019
MARIJA BLAZIC ET AL: "Directed Evolution of Cellobiose Dehydrogenase on the Surface of Yeast Cells Using Resazurin-Based Fluorescent Assay", APPLIED SCIENCES, vol. 9, no. 7, 3 April 2019 (2019-04-03), pages 1413, XP055749803, DOI: 10.3390/app9071413 *
MURPHYWEAVER: "Janeway's Immunobiology", 2017, JONES & BARTLETT LEARNING
NORDKVIST MNIELSEN PMVILLADSEN J ET AL.: "Oxidation of Lactose to Lactobionic Acid by a Microdochium nivale Carbohydrate Oxidase: Kinetics and Operational Stability", BIOTECHNOLOGY AND BIOENGINEERING, vol. 97, no. 4, 2007, pages 694 - 707
PURI VSTREAKER EPRABAKARAN PZHU ZDIMITROV DS: "Highly efficient selection of epitope specific antibody through competitive yeast display library sorting", MABS, vol. 5, no. 4, 2013, pages 533 - 539, XP055320832, DOI: 10.4161/mabs.25211
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", vol. 1 -3, 2012, COLD SPRING HARBOR LABORATORY PRESS
TAN QZHANG YSONG Q ET AL.: "Single-pot conversion of cephalosporin C to 7-aminocephalosporanic acid in the absence of hydrogen peroxide", WORLD J MICROBIOL BIOTECHNOL, vol. 26, 2010, pages 145
TAN T-CKRACHER DGANDINI RSYGMUND CKITTL RHALTRICH D ET AL.: "Structural basis for cellobiose dehydrogenase action during oxidative cellulose degradation", NAT COMMUN, vol. 6, no. 1, 2015, pages 7542, XP055526911, DOI: 10.1038/ncomms8542
YU JLI DYZHANG YJYANG SLI RBYUAN ZY: "High expression of Trigonopsis variabilis D-amino acid oxidase in Pichia pastoris", J MOL CATAL B ENZYM, vol. 18, 2002, pages 291 - 297
ZAMOCKY MSCHUMANN CSYGMUND CO'CALLAGHAN JDOBSON ADWLUDWIG R ET AL.: "Cloning, sequence analysis and heterologous expression in Pichia pastoris of a gene encoding a thermostable cellobiose dehydrogenase from Myriococcum thermophilum", PROTEIN EXPR PURIF., vol. 59, no. 2, 2008, pages 258 - 265, XP022637184, DOI: 10.1016/j.pep.2008.02.007

Similar Documents

Publication Publication Date Title
Pilone et al. D-amino acid oxidase as an industrial biocatalyst
US10428361B2 (en) Biocatalytic production of l-fucose
Gellissen et al. Recombinant Hansenula polymorpha as a biocatalyst: coexpression of the spinach glycolate oxidase (GO) and the S. cerevisiae catalase T (CTT1) gene
RU2294370C2 (ru) Способ получения спирта с использованием микроорганизма
CN105925518A (zh) 烯烃生产
JPH05507843A (ja) キシロース還元酵素およびキシリトール脱水素酵素をコードするｄｎａ配列を含む組換え酵母株
Khang et al. Fusion protein of Vitreoscilla hemoglobin with d‐amino acid oxidase enhances activity and stability of biocatalyst in the bioconversion process of cephalosporin C
WO2019008131A1 (fr) Pseudomonas putida recombinant destiné à la production de d-xylonate à partir de d-xylose
CN111454921A (zh) 一种酶活提高的酮还原酶突变体及其应用
US20220282227A1 (en) Recombinant heme thiolate oxygenases
Geueke et al. Overproduction and characterization of a recombinant D-amino acid oxidase from Arthrobacter protophormiae
JP2009514542A (ja) 主に１種のエナンチオマーを含む１，１，１−トリフルオロイソプロパノールの製造方法
CN111593077B (zh) 一种生物催化制备(r)-4-氯-3-羟基丁酸乙酯的方法
JP4133326B2 (ja) 新規なフルクトシルアミノ酸オキシダーゼ
CN109943542B (zh) 一种用于阿扎那韦中间体生产的醇脱氢酶
ES2358015T3 (es) Oxidorreductasa.
El-Enshasy et al. GpdA-promoter-controlled production of glucose oxidase by recombinant Aspergillus niger using nonglucose carbon sources
WO2021260022A1 (fr) Production de composés carbonylés à l'aide de la présentation d'oxydases à la surface des cellules
US20180362939A1 (en) Catalyst And Use Thereof
JPWO2015141761A1 (ja) フラビン結合型グルコース脱水素酵素
AU2004272775B2 (en) An NADH dependent L-xylulose reductase
JP2008212144A (ja) アルコール脱水素酵素、これをコードする遺伝子、およびそれを用いた光学活性（ｒ）−３−キヌクリジノールの製造方法
CN114806902B (zh) 一种获取非转基因的里氏木霉定向基因工程改良株的方法和应用
CN115786296B (zh) 一种内消旋-二氨基庚二酸脱氢酶突变体及生产方法
CN113913403B (zh) 一种nadh激酶突变体、编码基因及其应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21734843

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21734843

Country of ref document: EP

Kind code of ref document: A1