WO2021230704A1 - 지방조직에서 분리된 기질혈관분획의 수지상세포의 활성화 기능을 이용한 면역 반응 증진용 조성물 - Google Patents

지방조직에서 분리된 기질혈관분획의 수지상세포의 활성화 기능을 이용한 면역 반응 증진용 조성물 Download PDF

Info

Publication number
WO2021230704A1
WO2021230704A1 PCT/KR2021/006068 KR2021006068W WO2021230704A1 WO 2021230704 A1 WO2021230704 A1 WO 2021230704A1 KR 2021006068 W KR2021006068 W KR 2021006068W WO 2021230704 A1 WO2021230704 A1 WO 2021230704A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
dendritic cells
cells
tumor
antigen
Prior art date
Application number
PCT/KR2021/006068
Other languages
English (en)
French (fr)
Inventor
조남혁
이재원
장나윤
김영근
박범철
Original Assignee
서울대학교 산학협력단
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교 산학협력단, 고려대학교 산학협력단 filed Critical 서울대학교 산학협력단
Priority to EP21803905.5A priority Critical patent/EP4151224A4/en
Priority to US17/925,355 priority patent/US20230173065A1/en
Priority to CN202180035539.9A priority patent/CN116056716A/zh
Publication of WO2021230704A1 publication Critical patent/WO2021230704A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/35—Fat tissue; Adipocytes; Stromal cells; Connective tissues
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/57—Skin; melanoma
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/15—Cells of the myeloid line, e.g. granulocytes, basophils, eosinophils, neutrophils, leucocytes, monocytes, macrophages or mast cells; Myeloid precursor cells; Antigen-presenting cells, e.g. dendritic cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001103—Receptors for growth factors
    • A61K39/001104—Epidermal growth factor receptors [EGFR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001103—Receptors for growth factors
    • A61K39/001109—Vascular endothelial growth factor receptors [VEGFR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001116—Receptors for cytokines
    • A61K39/001121—Receptors for chemokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001128—CD44 not IgG
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001129—Molecules with a "CD" designation not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001169—Tumor associated carbohydrates
    • A61K39/00117—Mucins, e.g. MUC-1
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001169—Tumor associated carbohydrates
    • A61K39/001171—Gangliosides, e.g. GM2, GD2 or GD3
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/00118—Cancer antigens from embryonic or fetal origin
    • A61K39/001182—Carcinoembryonic antigen [CEA]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001184—Cancer testis antigens, e.g. SSX, BAGE, GAGE or SAGE
    • A61K39/001188—NY-ESO
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001193—Prostate associated antigens e.g. Prostate stem cell antigen [PSCA]; Prostate carcinoma tumor antigen [PCTA]; PAP or PSGR
    • A61K39/001195—Prostate specific membrane antigen [PSMA]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4615—Dendritic cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/462—Cellular immunotherapy characterized by the effect or the function of the cells
    • A61K39/4622—Antigen presenting cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0639—Dendritic cells, e.g. Langherhans cells in the epidermis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0653—Adipocytes; Adipose tissue
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0667—Adipose-derived stem cells [ADSC]; Adipose stromal stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5154—Antigen presenting cells [APCs], e.g. dendritic cells or macrophages
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5156—Animal cells expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55588—Adjuvants of undefined constitution
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/58—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation
    • A61K2039/585—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation wherein the target is cancer

Definitions

  • the present invention relates to a composition for enhancing an immune response using the activating function of dendritic cells of a stromal vascular fraction isolated from adipose tissue, and more particularly, to a composition for enhancing an immune response for anti-tumor use.
  • Dendritic cells strongly induce antigen-specific T cell responses in adaptive immunity. Promotion of dendritic cells in T cell responses is particularly important in antitumor immune responses. Dendritic cells capture tumor antigens characteristic of tumor cells and transport them to the nearest draining lymph node. In lymph nodes, dendritic cells present their tumor antigens as cytotoxic T lymphocytes through cross presentation. Based on their important role in antitumor efficacy and safety of clinical applications, dendritic cells are used in cancer immunotherapy. Although the first clinical trials were in the 1990s, the treatment response rate was less than 15% for 20 years. To improve the low response rate, dendritic cell therapy must overcome several obstacles.
  • dendritic cells it is important for dendritic cells to create an opportunity to migrate to the lymph nodes and encounter T cells to initiate an adaptive immune response.
  • Several papers have reported that less than 15% of dendritic cells can migrate to the lymph node and most remain at the injection site.
  • the tumor microenvironment also inhibits the antitumor immune response of lymph nodes near the tumor as well as at the tumor site, which limits the capabilities of dendritic cell-based immunotherapy. Therefore, it is essential to use the dendritic cells remaining at the injection site and avoid the effects of the tumor microenvironment in order to increase the antigen-specific immune response and fully exploit the potential of dendritic cell-based therapies.
  • Dendritic cells encounter T cells in special locations called "Specialized compartments of lymphoid organs" for proper T cell activation.
  • This organ is composed of different CD45-non-hematopoietic stromal cells, including fibroblastic reticular cells (FRC) and ednothelial cells.
  • FRC fibroblastic reticular cells
  • stromal cells can be divided into fibroblast markers podoplanin (PDPN, gp38) and endothelial cell marker CD31 (platelet endothelial cell adhesion molecule-1, PECAM-1) expression confirmation.
  • PDPN+CD31-FRC provides structural support by constructing a conduit system that delivers soluble antigens and forming a three-dimensional cellular network through which immune cells can migrate.
  • the chemokines CCL19 and CCL21 produced by FRC recruit CCR7+ T cells and dendritic cells. As a result, the interaction between T cells and dendritic cells is increased, dendritic cell maturation is promoted, and antigen presentation by dendritic cells is made.
  • FRC regulates the homeostasis of T cells and dendritic cells through secretion of interleukin (IL)-7 and IL-15.
  • IL-7 and IL-15 secretion of interleukin (IL)-7 and IL-15.
  • PDPN expressed in FRC promotes dendritic cell motility.
  • IL-6 secreted from FRC improved the survival and metabolism of CD8+ T cells through chromatin remodeling and led to the production of tissue-resident memory T cells.
  • PDPN+CD31+ lymphatic endothelial cells constitute influent and outflow lymphatic vessels that regulate leukocyte and lymph migration, and regulate T cell differentiation.
  • PDPN-CD31+ blood endothelial cells constitute high endothelial venules (HEV) and blood vessels.
  • HEV high endothelial venules
  • BECs are involved in the leakage of lymphocytes from the bloodstream. Therefore, since stromal cells are structurally and functionally helpful, dendritic cells in dendritic cell-based immunotherapy need the help of stromal cells that can induce a complete anti-tumor T-cell response. However, since stromal cells only exist in less than 5% of lymph nodes, it is virtually impossible to isolate these stromal cells and use them directly for therapeutics.
  • the present invention discloses that a stromal vascular fraction (SVF) isolated from adipose tissue present in a significant amount in the body can enhance the induction of anti-tumor T cell responses by dendritic cells, similar to stromal cells of lymph nodes.
  • SVF stromal vascular fraction
  • the present inventors separated and mixed visceral adipose tissue and subcutaneous adipose tissue, and the stromal vascular fraction (SVF) separated from the mixture was compared with lymph node stromal cells in phenotype and function. It was confirmed that it was composed of similar cells and that the SVF spheroids obtained by 3-dimensionally culturing the SVF could form blood vessels that serve as passageways for immune cells.
  • SVF stromal vascular fraction
  • SVF spheroids attract immune cells including dendritic cells in an in vitro test and enhance the interaction between dendritic cells and T cells when transplanted in vivo together with dendritic cells in an in vivo test. Confirmed. Furthermore, the present inventors found that the SVF two-dimensional culture promotes the activation of dendritic cells when co-cultured with dendritic cells in vitro or transplanted in vivo with dendritic cells loaded with a specific antigen (ovalbumin, OVA).
  • a specific antigen ovalbumin, OVA
  • the present invention is provided based on the experimental results as described above, and in one aspect, the stromal vascular fraction isolated from adipose tissue, particularly the spheroids of the stromal vascular fraction and dendritic cells loaded with the antigen, as an active ingredient It can be identified as a composition for enhancing an immune response comprising a.
  • the immune response refers to an adaptive immune response, preferably an immune response by a cell-mediated immune response, more preferably, a T cell.
  • the stromal vascular fraction isolated from adipose tissue may be used in the form of a two-dimensional culture or a spheroid that is a three-dimensional culture, but preferably may be used in the form of a spheroid.
  • the composition for enhancing immunity of the present invention can be identified as an antiviral immuno-enhancing composition for the treatment or prevention of viral infections, and the antigen loaded on the dendritic cells is pathogenic, such as bacteria.
  • a microorganism-derived antigen it can be identified as a composition for antimicrobial immunity for the treatment or prevention of infections caused by such microorganisms. It can be identified as a composition for enhancement.
  • composition for enhancing immunity of the present invention may be used for the treatment or prevention of any microbial infection, such as any viral infection, any bacterial infection, and preferably may be used as an anti-tumor application for any tumor treatment or prevention.
  • the dendritic cells may be autologous dendritic cells obtained from an individual to which the composition for enhancing immunity of the present invention is administered, allogeneic dendritic cells obtained from another individual, or heterogeneous dendritic cells obtained from a heterogeneous individual.
  • Dendritic cells obtained from heterogeneous individuals are obtained from mammals such as mice, rats, rabbits, monkeys, pigs, horses, cattle, sheep, antelopes, dogs and cats when the subject to which the composition for enhancing immunity of the present invention is administered is human. it could be These dendritic cells may be derived from bone marrow, peripheral blood, or umbilical cord blood.
  • the dendritic cells may be immature dendritic cells or mature dendritic cells, preferably mature dendritic cells.
  • mature dendritic cells express high concentrations of MHC type II molecules, T-cell co-stimulatory factors CD80, CD86, CD83, and immune-stimulating factors, such as cytokines IL-12, IL-10, and TNF, on the cell surface.
  • immune-stimulating factors such as cytokines IL-12, IL-10, and TNF
  • undifferentiated progenitor cells such as CD34+ hematopoietic cells, which can be isolated from bone marrow, peripheral blood, and umbilical cord blood and differentiated into microphages, dendritic cells, etc.
  • IFN- A method of culturing together with dendritic cell maturation factors such as ⁇ (European Patent No. 922,758), a method of culturing with dendritic cell maturation factors such as GM-CSF, TNF- ⁇ , IL-3 (European Patent No.
  • the stromal vascular fraction (SVF) isolated from adipose tissue can be obtained by being separated from adipose tissue by enzymatic isolation methods and mechanical isolation methods.
  • adipose tissue or lipoaspirate is washed 2-3 times with an aqueous salt solution such as PBS, LBS (Lactated Ringer's solution), HBSS (Hank's Balanced Salt Solution), etc.
  • An enzyme that decomposes extracellular matrix (ECM), etc. is treated in the washed adipose tissue or liposuction product.
  • This enzymatic treatment is usually performed while stirring at 37° C. for 30 minutes to 2 hours. After enzyme treatment, centrifugation is performed.
  • the enzyme-treated adipose tissue or liposuction product by centrifugation is divided into (i) adipose tissue or oil layer, (ii) aqueous solution layer, and (ii) pellet layer, and the remaining The layer is discarded and a pellet layer is obtained.
  • This pellet contains the matrix vascular fraction.
  • the enzyme that can be used for the purpose of decomposing the extracellular matrix, etc. is a first type of collagenase isolated from Clostridium histolyticum or a second type of collagenase.
  • a first type of collagenase isolated from Clostridium histolyticum or a second type of collagenase.
  • genase isolated from P. polymyxa Dispase
  • a neutral protease isolated from G. stearothermophilus or B. thermoproteolyticus Thermolysin and the like
  • enzyme mixtures such as CIzymeTM AS (Vitacyte LLC, Indianapolis, Indiana), which is a mixture of collagenase and dispase enzymes of the first and second types or collagenases of the first and second types and Thermo.
  • a lysine enzyme mixture, LiberaseTM Research Grade (Roche Diagnostic, Based, Switzerland), etc. may be used.
  • a nucleic acid degrading enzyme such as a DNA degrading enzyme decomposes the chromosomes flowed from the dead cells when the cells are separated, and consequently may be used for the purpose of improving the efficiency of cell separation.
  • the mechanical separation method is performed by washing and centrifuging as in the above enzymatic separation method to recover the pellet, and in order to facilitate the recovery of the pellet before centrifugation, shaking / vibrating may be performed on the washing. .
  • This stromal vascular fraction is composed of various cells such as lymphocytes, adipocyte precursors, adipocyte-derived stromal cells, fibroblasts, endothelial cells, and pericytes (Stem Cell Res Ther 2017 Jun 15;8(1)) :145).
  • lymphocytes die and are removed, and various types of adherent stromal cells can be obtained (Cytotherapy 15, 641-648, 2013).
  • the stromal vascular fraction can be obtained from adipose tissue of any mammal, more preferably human, mouse, rat, rabbit, monkey, pig, horse, cow, sheep, antelope, dog or cat fat. It can be obtained from a tissue, more preferably from a human, mouse, rat or monkey, and most preferably from a human or mouse.
  • the stromal vascular fraction can be obtained from any adipose tissue. It can be obtained from subcutaneous fat tissue or visceral fat tissue, which is a fat tissue around organs, and can be obtained from brown adipose tissue or white adipose tissue.
  • the two-dimensional culture of the stromal vascular fraction isolated from adipose tissue refers to a culture obtained by culturing the stromal vascular fraction in a two-dimensional monolayer so that one side of the cell culture is attached to a culture surface such as a culture dish.
  • the spheroids of the stromal vascular fraction isolated from adipose tissue are obtained in a spherical shape by three-dimensionally culturing the stromal vascular fraction isolated from adipose tissue.
  • Various three-dimensional culture methods for obtaining such spheroids are known in the art.
  • antigen loading to dendritic cells is performed by antigen processing to present antigen peptides in a complex form with MHC on the surface of dendritic cells, thereby selectively recognizing T cells having T cell receptors. It is to increase the immune response of antiviral, antimicrobial, antitumor, etc. by inducing the activity.
  • the peptide antigen itself is introduced and used, or an antigen-expressing gene such as RNA, an antigen-expressing viral vector, or a cell-penetrating peptide such as an antigen-bound Tat peptide of human immunodeficiency virus (HIV) is treated to dendritic cells.
  • HIV human immunodeficiency virus
  • Fe3O4-ZnO core (Fe3O4) cell (ZnO) structure nanoparticles (Fe3O4-ZnO core-shell nanoparticles, FZ -NP) can also be used. More specific methods for loading antigens into dendritic cells are described in Immunol Res. 2017, 65:798-810] and the like.
  • the antigen may be a virus-derived antigen, an antigen derived from pathogenic microorganisms such as bacteria, or a tumor-derived antigen. It may be a lysate of a cell, etc.
  • tumor antigens are preferably expressed only in cancer cells or overexpressed in cancer cells compared to normal cells, for example, epidermal growth factor receptor variant III (EGFRvIII) expressed in glioblastoma, anaplastic thyroid cancer or breast cancer, lung cancer, glioma ( EGFR (Epidermal growth factor receptor) overexpressed in glioma), metastin receptor overexpressed in papillary thyroid cancer, etc., ErbB-type receptor tyrosine kinases overexpressed in breast cancer, etc.; HER2 (Human epidermal growth factor receptor 2) overexpressed in breast cancer, bladder cancer, gallbladder cancers, cholangiocarcinomas, esophagogastric junction cancers, etc., tyrosine kinase-18 overexpressed in nutritive renal carcinoma -Receptor (c-Kit), HGF receptor c-Met overexpressed in esophageal adenocarcinoma, CXCR4 or CCR7 over
  • LMP1 (Latent membrane protein 1), lung cancer, non-Hodgkin's lymphoma, ovarian cancer, colon cancer, colon It may be tumor-necrosis factor-related apoptosis-inducing ligand receptor (TRAILR2) overexpressed in cancer, pancreatic cancer, etc., vascular endothelial growth factor receptor 2 (VEGFR2), an angiogenesis factor receptor, hepatocyte growth factor receptor (HGFR) overexpressed in hepatocellular carcinoma, etc. and may also be CD44, CD166, etc., which are surface antigens of cancer stem cells.
  • TRAILR2 tumor-necrosis factor-related apoptosis-inducing ligand receptor
  • VEGFR2 vascular endothelial growth factor receptor 2
  • HGFR hepatocyte growth factor receptor
  • CD44, CD166, etc. which are surface antigens of cancer stem cells.
  • the composition for enhancing immunity of the present invention can be used against any cancer cell expressing an antigen mounted on dendritic cells when it is used for antitumor purposes.
  • Cancer cells include esophageal cancer, stomach cancer, colorectal cancer, rectal cancer, oral cancer, pharyngeal cancer, laryngeal cancer, lung cancer, colon cancer, breast cancer, cervical cancer, endometrial cancer, ovarian cancer, prostate cancer, testicular cancer, melanoma, bladder cancer, kidney cancer, liver cancer, pancreatic cancer , bone cancer, connective tissue cancer, skin cancer, brain cancer, thyroid cancer, leukemia, Hodgkin's disease, lymphoma, multiple myeloma, hematologic cancer, etc.
  • anti-tumor refers to apoptosis of cancer cells, reduction in viability of cancer cells, suppression or delay of pathological symptoms of cancer due to inhibition of proliferation of cancer cells, suppression of cancer metastasis, and suppression of cancer recurrence.
  • composition for enhancing immunity of the present invention may be used in combination or in combination with any approved antiviral agent, any antimicrobial agent (ie, antibiotic), or any anticancer agent.
  • the anticancer agent includes any anticancer agent that is cytotoxic to cancer cells, such as a metabolic antagonist, an alkylating agent, a topoisomerase antagonist, a microtubule antagonist, and a plant-derived alkaloid, any cytokine drug, any antibody medicines, any immune checkpoint inhibitor drugs, and any cell therapy (car-T cell therapy, car-NK cell therapy) drugs, and the like.
  • taxol nitrogen mustard, imatinib, oxaliplatin, gefitinib, bortezomib, sunitinib, carboplatin, cisplatin, rituximab, erlotinib, sorafenib, IL-2 drugs, INF- ⁇ drugs, INF drugs - ⁇ drugs, trastuzumab, blinatumomab, ipilimumab, pepbrolizumab, nivolizumab, atezolizumab, duvalumab, bevacizumab, cetuximab, Tisagenlecleucel, Kymria), Axicabtagene Ciloleucel, etc.
  • anticancer agents may be exemplified, and in addition to these exemplified anticancer agents, other anticancer agents known in the art are used in combination with the composition of the present invention without limitation. or may be used in combination.
  • composition of the present invention may be formulated by a conventional method known in the art according to the route of administration, including a pharmaceutically acceptable carrier or excipient, to prepare a pharmaceutical composition.
  • Such pharmaceutically acceptable carriers or excipients do not inhibit the activity or properties of drugs without being particularly toxic to the human body, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, algae nate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water (eg, saline and sterile water), syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc , magnesium stearate, mineral oil, Ringer's solution, buffer, maltodextrin solution, glycerol, ethanol, dextran, albumin, or any combination thereof.
  • a suitable carrier or excipient is one of saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and the like.
  • the above components may be used alone or in combination, and if necessary, other conventional pharmaceutical additives such as antioxidants, buffers, and bacteriostats may be added and used.
  • the pharmaceutical composition of the present invention may be formulated for parenteral administration, particularly injection, and in this case, it may be prepared in the form of unit dose ampoules or multiple doses.
  • the pharmaceutical composition of the present invention may be formulated in the form of a solution, suspension, or the like.
  • the pharmaceutical composition of the present invention is formulated in a dosage form of a unit dosage form suitable for administration in the body of a patient according to a conventional method in the pharmaceutical field, and the skin, lesion ( intralesional), intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intraventricular, pulmonary, transdermal, subcutaneous, intraperitoneal, intranasal, gastrointestinal, topical, sublingual, intravaginal, rectal route, renal capsule, etc. It may be administered by a parenteral route of administration.
  • the dosage (effective amount) of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity. may be prescribed, and a person skilled in the art can appropriately determine the dosage in consideration of these factors.
  • the pharmaceutical composition of the present invention is prepared as an injection in the form of a unit dose, and when prepared as an injection in the form of a unit dose, the stromal vascular fraction spheroids or dendritic cells included per unit dose of the pharmaceutical composition of the present invention are It can be in the range of 10 2 -10 8 cells.
  • the present invention relates to a method for enhancing immunity comprising administering to a subject, such as a patient, an effective amount of the pharmaceutical composition for enhancing immunity of the present invention as described above.
  • a subject such as a patient
  • an effective amount of the pharmaceutical composition for enhancing immunity of the present invention as described above.
  • the composition for immunity enhancement of the present invention is used for antiviral purposes by including dendritic cells loaded with viral antigens
  • the immunity enhancement method may be used for treatment or prevention of viral infections
  • the composition for immunity enhancement of the present invention contains pathogenic bacteria such as bacteria.
  • the immuno-enhancement method When used for antimicrobial purposes by including dendritic cells loaded with microbial antigens, the immuno-enhancement method may be used for treating or preventing infection of pathogenic microorganisms, and the immune-enhancing composition of the present invention includes dendritic cells loaded with tumor antigens Thus, when used for anti-tumor purposes, the immune-enhancing method may be anti-tumor (cancer treatment or prevention) use.
  • the immunostimulating method of the present invention can be applied to any viral infection having such an antigen, a microbial infection having such an antigen, and any carcinoma having such an antigen.
  • the immunostimulating method of the present invention When used for the treatment or prevention of cancer for anti-tumor use, it may be used in combination with other cancer therapies without limitation.
  • the effective amount of the present invention can exhibit the intended medical effect, such as cancer treatment or prevention effect, when the composition of the present invention is administered during the administration period according to the recommendation of a medical professional, etc. It refers to the amount by which the composition is administered.
  • Such an effective amount can be appropriately determined by a person skilled in the art, such as a medical professional, according to the patient's age, weight, sex, pathological condition, and the like, as described above.
  • the present invention provides a composition for enhancing an immune response comprising, as active ingredients, spheroids and dendritic cells of the stromal vascular fraction isolated from adipose tissue, particularly the stromal vascular fraction, or administering such a composition to a subject, such as a patient, in an effective amount. It can be identified as an immune enhancement method comprising the steps.
  • the present inventors confirmed that the interaction between dendritic cells and T cells was enhanced when spheroids of the stromal vascular fraction isolated from adipose tissue were transplanted together with dendritic cells in vivo.
  • T cells were effectively activated by promoting the activation of dendritic cells and improving the survival rate of dendritic cells.
  • composition for enhancing an immune response of the present invention or an immune enhancing method by administering such a composition is also related to the immunostimulating composition of the present invention comprising a vascular matrix fraction and an antigen-loaded dendritic cell, or an immune enhancing method using such a composition.
  • the immunostimulating composition of the present invention comprising a vascular matrix fraction and an antigen-loaded dendritic cell, or an immune enhancing method using such a composition.
  • it may be used for antiviral use, antimicrobial use, or antitumor use, and these compositions and methods may also be specified and used as described above.
  • the present invention relates to a dendritic cell maturation composition
  • a dendritic cell maturation composition comprising, as an active ingredient, a stromal vascular fraction isolated from adipose tissue, particularly a spheroid of the stromal vascular fraction.
  • the present inventors have investigated various factors such as chemokines (Spp1, Ccl8, Cxcl5, Postn, Cxcl16, Ccl17, etc.) and high expression of osteopontin, a factor known to regulate the maturation and survival of dendritic cells. It was confirmed that the activation of dendritic cells was promoted and the survival rate of dendritic cells was improved.
  • chemokines Spp1, Ccl8, Cxcl5, Postn, Cxcl16, Ccl17, etc.
  • dendritic cells In order to utilize dendritic cells for immunotherapy, etc. for anti-tumor purposes, it is essential to develop a technology to differentiate and manufacture dendritic cells ex vivo, as well as a maturation technology to effectively induce a T-cell immune response.
  • mature dendritic cells express a large amount of cytokines such as IL-12, IL-10, and TNF, and these cytokines are directly involved in the induction of T cell immune responses. These changes through maturation greatly increase the ability of dendritic cells to induce T cell immune responses.
  • the dendritic cell maturation composition of the present invention is IFN- ⁇ , IL-1 ⁇ , IL-6, IL-3, TNF- ⁇ , IFN- ⁇ , PGE2, OK432 (Picibanil), etc. known in the art as a dendritic cell maturation factor. may be further included, and may be used in addition to RPMI (Roswell Park Memorial Institute) 1640 medium, X-VIVO15, a serum free medium, and the like.
  • RPMI Roswell Park Memorial Institute
  • the dendritic cell maturation composition of the present invention may be prepared as a pharmaceutical composition and administered to a subject such as a patient or used for the purpose of maturation and proliferation of dendritic cells ex vivo.
  • a composition for enhancing an immune response using the activation function of dendritic cells of the stromal vascular fraction isolated from adipose tissue specifically, the stromal vascular fraction isolated from adipose tissue, in particular, the stromal vascular fraction spheroid and antigen
  • a composition for enhancing an immune response comprising the loaded dendritic cells as an active ingredient, a stromal vascular fraction isolated from adipose tissue, in particular, a composition for enhancing immune response comprising spheroids and dendritic cells of the stromal vascular fraction as active ingredients can do.
  • composition of the present invention may be used for antiviral use, antimicrobial use, antitumor use, and the like.
  • FIG. 6 is a result showing that the spheroids of the lipid vascular fraction isolated from adipose tissue can form blood vessels serving as passageways for immune cells.
  • mice implanted with B16 melanoma cells (B16-OVA) expressing tumor antigen (OVA) together with dendritic cells loaded with tumor antigen (OVA) in spheroids of lipid vascular fraction isolated from adipose tissue.
  • mice C57BL/6 wild-type mice (Koatech, Seoul, Republic of Korea) and C57BL/10NAGCSAni-(KO) Rag2(H-2b) mice (Taconic Biosciences, NY, US) were bred in a pathogen-free facility located at Seoul National University School of Medicine. became All mice were male and mice aged 6-12 weeks were used. All mouse experiments were approved by Seoul National University's Institutional Animal Care and Use Committee (IACUC) (IACUC Number: SNU-150115-2-7, SNU-160212-2-7, SNU-171123-4-7) ).
  • IACUC Institutional Animal Care and Use Committee
  • bovine serum albumin containing 0.8 mg/ml collagenase and 100ug/ml DNAase I (DNaseI).
  • BSA bovine serum albumin
  • SVF stromal vascular fraction
  • FIG. 1a Dulbecco's Modified Eagle Medium (Welgene, Daegu, Republic of Korea) containing 10% fetal bovine serum (Gibco, MA, US) and 1% penicillin/streptomycin (Gibco, MA, US).
  • Dulbecco's Modified Eagle Medium containing 10% fetal bovine serum (Gibco, MA, US) and 1% penicillin/streptomycin (Gibco, MA, US).
  • SVF cultured for 6-10 days was treated with trypsin and counted.
  • the cultured SVF was dispensed on a spheroid film (Incyto, Cheonan, Republic of Korea). It was confirmed that 361 SVF-spheroids (19X19) were formed on the spheroid film, and after culturing it for two days or more, SVF-spheroids were used for the experiment.
  • ZBP ZnO-binding peptide
  • OVA ovalalbumin
  • ZBP ZnO-binding peptide
  • OVA ovalalbumin
  • the extracted DNA is amplified by PCR (Forward primer: 5'-TTT GAA TTC ATG GGC TCC ATC GGT GCA-3' SEQ ID NO: 1, Reverse primer: 5'-AAA CTC GAG AGG GGA AAC ACA TCT GCC-3', EcoRI , XhoI restriction sites underlined) and cloned from the pET23d-ZBP vector encoded with 3xZBP (BamHI-RPHRKGGDARPHRKGGDARPHRKGGDA-EcoRI, SEQ ID NO: 3).
  • the cloned vector pET23d-ZBPOVA was transformed into the E.
  • coli HIT Competent BL21 strain (RBCBioscience, New Taipei City, Taiwan) according to the manufacturer's instructions.
  • IPTG isopropylthiogalactoside
  • the lysate was centrifuged, the supernatant was collected, filtered, and purified by column using AKTAstart (GEHealthcare, IL, US) and HisTrapTM FF (GEHealthcare, IL, US). Proteins were dialyzed in PBS at 4° C. overnight. Endotoxin was removed from the purified protein using Triton X-114 as previously described (Microbial cell factories 10, 57, 2011). Endotoxin contamination of purified proteins was checked using the Pierce LAL Chromogenic Endotoxin Quantification Kit (Thermo Fisher Scientific, MA, US) according to the manufacturer's instructions. Purified ZBPOVA protein was quantified by SDS-PAGE and stored at -80°C until further use.
  • bone marrow was isolated and differentiated into dendritic cells. Briefly, the bone marrow of Rag2-deficient (knock-out) mice was isolated, and 10% FBS, 1.5ng/ml recombinant mouse GM-CSF (PeproTech, NJ, US), 1.5ng/ml mouse IL-4 (PeproTech, Iscove's supplemented with 1% penicillin/streptomycin, 50 ⁇ g/ml gentamicin (Gibco, MA, US), 2 mM L-glutamine (Gibco, MA, US), 50 nM ⁇ -mercaptoethanol (Gibco, MA, US) It was cultured in modified Eagle medium (IMDM) (Gibco, MA, US).
  • IMDM modified Eagle medium
  • Immature dendritic cells were cultured for 6-8 days. The medium was changed every other day.
  • Fe3O4-ZnO core-shell nanoparticles Fe3O4-ZnO core-shell nanoparticles, FZ-NP
  • BMDCs bone marrow-derived dendritic cells
  • 100ug FZ-NPs were washed 3 times with PBS, and FZ-NPs were incubated at room temperature for 1 hour to bind with 20ug ZBP-OVA. Then, ZBP-OVA and FZ-NPs (NP-OVA) were washed 3 times with IMDM.
  • dendritic cells were incubated with NP-OVA at 37° C. for 1 hour.
  • dendritic cells were treated with 1ug/ml lipopolysaccharide (LPS) for 16-18 hours.
  • LPS lipopolysaccharide
  • Cells were prepared from 10% goat serum (Thermo Fisher Scientific, MA, US), 10% rat serum (Thermo Fisher Scientific, MA, US), 10% mouse serum (Sigma-Aldrich, MO, US), 10 ⁇ g/ml anti- Blocking was performed with a super-block solution composed of CD16/CD32(2.4G2) antibody (BD Pharmingen, NJ, US).
  • Live cells were separately stained with Zombi Aqua (Biolegend, CA, US) or 7-aminoactinomycin D (7-AAD) (BD Pharmingen, NJ, US). Cells were measured using a LSRFortessa X-20 flow cytometer, a BD LSRII flow cytometer (BD Pharmingen, NJ, US), and a CytoFLEX S (Beckman Coulter, CA, US). Data were analyzed with FlowJo software (Tree Star, Ashland, OR, USA).
  • RNA extraction was performed using Trizol reagent according to a standard protocol.
  • Complementary (complementary) DNA cDNA was sequentially synthesized using a reverse transcript premix kit (Intron, Seoul, Republic of Korea).
  • cDNA Complementary DNA
  • mRNA expression was analyzed using SYBR Green master mix (Life Technologies, CA, US) and CFX Real Time PCR Detection System (Bio-Rad Laboratories, CA, US). was measured by quantitative PCR (qPCR). Each sample was run in two replicates. Relative mRNA expression was calculated based on the value of ⁇ -actin (Actb). Primers are summarized in Table 1.
  • RNA quality was measured with an Agilent 2100 bioanalyzer using an RNA 6000 Nano Chip (Agilent Technologies, Amstelveen, Netherlands), and the amount of RNA was quantified using an ND-2000 Spectrophotometer (Thermo Fisher Scientific, MA, US). . Libraries were generated from total RNA using the SMARTer Stranded RNA-Seq Kit (Clontech Laboratories, CA, US).
  • Polyadenylated mRNA was specifically isolated using Poly(A) RNA Selection Kit (LEXOGEN, Vienna, Austria), and shearing for cDNA synthesis, fragmentation and PCR amplification were sequentially performed. Average fragment size was measured with an Agilent 2100 bioanalyzer and quantification was assessed with a StepOne Real-Time PCR System (Life Technologies, CA, US). Libraries were sequenced with paired-end 100-bp reads by HiSeq 2500 (Illumina, CA, US). The sequencing data were tabulated using TopHat. Data were analyzed with ExDEGA (E-biogen, Seoul, Republic of Korea) and visualized with Prism 8 (GraphPad, CA, US).
  • CCL21 and osteopontin at the translational level in the cell culture supernatant were measured with an ELISAM kit purchased from Research and Diagnostic Systems (MN, US) and Lifespan Biosciences (WA, US), respectively, according to the manufacturer's instructions.
  • a chemotaxis assay was performed using a ⁇ -Slide Chemotaxis kit (Cat#80326; Ibidi, Germany) according to the manufacturer's instructions. 1.5 mg/ml Type I Collagen solution (Corning, NY, US) was injected into the observation area. SVF-spheroids or medium in the medium were injected into the left space and splenocytes were inserted into the right space. Live cell imaging was taken with an FV1000 (Olympus corporation, Tokyo, Japan) during a 24-hour incubation period.
  • section samples were fixed in 4% paraformaldehyde and FITC-labeled anti-CD3, FITC-labeled anti-CD8 (BD Pharmingen, NJ, US), alexa 647-labeled anti-CD31, alexa 594- labeled anti-PDPN, alexa 647-labeled anti-CD11c, Alexa 647-labeled anti-CD4 (Biolegend, CA, US), alexa 594-labeled anti-VEGFR3 (Bioss Antibodies, MA, US), 4′,6-diamidino Stained with -2-phenylindole (DAPI; Thermo Fisher Scientific, MA, US). Confocal images were taken with FV3000 (Olympus corporation, Tokyo, Japan) and analyzed with IMARIS version 9.3 (Bitplane, Zurich, Switzerland).
  • each combination (1x10 6 dendritic cells/mouse or 361 SVF-spheroids/mouse or both) was Each mouse was implanted in the renal capsule twice, once in different weeks.
  • the dendritic cells injected in each group were intracellularly ingested with NP-OVA and then transplanted, and the same amount of NP-OVA was injected into the SVF-spheroid-only transplanted group.
  • spleen cells isolated from each mouse were presented by H-2K b major histocompatibility complex (MHC) type I and IA b MHC type II, respectively, to proliferate OVA-specific T cells, respectively.
  • MHC major histocompatibility complex
  • OVA 257-264 peptide and OVA 339-323 peptide were incubated. After incubation for 24 hours, the cells were stained with anti-MHC tetramer at 4° C. for 30 minutes, and cell surface staining was performed for an additional 30 minutes, followed by flow cytometry.
  • the APC-labeled tetramer SIINFEKL-H-2K b and the PE-labeled tetramer AAHAEINEA-IA b were provided by the National Institutes of Health Tetramer Core Facility in the United States.
  • OVA-expressing malignant melanoma B16MO5 (5 ⁇ 10 4 cells/mouse) was injected into the left flank of mice. After 7 days, each combination (1 ⁇ 10 6 dendritic cells/mouse, 361 SVF spheroids/mouse) was inserted under the renal capsule 3 times weekly. Each group consisted of 5 mice. To investigate the antitumor effect, tumor size and survival rates were evaluated. Tumor size was measured every 2-3 days. Tumor volume (mm 3 ) was calculated as 1/2 ⁇ [(shorter diameter) ⁇ (long diameter) 2 ]. When the tumor size grew beyond 2000 mm 3 , mice were considered dead.
  • RNA sequencing was performed with ExDEGA version 2.5.
  • CD4+ T cells, CD8+ T cells, and B220+ B cells were rapidly decreased, and CD11c+ dendritic cells were maintained until 10 days of culture ( FIGS. 2a to 2d ), and CD11b+ F4/ 80+ macrophages and Gr-1+ neutrophils were decreased (Fig. 2e. 2f).
  • P#0, P#1, and P#2 denote passage numbers 0, 1, and 2, respectively.
  • a subtype of lymph node stromal cells uses PDPN and CD31 markers to form PDPN+ CD31- fibroblastic reticular cells (FRC), PDPN+ CD31+ lymphatic endothelial cells, LEC) and PDPN- CD31+ are classified as blood endothelial cells (BEC). It was confirmed that the CD45- cell group showed characteristics classified into PDPN+ CD31-, PDPN+ CD31+, and PDPN- CD31+ similar to the phenotype of lymph node stromal cells ( FIGS. 3a to 3e ). In particular, it was confirmed that SVF showed a phenotype of FRC (PDPN+CD31-) of 60% or more when cultured for 5 days or more, and 80% or more when cultured for 10 days or more (Fig. 3b).
  • TLR3-agonist PolyI:C, plC
  • TLR7-agonist Imiquimod
  • ⁇ LT ⁇ R ⁇ LT
  • LT ⁇ R ligand anti-LT ⁇ R, LIGHT, L
  • SVF spheroids SPH
  • SVF SVF spheroids
  • PDPN-CD31+ BEC CD31+ cells
  • PDPN+ CD31+ LEC CD31+ LEC
  • vascular endothelial growth factor ⁇ (Vegfa) gene, platelet derived growth factor C (Pdgfc) gene, which are factors inducing angiogenesis, increased, and Mmp 8, 10 and Mmp 8, 10 and 13 (Matrix metalloproteinase 8, 10, 13) gene expression was also increased, and the expression of Spp1, Ccl8, Cxcl5, Postn, Cxcl16, Ccl17 genes, which are factors that attract and activate immune cells, also increased.
  • the expression of gene Spp1 for osteopontin a factor known to regulate the maturation and survival of dendritic cells, was increased.
  • the concentration in SVF spheroids was very high (Fig. 7b).
  • a migration assay was performed using a collagen layer for 24 hours. As a result, splenocytes on the right were It was confirmed that the SVF spheroids (SPH) were moved over time (FIG. 8a).
  • SPH SVF spheroids
  • FIG. 8a Regarding the ability of SVF spheroids to attract immune cells, when migration assay was performed on CD3+ T cells and bone marrow-derived dendritic cells (BMDCs), which are dendritic cells, CD3+ T cells did not migrate, but dendritic BMDCs was confirmed to migrate to the SVF spheroids (Figs. 8b, 8c, 8d).
  • the T cells attracted by the SVF spheroids contained CD4+, CD8+ T cells and CD11c+ dendritic cells ( FIGS. 10a and 10b ), and when quantified by flow cytometry, mature dendritic cells (mDC) and SVF In the spheroid-implanted group (SPH+mDC), it was confirmed that there were the most CD3+ T cells and CD4+ T cells, and it was also confirmed that there were many CD8+ T cells and CD11c+ dendritic cells (Figs. 10c-10j). . These results can be said to show that SVF spheroids can increase CD3+ T cell infiltration when coexisting with dendritic cells.
  • the attracted T cells were CD62L-CD44+ effector T cells, CD62L+CD44+ memory T cells, CD62L+CD44- When analyzed in more detail by flow cytometry to determine the status of immature T cells (CD62L+CD44- naive T cells), among the T cells gathered in the graft, CD4+ effector T cells accounted for the most ( 11a, 11b).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • Oncology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Hematology (AREA)
  • Developmental Biology & Embryology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Molecular Biology (AREA)
  • Rheumatology (AREA)
  • Dermatology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Pregnancy & Childbirth (AREA)
  • Reproductive Health (AREA)
  • Vascular Medicine (AREA)
  • Hospice & Palliative Care (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 지방조직에서 분리된 기질혈관분획의 수지상세포의 활성화 기능을 이용한 면역 반응 증진용 조성물에 관한 것으로, 특히 항종양 용도의 면역 반응 증진용 조성물을 개시한다.

Description

지방조직에서 분리된 기질혈관분획의 수지상세포의 활성화 기능을 이용한 면역 반응 증진용 조성물
본 발명은 지방조직에서 분리된 기질혈관분획의 수지상세포의 활성화 기능을 이용한 면역 반응 증진용 조성물에 관한 것으로, 특히 항종양 용도의 면역 반응 증진용 조성물에 관한 것이다.
수지상 세포는 적응 면역에서 항원-특이적 T 세포 반응을 강하게 유도한다. T 세포 반응에서 수지상 세포의 촉진은 특히 항종양 면역 반응에서 중요하다. 수지상 세포는 종양세포에서 특징적으로 보이는 종양 항원을 잡아 가장 가까운 림프절 (draining lymph node)로 운반한다. 림프절에서 수지상세포는 교차 제시(cross presentation)를 통해 세포독성 T 림프구로 가지고 있던 종양 항원을 제시한다. 항종양 효능에서의 중요한 역할과 임상 적용의 안전성을 기반으로, 수지상 세포는 암 면역치료법에 이용된다. 첫 임상시험은 1990년대에 있었지만, 치료 반응률은 20년 동안 15% 미만이었다. 낮은 반응률을 향상시키기 위해서 수지상세포 치료법은 몇 가지 장애물들을 극복해야 한다. 먼저 수지상세포가 림프절로 이동하고 적응 면역 반응을 개시하기 위해 T 세포와 만날 기회를 만드는 것이 중요하다. 여러 논문에서 15% 미만의 수지상 세포만이 림프절로 이동할 수 있으며 대부분이 주입한 부위에 남아있다고 보고하였다. 더욱이, 종양미세환경은 종양 부위 뿐만 아니라 종양 근처의 림프절의 항종양 면역 반응도 억제하는데, 이는 수지상 세포 기반 면역치료가 가진 능력을 제한한다. 그러므로 항원 특이적 면역 반응을 증가시키고 수지상 세포 기반 치료법이 가진 가능성을 완전히 이용하기 위해서는 주입한 부위에 남아있는 수지상 세포를 이용하고 종양미세환경의 효과를 피하는 것은 필수적이다.
수지상 세포는 적절한 T 세포 활성화를 위한 "림프성 기관의 특별화된 구획 (Speciallized compartments of lymphoid organs)"이라고 불리는 특별한 위치에서 T 세포와 만난다. 이 기관은 섬유 간질세포(fibroblastic reticular cells, FRC)와 내피 간질세포(ednothelial cell)를 포함하는 서로 다른 CD45- 비조혈 간질세포 (non-hematopoietic stromal cell)로 구성된다. 간질세포는 일반적으로 섬유아세포 마커인 포도플라닌(PDPN, gp38)과 내피세포 마커인 CD31(platelet endothelial cell adhesion molecule-1, PECAM-1)의 발현 확인으로 구분할 수 있다. PDPN+ CD31- FRC 는 수용성 항원을 전달하는 conduit system 을 구성하고 면역 세포가 이동할 수 있는 3차원 세포 네트워크를 형성함으로써 구조적인 지지를 제공한다. FRC에 의해 생산되는 케모카인인 CCL19과 CCL21은 CCR7+ T 세포와 수지상 세포를 불러온다. 그 결과, T 세포와 수지상 세포의 상호작용이 증가하고, 수지상세포의 성숙이 촉진되며 수지상 세포에 의한 항원 제시가 이루어진다. 또한 FRC는 인터루킨(IL)-7과 IL-15의 분비를 통해 T 세포와 수지상세포의 항상성을 조절한다. 추가적으로, FRC에서 발현되는 PDPN은 수지상세포의 이동성 (motility)을 촉진한다. 최근에, FRC에서 분비된 IL-6는 염색질 리모델링을 통해 CD8+ T 세포의 생존과 대사를 향상시키고 조직에 상주하는 기억 T 세포를 생산하도록 이끌었다. PDPN+CD31+ lymphatic endothelial cells (LEC)은 백혈구와 림프의 이동을 조정하는 유입 림프관과 유출 림프관을 구성하고, T 세포의 분화를 조절한다. PDPN-CD31+ blood endothelial cells(BEC)는 high endothelial venules(HEV)와 혈관을 구성한다. BEC는 혈류에서 림프구의 혈구 누출에 관여한다. 따라서 기질세포가 구조적이고 기능적으로 도움을 주기 때문에, 수지상 세포 기반 면역치료에서 수지상 세포는 완전한 항종양 T 세포 반응을 유도할 수 있는 기질세포의 도움이 필요하다. 그러나 기질 세포는 림프절 내에 단지 5% 미만만 존재하기 때문에 이러한 기질 세포를 분리하여 치료제에 직접 이용하는 것은 사실상 불가능에 가깝다.
본 발명은 몸에 상당량 존재하는 지방 조직으로부터 분리한 기질혈관분획(stromal vascular fraction, SVF)이 림프절의 기질 세포와 유사하게 수지상세포에 의한 항종양 T 세포 반응 유도를 향상킬 수 있음을 개시한다.
본 발명의 목적은 지방조직에서 분리된 기질혈관분획의 수지상세포의 활성화 기능을 이용한 면역증진용 조성물을 제공하는 데 있다.
본 발명의 다른 목적이나 구체적인 목적은 이하에서 제시될 것이다.
본 발명자들은 아래의 실시예에서 확인되는 바와 같이, 내장 지방조직과 피하 지방조직을 분리하여 혼합하고 그 혼합물로부터 분리한 기질혈관분획(stromal vascular fraction, SVF)이 표현형이나 기능에 있어서 림프절 기질세포와 유사한 세포들로 구성되어 있음과, 상기 SVF를 3차원 배양하여 얻은 SVF 스페로이드(spheroid)가 면역세포의 이동 통로가 되는 혈관을 형성할 수 있음을 확인하였고, SVF 스페로이드가 면역세포를 불러들이고 활성화시키는 케모카인 등 다양한 인자들(Spp1, Ccl8, Cxcl5, Postn, Cxcl16, Ccl17 등)를 높게 발현하고 또 수지상세포의 성숙과 생존을 조절하는 인자로 알려진 인자인 오스테오폰틴(osteopontin, Spp1)도 높게 발현함을 확인하였으며, 또 SVF 스페로이드가 시험관내 시험에서 수지상세포를 비롯한 면역세포를 유인하며 생체내 시험에서 수지상세포와 함께 생채내에서 이식될 때 수지상세포와 T 세포의 상호작용을 증진시킴을 확인하였다. 나아가 본 발명자들은 SVF 2차원 배양물을 수지상세포와 시험관내에서 공동배양하거나 특정 항원(ovalbumin, OVA)이 탑재된 수지상세포와 함께 생체내에 이식하였을 때 SVF 2차원 배양물이 수지상세포의 활성화를 촉진하고 수지상세포의 생존율을 향상시킴으로써 효과적으로 T 세포를 활성화시켜 항원 특이적 T 세포의 반응을 증진시킴을 확인하였으며, 특정 항원(OVA)을 발현하는 B16 멜라노마 세포(B16-OVA)가 이식된 마우스에 SVF 스페로이드가 그 항원(OAV)이 탑재된(OVA-loaded) 수지상세포와 함께 주입될 경우 종양이 성장이 억제되고 실험동물의 생존율도 향상됨을 확인하였다.
본 발명은 전술한 바의 실험 결과에 기초하여 제공되는 것으로, 본 발명은 일 측면에 있어서, 지방조직에서 분리된 기질혈관분획 특히 그 기질혈관분획의 스페로이드와 항원이 탑재된 수지상세포를 유효성분으로 포함하는 면역반응 증진용 조성물로 파악할 수 있다. 여기서 면역반응은 적응 면역 반응(Adaptive immune response), 바람직하게는 세포 매개 면역 반응(cell-mediated immune response) 더 바람직하게는 T 세포에 의한 면역반응을 의미한다.
본 발명에서, 지방조직에서 분리된 기질혈관분획은 2차원 배양물 형태 또는 3차원 배양물인 스페로이드 형태로 사용될 수 있으나, 바람직하게는 스페로이드 형태로 사용될 수 있다.
본 발명의 면역증진용 조성물은 수지상세포에 탑재된 항원이 바이러스 유래 항원일 경우 바이러스 감염증 치료 또는 예방을 위한 항바이러스용 면역증진용 조성물로 파악될 수 있고, 수지상세포에 탑재된 항원이 박테리아 등 병원성 미생물 유래 항원일 경우 그러한 미생물에 의한 감염증 치료 또는 예방을 위한 항미생물용 면역증진용 조성물로 파악될 수 있으며, 수지상세포에 탑재된 항원이 종양세포 유래 항원일 경우 종양 치료 또는 예방을 위한 항종양 면역증진용 조성물로 파악될 수 있다.
본 발명의 면역증진용 조성물은 임의의 바이러스 감염증, 임의의 박테리아 등 미생물 감염증 치료 또는 예방을 위한 용도로 사용될 수 있으며, 바람직하게는 임의의 종양 치료 또는 예방을 위한 항종양 용도로 사용될 수 있다.
본 발명에서, 수지상세포는 본 발명의 면역증진용 조성물이 투여되는 개체로부터 얻어진 자가(autologous) 수지상세포이거나, 다른 개체로부터 얻어진 동종의 수지상세포이거나 이종의 개체로부터 얻어진 이종의 수지상세포일 수 있다. 이종의 개체로부터 얻어진 수지상세포는 본 발명의 면역증진용 조성물이 투여되는 개체가 사람일 경우 마우스, 래트, 토끼, 원숭이, 돼지, 말, 소, 양, 영양, 개, 고양이 등의 포유동물로부터 얻어진 것일 수 있다. 이러한 수지상세포는 골수, 말초혈, 제대혈 유래일 수 있다.
본 발명에서, 수지상세포는 미성숙 수지상세포 또는 성숙 수지상세포일 수 있으며, 바람직하게는 성숙 수지상세포일 수 있다. 성숙 수지상세포는 미성숙 수지상세포에 비해 세포 표면에 MHC Ⅱ형 분자, T 세포 보조자극인자인 CD80, CD86, CD83 등과 면역 자극 인자인 사이토카인 IL-12, IL-10, TNF 등을 고농도로 발현하며, 형태적으로 미성숙 수지상세포는 부드러운 표면을 갖는 원형이지만 성숙 수지상세포는 그 표면이 거칠고 다중 위족(multiple pseudopodia) 갖는다. 미성숙 수지상세포를 성숙화시키는 기술은 당업계에 공지되어 있으며, 그러한 방법으로서 예컨대 골수, 말초혈, 제대혈에서 분리되어 마이크로파아지, 수지상세포 등으로 분화할 수 있는 CD34+ 조혈세포 등의 미분화 전구세포를 IFN-α 등의 수지상세포 성숙화 인자와 함께 배양시키는 방법(유럽특허 제922,758호), GM-CSF, TNF-α, IL-3 등의 수지상세포 성숙화 인자와 함께 배양하는 방법(유럽특허 제663,930호), 조혈 성장 인자와 사이토카인의 혼합물과 배양하는 방법(WO 95/28479), LPS(lipopolysaccharide) 등과 LPS(lipopolysaccharide)와 함께 배양하는 방법(Am. J. Physiol. Cell Physiol., 2011, 300, C1205-C1214; Annu. Rev. Immunol., 2003, 21, 335-376) 등이 예시될 수 있다. 본 명세서에서 인용되는 문헌은 상기 문헌을 포함하여 모두 본 명세서의 일부로서 간주된다.
본 발명에서, 지방조직에서 분리된 기질혈관분획(SVF)은 효소적 분리 방법(Enzymatic isolation methods)과 기계적 분리 방법(Mechanical isolation methods)에 의해 지방조직으로부터 분리되어 얻어질 수 있다.
효소적 분리 방법은 먼저 지방조직 또는 지방 흡입물(Lipoaspirate)을 PBS, LBS(Lactated Ringer's solution), HBSS(Hank's Balanced Salt Solution) 등의 수용성 염 용액(aqueous salt solution)으로 2~3회 세척하고, 세척한 지방조직 또는 지방 흡입물에 세포외기질(extracellular matrix, ECM) 등을 분해하는 효소를 처리한다. 이러한 효소 처리는 통상 37℃에서 30분 내지 2시간 동안 교반(agitating)하면서 이루어진다. 효소 처리 후에는 원심분리하게 되는데 원심분리에 의해 효소 처리된 지방조직 또는 지방흡입물은 (i) 지방조직이나 오일층과 (ii) 수용액층 그리고 (ii) 펠릿(pellet)층으로 나뉘어지는데, 나머지 층은 버리고 펠릿층을 수득하게 된다. 이 펠릿에 기질혈관분획이 함유되어 있다.
이러한 효소적 분리 방법에 있어서, 세포외기질 등을 분해할 목적으로 사용될 수 있는 효소는 클로스트리듐 히스토리티쿰(Clostridium histolyticum)으로부터 분리된 제1 유형의 콜라게나아제(collagenase)나 제2 유형의 콜라게나아제를 비롯하여, P. polymyxa로부터 분리된 중성 단백 가수분해 효소(neutral protease)인 디스파아제(dispase), G. stearothermophilus나 B. thermoproteolyticus로부터 분리된 서모리신(thermolysin) 등을 사용할 수 있다. 또한 이러한 용도로 시판되는 효소 혼합물 예컨대 제1, 제2 유형의 콜라게나아제와 디스파아제 효소 혼합물인 CIzyme™ AS(Vitacyte LLC, Indianapolis, Indiana) 또는 제1, 제2 유형의 콜라게나아제와 서모리신 효소 혼합물인 Liberase™ Research Grade(Roche Diagnostic, Based, Switzerland) 등을 사용할 수도 있다.
상기 콜라게나아제 등과 더불어 DNA 분해 효소 등 핵산분해소가 세포를 분리할 때 죽은 세포로부터 흘러나온 염색체를 분해함으로써 결과적으로 세포 분리의 효율성을 향상시킬 목적으로 사용될 수도 있다.
기계적 분리 방법은 상기 효소적 분리 방법에서처럼 세척하고 원심분리하여 펠릿을 회수함으로서 이루어지는데, 원심분리 전 펠릿의 회수를 용이하게 위하여 그 세척물에 대해 교반/진동(shaking/vibrating)이 수행될 수도 있다.
지방조직으로부터 기질혈관분획의 분리 방법과 관련해서 더 구체적인 것은 문헌[Aronowitz et al. SpringerPlus (2015) 4:713] 등을 참조할 수 있다.
이러한 기질혈관분획은 림프구, 지방세포 전구체, 지방세포-유래 기질 세포, 섬유아세포, 내피세포, 주피세포(pericytes)와 같은 다양한 세포로 구성되어 있다(Stem Cell Res Ther 2017 Jun 15;8(1):145). SVF를 배양하면 림프구들은 죽어서 제거되고 부착성을 가진 여러 종류의 기질 세포를 얻을 수 있다(Cytotherapy 15, 641-648, 2013).
본 발명에서, 기질혈관분획은 임의의 포유동물의 지방조직으로부터 수득할 수 있으며, 보다 바람직하게는 인간, 마우스, 래트, 토끼, 원숭이, 돼지, 말, 소, 양, 영양, 개 또는 고양이의 지방조직으로부터 수득할 수 있고, 보다 더 바람직하게는 인간, 마우스, 래트 또는 원숭이로부터 수득할 수 있으며, 가장 바람직하게는 인간 또는 마우스로부터 수득할 수 있다.
또 본 발명에서, 기질혈관분획은 임의의 지방조직으로부터 얻어질 수 있다. 피하 지방조직(subcutaneous fat tissue)이나 기관 주위의 지방조직인 내장 지방조직(visceral fat tissue)으부터 얻어질 수 있으며, 또 갈색 지방조직이나 백색 지방조직으로부터 얻어질 수 있다.
또 본 발명에서 지방조직에서 분리된 기질혈관분획의 2차원 배양물은 기질혈관분획을 2차원으로 단층 배양하여 세포 배양물의 한쪽면이 배양 접시 등의 배양면에 붙어 자라게 배양한 것을 말한다.
또 본 발명에서 지방조직에서 분리된 기질혈관분획의 스페로이드는 지방조직에서 분리된 기질혈관분획을 3차원 배양하여 구체 모양으로 얻어지는 것으로 당업계에서 이러한 스페로이드를 얻기 위한 다양한 3차원 배양 방법이 공지되어 있다. 그러한 방법으로서 예컨대 현적배양(haning-drop cultures) 방법(Biotechnol Bioeng 2003, 83(2):173-80; Trends Biotechnol 2004, 22(4):195-202; Crit Rev Oncol Hematol 2000, 36(2-3):107-22), 표면 유착 방지 처리 마이크로 웰 플레이트(microwell plates with non-adhesive surface)를 이용한 배양 방법(Cancer Res 1977, 37(10):3639-43; In Vitro Cell Dev Biol Anim 2001, 37(10):656-67), 미세 제작 구조틀(microfabricated microstructures)을 이용한 배양 방법(Biomed Microdevices 2008, 10(2):197-202; Tissue Eng 2007, 13(8):2087-94), 회전 바이오리액터를 이용한 배양 방법(In Vitro Cell Dev Biol Anim 1997, 33(6):459-66; Nat Med 1998, 4(8):901-7), 표면 조절 배양기 또는 스캐폴드(surface modified substrates or scaffolds)를 이용한 배양 방법(Tissue Eng 2007, 13(7):1455-68; Tissue Eng 2006, 12(5):1357-68), 외력(external forces)을 이용한 배양 방법(Cell Transplant 2006, 15(6):521-32; Biotechnol Bioeng 2007, 98(3):694-700), 스페로이드 칩(spheroid on a chip)을 이용한 배양 방법(Biomaterials 2007, 28(3):559-66;Biomaterials 2006, 27(36):6032-42) 등을 들 수 있다. 지방조직에서 분리된 기질혈관분획을 배양하여 스페로이드를 얻기 위한 3차원 배양 방법과 관련하여 더 구체적인 것은 문헌[Korean J Otorhinolaryngol-Head Neck Surg 2020, 63(6):245-51] 등을 참조할 수 있다.
또 본 발명에서 수지상세포에의 항원 탑재(loading)는 항원 처리(antigen processing)에 의해 수지상세포의 표면에 MHC와 복합체 형태로 항원 펩타이드가 제시되도록 함으로써 이를 선택적으로 인지하는 T 세포 수용체를 가진 T 세포 등의 활성을 유도함으로써 항바이러스, 항미생물, 항종양 등의 면역반응 높이기 위한 것이다. 이러한 수지상세포에의 항원 탑재 방법으로서는 펩타이드 항원 자체를 도입하여 사용하거나, RNA 등 항원 발현 유전자, 항원 발현 바이러스 벡터, 항원에 결합한 HIV(human immunodeficiency virus)의 Tat 펩타이드 등의 세포투과성 펩타이드를 처리하여 수지상세포 내에서 항원 단백질이 발현하도록 하는 방법 등이 당업계에 공지되어 있으며, 본 발명의 실시예에서처럼 Fe3O4-ZnO 코어(Fe3O4) 셀(ZnO) 구조의 나노입자(Fe3O4-ZnO core-shell nanoparticles, FZ-NP)를 이용할 수도 있다. 수지상세포에의 항원 탑재 방법과 관련하여 더 구체적인 것은 문헌[ Immunol Res. 2017, 65:798-810] 등을 참조할 수 있다.
또 본 발명에서 항원은 바이러스 유래 항원, 박테리아 등 병원성 미생물 유래 항원, 종양 유래 항원일 수 있는데, 종양 항원은 암세포 유래 임의의 항원 즉 표면 발현 단백질, 표면 발현 수용체, 종양세포 내부의 펩타이드나 단백질, 종양세포의 용해물 등일 수 있다.
이러한 종양 항원은 암세포에서만 발현되거나 정상세포에 비해 암세포에서 과발현되는 것이 바람직하나데, 예컨대 교모세포종(glioblastoma)에서 발현되는 EGFRvⅢ(epidermal growth factor receptor variantⅢ), 역형성 갑상선암이나 유방암, 폐암, 신경교종(glioma) 등에 과발현되는 EGFR(Epidermal growth factor receptor), 유두성 갑상선 암(papillary thyroid cancer) 등에서 과발현 메타스틴 수용체(Metastin receptor), 유방암 등에서 과발현되는 ErbB 계열의 수용체 타이로신 카이나제(Receptor tyrosine kinases), 유방암, 방광암, 담낭암(Gallbladder cancers), 담관암(Cholangiocarcinomas), 위식도접합부암(esophagogastric junction cancers) 등에서 과발현되는 HER2(Human epidermal growth factor receptor 2), 육두성 신암종 등에서 과발현되는 타이로신 카이나제-18-수용체(c-Kit), 식도 선암 등에 과발현되는 HGF 수용체 c-Met, 유방암 등에서 과발현되는 CXCR4 또는 CCR7, 전림선암에서 과발현되는 엔도테린-A 수용체, 직장암 등에서 과발현되는 PPAR-δ(peroxisome proliferator activated receptor δ), 난소암 등에서 과발현되는 PDGFR-α(Platelet-derived growth factor receptor α), 간암, 다발성 골수종 등에서 과발현되는 CD133, 폐암, 대장암, 위암, 췌장암, 유방암, 직장암, 결장암, 갑상선 수질암 등에서 과발현되는 CEA(carcinoembryonic antigen), 간암, 위암, 대장암, 췌장암, 유방암 등에서 과발현되는 EpCAM(Epithelial cell adhesion molecule), 신경모세포종 등에서 과발현되는 GD2(disialoganglioside), 간세포암 등에서 과발현되는 GPC3(Glypican 3), 전립선암 등에서 과발현되는 PSMA(Prostate Specific Membrane Antigen), 난소암, 유방암, 결장암, 폐암, 췌장암 등에서 과발현되는 TAG-72(tumor-associated glycoprotein 72), 흑색종 등에서 과발현되는 GD3(disialoganglioside), 혈액암, 고형암 등에서 과발현되는 HLA-DR(human leukocyte antigen-DR), 진행성 고형암 등에서 과발현되는 MUC1(Mucin 1), 진행성 폐암(advanced non-small-cell lung cancer) 등에서 과발현되는 NY-ESO-1(New York esophageal squamous cell carcinoma 1), 비인두종양(Nasopharyngeal neoplasms) 등에서 과발현되는 LMP1(Latent membrane protein 1), 폐암, 비호지킨 림프종, 난소암, 결장암, 대장암, 췌장암 등에서 과발현되는 TRAILR2(tumor-necrosis factor-related apoptosis-inducing ligand receptor), 혈관 신생 인자 수용체인 VEGFR2(vascular endothelial growth factor receptor 2), 간세포암 등에서 과발현되는 HGFR(hepatocyte growth factor receptor) 등일 수 있으며, 또한 암 줄기세포의 표면 항원인 CD44, CD166 등일 수 있다. 당업계에는 정상세포에 비해 암세포에서 과발현되는 많은 항원이 알려져 있으며, 상기 예시된 것 이외의 기타의 종양 항원과 관련해서 더 구체적인 것은 문헌[Anne T Collins et al. Prospective Identification of Tumorigenic Prostate Cancer Stem Cells. Cancer Res. 2005 Dec 1;65(23):10946-51], 문헌[Chenwei Li et al. Identification of Pancreatic Cancer Stem Cells. Cancer Res. 2007 Feb 1;67(3):1030-7], 문헌[Shuo Ma et al. Current Progress in CAR-T Cell Therapy for Solid Tumors. Int J Biol Sci. 2019 Sep 7;15(12):2548-2560], 문헌[Dhaval S Sanchala et al. Oncolytic Herpes Simplex Viral Therapy: A Stride Toward Selective Targeting of Cancer Cells. Front Pharmacol. 2017 May 16;8:270] 등을 참조할 수 있다.
본 발명의 면역증진용 조성물은 그것이 항종양 용도로 사용될 경우 수지상세포에 탑재되는 항원을 발현하는 임의의 암세포에 대해 사용될 수 있다. 암세포라면 식도암, 위암, 대장암, 직장암, 구강암, 인두암, 후두암, 폐암, 결장암, 유방암, 자궁 경부암, 자궁 내막체암, 난소암, 전립선암, 고환암, 흑색종, 방광암, 신장암, 간암, 췌장암, 골암, 결합 조직암, 피부암, 뇌암, 갑상선암, 백혈병, 호지킨(Hodgkin) 질환, 림프종, 다발성 골수종, 혈액암 등 암종을 불문한다.
본 발명에서 항종양은 암세포의 사멸, 암세포의 생존능 저하, 암세포의 증식 억제에 따른 암이 가지는 병리적 증상의 억제나 지연, 암 전이 억제, 암 재발 억제를 포함하는 의미이다.
본 발명의 면역증진용 조성물은 허가된(approved) 임의의 항바이러스제, 임의의 항미생물제(즉 항생제), 임의의 항암제와 병용 또는 혼합되어 사용될 수 있다. 항암제와 병용 또는 혼합되어 사용될 경우 그러한 항암제로는 대사 길항제, 알킬화제, 토포아이소머라제 길항제, 미세소관 길항제, 식물유래 알칼로이드 등 암세포에 세포독성을 나타내는 임의의 항암제, 임의의 사이토카인 의약품, 임의의 항체 의약품, 임의의 면역관문 억제제 의약품, 임의의 세포 치료제(car-T cell therarpy, car-NK cell therapy) 의약품 등을 포함한다. 구체적으로 탁솔, 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 제피티닙, 보르테조밉, 수니티닙, 카보플라틴, 시스플라틴, 리툭시맙, 엘로티닙, 소라페닙, IL-2 의약품, INF-α 의약품, INF-γ 의약품, 트라스투주맙, 블리나투모맙, 이필리무맙, 펩브롤리주맙, 니볼리주맙, 아테졸리주맙(Atezolizumab), 두발루맙(Durvalumab), 베바시주맙, 세툭시맙, 티사젠렉루셀(Tisagenlecleucel, 킴리아), 액시캡타젠 실로루셀(Tisagenlecleucel Axicabtagene Ciloleucel, 예스카타) 등이 예시될 수 있으며, 이들 예시된 항암제 이외에도 당업계에 공지된 여타의 항암제도 제한없이 본 발명의 조성물과 혼합되어 사용되거나 병용 사용될 수 있다.
본 발명의 조성물은 약제학적으로 허용되는 담체 또는 부형제를 포함하여 투여 경로에 따라 당업계에 공지된 통상의 방법으로 제제화되어 약제학적 조성물로 제조될 수 있다.
그러한 약제학적으로 허용가능한 담체 또는 부형제는 인체에 특별한 독성을 가지지 않으면서 약물의 활성이나 특성을 저해하지 않는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물(예를 들면, 식염수 및 멸균수), 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일, 링거액, 완충제, 말토덱스트린 용액, 글리세롤, 에탄올, 덱스트란, 알부민, 또는 이들의 임의의 조합일 수 있다. 특히 본 발명의 약제학적 조성물이 액상 용액으로 제제화될 경우 적합한 담체 또는 부형제로서는, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사 용액, 덱스트로스 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 등의 성분 중에서 하나 이상의 성분을 단독 또는 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 의약품 첨가제 등을 첨가하여 사용할 수 있다.
본 발명의 약제학적 조성물이 비경구 투여제 특히 주사제로 제제화될 수 있는데, 이 경우 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 본 발명의 약제학적 조성물은 특히 용액, 현탁액 등의 형태로 제제화할 수 있다.
본 발명의 약제학적 조성물은 약제학적 분야에서 통상의 방법에 따라 환자의 신체 내 투여에 적합한 단위 투여형의 제제 형태로 제형화시켜 당업계에서 통상적으로 사용하는 투여 방법을 이용하여 피부, 병변 내(intralesional), 정맥 내, 근육 내, 동맥 내, 골수 내, 수막강 내, 심실 내, 폐, 경피, 피하, 복 내, 비강 내, 소화관 내, 국소, 설하, 질 내, 직장 경로, 신장 캡슐 등 비경구 투여 경로에 의하여 투여될 수 있다.
본 발명의 약제학적 조성물의 투여량(유효량)은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성별, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있고, 당업자라면 이러한 요인들을 고려하여 투여량을 적절히 결정할 수 있다. 바람직한 양태에 있어 본 발명의 약제학적 조성물은 단위 용량 형태의 주사제로 제조되며, 단위 용량 형태의 주사제로 제조될 경우 본 발명의 약제학적 조성물의 단위 용량 당 포함되는 기질혈관분획 스페로이드나 수지상세포는 102-108 cells 범위일 수 있다.
다른 양태에 있어서, 본 발명은 전술한 바의 본 발명의 면역증진용 약제학적 조성물을 유효량으로 환자 등의 대상체에 투여하는 단계를 포함하는 면역증진 방법에 관한 것이다. 본 발명의 면역증진용 조성물이 바이러스 항원이 탑재된 수지상세포를 포함함으로써 항바이러스 용도로 사용될 경우 상기 면역증진 방법은 바이러스 감염증 치료 또는 예방 용도일 수 있고, 본 발명의 면역증진용 조성물이 박테리아 등 병원성 미생물 항원이 탑재된 수지상세포를 포함함으로써 항미생물 용도로 사용될 경우 상기 면역증진 방법은 병원성 미생물의 감염증 치료 또는 예방 용도일 수 있으며, 본 발명의 면역증진용 조성물이 종양 항원이 탑재된 수지상세포를 포함함으로써 항종양 용도로 사용될 경우 상기 면역증진 방법은 항종양(암 치료 또는 예방) 용도일 수 있다.
본 발명의 면역증진 방법은 본 발명의 면역증진용 조성물에 포함된 기질혈관분획의 스페로이드와 항원이 탑재된 수지상세포가 그 항원에 특이적인 T 세포를 활성시켜 항바이러스, 항미생물, 항종양 활성을 나타내게 함으로써 가능해진다. 따라서 본 발명의 면역증진 방법은 그러한 항원을 가지는 임의의 바이러스 감염증, 그러한 항원을 가지는 미생물 감염증, 그러한 항원을 가지는 임의의 암종에 대해서 적용이 가능하다.
본 발명의 면역증진 방법이 항종양 용도로 암 치료 또는 예방을 위해 사용될 경우 다른 암 치료법과 제한없이 병용되어 사용될 수 있다. 예컨대 앞서 예시된 세포독성 항암제, 사이토카인 의약품, 항체 의약품, 면역관문 억제제 의약품, 세포 치료제(car-T cell therarpy, car-NK cell therapy) 의약품, 방사선 치료 요법, 수술 요법 등이 본 발명의 조성물의 투여 전·후나 동시 투여 방식으로 병용 사용될 수 있다.
본 발명의 치료 방법에서 유효량은 그 적용 대상인 환자 등에 의료 전문가 등의 제언에 의한 투여 기간 동안 본 발명의 조성물이 투여될 때, 암 치료 또는 예방 효과 등 의도한 의학적 효과를 나타낼 수 있는, 본 발명의 조성물이 투여되는 양을 말한다. 이러한 유효량은 전술한 바와 같이 환자의 연령, 체중, 성별, 병적 상태 등에 따라 의료 전문가 등 당업자가 적절히 결정할 수 있다.
다른 측면에 있어서는 본 발명은 지방조직에서 분리된 기질혈관분획 특히 그 기질혈관분획의 스페로이드와 수지상세포를 유효성분으로 포함하는 면역반응 증진용 조성물 또는 이러한 조성물을 유효량으로 환자 등의 대상체에 투여하는 단계를 포함하는 면역증진 방법으로 파악할 수 있다.
전술한 바와 같이 아래의 실시예에서 본 발명자들은 지방조직에서 분리된 기질혈관분획의 스페로이드가 수지상세포와 함께 생채내에서 이식될 때 수지상세포와 T 세포의 상호작용을 증진시킴을 확인하였으며, 또 지방조직에서 분리된 기질혈관분획의 2차원 배양물을 수지상세포와 시험관내에서 공동배양하였을 때 수지상세포의 활성화를 촉진하고 수지상세포의 생존율을 향상시킴으로써 효과적으로 T 세포를 활성화시킴을 확인하였다.
이러한 결과들은 지방조직에서 분리된 기질혈관분획의 스페로이드와 수지상세포가 함께 투여될 때 면역반응, 구체적으로 세포 매개 면역 반응(cell-mediated immune response) 더 구체적으로는 T 세포에 의한 면역반응을 증진시킴을 보여주는 것이라 할 수 있다.
본 발명의 면역반응 증진용 조성물이나 그러한 조성물을 투여하는 면역증진 방법도, 혈관기질분획과 항원이 탑재된 수지상세포를 포함하는 본 발명의 면역증진용 조성물이나 이러한 조성물을 이용한 면역증진 방법과 관련하여 전술한 바와 같이, 항바이러스 용도, 항미생물 용도 또는 항종양 용도로 사용될 수 있으며, 이들 조성물과 방법도 전술한 바와 같이 구체화되어 사용될 수 있다.
또 다른 측면에 있어서, 본 발명은 지방조직에서 분리된 기질혈관분획 특히 그 기질혈관분획의 스페로이드를 유효성분으로 포함하는 수지상세포 성숙화 조성물에 관한 것이다.
전술한 바와 같이 아래의 실시예에서 본 발명자들은 지방조직에서 분리된 기질혈관분획의 스페로이드가 면역세포를 불러들이고 활성화시키는 케모카인 등 다양한 인자들(Spp1, Ccl8, Cxcl5, Postn, Cxcl16, Ccl17 등)를 높게 발현하고 또 수지상세포의 성숙과 생존을 조절하는 인자로 알려진 인자인 오스테오폰틴(osteopontin)을 또한 높게 발현하며, 수지상세포와 시험관내에서 공동배양하였을 때 기질혈관분획의 2차원 배양물이 수지상세포의 활성화를 촉진하고 수지상세포의 생존율을 향상시킴을 확인하였다.
이러한 결과들은 지방조직에서 분리된 기질혈관분획의 스페로이드가 수지상세포의 성숙화를 유도하고 나아가 활성화, 생존율 향상을 유도할 수 있음을 보여주는 것이라 할 수 있다.
수지상세포를 항종양 등의 용도로 면역 치료 등에 활용하기 위해서는, 체외(ex vivo)에서 수지상세포를 분화 제조하는 기술과 더불어 T 세포 면역 반응을 효과적으로 유도하기 위한 성숙화 기술이 필수적이다. 전술한 바와 같이 성숙 수지상세포는 다량의 IL-12, IL-10, TNF 등의 사이토카인을 발현하며, 이들 사이토카인은 T 세포 면역반응 유도에 직접적으로 관여한다. 성숙화를 통한 이러한 변화에 의해 수지상세포의 T 세포 면역반응 유도능이 크게 증가하게 된다.
본 발명의 수지상세포 성숙화 조성물은 수지상세포의 성숙화 인자로 당업계에 공지된 IFN-α, IL-1β, IL-6, IL-3, TNF-α, IFN-γ, PGE2, OK432(Picibanil) 등을 추가로 포함할 수 있으며, RPMI(Roswell Park Memorial Institute) 1640 배지, serum free 배지인 X-VIVO15 등에 첨가되어 사용될 수 있다.
본 발명의 수지상세포 성숙화 조성물은 약제학적 조성물로 제조되어 환자 등 대상체에 투여되어 사용되거나, 수지상세포를 체외(ex vivo)에서 성숙화, 증식시키기 위한 목적으로 사용될 수 있다.
전술한 바와 같이, 본 발명에 따르면 지방조직에서 분리된 기질혈관분획의 수지상세포의 활성화 기능을 이용한 면역반응 증진용 조성물, 구체적으로 지방조직에서 분리된 기질혈관분획 특히 그 기질혈관분획 스페로이드와 항원이 탑재된 수지상세포를 유효성분으로 포함하는 면역반응 증진용 조성물, 지방조직에서 분리된 기질혈관분획 특히 그 기질혈관분획의 스페로이드와 수지상세포를 유효성분으로 포함하는 면역반응 증진용 조성물 등을 제공할 수 있다.
본 발명의 조성물은 항바이러스 용도, 항미생물 용도, 항종양 용도 등으로 사용될 수 있다.
도 1 내지 도 5는 지방조직에서 분리한 지질혈관분획을 배양하였을 때 림프노드 기질세포와 유사한 특성과 기능을 가짐을 보여주는 결과이다.
도 6은 지방조직에서 분리한 지질혈관분획의 스페로이드가 면역세포의 이동 통로가 되는 혈관을 형성할 수 있음을 보여주는 결과이다.
도 7 내지 도 11은 지방조직에서 분리한 지질혈관분획의 스페로이드가 수지상세포를 유인하고 수지상세포가 T 세포와 상호작용하는 것을 증진시키며, T 세포가 대부분 CD4+ 효과기 T 세포로 분화되어 면역반응을 수행하는 것임을 보여주는 결과이다.
도 12 및 도 13은 지방조직에서 분리한 지질혈관분획의 2차원 배양물 또는 그 스페로이드가 수지상세포의 생존율을 향상시키고 항원이 탑재된 수지상세포와 함께 항원 특이적 T 세포의 면역반응을 증진시킴을 보여주는 결과이다.
도 14는 지방조직에서 분리한 지질혈관분획의 스페로이드가 종양 항원(OVA)이 탑재된 수지상세포와 함께 종양 항원(OVA)을 발현하는 B16 멜라노마 세포(B16-OVA)가 이식된 마우스에 투여될 때 종양의 크기를 감소시키고 마우스 생존율을 향상시킴을 보여주는 결과이다.
도 15는 본 발명의 개념도이다.
이하 본 발명을 실시예를 참조하여 설명한다. 그러나 본 발명의 범위가 이러한 실시예에 한정되는 것은 아니다.
실시예
1. 시료 및 실험 방법
1.1 마우스
C57BL/6 야생형 마우스(Koatech, Seoul, Republic of Korea)와 C57BL/10NAGCSAni-(KO) Rag2(H-2b) 마우스 (Taconic Biosciences, NY, US)는 서울대학교 의과대학에 위치한 특정 병원체 부재 시설에서 사육되었다. 모든 마우스들은 수컷이며 6~12주령의 마우스들을 사용했다. 모든 마우스 실험들은 서울대학교 동물실험 위원회(Institutional Animal Care and Use Committee, IACUC)에 의해 승인되었다(IACUC Number : SNU-150115-2-7, SNU-160212-2-7, SNU-171123-4-7).
1.2 기질혈관분획(SVF)의 분리와 스페로이드 배양
내장(Viscera)과 피부(Skin)에서 지방조직을 모으고 잘게 자른 뒤, 조직은 0.8mg/ml 콜라겐 분해효소와 100ug/ml DNA 분해효소 I(DNaseI)이 들어있는, 3% bovine serum albumin(BSA)(MP biomedicals, CA, US), 1.0mM CaCl2 (Sigma-Aldrich, MO, US), 0.8mM MgCl2 (Sigma-Aldrich, MO, US)가 포함된 살균된 Hank's balanced salt solution (Intron, Seoul, Republic of Korea)에서 1시간 동안 170rpm으로 37℃의 진탕배양기에서 배양되었다. 3분 동안 500g의 조건에서 원심분리 후, 상층액은 제거하고 펠렛인 기질혈관분획(Stromal vascular fraction, SVF)을 분리하였다(도 1a). 그리고나서 10% fetal bovine serum(Gibco, MA, US)과 1% penicillin/streptomycin(Gibco, MA, US)이 포함된 Dulbecco’s Modified Eagle Medium(Welgene, Daegu, Republic of Korea)에서 배양하였다. 스페로이드(spheroids)를 만들기 위해선, 6~10일 동안 배양한 SVF를 트립신으로 처리하여 수를 세었다. 배양된 SVF는 스페로이드 필름(Incyto, Cheonan, Republic of Korea)에 분주하였다. SVF-스페로이드 361개(19X19)가 스페로이드 필름에서 형성되었음을 확인하고, 이를 이틀 이상 배양한 뒤, SVF-스페로이드를 실험에 사용했다.
1.3 재조합 ZnO-결합 펩타이드(ZBP)-난백알부민(OVA) 단백질의 생산
재조합 ZnO-결합 펩타이드(ZBP)-난백알부민(OVA) 단백질(ZBPOVA)을 생산하기 위해서, 먼저 B16MO5 세포주의 유전체 DNA를 DNeasy Blood & Tissue Kits(Qiagen, Hilden, Germany)을 사용하여 제조사의 설명서에 따라 추출했다. 추출된 DNA는 PCR로 증폭(Forward primer: 5'-TTT GAA TTC ATG GGC TCC ATC GGT GCA-3' 서열번호 1, Reverse primer: 5'-AAA CTC GAG AGG GGA AAC ACA TCT GCC-3', EcoRI, XhoI restriction sites underlined)하고 3xZBP (BamHI-RPHRKGGDARPHRKGGDARPHRKGGDA-EcoRI, 서열번호 3)로 암호화된 pET23d-ZBP vector에서 복제되었다. 복제된 벡터는 pET23d-ZBPOVA는 제조사의 설명서에 따라 E. coli HIT Competent BL21 균주(RBCBioscience, New Taipei City, Taiwan)로 형질전환 되었다. ZBPOVA는 이전에 설명한 방법(Nature methods 3, 55-64, 2006; Biochemistry and Molecular Biology Education 39, 28-37, 2011)에서 적절히 개조된 프로토콜로 정제되었다. 간단하게, isopropylthiogalactoside (IPTG; 0.1mM)에 의해 단백질 발현이 유도된 E. coli 배양액을 리소자임 (1mg/ml)과 단백질분해효소 억제제 칵테일이 추가된 얼음처럼 차가운 완충액(300mM NaCl, 50mM phosphate, pH=8.0)으로 30분 동안 용해시키고 추가로 초음파 처리에 의해 용해되었다. 용해물은 원심분리하고 상층액을 모아 여과하고 AKTAstart(GEHealthcare, IL, US)와 HisTrap™ FF(GEHealthcare, IL, US)를 사용하여 컬럼으로 정제하였다. 단백질은 밤새 4℃ PBS에서 투석했다. 내독소는 이전에 설명된 바와 같이(Microbial cell factories 10, 57, 2011) Triton X-114를 이용해서 정제된 단백질에서 제거했다. 정제된 단백질의 내독소 오염 여부는 제조업체의 지침에 따라 Pierce LAL Chromogenic Endotoxin Quantification Kit (Thermo Fisher Scientific, MA, US)를 사용하여 확인했다. 정제된 ZBPOVA 단백질은 SDS-PAGE로 정량화하고 이후에 사용하기 전까지 -80℃에서 보관했다.
1.4 골수유래수지상세포 분리, 항원 전달과 성숙
이전에 설명된 바와 같이(Nat Nanotechnol 6, 675-682, 2011) 골수는 분리되어 수지상세포로 분화되었다. 간단하게 설명하자면, Rag2 결핍(knock-out) 마우스의 골수는 분리되고 10% FBS, 1.5ng/ml recombinant mouse GM-CSF(PeproTech, NJ, US), 1.5ng/ml mouse IL-4(PeproTech, NJ, US), 1% penicillin/streptomycin, 50μg/ml gentamicin(Gibco, MA, US), 2mM L-glutamine(Gibco, MA, US), 50nM β-mercaptoethanol(Gibco, MA, US)가 추가된 Iscove's modified Eagle medium(IMDM)(Gibco, MA, US)에서 배양되었다. 미성숙 수지상세포는 6~8일 동안 배양되었다. 배지는 하루 걸러 교체해주었다, 미성숙 골수유래수지상세포(BMDC)로 내부 항원 운반을 위해 Fe3O4-ZnO 코어 셀 구조의 나노입자(Fe3O4-ZnO core-shell nanoparticles, FZ-NP)이 사용되었다. 100ug FZ-NPs는 PBS로 3번 wash하고, FZ-NPs는 20ug ZBP-OVA와 서로 결합하도록 1시간 동안 상온에서 배양항ㅆ다. 그 뒤, ZBP-OVA와 FZ-NPs(NP-OVA)는 IMDM으로 3번 wash하였다. 다음 1×106 수지상세포는 37℃에서 1시간 동안 NP-OVA와 배양하였다. 성숙 과정을 위해, 수지상세포는 1ug/ml 지질다당류(LPS, lipopolysaccharide)로 16~18시간동안 처리하였다. LPS에 의해 성숙된 수지상세포는 실험 전에 IMDM으로 3번 wash하였다.
1.5 유세포 분석과 항체
세포는 10% goat serum(Thermo Fisher Scientific, MA, US), 10% rat serum(Thermo Fisher Scientific, MA, US), 10% mouse serum(Sigma-Aldrich, MO, US), 10 μg/ml anti-CD16/CD32(2.4G2) antibody(BD Pharmingen, NJ, US)으로 구성된 super-block solution으로 blocking하였다. 이어서 30분 동안 얼음에서 APC/Cy7-conjugated anti-CD45, BV405-conjugated anti-CD11c, alexa488-conjugated anti-CD11c, APC-conjugated anti-B220, PE-conjugated anti-CD11b, APC-conjugated anti-PDPN, FITC-conjugated antiICAM-1, PE/Cy7-conjugated anti-CD31, PE-conjugated anti-LTβR, FITC-conjugated anti-VCAM-1, PE-conjugated anti-CD140α, PerCP/Cy5.5-conjugated anti-CD44, PE/Cy7-conjugated anti-CD86, APC-conjugated antiI-Ab, BV605-conjugated anti-Ki67, PE-conjugated anti-DC-SIGN (Biolegend, CA, US), PE-conjugated anti-CD3, BV421-conjugated anti-CD3, PerCP-conjugated anti-CD4, FITC-conjugated anti-CD8, APC-conjugated anti-Gr-1, BV605-conjugated anti-CD62L, FITC-conjugated anti-I-Ab, PE-conjugated anti-CD40 (BD Pharmingen, NJ, US), PE/Cy7-conjugated anti-CD4, eFlour 450-conjugated anti-CD3, PE/Cy7-conjugated anti-F4/80, APC-conjugated anti-CD80 (eBioscience, CA, US)로 표면 표지(surface marker) 염색을 하였다. 살아있는 세포는 Zombi Aqua(Biolegend, CA, US)나 7-aminoactinomycin D(7-AAD) (BD Pharmingen, NJ, US)로 따로 염색하였다. 세포는 LSRFortessa X-20 flow cytometer, BD LSRII flow cytometer(BD Pharmingen, NJ, US), CytoFLEX S(Beckman Coulter, CA, US)를 이용하여 측정하였다. 데이터는 FlowJo software (Tree Star, Ashland, OR, USA)로 분석하였다.
1.6 신장 캡슐로 이식
SVF-스페로이드나 수지상세포를 신장 캡슐로 이식하는 것은 이전에 언급한대로 수행하였다(Biochem Biophys Res Commun 514, 1081-1086, 2019). 간단하게 설명하자면, 마우스를 마취시키고 수술할 측면의 털을 제거한 후, 피부를 소독 후 절개하고 신장을 외부로 노출시켰다. 신장 캡슐 표면은 30 게이지 바늘(BD Pharmingen, NJ, US)로 찢고, 이식편은 threaded plunger(Hamilton, NV, US)를 이용해 천천히 주입하였다. 절개 부위는 고온의 cautery(Bovie medical corporation, NY, US)로 지져서 봉합하였다. 신장은 몸 안으로 다시 넣고 피부를 봉합하였다.
1.7 정량 PCR
RNA 추출은 표준 프로토콜을 따라 Trizol reagent를 이용해 수행하였다. Complementary(상보성) DNA(cDNA)는 reverse transcript premix kit(Intron, Seoul, Republic of Korea)를 이용해 순차적으로 합성되었다. SVF가 림프절기질세포의 주요한 케모카인을 분비할 수 있는지를 확인하기 위해, mRNA 발현을 SYBR Green master mix(Life Technologies, CA, US)와 CFX Real Time PCR Detection System(Bio-Rad Laboratories, CA, US)을 이용하여 정량 PCR(qPCR)로 측정했다. 각 샘플은 2번 반복 실험으로 진행되었다. 상대적인 mRNA 발현은 β-actin (Actb)의 값을 기준으로 계산되었다. 프라이머는 표 1에 정리했다.
Gene 정방향 프라이머 역방향 프라이머
CCL19 CCTGGGAACATCGTGAAAGC (서열번호 3) TAGTGTGGTGAACACAACAGC (서열번호 4)
CCL21 GTGATGGAGGGGGTCAGGA (서열번호 5) GGGATGGGACAGCCTAAACT (서열번호 6)
CXC13 GGCCACGGTATTCTGGAAGC (서열번호 7) GGGCGTAACTTGAATCCGATCTA (서열번호 8)
CXCL12 CATCAGTGACGGTAAACCAG (서열번호 9) CACAGTTTGGAGTGTTGAGG (서열번호 10)
Actb TGTTACCAACTGGGACGACATG (서열번호 11) GGGGTGTTGAAGGTCTCAAAC (서열번호 12)
1.8 mRNA 염기서열 분석
SVF와 SVF-스페로이드의 유전자 발현 특징을 확인하기 위해, 항-CD45 microbeads와 magnetic cell separation(MACS; Miltenyi Biotec, Bergisch Gladbach, Germany)을 사용해서 SVF으로부터 CD45- 세포를 분류하고 total RNA를 분리했다. RNA의 quality(품질)은 RNA 6000 Nano Chip(Agilent Technologies, Amstelveen, Netherlands)를 사용하여 Agilent 2100 bioanalyzer로 측정했고, RNA의 양은 ND-2000 Spectrophotometer (Thermo Fisher Scientific, MA, US)를 사용하여 정량화했다. 라이브러리는 SMARTer Stranded RNA-Seq Kit (Clontech Laboratories, CA, US)를 이용하여 total RNA로부터 생성되었다. Poly(A) RNA Selection Kit(LEXOGEN, Vienna, Austria)를 이용하여 Polyadenylated mRNA를 특이적으로 분리하고, cDNA 합성, 단편화와 PCR에 의한 증폭를 위한 전단 가공(shearing)을 순차적으로 수행했다. 평균 단편 크기는 Agilent 2100 bioanalyzer로 측정했고 정량화는 StepOne Real-Time PCR System (Life Technologies, CA, US)으로 평가했다. 라이브러리는 HiSeq 2500(Illumina, CA, US)에 의해 paired-end 100-bp 판독으로 염기서열분석을 했다. 시퀀싱 데이터는 TopHat을 이용해 도표화했다. 데이터는 ExDEGA (E-biogen, Seoul, Republic of Korea)로 분석하고, Prism 8(GraphPad, CA, US)으로 시각화했다.
1.9 효소결합면역흡착분석(ELISA)
세포 배양 상층액에서 CCL21과 osteopontin의 번역 수준에서의 발현은 제조업체의 지침에 따라 각각 Research and Diagnostic Systems(MN, US)과 Lifespan Biosciences (WA, US)에서 구입한 ELISAM kit로 측정되었다.
1.10 주화성 분석
SVF-스페로이드의 화학적 유인 능력을 확인하기 위해, 제조업체의 설명에 따라 μ-Slide Chemotaxis kit(Cat#80326; Ibidi, Germany)를 이용하여 주화성 분석(Chemotaxis assay)을 실시하였다. 1.5mg/ml Type I Collagen solution(Corning, NY, US)은 관찰 지역에 주입되었다. 배지 내의 SVF-스페로이드 또는 배지는 왼쪽 공간에 주입되었고 비장세포는 오른쪽 공간에 삽입되었다. 살아있는 세포 이미징은 24시간의 배양 기간 동안 FV1000(Olympus corporation, Tokyo, Japan)으로 촬영되었다.
1.11 기질혈관분획(SVF)과 수지상세포(DC) 또는 비장세포 공동배양
24-well plate에서 1×106/well 수지상세포, 1x106/well 비장세포, 1×106/well 성숙 수지상세포 (mature DC) 또는 1×106/well 비장세포와 배양된 2×104/well SVF를 준비하여 공동배양하였다. 배양 후, 세포들은 유세포분석기를 이용해 분석되었다.
1.12 생체외(in vitro), 생체내(in vivo) 이미징
생체외에서 배양된 SVF는 현미경(Olympus corporation, Tokyo, Japan)과 VisiView software (Visitron systems, Puchheim, Germany)으로 관찰되었다. 생체 내 신장 캡슐 이식으로 인한 구조를 확인하기 위해 이식편을 수술 2주 후 모아서 frozen section media(Leica Biosystems, IL, US)에 넣고 빠르게 액체 질소에서 얼렸다. 샘플들은 5~6um 두께로 냉동 절편을 만들고 실험 전까지 -80℃에서 보관했다. 조직학적 분석을 위해, 헤마톡실린-에오신(H&E) 염색을 하였다. 공초점 이미징을 위해, 절편 샘플은 4% 파라포름알데하이드에서 고정되고 FITC-labeled anti-CD3, FITC-labeled anti-CD8(BD Pharmingen, NJ, US), alexa 647-labeled anti-CD31, alexa 594-labeled anti-PDPN, alexa 647-labeled anti-CD11c, Alexa 647-labeled anti-CD4 (Biolegend, CA, US), alexa 594-labeled anti-VEGFR3 (Bioss Antibodies, MA, US), 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, MA, US)로 염색하였다. 공초점 이미지는 FV3000(Olympus corporation, Tokyo, Japan)으로 촬영되었으며 IMARIS version 9.3 (Bitplane, Zurich, Switzerland)으로 분석했다.
1.13 항원 특이적 면역 반응 평가
SVF-스페로이드, 수지상세포 각각 또는 이들의 혼합 주입이 효과적으로 항원 특이적 면역 반응을 유도하는지 평가하기 위해, 각 조합(1x106 수지상세포/mouse 또는 361개의 SVF-스페로이드/mouse 또는 둘 다)은 서로 다른 주에 1회씩, 총 2회를 각 마우스의 신장 캡슐에 이식했다. 각 그룹에서 주입된 수지상세포에는 NP-OVA를 세포내로 섭취시킨 뒤 이식하였고, SVF-스페로이드 단독 이식 그룹에는 동일한 양의 NP-OVA를 함께 주입했다. 첫 면역을 하고 5주 후, OVA-특이적 T 세포를 확산시키기 위해 각 마우스에서 분리된 비장 세포를 각각 H-2Kb 주조직 적합성 복합체(MHC) I형과 I-Ab MHC II형에 의해 각각 제시되는 OVA 257-264 펩타이드와 OVA 339-323 펩타이드(InvivoGen, CA, US)와 배양하였다. 24시간 동안 배양 후, 세포들을 30분 동안 4℃에서 항-MHC 사량체(tetramer)로 염색하고 세포 표면 염색을 추가로 30분을 한 뒤, 유세포 분석을 수행하였다. APC-labeled tetramer SIINFEKL-H-2Kb와 PE-labeled tetramer AAHAEINEA-I-Ab은 미국의 National Institutes of Health Tetramer Core Facility에서 제공받았다.
1.14 종양 접종 및 항종양 효과 검사
종양 접종을 위해, OVA-발현 악성 흑색종 B16MO5(5×104 cells/mouse)를 마우스의 왼쪽 측면에 주입했다. 7일 후, 각 조합(1×106 수지상세포/mouse, 361개의 SVF스페로이드/mouse)을 매주 3회 신장 캡슐 아래에 삽입했다. 각 그룹당 5마리의 마우스로 구성되었다. 항종양 효과를 조사하기 위해, 종양 크기와 생존율을 평가했다. 종양 크기는 2~3일마다 측정했다. 종양 부피(mm3)는 1/2×[(짧은 지름)×(긴 지름)2]으로 게산했다. 종양 크기가 2000mm3 이상 성장하면, 마우스는 죽은 것으로 간주했다.
1.15 통계 분석
데이터는 통계 분석을 위해서 GraphPad Prism software로 분석되었다. RNA 염기서열분석은 ExDEGA version 2.5로 수행되었다.
2. 실험 결과
2.1 지방조직으로부터 분리한 SVF의 특성
지방조직에서 추출한 SVF은 최초 0일째(D0) 대부분 크기가 작고(FSC<250K, FSC: forward scatter, SCC: side scatter) 원형 모양의 세포들이었으나 배양하면(D3: 배양 3일째, D6:배양 6일째) 크기가 크고(FSC>250K) 긴 모양의 세포들로 대체되었다(도 1b~1d). 이러한 세포 변화를 자세히 확인하기 위하여 유세포 분석을 수행하였을 때 CD45+ 조혈세포 집단(hematopoietic cell population)는 배양하면 감소하고(23.4%→5.94%) CD45- 비조혈세포(non-hematopoietic cell population)는 증가함(76.0%→93.7%)을 확인하였다(도 1e, 1f).
마커 분석을 통해 이러한 세포 변화에 따른 세포 유형을 분석한 결과 CD4+ T 세포, CD8+ T 세포 및 B220+ B 세포들은 빠르게 감소하였고 CD11c+ 수지상세포는 배양 10일까지 유지되었으며(도 2a~2d), CD11b+ F4/80+ 대식세포와 Gr-1+ 호중구 세포는 감소하였다(도 2e. 2f). 도 2에서 P#0, P#1, P#2는 각각 계대 횟수 0번, 1번, 2번을 의미한다.
림프절 기질 세포(lymph node stromal cell)의 하위그룹(subtype)은 PDPN과 CD31 마커를 사용하여 PDPN+ CD31-는 섬유아세망세포(fibroblastic reticular cell, FRC), PDPN+ CD31+는 림프내피세포(lymphatic endothelial cell, LEC), PDPN- CD31+는 혈액내피세포(Blood endothelial cell, BEC)로 분류되는데, 지방조직에서 분리한 SVF를 배양하여 유세포 분석을 실시하면 CD45- 세포 그룹은 림프절 기질 세포의 표현형(phenotype)과 비슷하게 PDPN+ CD31-, PDPN+ CD31+, PDPN- CD31+ 로 구분되는 특성을 보이는 것을 확인하였다(도 3a~3e). SVF는 특히 5일 이상 배양시 60% 이상, 10일 이상 배양시 80% 이상 FRC의 표현형(PDPN+ CD31-)을 보이는 것으로 확인되었다(도 3b).
PDPN+ CD31- FRC 유사 표현형을 보이는 SVF를 FRC 특이적 마커를 활용해 추가적으로 확인한 결과, 이들 세포는 LTβR(Lymphotoxin β receptor), CD140α(Platelet-derived growth factor α), VCAM-1(vascular cell adhesion molecule-1), ICAM-1(Intracelluar adhesion molecule-1) 등 FRC 특이적 마커를 발현하는 것을 확인하였다(도 4). 도 4에서 P#0, P#1, P#2는 각각 계대 횟수 0번, 1번, 2번을 의미한다.
이와 같은 표현형 외에, SVF가 기능적으로도 림프노드 기질 세포와 비슷하게 작동 하는지 알아보기 위해서 여러 가지 자극원 TLR3-agonist(PolyI:C, plC), TLR7-agonist(Imiquimod), αLTβR(αLT) 및 LTβR 리간드(anti-LTβR, LIGHT, L)를 24시간 동안 처리하고 정량적 PCR로 mRNA를 정량하였을 때 림프노드 기질 세포가 분비하는 대표적인 케모카인인 Ccl19, Ccl21, Cxcl13, Cxcl12을 발현하는 것을 확인할 수 있었다(도 5a). 3차원 세포 배양 방법인 스페로이드 형태로 배양시(SVF 스페로이드, SPH) 2차원 배양 SVF(SVF)에 비해 훨씬 많은 케모카인인 Ccl19, Ccl21, Cxcl13을 발현할 수 있음을 확인하였다(도 5b).
이상과 같은 결과들은 지방조직으로부터 분리한 SVF가 표현형이나 기능에 있어서 림프절 기질세포와 유사한 세포들로 구성되어 있음을 보여주는 것이라 할 수 있다.
2.2 SVF 스페로이드의 혈관 형성 능력
mRNA 분석으로 3차원 배양 방식으로 8일 배양한(D8) 배양한 SVF 스페로이드(SPH)와 2차원 배양 방식(monolayer)으로 배양한 SVF(SVF)의 유전자 발현을 비교하였을 때, SVF 스페로이드로 배양하면 혈관생성에 관련한 11개의 유전자들의 발현이 증가하는 것을 확인할 수 있었고(도 6a, 6b), 유세포 분석을 실시하였을 때 CD31+ 세포들(PDPN-CD31+ BEC, PDPN+ CD31+ LEC)이 증가함을 확인할 수 있었다(도 6c). 도 6에서 >10은 유전자 발현의 배수(fold change) 값이 대조군(SVF(D8)) 평균의 10배 초과를 의미하고 <0.1은 0.1배 미만을 의미하고, P#0, P#1은 각각 각각 계대 횟수 0번, 1번을 의미한다.
실제로 in vivo에서 혈관 형성 능력이 있는지를 확인하기 위하여 SVF 스페로이드를 마우스의 신장 캡슐에 이식하였을 때 이식 2주 후 이식 표면에서 혈관이 형성됨을 확인하였으며(도 6d), 생성된 혈관은 각각 림프구와 내피세포 마커인 VEGFR3와 CD31에 대해 양성임을 확인하였다(도 6e). 또한 동결단면(frozen section) 이미지를 통해 CD3+ T 세포는 CD31+ 세포와 상호작용하여 이동하는 것으로 보였다(도 6f).
이상과 같은 결과들은 SVF 스페로이드가 면역세포의 이동 통로가 되는 혈관을 형성할 수 있음을 보여주는 것이라 할 수 있다.
2.3 SVF 스페로이드의 수지상세포의 유인 능력과 T 세포와 수지상세포의 상호 작용 증진 능력
mRNA 분석을 통해 3차원 배양 SVF 스페로이드(SPH)에서 케모카인, 사이토카인, 성장인자의 유전자 발현 변화를 확인한 결과, 0일째(D0) 2차원 배양 SVF에 비해 면역세포를 불러오거나 활성화시키는 인자들의 발현이 통계적으로 유의성(p value <0.05) 있게 증가하였음을 확인하였다(도 7a). 도 7a에서 >10은 유전자 발현의 배수(fold change) 값이 대조군(SVF(D0)) 평균의 10배 초과를 의미하고 <0.1은 0.1배 미만을 의미한다. 구체적으로 혈관신생을 유도하는 인자인 Vegfa(vascular endothelial growth factor α) 유전자, Pdgfc(platelet derived growth factor C) 유전자 발현이 증가하였고, 세포외기질을 분해하여 세포 이동 통로를 열어주는 Mmp 8, 10 및 13(Matrix metalloproteinase 8, 10, 13) 유전자 발현 또한 증가하였으며, 면역세포를 불러들이고 활성화시키는 인자인 Spp1, Ccl8, Cxcl5, Postn, Cxcl16, Ccl17 유전자 발현도 증가하였다. 특히 수지상세포의 성숙과 생존을 조절하는 인자로 알려진 인자 osteopontin에 대한 유전자 Spp1의 발현이 증가하였는데, 배양 상층액에 있는 osteopontin을 정량한 결과 SVF 스페로이드에서 그 농도 매우 높게 증가하였음을 확인하였다(도 7b).
이러한 결과들은 SVF 스페로이드가 면역세포를 불러들이고 활성화시키는 다양한 인자들을 발현함을 보여주는 것이라 할 수 있다.
상기 SVF 스페로이드에서 분비되는 케모카인 등이 실제로 면역세포를 불러올 수 있는지 확인하기 위해서 콜라겐 층을 이용하여 이동 분석(migration assay)를 24시간 수행하였는데, 그 결과 오른쪽에 있는 비장세포(splenocyte)가 왼쪽에 있는 SVF 스페로이드(SPH)로 향해서 시간이 지날수록 이동하는 것을 확인할 수 있었다(도 8a). SVF 스페로이드의 면역세포 유인 능력에 대해서 CD3+ T 세포와 수지상세포인 BMDCs(bone marrow-derived dendritic cells)에 대해서 이동 분석(migration assay)를 수행하였을 때 CD3+ T 세포는 이동하지 못하였지만 수지상세포인 BMDCs는 SVF 스페로이드로 이동함을 확인하였다(도 8b, 8c, 8d).
SVF 스페로이드가 in vivo에서 면역세포의 유인 능력이 있는지를 확인하기 위하여 마우스 신장 캡슐에 SVF 스페로이드(SVF)를 이식하였을 때 CD3+ T 세포를 유인하지 못하였으나 성숙 수지상세포(mDC) BMDCs를 같이 이식하였을 때 많은 CD3+ T 세포를 유인함을 확인하였으며 이러한 CD3+ T 세포는 PDPN+ SVF 세포와 혼재되어 있음을 확인하였다(도 9a: SVF 스페로이드 단독 이식군, 9b: 성숙 수지상세포 단독 이식군, 9c: SVF 스페로이드와 성숙 수지상세포를 함께 주입한 이식군). 수지상세포 BMDCs만을 이식하였을 때도 CD3+ T 세포를 유인하였지만 수지상세포를 SVF 스페로이드와 함께 이식하였을 때 더 많은 CD3+ T 세포를 유인함을 확인하였다(도 9d).
상기 SVF 스페로이드에 의해 유인된 T 세포들은 CD4+, CD8+ T 세포들과 CD11c+ 수지상세포들을 포함하고 있었으며(도 10a, 10b), 유세포 분석(flow cytometry)으로 정량화하였을 때 성숙 수지상세포(mDC)와 SVF 스페로이드를 이식한 그룹(SPH+mDC)에서 CD3+ T 세포, CD4+ T 세포가 가장 많이 있었음을 확인할 수 있었고, 또 CD8+ T 세포, CD11c+ 수지상세포가 많이 존재함을 확인할 수 있었다(도 10c~10j). 이러한 결과들은 SVF 스페로이드가 수지상세포와 함께 존재할 때 CD3+ T 세포의 침윤을 증가시킬 수 있음을 보여주는 것이라 할 수 있다.
SVF 스페로이드가 수지상세포와 함께 존재할 때 유인된 상기 T 세포들이 CD62L-CD44+ 효과기 T 세포(CD62L-CD44+ effector T cell), CD62L+CD44+ 기억 T 세포(CD62L+CD44+ memory T cell), CD62L+CD44- 미성숙 T 세포 (CD62L+CD44- naive T cell) 중 어떤 상태인지 알기 위해서 유세포 분석(flow cytometry)으로 더 상세히 분석하였을 때 이식편에 모여든 T 세포 중에 CD4+ 효과기 T 세포가 가장 많은 부분을 차지 하고 있다(도 11a, 11b).
이상과 같은 결과들은 SVF 스페로이드가 수지상세포를 유인하고 수지상세포가 T 세포와 상호작용하는 것을 증진시키며, T 세포가 대부분 CD4+ 효과기 T 세포로 분화되어 면역반응을 수행하는 것임을 보여준다 할 수 있다.
2.4 SVF 스페로이드와 수지상세포의 복합체는 항원 특이적 T 세포의 반응을 증진시킴
SVF(SVF의 2차원 배양물)가 수지상세포와 T 세포의 상호작용을 조절하는 기작을 확인하기 위하여 2차원 배양물인 SVF와 성숙 수지상세포(mature DC, mDC)를 공동배양 했을 때, 수지상세포의 활성화마커인 CD40, CD80, MHCII, DC-SIGN의 발현이 미성숙 수지상세포(immature DC, iDC), 성숙 수지상세포 단독 배양에 비해 실제로 증가함을 확인할 수 있었다(도 12a). 또한, 2차원 배양물인 SVF와 성숙 수지상세포를 1일 동안 공동배양하고 7 AAD로 염색하여 세포사멸 정도를 살펴보았을 때 미성숙 수지상세포(iDC)와 성숙 수지상세포(mDC) 단독배양에 비해 SVF와 공동배양했을 때 성숙 수지상세포 (SVF+mDC)의 생존율이 향상됨을 확인하였다(도 12b). 또 이차원 배양물인 SVF와 비장세포를 7일 동안 공동배양하고 7 AAD를 염색했을 때도 비장세포 단독 배양 (Spl) 보다 SVF와 7일간 공동배양한 비장세포 (SVF+Spl)이 약 8배 높은 생존율을 보였다(도 12c).
SVF 스페로이드와 mDC 복합체가 항원 특이적 T 세포의 반응을 증진시킬 수 있는지를 살펴보기 위하여 (i) 미처리(untreated, UT), (ii) SVF 스페로이드와 OVA(ovabulbumin) 이식군(SPH), (iii) OVA를 탑재한 성숙 수지장세포(mDC) 이식군(mDC), (iv) SVF 스페로이드와 OVA를 탑재한 성숙 수지상세포(mDC) 이식군(SPH+mDC)으로 나누어(n=5), 마우스 신장 캡슐에 실험 시작시와 2주째 2회 이식하고(도 13a), 4주 후 MHC 사중체(tetramer)에 제시된 OVA 펩티드를 염색하여 OVA 항원 특이적 CD4+, CD8+ T 세포의 비율을 살펴보았을 때 CD4+, CD8+ T 세포의 비율이 SVF 스페로이드와 OVA로 활성화사킨 mDC 이식군에서 높게 증가함을 확인하였다(도 13b). 여기서 항원인 OVA는 Fe3O4-ZnO 나노 입자에 결합시켜 수지상세포로의 탑재에 사용하였다.
이러한 결과들은 성숙 수지상세포를 SVF 이차원 배양물이나 그 스페로이드와 공동배양하거나 공동이식할 경우 수지상세포의 활성화가 촉진되고 생존율이 향상됨으로써 결과적으로 보다 효과적으로 T 세포를 활성화시켜 항원 특이적 T 세포의 반응을 증진시킬 수 있음을 보여주는 것이라 할 수 있다.
2.5 SVF 스페로이드와 수지상세포의 복합체의 항종양 활성
앞에서와 확인하였던 증가된 항원특이적 T 세포 면역반응이 실제로 암세포의 성장을 억제하는 항암 효과가 있는지 확인하기 위해서, OVA를 발현하는 B16 멜라노마 세포(B16-OVA)를 마우스의 옆구리에 주입하고, 앞에서와 같이 (i) 미처리(untreated, UT), (ii) SVF 스페로이드와 OVA(ovabulbumin) 이식군(SPH), (iii) OVA를 탑재한 mDC 이식군(mDC), (iv) SVF 스페로이드와 OVA를 탑재한 mDC 이식군(SPH+mDC)으로 나누어(n=5), 마우스 신장 캡슐에 총 3번 1주일 간격으로 이식하였다(도 14a). 여기서도 항원인 OVA는 Fe3O4-ZnO 나노 입자에 결합시켜 수지상세포로의 탑재에 사용하였다. 32일 동안의 실험 결과, SVF 스페로이드와 OVA로 활성화사킨 mDC 이식군에서 종양의 성장이 가장 많이 억제되었고 또한 생존율도 실험 기간 동안 100%를 유지하였다(도 14b, 14c, 14d). 따라서, SVF 스페로이드와 수지상세포가 수지상세포 단독으로 주입하는 것에 비해 효과가 증가했음을 알 수 있었다.
이상과 같이, 지방조직에서 분리한 기질혈관분획(SVF)이 수지상세포 이식 부위에 수지상세포와 함께 이식될 때 그 이식된 부위에서 수지상세포를 활성화시켜 결과적으로 T 세포의 반응을 증진시킬 수 있음을 확인할 수 있다(도 15).

Claims (18)

  1. 지방조직에서 분리된 기질혈관분획과 항원이 탑재된 수지상세포를 유효성분으로 포함하는 면역반응 증진용 조성물.
  2. 제1항에 있어서,
    상기 기질혈관분획은 2차원 배양물 또는 3차원 배양물인 스페로이드인 것을 특징으로 하는 조성물.
  3. 제1항에 있어서,
    상기 면역반응은 T 세포에 의한 면역반응인 것을 특징으로 하는 조성물.
  4. 제1항에 있어서,
    상기 항원은 바이러스 유래 항원, 병원성 미생물 유래 항원 또는 종양 유래 항원인 것을 특징으로 하는 조성물.
  5. 제1항에 있어서,
    상기 조성물은 바이러스 감염증 치료 또는 예방을 위한 항바이러스용 면역증진용 조성물, 병원성 미생물에 의한 감염증 치료 또는 예방을 위한 항미생물용 면역증진용 조성물 또는 종양 치료 또는 예방을 위한 항종양 면역증진용 조성물인 것을 특징으로 하는 조성물.
  6. 제1항에 있어서,
    상기 수지상세포는 상기 조성물이 투여되는 개체로부터 얻어진 자가(autologous) 수지상세포이거나, 다른 개체로부터 얻어진 동종의 수지상세포이거나 이종의 개체로부터 얻어진 이종의 수지상세포인 것을 특징으로 하는 조성물.
  7. 제1항에 있어서,
    상기 수지상세포는 미성숙 수지상세포 또는 성숙 수지상세포인 것을 특징으로 하는 조성물.
  8. 제1항에 있어서,
    상기 지방조직은 피하 지방조직(subcutaneous fat tissue)이나 기관 주위의 지방조직인 내장 지방조직(visceral fat tissue)인 것을 특징으로 하는 조성물.
  9. 제1항에 있어서,
    상기 항원은 종양 유래 항원이고,
    그 종양 유래 항원은 종양세포의 표면 발현 단백질, 종양세포의 표면 발현 수용체, 종양세포 내부의 펩타이드, 종양세포 내부의 단백질 또는 종양세포의 용해물인 것을 특징으로 하는 조성물.
  10. 제1항에 있어서,
    상기 항원은 종양 유래 항원이고,
    그 종양 유래 항원은 EGFRvⅢ, EGFR, 메타스틴 수용체(Metastin receptor), 수용체 타이로신 카이나제(Receptor tyrosine kinases), HER2(Human epidermal growth factor receptor 2), 타이로신 카이나제-18-수용체(c-Kit), HGF 수용체 c-Met, CXCR4, CCR7, 엔도테린-A 수용체, PPAR-δ(peroxisome proliferator activated receptor δ), PDGFR-α(Platelet-derived growth factor receptor α), CD133, CEA(carcinoembryonic antigen), EpCAM(Epithelial cell adhesion molecule), GD2(disialoganglioside), GPC3(Glypican 3), PSMA(Prostate Specific Membrane Antigen), TAG-72(tumor-associated glycoprotein 72), GD3(disialoganglioside), HLA-DR(human leukocyte antigen-DR), MUC1(Mucin 1), NY-ESO-1(New York esophageal squamous cell carcinoma 1), LMP1(Latent membrane protein 1), TRAILR2(tumor-necrosis factor-related apoptosis-inducing ligand receptor), VEGFR2(vascular endothelial growth factor receptor 2), HGFR(hepatocyte growth factor receptor), CD44 또는 CD166인 것을 특징으로 하는 조성물.
  11. 제1항에 있어서,
    상기 조성물은 항바이러스제, 항미생물제, 항암제와 병용 또는 혼합되어 사용되는 것을 특징으로 하는 조성물.
  12. 제1항에 있어서,
    상기 조성물은 약제학적 조성물인 것을 특징으로 하는 조성물.
  13. 지방조직에서 분리된 기질혈관분획과 수지상세포를 유효성분으로 포함하는 면역반응 증진용 조성물.
  14. 제13항에 있어서,
    상기 기질혈관분획은 2차원 배양물 또는 3차원 배양물인 스페로이드인 것을 특징으로 하는 조성물.
  15. 제13항에 있어서,
    상기 면역반응은 T 세포에 의한 면역반응인 것을 특징으로 하는 조성물.
  16. 제13항에 있어서,
    상기 조성물은 바이러스 감염증 치료 또는 예방을 위한 항바이러스용 면역증진용 조성물, 병원성 미생물에 의한 감염증 치료 또는 예방을 위한 항미생물용 면역증진용 조성물 또는 종양 치료 또는 예방을 위한 항종양 면역증진용 조성물인 것을 특징으로 하는 조성물.
  17. 지방조직에서 분리된 기질혈관분획의 스페로이드를 유효성분으로 포함하는 수지상세포 성숙화 조성물.
  18. 제17항에 있어서,
    상기 기질혈관분획은 2차원 배양물 또는 3차원 배양물인 스페로이드인 것을 특징으로 하는 조성물.
PCT/KR2021/006068 2020-05-15 2021-05-14 지방조직에서 분리된 기질혈관분획의 수지상세포의 활성화 기능을 이용한 면역 반응 증진용 조성물 WO2021230704A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP21803905.5A EP4151224A4 (en) 2020-05-15 2021-05-14 COMPOSITION FOR ENHANCEMENT OF THE IMMUNE RESPONSE BY USING THE ACTIVATION FUNCTION OF DENDRITIC CELLS FROM CURRENT VESSEL FRACTIONS FROM ADIBLE TISSUE
US17/925,355 US20230173065A1 (en) 2020-05-15 2021-05-14 Composition for enhancing immune response by using activation function of dendritic cells of stromal vascular fractions isolated from adipose tissues
CN202180035539.9A CN116056716A (zh) 2020-05-15 2021-05-14 利用从脂肪组织分离出来的基质血管组分的树突状细胞的激活功能的免疫反应增强用组合物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0058661 2020-05-15
KR20200058661 2020-05-15

Publications (1)

Publication Number Publication Date
WO2021230704A1 true WO2021230704A1 (ko) 2021-11-18

Family

ID=78524703

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006068 WO2021230704A1 (ko) 2020-05-15 2021-05-14 지방조직에서 분리된 기질혈관분획의 수지상세포의 활성화 기능을 이용한 면역 반응 증진용 조성물

Country Status (5)

Country Link
US (1) US20230173065A1 (ko)
EP (1) EP4151224A4 (ko)
KR (1) KR20210141411A (ko)
CN (1) CN116056716A (ko)
WO (1) WO2021230704A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0663930A1 (fr) 1992-10-09 1995-07-26 Cray Valley Sa Compositions de resines chargees moulables en feuilles aptes a etre transformees par compression et leur application a la production de pieces moulees
WO1995028479A1 (de) 1994-04-14 1995-10-26 KLINIKUM DER ALBERT-LUDWIGS-UNIVERSITäT FREIBURG Verfahren zur herstellung von dendritischen zellen, so erhaltene zellen und behälter zur durchführung dieses verfahrens
EP0922758A2 (en) 1997-10-27 1999-06-16 Rockefeller University Methods and compositions for obtaining mature dendritic cells
US20120164113A1 (en) * 2010-12-27 2012-06-28 Steven Victor Ultrasonic cavitation derived stromal or mesenchymal vascular extracts and cells derived therefrom obtained from adipose tissue and use thereof
KR20180042284A (ko) * 2015-08-11 2018-04-25 스템이뮨, 인코포레이티드 암 치료에 사용하기 위한 천연두 백신

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW200726474A (en) * 2005-07-15 2007-07-16 Cognate Therapeutics Inc The immunophenotype and immunogenicity of human adipose derived cells
EP2566518A4 (en) * 2010-05-07 2013-12-25 Baylor Res Inst THROUGH DENDRITIC CELL IMMUNE RECEPTORS MEDIATED CROSS-PRIMING OF HUMAN CD8 + T CELLS
WO2012040101A1 (en) * 2010-09-21 2012-03-29 University Of Miami Compositions and methods for inducing migration by dendritic cells and an immune response
EP2999780B1 (en) * 2013-05-22 2019-10-09 The Regents of the University of California Pluripotent human adipose adult stem cells: isolation, characterization and clinical implications
SG11201600133TA (en) * 2013-07-10 2016-02-26 Agency Science Tech & Res Method for isolating stromal vascular fraction
US20160024469A1 (en) * 2013-07-29 2016-01-28 Allan Yang Wu Non-conventional Cellular Based Immunotherapy
CN104706674A (zh) * 2013-12-16 2015-06-17 西比曼生物科技（上海）有限公司 用于治疗乙肝的脂肪间充质祖细胞和脂肪基质血管成分组合物
US20200078411A1 (en) * 2017-02-10 2020-03-12 Obatala Sciences, Inc. Biological Scaffolds, Products Containing Biological Scaffolds and Methods of Using the Same

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0663930A1 (fr) 1992-10-09 1995-07-26 Cray Valley Sa Compositions de resines chargees moulables en feuilles aptes a etre transformees par compression et leur application a la production de pieces moulees
WO1995028479A1 (de) 1994-04-14 1995-10-26 KLINIKUM DER ALBERT-LUDWIGS-UNIVERSITäT FREIBURG Verfahren zur herstellung von dendritischen zellen, so erhaltene zellen und behälter zur durchführung dieses verfahrens
EP0922758A2 (en) 1997-10-27 1999-06-16 Rockefeller University Methods and compositions for obtaining mature dendritic cells
US20120164113A1 (en) * 2010-12-27 2012-06-28 Steven Victor Ultrasonic cavitation derived stromal or mesenchymal vascular extracts and cells derived therefrom obtained from adipose tissue and use thereof
KR20180042284A (ko) * 2015-08-11 2018-04-25 스템이뮨, 인코포레이티드 암 치료에 사용하기 위한 천연두 백신

Non-Patent Citations (33)

* Cited by examiner, † Cited by third party
Title
AM. J. PHYSIOL. CELL PHYSIOL., vol. 300, 2011, pages C1205 - C1214
ANNE T COLLINS ET AL.: "Prospective Identification of Tumorigenic Prostate Cancer Stem Cells", CANCER RES., vol. 65, no. 23, 1 December 2005 (2005-12-01), pages 10946 - 51, XP008128778, DOI: 10.1158/0008-5472.CAN-05-2018
ANNU. REV. IMMUNOL., vol. 21, 2003, pages 335 - 376
ARONOWITZ ET AL., SPRINGERPLUS, vol. 4, 2015, pages 713
BIOCHEM BIOPHYS RES COMMUN, vol. 514, 2019, pages 1081 - 1086
BIOCHEMISTRY AND MOLECULAR BIOLOGY EDUCATION, vol. 39, 2011, pages 28 - 37
BIOMATERIALS, vol. 27, no. 36, 2006, pages 6032 - 42
BIOMATERIALS, vol. 28, no. 3, 2007, pages 559 - 66
BIOMED MICRODEVICES, vol. 10, no. 2, 2008, pages 197 - 202
BIOTECHNOL BIOENG, vol. 83, no. 2, 2003, pages 173 - 80
BIOTECHNOL BIOENG, vol. 98, no. 3, 2007, pages 694 - 700
BOWLES ANNIE C., WISE RACHEL M., GERSTEIN BRITTANY Y., THOMAS ROBERT C., OGELMAN ROBERTO, FEBBO ISABELLA, BUNNELL BRUCE A.: "Immunomodulatory Effects of Adipose Stromal Vascular Fraction Cells Promote Alternative Activation Macrophages to Repair Tissue Damage", STEM CELLS, vol. 35, no. 10, 1 October 2017 (2017-10-01), pages 2198 - 2207, XP055869666, ISSN: 1066-5099, DOI: 10.1002/stem.2689 *
CANCER RES, vol. 37, no. 10, 1977, pages 3639 - 43
CELL TRANSPLANT, vol. 15, no. 6, 2006, pages 521 - 32
CHENWEI LI ET AL.: "Identification of Pancreatic Cancer Stem Cells", CANCER RES., vol. 67, no. 3, 1 February 2007 (2007-02-01), pages 1030 - 7, XP002461762, DOI: 10.1158/0008-5472.CAN-06-2030
CRIT REV ONCOL HEMATOL, vol. 36, no. 2-3, 2000, pages 107 - 22
CYTOTHERAPY, vol. 15, 2013, pages 641 - 648
DHAVAL S SANCHALA ET AL.: "Oncolytic Herpes Simplex Viral Therapy: A Stride Toward Selective Targeting of Cancer Cells", FRONT PHARMACOL., vol. 16, no. 8, 2017, pages 270
IMMUNOL RES., vol. 65, 2017, pages 798 - 810
IN VITRO CELL DEV BIOL ANIM, vol. 33, no. 6, 1997, pages 459 - 66
IN VITRO CELL DEV BIOL ANIM, vol. 37, no. 10, 2001, pages 656 - 67
KOREAN J OTORHINOLARYNGOL-HEAD NECK SURG, vol. 63, no. 6, 2020, pages 245 - 51
NAT MED, vol. 4, no. 8, 1998, pages 901 - 7
NAT NANOTECHNOL, vol. 6, 2011, pages 675 - 682
NATURE METHODS, vol. 3, 2006, pages 55 - 64
PER ANDERSON, ELENA GONZALEZ-REY, FRANCISCO O’VALLE, FRANCISCO MARTIN, F. JAVIER OLIVER, MARIO DELGADO: "Allogeneic Adipose-Derived Mesenchymal Stromal Cells Ameliorate Experimental Autoimmune Encephalomyelitis by Regulating Self-Reactive T Cell Responses and Dendritic Cell Function", STEM CELLS INTERNATIONAL, HINDAWI PUBLISHING CORPORATION, US, vol. 2017, 1 January 2017 (2017-01-01), US , pages 1 - 15, XP055663479, ISSN: 1687-966X, DOI: 10.1155/2017/2389753 *
See also references of EP4151224A4
SHUO MA ET AL.: "Current Progress in CAR-T Cell Therapy for Solid Tumors", INT J BIOL SCI., vol. 15, no. 12, 7 December 2019 (2019-12-07), pages 2548 - 2560
STEM CELL RES THER, vol. 8, no. 1, 15 June 2017 (2017-06-15), pages 145
TISSUE ENG, vol. 12, no. 5, 2006, pages 1357 - 68
TISSUE ENG, vol. 13, no. 7, 2007, pages 1455 - 68
TRENDS BIOTECHNOL, vol. 22, no. 4, 2004, pages 195 - 202
WCULEK STEFANIE K.; CUETO FRANCISCO J.; MUJAL ADRIANA M.; MELERO IGNACIO; KRUMMEL MATTHEW F.; SANCHO DAVID: "Dendritic cells in cancer immunology and immunotherapy", NATURE REVIEWS IMMUNOLOGY, NATURE PUBLISHING GROUP UK, LONDON, vol. 20, no. 1, 29 August 2019 (2019-08-29), London, pages 7 - 24, XP036976389, ISSN: 1474-1733, DOI: 10.1038/s41577-019-0210-z *

Also Published As

Publication number Publication date
CN116056716A (zh) 2023-05-02
KR20210141411A (ko) 2021-11-23
EP4151224A1 (en) 2023-03-22
US20230173065A1 (en) 2023-06-08
EP4151224A4 (en) 2024-03-13

Similar Documents

Publication Publication Date Title
US9789174B2 (en) Method for proliferation of antigen-specific T cells
JP5816627B2 (ja) 抗原特異的ｔ細胞の増殖のための方法
RU2399382C2 (ru) Улучшенный способ увеличения числа опухоле-реактивных т-лимфоцитов в иммунотерапии онкологических больных
CN110914410A (zh) γδT细胞扩增、组合物及其使用方法
WO2019189115A1 (ja) ケモカインレセプターと細胞接着分子を発現するｃｄ３陰性細胞の集団、およびその利用並びにその製造方法
US20240263136A1 (en) Methods of preparing an isolated population of dendritic cells and methods of treating cancer using same
US7595192B2 (en) Process for the production of temperature-induced tumor cell lysates for use as immunogenic compounds
Yang et al. Interferon-γ-producing B cells induce the formation of gastric lymphoid follicles after Helicobacter suis infection
CN115461073A (zh) 用于增强树突细胞和T细胞激活以及用于诱导Th-1免疫应答的体外方法和组合物
CA2682661A1 (en) Methods for inducing a natural killer (nk) cell-mediated immune response and for increasing nk cell activity
Lakho et al. Recombinant ubiquitin-conjugating enzyme of Eimeria maxima induces immunogenic maturation in chicken splenic-derived dendritic cells and drives Th1 polarization in-vitro
Hernández-Granados et al. Immunogenic potential of three transmissible venereal tumor cell lysates to prime canine-dendritic cells for cancer immunotherapy
US8691568B2 (en) Method for preparing cell populations with anti-tumor immune response activity
Pham et al. Tracking the migration of dendritic cells by in vivo optical imaging
WO2004055053A1 (fr) Vaccin antitumoral
WO2021230704A1 (ko) 지방조직에서 분리된 기질혈관분획의 수지상세포의 활성화 기능을 이용한 면역 반응 증진용 조성물
WO2020145222A1 (ja) 新規ネオアンチゲン及びそれらを用いたがん免疫治療薬
TWI721969B (zh) 藉由使用干擾素（ｉｆｎ）之非接著培養之樹突細胞之調製方法
JP7525109B2 (ja) Ｃｄ１３５＋細胞を含む医薬組成物
WO2024205257A1 (en) Human cd141+ dendritic cells matured with zoledronate carrying wt1 information
WO2024094043A1 (zh) 一种改造的外泌体制剂、其制备方法及应用
US20230149523A1 (en) Treatment of autoimmunity and transplant rejection through establishment and/or promotion of tolerogenic processes by fibroblast-mediated reprogramming of antigen presenting cells
이재원 Application of Stromal Vascular Fractions from Fat Tissues to Improve Dendritic Cell-Mediated Immune Responses
Kirkling Notch signaling facilitates in vitro generation of cross-presenting
Jæhger Preclinical Evaluation of Novel Drug Delivery Platforms for the Improvement of Adoptive T cell Therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21803905

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021803905

Country of ref document: EP

Effective date: 20221215