Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2217/00—Genetically modified animals
  • A01K2217/07—Animals genetically altered by homologous recombination
  • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2227/00—Animals characterised by species
  • A01K2227/10—Mammal
  • A01K2227/105—Murine
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2267/00—Animals characterised by purpose
  • A01K2267/03—Animal model, e.g. for test or diseases
  • A01K2267/035—Animal model for multifactorial diseases
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

• AAV adeno-associated virus
• the system is an AAV expression system for systemic expression (e.g., uniform systemic expression), e.g., a single or multi AAV expression system for uniform, systemic expression (DAEUS).
• DAEUS can achieve overexpression of several geroprotective genes in aged wild-type mice.
• DAEUS can fully rescue Cisd2 expression in Wolfram Syndrome II mice, as well as retard and reverse major progeroid morbidities in these mice.
• DAEUS is a gene therapy platform that, among other uses, enables acceleration of studies into the basic biology of aging, the treatment of progerias, and the overexpression of geroprotective genes to extend healthspan and/or lifespan.
• a viral vector delivery system Disclosed herein is a viral vector delivery system.
• the viral vector delivery system comprises two or more viral serotypes engineered for delivery of a single gene (i.e., the same gene is delivered by each of the two or more viral serotypes).
• the viral vector delivery system comprises an unlimited number of viral serotypes for delivery of the single gene.
• the viral vector delivery system may comprise at least 5, 10, 25, 50, 75, or 100 viral serotypes, or may comprise 2 to 20 or 5 to 10 viral serotypes.
• the viral serotypes are adeno-associated viral serotypes (e.g., AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, Anc80, AAVrh10, AAV-DJ, AAV-DJ/8, AAV-PHP.B, AAV- PHP.S, AAV-PHP.eB, AAV.CAP-B10, AAV.CAP-B22, and AAVMYO, etc.).
• each of the two or more viral serotypes is trophic for a different cell or tissue type (i.e., a first viral serotype is trophic for a first cell or tissue type, and a second viral serotype is trophic for a second cell or tissue type).
• at least one viral serotype is AAV9.
• at least one viral serotype is PHP.eB.
• a first viral serotype is AAV9 and a second viral serotype is PHP.eB.
• a viral serotype is selected from Table 1.
• the viral vector delivery system may further comprise a miRNA target site.
• the miRNA target site is selected based on a tissue target, e.g., aorta, endothelium, cardiac muscle skeletal muscle, tongue, esophagus, stomach, small intestine, large intestine, diaphragm, eye, optic nerve, inner ear, auditory nerve, brown fat, white fat, central nervous system, peripheral nervous system, kidney, spleen, liver, lung, heart, brain, thymus, ovaries, testes, skin, pancreas, bone marrow cells, osteoblasts and osteoclasts, blood cells, hematopoietic stem cells, or muscle satellite cells, or more specifically, cardiac, liver, muscle, or brain tissue.
• a tissue target e.g., aorta, endothelium, cardiac muscle skeletal muscle, tongue, esophagus, stomach, small intestine, large intestine, diaphragm, eye, optic nerve, inner ear, auditory nerve, brown fat, white fat, central nervous system
• miRNA target site is selected from the group consisting of miRNA-1, miRNA-24, miRNA-29, miRNA-30c, miRNA-33, miRNA-122, miRNA-124, miRNA-128, miRNA-133, miRNA-144, miRNA-148a, miRNA-208a, miRNA-208b, miRNA- 223, and miRNA-499.
• a target tissue may be cardiac tissue and the miRNA target site may be miRNA-1, miRNA-133, miRNA-208a, miRNA- 208b, or miRNA-499.
• a target tissue is liver tissue and the miRNA target site is selected from the group consisting of miRNA-24, miRNA-29, miRNA-30c, miRNA-33, miRNA-122, miRNA-144, miRNA-148a, and miRNA-223.
• a target tissue is muscle tissue and the miRNA target site is miRNA-1 or miRNA-133.
• a target tissue is brain tissue and the miRNA target site is miRNA-124 or miRNA-128.
• the viral vector delivery system may further comprise a non-silencing promoter.
• the non-silencing promoter leads to RNA expression of at least 30%, or optionally at least 50%, of CMV promoter expression.
• the promoter is selected from the group consisting of Cbh, CAG, CB7, and CBA. In certain embodiments, the promoter is Cbh.
• the viral vector delivery system optionally further comprises a self-complementary vector backbone.
• the gene to be delivered is selected from Table 2. In certain embodiments, the gene is selected from the group consisting of Cisd2, Atg5, and PTEN. In some embodiments, the gene is a geroprotective gene. In some embodiments, the gene is a gene associated with a disease or disorder in need of treatment in a subject, e.g., a gene whose expression is absent or reduced in a disease or disorder to be treated.
• compositions comprising the viral vector delivery systems disclosed herein.
• methods of treating or preventing a disease or disorder in a subject comprising administering the pharmaceutical compositions or viral vector delivery systems disclosed herein.
• methods of delivering to and expressing in multiple (two or more) cell or tissue types of a subject the same gene relatively simultaneously as well as methods of treating or preventing a disease or disorder.
• the methods comprise administering to a subject a viral vector delivery system comprising at least one viral serotype, at least two viral serotypes, at least three viral serotypes, at least four viral serotypes, or at least five viral serotypes engineered for delivery of a single gene.
• the viral vector delivery system comprises an unlimited number of viral serotypes for delivery of the single gene.
• the disease or disorder is an aging related disease or disorder, e.g., progeria syndrome, Wolfram Syndrome, neurodegenerative disorder, neurovascular disorder, skeletal muscle conditions, Cowden syndrome, Bannayan- Riley-Ruvalcaba syndrome, Proteus syndrome, Proteus-like syndrome and other PTEN-opathies.
• the disease or disorder would benefit from administration of the gene to two or more tissue targets.
• the disease or disorder is Wolfram Syndrome II.
• the gene is expressed in two or more tissues in the subject. The gene may be uniformly expressed or overexpressed across two or more tissues in the subject.
• the gene is delivered to at least 50% of tissues in the subject, and in some embodiments, is expressed for at least 4 months in the subject.
• a viral vector delivery system comprising two or more AAV serotypes engineered for delivery of a single gene, a non-silencing promoter, at least one miRNA target site, the gene, and optionally a self-complementary backbone.
• the AAV serotypes are AAV9 and PHP.eB.
• the gene is selected from the group consisting of Cisd2, Atg5, and PTEN, and preferably is Cisd2.
• Methods of treating a disease or disorder comprising administering to a subject the viral vector delivery system disclosed herein.
• methods of extending the lifespan of a subject comprising administering the viral vector delivery system described herein or a pharmaceutical composition comprising the viral vector delivery system described herein (e.g., a viral vector delivery system comprising at least one, at least two, at least three, at least four, or more viral serotypes engineered for delivery of a single gene).
• methods of treating Wolfram Syndrome II comprising administering an effective amount of Cisd2 to a subject suffering from Wolfram Syndrome II.
• Cisd2 is administered to the subject via gene therapy, e.g., via a viral vector delivery system or any other gene therapy known to those of skill in the art.
• the viral vector delivery system comprises at least one viral serotype, at least two viral serotypes, at least three viral serotypes, at least four viral serotypes, at least five viral serotypes.
• Also described herein are methods of identifying a pre-determined level of gene transfer in one or more target tissues of a subject comprising: obtaining a dose- response curve characterizing the relationship between an amount of a vector administered to the subject and a resulting gene transfer level in the one or more target tissues; obtaining a linear or non-linear equation charactering the relationship between the amount of vector administered to the subject and the resulting gene transfer level in the one or more target tissues; and interpolating or extrapolating a required dose of a gene delivery system to achieve a defined level of gene transfer in the one or more target tissues.
• identifying a pre-determined level of transgene expression in one or more target tissues of a subject comprising: obtaining a dose-response curve characterizing the relationship between an amount of a vector administered to the subject and a resulting transgene expression level in the one or more target tissues; obtaining a linear or non-linear equation charactering the relationship between the amount of vector administered to the subject and the resulting transgene expression level in the one or more target tissues; and interpolating or extrapolating a required dose of a gene delivery system to achieve a defined level of transgene expression in the one or more target tissues.
• the gene delivery system comprises at least one viral serotype, at least two viral serotypes, at least three viral serotypes, at least four viral serotypes, at least five viral serotypes.
• the viral serotype is an adeno-associated viral serotype (e.g., AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, Anc80, AAVrh10, AAV-DJ, AAV- DJ/8, AAV-PHP.B, AAV-PHP.S, AAV-PHP.eB, AAV.CAP-B10, AAV.CAP-B22, AAVMYO, etc.).
• the viral serotype is selected from Table 1.
• the one or more target tissues comprise a single tissue or two or more tissues.
• the one or more target tissues are selected from the group consisting of aorta, endothelium, cardiac muscle skeletal muscle, tongue, esophagus, stomach, small intestine, large intestine, diaphragm, eye, optic nerve, inner ear, auditory nerve, brown fat, white fat, central nervous system, peripheral nervous system, kidney, spleen, liver, lung, heart, brain, thymus, ovaries, testes, skin, pancreas, bone marrow cells, osteoblasts and osteoclasts, blood cells, hematopoietic stem cells, and muscle satellite cells.
• FIGS.1A-1B demonstrates the results of Cisd2 deficiency in mice.
• FIG.1A shows dose-dependent modulation of lifespan by Cisd2 in male mice.
• Cisd2 deficiency shortens the lifespan and causes premature aging in Cisd2 KO mice.
• a persistent level of Cisd2 expression prolongs lifespan and increases the survival rate of Cisd2 TG mice. See Wu, et al. Hum. Mol. Genet.21, 3956–3968 (2012).
• FIG.1B provides images showing the decreased body weight, shortened life span, and the ocular and cutaneous symptoms of aging in Cisd2 ⁇ / ⁇ mice. Early depigmentation and gray hair are seen on the top of the head and on the shoulders, and the prominent eyes and protruding ears of the Cisd2 ⁇ / ⁇ mice are also shown. See Chen, et al. Genes Dev.23, 1183–1194 (2009).
• FIGS.2A-2D provide an overview of ssAAV9.
• FIG.2A provides an ssAAV9 vector overview.
• FIG.2B shows ssAAV9 DNA biodistribution at a dose of ⁇ 1e12vg/mouse (ssAAV9-Atg5 and ssAAV9-Cisd2 denoted as ssAAV9).
• FIGS.2C- 2D show lack of global overexpression on the protein level for Atg5 (FIG.2C) or Cisd2 (FIG.2D).8 week old wild-type C57BL6/J mice were injected and euthanized 28 days post-injection. Cisd2 and Atg5 levels were determined via Simple Wes.
• FIGS.3A-3E demonstrate poor systemic overexpression of rejuvenation genes Oct4-Sox2-Klf4 using conventional ssAAV9 vectors.
• FIG.3A shows Sox2 expression in the liver of WT mice post-intravenous delivery of OSK- AAV9 and OSK transgenic (TG) mice.
• FIG.3C shows AAV-UBC-rtTA and AAV-TRE-Luc vectors used for measuring tissue distribution.
• FIG.3D shows Luciferase imaging of WT mice at 2 months after retroorbital injections of AAV9-UBC-rtTA and AAV9-TRE-Luc (1.0x10 ⁇ 12 gene copies total).
• FIG.3E shows Luciferase imaging of eye (Ey), brain (Br), pituitary gland (Pi), heart (He), thymus (Th), lung (Lu), liver (Li), kidney (Ki), spleen (Sp), pancreas (Pa), testis (Te), adipose (Ad), muscle (Mu), spinal cord (SC), stomach (St), small intestine (In), and cecum(Ce) 2 months after retro-orbital injection of AAV9-UBC-rtTA and AAV9-TRE-Luc followed by treatment with doxycycline for 7 days.
• FIGS.4A-4B demonstrate viral DNA and luciferase expression in different tissues using single-stranded backbone and various AAV serotypes. All serotypes show large variability of more than 100-fold in DNA load and expression levels between major tissues (See Zincarelli et al 2008).
• FIG.4A provides luciferase protein expression profiles of adeno-associated virus (AAV) serotypes 1–9.
• AAV adeno-associated virus
• FIG.4B provides vector genome copy numbers in selected tissues. Luciferase genome copy numbers/ ⁇ g of genomic DNA. Persistence of viral genomes in selected tissues 100 days after tail vein injection of 1 ⁇ 10e11particles of adeno-associated virus (AAV) serotypes 1–9. Genomic DNA was isolated from the indicated tissues and 100 ng of each was used in triplicate to determine vector genome copies. Levels of significance were determined using one-way analysis of variance. The data are shown as mean values ⁇ SEM.
• FIGS.5A-5C provide an overview of the DAEUS system.
• FIG.5A shows the vector delivery system.
• FIG.5B shows AAV DNA biodistribution and
• FIG.5C shows GFP expression at a dose of 2e12vg per mouse using AAV9, PHP.eB or AAV9+PHP.eB together. Note the high tissue-to-tissue variability in viral DNA and GFP expression when AAV9 and PHP.eB are used separately. 18-month old male C57BL6/J mice were injected and euthanized 28 days post-injection.
• FIG.6 shows alanine aminotransferase (ALT) levels 7 days post ssAAV9 (left panel) or scAAV9-miR122 injection (right panel). Elevated ALT levels are indicative of liver damage.
• FIG.7 shows scAAV9 vs DAEUS overexpression of Cisd2. AAV9 alone is insufficient to achieve systemic overexpression.
• FIG.8 shows scAAV9 vs DAEUS overexpression of Atg5. AAV9 alone is insufficient to achieve systemic overexpression.
• 18 month old male C57BL/6J mice were retro-orbitally injected with 2e12 vg/mouse of scAAV9-Atg5.
• FIG.9 demonstrates DAEUS overexpression of PTEN. 18-month old male and female mice (50:50 ratio) were retro-orbitally injected with a total of 4e11or 2e12 vg/mouse of DAEUS-PTEN. Mice were euthanized 28 days post-injection and PTEN levels measured using Simple Wes.
• FIG.10 provides dose-response curves of AAV dose to AAV gene transfer for the brain, heart, liver, and tibialis anterior.
• FIG.11 provides a regression analysis of expected vs observed gene transfer levels.
• the gene transfer levels observed in the mice of group (1) and group (3) from FIG.10 were summed for each tissue individually and compared to the observed gene transfer levels in the mice of group (4) of FIG.10. If no interaction is present between AAV9 and PHP.eB, the sum of gene transfer from groups 1 and 3 for every tissue (Expected) should closely match gene transfer levels in group 4 for every tissue respectively (Observed).
• the regression analysis of the expected vs observed gene transfer levels indicated that the expected values matched to and correlated highly with the observed values.
• FIG.12 provides a comparison of predicated and observed gene transfer patterns for the brain, heart, liver, and tibialis anterior (TA).
• FIG.13 provides a linear regression analysis showing a high correlation of predicted and observed gene transfer levels in the brain, heart, liver, and tibialis anterior (TA) for the different combinations of AAV9 and PHP.eB identified in FIG. 12.
• FIG.14 shows Cisd2 KO mice and their symptoms at 5 months of age. Statistical significance was assessed via two-way ANOVA with Tukey’s post-hoc tests.
• FIGS.15A-15D demonstrate effects of DAEUS-Cisd2. Uniform transduction (FIG.15A) and rescue of Cisd2 expression (FIG.15B) in Cisd2 knockout Wolfram Syndrome II mice is shown.
• FIG.16 shows timelines for assessing effects from administration of DAEUS- Cisd2 on Cisd2 KO mice of various ages (aged (7 months), young (2-4 months), and neonatal (P5-P8)).
• FIG.17 provides results of administering DAEUS-Cisd2 or a vehicle to Cisd2 KO mice aged about P5-P8 days (neonatal) compared to administering a vehicle to WT mice.
• the data measures survival post-injection, frailty, weight change, speed, and time in movement of mice.
• the neonatal mice were further observed for corneal scarring or opacity.
• FIG.18 provides results of administering DAEUS-Cisd2 or a vehicle to Cisd2 KO mice aged about 2-4 months (young) compared to administering a vehicle to WT mice.
• the data measures survival post-injection, frailty, weight change, grid hang ability, and challenging beam crossing of mice.
• FIG.19 provides results of administering DAEUS-Cisd2 or a vehicle to Cisd2 knockout (KO) mice aged about 7 months (aged). Photographs show the mice 40, 64, and 125 days post infection (DPI) and graphs show weight gain and survival of mice who were administered DAEUS-Cisd2 compared to mice that were administered the vehicle (FFB) only.
• DPI days post infection
• FIG.20 shows results of overexpressing DAEUS-PTEN, DAEUS-Atg5, and DAEUS-Cisd2 in WT mice.
• 18 month old wild-type male and female (1:1 ratio) C57BL6/J mice were injected with either 1e12 vg/mouse of DAEUS-PTEN, 2e12vg/mouse of DAEUS-Cisd2 or 8e12 vg/mouse of DAEUS-Atg5.
• FIG.21 shows the lifespan of 24 month old wild-type C57BL/6J mice treated with DAEUS-PTEN/Cisd2/GFP or vehicle.
• DAEUS-Cisd2 treated mice showed a 7% increase in overall median survival and 38% increase in post-injection median survival compared to FFB treated mice.
• DETAILED DESCRIPTION OF THE INVENTION Disclosed herein are gene therapy methods that allow for long-term, efficient, and body wide gene expression. Also disclosed herein are viral vector delivery systems for delivery of one or more genes. The viral vector delivery systems described herein deliver genes into the majority of tissues within a subject, provide uniform gene expression across these tissues, provide long-term and stable gene expression, provide strong and efficient expression of the genes so as to achieve overexpression above wild-type levels, and provide evenly distributed gene expression between individual cells.
• gene therapy e.g., a viral vector delivery system
• a gene e.g., Cisd2, Atg5, of PTEN
• Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, tissue culture and transformation, protein purification, etc. Enzymatic reactions and purification techniques may be performed according to the manufacturer's specifications or as commonly accomplished in the art or as described herein. The following procedures and techniques may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the specification.
• the present application provides viral vector delivery systems capable of delivering genes to a target environment, for example, a cell, a population of cells, a tissue, an organ, or a combination thereof, in a subject transduced with the viral vector delivery system.
• the viral vector delivery system can be used to deliver genes to the aorta, endothelium, cardiac muscle, skeletal muscle, tongue, esophagus, stomach, small intestine, large intestine, diaphragm, eye, optic nerve, inner ear, auditory nerve, brown fat, white fat, central nervous system, peripheral nervous system, kidney, spleen, liver, lung, heart, brain, thymus, ovaries, testes, skin, pancreas, bone marrow cells, osteoblasts and osteoclasts, blood cells, hematopoietic stem cells, and muscle satellite cells of a subject.
• the viral vector delivery system can be used to deliver genes to the brain, heart, liver, and/or muscle (e.g., transverse abdominal muscle or quadricep muscle) of a subject.
• peptides capable of directing viral vectors to a target environment (e.g., the brain, the heart, the liver, muscles, or the combination thereof) in a subject, viral vector capsid proteins comprising the peptides, compositions (e.g., pharmaceutical compositions) comprising viral vectors having capsid proteins comprising the peptides, and the nucleic acid sequences encoding the peptides and viral vector capsid proteins.
• methods of making and using the viral vectors are also disclosed.
• the viral vectors are used to prevent and/or treat one or more diseases and disorders, for example diseases and disorders related to aging.
• vector delivery systems e.g., viral vector delivery systems.
• the viral vector delivery systems may comprise one or more viral serotypes for delivery of a single gene, and in certain aspects may comprise two or more viral serotypes for delivery of a single gene.
• a viral vector delivery system may comprise an unlimited number of viral serotypes for delivery of a single transgene to a subject.
• the viral vector delivery system comprises at least 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 viral serotypes.
• the viral vector delivery system comprises at least one, two, three, four, five, six, seven, eight, nine, or ten viral serotypes. In some embodiments, the viral vector delivery system comprises one to ten, two to eight, five to ten, or five to eight viral serotypes. In some embodiments, the viral vector delivery system comprises one viral serotype. In some embodiments, the viral vector delivery system comprises two viral serotypes. In some embodiments, a first viral serotype delivers a gene to a first target tissue and a second viral serotype delivers the same gene to the first target tissue and/or to a second target tissue.
• a third, fourth, fifth, sixth, seventh, eighth, ninth, and/or tenth viral serotype delivers the gene to one or more tissues.
• the viral serotypes are administered concurrently, proximately, or sequentially.
• Suitable viruses for use in the viral vector delivery system described herein include, e.g., adenoviruses, adeno-associated viruses, retroviruses (e.g., lentiviruses), vaccinia virus and other poxviruses, herpesviruses (e.g., herpes simplex virus), and others.
• the virus may or may not contain sufficient viral genetic information for production of infectious virus when introduced into host cells, i.e., viral vectors may be replication-competent or replication-defective.
• the virus is adeno-associated virus.
• Adeno-associated virus (AAV) is a small (20 nm) replication-defective, nonenveloped virus.
• the AAV genome a single-stranded DNA (ssDNA) about 4.7 kilobase long.
• the genome comprises inverted terminal repeats (ITRs) at both ends of the DNA strand, and two open reading frames (ORFs): rep and cap.
• ITRs inverted terminal repeats
• ORFs open reading frames
• the integrative capacity may be eliminated by removing at least part of the rep ORF from the vector resulting in vectors that remain episomal and provide sustained expression at least in non-dividing cells.
• AAV as a gene transfer vector, a nucleic acid comprising a nucleic acid sequence encoding a desired protein or RNA, e.g., encoding a polypeptide or RNA, operably linked to a promoter, is inserted between the inverted terminal repeats (ITR) of the AAV genome.
• ITR inverted terminal repeats
• Adeno-associated viruses and their use as vectors, e.g., for gene therapy, are also discussed in Snyder, RO and Moullier, P., Adeno-Associated Virus Methods and Protocols, Methods in Molecular Biology, Vol.807. Humana Press, 2011.
• the virus is AAV serotype 1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 10, 11, Anc80, or PHP.eB. (disclosed in US 2017/0166926, incorporated herein by reference). Any AAV serotype, or modified AAV serotype, may be used as appropriate and is not limited.
• AAV a suitable AAV
• Anc80 i.e., Anc80L65
• rhlO WO 2003/042397
• Still other AAV sources may include, e.g., PHP.B, PHP.S, hu37 (see, e.g.
• a viral vector delivery system comprises viral serotypes AAV9 and PHP.eB.
• a recombinant AAV vector may comprise, packaged within an AAV capsid, a nucleic acid molecule containing a 5' AAV ITR, the expression cassettes described herein and a 3' AAV ITR.
• an expression cassette may contain regulatory elements for an open reading frame(s) within each expression cassette and the nucleic acid molecule may optionally contain additional regulatory elements.
• the AAV vector may contain a full-length AAV 5' inverted terminal repeat (ITR) and a full-length 3 ' ITR.
• ITR inverted terminal repeat
• AITR A shortened version of the 5' ITR, termed AITR, has been described in which the D-sequence and terminal resolution site (trs) are deleted.
• sc refers to self-complementary.
• Self-complementary AAV refers to a construct in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intra-molecular double-stranded DNA template.
• dsDNA double stranded DNA
• scAAV Self- complementary recombinant adeno-associated virus
• AAV2 ITRs may be selected for use with an AAV capsid having a particular efficiency for a selected cellular receptor, target tissue or viral target.
• the ITR sequences from AAV2, or the deleted version thereof (AITR) are used for convenience and to accelerate regulatory approval.
• ITRs from other AAV sources may be selected. Where the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped. However, other sources of AAV ITRs may be utilized. Methods for generating and isolating AAV viral vectors suitable for delivery to a subject are known in the art.
• a producer cell line is transiently transfected with a construct that encodes the transgene flanked by ITRs and a construct(s) that encodes rep and cap.
• a packaging cell line that stably supplies rep and cap is transfected (transiently or stably) with a construct encoding the transgene flanked by ITRs.
• AAV virions are produced in response to infection with helper adenovirus or herpesvirus, requiring the separation of the rAAVs from contaminating virus.
• helper adenovirus or herpesvirus More recently, systems have been developed that do not require infection with helper virus to recover the AAV - the required helper functions (i.e., adenovirus El, E2a, VA, and E4 or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase) are also supplied, in trans, by the system.
• helper functions can be supplied by transient transfection of the cells with constructs that encode the required helper functions, or the cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or posttranscriptional level.
• the transgene flanked by ITRs and rep/cap genes are introduced into insect cells by infection with baculovirus-based vectors.
• a “replication-defective virus” or “viral vector” refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells.
• the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the transgene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production.
• the one or more viruses may contain a promoter capable of directing expression in mammalian cells, such as a suitable viral promoter, e.g., from a cytomegalovirus (CMV), retrovirus, simian virus (e.g., SV40), papilloma virus, herpes virus or other virus that infects mammalian cells, or a mammalian promoter from, e.g., a gene such as EF1alpha, ubiquitin (e.g., ubiquitin B or C), globin, actin, phosphoglycerate kinase (PGK), etc., or a composite promoter such as a CAG promoter (combination of the CMV early enhancer element and chicken beta-actin promoter).
• a suitable viral promoter e.g., from a cytomegalovirus (CMV), retrovirus, simian virus (e.g., SV40), papilloma virus, her
• a human promoter may be used.
• the promoter directs expression in a particular cell type (e.g., a targeted population of cells).
• the promoter selectively directs expression in any population of cells described herein.
• the promoter is a non-silencing promoter.
• the promoter is selected from the group consisting chicken ⁇ -actin hybrid (Cbh), CAG, CB7, and CBA.
• a non-silencing promoter is Cbh.
• the non- silencing promoter directs expression that is high, long-term, and uniform across the cells.
• the non-silencing promoter may direct expression that is at least 30%, 40%, 50%, 60%, or 70% of CMV and continues for at least one, two, three, four, five, six, or seven months.
• the viral vector comprises a microRNA (miRNA) target site.
• the miRNA target site is engineered into the vector to detarget particular tissues by reducing or silencing expression of the transgene in selected tissues.
• liver toxicity may be reduced by including a liver- specific miRNA122 target site within the viral vector.
• an miRNA target site is selected based on the particular tissues in which expression is to be silenced or reduced.
• a viral vector comprises liver specific (e.g., miRNA-33, miRNA-223, miRNA-30c, miRNA-144, miRNA-148a, miRNA-24, miRNA-29, and miRNA-122) (see, e.g., Willeit, et al., Eur Heart J 37, 3260-3266 (2016)), muscle specific (e.g., miRNA-1 and miRNA-133) (see, e.g., Xu et al., J.
• liver specific e.g., miRNA-33, miRNA-223, miRNA-30c, miRNA-144, miRNA-148a, miRNA-24, miRNA-29, and miRNA-122
• muscle specific e.g., miRNA-1 and miRNA-133
• cardiac specific e.g., miRNA-1, miRNA-133, miRNA- 208a, miRNA-208b, and miRNA-499
• cardiac specific e.g., miRNA-1, miRNA-133, miRNA- 208a, miRNA-208b, and miRNA-499
• brain specific miRNAs e.g., miRNA-124 and miRNA-128
• Cao et al., Genes Dev.21, 531–536 (2007)
• Adlakha et al., Molecular Cancer 13, 33 (2014).
• a viral vector comprises an miRNA target site selected from the group of miRNA-1, miRNA-24, miRNA-29, miRNA-30c, miRNA-33, miRNA-122, miRNA-124, miRNA-128, miRNA-133, miRNA-144, miRNA-148a, miRNA-208a, miRNA-208b, miRNA- 223, and miRNA-499. Additional examples of miRNA target sites are available at mirbase.org. See Kozomara A, et al. Nucleic Acids Res 2019 47:D155-D162.
• an miRNA target site is an miRNA that is specific (e.g., expressed in a specific tissue at least 10-fold higher than other tissues) and/or highly expressed (e.g., present at levels at least 5X higher than the average levels of all miRNAs in the target tissue).
• the miRNA can be identified using FANTOM (see De Rie, et al., Nat. Biotechnol.35, 872-878 (2017)) or other databases known to those of skill in the art.
• a viral vector comprises a self-complementary (self comp) vector backbone.
• a viral vector may comprise codon-optimized gene coding sequences.
• a viral vector comprising a self- complementary backbone exhibits increased expression, e.g., at least 2X, 5X, 10X, or 15X greater expression.
• the gene is any gene to be delivered to a tissue.
• the gene is associated with a monogenic disease or disorder.
• the gene is an aging-related gene or a geroprotective gene.
• the gene may be any gene listed in Table 2.
• the gene is associated with neurological disorders, oncological disorders, retinal disorders, musculoskeletal disorders, hematology/blood disorders, infectious diseases, immunological disorders, etc. Genes may be identified utilizing the OMIM database available at omim.org.
• the gene is selected from the group consisting of Cisd2, Atg5, and PTEN. Table 2:
• a viral vector delivery system comprises an AAV9 serotype and/or a PHP.eB serotype for delivery of the Cisd2 gene to a subject.
• the viral vector delivery system comprises a miRNA target site, e.g., a miRNA-122 target site.
• the viral vector delivery system comprises a non-silencing promoter, e.g., Cbh, and optionally further comprises a self-complementary backbone.
• the viral vector delivery system may result in overexpression of a native gene by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% of wild-type levels in a target tissue (e.g., in at least 70% of fat free, blood free body mass).
• the viral vector delivery system may result in overexpression of a native gene by at least 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1500%, 2000%, 2500%, 5000%, 7500%, 10000%, 50000%, 100000% of wild-type levels in a target tissue.
• the viral vector delivery system delivers a native gene resulting in overexpression of the native gene by about 10%-90%, 20%-80%, 30%-70%, or 40%-60% of wild-type levels in a tissue. In some embodiments, the viral vector delivery system results in overexpression of a native gene by at least 30%, or by about 25-50%, of wild-type levels.
• the viral vector delivery system may result in detectable expression (e.g., greater than trace expression) of a non-native gene in a target tissue (e.g., in at least 70% of fat free, blood free body mass).
• expression of the delivered gene is stable and long-term (e.g., expression is maintained for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 15 months, 18 months, 21 months, 24 months, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 40 years, 50 years, 60 years, 70 years, 80 years, 90 years).
• the viral vector delivery system delivers a gene of interest to a tissue of interest (e.g., aorta, endothelium, cardiac muscle skeletal muscle, tongue, esophagus, stomach, small intestine, large intestine, diaphragm, eye, optic nerve, inner ear, auditory nerve, brown fat, white fat, central nervous system, peripheral nervous system, kidney, spleen, liver, lung, heart, brain, thymus, ovaries, testes, skin, pancreas, bone marrow cells, osteoblasts and osteoclasts, blood cells, hematopoietic stem cells, and/or muscle satellite cells).
• a tissue of interest e.g., aorta, endothelium, cardiac muscle skeletal muscle, tongue, esophagus, stomach, small intestine, large intestine, diaphragm, eye, optic nerve, inner ear, auditory nerve, brown fat, white fat, central nervous system, peripheral nervous system, kidney, s
• the viral vector delivery system delivers a gene of interest to multiple tissues of interest in a subject.
• the viral vector delivery system may deliver a gene of interest to at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of tissues in a subject.
• the viral vector delivery system delivers a gene to about 10%- 90%, 20%-80%, 30%-70%, or 40%-60% of tissues in the subject.
• the viral vector delivery system may provide uniform or limited variable delivery of a gene across multiple tissues within a subject.
• an effective amount of the pharmaceutical composition is an amount sufficient to prevent, slow, inhibit, or ameliorate a disease or disorder in a subject to whom the composition is administered.
• the delivery of a pharmaceutical composition comprising an effective amount of the viral vector delivery system described herein extends the life expectancy or lifespan of a subject.
• the viral vector delivery system is administered to a subject.
• the viral vector delivery system may deliver a gene to a subject, e.g., to one or more tissues of a subject.
• the subject is expected to suffer from a disease or disorder based on family history or genetic analysis but is not currently suffering from the disease or disorder.
• the subject is suffering from a disease or disorder.
• the subject lacks an effective amount of active Cisd2.
• the Cisd2 gene may be mutated or otherwise inactive in a subject.
• the gene may be delivered using the viral vector delivery system to treat or ameliorate the disease or disorder in the subject.
• a “subject” means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters.
• Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon.
• Patient or subject includes any subset of the foregoing, e.g., all of the above, but excluding one or more groups or species such as humans, primates or rodents.
• the subject is a mammal, e.g., a primate, e.g., a human.
• the subject is a mammal.
• the mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but are not limited to these examples.
• the methods described herein can be used to treat domesticated animals and/or pets.
• a subject can be male or female.
• a subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment or one or more complications related to such a condition, and optionally, but need not have already undergone treatment for a condition or the one or more complications related to the condition.
• a subject can also be one who has not been previously diagnosed as having a condition in need of treatment or one or more complications related to such a condition. Rather, a subject can include one who exhibits one or more risk factors for a condition or one or more complications related to a condition.
• a “subject in need” of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at increased risk of developing that condition relative to a given reference population.
• treat when used in reference to a disease, disorder or medical condition, refer to therapeutic treatments for a condition, wherein the object is to prevent, reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a symptom or condition.
• treating includes reducing or alleviating at least one adverse effect or symptom of a condition.
• Treatment is generally “effective” if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective” if the progression of a condition is reduced or halted.
• treatment includes not just the improvement of symptoms or markers, but also a cessation or at least slowing of progress or worsening of symptoms that would be expected in the absence of treatment.
• Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of the deficit, stabilized (i.e., not worsening) state as compared to that expected in the absence of treatment.
• the viral vector delivery system is administered for immunological purposes, e.g., for vaccination or tolerance induction.
• the efficacy of a given treatment for a disorder or disease can be determined by the skilled clinician.
• a treatment is considered “effective treatment,” as the term is used herein, if any one or all of the signs or symptoms of a disorder are altered in a beneficial manner, other clinically accepted symptoms are improved or ameliorated, e.g., by at least 10% following treatment with an agent or composition as described herein. Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization or need for medical interventions (i.e., progression of the disease is halted). Methods of measuring these indicators are known to those of skill in the art and/or described herein.
• treatment comprises contacting one or more tissues with a composition according to the invention.
• the routes of administration will vary and include, e.g., intradermal, transdermal, parenteral, intravenous, intramuscular, intranasal, subcutaneous, regional, percutaneous, intratracheal, intraperitoneal, intraarterial, intravesical, intraocular, intratumoral, inhalation, perfusion, lavage, and oral administration and formulation.
• Treatment regimens may vary as well, and often depend on disease type, disease location, disease progression, and health and age of the patient.
• the treatments may include various "unit doses" defined as containing a predetermined-quantity of the therapeutic composition.
• the quantity to be administered, and the particular route and formulation are within the skill of those in the clinical arts.
• a unit dose need not be administered as a single injection but may comprise continuous infusion over a specified period of time.
• the dosage ranges for the agent depends upon the potency, and are amounts large enough to produce the desired effect. The dosage should not be so large as to cause unacceptable adverse side effects.
• the efficacy of a given treatment for a disorder or disease can be determined by the skilled clinician. However, a treatment is considered “effective treatment,” as the term is used herein, if any one or all of the signs or symptoms of a disorder are altered in a beneficial manner, other clinically accepted symptoms are improved or ameliorated, e.g., by at least 10% following treatment with an agent or composition as described herein.
• Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization or need for medical interventions (i.e., progression of the disease is halted). Methods of measuring these indicators are known to those of skill in the art and/or described herein.
• the pharmaceutical compositions disclosed herein may be administered intratumorally, parenterally, intravenously, intradermally, intramuscularly, transdermally or even intraperitoneally as described in U.S. Pat. Nos.5,543,158; 5,641,515 and 5,399,363.
• Injection of the viral vector delivery system may be delivered by syringe or any other method used for injection of a solution, as long as the expression construct can pass through the particular gauge of needle required for injection and the dosage can be administered with the required level of precision.
• the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
• aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral and intraperitoneal administration.
• sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure.
• one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologics standards.
• carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
• carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
• the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the viral agent, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
• the methods further comprise administering the pharmaceutical composition described herein along with one or more additional agents, biologics, drugs, or treatments beneficial to a subject suffering from a disorder or disease.
• the viral vector delivery system or pharmaceutical compositions comprising the viral vector delivery system are administered to a subject to treat a disease or condition.
• the disease or condition may be an aging-related disease or condition.
• the disease or condition is a progeria syndrome, (e.g., Hutchinson–Gilford progeria syndrome (HGPS), Wolfram Syndrome (e.g., Wolfram Syndrome I or II), Werner Syndrome, Cockayne syndrome, Myotonic Dystrophy type 1, MDPL syndrome, Dyskeratosis congenital disorder, etc.), connective tissue disorder (e.g., Marfan syndrome, Loeys-Dietz syndrome, Ehlers-Danlos syndrome, Osteogenesis Imperfecta, etc.), metabolic disorders (e.g., Methylmalonic Acidemia, Wilson’s disease, etc.), tumor suppressor and DNA replication deficiency disorders (e.g., PTENopathies (Cowden syndrome, Proteus-like syndromes), Bloom syndrome, RASopathies (Noonan syndrome, Costello syndrome)), neurodegenerative disorder (e.g., Alzheimer’s disease, dementia, mild cognitive decline, etc.), neurovascular disorder (e.g., stroke), skeletal muscle
• the subject may be suffering from any disease or condition that would benefit from administration of a gene to two or more types of tissue.
• the neurodegenerative disorder is one of polyglutamine expansion disorders (e.g., HD, dentatorubropallidoluysian atrophy, Kennedy's disease (also referred to as spinobulbar muscular atrophy), and spinocerebellar ataxia (e.g., type 1, type 2, type 3 (also referred to as Machado-Joseph disease), type 6, type 7, and type 17)), other trinucleotide repeat expansion disorders (e.g., fragile X syndrome, fragile XE mental retardation, Friedreich's ataxia, myotonic dystrophy, spinocerebellar ataxia type 8, and spinocerebellar ataxia type 12), Alexander disease, Alper's disease, Alzheimer disease, amyotrophic lateral sclerosis (ALS), ataxia telangiectasia, Batten disease (also referred to as Spielmeyer-Vogt-Sjogren-Batten disease), Canavan disease, Cockayne syndrome, cortic
• the neurovascular disorder is selected from the group consisting of brain atherothrombosis, brain aneurysms, brain arteriovenous malformations, brain embolism, brain ischemia, for example caused by atherothrombosis, embolism, or hemodynamic abnormalities, cardiac arrest, carotid stenosis, cerebrovascular spasm, headache, intracranial hemorrhage, ischemic stroke, seizure, spinal vascular malformations, reflex neurovascular dystrophy (RND), neurovascular compression disorders such as hemifacial spasms, tinnitus, trigeminal neuralgia, glossopharyngeal neuralgia, stroke, transient ischemic attacks, and vasculitis.
• brain atherothrombosis hemifacial spasms, tinnitus, trigeminal neuralgia, glossopharyngeal neuralgia, stroke, transient ischemic attacks, and vasculitis.
• the skeletal muscle condition is selected from the group consisting of atrophy, bony fractures associated with muscle wasting or weakness, cachexia, denervation, diabetes, dystrophy, exercise-induced skeletal muscle fatigue, fatigue, frailty, inflammatory myositis, metabolic syndrome, neuromuscular disease, obesity, post-surgical muscle weakness, post-traumatic muscle weakness, sarcopenia, toxin exposure, wasting, and weakness.
• a vector delivery system or a pharmaceutical composition comprising the vector delivery system is administered (e.g., intravenously) to a subject.
• the vector delivery system may deliver a gene, e.g., Cisd2, to the subject to treat a disease or condition associated with mutated Cisd2 (e.g., Wolfram Syndrome II or related condition, i.e., loss of vision or cataracts, diabetes, deafness, kidney failure, etc.).
• a disease or condition associated with mutated Cisd2 e.g., Wolfram Syndrome II or related condition, i.e., loss of vision or cataracts, diabetes, deafness, kidney failure, etc.
• mutated Cisd2 e.g., Wolfram Syndrome II or related condition, i.e., loss of vision or cataracts, diabetes, deafness, kidney failure, etc.
• Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context.
• the invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process.
• the invention also includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
• any one or more active agents, additives, ingredients, optional agents, types of organism, disorders, subjects, or combinations thereof, can be excluded.
• claims or description relate to a composition of matter, it is to be understood that methods of making or using the composition of matter according to any of the methods disclosed herein, and methods of using the composition of matter for any of the purposes disclosed herein are aspects of the invention, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
• the invention includes an embodiment in which the exact value is recited.
• the invention includes an embodiment in which the value is prefaced by “about” or “approximately”.
• “Approximately” or “about” generally includes numbers that fall within a range of 1% or in some embodiments within a range of 5% of a number or in some embodiments within a range of 10% of a number in either direction (greater than or less than the number) unless otherwise stated or otherwise evident from the context (except where such number would impermissibly exceed 100% of a possible value).
• geroprotectors target conserved aging pathways (e.g., proteostasis, autophagy, insulin-IGF signaling, mitochondrial metabolism and other pathways) at a systemic level. They have gone through an explosive growth in number and investment over the past 5 years, with over 200 different drugs now existing. [4] These drugs are important first steps towards preventing age-related diseases at their source and will likely go on to have a large patient population.
• small-molecule drugs are fundamentally limited as geroprotectors due to three aspects. Firstly, they have side-effects. Side-effects are caused by off-target effects and on-target effects in tissues where perturbation of the target is unwanted.
• Gene therapies are also the main contestants for treatment of progerias.
• An example of one such disease is Wolfram Syndrome II – a progeria characterized by diabetes, deafness, cataracts, loss of vision and hearing, atrophy of optic nerves, kidney and GI failure, and a number of other health problems, with average lifespan of about 30 years [5,6].
• Wolfram Syndrome II was found to be caused by homozygous loss-of-function mutation in Cisd2 – a small protein active in the mitochondrial membrane and endoplasmic reticulum (ER) [7,8].
• Cisd2 loss in mice leads to decreased lifespan and phenocopy of most human Wolfram Syndrome II symptoms (FIGS.1A-1B) [9].
• Levels of Cisd2 decrease with age in mice [9], whereas overexpression of Cisd2 increases health and lifespan in mice (FIG.1A) [10] and possibly humans [7,11].
• Cisd2 gene therapy is both a potential treatment of Wolfram Syndrome II and geroprotector to increase healthspan in the general population.
• AAV-based geroprotective gene therapies are on track to become a major part of healthcare.
• DAEUS and the shortcomings of current gene therapy methods
• AAVs adeno-associated viruses
• AAVs are by far the most efficacious and commonly used vectors.
• AAVs one of the most commonly used vectors in both research and new clinical trials are single-stranded AAV9 based vectors (ssAAV9).
• ssAAV9 can be produced at high titers and can transduce various tissues of the body, with highest expression present in the liver and lowest (by about 100-1000x) in the brain. While there is now a flurry of new engineered and discovered AAV serotypes, ssAAV9 has remained the method of choice as new vectors have either been more difficult to produce (Anc80) or are more efficacious towards a specific tissue only (PHP.B). Similarly to AAV9, other currently existing AAV serotypes result in highly variable gene transfer levels between various tissues. While ssAAV9 is sufficient for some applications, the attempts to use them for aging studies, which require gene delivery to a broad set of tissues, quickly shows that they are not suitable for this purpose.
• DAEUS Different AAV Expression system for Uniform, Systemic expression
• DAEUS employs a newly designed vector architecture using self-complementary vector backbone, two or more AAV serotypes, one or more microRNA target sites, and a strong non-silencing promoter.
• the chicken ⁇ -actin hybrid (Cbh) promoter uses the chicken ⁇ -actin hybrid (Cbh) promoter to provide expression that is high, long-term and uniform across cells, the liver-specific microRNA 122 target sequence to normalize expression in the liver, codon-optimized gene coding sequences to increase expression further, and two viral serotypes simultaneously (AAV9 and PHP.eB) to deliver genes to most tissues of the body (FIG.5A).
• the resulting DAEUS system provided uniform gene transfer and gene expression across major tissues of the body, unlike their components AAV9 and PHP.eB alone (FIGS. 5B-5C). miRNA target sites are included to dampen too high expression in unwanted tissues.
• liver-specific miRNA122 target site was included as the experiments with non-dampened ssAAV9 vectors demonstrated liver toxicity apparent from elevated alanine transaminase (ALT) levels (FIG.6A).
• Addition of miR-122 target site decreased toxicity despite the use of more potent vectors (FIG. 6B).
• at least two serotypes were included because the experiments using a single serotype alone, even with an optimized self- complementary backbone containing the Cbh promoter and miR122 target sites showed highly unequal or unsatisfactory expression (FIGS.5B-5C, FIGS.7-9).
• DAEUS very uniform, high level and long-term overexpression of several geroprotective genes in aged wild-type mice was demonstrated (FIGS.7-9). Achieving defined levels of gene transfer and transgene expression using DAEUS To achieve optimal therapeutic efficacy, a defined level of transgene expression across various tissues is often required.
• the methods described herein employ DAEUS (consisting of multiple different AAV serotypes, such as AAV9, PHP.eB, AAV8, AAV2, etc. in a single cocktail, possibly in conjunction with miRNA target sites on the vector genome, such as miR122 target site, miR182 target site, etc.) to achieve target levels of gene transfer and expression across multiple tissues of the body.
• first standard curves of the relationship between injected dose of a specific AAV serotype and the resulting gene transfer level and gene expression at the RNA and/or the protein level are created.
• individuals of the target species are injected with a specific AAV serotype with doses ranging anywhere between 1e10 to 1e18 AAV vector genomes copies (GC) per kg and the resulting gene transfer and gene expression at the RNA and/or protein levels are measured.
• GC vector genomes copies
• gene transfer is defined as AAV vector genome DNA per host cell nuclear genome DNA in a target tissue.
• RNA expression is defined as transgene RNA counts per million based on next generation sequencing or as transgene RNA levels normalized to host housekeeping gene levels as determined by reverse quantitative PCR or other quantitative RNA assay in a target tissue.
• Protein expression is defined as levels of transgene protein expression normalized to weight of input tissue, total protein or housekeeping gene protein levels, as assayed by Western Blot, Simple Western, ELISA, or other quantitative protein expression assays in a target tissue. From these data, standard dose-response curves of AAV dose vs gene transfer and gene expression are estimated using linear or non-linear regression methods for each target tissue.
• the equations derived from regression are summed, including interaction terms, for every AAV serotype and miRNA target site used, providing a model which consists of a set of equations, that allows prediction of the individual doses of AAV serotypes used in the cocktail to achieve target level of gene transfer and gene expression pattern.
• Any target species, target tissue, AAV serotype and miRNA target site can optionally be used in this method.
• a prototype system based on the methods described above, to achieve target levels of gene transfer in brain, tibialis anterior, heart, liver, and other organs and tissues of house mice (Mus musculus) was engineered.
• one embodiment of the DAEUS system employing serotypes AAV9 and PHP.eB and miR122 target site was used.
• Cisd2 gene therapy is potentially both a treatment for Wolfram Syndrome II (WSII) and a geroprotective gene therapy for the general population.
• WSII Wolfram Syndrome II
• Cisd2 KO mice were treated with DAEUS-Cisd2 at a total dose of 2e13 vector genomes/kg across various stages of the disease.
• Treatment of mice with DAEUS-Cisd2 at this dose indeed resulted in uniform restoration of Cisd2 gene transfer (FIG.15A) and Cisd2 protein expression to physiological levels across multiple tissues (FIG.15B).
• mice injected as neonates at 2-4 months old, or at 7 months old
• FIGS.15-16 mice injected as neonates, frailty, weight loss, activity, and vision (assayed as looming spot) were maintained at wild-type levels by DAEUS-Cis2 treatment in comparison to the untreated Cisd2 knockout mice, which saw increased morbidity in all of these functions (FIG.17). Additionally, lifespan of DAEUS-Cisd2 treated mice was extended approximately two-fold compared to untreated controls (FIG.17).
• DAEUS DAEUS
• a DAEUS system was engineered to overexpress geroprotective genes Cisd2, Atg5, and PTEN in wild-type (not progeroid) mice with the goal of extending the lifespan of treated mice.
• the ability to overexpress Cisd2, Atg5, and PTEN above wild-type levels in wild-type mice was verified by delivering DAEUS-Atg5, DAEUS-PTEN, and DAEUS-Cisd2 at optimized doses into 18 month old wild-type mice, and measuring the resulting protein expression 1 month post- injection.
• overexpression of all three genes using optimized doses of DAEUS across multiple major tissues of the body were demonstrated (FIG.20).
• DAEUS-Cisd2 and DAEUS-PTEN treated mice did show longer lifespans compared to DAEUS-GFP or vehicle treated mice (DAEUS-Cisd2: 7% increase in overall median lifespan and 38% increase in post-injection lifespan; DAEUS-PTEN: 7% increase in overall median lifespan and 37% increase in post-injection lifespan) (FIG.21).
• DAEUS-Cisd2 7% increase in overall median lifespan and 38% increase in post-injection lifespan
• DAEUS-PTEN 7% increase in overall median lifespan and 37% increase in post-injection lifespan
• FIG.21 The results demonstrate that the DAEUS system described herein can be used to overexpress the geroprotective genes and extend the lifespan of treated subjects.
• the ITR to ITR sequence of DAEUS vectors were fully synthesized and cloned into pAAV ⁇ SC ⁇ CMV ⁇ EGFP ⁇ WPRE ⁇ bGH-2 backbone (received from Vandenberghe lab) using standard molecular cloning.
• ssAAV9 vectors were partially synthesized and cloned into the AAV pCAG-FLEX2-tTA2-WPRE-bGHpA backbone (Addgene).
• native Mus musculus coding sequences were used.
• Atg5 and PTEN coding sequences were codon optimized.
• AAV production and purification HEK293 cells at 80% confluency from four 15cm dishes were seeded to a hyperflask, grown to 80% confluency and triple-transfected with AAV vector, Rep/Cap for AAV8 or AAV9 (Addgene 112864 and 112865) and pAd ⁇ F6 at 130ug :130ug :260ug per hyperflask respectively.
• Lysate was then decanted from the hyperflask, and the hyperflask washed with 140mL of DPBS (10010072 Life Tech) which was added to the rest of the lysate. The total lysate was then centrifuged at 4000g, 4 °C for 30 min, and the supernatant was filtered through a 0.45 ⁇ m PES bottle-top filter (295-4545 Thermo Fisher) before loading onto HPLC.
• DPBS 10010072 Life Tech
• AAV purification was performed using AAVX POROS CaptureSelect (ThermoFisher Scientific) resin with 6.6mm X 100mm column (Glass, Omnifit, kinesis-USA) in an Akta Pure HPLC system containing an auxiliary sample pump (GE LifeSciences ). The machine was setup at room temperature and all purifications were performed at room temperature (approximately 21 °C). Column volume [CV] for each purification was 1 mL. The chromatography column was pre-equilibrated with 10 [CV] of wash buffer 1X Tris-buffered Saline (1X TBS) (Boston Bioproducts), before application of the AAV lysate.
• AAVX POROS CaptureSelect ThermoFisher Scientific
• 6.6mm X 100mm column Glass, Omnifit, kinesis-USA
• Akta Pure HPLC system containing an auxiliary sample pump (GE LifeSciences ).
• Column volume [CV] for each purification was 1 mL.
• the bound AAV was eluted using a low-pH (pH 2.5...2.9) buffer of 0.2M Glycine in 1X TBS at a rate of 1ml/minute. Elution fractions were taken as 0.25 – 1 mL volumes per fraction. The eluted virus solution was neutralized by adding 1M Tris-HCL (pH 8.0) at 1/10th of the fraction volume directly into the fraction collection tube prior to elution.
• Peak fractions based on UV (280 nm) absorption graphs were collected and buffer exchanged in final formulation buffer (FFB: 1X PBS, 172mM NaCl, 0.001% pluronic F68) and concentrated using an Amicon filter with a molecular weight cut-off of 50kDa (UFC905008 EMD Millipore) prior to virus titration.
• FFB final formulation buffer
• viral titer and the genomic titer was determined by a quantitative PCR (TaqMan, Life Technologies).
• Real-time qPCR (7500 Real-Time PCR System; Applied Biosystems, Foster City, CA, USA) with BghpA-targeted primer-probes (GCCAGCCATCTGTTGT (SEQ ID NO: 1), GGAGTGGCACCTTCCA (SEQ ID NO: 2), 6FAM-TCCCCCGTGCCTTCCTTGACC-TAMRA (SEQ ID NO: 3)) was used.
• Linearized CBA-EGFP DNA was used at a series of dilutions of known concentration as a standard. After 95 °C holding stage for 10 seconds, two-step PCR cycling stage was performed at 95 °C for 5 seconds, followed by 60 °C for 5 seconds for 40 cycles.
• Genomic vector titers were interpolated from the standard and expressed as vector genomes per milliliter.
• DNA and protein quantification Tissues were homogenized by disrupting 30mg of tissue in 1mL of RLT+ buffer for DNA and RNA and 1mL of RIPA buffer containing 1X Halt protease and phosphatase inhibitors for protein (78444 Thermo Fisher Sci).
• samples, buffer and 1mm Zirconia/Silica beads (11079110z Biospec) were loaded into XXTuff vials (330TX BioSpec) and disrupted using Mini Beadbeater 24 (112011 BioSpec) at max speed for 3 minutes.
• Vials were then placed on ice for 2-5 minutes for RNA and 1 hour for protein, centrifuged at 10,000g for 3 min and supernatant used for further procedures.
• 700 ⁇ L of supernatant was loaded onto AllPrep DNA Mini Spin Columns and purified using AllPrep DNA/RNA/miRNA Universal Kit (80224 Qiagen) for quadriceps and Allprep DNA/RNA mini kit (80204 Qiagen) for brain and liver. Purification was performed on Qiacube Connect (9002864 Qiagen).
• Total AAV copy number was assessed using BghpA primers and linearized CBA-GFP plasmid dilution series as standard for AAV copy number (GCCAGCCATCTGTTGT (SEQ ID NO: 1), GGAGTGGCACCTTCCA (SEQ ID NO: 2), 6FAM-TCCCCCGTGCCTTCCTTGACC-TAMRA (SEQ ID NO: 3)).
• Total genome copy number was estimated using RPII primers-probes (GTTTTCATCACTGTTCATGATGC (SEQ ID NO: 4), TCATGGGCATTACTATTCCTAC (SEQ ID NO: 5), probe: VIC- AGGACCAGCTTCTCTGCATTATCATCGTTGAAGAT-3IABkFQ (SEQ ID NO: 6)) along with a standard of gDNA dilution series of known concentration. AAV copy number per diploid genome was then calculated as . Efficiency and specificity of amplification for both primer-probe sets was previously established, and amplification was performed using Luna Universal Probe qPCR Master Mix (M3004L NEB) at thermocycling conditions recommended by the manufacturer.
• M3004L NEB Luna Universal Probe qPCR Master Mix
• protein lysate was first diluted 5x twice in fresh RIPA+Halt inhibitors buffer and all dilutions were assayed for total protein content using PierceTM BCA Protein Assay Kit (23225 Thermo Fisher). For each tissue type, lysates were then diluted in RIPA+Halt inhibitors buffer to the concentration where they would be at the lower end of the linear range.
• GFP anti- GFP antibody ab290 (ab290 Abcam) was used.
• Cisd2 PTEN and Atg5, anti- Cisd2 (13318-1-AP Proteintech), anti-Atg5 (NB110-53818 Novus) and anti-PTEN D4.3 (Cell Signaling) antibodies, respectively, were used.
• Linear range for protein quantification was previously determined by assaying each protein separately using 12-230 kDa Jess or Wes Separation Module (SM-W004 Protein Simple) on Wes with ab290 for dilutions ranging from 3 ⁇ g/ ⁇ l...0.03 ⁇ g/ ⁇ l for each tissue.
• Linear range for total protein was also previously determined by assaying total protein in the range of 4 ⁇ g/ ⁇ l...0.1 ⁇ g/ ⁇ l using Total Protein Detection Module (DM-TP01 Protein Simple) (linear range: ⁇ 1 ⁇ g/ ⁇ l for all tissues tested).
• GFP, Atg5, Cisd2 and PTEN as well as total protein levels were then assayed and GFP and total protein quantified using Compass for SW 4.1 (Protein Simple).
• mice were housed in standard ventilated racks at a maximum density of 5 mice per cage. Room temperature was maintained at 22 °C with 30%–70% humidity. Mice were kept on a 12-hour light/dark cycle and provided food and water ad libitum. Breeder mice were kept on irradiated PicoLab Mouse Diet 205058 (LabDiet, St. Louis, MO), and non-breeder mice were kept on irradiated LabDiet Prolab Isopro RMH 30005P75 (LabDiet, St. Louis, MO).
• AAV9 and PHP.eB were used in 1:1 ratios for injections of DAEUS-Atg5, DAEUS-Cisd2, DAEUS-GFP and DAEUS-PTEN, 8-week old or 18-month old wild-type C57BL/6J mice were used as described in text and in figures. Mice were CO2 euthanized 28 days post-injection and tissues and serum collected for analysis, except as otherwise noted in the text and in figures. Serum ALT levels were quantified by UMass Mouse Metabolic Phenotyping Center.
• Cisd2 knockout mice were generated via microinjection of C57BL6/J fertilized oocytes with SpCas9 protein and three guide RNAs targeting Exon 2 of Cisd2 (AGCGCAAGTACCCCGAGGAA (SEQ ID NO: 7), CCCCGAGGAAGGGCAGTAGG (SEQ ID NO: 8), TGCTGTGTTCAGTTTCAGAC (SEQ ID NO: 9)).
• Cisd2 expression was confirmed via Simple Wes (not shown). Mice were then weighed at intervals and frailty assessed 4 months post-injection. Frailty was assessed blinded as the weighted sum of 31 morbidity related measures as described in Whitehead et al. [14], with the exception that non-informative measures (measures that were 0 or 1 across all mice) were excluded from final analysis. Statistical analysis All data was visualized and statistical analysis was performed in GraphPad Prism (GraphPad). Specific statistical tests used are listed in figure legends for each test, and all tests were performed with default settings unless otherwise specified.
• Exemplary viral vectors LOCUS scAAV-CbhM-Atg5(GS)-miR 5237 bp ds-DNA circular DEFINITION .
• Miner1 The redox-active 2Fe-2S protein causative in Wolfram Syndrome 2. J. Mol. Biol.392, 143–53 (2009). PMID:19580816 9. Chen, Y.-F. et al. Cisd2 deficiency drives premature aging and causes mitochondria-mediated defects in mice. Genes Dev.23, 1183–1194 (2009). PMID:19451219 10. Wu, C.-Y. et al. A persistent level of Cisd2 extends healthy lifespan and delays aging in mice. Hum. Mol. Genet.21, 3956–3968 (2012). PMID:22661501 11. Puca, A. A. et al.
• the muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70 and caspase-9 in cardiomyocytes.
• J. Mol. Cell. Cardiol.94, 107–121 (2016). doi:10.1016/j.yjmcc.2016.03.015 18.
• Cao X., Pfaff, S. L. & Gage, F. H.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Biotechnology (AREA)
• Organic Chemistry (AREA)
• Molecular Biology (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• Virology (AREA)
• Physics & Mathematics (AREA)
• Veterinary Medicine (AREA)
• Biophysics (AREA)
• Public Health (AREA)
• Plant Pathology (AREA)
• Animal Behavior & Ethology (AREA)
• Microbiology (AREA)
• Epidemiology (AREA)
• Pharmacology & Pharmacy (AREA)
• Biochemistry (AREA)
• Medicinal Chemistry (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Priority Applications (4)

Applications Claiming Priority (2)

Related Child Applications (1)

Publications (2)

Family

ID=78374241

Family Applications (1)

Country Status (4)

Cited By (3)

Families Citing this family (2)

Family Cites Families (8)

• 2021
  • 2021-04-28 EP EP21796199.4A patent/EP4142758A4/en active Pending
  • 2021-04-28 JP JP2022565920A patent/JP2023524010A/ja active Pending
  • 2021-04-28 WO PCT/US2021/029757 patent/WO2021222476A2/en not_active Ceased
• 2022
  • 2022-02-07 US US17/666,543 patent/US20220193262A1/en not_active Abandoned
• 2025
  • 2025-02-13 US US19/053,116 patent/US20250325701A1/en active Pending

Also Published As

Similar Documents

Legal Events