WO2021195491A2 - Promoteur inductible pour la production de vecteurs viraux - Google Patents

Promoteur inductible pour la production de vecteurs viraux Download PDF

Info

Publication number
WO2021195491A2
WO2021195491A2 PCT/US2021/024350 US2021024350W WO2021195491A2 WO 2021195491 A2 WO2021195491 A2 WO 2021195491A2 US 2021024350 W US2021024350 W US 2021024350W WO 2021195491 A2 WO2021195491 A2 WO 2021195491A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
protein
promoter
inducible promoter
acid sequence
Prior art date
Application number
PCT/US2021/024350
Other languages
English (en)
Other versions
WO2021195491A3 (fr
Inventor
Graham WHYTESIDE
Michael L. Roberts
Victoria Fiona TORRANCE
Original Assignee
Asklepios Biopharmaceutical, Inc.
Synpromics Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Asklepios Biopharmaceutical, Inc., Synpromics Ltd filed Critical Asklepios Biopharmaceutical, Inc.
Priority to JP2022557756A priority Critical patent/JP2023519242A/ja
Priority to US17/907,229 priority patent/US20230407326A1/en
Priority to EP21774695.7A priority patent/EP4125974A4/fr
Priority to CN202180038621.7A priority patent/CN115885046A/zh
Publication of WO2021195491A2 publication Critical patent/WO2021195491A2/fr
Publication of WO2021195491A3 publication Critical patent/WO2021195491A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151—Methods of production or purification of viral material
    • C12N2750/14152—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor

Definitions

  • the present invention relates to cell lines for rapid and scalable production of viral vectors, for example, adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • Recombinant viral vectors for example recombinant adeno-associated viral vectors, lentiviral vectors and adeno vectors, all carrying a heterologous DNA (transgene) are used to deliver genes to cells, where the gene may be expressed to permit, e.g., production of recombinant proteins in vitro or in vivo, vaccination, or treatment of disease states or genetic defects.
  • a disease state or genetic defects by, e.g., a viral gene, such as replication providing an effective level of normal gene products, increased levels of gene products thereby correcting a mal-f mctioning gene, or by blocking endogenous production of a gene, whose expression is deleterious to the cell or organism.
  • Methods for delivering an exogenous gene to a mammalian cell include the use of mammalian viral vectors, such as those that are derived from retroviruses (e.g., lentiviruses), adenoviruses, herpes viruses, vaccinia viruses, polio viruses, adeno-associated viruses, hybrid viruses and the like.
  • retroviruses e.g., lentiviruses
  • adenoviruses e.g., lentiviruses
  • herpes viruses e.g., vaccinia viruses, polio viruses, adeno-associated viruses, hybrid viruses and the like.
  • Adeno-associated virus (AAV) systems have many advantages that can be exploited for delivery of transgenes, and are thus an ideal viral vector for a gene therapeutic.
  • viral protein, replication rep
  • Rep protein has long been known to be required for replication and excision of the AAV genome, however, it is unclear how much Rep protein is required for effective rAAV production.
  • Rep proteins have been shown to be toxic to cell lines, resulting in difficulties with producing stable cell lines expressing Rep. It has further been suggested that attenuation of Rep78/68 production during viral propagation results in higher levels of production of rAAV.
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter operatively linked to a heterologous gene that encodes a toxic protein.
  • the regulatable promoter is an inducible or repressible promoter. In one embodiment of any aspect provided herein, the regulatable promoter is an inducible promoter.
  • the toxic protein is a viral protein.
  • viral proteins include replication (rep), capsid (cap), envelope (env), and polymerase (pol).
  • the toxic protein is associated with nucleic acid transcription.
  • the toxic protein is associated with capsid or envelope production.
  • the inducible promoter is selected from the group selected from a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and
  • the cell comprises at least two inducible promoters, and wherein the at least two inducible promoters are induced by different compositions, and the at least two inducible promoters are operatively linked to distinct heterologous genes that encode different toxic proteins.
  • the cell comprises a first inducible promoter that is operatively linked to a repressible element that can stop protein expression.
  • the first inducible promoter that further encodes a protein that represses expression of the first inducible promoter.
  • the cell comprises a first inducible promoter that further encodes a protein that induces expression of a second inducible promoter.
  • the cell is a eukaryotic cell or a prokaryotic cell.
  • the cell is selected from the cell types listed in Table 2. In one embodiment of any aspect provided herein, the cell is derived from a cell type selected from the cell types listed in Table 2. [0018] In one embodiment of any aspect provided herein, contacting the cell with an inducer results in expression of the at least one toxic protein.
  • the cell is for use in production of a viral particles selected from the group consisting of: an adenovirus vector, a lentivirus vector, a retrovirus vector, a herpesvirus vector, an alphavirus vector, a poxvirus vector, a baculovirus vector, and a chimeric virus vector.
  • a viral particles selected from the group consisting of: an adenovirus vector, a lentivirus vector, a retrovirus vector, a herpesvirus vector, an alphavirus vector, a poxvirus vector, a baculovirus vector, and a chimeric virus vector.
  • One aspect of the invention described herein is a stable cell line for recombinant AAV vector production, comprising at least one inducible promoter, wherein the inducible promoter is operatively linked to a heterologous rep gene that encodes a rep protein.
  • the inducible promoter is further operatively linked to a heterologous cap gene that encodes a cap protein.
  • the stable cell further comprises a second inducible promoter operatively linked to a heterologous cap gene that encodes a cap protein, wherein the second inducible promoter is induced by a compound different from the first inducible promoter.
  • One aspect of the invention described herein is a stable cell line for recombinant AAV vector production, comprising at least one inducible promoter, wherein the inducible promoter is operatively linked to a heterologous cap gene that encodes a cap protein.
  • One aspect of the invention described herein is a method of producing any of the stable cell lines provided herein, the method comprising: (a) transforming a population of cells with at least one nucleic acid cassette containing an inducible promoter operatively linked to a heterologous gene that encodes a toxic protein; (b) culturing the population of cells of (a) under conditions and for a time sufficient to permit expression of the nucleic acid cassette; (c) selecting for a cell that stably expresses the nucleic acid cassette; and (d) growing the cell of (c) to produce the cell line.
  • AAV adeno associate virus
  • the cells are cultured in suspension.
  • the cells are cultured in animal component-free conditions.
  • step (c) comprises isolating the AAV particles from the cells.
  • step (c) comprises isolating the AAV particles from medium in which the cells are cultured.
  • the cells are cultured in shaker flasks.
  • the cells are cultured in bioreactors.
  • step (c) occurs after the toxic protein is expressed.
  • the stable cell comprises at least two inducible promoters
  • the at least two inducible promoters are induced at substantially the same time.
  • the stable cell comprises at least two inducible promoters
  • the at least two inducible promoters are induced at different time and/or for different durations.
  • the method is capable of producing all serotypes, chimeras, and hybrids of AAV.
  • Exemplary AAVs include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, and AAV 13 or a chimeric AAV that is composed of AAV1-13 2.5, 218, 9.45 and other chimeric or hybrid capsids.
  • the AAV particle comprises a rational haploid capsid.
  • the AAV expression system comprises at least one of a recombinant AAV plasmid, a plasmid expressing Rep, a plasmid expressing Cap, and an adenovirus helper plasmid.
  • the recombinant AAV plasmid encodes a transgene.
  • the transgene is a therapeutic transgene.
  • the method provides at least about 4 x 10 4 vector genome-containing particles per cell prior to purification. In one embodiment of any aspect provided herein, the method provides at least about 1 x 10 5 vector genome -containing particles per cell prior to purification. In one embodiment of any aspect provided herein, the method provides at least about 1 x 10 12 purified vector genome-containing particles per liter of cell culture. In one embodiment of any aspect provided herein, the method provides at least about 1 x 10 13 purified vector genome -containing particles per liter of cell culture.
  • One aspect of the invention described herein is a method of producing viral particles, comprising; (a) providing and of the stable cell line described herein in a viral expression system; (b) culturing the cells under conditions in which at least one toxic protein is expressed, wherein the at least one toxic protein is operatively linked to at least one inducible promoter; (c) culturing the cells under conditions in which viral particles are produced; and (d) optionally isolating the viral particles.
  • the viral particles are selected from the group consisting of: an adenovirus vector, a lentivirus vector, a retrovirus vector, a herpesvirus vector, an alphavirus vector, a poxvirus vector, a baculovirus vector, and a chimeric virus vector.
  • One aspect of the invention described herein provides a cell line for recombinant viral vector production, comprising transient expression of at least one inducible promoter, wherein the inducible promoter is operatively linked to a heterologous gene that encodes a toxic protein.
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter operatively linked to a heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to a heterologous gene that encodes a toxic protein
  • the at least one inducible promoter is selected from the group consisting of: a forskolin
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein.
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein.
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to at least one heterolog
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to at least one heterologous gene
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein.
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes a toxic protein. Variants of these and other promoters suitable for use in the present invention are described below.
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter having a sequence of any one of SEQ ID NO: 6 to SEQ ID NO: 9 operatively linked to at least one heterologous gene that encodes a toxic protein. Variants of these and other promoters suitable for use in the present invention are described below.
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter having a sequence of any one of SEQ ID NO: 6 to SEQ ID NO: 9 operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter having a sequence of any one of SEQ ID NO: 6 to SEQ ID NO: 9 operatively linked to at least one heterologous gene that encodes a toxic protein.
  • One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one inducible promoter operatively linked to a heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to a heterologous gene that encodes a toxic protein
  • the at least one inducible promoter is selected from the group consisting of: a forskolin inducible
  • One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein.
  • One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein.
  • One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to at least one heterologous gene that
  • One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to at least one heterologous gene that encodes
  • One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes atoxic protein.
  • One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes a toxic protein.
  • One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one inducible promoter having a sequence of any one of SEQ ID NO:
  • One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one inducible promoter having a sequence of any one of SEQ ID NO:
  • the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone induc
  • One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter having a sequence of any one of SEQ ID NO: 6 to SEQ ID NO: 9 operatively linked to at least one heterologous gene that encodes a toxic protein.
  • the stable cell line further comprises at least one repressible element operatively linked to at least one heterologous gene that encodes a toxic protein.
  • the stable cell line has at least two inducible promoters, and the at least two inducible promoters are the same.
  • the stable cell line has at least two inducible promoters, and the at least two inducible promoters are different.
  • nucleic acid constructs generally relates to nucleic acid constructs, methods, and systems for sequential and/or temporal regulation of gene expression of one or more viral proteins.
  • Such nucleic acid constructs described herein are suitable for viral vector expression systems, e.g., AAV expression systems, and for the generations of a stable cell line for viral vector expression systems and AAV vector expression systems.
  • nucleic acid construct comprising a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding a viral, e.g., E4, protein, a nucleic acid sequence encoding a second viral, e.g., E2A, protein, and a nucleic acid sequence encoding a viral RNA, e.g., VA RNA, wherein each nucleic acid sequence encoding any one of E4, E2A, VA is operatively linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding a Rep protein is under the control of a second regulatable promoter or regulatable transcriptional activator, wherein the first and the second regulatable promoters are different types of regulatable promoters.
  • the regulatable promoters are inducible promoters e.g., hypoxia and/or forskolin inducible promoters
  • Exemplary transcriptional activators include homeodomain transcriptional activator, zinc-finger transcriptional activator, winged-helix (Forkhead) transcriptional activator, leucine-zipper transcriptional activator, and helix-loop-helix transcriptional activator.
  • the transcriptional activator is a zinc-finger transcriptional activator (ZF-TA).
  • a first and a second Rep protein are encoded by the nucleic acid sequence, or by one or more nucleic acid sequences.
  • the first Rep protein is large Rep, e.g., Rep78
  • the second Rep protein is small Rep, e.g., Rep 52.
  • the nucleic acid encoding the first and second Rep proteins is under the control of a second regulatable promoter or regulatable transcriptional activator.
  • each nucleic acid encoding the first and second Rep proteins is under the control of a regulatable transcriptional activator.
  • each nucleic acid encoding the first and second Rep proteins is under the control of the same regulatable transcriptional activator.
  • the transcriptional activator is a zinc- finger transcriptional activator (ZF-TA).
  • the nucleic acid sequence encoding the Rep protein comprises a modified start codon. In one embodiment, the nucleic acid sequence encoding the Rep78 protein comprises a modified start codon. In one embodiment, the nucleic acid sequence encoding the Rep78 protein comprises a modified start codon selected from: ACC, AUC, CUG, and AGG. In such embodiments, the nucleic acid sequence encoding the Rep52 protein comprises a typical start codon. In such embodiments, the nucleic acid sequence encoding the Rep52 protein comprises and ATG start codon.
  • the Rep protein is a modified Rep protein. In one embodiment of any aspect, the Rep protein is a modified Rep78 protein.
  • the modified Rep protein has a lysine to arginine mutation at amino acid 84. In one embodiment of any aspect, the modified Rep78 protein has a lysine to arginine mutation at amino acid 84.
  • the nucleic acid encoding the Rep protein further comprises a nucleic acid encoding a ribozyme at its 3’ end.
  • the second regulatable promoter operatively linked to the nucleic acid encoding the Rep protein is an inducible promoter or comprises a binding site for a regulatable transcriptional activator.
  • the first regulatable promoter operatively linked to the nucleic acid encoding any one of E4, E2A, VA is an inducible promoter.
  • the inducible promoter is selected from the group consisting of a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • the inducible promoter is a forskolin inducible promoter or a hypoxia inducible promoter.
  • the inducible promoter lacks a minimal promoter.
  • the inducible promoter further comprises a TATA box sequence, or a p5 replication sequence, or both a TATA box sequence and p5 replication sequence.
  • the inducible promoter comprises a TATA box sequence, or a p5 replication sequence, or both a TATA box sequence and p5 replication sequence, instead of a minimal promoter.
  • the inducible promoter may be the second regulatable promoter.
  • nucleic acid construct comprising a nucleic acid encoding a promoter, and a TATA box and/or p5, wherein the promoter does not comprise a minimal promoter.
  • nucleic acid construct comprising a nucleic acid sequence encoding a regulatable transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a E4-responsive promoter, or a E2 -responsive promoter or other helper-gene responsive promoter.
  • the helper gene responsive promoter comprises a sequence bound by a transcriptional activator, and wherein the expression or activity of the transcriptional activator is inducible by expression of one or more helper genes.
  • the regulatable transcriptional activator is a zinc -finger transcriptional activator.
  • nucleic acid construct comprising a toxic protein operatively linked to a promoter comprising a target site for binding of a regulatable transcriptional activator, e.g., a zinc -finger transcriptional activator (ZF-TA).
  • a regulatable transcriptional activator e.g., a zinc -finger transcriptional activator (ZF-TA).
  • the toxic protein is a Rep protein.
  • the helper gene responsive promoter comprises a sequence bound by a transcriptional activator, and wherein the expression or activity of the transcriptional activator is inducible by expression of one or more helper genes.
  • nucleic acid construct comprising a gene encoding a Rep protein operatively linked to a promoter comprising a target site for binding of a regulatable transcriptional activator, e.g., a zinc-finger transcriptional activator (ZF-TA), and a promoter.
  • a regulatable transcriptional activator e.g., a zinc-finger transcriptional activator (ZF-TA)
  • ZF-TA zinc-finger transcriptional activator
  • the regulatable transcriptional activator e.g. zinc- finger transcriptional activator (ZF-TA)
  • ZF-TA zinc- finger transcriptional activator
  • the nucleic acid construct encoding a regulatable transcriptional activator, e.g., zinc finger (ZF) transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a helper gene responsive promoter, e.g., an E4-responsive promoter, or a E2 -responsive promoter or other helper-gene responsive promoter.
  • the nucleic acid construct further comprises at least one of: a nucleic acid sequence encoding at least one helper protein, wherein each nucleic acid construct is operatively linked to a regulatable promoter; a nucleic acid encoding a toxic protein wherein the toxic protein under the control of a second regulatable promoter or a regulatable transcriptional activator; a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA RNA, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operatively linked to a regulatable promoter; or a nucleic acid encoding a Rep protein, wherein the Rep protein is under the control of a second regulatable promoter or a regulatable transcriptional activator.
  • the regulatable transcriptional activator is a zinc-finger transcriptional activator.
  • nucleic acid construct comprising a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operatively linked to a promoter, e.g., a constitutive promoter; a nucleic acid sequence comprising at least one of: a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA RNA, wherein each nucleic acid sequences encoding any one of E4, E2A, VA RNA is operatively linked to a regulatable promoter; and/or a nucleic acid sequence encoding a regulatable transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a E4-responsive promoter, or a E2 -responsive promoter; and a nucleic acid construct comprising a Rep protein operatively linked to a promoter comprising
  • the regulatable transcriptional activator is a zinc-finger transcriptional activator.
  • Another aspect described herein provides a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 3’ of the nucleic acid sequence encoding the Cap protein.
  • Another aspect described herein provides a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 5’ of the nucleic acid sequence encoding the Cap protein.
  • nucleic acid sequence encoding a Cap protein is operatively linked to a constitutive promoter.
  • nucleic acid sequence encoding a Cap protein is operatively linked a regulatable promoter.
  • the regulatable promoter is an inducible promoter.
  • the RRS is a Flippase-responsive RRSs.
  • the nucleic acid construct further comprises a nucleic acid encoding a recombinase protein operatively linked to an inducible promoter.
  • nucleic acid construct comprising a first nucleic acid construct comprising a promoter, a stop nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and nucleic acid sequence encoding a Rep protein, wherein the promoter is operatively linked to the nucleic acid encoding the Rep protein, and a second nucleic acid construct comprising, in a 5 ’ to 3 ’ direction: a promoter, a stop nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRSs), and nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operatively linked to the nucleic acid encoding the one or more of E2A, E4, and VA RNA.
  • nucleic acid construct comprising a first nucleic acid construct comprising in a 5’ to 3’ direction: a promoter, a stop nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and nucleic acid sequence encoding a Rep protein, wherein the promoter is operatively linked to the nucleic acid encoding the Rep protein, and a second nucleic acid construct comprising, in a 5’ to 3’ direction: a promoter, a stop nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRSs), and nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operatively linked to the nucleic acid encoding the one or more of E2A, E4, and VA RNA.
  • the nucleic acid construct further comprises a nucleic acid encoding one or more selection markers flanked between a third pair of recombinase recognition sequences (RRSs), wherein the pair of RRS are in the same orientation with respect to each other, and wherein the nucleic acid encoding the one or more selection markers is operatively linked to one or more promoters described herein.
  • RRSs recombinase recognition sequences
  • first pair of RRS and the second pair of RRS are in the same orientation with respect to each other. [0096] In one embodiment of any aspect, the first pair of RRS and the second pair of RRS are in the inverse orientation with respect to each other.
  • the first pair of RRS, second pair of RRS, and third pair of RRS are each responsive to different tyrosine recombinase or serine integrase enzymes.
  • the first pair of RRS and second pair of RRS are responsive to the same tyrosine recombinase or serine integrase enzyme.
  • the first pair of RRS, or second pair of RRS, or both are Cre-responsive RRS.
  • the third pair of RRSs are Flipase-responsive RRS.
  • the cell further comprises a construct comprising a nucleic acid encoding a recombinase protein operatively linked to an inducible promoter. In one embodiment of any aspect, the cell further comprises a nucleic acid encoding a Flipase recombinase protein operatively linked to an inducible promoter.
  • the cell further comprises a nucleic acid encoding a Cre recombinase protein operatively linked to an inducible promoter.
  • Another aspect described herein provides a cell comprising any of the nucleic acid constructs described herein.
  • Another aspect described herein provides a cell comprising at least one of any of the nucleic acid constructs described herein. In one embodiment of any aspect, the cell comprises at least two of any of the nucleic acid constructs described herein. In one embodiment of any aspect, the cell comprises at least three of any of the nucleic acid constructs described herein.
  • the cell further comprises a construct comprising a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operatively linked to a promoter (e.g., a constitutive promoter).
  • a promoter e.g., a constitutive promoter
  • the cell further comprises a construct comprising a nucleic acid sequence encoding a marker protein.
  • the nucleic sequence encoding a marker protein is flanked by recombinase recognition sequences (RRSs) in the same orientation with respect to each other.
  • the cell further comprises a synthetic gene regulation system, wherein the synthetic gene regulation system comprises a targeted DNA binding protein or a nucleic acid sequence encoding a targeted DNA binding protein operably linked to a promoter; and a nucleic acid sequence encoding a gene of interest operably linked to a target promoter, wherein the targeted DNA binding protein is capable of binding to a target sequence, wherein the target sequence is located within the target promoter and/or the nucleic acid sequence encoding the gene of interest to thereby moderate or prevent expression of the gene of interest.
  • the synthetic gene regulation system comprises a targeted DNA binding protein or a nucleic acid sequence encoding a targeted DNA binding protein operably linked to a promoter; and a nucleic acid sequence encoding a gene of interest operably linked to a target promoter, wherein the targeted DNA binding protein is capable of binding to a target sequence, wherein the target sequence is located within the target promoter and/or the nucleic acid sequence encoding the gene of interest to thereby moderate or prevent expression of
  • expression of the construct is a stable expression. [0109] In one embodiment of any aspect, expression of the construct is a transient expression.
  • the cell comprises at least two nucleic acid constructs, and the expression of the at least two nucleic acid constructs is a stable expression.
  • the cell comprises at least two nucleic acid constructs, and the expression of the at least two nucleic acid constructs is a transient expression.
  • the cell comprises at least two nucleic acid constructs, and the expression of at least one nucleic acid construct is a stable expression.
  • Another aspect described herein provides a stable cell comprising stable expression of at least one nucleic acid construct described herein.
  • Another aspect described herein provides a cell comprising transient expression of at least one nucleic acid construct described herein.
  • Another aspect described herein provides a method of producing viral particles, comprising providing any cell lines described herein, any stable cell line described herein, or any transient cell line described herein in a viral expression system; culturing the cells for a time sufficient and under conditions in which the at least one nucleic acid under the control of an regulatable promoter is expressed; culturing the cells under conditions in which viral particles are produced; and optionally isolating the viral particles.
  • Another aspect described herein provides a method of producing viral particles, comprising; (a) providing the cell line expressing a nucleic acid sequence comprising at least one of: a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding a Rep protein is under the control of a second regulatable promoter, wherein the first and the second regulatable promoters are different; (b) culturing the cells for a time sufficient and under conditions in which at least the nucleic acid sequence encoding a E4 protein, the nucleic acid sequence encoding a E2A protein, or the nucleic acid sequence encoding a VA
  • the nucleic acid sequence encoding a E4 protein, the nucleic acid sequence encoding a E2A protein, or the nucleic acid sequence encoding a VA RNA is expressed between hours 3-4 of the viral vector production protocol. In one embodiment, the nucleic acid sequence encoding a Rep protein is expressed between hours 6-8 of the viral vector production protocol.
  • culturing in step (b) is culturing with an inducer of the first regulatable promoter. In one embodiment of any aspect, culturing in step (c) is culturing with an inducer of the second regulatable promoter. In one embodiment of any aspect, the or each inducer may act directly or indirectly to induce expression of a given nucleic acid.
  • Another aspect described herein provides a method of producing viral particles, comprising; (a) providing the cell line expressing at least one of a nucleic acid construct comprising a nucleic acid sequence encoding a regulatable transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a helper gene responsive promoter, e.g., an Ed- responsive promoter, or a E2 -responsive promoter or other helper-gene responsive promoter; nucleic acid construct comprising a toxic protein operatively linked to a promoter comprising a target site for binding of a regulatable transcriptional activator; nucleic acid construct comprising a Rep protein operatively linked to a promoter comprising a target site for binding of a regulatable transcriptional activator; a nucleic acid sequence encoding at least one helper protein, wherein each nucleic acid construct is operatively linked to a regulatable promoter; a nucleic acid encoding the toxic protein is under the control
  • the nucleic acid sequence encoding a E4 protein, the nucleic acid sequence encoding a E2A protein, or the nucleic acid sequence encoding a VA RNA is expressed between hours 3-4 of the viral vector production protocol. In one embodiment, the nucleic acid sequence encoding a Rep protein is expressed between hours 6-8 of the viral vector production protocol.
  • the regulatable transcriptional activator is a zinc-finger transcriptional activator (ZF-TA). In one embodiment the expression or activity of the transcriptional activator is inducible by expression of one or more helper genes.
  • culturing in step (b) is culturing with an inducer of the regulatable promoter operatively linked to a nucleic acid encoding at least E4, E2A, or VA RNA.
  • culturing in step (c) is culturing with the transcriptional activator (e.g., ZF-TA) or an inducer of a second regulatable promoter.
  • expression of the transcriptional activator e.g., ZA-TA
  • expression of the transcriptional activator is induced by expression of E4 or E2 or VA RNA.
  • expression of the transcriptional activator e.g., ZA-TA
  • expression of the transcriptional activator is induced by expression of E4 or E2 or VA RNA directly or indirectly.
  • Another aspect described herein provides a method of producing viral particles, comprising (a) providing the cell line expressing a nucleic acid sequence encoding a tetracycline- responsive transactivator protein operatively linked to a promoter (e.g., a constitutive promoter); a nucleic acid sequence comprising at least one of: a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA RNA, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a regulatable promoter; a nucleic acid sequence encoding a regulatable transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a Ed- responsive promoter, or a E2 -responsive promoter or a VA RNA-responsive promoter; and a nucleic acid construct comprising
  • the nucleic acid sequence encoding a E4 protein, the nucleic acid sequence encoding a E2A protein, or the nucleic acid sequence encoding a VA RNA is expressed between hours 3-4 of the viral vector production protocol. In one embodiment, the nucleic acid sequence encoding a Rep protein is expressed between hours 6-8 of the viral vector production protocol.
  • the regulatable transcriptional activator is a zinc-finger transcriptional activator. In one embodiment the expression or activity of the transcriptional activator is inducible by expression of one or more helper genes.
  • culturing in step (b) is culturing with an inducer of the regulatable promoter operatively linked to at least E4, E2A, or VA RNA.
  • culturing in step (c) is culturing with the transcriptional activator (e.g., ZF-TA).
  • expression of the transcriptional activator (ZF-TA) is induced by expression of E4 or E2 or VA RNA.
  • expression of the zinc-finger transcriptional activator (ZF-TA) is induced by expression of E4 or E2 or VA directly or indirectly.
  • Another aspect described herein provides a method of producing viral particles, comprising (a) providing the cell line expressing a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 3 ’ of the nucleic acid sequence encoding the Cap protein; (b) culturing the cells for a time sufficient and under conditions in which at least the nucleic acid sequence encoding the Cap protein is highly expressed for the first 24 hours of the viral vector production protocol, and is moderately expressed for the remaining 48 hours of the viral vector production protocol; (c) culturing the cells for a time sufficient and under conditions in which viral particles are produced; and (d) optionally isolating the viral particles.
  • a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 3 ’ of the nucleic acid sequence encoding the Cap protein
  • RTS recombinase
  • culturing in step (b) is culturing with an inducer of the regulatable promoter operatively linked to the Cap protein.
  • Another aspect described herein provides a method of producing viral particles, comprising (a) providing the cell expressing a first nucleic acid construct comprising in a 5 ’ to 3 ’ direction: a promoter, a stop nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and nucleic acid sequence encoding a Rep protein, wherein the promoter is operatively linked to the nucleic acid encoding the Rep protein, and a second nucleic acid construct comprising, in a 5’ to 3’ direction: a promoter, a stop nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRSs), and nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operatively linked to the nucleic acid encoding the one or more of E2A, E4, and VA RNA; (b) culturing the cells for a time sufficient
  • the nucleic acid sequence encoding a E4 protein, the nucleic acid sequence encoding a E2A protein, or the nucleic acid sequence encoding a VA RNA is expressed between hours 3-4 of the viral vector production protocol. In one embodiment, the nucleic acid sequence encoding a Rep protein is expressed between hours 6-8 of the viral vector production protocol.
  • culturing in step (b) is culturing with a recombinase specific for the first pair of recombinase recognition sequences (RRSs).
  • culturing in step (c) is culturing with a recombinase specific for the second pair of recombinase recognition sequences (RRSs).
  • Y et another aspect described herein provides a method of producing a stable cell line for producing viral particles, containing a packaging sequence (sometimes referred to as an AAV genome).
  • FIG 1A shows a schematic diagram of hypoxia-inducible gene expression.
  • Transcription factor HIF1A HIFla
  • HIF1B HIF 1 b
  • FIG. IB shows a schematic diagram of the structural organisation of HIFla and HIFi .
  • Both HIFla and HIF 1 b have a bHLH domain for DNA binding.
  • HIF 1 b has a Per-ARNT-Sim (PAS) domain for central heterodimerisation and HIF la’s C terminal domain (TAD N/TAD C) recruits transcriptional coregulatory proteins.
  • PAS Per-ARNT-Sim
  • TAD N/TAD C C terminal domain
  • FIG 2 shows a schematic diagram of promoters RTV-015 and Synp-HYP-001.
  • RTV-015 promoter comprises of five HRE1 and a synthetic minimal promoter MP1. These elements are spaced apart with spacers (not shown).
  • Synp-HYP-001 comprises of four HRE2 and a CMV minimal promoter. The HRE2 elements are not spaced apart with spacers but there is a spacer between the last HRE2 element and the CMV minimal promoter (not shown).
  • Figure 3 shows atime course of luciferase expression from the RTV-015, SYNP- HYP-001, and CMV-IE constructs in transiently transduced HEK293-F cells under hypoxia.
  • Cells were placed in hypoxia at 0 hours and then luciferase activity monitored.
  • Luciferase expression from the CMV minimal promoter which was used as a control, does not change but the rest of the constructs show increase in luciferase activity with time.
  • Figure 4 shows measurement of luciferase expression from the RTV-015 and CMV- IE constructs in transiently transduced HEK293-T in normoxic conditions and after 24 hours in hypoxia.
  • the luciferase expression from the CMV-IE promoter is the same in normoxia and hypoxia.
  • RTV-015 constructs show almost no luciferase activity in normoxia but is induced after 24 hours in hypoxia.
  • Figure 5 shows measurement of luciferase expression from the RTV-015 and CMV- IE constructs in transiently transduced CHO GS suspension cell line in normoxic conditions and after 24 hours in hypoxia.
  • the luciferase expression from the CMV-IE is the same in normoxia and hypoxia.
  • RTV-015 showed almost no luciferase activity in normoxia but is induced after 24 hours in hypoxia.
  • Figure 6 is an illustration of the mechanism of action of forskolin and other adenylyl cyclase activators.
  • Figure 7 shows the activity of the promoters after transient transfection into the suspension cell line HEK293-F.
  • the cells were induced (at time 0 h) with 20 mM forskolin and luciferase expression was measured at 0 h, 3 h, 5 h and 24 h. All constructs showed increase in activity (to a varying degree) while the activity of CMV-IE remained constant.
  • FIG. 8 A shows the cells prior to transformation (day 2).
  • FIG. 8B shows the C2C12 cells 24 hours after transfection (day 3).
  • FIG. 8C shows the differentiated C2C12 cells after 5.5 days into differentiation medium (day 7.5). Scale bar is 50 pm.
  • Figure 9 presents exemplary data showing differences in E1A gene expression between Hek293 cells and ProlO. Results are an average of three (3) experiments and the error bars are standard deviation. ProlO cells express E1A RNA at —1/2 of the level of the parental Hek293 cells.
  • Figure 10 presents exemplary data showing viable cell density at point of transfection and point of harvest.
  • Figure 11 presents exemplary data showing viability at transfection and at point of harvest.
  • Figure 12 presents exemplary data showing E1A RNA levels at point of harvest.
  • Figure 13 presents exemplary data showing vg/cell of rAAV produced from ProlO at different concentrations of El.
  • Figure 14 presents exemplary data showing viable cell density for each of the indicated conditions tested.
  • Figure 15 presents exemplary data showing cell viability of the cells for each of the indicated conditions tested. Mutated Rep has no significant effect on cell viability or growth during production.
  • Figure 16 presents exemplary data showing final viral titer from virus production.
  • Figure 17 presents exemplary data showing viral titer from wtAAV and rAAV productions.
  • wtAAV produces up to 2 log more vg/ml than rAAV.
  • Figure 18 presents exemplary data showing levels of the E2A gene expression during wt and rAAV production.
  • Figure 19 presents exemplary data showing levels of the E4 gene expression during wt and rAAV production
  • Figure 20 presents exemplary data showing levels of Rep78, 52 and Cap2 expression during wtAAV production
  • Figure 21 presents exemplary data showing levels of Rep78, 52 and Cap2 expression during rAAV production
  • Figure 22 presents exemplary schematic showing mechanism of action of leaky scanning.
  • Figure 23 presents exemplary data showing comparison of vg/ml for wt vs mut-Rep. Removal of the 9 potential ATG’s that could be used as a translation initiation site from Rep78 had no effect its ability to make rAAV
  • Figure 24 presents exemplary data showing western blot of Rep78 and Rep52 protein expression from rAAV production runs using various start codons. % numbers are published translation initiation rates compared to ATG.
  • Figure 25 presents exemplary data showing vg/ml of rAAV produced using alternate start codons to control the ratio of Rep78/52. Only the ACG mutation makes a significant improvement on viral titer.
  • Figure 26 presents exemplary data showing expression of the Cap2 gene induced via the adenovirus helper genes.
  • Figure 28 presents exemplary data showing effect of the adenovirus helper functions on the forskolin promoter controlling Cap2 expression in stable cell line.
  • Figure 29 presents exemplary data showing effect of forskolin on new promoter designs.
  • Figure 30 presents exemplary data showing effect of the adenovirus helper functions on the activity of FORN-pJB42.
  • Figure 31 presents exemplary data showing configuration of the Rep LoxP constructs.
  • FIG 32 presents exemplary data showing diagram of the Rep constructs. Effect of Cre and or NHK477 treatment on the induction of Rep expression. There is no expression of either Rep protein in the untreated samples for both promoters.
  • Figure 33 presents exemplary data showing AAV production using cre-recombinase control of Rep expression.
  • Figure 35 presents exemplary data showing concept of cascaded gene expression for rAAV production in Pro 10 cells.
  • Figure 36 presents exemplary data showing exemplification of ZF-TF design.
  • Figure 37 presents exemplary data showing comparison of standard Rep2-Cap8 transfection vs the new novel plasmid configuartion.
  • the invention described herein provides stable cell lines for recombinant viral vector production having expression of at least one toxic protein under control of at least one regulatable promoter, e.g., an inducible promoter, methods for producing such cells, a promoter linked to another sequence providing a regulatory control, such as a Zinc finger, and methods for manufacturing a recombinant viral vector using the same.
  • the described stable cell lines provide temporal and/spatial control of at least one (e.g., at least one, at least two, at least three) toxic proteins during viral vector production.
  • a toxic protein for example, expressed from a viral gene, such as replication (rep), capsid (cap), helper gene products, polymerase (pol), reverse polymerase, or envelope (env), is one that is detrimental to a cell when expressed.
  • viral genes are essential to the manufacture of recombinant viral vectors.
  • Current methods to mitigate the negative effects of expression of toxic proteins include using cells which transiently express the toxic protein during production, however, these methods can adversely affect the yield of production.
  • Our stable cells described herein provide a stable cell line that allows for expression of a toxic protein primarily at the time in which it is needed, thus limiting the negative effects of its expression. Our methods described herein, which utilize these stable cell lines, result in a higher yield of recombinant viral vector production as compared to current methods.
  • nucleotide sequence As used herein, the terms “nucleotide sequence”, “nucleic acid sequence”, “RNA sequence,” and “DNA sequence,” are used interchangeably herein and refer to a sequence of a nucleic acid, e.g., a circular nucleic acid that is to be introduced into a target cell and encodes a gene product or polypeptide.
  • the nucleic acid sequence may comprise at least a sequence that encodes a toxic polypeptide (i.e., protein).
  • a heterologous nucleic acid sequence refers to a nucleic acid sequence that is not “naturally occurring,” that is, a sequence not normally expressed in the cell.
  • promoter refers to a region of DNA that generally is located upstream of a nucleic acid sequence to be transcribed that is needed for transcription to occur. Promoters permit the proper activation or repression of transcription of sequence under their control.
  • a promoter typically contains specific sequences that are recognized and bound by transcription factors, e.g. enhancer sequences. Transcription factors bind to the promoter DNA sequences and result in the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of the gene. A great many promoters are known in the art.
  • Regulatable promoters include both inducible promoters and repressible promoters.
  • an “inducible promoter” refers to a promoter that is characterized by initiating or enhancing transcriptional activity when in the presence of, influenced by, or contacted by an inducer or inducing agent or when or suitable inducing conditions are applied (e.g. hypoxia).
  • An “inducer” or “inducing agent,” as defined herein, can be endogenous, or a normally exogenous compound or protein that is administered in such a way as to be active in inducing transcriptional activity from the inducible promoter.
  • the term “inducer” as used herein can also relate to applying suitable conditions such that transcriptional activity from the inducible promoter is induced (e.g. hypoxia).
  • the inducer or inducing agent i.e., a chemical, a compound, a protein, or suitable conditions
  • can itself be the result of transcription or expression of a nucleic acid sequence i.e., an inducer can be an inducer protein expressed by another component or module
  • an inducible promoter is induced in the absence of certain agents, such as a repressor.
  • inducible promoters include but are not limited to, forskolin-inducible, hypoxia-inducible, temperature- inducible, tetracycline-inducible (Tet-ON), pH-inducible, osmolarity-inducible, metallothionine- inducible, hormone- (e.g. ecdysone-) inducible, carbon source-inducible, alcohol (e.g.
  • mammalian viruses e.g., the adenovirus late promoter; and the mouse mammary tumor virus long terminal repeat (MMTV-LTR)
  • MMTV-LTR mouse mammary tumor virus long terminal repeat
  • An inducible promoter can be said to drive expression of the nucleic acid sequence that it regulates, e.g., a heterologous gene that encodes atoxic protein.
  • the phrases “operably linked,” “operatively linked,” and “under control,” indicate that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence it regulates to control transcriptional initiation and/or expression of that sequence.
  • a “repressible promoter” refers to a promoter that is characterized by stopping or preventing transcriptional activity such that the activity is down-regulated when in the presence of, influenced by, or contacted by a repressor or repressing agent.
  • An “repressor” or “repressing agent,” as defined herein, can be endogenous, or a normally exogenous compound or protein that is administered in such a way as to be active in stopping transcriptional activity from the repressible promoter.
  • the repressor or repressing agent i.e., a chemical, a compound or a protein
  • a repressor can itself be the result of transcription or expression of a nucleic acid sequence (i.e., a repressor can be a repressor protein expressed by another component or module), which itself can be under the control of, e.g., an inducible or repressible promoter.
  • a repressible promoter is repressed in the absence of certain agents, such as an inducer. Examples of repressible promoters include but are not limited to tetracycline-off (Tet-OFF), glucose, copper ion, F-Methionine, low-phosphate, ADH1, Gal80, and MET25.
  • a promoter can be both repressible and inducible, e.g. through the use of different repressing or inducing agents (e.g. an agonist and agonist of a relevant transcription regulator or pathway) or by varying conditions which repress or induce expression.
  • different repressing or inducing agents e.g. an agonist and agonist of a relevant transcription regulator or pathway
  • a promoter can be induced when an inducer is administered and repressed when a repressor is administered.
  • introducing refers broadly to placing the synthetic nucleic acid, expression vector, or plasmid into a viral expression system (e.g., a cell or viral vector) such that it is present in, e.g., a cell, or viral vector expression system.
  • introducing refers to any appropriate means of placing the synthetic nucleic acid, expression vector, or plasmid in a viral expression system described herein.
  • Introducing can be by such means that the synthetic nucleic acid, expression vector, or plasmid is appropriately transported into the interior of the cell or viral expression system such that, e.g., the synthetic nucleic acid, expression vector, or plasmid is produced by the host cell machinery.
  • Such introducing may involve, for example transformation, transfection, electroporation, or lipofection.
  • vector refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells.
  • a vector can be viral or non-viral.
  • vector encompasses any genetic element that is capable of replication when associated with the proper control elements and that can transfer gene sequences to cells.
  • a vector can include, but is not limited to, a cloning vector, an expression vector, a plasmid, phage, transposon, cosmid, artificial chromosome, virus, virion, etc.
  • expression vector refers to a nucleic acid that includes an open reading frame (ORF) and, when introduced to a cell, contains all of the nucleic acid components necessary to allow mRNA expression of said open reading frame. “Expression vectors” of the invention also include elements necessary for replication and propagation of the vector in a host cell. In particular, as used herein, “expression vector” refers to a vector that directs expression of a heterologous nucleic acid described herein. The sequences expressed will often, but not necessarily, be heterologous to the cell.
  • An expression vector may comprise additional elements, for example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in human cells for expression and in a prokaryotic host for cloning and amplification.
  • expression refers to the cellular processes involved in producing RNA and proteins and as appropriate, secreting proteins, including where applicable, but not limited to, for example, transcription, transcript processing, translation and protein folding, modification and processing.
  • viral vector refers to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle.
  • the viral vector can contain a nucleic acid encoding a polypeptide as described herein in place of non-essential viral genes.
  • the vector and/or particle may be utilized for the purpose of transferring synthetic nucleic acids described herein into cells either in vitro or in vivo. Numerous forms of viral vectors are known in the art.
  • capsid protein refers to a capsid protein, suitably an AAV capsid protein, e.g. one or more of the VP capsid proteins of AAV.
  • AAV viral particles typically comprise the capsid proteins VP1, VP2 and VP3.
  • the capsid proteins can be naturally occurring or modified, as is well known in the art.
  • AAV adeno-associated virus
  • AAV includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, and any other AAV now known or later discovered. See, e.g., FIELDS el al. VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
  • a “rAAV vector genome” or “rAAV genome” is an AAV genome (i.e., vDNA) that comprises one or more heterologous nucleic acid sequences. rAAV vectors generally require only the 145 base ITR in cis to generate virus. All other viral sequences are dispensable and may be supplied in trans (Muzyczka, Curr. Topics Microbiol. Immunol. 158:97 (1992)).
  • the rAAV vector genome will only retain the one or more ITR sequence so as to maximize the size of the transgene that can be efficiently packaged by the vector.
  • the structural and non-structural protein coding sequences may be provided in trans (e.g., from a vector, such as a plasmid, or by stably integrating the sequences into a packaging cell).
  • the rAAV vector genome comprises at least one ITR sequence (e.g., AAV ITR sequence), optionally two ITRs (e.g., two AAV ITRs), which typically will be at the 5' and 3' ends of the vector genome and flank the heterologous nucleic acid, but need not be contiguous thereto.
  • the ITRs can be the same or different from each other.
  • AAV1, AAV2 and AAV3 ITR sequences are provided by Xiao, X., (1996), "Characterization of Adeno-associated virus (AAV) DNA replication and integration," Ph.D. Dissertation, University of Pittsburgh, Pittsburgh, PA (incorporated herein it its entirety).
  • RNA and proteins refers to the cellular processes involved in producing RNA and proteins, including where applicable, but not limited to, for example, transcription, transcript processing, translation and protein folding, post-translational modification and other types of processing.
  • the term “gene” means the nucleic acid sequence which is transcribed (DNA) to RNA in vitro or in vivo when operably linked to appropriate regulatory sequences.
  • the gene may or may not include regions preceding and following the coding region, e.g., 5’ untranslated (5’UTR) or “leader” sequences and 3’ UTR or “trailer” sequences, as well as intervening sequences (introns) between individual coding segments (exons).
  • polypeptide encompasses both peptides and proteins, unless indicated otherwise.
  • a “polypeptide” or “protein” is a sequence of nucleotide bases, and may be RNA, DNA or DNA-RNA hybrid sequences (including both naturally occurring and non- naturally occurring nucleotide), and can be either single or double stranded DNA sequences.
  • cell culture refers to a proliferating mass of cells that may be in either an undifferentiated or differentiated state.
  • a “viral vector expression system” is a system of one or more polynucleotides that are sufficient, when introduced into a suitable host cell, to support production of viral vector.
  • a viral vector expression system will typically include polynucleotides encoding the appropriate viral proteins, for example, an envelope and polymerase gene, e.g., for producing a lentivirus or adeno virus.
  • An “AAV expression system” is a system of one or more polynucleotides that are sufficient, when introduced into a suitable host cell, to support production of recombinant AAV (rAAV).
  • An AAV expression system will typically include polynucleotides encoding AAV rep and cap, helper genes, and a rAAV genome.
  • AAV genomes have palindromic sequences at both their 5' and 3' ends.
  • the palindromic nature of the sequences leads to the formation of a hairpin structure that is stabilized by the formation of hydrogen bonds between the complementary base pairs.
  • This hairpin structure is believed to adopt a "Y” or a "T” shape. See, e.g., FIELDS el al. VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).
  • terminal repeat or “TR” includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (i.e., mediates the desired functions such as replication, virus packaging, integration and/or provirus rescue, and the like).
  • the ITR can be an AAV ITR or a non-AAV ITR.
  • a non-AAV ITR sequence such as those of other parvoviruses (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19) or the SV40 hairpin that serves as the origin of SV40 replication can be used as an ITR, which can further be modified by truncation, substitution, deletion, insertion and/or addition.
  • the ITR can be partially or completely synthetic, such as the “double-D sequence” as described in United States Patent No. 5,478,745 to Samulski et al.
  • An “AAV inverted terminal repeat” or “AAV ITR” may be from any AAV, including but not limited to serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, or any other AAV now known or later discovered (see, e.g., Table 1).
  • An AAV ITR need not have the native terminal repeat sequence (e.g., a native AAV ITR sequence may be altered by insertion, deletion, truncation and/or missense mutations), as long as the terminal repeat mediates the desired functions, e.g., replication, virus packaging, integration, and/or provirus rescue, and the like.
  • a can mean a single cell or it can mean a multiplicity of cells.
  • the term “about,” as used herein when referring to a measurable value such as an amount of a composition of this invention, dose, time, temperature, and the like, is meant to encompass variations of ⁇ 20%, ⁇ 10%, ⁇ 5%, ⁇ 1%, ⁇ 0.5%, or even ⁇ 0.1% of the specified amount.
  • the term “consisting essentially of’ refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment.
  • the term “consisting of’ refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
  • nucleic acid construct comprising at least a nucleic acid sequence encoding at least one helper protein, wherein each nucleic acid construct is operatively linked to a regulatable promoter.
  • helper genes for example for AAV viral particle particles, include, but are not limited to El, E2A, E4, and VA. Further helper genes may include one or more of the following elements known in the Pro 10 cell line. Helper genes used for the production of other viral particles, for example, lentiviral particles or adeno viral particles can further be used in the nucleic acid constructs described herein.
  • the nucleic acid construct encoding at least one helper protein comprises a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operatively linked to a constitutive promoter. In one embodiment, the nucleic acid construct encoding at least one helper protein further comprises a nucleic sequence encoding a marker protein. In one embodiment, the nucleic acid construct encoding at least one helper protein, comprises a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operatively linked to a constitutive promoter and a nucleic sequence encoding a marker protein.
  • the regulatable promoter is a repressible promoter, for example a tetracycline repressible promoter.
  • the repressible promoter is repressed by a tetracycline-responsive transactivator and repression is reversed by contact with tetracycline or doxy cy cline.
  • expression of the at least one helper gene is responsive to the inducer of a regulatable promotor. In one embodiment, expression of the at least one helper gene is responsive to an inducer of a repressible promotor. In one embodiment, expression of the at least one helper gene is responsive to tetracycline or doxycycline.
  • Another aspect provided herein is a nucleic acid construct encoding a tetracycline- responsive transactivator protein operatively linked to a constitutive promoter.
  • Another aspect provided herein is a nucleic sequence encoding a marker protein.
  • nucleic acid construct comprising at least a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding a toxic protein is operatively linked to a regulatable promoter.
  • the nucleic acid encoding a toxic protein further encodes a ribozyme enzyme at the 3 ’ of the nucleic acid encoding the toxic protein, e.g., a small self-cleaving ribozyme enzyme.
  • the regulatable promoter is an inducible promoter or comprises a binding site for a regulatable transcriptional activator.
  • the inducible promoter comprises a TATA box sequence, or a p5 replication sequence, or both a TATA box sequence and p5 replication sequence.
  • the inducible promoter comprises a TATA box sequence, or a p5 replication sequence, or both a TATA box sequence and p5 replication sequence instead of a minimal promoter.
  • the regulatable promoter comprises a binding site for a Zinc- Finger transcriptional activator (ZF-TA).
  • nucleic acid construct comprising a nucleic acid sequence encoding at least one helper protein, wherein the at least one helper gene is operatively linked to a first regulatable promoter; and a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is under the control of a second regulatable promoter or a transcriptional activator.
  • nucleic acid construct comprising a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding a helper gene, e.g., a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA RNA, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a regulatable promoter.
  • any helper protein for example for producing a lentiviral particle, an adeno viral particle, can be used.
  • nucleic acid construct encoding a Rep protein, wherein the nucleic acid encoding a Rep protein is under the control of a regulatable promoter or a zinc-finger transcriptional activator (ZF-TA).
  • ZF-TA zinc-finger transcriptional activator
  • nucleic acid construct comprising a nucleic acid sequence comprising at least one of: a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding a Rep protein is under the control of a second regulatable promoter or transcriptional activator, wherein the first and the second regulatable promoters are different kinds of regulatable promoter, e.g., the first promoter can be a hypoxia promoter, and the second promoter another type.
  • the first promoter can be a hypoxia promoter, and the second promoter another type.
  • the regulatable promoter is an inducible promoter, or an inducible promoter that comprises a TATA box sequence, or a p5 replication sequence, or both a TATA box sequence and p5 replication sequence. In one embodiment the regulatable promoter is an inducible promoter that lacks a minimal promoter but comprises a TATA box sequence, and/or a p5 replication sequence.
  • Exemplary transcriptional activators include homeodomain transcriptional activator, zinc-finger transcriptional activator, winged-helix (Forkhead) transcriptional activator, leucine-zipper transcriptional activator, and helix-loop-helix transcriptional activator.
  • the transcriptional activator is a zinc-finger transcriptional activator (ZF-TA).
  • nucleic acid construct comprising a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a E4-responsive promoter, or a E2 -responsive promoter or other helper-gene responsive promoter.
  • ZF-TA zinc-finger transcriptional activator
  • nucleic acid construct comprising a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operatively linked to a constitutive promoter.
  • ZF zinc finger
  • nucleic acid construct comprising a toxic protein operatively linked to a promoter comprising a target site for binding of a zinc finger transcriptional activator (ZF-TA).
  • ZF-TA zinc finger transcriptional activator
  • Another aspect provided herein is a nucleic acid construct comprising a Rep protein operatively linked to a promoter comprising a target site for binding of a zinc-finger transcriptional activator (ZF-TA).
  • ZF-TA zinc-finger transcriptional activator
  • any of the nucleic acid constructs described herein further comprises at least one of a nucleic acid sequence encoding at least one helper protein, wherein each nucleic acid construct is operatively linked to a regulatable promoter; a nucleic acid encoding the toxic protein is under the control of a second regulatable promoter or a zinc -finger transcriptional activator; a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a regulatable promoter; or a nucleic acid encoding the Rep protein is under the control of a second regulatable promoter or a zinc- finger transcriptional activator.
  • nucleic acid construct comprising a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operatively linked to a constitutive promoter; a nucleic acid sequence comprising at least one of: a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA, or any combination thereof, is operatively linked to a regulatable promoter; and a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a E4-responsive promoter, or a E2 -responsive promoter; and a nucleic acid construct comprising a Rep protein operatively linked to a promoter comprising a target site
  • nucleic acid construct comprising a nucleic acid sequence encoding a toxic protein and a recombinase recognition sequence (RRS) located 3 ’ of the nucleic acid sequence encoding the toxic protein.
  • a toxic protein or polypeptide that when expressed by the cell, results in decreased viability of the cell that it is expressed in, or decreased protein production or protein synthesis.
  • exemplary toxic proteins include, but are not limited to Cap, Rep, or proteins encoded by helper genes.
  • the toxic protein is operatively linked to a constitutive promoter.
  • the toxic protein is operatively linked to a regulatable promoter, e.g., an inducible promoter.
  • the nucleic acid construct comprises a nucleic acid encoding a recombinase protein operatively linked to an inducible promoter.
  • nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 3 ’ of the nucleic acid sequence encoding the Cap protein.
  • the Cap protein is operatively linked to a constitutive promoter.
  • the Cap protein is operatively linked to a regulatable promoter, e.g., an inducible promoter.
  • the nucleic acid construct comprises a nucleic acid encoding a recombinase protein operatively linked to an inducible promoter.
  • the RRS is a Flippase -responsive RRSs.
  • nucleic acid construct comprising a nucleic acid construct comprising a nucleic acid encoding a recombinase protein operatively linked to an inducible promoter.
  • nucleic acid construct comprising a first nucleic acid construct comprising in a 5’ to 3’ direction: a promoter, a stop nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and nucleic acid sequence encoding a Rep protein, wherein the promoter is operatively linked to the nucleic acid encoding the Rep protein, and a second nucleic acid construct comprising, in a 5’ to 3’ direction: a promoter, a stop nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRSs), and nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operatively linked to the nucleic acid encoding the one or more of E2A, E4, and VA RNA.
  • the RRS flanking the nucleic acid encoding Rep and the RRS flanking a helper gene are the same such that they are controlled by the same inducer.
  • the RRS flanking the nucleic acid encoding Rep and the RRS flanking a helper gene are different. Different flanking RRSs allows for temporal control of the Rep protein and the helper gene.
  • the nucleic acid construct further comprises a nucleic acid encoding one or more selection markers flanked between a third pair of recombinase recognition sequences (RRSs), wherein the pair of RRS are in the same orientation with respect to each other, and wherein the nucleic acid encoding the one or more selection markers is operatively linked to one or more promoters from another construct provided herein.
  • RRSs recombinase recognition sequences
  • nucleic acid sequence e.g., a target gene
  • RRS recombinase recognition sequences
  • the nucleic acid sequence can be excised upon the recognition of the RRS by the proper recombinase.
  • nucleic acid sequence can be inverted upon the recognition of the RRS by the proper recombinase.
  • the inversion and/or excision reactions will place the nucleic acid sequence (e.g., a target gene) in a new location and/or orientation, and depending on the elements outside of the RRS site, to make the nucleic acid operatively linked to a promoter, thereby driving expression of a gene encoding by the nucleic acid sequence.
  • the nucleic acid sequence e.g., a target gene
  • the excision reaction by a recombinase can lead to activation or inhibition of gene expression.
  • a transcription termination sequence flanked on both sides by recombination sites, upstream of a target gene of interest.
  • the transcription termination sequence is removed or excised, thus allowing gene expression to occur.
  • the recombination sites can be engineered to flank the gene of interest. In such embodiment, the gene is expressed without the recombinase.
  • the determinant factor that governs the on/off state of the gene resides in the presence of the recombinase and the location of the RRS.
  • the expression of the recombinase can be regulated by a signal inducible promoter, thus restricting the expression of the recombinase in a certain subset of cells that are undergoing that particular signal. For instance, by controlling the expression of Cre recombinase with neuron specific promoters, one can turn genes on or off in neurons only while leaving the same gene unperturbed in other tissues.
  • These enzymes have been engineered to be very active in a wide range of organisms, including bacteria, mammals, insects, plants and fish.
  • the first pair of RRS, second pair of RRS, and third pair of RRS are each responsive to different tyrosine recombinase or serine integrase enzymes.
  • the first pair of RRS and second pair of RRS are responsive to the same tyrosine recombinase or serine integrase enzyme.
  • the first pair of RRS, or second pair of RRS, or both are Cre-responsive RRS.
  • the third pair of RRSs are Flipase- responsive RRS.
  • any nucleic construct described herein further comprises a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operatively linked to a constitutive promoter.
  • any nucleic construct described herein further comprises a nucleic sequence encoding a marker protein.
  • marker proteins include fluorescent proteins, such as green fluorescent protein (GFP), red fluorescent protein (RFP), or luciferase; molecular tags, such as a Myc tag, a Flag tag, or a His tag; and molecular barcodes.
  • any nucleic construct described herein further comprises a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operatively linked to a constitutive promoter and a nucleic sequence encoding a marker protein.
  • the nucleic sequence encoding a marker protein is removed from the construct.
  • the nucleic sequence encoding a marker protein is flanked by recombinase recognitions sequences (RRSs) in the same orientation with respect to each other, e.g., to facilitate its removal from the construct.
  • RRSs recombinase recognitions sequences
  • the transactivator is a CRISPR transactivator or a CAS transactivator.
  • CRISPR transactivator or a “CAS transactivator” refer to transcriptional activators protein domains or whole proteins linked, e.g., to dCas9 or sgRNAs that assist in the recruitment of co-factors or RNA Polymerase for transcription of the gene(s) targeted by the system.
  • Transcriptional activators have, e.g., at least a DNA binding domain and a domain for activation of transcription.
  • the activation domain can recruit general transcription factors or RNA polymerase to the gene sequence, or function by facilitating transcription by stalled RNA polymerases, and in eukaryotes can act to move nucleosomes on the DNA or modify histones to increase gene expression.
  • These activators can be introduced into the system through attachment to dCas9 or to the sgRNA.
  • CRISPR transactivator or a CAS transactivator are known in the art and can be readily identified by one skilled in the art.
  • RRSs Recombinase Recognitions Sequences
  • a "recombinase,” as used herein, is a site-specific enzyme that recognizes short DNA sequence(s), referred to as recombinase recognition sequences or RRS herein, which are typically between about 30 base pairs (bp) and 40 bp, and that mediates the recombination between these recombinase recognition sequences, which results in the excision, integration, inversion, or exchange of DNA fragments between the recombinase recognition sequences.
  • Exemplary recombinases include, but are not limited to, Cre, Flp, Dre, SCre, VCre, Vika, B2, B3, KD, ⁇ DC31, Bxbl, l, HK022, HP1, gd, ParA, Tn3, Gin, R4, TP901-1, TGI, PhiRvl, PhiBTl, SprA, XisF, TnpX, R, A118, spoIVCA, PhiMRl 1, SCCmec, TndX, XerC, XerD, XisA, Hin, Cin, mrpA, beta, PhiFCl, Fre, Clp, sTre, FimE, and HbiF.
  • Exemplary recombinase recognitions sequences include, but are not limited to, loxP, loxN, lox 511, lox 5171, lox 2272, M2, M3, M7, Ml 1, lox71, lox66, FRT, rox, SloxMl, VloxP, vox, B3RT, KDRT, F3, F14, attB/P, F5, F13, Vlox2272, Slox2272, SloxP, RSRT, and B2RT.
  • Recombinases can be classified into two distinct families: serine recombinases (e.g., resolvases and invertases) and tyrosine recombinases (e.g., integrases), based on distinct biochemical properties. Serine recombinases and tyrosine recombinases are further divided into bidirectional recombinases and unidirectional recombinases.
  • bidirectional serine recombinases include, without limitation, b-six, CinH, ParA and gd; and examples of unidirectional serine recombinases include, without limitation, Bxbl, c
  • bidirectional tyrosine recombinases include, without limitation, Cre, FLP, and R; and unidirectional tyrosine recombinases include, without limitation, Lambda, HKIOI, HK022 and pSAM2.
  • the serine and tyrosine recombinase names stem from the conserved nucleophilic amino acid residue that the recombinase uses to attack the DNA and which becomes covalently linked to the DNA during strand exchange. Recombinases have been used for numerous standard biological applications, including the creation of gene knockouts and the solving of sorting problems.
  • the recombinases for use in the present invention are orthogonal recombinases.
  • a first recombinase is orthogonal to the second recombinase, it means that the second recombinase does not recognize the RRS specific for the first recombinase, neither does the first recombinase recognize the RRS specific for the second recombinase.
  • the outcome of recombination depends, in part, on the location and orientation of two short repeated DNA sequences (e.g., RRS) that are to be recombined, typically less than 30 bp long.
  • the site-specific recombinases bind to these repeated sequences, which are specific to each recombinase, and are herein referred to as "recombinase recognition sequences" or "recombinase recognition sites.”
  • a recombinase is "specific for" a recombinase recognition site when the recombinase can mediate inversion or excision between the repeat DNA sequences.
  • a recombinase may also be said to recognize its "cognate recombinase recognition sites," which flank an intervening genetic element (e.g., promoter, terminator, or target gene).
  • a genetic element is said to be "flanked” by recombinase recognition sites when the element is located between and immediately adjacent to two repeated DNA sequences.
  • the recombinase recognition sites do not overlap each other. However, in other embodiments, recombinase recognition sites do overlap each other, such as described herein below, which permits greatly increased combinatorial complexity.
  • Inversion recombination happens between two short, inverted, repeated DNA sequences.
  • a DNA loop formation assisted by DNA bending proteins, brings the two repeat sequences together, at which point DNA cleavage and ligation occur.
  • This reaction is ATP independent and requires supercoiled DNA.
  • the end result of such an inversion recombination event is that the DNA located between the repeated site inverts (i.e., the DNA between the two RRS reverses orientation) such that what was the coding strand is now the non-coding strand and vice versa. In such reactions, the DNA is conserved with no net gain or no loss of DNA.
  • excision (integration) recombination occurs between two short, repeated DNA sequences that are oriented in the same direction.
  • the intervening DNA is excised/removed.
  • an AND gate can be assembled by placing a terminator between each of two different sets of recombinase sites oriented for excision, flanked by a promoter and an output such as a GFP-encoding sequence.
  • both terminators must be excised by input- dependent action of the recombinase (s) to permit readthrough from the promoter to the GFP-encoding sequence.
  • two inputs are needed to excise both terminators to generate output.
  • Recombinases can also be classified as irreversible or reversible.
  • an "irreversible recombinase” refers to a recombinase that can catalyze recombination between two complementary recombination sites, but cannot catalyze recombination between the hybrid sites that are formed by this recombination without the assistance of an additional factor.
  • an "irreversible recognition site” refers to a recombinase recognition site that can serve as the first of two DNA recognition sequences for an irreversible recombinase and that is modified to a hybrid recognition site following recombination at that site.
  • a "complementary irreversible recognition site” refers to a recombinase recognition site that can serve as the second of two DNA recognition sequences for an irreversible recombinase and that is modified to a hybrid recombination site following homologous recombination at that site.
  • attB and attP are the irreversible recombination sites for Bxbl and phiC31 recombinases — attB is the complementary irreversible recombination site of attP, and vice versa.
  • the attB/attP sites can be mutated to create orthogonal B/P pairs that only interact with each other but not the other mutants [72] This allows a single recombinase to control the excision or integration or inversion of multiple orthogonal B/P pairs.
  • the phiC31 (f €31) integrase catalyzes only the attB x attP reaction in the absence of an additional factor not found in eukaryotic cells.
  • the recombinase cannot mediate recombination between the attL and attR hybrid recombination sites that are formed upon recombination between attB and attP. Because recombinases such as the phiC31 integrase cannot alone catalyze the reverse reaction, the phiC31 attB x attP recombination is stable.
  • Irreversible recombinases and nucleic acids that encode the irreversible recombinases, are described in the art and can be obtained using routine methods.
  • irreversible recombinases include, without limitation, phiC31 (f €31 ) recombinase, coliphage P4 recombinase, coliphage lambda integrase, Listeria A118 phage recombinase, and actinophage R4 Sre recombinase, HK101, HK022, pSAM2, Bxbl, TP901, TGI, cpBTI, cpRVl, cpFCl, MRU, U153 and gp29.
  • a "reversible recombinase” refers to a recombinase that can catalyze recombination between two complementary recombinase recognition sites and, without the assistance of an additional factor, can catalyze recombination between the sites that are formed by the initial recombination event, thereby reversing it.
  • the product-sites generated by recombination are themselves substrates for subsequent recombination.
  • Examples of reversible recombinase systems include, without limitation, the Cre-lox and the Flp-frt systems, R, b-six, CinH, ParA and gd.
  • recombinases provided herein are not meant to be exclusive examples of recombinases that can be used in embodiments of the invention.
  • Other examples of recombinases that are useful in the invention described herein are known to those of skill in the art, and any new recombinase that is discovered or generated is expected to be able to be used in the different embodiments of the invention.
  • the recombinase is serine recombinase.
  • the recombinase is considered to be irreversible.
  • an initial recombination event can be reversed when a recombinase directionality factor (RDF) is present.
  • RDFs are a diverse group of proteins involved in controlling the directionality of integrase-mediated site-specific recombination reactions. Typically, RDFs are small DNA-binding proteins acting as accessory factors to influence the choice of substrates that are recombined by their cognate recombinase. See Lewis and Hatfull, Nucleic Acids Res.
  • RDF examples include, but are not limited to, gp47 for bxbl, gp3 for phiC31, gp3 for PhiBTl, ORF7 for TP901-1, gp25 for TGI, and gp3 for PhiRvl.
  • the recombinase is a tyrosine recombinase.
  • the recombinase is considered to be reversible.
  • all the recombinases for an AAV expression system described herein can be of the same type (e.g., serine or tyrosine).
  • tyrosine recombinases and serine recombinases can be used together in the same nucleic acid construct described herein.
  • the recombinase comprises the sequence of Bxbl recombinase, and the corresponding recombinase recognition sequences are Bxbl attB and Bxbl attP.
  • the recombinase comprises the sequence of phiC31 ( f C 31 ) recombinase and the corresponding recombinase recognition sequences comprise phiC31attB and phiC31 attP.
  • a recombinase can recognize multiple pairs of RRS.
  • the recombinase comprises the sequence of Cre and the corresponding recombinase recognition sequences comprise loxP.
  • the recombinase comprises the sequence of Cre and the corresponding recombinase recognition sequences comprise lox2272.
  • the recombinase comprises the sequence of Cre and the corresponding recombinase recognition sequences comprise loxN.
  • the recombinase comprises the sequence of Dre and the corresponding recombinase recognition sequences comprise rox.
  • the recombinase comprises the sequence of VCre and the corresponding recombinase recognition sequences comprise VloxP.
  • the recombinase comprises the sequence of VCre and the corresponding recombinase recognition sequences comprise VloxP.
  • the recombinase comprises the sequence of Flp and the corresponding recombinase recognition sequences comprise FRT.
  • the recombinase comprises the sequence of SCre and the corresponding recombinase recognition sequences comprise SloxMl.
  • the recombinase comprises the sequence of Vika and the corresponding recombinase recognition sequences comprise vox.
  • the recombinase comprises the sequence of B3 and the corresponding recombinase recognition sequences comprise B3RT.
  • the recombinase comprises the sequence of KD and the corresponding recombinase recognition sequences comprise KDRT.
  • hPGK (SEQ ID NO: 10): ggggttggggttgcgccttttccaaggcagccctgggtttgcgcagggacgcggctgctctgggcgtggttccgggaaacgcagcggcgaccctgggtctcgcacattcttcacgtccgttcgcagcgtcacccggatcttcgccgctacccttgtgggcccccggcgac gcttcctaagtcgggaaggttccttgcggttcgcggacgtgacaaacggaagcccgtctcactagt accctcgcagacggacagcgcca
  • SFFV SEQ ID NO: 12: ccgataaaataaaagattttatttagtctccagaaaaggggggaatgaaagaccccacctgtaggtttggcaagctagctgcagtaac gccattttgcaaggcatggaaaaataccaaaccaagaatagagaagttcagatcaagggcgggtacatgaaaatagctaacgttgggc caaacaggatatctgcggtgagcagtttcggcccggccggggccaagaacagatggtcaccgcagtttcggccccggcccgagccaagaacagatggtcaccgcagtttcggccccggcccgag gccaagaacagatggtcaccgcagtttcggccccgagccaagaacagatggt
  • CAG (SEQ ID NO: 13):
  • NLS-iCre (SEQ ID NO: 14): atggtgcccaagaagaagaggaaagtctccaacctgctgactgtgcaccaaaacctgcctgcctccctgtggatgccacctctgatg aagtcaggaagaacctgatggacatgttcagggacaggcaggccttctgaacacacctggaagatgctcctgtgtgtgcagatccc tggggtgcaagctgaacaacaggaaatggttccctgctgaacctgaggatgtgagggactacctcctgtacctgcaagcca gaggcctggctgtgaagaccatccaacagcacctgggccagctcaacatgctggcccccctgtggatg aaggatgctggct
  • NLS-FlpO (SEQ ID NO: 15): atggctcctaagaagaagaggaaggtgatgagccagttcgacatcctgtgcaagaccccccccaaggtgctggtgcggcagttcgtg gagagattcgagaggcccagcggcgagaagatcgccagctgtgccgccgagctgacctacctgtgctggatgatcacccacaacgg caccgccatcaagagggccaccttcatgagctacaacaccatcatcagcaacagcctgagcttcgacatcgtgaacaagagcctgcaagacccagaaggccaccatcctgaggccagcctgaggaggcgtgaggcgtgaggcgtgaggcgtgaggcgtgaggcg
  • NLS-DreO SEQ ID NO: 16
  • NLS-SCre SEQ ID NO: 17:
  • NLS-VCre SEQ ID NO: 18:
  • NLS-VikaO SEQ ID NO: 19:
  • NLS-B3 (SEQ ID NO: 20):
  • NLS-KD (SEQ ID NO: 21):
  • NLS-B2 (SEQ ID NO: 22):
  • NLS-R SEQ ID NO: 23
  • NLS-PhiC31 (SEQ ID NO: 24): atgcctaagaaaaagcggaaagtggatacctacgccggagcctacgacagacagagccgggagagagagaacagcagcgcgc cagccccgccacccagagaagcgccaacgaggataaggccgccgatctgcagagagaggtggagagggacggcggcagattca gatttgtgggccacttcagcgaggcccctggcaccagcgccttcggcaccgccgagagacccgagttcgagagaatcctgaacgagtgtagggccggcaggctgaacatgatcatcgtgtacgacgtgtcccggttcagcaggctgaaggtggtggggctg
  • loxP SEQ ID NO: 26
  • ATAACTTCGTATAgcatacatTATACGAAGTTAT lox2272 (SEQ ID NO: 27):
  • Vlox2272 (SEQ ID NO: 34): TCAATTTCTGAGAagtgtcttTCTCGGAAATTGA
  • SloxMl (SEQ ID NO: 36): CTCGTGTCCGATAactgtaatTATCGGACACGAG
  • Slox2272 (SEQ ID NO: 37): CTCGTGTCCGATAagtgtattTATCGGACATGAT
  • stable cell lines for recombinant viral vector production comprising at least one inducible promoter operatively linked to a heterologous gene that encodes a toxic protein.
  • One aspect of this application provides a stable cell line for recombinant viral vector production, for example, AAV vector production, comprising at least one inducible promoter, wherein the inducible promoter is operatively linked to a heterologous rep or pol gene that encodes a rep protein or polymerase protein, respectively.
  • the inducible promoter is further operatively linked to a heterologous cap or env gene that encodes a cap protein or env protein, respectively.
  • the stable cell line further comprises a second inducible promoter operatively linked to a heterologous cap or env gene that encodes a cap protein or env protein, respectively, wherein the second inducible promoter is induced by a different inducer from the first inducible promoter.
  • a stable cell line for recombinant AAV vector production comprising at least one inducible promoter, wherein the inducible promoter is operatively linked to a heterologous cap gene that encodes a cap protein.
  • Another aspect of this application provides a stable cell line for recombinant AAV vector production comprising at least one regulatable promoter, e.g., an inducible promoter, wherein the inducible promoter is operatively linked to a heterologous helper gene that encodes a helper gene product.
  • Helper genes are commonly used in the production of AAV vectors.
  • Exemplary helper genes conventionally used include in AAV production include El (E1A and E1B), E2A, E4 and VA RNA.
  • a stable cell line for recombinant viral vector production comprising at least one inducible promoter operatively linked to a heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to a heterologous gene that encodes a toxic protein
  • the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia
  • Another aspect of this application provides a stable cell line for recombinant viral vector production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein.
  • Another aspect of this application provides a stable cell line for recombinant viral vector production, comprising at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein.
  • Another aspect of this application provides a stable cell line for recombinant viral vector production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to at least one heterologous gene that
  • Another aspect of this application provides a stable cell line for recombinant viral vector production, comprising at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to at least one heterologous gene that encodes
  • Another aspect of this application provides a stable cell line for recombinant viral vector production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes atoxic protein.
  • Another aspect of this application provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes a toxic protein.
  • Another aspect of this application provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter having a sequence of any one of SEQ ID NO: 6 to SEQ ID NO: 9 operatively linked to at least one heterologous gene that encodes a toxic protein.
  • Another aspect of this application provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • Another aspect of this application provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter having a sequence of any one of SEQ ID NO: 6 to SEQ ID NO: 9 operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • Another aspect of this application provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter having a sequence of any one of SEQ ID NO: 6 to SEQ ID NO: 9 operatively linked to at least one heterologous gene that encodes atoxic protein.
  • a stable cell line for rAAV production comprising at least one inducible promoter operatively linked to a heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to a heterologous gene that encodes a toxic protein
  • the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible
  • Another aspect of this application provides a stable cell line for rAAV production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein.
  • Another aspect of this application provides a stable cell line for rAAV production, comprising at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein.
  • Another aspect of this application provides a stable cell line for rAAV production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to at least one heterologous gene that encodes
  • Another aspect of this application provides a stable cell line for rAAV production, comprising at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic
  • Another aspect of this application provides a stable cell line for rAAV production, comprising at least one forskolin inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one hypoxia inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein.
  • Another aspect of this application provides a stable cell line for rAAV production, comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes atoxic protein.
  • Another aspect of this application provides a stable cell line for rAAV production, comprising at least one inducible promoter having a sequence of any one of SEQ ID NO: 6 to SEQ ID NO: 9 operatively linked to at least one heterologous gene that encodes a toxic protein.
  • Another aspect of this application provides a stable cell line for rAAV production, comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a forskolin inducible promoter a
  • Another aspect of this application provides a stable cell line for rAAV production, comprising at least one inducible promoter having a sequence of any one of SEQ ID NO: 6 to SEQ ID NO: 9 operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter operatively linked to at least one heterologous gene that encodes a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of: a forskolin inducible promoter, a hypoxia inducible promoter, a tetracycline inducible promoter, an alcohol inducible promoter, a steroid inducible promoter, an RU486 inducible promoter, an ecdysone inducible promoter, a rapamycin inducible promoter, a metallothionein inducible promoter, a hormone inducible promoter and a metal inducible promoter.
  • a stable cell line for rAAV production comprising at least one inducible promoter having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operatively linked to at least one heterologous gene that encodes a toxic protein, and at least one inducible promoter having a sequence of any one of SEQ ID NO: 6 to SEQ ID NO: 9 operatively linked to at least one heterologous gene that encodes a toxic protein.
  • the stable cell further comprises at least one repressible element operatively linked to at least one heterologous gene that encodes atoxic protein.
  • the stable cell line has at least two inducible promoters, and the at least two inducible promoters are the same, e.g., the stable cell comprises two forskolin promoters. In one embodiment, the stable cell line has at least two inducible promoters, and the at least two inducible promoters are different, e.g., the stable cell comprises a forskolin and a hypoxia promoter.
  • a stable cell line described herein can comprise at least 1, 2, 3, 4, 5, or more inducible promoters operatively linked to distinct toxic genes. Alternatively, an inducible promoter can be operatively linked to at least 2, 3, 4, 5, or more genes.
  • an inducible promoter can be operatively linked to at least 2 different toxic genes, for example, rep and cap, such that inducing expression (e.g. by contacting the cell with an inducer for the inducible promoter) will result in expression of the at least 2 different toxic genes.
  • An inducible promoter can be operatively linked to at least 2 different helper genes, such that inducing expression (e.g. by contacting the cell with an inducer for the inducible promoter) will result in expression of the at least 2 different helper genes.
  • An inducible promoter can be operatively linked to at least one toxic protein and at least one different helper gene, such that inducing expression (e.g. by contacting the cell with an inducer for the inducible promoter) will result in expression of the at least one toxic protein and at least one different helper gene.
  • the cell comprises at least two separate inducible promoters, wherein the at least two inducible promoters are induced by different inducers (e.g. by hypoxia and forskolin), and the at least two inducible promoters are operatively linked to distinct heterologous genes that encode different toxic proteins.
  • the cell comprises a first inducible promoter operatively linked to a first toxic gene, and a second inducible promoter operatively linked to a second toxic gene.
  • the cell comprises at least two inducible promoters, wherein the at least two inducible promoters are induced by different inducers, and the at least two inducible promoters are induced by the same inducer.
  • the cell comprises a first inducible promoter operatively linked to a first toxic gene, and a second inducible promoter operatively linked to a second toxic gene.
  • the cell comprises at least two inducible promoters, wherein the at least two inducible promoters are induced by different inducers, and the at least two inducible promoters are each operatively linked to at least one distinct heterologous genes that encode at least one toxic protein.
  • the cell comprises a first inducible promoter operatively linked to a first and second toxic gene, and a second inducible promoter operatively linked to a third toxic gene.
  • the stable cell line comprises the at least one inducible promoter operatively linked to a heterologous gene that encodes a toxic protein incorporated in the genome.
  • the stable cell line comprises the at least one inducible promoter operatively linked to a heterologous gene that encodes a toxic protein in a stable episomal form (e.g. as a stable plasmid).
  • a cell line for recombinant viral vector production comprising at least one inducible promoter need not be a stable cell line.
  • a vector comprising the at least one inducible promoter may be transiently introduced (e.g. transiently transfected) into the cell.
  • One aspect of this application provides a cell line for recombinant viral vector production comprising transient introduction of at least one inducible promoter, wherein the inducible promoter is operatively linked to a heterologous gene that encodes a toxic protein.
  • Another aspect of this application provides a cell line for rAAV vector production comprising transient introduction of at least one inducible promoter, wherein the inducible promoter is operatively linked to a heterologous gene that encodes a toxic protein required for rAAV production (e.g., rep or cap).
  • Transient expression can be achieved by, e.g., introducing to a cell a synthetic nucleic acid, expression vector, or plasmid for expressing at least one inducible promoter, wherein the inducible promoter is operatively linked to a heterologous gene that encodes a toxic protein.
  • Such introducing may involve, for example, transformation, transfection, electroporation, or lipofection.
  • One skilled in the art can determine if a cell has transient introduction of a synthetic nucleic acid, expression vector, or plasmid by, e.g., using PCR-based assays or western-blotting to assess mRNA or protein levels of the synthetic nucleic acid, expression vector, or plasmid, respectively.
  • Another aspect provided herein is a cell expressing a nucleic acid construct encoding a tetracycline -responsive transactivator protein operatively linked to a constitutive promoter.
  • Another aspect provided herein is a cell expressing a nucleic sequence encoding a marker protein.
  • Another aspect provided herein is a cell expressing a nucleic acid construct comprising at least a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding a toxic protein is operatively linked to a regulatable promoter.
  • Another aspect provided herein is a cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding at least one helper protein, wherein the at least one helper gene is operatively linked to a first regulatable promoter; and a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is under the control of a second regulatable promoter or a zinc-finger transcriptional activator (ZF-TA).
  • ZF-TA zinc-finger transcriptional activator
  • Another aspect provided herein is a cell expressing a nucleic acid construct comprising a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a regulatable promoter.
  • Another aspect provided herein is a cell expressing a nucleic acid construct encoding a Rep protein, wherein the nucleic acid encoding a Rep protein is under the control of a regulatable promoter or a zinc-finger transcriptional activator (ZF-TA).
  • ZF-TA zinc-finger transcriptional activator
  • nucleic acid construct comprising a nucleic acid sequence comprising at least one of: a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding a Rep protein is under the control of a second regulatable promoter or transcriptional activator, wherein the first and the second regulatable promoters are different.
  • the transcriptional activator is a zinc-finger transcriptional activator (ZF-TA).
  • Another aspect provided herein is a cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a E4-responsive promoter, or a E2- responsive promoter or other helper-gene responsive promoter.
  • ZF-TA zinc- finger transcriptional activator
  • Another aspect provided herein is a cell expressing a nucleic acid construct comprising a target site for binding of a zinc-finger transcriptional activator (ZF-TA).
  • ZF-TA zinc-finger transcriptional activator
  • Another aspect provided herein is a cell expressing a nucleic acid construct comprising a Rep protein operatively linked to a promoter comprising a target site for binding of a zinc-finger transcriptional activator (ZF-TA).
  • ZF-TA zinc-finger transcriptional activator
  • nucleic acid construct comprising a nucleic acid sequence encoding a tetracycline -responsive transactivator protein operatively linked to a constitutive promoter; a nucleic acid sequence comprising at least one of: a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a regulatable promoter; and a nucleic acid sequence encoding, e.g., a zinc finger (ZF) transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a E4-responsive promoter, or a E2 -responsive promoter; and a nucleic acid construct comprising a Rep protein operatively linked to a promoter;
  • ZF zinc finger
  • Another aspect provided herein is a cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding a toxic protein and a recombinase recognition sequence (RRS) located 3’ of the nucleic acid sequence encoding the toxic protein.
  • RTS recombinase recognition sequence
  • Another aspect provided herein is a cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 5” and 3’ of the nucleic acid sequence encoding the Cap protein, such that the RRSs are flanking the nucleic acid sequence encoding the Cap protein.
  • RRS recombinase recognition sequence
  • Another aspect provided herein is a cell expressing a nucleic acid construct comprising a first nucleic acid construct comprising in a 5 ’ to 3 ’ direction: a promoter, a stop nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and nucleic acid sequence encoding a Rep protein, wherein the promoter is operatively linked to the nucleic acid encoding the Rep protein, and a second nucleic acid construct comprising, in a 5’ to 3’ direction: a promoter, a stop nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRSs), and nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operatively linked to the nucleic acid encoding the one or more of E2A, E4, and VA RNA.
  • a promoter a stop nucleic acid sequence flanked by a first
  • Expression of the construct can be stably expressed, i.e., integrated into the genome of the cell.
  • One aspect herein provides a stable cell expressing at least one nucleic acid construct described herein.
  • the stable cell expresses at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 of the nucleic acid constructs described herein.
  • One aspect provided herein is a stable cell expressing a nucleic acid construct comprising at least a nucleic acid sequence encoding at least one helper protein, wherein each nucleic acid construct is operatively linked to a regulatable promoter.
  • Another aspect provided herein is a stable cell expressing a nucleic acid construct encoding a tetracycline-responsive transactivator protein operatively linked to a constitutive promoter.
  • Another aspect provided herein is a stable cell expressing a nucleic sequence encoding a marker protein.
  • nucleic acid construct comprising at least a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding a toxic protein is operatively linked to a regulatable promoter.
  • Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding at least one helper protein, wherein the at least one helper gene is operatively linked to a first regulatable promoter; and a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is under the control of a second regulatable promoter or a zinc-finger transcriptional activator (ZF-TA).
  • ZF-TA zinc-finger transcriptional activator
  • nucleic acid construct comprising a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a regulatable promoter.
  • Another aspect provided herein is a stable cell expressing a nucleic acid construct encoding a Rep protein, wherein the nucleic acid encoding a Rep protein is under the control of a regulatable promoter or a zinc-finger transcriptional activator (ZF-TA).
  • ZF-TA zinc-finger transcriptional activator
  • nucleic acid construct comprising a nucleic acid sequence comprising at least one of: a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding a Rep protein is under the control of a second regulatable promoter or transcriptional activator, wherein the first and the second regulatable promoters are different
  • Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a E4-responsive promoter, or a E2- responsive promoter or other helper-gene responsive promoter.
  • ZF-TA zinc- finger transcriptional activator
  • Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising a toxic protein operatively linked to a promoter comprising a zinc-finger transcriptional activator (ZF-TA).
  • ZF-TA zinc-finger transcriptional activator
  • Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising a Rep protein operatively linked to a promoter comprising a target site for binding of a transcriptional activator, e.g., a zinc -finger transcriptional activator (ZF-TA).
  • a transcriptional activator e.g., a zinc -finger transcriptional activator (ZF-TA).
  • nucleic acid construct comprising a nucleic acid sequence encoding a tetracycline -responsive transactivator protein operatively linked to a constitutive promoter; a nucleic acid sequence comprising at least one of: a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a regulatable promoter; and a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a E4-responsive promoter, or a E2 -responsive promoter; and a nucleic acid construct comprising a Rep protein operatively linked to a promoter comprising a target
  • Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding a toxic protein and a recombinase recognition sequence (RRS) located 3’ of the nucleic acid sequence encoding the toxic protein.
  • RTS recombinase recognition sequence
  • Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 3’ of the nucleic acid sequence encoding the Cap protein.
  • RTS recombinase recognition sequence
  • Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising a first nucleic acid construct comprising in a 5 ’ to 3 ’ direction: a promoter, a stop nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and nucleic acid sequence encoding a Rep protein, wherein the promoter is operatively linked to the nucleic acid encoding the Rep protein, and a second nucleic acid construct comprising, in a 5’ to 3’ direction: a promoter, a stop nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRSs), and nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operatively linked to the nucleic acid encoding the one or more of E2A, E4, and VA RNA.
  • a promoter a stop nucleic acid sequence flanked by a
  • Expression of the construct can be transiently expressed, i.e., not integrated into the genome of the cell.
  • One aspect herein provides a cell having transient expression of at least one nucleic acid construct described herein.
  • the cell has transient expression of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 of the nucleic acid constructs described herein.
  • One aspect provided herein is a cell having transient expression of a nucleic acid construct comprising at least a nucleic acid sequence encoding at least one helper protein, wherein each nucleic acid construct is operatively linked to a regulatable promoter.
  • Another aspect provided herein is a cell having transient expression of a nucleic acid construct encoding a tetracycline -responsive transactivator protein operatively linked to a constitutive promoter.
  • Another aspect provided herein is a cell having transient expression of a nucleic sequence encoding a marker protein.
  • Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising at least a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding a toxic protein is operatively linked to a regulatable promoter.
  • Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a nucleic acid sequence encoding at least one helper protein, wherein the at least one helper gene is operatively linked to a first regulatable promoter; and a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is under the control of a second regulatable promoter or a zinc -finger transcriptional activator (ZF-TA).
  • ZF-TA zinc -finger transcriptional activator
  • Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a regulatable promoter.
  • Another aspect provided herein is a cell having transient expression of a nucleic acid construct encoding a Rep protein, wherein the nucleic acid encoding a Rep protein is under the control of a regulatable promoter or a zinc -finger transcriptional activator (ZF-TA).
  • ZF-TA zinc -finger transcriptional activator
  • nucleic acid construct comprising a nucleic acid sequence comprising at least one of: a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding a Rep protein is under the control of a second regulatable promoter or transcriptional activator, wherein the first and the second regulatable promoters are different.
  • Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a E4-responsive promoter, or a E2-responsive promoter or other helper-gene responsive promoter.
  • ZF-TA zinc-finger transcriptional activator
  • Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a toxic protein operatively linked to a promoter comprising a zinc -finger transcriptional activator (ZF-TA).
  • ZF-TA zinc -finger transcriptional activator
  • Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a Rep protein operatively linked to a promoter comprising a target site for binding of a transcriptional activator, e.g., a zinc -finger transcriptional activator (ZF-TA).
  • a transcriptional activator e.g., a zinc -finger transcriptional activator (ZF-TA).
  • nucleic acid construct comprising a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operatively linked to a constitutive promoter; a nucleic acid sequence comprising at least one of: a nucleic acid sequence encoding a E4 protein, a nucleic acid sequence encoding a E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequences encoding any one of E4, E2A, and VA RNA is operatively linked to a regulatable promoter; and a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operatively linked to an inducible promoter, wherein the inducible promoter is a E4-responsive promoter, or a E2 -responsive promoter; and a nucleic acid construct comprising a Rep protein operatively linked to a promoter comprising a
  • Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a nucleic acid sequence encoding a toxic protein and a recombinase recognition sequence (RRS) located 3’ of the nucleic acid sequence encoding the toxic protein.
  • RTS recombinase recognition sequence
  • Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 3’ of the nucleic acid sequence encoding the Cap protein.
  • RTS recombinase recognition sequence
  • Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a first nucleic acid construct comprising in a 5’ to 3’ direction: a promoter, a stop nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and nucleic acid sequence encoding a Rep protein, wherein the promoter is operatively linked to the nucleic acid encoding the Rep protein, and a second nucleic acid construct comprising, in a 5 ’ to 3 ’ direction: a promoter, a stop nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRSs), and nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operatively linked to the nucleic acid encoding the one or more of E2A, E4, and VA RNA.
  • a promoter a stop nucleic acid sequence flanked by
  • the type of expression i.e., stable or transient
  • the expression of the at least two nucleic acid constructs can both be stable expression.
  • the expression of the at least two nucleic acid constructs can both be transient expression.
  • a cell expresses at least two nucleic acid constructs
  • the expression of at least one of the two nucleic acid constructs is stable expression, e.g., a cell can have both stable expression of a nucleic acid construct, and transient expression of a different nucleic acid construct.
  • Cell culture systems used for viral vector propagation such as viral vector producer cells - which include primary cells, semi-continuous cell lines, and continuous cell lines - can express any of the inducible promoters described herein to control a gene product required for viral vector propagation.
  • Primary cell lines are cell lines derived from animal tissues, such as human, mouse, canine, monkey, and the like, and may be passaged once or twice to generate secondary cultures (i.e., subculture of the primary culture), but grow only for limited time. Secondary cultures are similar to primary cultures in both morphology and viral susceptibility.
  • Semi-continuous cell lines e.g., human diploid cells, are derived from fetal tissues, and can be sub-cultured for ⁇ 50 passages.
  • Continuous cell lines are cancer or other immortalized cell lines, which multiply rapidly and may be cultured indefinitely. These cells may become heteroploid on serial passage. Continuous cell lines typically have a narrower range of viral susceptibility as compared to primary cells and semi-continuous cell lines, but are easy to adapt for viral propagation.
  • Cell lines for propagating viral vectors are known in the art, and include, but are not limited to, the exemplary cell lines presented in Table 2. In one embodiment, the cell line for viral propagation is selected from Table 2, In one embodiment, the cell line for viral propagation is derived from a cell line selected from Table 2.
  • the cell line is an HEK293 cell line that has been modified such that it is no longer an adhesive cell line.
  • the cell line is a HEK293 cell line which grows in suspension.
  • the cell line is the ProlO cell line. The ProlO cell line is described, e.g., in US Patent No. 9,441,206, which is incorporated herein by reference.
  • a method of producing any of the stable cell lines described herein comprising (a) transforming a population of cells with at least one nucleic acid cassette containing an inducible promoter operatively linked to a heterologous gene that encodes a toxic protein, or a nucleic acid described herien (b) culturing the population of cells of (a) under conditions and for a time sufficient to permit expression of the nucleic acid cassette or construct, (c) selecting for a cell that stably expresses the nucleic acid cassette, and (d) growing the cell of (c) to produce the cell line.
  • the parent cells were co-introduced with a vector comprising a gene that confers antibiotic resistant to the cell.
  • the bsr, bis, or BSD genes confer resistance to Blasticidin; the Sh ble gene confers resistance to ZeocinTM; the pac gene confers resistance to Puromycin; the neo gene confers resistance to G418 (Geneticin); the hph gene confers resistance to Hygromycin B; and the Sh ble gene confers resistance to Phleomycin.
  • the initial selection cells expressing a gene that confers resistance to an antibiotic are cultured in the presence of the antibiotic.
  • a cell expressing the neo gene is cultured in a geneticin- containing medium. After initial selection, surviving cells are isolated, cultured under conditions permitting expression of the nucleic acid cassette, harvested, and assayed to confirm expression of the nucleic acid cassette.
  • the method further comprises culturing the cells under conditions and for a time sufficient to induce expression of the at least one toxic protein, for example, Rep, Cap, or a helper protien.
  • Western blotting or other suitable assays may be used to assess expression of the nucleic acid cassette or at least one toxic protein.
  • Inducing expression suitable involved applying at least one inducer to said cells.
  • the inducer is applied for a suitable period of time to induce expression from the inducible promoter.
  • the inducer can be an agent which is administered to said cells, or can be a condition to which the cells are subjected. Suitable inducers are discussed herein.
  • Clones producing the nucleic acid cassette are expanded to produce the inventive stable cell lines (the term “cell line” is intended to include progeny (subclones) of an original line).
  • stability is confirmed by the ability to produce the at least one toxic protein over at least about 12 months, and for greater than about 50 passages. In one embodiment, stability is confirmed by the ability to produce the at least one toxic protein over at least about 1, 2, 3, 4, 5, 6, 7,
  • the or each nucleic acid sequence encoding a Rep protein is under the control of a second regulatable promoter or a regulatable transcriptional activator.
  • the second regulatable promoter operatively linked to the or each nucleic acid encoding the or each Rep protein comprises a binding site for a regulatable transcriptional activator.
  • Exemplary transcriptional activators include homeodomain transcriptional activator, zinc-finger transcriptional activator, winged-helix (Forkhead) transcriptional activator, leucine-zipper transcriptional activator, and helix-loop-helix transcriptional activator.
  • the regulatable transcriptional activator is a zinc-finger transcriptional activator (ZF-TA).
  • the second regulatable promoter comprises a binding site for a zinc -finger transcriptional activator (ZF-TA).
  • the zinc-finger transcriptional activator is expressed from a nucleic acid construct encoding a zinc finger (ZF) transcriptional activator operatively linked to an inducible promoter, optionally wherein the inducible promoter is a Ed- responsive promoter, or a E2 -responsive promoter or other helper-gene responsive promoter.
  • the second regulatable promoter operatively linked to the or each nucleic acid encoding the or each Rep protein comprises a binding site for a zinc finger (ZF) transcriptional activator.
  • ZF zinc finger
  • the zinc-finger transcriptional activator (ZF-TA) is encoded by the following nucleic acid sequence:
  • the inducible promoter is a E4-responsive promoter, or a E2- responsive promoter or other helper-gene responsive promoter.
  • the binding site for a zinc-finger transcriptional activator (ZF- TA) binding sites comprises the nucleic acid sequence:
  • the second regulatable promoter comprising a ZF-TA binding site operatively linked to the or each nucleic acid encoding the or each Rep protein comprises the following nucleic acid sequence, wherein the ZF-TA binding site is shown in bold: TCTAGAGGGTATATAATGGGGGCCACTAGTGCCAGCAGCAGCCTGACCACATCTCA TCCTCCAGCCACCATGCCGGGGTTTTACGAGATTGTGATTAAGGTCCCCAGCGACCTTG ACGAGCATCTGCCCGGCATTTCTGACAGCTTTGTGAACTGGGTGGCCGAGAAGGAGTGG GAGTTGCCGCCAGATTCTGACTTGGATCTGAATCTGATTGAGCAGGCACCCCTGACCGTG GCCGAGAAGCTGCAGCGCGACTTTCTGACGGAGTGGCGCCGTGTGAGTAAGGCCCCGGA GGCCCTTTTCTTTGTGCAATTTGAGAAGGGAGAGCTACTTCCACTTACACGTGCTCGT GGAAACCACCGGGGTGAAATCC
  • the at least one regulatable is an inducible promoter.
  • the inducible promoter may be a promoter induced by the presence of an inducer, the absence of a repressor, or any other suitable physical or chemical condition that induces transcription from the inducible promoter.
  • inducer inducing conditions
  • an inducible promoter for use in embodiments of the invention may be a forskolin-inducible promoter, a hypoxia-inducible promoter, a small molecule -inducible promoter, a tetracycbne-regulatable (e.g.
  • an inducible promoter for use in embodiments of the invention is a forskolin-inducible promoter or a hypoxia-inducible promoter.
  • the present invention may make use of at least one regulatable intron.
  • the at least one regulatable intron may be operable to control expression of one or more proteins.
  • the at least one regulatable intron may be used alone or in combination with one or more of the regulatable promoters described herein.
  • the regulatable intron controls expression at the translation stage.
  • a regulatable promoter such as an inducible promoter
  • the regulatable intron of the present invention a dual level of expression can be achieved, i.e. control at both the transcription level and at the translation level. This can allow for very tight control of expression of a gene, e.g. to avoid any expression “leakage”, i.e., expression in an unintended location, for example, a tissue or organ.
  • said regulatable intron is an intron which comprises an excisable sequence which is capable of being spliced out of a transcript produced from the nucleic acid sequence via the unfolded protein response (UPR) system in the cell, thereby resulting in a transcript encoding a functional protein.
  • the unfolded protein response (UPR) is a cellular coping mechanism for endoplasmic reticulum stress which is highly conserved across all eukaryotes.
  • a nucleic acid construct of the present invention may comprise a sequence which encodes a regulatable intron, suitably a nucleic acid sequence which encodes a regulatable intron.
  • a nucleic acid sequence of the present invention which encodes a protein may comprise a sequence which encodes a regulatable intron.
  • a nucleic acid construct of the present invention may comprise a nucleic acid sequence encoding a protein, wherein the nucleic acid sequence encoding the protein comprises a sequence which encodes a regulatable intron.
  • a nucleic acid sequence encoding a regulatable intron may be present in any nucleic acid sequence encoding any protein described herein.
  • the nucleic acid sequence encoding any of the following: an E4 protein, an E2A protein, a Rep protein, and a Cap protein may comprise a sequence which encodes a regulatable intron.
  • the nucleic acid sequence encoding the Rep protein may comprise a sequence encoding a regulatable intron.
  • there is provided a nucleic acid sequence encoding a Rep protein wherein the nucleic acid sequence encoding the Rep protein comprises a sequence which encodes a regulatable intron.
  • a cell of the present invention may comprise a nucleic acid sequence or a nucleic acid construct comprising a sequence which encodes a regulatable intron, as described above.
  • the cell is a stable cell as described herein.
  • a method of producing viral particles of the present invention may comprise providing and culturing a cell which comprises a nucleic acid sequence or a nucleic acid construct comprising a sequence which encodes a regulatable intron as described above.
  • said methods further comprise a step of treating the cell to induce UPR, to thereby induce splicing of the excisable sequence out of the regulatable intron.
  • treating the cell to induce UPR comprises applying stress to the cell.
  • a chemical agent such as forskolin, dithiothreitol (DTT), tunicamycin, thapsigargin, a saturated fatty acid, an agent that is able to downregulate stearoyl-CoA desaturase enzyme activity, or by applying hypoxia, carbohydrate deprivation, or the like, to the cell.
  • a chemical agent such as forskolin, dithiothreitol (DTT), tunicamycin, thapsigargin, a saturated fatty acid, an agent that is able to downregulate stearoyl-CoA desaturase enzyme activity, or by applying hypoxia, carbohydrate deprivation, or the like, to the cell.
  • the un-spliced transcript produced from the nucleic acid sequence encoding the protein encodes a truncated or otherwise defective version of the protein as a result of the presence of the regulatable intron, but when the transcript is processed by the UPR mechanism in the cell the excisable sequence of the intron is spliced out and the functional protein can be produced from the transcript.
  • splicing out of the regulatable intron results in a functional mRNA encoding the functional protein expression product.
  • the regulatable intron is capable of being spliced out by the IRE1 protein or a homologue or orthologue thereof, which is already present in the cell,
  • IRE 1 orthologues or orthologues of IRE 1 are present in all eukaryotes, including fungi, plants and mammals).
  • the regulatable intron is the XBP1 intron, the Had intron, the bZIP60 intron, or a homologue thereof.
  • the intron can be a wild type form of the XBP1, Had or bZIP60 intron, or a naturally occurring homologue thereof.
  • the regulatable intron comprises the sequence CNG/CNG-Xn- CNG/CNG, wherein Xn represents a sequence of length n bases, wherein / represents a cleavage site and wherein the sequence CNG-Xn-CNG is excised from the transcript.
  • the regulatable intron suitably comprises a central sequence (Xn) flanked by two splice site target sequences, each having the sequence CNG/CNG, wherein / represents a cleavage site.
  • CNG/CNG is a consensus splice site sequence targeted in a highly-conserved manner by the UPR system in eukaryotic cells. As is known in the art, this splice site consensus sequence is targeted by the IRE1 protein (homologues or orthologues of which are present in all eukaryotes, including fungi, plants and mammals) when the UPR response is induced.
  • IRE1 protein homologues or orthologues of which are present in all eukaryotes, including fungi, plants and mammals
  • the regulatable intron or Xn can be from 10 to 500 nucleotides in length, 15 to 350 nucleotides in length, 15 to 100 nucleotides in length, 15 to 35 nucleotides in length, 20 to 25 nucleotides in length.
  • the excisable sequence of the regulatory intron thus suitably has a length of 16 to 506 nucleotides, 21 to 356 nucleotides in length, 21 to 106 nucleotides in length, 21 to 41 nucleotides in length, 26 to 31 nucleotides in length.
  • the regulatable intron comprises the sequence CNG/CNG- Xn-CNG/CNG[CG] (SEQ ID NO: 50), wherein Xn represents a sequence of length n nucleotides, wherein / represents the cleavage site such that the excisable sequence CNG-Xn-CNG (SEQ ID NO: 51) is excised from the transcript upon splicing, and wherein the nucleotide at the 5’ end of the sequence Xn is a C or G.
  • Xn comprises or consists of the sequence CACUCAGACUACGUGCACCU (SEQ ID NO: 52) or a sequence which is at least 60% identical thereto at least 70% identical thereto, at least 80% identical thereto, at least 90% identical thereto, at least 95%, 96%, 97%, 98% or 99% identical thereto.
  • Xn comprises or consists of one of the following sequences:
  • CACUCAGACUACGUGCACCU (SEQ ID NO: 53);
  • CACUCAGACUACGUGCUCCU (SEQ ID NO: 54);
  • CACUCAGACUACGUGCCCCU (SEQ ID NO: 55);
  • CACUCAGACUACGUGCGCCU (SEQ ID NO: 56).
  • CACUCAGACUAUGUGCACCU (SEQ ID NO: 57).
  • Xn comprises or consists of the sequence ACGGGCAACUUUACACGACG (SEQ ID NO: 58) or a sequence which is at least 60% identical thereto, at least 70% identical thereto, at least 80% identical thereto, at least 90% identical thereto, at least 95%, 96%, 97%, 98% or 99% identical thereto.
  • the regulatable intron comprises or consists of the sequence CNG/CNGCACUCAGACUACGUGCACCUCNG/CNGC (SEQ ID NO: 59), or a sequence which is at least 60% identical thereto, at least 70% identical thereto, at least 80% identical thereto, at least 90% identical thereto, at least 95%, 96%, 97%, 98% or 99% identical thereto, wherein / represents a cleavage site.
  • the splice site target sequence may remain as CNG/CNGC, and sequence variation occurs in the other regions.
  • the regulatable intron comprises or consists of the sequence CAG/CAGCACUCAGACUACGUGCACCUCUG/CUGC (SEQ ID NO: 60), or a sequence which is at least 60% identical thereto, at least 70% identical thereto, at least 80% identical thereto, at least 90% identical thereto, at least 95%, 96%, 97%, 98% or 99% identical thereto, wherein / represents a cleavage site.
  • the splice site target sequence may remain as CAG/CUGC, and sequence variation occurs in the other regions.
  • the regulatable intron comprises or consists of one of the following sequences: [0398] CNG/CAGCACUCAGACUACGUGCACCUCUG/CNG (SEQ ID NO: 61);
  • the regulatable intron comprises or consists of one of the following sequences:
  • CAG/CAGCACUCAGACUACGUGCUCCUCUG/CUGC (SEQ ID NO: 67);
  • CAG/CAGCACUCAGACUAUGUGCACCUCUG/CUGC (SEQ ID NO: 70).
  • the regulatable intron comprises the sequence CAG/CUGCAGCACUCAGACUACGUGCACCUCUG/CAG (SEQ ID NO: 71) or CAG/CUGCAGCACUCAGACUACGUGCACCUCUG/CUGG (SEQ ID NO: 72), wherein / represents a cleavage site.
  • This sequence results from the addition of the trinucleotide CUG to the mammalian XBP1 intron sequence. Addition of this trinucleotide is believed to slightly de-optimise splicing of the intron to reduce any undesirable splicing (and hence background expression of the expression product) in cells.
  • Xn comprises or consists of CAGCACUCAGACUACGUGCACCU (SEQ ID NO: 73).
  • the regulatable intron comprises the sequence: CNG/CAGACGGGCAACUUUACACGACGCUG/CNG (SEQ ID NO: 74), or a sequence which is at least 60% identical thereto, at least 70% identical thereto, at least 80% identical thereto, at least 90% identical thereto, at least 95%, 96%, 97%, 98% or 99% identical thereto, wherein / represents a cleavage site.
  • the splice site target sequence may remain as CNG/CNG, and sequence variation occurs in the other regions.
  • the splice site target sequence (i.e. comprising the sequence CNG/CNG) in the transcript is flanked by sequences which are able to interact to form a stem-loop structure.
  • the splice site target sequence is preferably flanked by sequences which are complementary to one another, such that they will hybridize with each other to form a stem-loop structure in which the splice site target sequence is located at least partially, or entirely, within the loop region of the stem-loop structure that is formed in the transcript.
  • the stem-loop structure formed by the transcript preferably comprises a loop which comprises from 6 to 9 nucleotides, and a stem which is from 3 to 10 nucleotides in length. In some embodiments, the stem-loop structure comprises a loop which comprises from 7 to 8 nucleotides, and a stem which is from 4 to 8 nucleotides in length.
  • the intron may suitably comprise a sequence at the splice target site as follows:
  • A is an sequence having a length of from 0 to 3 nucleotides, in some embodiments 1 or 2 nucleotides, wherein / represents the cleavage site, and wherein Yn and Zn represent sequences that are complementary in nucleotide sequence when read in opposite directions, and are thus are able to hybridize to form the stem of the stem-loop structure.
  • Yn and Zn are preferably from 3 to 10 nucleotides in length, in some embodiments from 4 to 8 nucleotides in length.
  • the intron may suitably comprise a sequence at the splice target site as follows:
  • A preferably has a length of 0, 1 or 2 nucleotides.
  • hypoxia-inducible promoter is a synthetic hypoxia- inducible promoter.
  • synthetic hypoxia-inducible promoter comprises at least one hypoxia-responsive element (HRE) that is capable of being bound and activated by a hypoxia-inducible factor (HIF).
  • HRE hypoxia-responsive element
  • HIF is a family of transcription factors which are activated by decrease in the oxygen level in a cell. Under normal oxygen conditions, HIF is degraded following hydroxylation. Hypoxic conditions stabilize HIF and prevent its degradation. This allows HIF to translocate to the nucleus, bind to the HRE and activate HRE-responsive genes.
  • the hypoxia-inducible promoter typically comprises an HRE that is capable of being bound and activated by HIF operably linked to a minimal promoter.
  • HRE that is capable of being bound and activated by HIF is operably linked to a promoter other than a minimal promoter (e.g. a proximal promoter, such as a tissue-specific proximal promoter).
  • a promoter other than a minimal promoter e.g. a proximal promoter, such as a tissue-specific proximal promoter.
  • the particular promoter associated with the HRE can be selected depending on the circumstances, but typically minimal promoters are preferred, especially when it is desired to minimize background expression levels.
  • HREs are generally composed of multimers of short conserved sequences, termed HIF-binding sites (HBSs). As the name suggests, HBSs are bound by HIF, whereupon the HRE is activated to drive transcription. Accordingly, the HRE of the present invention comprises a plurality of HBS, preferably 3 or more HBS, more preferably from 3 to 10 HBS, more preferably from 3 to 8 HBS, more preferably from 4 to 8 HBS. In some preferred embodiments of the present invention the HRE comprises 5, 6 or 8 HBS.
  • a core consensus sequence for the HBS has been determined.
  • the core consensus sequence is NCGTG (SEQ ID NO: 75, N represents any nucleotide).
  • N represents any nucleotide.
  • a or G is optimal in the first position, so a generally preferred consensus sequence is [AG]CGTG (SEQ ID NO: 76).
  • the HBS is functional when it is present in either strand of the double-stranded DNA (i.e. in either orientation).
  • the HBS may be represented by the reverse complement consensus sequence CACG[CT] (SEQ ID NO: 77) in one strand, indicating the presence of the sequence [AG]CGTG (SEQ ID NO: 76) on the corresponding complementary strand (in such cases the HBS can be described as being in the “reverse orientation” or “opposite orientation”).
  • the HBSs contained in the HRE each preferably comprise the consensus sequence NCGTG (SEQ ID NO: 75), and optionally the consensus sequence [AG]CGTG (SEQ ID NO: 76). Additional sequences flanking the consensus sequence may be present, and these have some effect on the affinity of the HIF for the HBS. Preferred HBS for some embodiments of the invention are discussed below.
  • Adjacent HBSs are typically, but not always, separated by spacer sequences.
  • the spacing between HBSs in an HRE can have a significant effect on the inducibility and/or overall power of the promoter. In some cases, it may be desirable to optimize spacing between adjacent HBSs in order to maximize inducibility and power of the promoter. In other cases, it may be desirable to use suboptimal spacing in order to provide a promoter with lower inducibility and/or overall power of the promoter. Specific spacing between HBSs present in preferred embodiment of the invention will be discussed below. However, in general, it is typically preferred that the spacing between adjacent core consensus sequences in adjacent HBSs is from 3 to 50 nucleotides.
  • the spacing between core consensus sequences in adjacent HBSs is from 7 to 25 nucleotides, preferably about 8 to 22 nucleotides.
  • the spacing between core consensus sequences in adjacent HBSs is from 5 to 6 nucleotides or from 26 to 32 nucleotides.
  • the spacing between core consensus sequences in adjacent HBSs is from 2 to 4 nucleotides or from 33 to 50 nucleotides. It will be appreciated that there is scope to vary the spacing between adjacent HBS and thereby tailor the properties of the HRE.
  • the HRE is typically spaced from the promoter (e.g. minimal promoter), though it need not be.
  • the spacing can have an effect on the inducibility and/or overall power of the promoter.
  • the spacing between the core consensus sequences in the final HBS (i.e. that which is most proximal to the minimal promoter) and the TATA box (or equivalent sequence if a TATA box is not present) of the minimal promoter is from 0 to 200 nucleotides, more preferably 10 to 100 nucleotides, yet more preferably 20 to 70 nucleotides, yet more preferably 20 to 50 nucleotides, and yet more preferably 20 to 30 nucleotides.
  • the spacing between final HBS and the TATA box (or equivalent sequence if a TATA box is not present) of the minimal promoter is 20-30, with spacings significantly over and under this leading to weaker expression levels. It will be appreciated that there is scope to vary the spacing between the final HBS and the MP and thereby tailor the properties of the HRE.
  • the HRE that is capable of being bound and activated by HIF comprises at least one HBS that comprises or consists of the HREl sequence.
  • the HREl HBS sequence is ACGTGC (SEQ ID NO: 78).
  • HREl of course may be present on either strand of the nucleic acid, and thus in such cases the reverse orientation HREl will be indicated by the presence of the reverse complement sequence GCACGT (SEQ ID NO: 79).
  • all HBS present in the HRE comprise or consist of the HREl sequence.
  • the HREl sequences that are present in the HRE may each independently be present in either orientation. In some embodiments it is preferred that all of the HREl sequences that are present in the HRE are in the same orientation.
  • the HRE that is capable of being bound and activated by HIF comprises at least one HBS that comprises or consists of the HRE2 sequence.
  • the sequence of HRE2 is CTGCACGTA (SEQ ID NO: 80).
  • the HBS is present in the reverse orientation when compared with HREl, and as such the HRE2 sequence contains the reverse complement of the HREl sequence.
  • HRE2 may be present on either strand of the nucleic acid, and thus in such cases the reverse orientation HRE2 may be indicated by the presence of the reverse complement sequence TACGTGCAG (SEQ ID NO: 81).
  • the HRE2 sequence comprises additional flanking sequences and is considered to be an optimized HBS, which binds HIF more strongly than HREl.
  • HRE2 may be considered to be preferable to HREl.
  • all of the HBS present in the HRE comprise or consist of the HRE2 sequence.
  • the HRE2 sequence effectively comprises the HREl sequence, it will be apparent that when the HRE2 is provided HREl will inevitably also be present.
  • the HRE2 sequences that are present in the HRE may each independently be present in either orientation. In some embodiments it is preferred that all of the HRE2 sequences that are present in the HRE are in the same orientation.
  • the HRE that is capable of being bound and activated by a HIF comprises at least one HBS that comprises or consists of the HRE3 sequence, or a functional variant thereof.
  • HRE3 sequence is ACCTTGAGTACGTGCGTCTCTGCACGTATG (SEQ ID NO: 82, HBS underlined).
  • HRE3 represents a composite HBS which comprises two individual HBSs (i.e. binding sites for HIF, underlined) separated by a spacer, and with further spacers at each end. It can be seen that HRE3 comprises one HBS in each orientation (one comprising HRE1 and one comprising HRE2, the HRE1 sequence being positioned 5’ with respect to the HRE2 sequence). Given that each HRE3 sequence comprises 2 individual HBS, for the purposes of the present invention, each HRE3 sequence or functional variant thereof contributes 2 individual HBS to the total number of HBS present in the HRE.
  • HRE3 or functional variants thereof may be present on either strand of the nucleic acid, and thus in such cases the reverse orientation of HRE3 may be indicated by the presence of the reverse complement sequence CATACGTGCAGAGACGCACGTACTCAAGGT (SEQ ID NO:
  • functional variants of HRE3 also form embodiments of the present invention. Such variants are functional if they retain the ability to be bound by HIF leading to activation.
  • Preferred functional variants of HRE3 retain the same HBSs as HRE3 in substantially the same position and orientation, but contain different spacer sequences. Accordingly, in some preferred embodiments the functional variant of HRE3 suitably has the following sequence:
  • SI is a spacer of length 8-10, preferably 9, where S2 is a spacer of length 4-6, preferably 5, where S3 is a spacer of length 1-3, preferably 2.
  • the functional variant of HRE3 comprises the sequence NNNNNNNNNACGTGNNNNNCTGCACGTANN (SEQ ID NO: 85).
  • the functional variant of HRE3 has an overall sequence identity to HRE3 of a least 80%, preferably at least 90%, more preferably at least 95% identical to HRE3, and wherein the HBS sequences are completely identical to HRE3.
  • HRE3 is considered to be a particularly optimal sequence, which binds HIF strongly. Thus, in cases where a high level of prompter inducibility and power are desired, the presence of HRE3 or functional variants thereof that maintain similar properties may be considered to be preferable.
  • all HBS present in the HRE comprise or consist of the HRE3 sequence, or a functional variant thereof.
  • the HRE3 sequences, or functional variants thereof, that are present in the HRE may each independently be present in either orientation. In some embodiments it is preferred that all of the HRE3 sequences, or functional variants thereof, that are present in the HRE are in the same orientation.
  • the HRE may comprise a combination of two or more of HREl, HRE2 and/or HRE3.
  • the HRE that is capable of being bound and activated by HIF suitably comprises the following sequence:
  • S] n (SEQ ID NO: 87) may or may not have the same sequence or length.
  • the length of the spacer can be varied depending on the desired inducibility and power of the promoter.
  • spacers are provided such that spacing between core consensus sequences in adjacent HBSs is from 7 to 18 nucleotides, preferably about 8-12 nucleotides, more preferably about 10 nucleotides. While it is often desirable to maximize inducibility and power of the promoter, in some cases a lower level of inducibility and power may be desired. In embodiments where a somewhat lower level of inducibility and power is desired, spacers can be provided such that adjacent HBSs are spaced apart by lesser or greater amounts, e.g. by from 4-6 nucleotides or from 19-50 nucleotides. It will be apparent that the HREl HBS comprises one nucleotide flanking the core consensus sequence (underlined - ACGTGC, SEQ ID NO: 78), and as such the spacers in in these embodiments take this into account to provide the desired spacing.
  • the HRE that is capable of being bound and activated by HIF suitably comprises the following sequence:
  • ACGTGC-S-ACGTGC-S-ACGTGC-S-ACGTGC-S-ACGTGC-S-ACGTGC-S-ACGTGC (SEQ ID NO: 88) wherein S is a spacer.
  • spacers each have a length of 30-50 nucleotides.
  • an exemplary, but non-limiting, spacer has the following sequence:
  • HRE that is capable of being bound and activated by HIF suitably comprises the following sequence:
  • HRE1 sequences are substantially or completely identical to the reference sequence, and substantially all sequence variation arises in the spacer sequences
  • Such an HRE generally displays a very low level of inducibility and low expression levels when induced. This may be desirable in situations where background expression is to be minimized, and a high level of expression when induced is not required. Optimized spacing of the HBS can of course lead to higher levels of inducibility and expression upon induction.
  • HRE that is capable of being bound and activated by HIF suitably comprises the following sequence:
  • CTGCACGTA-S n -CTGCACGTA (SEQ ID NO: 91); wherein S is an optional spacer and n is from 2 to 9, preferably from 3 to 7.
  • sequence of the spacer when present, can vary; that is to say that the spacer in each repeat unit [CTGCACGTA-S] n (SEQ ID NO: 92) may or may not have the same sequence or length.
  • HRE2 HBS comprises four nucleotides flanking the core consensus sequence (underlined - CTGCACGTA. SEQ ID NO: 80), and as such the spacers in these embodiments take this into account to provide the desired spacing.
  • the HRE that is capable of being bound and activated by HIF suitably comprises the following sequence:
  • the spacers each have a length of 20 nucleotides.
  • an exemplary, but non-limiting, spacer has the following sequence: GATGATGCGTAGCTAGTAGT (SEQ ID NO: 94).
  • HRE that is capable of being bound and activated by HIF suitably comprises the following sequence:
  • HRE2 sequences are substantially or completely identical to the reference sequence, and substantially all sequence variation arises in the spacer sequences.
  • Such an HRE generally displays an intermediate level of inducibility and low expression levels when induced. This may be desirable in situations where background expression is to be minimized, and a moderate level of expression when induced is required. Further optimization of the spacing of the HBSs can of course lead to higher levels of inducibility and expression upon induction. Likewise, de -optimization can lead to lower levels of inducibility and expression upon induction.
  • the HRE that is capable of being bound and activated by HIF suitably comprises the following sequence:
  • CTGCACGTACTGCACGTACTGCACGTACTGCACGTA (SEQ ID NO: 96, HBSs underlined), or a functional variant that comprises a sequence that is at least 80% identical thereto, preferably 85%, 90%, 95% or 99 % identical thereto.
  • this HRE comprises no additional spacers between adjacent HRE2 elements.
  • the core consensus sequences have an effective spacing of 4 nucleotides.
  • Such an HRE generally displays an intermediate level of inducibility and low expression levels when induced. This may be desirable in situations where background expression is to be minimized, and a moderate level of expression when induced required. Further optimization of the spacing of the HBSs can of course lead to higher levels of inducibility and expression upon induction. Likewise, de-optimization can lead to lower levels of inducibility and expression upon induction.
  • the HRE that is capable of being bound and activated by HIF suitably comprises from 3 to 6 HRE3 sequences, preferably from 3 to 5, preferably 4 HRE3 sequences, or a functional variant thereof, wherein adjacent HRE3 sequences, or functional variants thereof, are separated from each other by a spacer having a length of from 4 to 20 nucleotides, preferably from 6 to 15 nucleotides, more preferably 9 nucleotides.
  • the HRE that is capable of being bound and activated by HIF suitably comprises the following sequence:
  • the HRE3 composite HBS comprises 11 nucleotides flanking the region containing the two core consensus sequence (underlined - ACCTTGAGTACGTGCGTCTCTGCACGTATG. SEQ ID NO: 99), and as such the spacers in in these embodiments take this into account to provide the desired spacing.
  • the spacer, S suitably has a length of from 4 to 20 nucleotides, preferably from 7 to 15 nucleotides, more preferably 9 nucleotides.
  • the EIRE that is capable of being bound and activated by HIF suitably comprises the following sequence:
  • the HRE that is capable of being bound and activated by HIF suitably comprises the following sequence:
  • the spacers each have a length of 9 nucleotides.
  • an exemplary, but non-limiting, spacer has the following sequence: GCGATTAAG (SEQ ID NO: 102).
  • HRE that is capable of being bound and activated by HIF suitably comprises the following sequence:
  • HRE1 and HRE2 sequences present in the HRE3 sequence are substantially or completely identical to the reference sequence, and substantially all sequence variation arises in the spacer sequences.
  • Such an HRE generally displays a high level of inducibility and high expression levels when induced. This may be desirable in situations where a high level of expression when induced is required. Further optimization of the spacing of the HBSs may potentially lead to higher levels of inducibility and expression upon induction. Likewise, de-optimization can lead to lower levels of inducibility and expression upon induction.
  • the hypoxia-inducible promoter typically comprises the HRE that is capable of being bound and activated by HIF operably linked to a minimal or proximal promoter. It is preferred that the prompter operably linked to the HRE is a minimal promoter.
  • the minimal promoter can be any suitable minimal promoter.
  • suitable minimal promoters include CMV minimal promoter (CMV-MP), YB-TATA minimal promoter (YB-TABA), HSV thymidine kinase minimal promoter (MinTK), and SV40 minimal promoter (SV40-MP).
  • CMV-MP CMV minimal promoter
  • YB-TABA YB-TATA minimal promoter
  • MinTK HSV thymidine kinase minimal promoter
  • SV40-MP SV40 minimal promoter
  • the minimal promoter can be a synthetic minimal promoter.
  • Particularly preferred minimal promoters are the CMV minimal promoter (CMV-MP) and YB-TATA minimal promoter (YB-TABA).
  • ATCCACGCTGTTTTGACCTCCATAGAAGATCGCCACC (SEQ ID NO: 104).
  • a longer sequence containing the YB-TATA MP is used in some preferred embodiments of the invention.
  • the sequence of this longer sequence of the YB-TATA MP (referred to herein as long YB-TATA) is
  • YB- TATA is provided as a component of an inducible promoter herein, a substantially equivalent sequence with long YB-TATA substituted in place of YB-TATA is also considered to be an embodiment of the invention.
  • the spacing between the last HBS and the TATA box of MP is preferably retained.
  • MinTK The sequence of MinTK is:
  • sequence of SV40-MP is: GCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCC A
  • preferred embodiments comprise the HRE that is capable of being bound and activated by HIF operably linked to one of the abovementioned minimal promoters, more preferably to CMV-MP or YB-TATA, and most preferably CMV-MP.
  • CMV-MP when combined with HREs of the present invention, has shown to provide extremely high levels of inducibility and high promoter strength. Low background expression levels have also been observed.
  • the HRE is preferably spaced from the minimal promoter (or other type of promoter, if used) by a spacer sequence.
  • the spacing between the HRE and the minimal promoter can affect the inducibility and power of the hypoxia-inducible promoter.
  • the spacing between the core consensus sequences in the final HBS (i.e. that which is most proximal to the minimal promoter) and the TATA box (or equivalent sequence if a TATA box is not present) of the minimal promoter is from 10 to 100 nucleotides, more preferably 20 to 70 nucleotides, yet more preferably 20 to 50 nucleotides, and yet more preferably 20 to 30 nucleotides.
  • the spacing between the final HBS and the TATA box (or equivalent sequence if a TATA box is not present) of the minimal promoter is preferably from 20 to 30 nucleotides. In embodiments where a somewhat lower level of inducibility and power is desired, the spacing between the final HBS and the TATA box (or equivalent sequence if a TATA box is not present) can be lesser or greater, e.g. from 0 to 10 nucleotides or from 31 to 100 nucleotides. While it is often desirable to maximize inducibility and power of the promoter, in some cases a lower level of inducibility and power may be desired.
  • hypoxia-inducible promoter comprises on of the following sequences (the HBS sequences are underlined and minimal promoter sequences are shown in bold):
  • the HRE1, HRE2 and MP sequences are substantially identical to the reference sequence, and substantially all sequence variation arises in the spacer sequences.
  • the expression level of the transgene is increased by at least a 5 -fold, more preferably a 10-, 15-, 20-, 30-, or 50- fold.
  • the expression level of the transgene upon induction (e.g. after cells are exposed to 5% oxygen for 5h, having previously been normoxic, e.g. exposed to 20% oxygen) is at least 50% of that provided by the CMV-IE promoter (i.e. an otherwise identical vector in the same cells under the same conditions, but in which expression of the transgene is under control of CMV-IE rather than the hypoxia inducible promoter). More preferably the expression level of the transgene is at least 75%, 100%, 150%, 200%, 300%, 400% or 500% of that provided by the CMV-IE promoter.
  • hypoxia-inducible promoter can be selected from the group consisting of: Adenosine A2B receptor (A2BR) promoter, Plasminogen activator receptor (uPAR) VEGF receptors (VEGFR1 and VEGFR2) promoter, Platelet-derived endothelial cell growth factor/thymidine phosphorylase (PDECGF/TP) promoter, nitric oxide synthase (NOS) promoter, Phosphoglycerate kinase- 1 (PGK- 1) promoter, Pyruvate kinase M (PK-M) promoter, Glucose transporter 1 (GLUT1) promoter, Hypoxia-inducible factor (HIF-1) promoter, Early growth response 1 (Egr-1) promoter, Nuclear factor kB (NFkB) promoter
  • hypoxia-inducible promoters are described in WO2016/146819, which is incorporated herein by reference. See, for example, Table 4.
  • Induction of a hypoxia-inducible promoter can be achieved by making the cells hypoxic, i.e. treating said population of cells so as to induce hypoxia in the cells, such that expression from the transgene linked to the hypoxia-inducible promoter is induced and the expression product is produced.
  • Suitable approaches will be apparent to the skilled person for any particular cell type.
  • eukaryotic cells are cultured under aerobic conditions, and many approaches are known in the art to achieve this for various cell and culture types.
  • Hypoxic conditions can be achieved by reducing the amount of oxygen supplied to the cell.
  • cells can be grown under normoxic conditions (e.g. approximately 20% oxygen), before being switched to a gas mix comprising less oxygen or no oxygen to induce hypoxia.
  • hypoxia in cells can be used to induce hypoxia in cells.
  • An exemplary suitable gas mix for use to induce hypoxic conditions in cell culture is 5% oxygen, 10% carbon dioxide and 85% nitrogen, but other gas mixes can be used.
  • hypoxia in cell culture can be induced by introduction of an agent that can induce hypoxia in the cells.
  • an agent that can induce hypoxia in the cells For example, CoC12 can be used at suitable concentrations, e.g. a final concentration of approximately IOOmM in cell culture media, to induce hypoxia.
  • hypoxia-inducible promoter as discussed herein can be adjusted (e.g. uninduced, repressed or modulated) by altering the level of oxygen to which cells comprising the promoter are exposed. For example, induced expression through hypoxia can be switched off (uninduced) by exposing the cells to normoxic conditions (e.g. exposed to 20% oxygen).
  • the synthetic hypoxia-inducible promoter does not comprise or consist of one of the following structures:
  • S x represents a spacer of length X nucleotides.
  • the synthetic hypoxia-inducible promoter does not comprise or consist of one of the following sequences:
  • the inducible promoter is a forskolin-inducible promoter.
  • the forskolin-inducible promoter is a synthetic forskolin- inducible promoter.
  • the synthetic forskolin-inducible promoter comprises a synthetic forskolin-inducible cis-regulatory element (CRE) that is capable of being bound by CREB and/or API.
  • the forskolin responsive enhancer element has a sequence comprising
  • This enhancer was combined with the following minimal promoters, with a 5bp spacer between the enhancer and the minimal promoter: YB-Tata (FORNYB- REP), CMV (FORNCMV), CMV53 (FORNCMV53), MinTK (FORNMinTK), MLP (FORNMLP), SV40 (FORNSV40), pJB42 (FORNJB42). Sequences of the forskolin responsive enhancer element combined with the minimal promoter are provided herein, e.g., in Example 7.
  • the enhancer element was further combined with the minimal promoter, TATA-m6A.
  • the minimal promoter TATA-m6A has a sequence comprising of (SEQ ID NO: 111)
  • SEQ ID NO: 111 comprises a consensus sequence TATA box highlighted in underlined text and an m6a sequence highlighted in bolded, underlined text.
  • the TATA box is the minimal sequence required to stablize transcription from an enhancer, whereas the m6A sequence that is signal for the mRNA to be methylated.
  • This and other chemical modifications, of which there are at least 160 known, of mRNA are believed to create another layer of post-transcriptional control during gene expression.
  • the m6a is the best understood and research has shown that is involved in a large number of mRNA functions e.g. splicing, export, translation and stability.
  • One aspect provided herein is a synthetic forskolin inducible promoter comprising a sequence according to SEQ ID NO: 110, or a functional variant thereof.
  • the synthetic forskolin inducible promoter comprising a sequence which is at least 60%, 65%, 70%, 75%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 110.
  • the functional variant of the synthetic forskolin inducible promoter retains at least 25%, 50%, 75%, 80%, 85%, 80%, 95% or 100% of the activity of the reference promoter.
  • the synthetic forskolin inducible promoter is operatively linked to a nucleic acid sequence to drive expression of the same, for example, a nucleic acid seqeunce that encodes a toxic gene described herein.
  • the nucleic acid need not be a nucleic acid sequence described herein; any sequence can be operatively linked to the synthetic forskolin inducible promoter.
  • the CRE/promoter is referred to as forskolin-inducible, it may also be induced by other agents, as discussed in more detail below.
  • the mechanism of induction by forskolin is via the activation of adenylyl cyclase and the resultant increase of intracellular cAMP. Accordingly, the CRE/promoter is also inducible by other activators of adenylyl cyclase or factors that increase intracellular cAMP.
  • the CRE comprises at least 2, more preferably at least 3, transcription factor binding sites (TFBS) for CREB and/or API (as used herein, the term “TFBS for X” means a TFBS which is capable of being bound by transcription factor X).
  • TFBS transcription factor binding sites
  • the CRE comprises at least 4 TFBS for CREB and/or API.
  • the CRE comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 TFBS for CREB and/or API.
  • the CRE comprises 15 or fewer TFBS for CREB and/or API, optionally 10 or fewer TFBS for CREB and/or API.
  • the CRE comprises at least 1 TFBS for each of CREB and API. In some embodiments the CRE comprises at least 2, 3, 4, 5, 6 or 7 TFBS for each of CREB and API.
  • TFBS for CREB typically comprise or consist of the highly conserved consensus sequence TGACGTCA (SEQ ID NO: 112). This sequence is known as the cAMP Responsive Element (or cAMPRE or CRE; the abbreviation cAMPRE will be used herein to avoid confusion with the abbreviation for cis-regulatory element). Other cAMPREs that can be used are discussed below.
  • TFBS for API typically comprise or consist of the consensus sequence TGA[GC]TCA (SEQ ID NO: 113).
  • sequences TGAGTCA (named AP1(1), SEQ ID NO: 114), TGACTCAG (named AP1(2), SEQ ID NO: 115) and TGACTCA (named AP1(3), SEQ ID NO: 116) were used, and thus AP1(1), AP1(3) and AP1(2) can be viewed as preferred TFBS for API .
  • the generic term API in respect of a TFBS refers to a TFBS comprising the above consensus sequence, and it encompasses both AP1(1), AP1(3) and API (2).
  • the CRE comprises at least one TFBS for a transcription factor other than CREB and/or API .
  • the CRE comprises at least one TFBS for ATF6 and/or hypoxia inducible factor (HIF).
  • the CRE may comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 TFBS for a transcription factor other than CREB and/or API, for example for ATF6 and/or HIF.
  • the CRE comprises at least 1 TFBS for each of ATF6 and HIF.
  • TFBS for HIF comprise or consist of the consensus sequence NCGTG (SEQ ID NO: 75), more preferably [AG]CGTG (SEQ ID NO: 76). This sequence is referred to as the HIF binding sequence (HBS).
  • HBS HIF binding sequence
  • CTGCACGTA named HRE1, SEQ ID NO: 80
  • HRE1 can be viewed as a preferred TFBS for HIF.
  • other TFBS for HIF are known and can be used in the present invention, for example ACGTGC (SEQ ID NO: 78) or ACCTTGAGTACGTGCGTCTCTGCACGTATG (SEQ ID NO: 82).
  • TFBS for ATF6 comprise or consist of the consensus sequence TGACGT (SEQ ID NO: 117), more preferably TGACGTG (SEQ ID NO: 118).
  • the TFBS sequence TGACGTGCT (SEQ ID NO: 119) was used and this can be viewed as preferred TFBS for ATF6.
  • any sequence comprising the consensus sequence TGACGT (SEQ ID NO: 117), more preferably TGACGTG (SEQ ID NO: 118), can be used.
  • each of the TFBS discussed above can be present in either orientation (i.e. they can be functional when present on either strand of the double-stranded DNA).
  • any of the TFBS may be represented by the reverse complement consensus sequence in one strand, which indicates the presence of the TFBS sequence on the corresponding complementary strand (in such cases the TFBS can be described as being in the “reverse orientation” or “opposite orientation”).
  • a reference to a TFBS whether by name or by reciting the sequence of a TFBS, should be considered to refer to the presence of the TFBS in either orientation.
  • orientation shown represents a specifically disclosed, and typically a preferred, embodiment.
  • the CRE comprises:
  • TFBS for CREB and 6 TFBS for API; wherein adjacent TFBS are optionally, but preferably, separated by spacer sequences.
  • the spacer sequence can be any suitable length.
  • the spacer is from 2 to 100 nucleotides in length, from 5 to 50 nucleotides in length, from 6 to 40 nucleotides in length, from 7 to 30 nucleotides in length, from 8 to 25 nucleotides in length or from 10 to 20 nucleotides in length.
  • Spacers of 5, 10, 20 nucleotides in length have been used in some specific embodiments of the invention, and these function well, but other lengths of spacers can be used.
  • it is preferred that the spacer is a multiple of 5 nucleotides in length. The skilled person can readily determine suitable lengths of spacers.
  • sequence and length of the of the spacers can vary; that is to say that each spacer in a sequence need not have the same sequence or length as any other.
  • sequence and length For convenience, some or all of the spacers between TFBS in a CRE often do have the same sequence and length, so, while this may be preferred, it is not required.
  • the TFBS can suitably be in any order, but in preferred embodiments they are provided in the order in which they are recited, i.e. in the first embodiment in the list above there would be 4 TFBS for cAMPRE and then 3 TFBS for API in an upstream to downstream direction.
  • the CRE consists of:
  • TFBS for CREB and 6 TFBS for AP 1 ; wherein adjacent TFBS are optionally, but preferably, separated by spacer sequences.
  • the TFBS can suitably be in any order, but in preferred embodiments they are provided in the order in which they are recited.
  • the CRE comprises one of the following structures:
  • CRE comprising 5x cAMPRE and 3x API TFBS
  • CRE comprising 5x cAMPRE and 3x AP1(2) TFBS
  • CRE comprising 5x cAMPRE and 4x API TFBS
  • CRE comprising 5x cAMPRE and 4x API (2) TFBS
  • CRE comprising 8x API TFBS
  • CRE comprising 8x AP1(1) TFBS
  • CRE comprising 3x ATF6, 4x API and 3x HIF TFBS
  • CRE comprising 5x cAMPRE 4x AP1(1) TFBS
  • CRE comprising 7x cAMPRE and 6 x AP1(3)
  • S represents an optional, but preferable, spacer sequence. Suitable lengths for the spacers are discussed above.
  • reference to a TF represents the presence of the TFBS for that TF.
  • cAMPRE is used to refer to the TFBS for CREB.
  • the CRE comprises one of the following structures:
  • CRE comprising 5x cAMPRE and 4x API TFBS
  • CRE comprising 8x AP1(1) TFBS
  • the CRE comprises one of the following sequences:
  • the CRE comprises one of the following sequences:
  • the CRE comprises one of the following sequences:
  • the TFBS sequences present are identical to the reference sequence, and substantially all variation arises in the spacer sequences lying therebetween.
  • the abovementioned CREs have been shown to provide good levels of inducibility and powerful expression upon induction, and low levels of background expression, when combined with a minimal promoter to for an inducible promoter. Thus, they are all useful for the provision of forskolin inducible promoters.
  • the CREs demonstrate some degree of variation in terms of inducibility and expression levels upon induction, and this allows a promoter to be selected which has desired properties.
  • a CRE having the following structure cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-APl-S-APl-S-APl-S-AP has been shown to provide excellent properties in terms of inducibility and expression when coupled to a minimal promoter. Accordingly, such a CRE represents a particularly preferred embodiment of the invention.
  • a CRE having the following structure ATF6-S-ATF6-S-ATF6-S-AP1-S-AP1-S- AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-HIF-S-HIF-S-HIF-S-HIF has been shown to provide exceptional properties in terms of inducibility and expression when coupled to a minimal promoter. Accordingly, such a CRE represents a particularly preferred embodiment of the invention. It is surprising that such a CRE should perform so well, given that it includes several TFBS that are not known or expected to be induced by forskolin, and fewer TFBS that are induced by forskolin than some other CREs that are less inducible and powerful. It seems that an unexpected synergy has arisen in view of the combination of TFBS present in the CRE.
  • a synthetic forskolin-inducible promoter comprising the structure cAMPRE-S- cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-APl(3)-S-APl(3)-S- AP1(3)-S-AP1(3)-S-AP1(3) has been shown to provide exceptional properties in terms of inducibility and expression. Accordingly, such a promoter represents a particularly preferred embodiment of the invention. It seems that a particular synergy has arisen in view of the combination of TFBS present in the CRE.
  • the promoter may comprise a cis-regulatory module (CRM) comprising a CRE according to the first aspect of the invention.
  • CCM cis-regulatory module
  • Other CREs in the CRM can be forskolin-inducible CREs, or they can have any other function.
  • the synthetic forskolin-inducible promoter comprises a CRE (or CRM) as discussed above linked to a minimal promoter or a proximal promoter, preferably a minimal promoter.
  • the minimal promoter can be any suitable minimal promoter.
  • suitable minimal promoters include CMV minimal promoter (CMV-MP), YB-TATA minimal promoter (YB-TABA), HSV thymidine kinase minimal promoter (MinTK), SV40 minimal promoter (SV40-MP), or G6PC-MP (which is a liver-derived non-TATA box MP).
  • CMV-MP CMV minimal promoter
  • MinTK HSV thymidine kinase minimal promoter
  • SV40-MP SV40 minimal promoter
  • G6PC-MP which is a liver-derived non-TATA box MP
  • CACGCTGTTTTGACCTCCATAGAAGATCGCCACC (SEQ ID NO: 104).
  • AAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 137).
  • sYB-TATA a shorter version of the YB-TATA MP is known in the art and this is should provide an effective alternative to the YB-TATA MP sequence recited above.
  • the sequence of this shorter YB-TATA MP (referred to as sYB-TATA) is
  • YB-TATA is referred to as a component of an inducible promoter herein
  • an equivalent sequence with sYB- TATA substituted in place of YB-TATA is also considered to be an alternative embodiment of the invention.
  • the sequence of sYB-TATA is retained, while the remaining portions of YB-TATA can be replaced with other sequences, typically spacer sequences.
  • the synthetic forskolin-inducible promoter comprises any one of the CRE sequences set out above operably linked to a minimal promoter or a proximal promoter, preferably a minimal promoter.
  • the CRE is preferably coupled to the MP via a spacer, but in some cases, there may be another CRE provided therebetween.
  • the CRE may also be operably linked to the MP without a spacer.
  • the spacer sequence between the CRE and the minimal promoter can be of any suitable length.
  • the spacer is from 5 to 100 nucleotides in length, from 20 to 80 nucleotides in length, or from 30 to 70 nucleotides in length.
  • spacers of 5, 10, 18, 20, 21, 42, 50, 59, 65 and 66 nucleotides in length have been used in specific non-limiting examples of the invention, and these function well.
  • other lengths of spacers can be used, and the skilled person can readily determine suitable lengths of spacers.
  • the synthetic forskolin-inducible promoter comprises one of the following structures:
  • - cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-APl-S-APl-S-MP i.e. a CRE comprising 5x cAMPRE and 3x ATF6TFBS and a MP
  • - cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-APl-S-APl-S-MP (i.e. a CRE comprising 5x cAMPRE and 4x API TFBS and a MP);
  • AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-MP (i.e. a CRE comprising 8x API TFBS and a MP);
  • ATF6-S-ATF6-S-ATF6-S-ATF6-S-AP1-S-AP1-S-AP1-S-AP1-S-HIF-S-HIF-S-HIF-S-MP i.e. a CRE comprising 3x ATF6, 4x API and 3x HIF TFBS and a MP;
  • CRE comprising 7x cAMPRE and 6 x AP1(3) and MP
  • S represents an optional, but preferable, spacer sequence
  • MP represents a minimal promoter. Suitable lengths for the spacers are discussed above.
  • the synthetic forskolin-inducible promoter comprises the following structure ATF6-S-ATF6-S-ATF6-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-HIF-S- HIF-S-HIF-S-MP, wherein S represents an optional, but preferable, spacer sequence and MP represents a minimal promoter. More preferably, the MP is CMV-MP.
  • the synthetic forskolin-inducible promoter comprises one of the following structures:
  • - cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-APl-S-APl-S-SV40- MP i.e. a CRE comprising 5x cAMPRE and 3x API TFBS and SV40-MP
  • - cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-APl-S-APl-S-APl-S-CMV-MP i.e. a CRE comprising 5x cAMPRE and 4x API TFBS and CMV-MP
  • - APl-S-APl-S-APl-S-APl-S-APl-S-APl-S-APl-S-APl-S-APl-S-(Min-TK or G6PC MP or CMV- MP) i.e. a CRE comprising 8x API TFBS and Min-TK or G6PC MP or CMV-MP;
  • ATF6-S-ATF6-S-ATF6-S-ATF6-S-AP1-S-AP1-S-AP1-S-AP1-S-HIF-S-HIF-S-CMV-MP i.e. CRE comprising 3x ATF6, 4x API and 3x HIF TFBS and CMV-MP
  • CRE comprising 7x cAMPRE and 6 x AP1(3) and YB TATA or CMV-MP or CMV53 or MinTK or MLP or SV40 or pJV42 or TATAm6a), wherein S represents an optional, but preferable, spacer sequence. Suitable lengths for the spacers are discussed above.
  • the synthetic forskolin-inducible promoter comprises one of the following sequences:
  • the synthetic forskolin-inducible promoter comprises one of the following sequences (the TFBS sequences are underlined and minimal promoter sequences are shown in bold):

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Des aspects de l'invention concernent une lignée cellulaire stable pour la production de vecteurs viraux recombinants (par exemple d'un vecteur viral adéno-associé recombinant) comprenant au moins un promoteur inductible lié de manière fonctionnelle à un gène hétérologue qui code pour une protéine toxique. L'invention concerne en outre des procédés de fabrication de lignées cellulaires stables et des procédés de production de vecteurs viraux.
PCT/US2021/024350 2020-03-26 2021-03-26 Promoteur inductible pour la production de vecteurs viraux WO2021195491A2 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2022557756A JP2023519242A (ja) 2020-03-26 2021-03-26 ウイルスベクター産生のための誘導性プロモーター
US17/907,229 US20230407326A1 (en) 2020-03-26 2021-03-26 Inducible promoter for viral vector production
EP21774695.7A EP4125974A4 (fr) 2020-03-26 2021-03-26 Promoteur inductible pour la production de vecteurs viraux
CN202180038621.7A CN115885046A (zh) 2020-03-26 2021-03-26 用于病毒载体生产的诱导型启动子

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US202063000155P 2020-03-26 2020-03-26
US63/000,155 2020-03-26
US202063010330P 2020-04-15 2020-04-15
US63/010,330 2020-04-15
US202163148905P 2021-02-12 2021-02-12
US63/148,905 2021-02-12

Publications (2)

Publication Number Publication Date
WO2021195491A2 true WO2021195491A2 (fr) 2021-09-30
WO2021195491A3 WO2021195491A3 (fr) 2021-11-11

Family

ID=77890723

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/024350 WO2021195491A2 (fr) 2020-03-26 2021-03-26 Promoteur inductible pour la production de vecteurs viraux

Country Status (1)

Country Link
WO (1) WO2021195491A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111566216A (zh) * 2017-08-23 2020-08-21 塞普洛麦克斯有限公司 使用可调节内含子的表达控制
WO2023182476A1 (fr) * 2022-03-25 2023-09-28 学校法人自治医科大学 Systeme efficace de production d'un vecteur viral adeno-associe (aav)

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005002526A2 (fr) * 2003-07-01 2005-01-13 President And Fellows Of Harvard College Procedes et compositions pour le traitement d'infections virales
KR101589259B1 (ko) * 2006-06-21 2016-02-01 유니큐어 아이피 비.브이. 곤충세포 내 ａａｖ의 생산에 유용한 ａａｖ-ｒｅｐ78의 번역을 위한 변형된 개시 코돈을 갖는 벡터
MX2010000944A (es) * 2007-07-26 2010-08-31 Amsterdam Molecular Therapeutics Bv Vectores baculovirales que comprenden secuencias de codificacion repetida con deformaciones diferenciales en codones.
CN102741273A (zh) * 2009-12-16 2012-10-17 华盛顿大学 毒素-免疫系统
MX2016011585A (es) * 2014-03-10 2016-11-29 Uniqure Ip Bv Vectores aav mejorados adicionales producidos en celulas de insecto.
US20180230489A1 (en) * 2015-10-28 2018-08-16 Voyager Therapeutics, Inc. Regulatable expression using adeno-associated virus (aav)
WO2019006418A2 (fr) * 2017-06-30 2019-01-03 Intima Bioscience, Inc. Vecteurs viraux adéno-associés destinés à la thérapie génique

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111566216A (zh) * 2017-08-23 2020-08-21 塞普洛麦克斯有限公司 使用可调节内含子的表达控制
WO2023182476A1 (fr) * 2022-03-25 2023-09-28 学校法人自治医科大学 Systeme efficace de production d'un vecteur viral adeno-associe (aav)

Also Published As

Publication number Publication date
WO2021195491A3 (fr) 2021-11-11

Similar Documents

Publication Publication Date Title
JP7463358B2 (ja) アデノ随伴ウイルスベクタープロデューサー細胞株
US10858631B2 (en) Methods for adeno-associated viral vector production
WO2021195491A2 (fr) Promoteur inductible pour la production de vecteurs viraux
JP2022537410A (ja) ファージ複製起点を用いたベクターの産生
WO2020161484A1 (fr) Système aav inductible comprenant des séquences d'opérateur de cumate
EP3722434B1 (fr) Système plasmidique
WO2021195494A2 (fr) Promoteur inductible pour la production de vecteurs viraux
TW202116794A (zh) 用於生物製造之合成遺傳因子
EP4125974A2 (fr) Promoteur inductible pour la production de vecteurs viraux
US20230407327A1 (en) Inducible promoter for viral vector production
US20220154223A1 (en) Nucleic acid constructs for simultaneous gene activation
GB2566572A (en) Methods for adeno-associated viral vector production
US20230111672A1 (en) Compositions and methods for production of recombinant adeno-associated virus
WO2021252909A1 (fr) Modules riborégulateurs et procédés de régulation de la traduction des protéines eucaryotes
WO2021003374A2 (fr) Systèmes hôtes comprenant des inhibiteurs d'une protéine d'édition de gène pour la production de vecteurs viraux
Bilal et al. Design and production of heart chamber-specific AAV9 vectors
De Carluccio et al. The CASwitch: a synthetic biology solution for high-performance inducible gene expression systems in biotechnology
WO2023250416A2 (fr) Acides nucléiques à base d'adénovirus et procédés associés
KR20240050462A (ko) 항-aav 중화 항체의 검출 및 정량을 위한 신규 시스템
JP2023546116A (ja) Ｖａ ｒｎａ転写のための核酸構築物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21774695

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2022557756

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021774695

Country of ref document: EP

Effective date: 20221026

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21774695

Country of ref document: EP

Kind code of ref document: A2