WO2021189546A1 - Kit for detecting sars-cov-2 coronavirus, and specific primer and probe thereof - Google Patents

Abstract

Disclosed are a kit for detecting SARS-CoV-2 coronavirus, and a specific primer and probe thereof, which fall within the field of biotechnology. The provided kit and the specific primer and probe thereof can be used for quickly detecting SARS-CoV-2 coronavirus to realize to the rapid qualitative or quantitative detection of a sample to be subjected to detection. Same can play an important role in the detection of SARS-CoV-2 coronavirus and the production process of vaccines.

Description

Kit for detecting SARS-CoV-2 coronavirus and its special primers and probes Technical field

The invention belongs to the field of biotechnology, and specifically relates to a kit for detecting SARS-CoV-2 coronavirus and its special primers and probes.

Background technique

[Correct 25.05.2020 according to Rule 91]
Novel coronavirus pneumonia is a new infectious disease caused by SARS-COV-2 coronavirus infection. Its pathogen virus is a type of coronavirus, also known as 2019-nCoV. It was released by the world on January 12, 2020. The new virus named by the health organization has a genome size of 29903 nucleotides and mainly expresses 10 genes. Studies have shown that SARS-COV-2 is the same as SARS coronavirus (SARS-CoV) and "Middle East respiratory syndrome" MERS coronavirus (MERS-CoV), and belongs to β coronavirus. Through gene sequence alignment, SARS-COV-2 has about 80% identity with SARS-CoV, and about 40% identity with MERS-CoV.

The SARS-COV-2 coronavirus is currently infecting more than millions of people in many countries around the world, and it is still in an outbreak trend. Although all countries are actively controlling it, due to its strong contagiousness and long incubation period, Human health is still a major threat. Therefore, the establishment of a rapid, accurate and specific method and tool to detect the virus is of great significance to the spread and control of the epidemic.

Summary of the invention

The invention aims to provide a kit for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus, its special primers and probes, and applications.

In the first aspect of the present invention, there is provided a primer and a probe for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus, wherein the primer includes an upstream primer SA-F1 and a downstream primer SA-R1 , Wherein the nucleotide sequence of SA-F1 is shown in SEQ ID NO: 2, the nucleotide sequence of SA-R1 is shown in SEQ ID NO: 3; the nucleotide sequence of the probe is shown in SEQ ID NO: 4 is shown.

In one embodiment, the 5'end of the probe is labeled with a fluorescent reporter group, and the 3'end of the probe is labeled with a fluorescence quenching group.

In one embodiment, the fluorescent reporter group is any one selected from FAM, ROX, CY5, and HEX, and the fluorescence quenching group is any one selected from TAMRA, BHQ, and Eclipse.

In the second aspect of the present invention, a kit for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus is provided, which includes the above-mentioned primers and probes; 20 μL of real-time fluorescence when using the kit The dosage of the primers and probes in the quantitative PCR detection system is: the final use concentration of each primer is 0.1-1.0 μM, and the final use concentration of the probe is 0.1-0.5 μM.

In one embodiment, the kit also includes a positive control substance and a negative control substance, the positive control substance is a SARS-COV-2 coronavirus positive quality control substance, and the negative control substance is a SARS-COV-2 coronavirus free The reaction system.

The application of the aforementioned primers, probes and kits in the detection of SARS-COV-2 coronavirus also belongs to the content of the present invention.

In the third aspect of the present invention, a method for detecting SARS-COV-2 coronavirus is also provided, which includes the following steps:

1) Establish a standard curve: Dilute the SARS-COV-2 coronavirus positive quality control material in a 10-fold gradient to a concentration of 1×10 ⁷ copies/μL, 1×10 ⁶ copies/μL, 1×10 ⁵ copies/μL, 1 ×10 ⁴ copies/μL, 1×10 ³ copies/μL, 1×10 ² copies/μL, 1×10 ¹ copies/μL are used as standard products; standard products of different concentrations are used as templates, and the above primers and probes Real-time fluorescent quantitative PCR detection is performed under the guidance of, and after the detection, the concentration Log value (X axis) of each standard substance is plotted against its corresponding Ct value (Y axis) to draw a standard curve;

2) Extract the total RNA of the sample to be tested, use the extracted total RNA as a template, perform real-time fluorescent quantitative PCR detection under the guidance of the above primers and probes, and simultaneously detect the positive control substance and the negative control substance;

3) Realize the qualitative detection of SARS-COV-2 coronavirus by using the obtained Ct value and the change of fluorescence signal.

In one embodiment, the method further includes the following steps:

4) According to the Ct value and the standard curve in step 1), the copy number of the SARS-COV-2 coronavirus contained in the sample to be tested is obtained to realize quantitative detection.

In one embodiment, the sample to be tested in step 2) includes raw materials for vaccine production, vaccine semi-finished products and finished products.

In one embodiment, the 20μL real-time fluorescent quantitative PCR detection system in step 1) and step 2) includes: template 2μL, real-time fluorescent quantitative one-step PCR reaction solution 2×One Step RT-PCR Buffer III 10μL, PrimeScript RT Enzyme Mix II 0.4μL, 5U/μL TaKaRa Ex Taq HS 0.4μL, upstream primer 0.4μL, downstream primer 0.4μL, probe 0.8μL, RNase Free ddH ₂ O 5.6μL.

In one embodiment, the detection conditions of real-time fluorescent quantitative PCR in step 1) and step 2) are: reverse transcription reaction procedure: 42°C 5min; 95°C 10sec; 1 cycle; PCR reaction procedure: 95°C 5sec ; 60℃20sec; 40 cycles.

In one embodiment, the determination method in step 3) is:

If the positive control product has an S-type amplification curve in the channel corresponding to the fluorescent reporter group (such as FAM fluorescent reporter group), and the negative control product has no amplification curve in the channel corresponding to the fluorescent reporter group, then the experiment is judged to be valid ; Otherwise, the experimental result is invalid;

When the experiment is established, the following judgments are made:

If the sample to be tested has an S-type amplification curve in the channel corresponding to the fluorescent reporter group, and the Ct value is ≤38, it is determined that the sample to be tested contains SARS-COV-2 coronavirus;

If the sample to be tested has an S-type amplification curve in the channel corresponding to the fluorescent reporter group, and the Ct value is greater than 38, the sample to be tested is determined to be an undetermined sample, and the RNA needs to be re-extracted and tested; if the retest results are the same, It is judged as a weak positive sample;

If the sample to be tested has no obvious S-type amplification curve in the channel corresponding to the fluorescent reporter group, it is judged as a negative sample, that is, it does not contain SARS-COV-2 coronavirus.

Based on the above technical solutions, the primers and probes used for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus can be used for rapid detection of SARS-COV-2 coronavirus, realizing rapid qualitative and quantitative detection of samples to be tested. It can provide a favorable basis for the quality monitoring and rationalization of the vaccine during the production process of the SARS-COV-2 coronavirus vaccine to ensure the safety and rationality of vaccination. The kit and detection method provided by the present invention are easy to operate and have high detection sensitivity. They can realize accurate qualitative and quantitative detection of SARS-COV-2 coronavirus, and will be used in the detection of SARS-COV-2 coronavirus (including clinical diagnosis). It plays an important role in the accurate detection of SARS-COV-2 coronavirus in clinical materials or cultures and in the production of vaccines, and has a broad application prospect.

Description of the drawings

Panel A and Panel B in Figure 1 are respectively the PCR amplification curves of the primers and probes of group 1 and group 2 in Example 1 against the SARS-COV-2 coronavirus positive quality control material of gradient concentration;

Figure 2 is a PCR amplification curve of the primers and probes of group 1 against the SARS-COV-2 coronavirus standard product of gradient concentration in Example 1;

_{Fig. 3 is a Log Copy-} Ct standard curve according to the PCR amplification curve of Fig. 2.

Detailed ways

The present invention aims to provide a special primer and probe for detecting the new type of coronavirus SARS-COV-2, and to provide a kit for detecting the SARS-COV-2 coronavirus based on the primer and probe, At the same time, a method for rapid detection of SARS-COV-2 coronavirus based on fluorescence quantitative polymerase amplification technology was established.

The present invention will be further described below in conjunction with specific embodiments. It should be understood that the specific embodiments are only used to further illustrate the present invention, rather than to limit the content of the present invention.

The methods used in the following examples are conventional methods unless otherwise specified. For specific steps, please refer to: "Molecular Cloning: A Laboratory Manual" Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

The ways to obtain various biological materials described in the examples are only to provide an experimental way to achieve specific disclosure purposes, and should not be a limitation on the source of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and ethics can be replaced and used according to the prompts in the examples.

The primers used were synthesized by General Biotech Co., Ltd.; the probes used were synthesized by General Biogenes Co., Ltd.

Example 1: Design of primers and probes

This example aims to determine the primers and probes that can use fluorescent quantitative polymerase amplification technology to quickly detect SARS-COV-2 coronavirus. The inventors used the surface protein S gene of SARS-COV-2 coronavirus (SEQ ID NO: 1) According to the design principles of primers and probes, design multiple sets of primer and probe combinations, select the following group 1 and group 2 from the multiple combinations, and the sequence information is as follows:

Group 1:

SA-F1: 5'-TGCCTTGGTGATATTGCTGC-3' (SEQ ID NO: 2);

SA-R1: 5'-GTACCCGCTAACAGTGCAGAA-3' (SEQ ID NO: 3);

SA-probe1: 5'-FAM-CGGCCTTACTGTTTTGCCACCTTTGC-BHQ-3' (SEQ ID NO: 4);

The amplified sequences of primers SA-F1 and SA-R1 are:

5'-TGCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTAC-3' (SEQ ID NO: 5);

Group 2:

SA-F2: 5'-CAATGGTTTAACAGGCACAGG-3' (SEQ ID NO: 6);

SA-R2: 5'-CTCAAGTGTCTGTGGATCACG-3' (SEQ ID NO: 7);

SA-probe2: 5’-FAM-GGCAGAGACATTGCTGACACTACTGATGC-BHQ-3’ (SEQ ID NO: 8);

The amplified sequences of primers SA-F2 and SA-R2 are:

5'-CAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAG-3' (SEQ ID NO: 9);

The 5'-labeled luminescent groups of SA-probe1 and SA-probe2 in the above groups 1 and 2 are not limited to FAM, but can also be HXE, ROX, etc., and the 3'-labeled quenching group is not limited to BHQ, but also It can be TAMRA, etc., all of which belong to the content of the present invention.

Use the primers and probes of the above group 1 and group 2 to respectively construct the SARS-COV-2 coronavirus positive quality control product (the artificially synthesized SARS-COV-2 coronavirus surface protein S gene (SEQ ID NO: 1) To the vector pcDNA3.1, the plasmid was amplified by Escherichia coli and the plasmid was extracted as a positive quality control. The serial dilutions (1.0×10 ⁶ copies/μl, 1.0×10 ⁵ copies/μl, 1.0×10 ⁴ copies/μl, 1.0×10 ³ copies/μl, 1.0×10 ² copies/μl, 1.0×10 ¹ copies/μl). The results are shown in Figure 1. Panel (A) represents the results obtained by using the primers and probes of group 1. Amplification curves. The six standard S-type amplification curves from left to right indicate 1.0×10 ⁶ copies/μl, 1.0×10 ⁵ copies/μl, 1.0×10 ⁴ copies/μl, 1.0×10 ³ copies/ μl, 1.0×10 ² copies/μl, 1.0×10 ¹ copies/μl dilutions, (B) panel shows the amplification curve obtained by using the primers and probes of group 2, and the standard S-shaped amplification curve does not appear . According to the results in Figure 1, it can be seen that the detection limit of the primers and probes of group 1 can reach 1.0×10 ¹ copies/μl, and has a high relative fluorescence intensity; while the primers and probes of group 2 cannot be used to detect SARS at all. -COV-2 coronavirus is tested. Therefore, the following primers and probes of preferred group 1 of the present invention are used to detect SARS-COV-2 coronavirus.

Example 2: Establish a method for rapid detection of SARS-COV-2

This embodiment uses the primers and probes of group 1 obtained in the above embodiment 1 to establish a method for rapid detection of SARS-COV-2 coronavirus, which specifically includes the following steps:

2.1. Establish a standard curve: Dilute the positive quality control product obtained in Example 1 above in a 10-fold gradient to obtain the following gradient concentration solution as the SARS-COV-2 standard product: 1×10 ⁷ copies/μL, 1×10 ⁶ copies /μL, 1×10 ⁵ copies/μL, 1×10 ⁴ copies/μL, 1×10 ³ copies/μL, 1×10 ² copies/μL, 1×10 ¹ copies/μL, with different concentrations of standard products For the template, fluorescent quantitative PCR detection was performed under the guidance of the primers and probes shown in set 1 (Example 1), and the PCR detection system used the One Step PrimeScript ^TM RT-PCR Kit of TAKARA Company, as shown in Table 1 below. For PCR detection, the LightCycler Real Time PCR amplification instrument was used for the amplification reaction. The amplification procedure was: reverse transcription reaction: 42°C 5min; 95°C 10sec; 1 cycle; PCR reaction procedure: 95°C 5sec; 60°C 20sec; 40 Cycles.

Table 1: PCR detection system

Component name	Usage amount	Final concentration
2X One Step RT-PCR BufferⅢ	10μL	1×
SA-F1	0.4μL	Final concentration 0.2μM *1
SA-R1	0.4μL	Final concentration 0.2μM *1
SA-probe	0.8μL *2	To
PrimeScript RT Enzyme MixⅡ	0.4μL	To
TaKaRa Ex Taq HS(5U/μL)	0.4μL	To
template	2μL *3	To
RNase Free ddH2O	5.6μL	To
total	20μL	To

*1 Generally, a final primer concentration of 0.2μM can get better results. When the reaction performance is poor, the primer concentration can be adjusted in the range of 0.1-1.0μM.

*2 The concentration of the probe is related to the Real Time PCR amplification instrument used, the type of probe, and the type of fluorescent labeling material. Please refer to the instrument manual and the specific use requirements of the fluorescent probe when actually using it.

*3 It is recommended to use 10pg～100ng Total RNA as template.

The real-time fluorescence quantitative PCR amplification curve of each standard product is shown in Figure 2. The standard product amplification curve is a smooth "S"-shaped curve (positive). The seven groups of curves in Figure 2 correspond to the concentrations from left to right: 1×10 ⁷ copies/μL, 1×10 ⁶ copies/μL, 1×10 ⁵ copies/μL, 1×10 ⁴ copies/μL, 1×10 ³ copies/μL, 1×10 ² copies/μL, 1× 10 ¹ copies/μL.

After the detection, use the Log value of the concentration of each standard as the X-axis, and the cycle number (Ct value) as the Y-axis to plot the standard curve. The standard curve is shown in Figure 3, and its correlation coefficient is R ² =0.951 , So the error is small. The drawn standard curve can be used for real-time fluorescent quantitative PCR detection of SARS-COV-2. The linear equation obtained from the standard curve is: y=-3.345X+38.25.

2.2. Real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus

This step uses the primers and probes of group 1 obtained in Example 1 to perform real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus, where SARS-COV-2 coronavirus positive quality control is used as a positive control, and deionized Water is used as a negative control. According to the real-time fluorescent quantitative PCR detection results, the sample to be tested contains SARS-COV-2 coronavirus for qualitative determination. And according to the standard curve to quantify the copy number of the virus contained in the positive sample. It includes the following steps:

1) Extract the total RNA of the sample to be tested;

2) Using the above-mentioned total RNA as a template, use the primers and probes of group 1 in Example 1 for real-time fluorescent quantitative PCR detection; the detection system is as shown in Table 1 above, and the PCR amplification procedure is as described in step 2.1 above; Perform fluorescence signal detection at the end of each cycle of annealing;

3) Use the obtained Ct value and the change of fluorescence signal to realize the qualitative detection of SARS-COV-2, and the result is judged:

If the positive quality control product has an S-type amplification curve in the FAM fluorescence channel, and the negative control deionized water has no amplification curve in the FAM fluorescence channel, the experiment is judged to be valid; otherwise the experimental result is invalid.

When the experiment is established, the following judgments are made:

If the sample to be tested has an S-type amplification curve in the FAM fluorescence channel, and the Ct value is less than or equal to 38, it is determined as a positive sample, that is, the sample to be tested contains SARS-COV-2 coronavirus;

If the sample to be tested has an S-type amplification curve in the FAM fluorescence channel and the Ct value is greater than 38, the sample to be tested is judged to be an undetermined sample, and RNA needs to be re-extracted for detection; if the retest results are the same, it is judged to be weakly positive sample;

If the sample to be tested has no obvious S-type amplification curve in the FAM fluorescence channel, it is judged as a negative sample, that is, the sample to be tested does not contain SARS-COV-2 coronavirus.

4) For the sample to be tested that is determined to be positive for SARS-COV-2 coronavirus in step 3), then according to the Ct value and the previously determined standard curve, the copy number of the virus contained in the sample to be tested is obtained to realize the virus Quantitative detection.

Example 3. Sensitivity of real-time fluorescent quantitative PCR detection for SARS-COV-2 coronavirus

Panel A in Figure 1 and Figure 2 also show the sensitivity of the present invention to the real-time fluorescent quantitative PCR detection method for SARS-COV-2 coronavirus. It can be seen that the present invention performs real-time fluorescent quantitative PCR on SARS-COV-2 coronavirus. The PCR detection method can detect up to 1×10 ¹ copies/μl, and the amplification curve is a specific "S" type curve, indicating that the primers and probes of the present invention are suitable for binding to SARS-COV-2 coronavirus RNA, and have relatively good properties. High sensitivity.

Example 4 Real-time fluorescent quantitative PCR detection kit for SARS-COV-2 coronavirus

The real-time fluorescent quantitative PCR detection kit for SARS-COV-2 coronavirus provided by the present invention includes:

The primers (upstream primer SA-F1 and downstream primer SA-R1) and probe (SA-probe1) for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus shown in group 1 in Example 1.

Specifically, the real-time fluorescent quantitative PCR detection kit for SARS-COV-2 coronavirus provided by the present invention includes the following reagents for a 20 μL real-time fluorescent quantitative PCR detection system: real-time fluorescent quantitative one-step PCR reaction solution 2×One Step RT- PCR Buffer III (TAKARA) 10μL, PrimeScript RT Enzyme Mix II (TAKARA) 0.4μL, 5U/μL TaKaRa Ex Taq HS (TAKARA) 0.4μL, SA-F1 0.4μL (final concentration 0.1～1.0μM), SA-R1 0.4μL (Final concentration 0.1～1.0μM), SA-probe1 0.8μL, RNase Free ddH ₂ O 5.6μL. When in use, the usage amount of template RNA (10pg-100ng) is 2μL.

To facilitate detection, the kit can also include a positive control substance and a negative control substance. The positive control substance is the SARS-COV-2 coronavirus positive quality control substance obtained in Example 1, and the negative control substance does not contain SARS-COV-2. Coronavirus reaction system, such as H ₂ O (double distilled water, sterile deionized water, etc.).

To facilitate detection, the kit may also include the standard curve obtained in Example 2 and instructions. The instructions include PCR reaction conditions: reverse transcription reaction: 42°C for 5 min; 95°C for 10 sec; 1 cycle; PCR reaction program: 95 ℃5sec; 60℃20sec; 40 cycles;

Example 5. Clinical sample detection

This example uses the detection kit (this kit) provided in Example 4 to analyze 8 clinical throat swab samples (numbered as No.1, No.2, No.3, No. .4, No.5, No.6, No.7, No.8) total RNA extracted for detection, with SARS-COV-2 coronavirus positive quality control as a positive control, and deionized water as a negative control At the same time, using the commercial kit for detecting SARS-COV-2 coronavirus (purchased from Nanjing Jinweizhi Biotechnology Co., Ltd.) as a reference, according to the test results, follow the instructions provided in the kit to determine whether the clinical samples contain SARS-COV -2 Coronavirus is qualitatively determined, and the SARS-COV-2 coronavirus contained in the positive sample is quantified.

The test results are shown in Table 2 below. It can be seen that the test results of the clinical samples No. 1-6 are positive, that is, the clinical sample No. 1-6 contains the SARS-COV-2 coronavirus; the other two clinical sample No. 7. The test result of No. 8 is negative, that is, it is not infected with SARS-COV-2 coronavirus; this is consistent with the test result of the commercial kit, which proves that the test kit provided in Example 4 above is effective against SARS-COV-2 coronavirus. Reliability of test results. At the same time, the test results show that for all positive clinical samples, the Ct value measured by this kit is less than the Ct value detected by the commercial kit. It can be seen that this kit has a higher sensitivity than the commercial kit. In addition, for clinical samples with positive test results, the copy number of SARS-COV-2 coronavirus in positive clinical samples can also be calculated according to the Ct value of the cycle number and the standard curve provided in the kit. 2 plays an important role in the preparation of coronavirus vaccines.

Table 2: Real-time fluorescence quantitative PCR detection results of 8 clinical samples

The embodiments described here are only for illustration (as an illustration), and various modifications or changes made by technical personnel should also be included in the essential scope of the patent application.

Industrial applicability

The invention provides a kit for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus and its special primers, probes and applications, which can realize the qualitative and quantitative detection of SARS-COV-2 coronavirus, and is suitable For industrial applications.

Claims (12)

1. Primers and probes for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus, wherein the primers include upstream primer SA-F1 and downstream primer SA-R1, wherein the nucleotide sequence of SA-F1 As shown in SEQ ID NO: 2, the nucleotide sequence of SA-R1 is shown in SEQ ID NO: 3; the nucleotide sequence of the probe is shown in SEQ ID NO: 4.
2. The primer and probe according to claim 1, wherein the 5'end of the probe is labeled with a fluorescent reporter group, and the 3'end of the probe is labeled with a fluorescence quenching group.
3. The primer and probe according to claim 2, wherein the fluorescent reporter group is any one selected from FAM, ROX, CY5, and HEX, and the fluorescence quenching group is selected from TAMRA, BHQ, Eclipse Any of them.
4. A kit for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus, which comprises the primers and probes described in any one of claims 1-3.
5. The kit according to claim 4, wherein the dosage of the primers and probes in the 20 μL real-time fluorescent quantitative PCR detection system when the kit is used is: the final use concentration of each primer is 0.1-1.0 μM, The final use concentration of the probe is 0.1-0.5μM.
6. The kit according to claim 4, wherein the kit further comprises a positive control substance and a negative control substance, the positive control substance is a SARS-COV-2 coronavirus positive quality control substance, and the negative control substance is SARS-free The reaction system of the COV-2 coronavirus.
7. Use of the primers and probes according to any one of claims 1-3 or the kit according to any one of claims 4-6 in the detection of SARS-COV-2 coronavirus.
8. A method for detecting SARS-COV-2 coronavirus, which includes the following steps:

   1) Establish a standard curve: Dilute the SARS-COV-2 coronavirus positive quality control product in a 10-fold gradient to a concentration of 1×10 ⁷ copies/μL, 1×10 ⁶ copies/μL, 1×10 ⁵ copies/μL, 1×10 ⁴ copies/μL, 1×10 ³ copies/μL, 1×10 ² copies/μL, 1×10 ¹ copies/μL are used as standard products; standard products of different concentrations are used as templates, in claim 2 or 3 The real-time fluorescent quantitative PCR detection is performed under the guidance of the primers and probes, and after the detection is completed, the log value of the concentration of each standard substance is plotted against its corresponding Ct value to draw a standard curve;

   2) Extract the total RNA of the sample to be tested, use the extracted total RNA as a template, perform real-time fluorescent quantitative PCR detection under the guidance of the primers and probes of claim 2 or 3, and simultaneously detect the positive control and the negative control Taste;

   3) Realize the qualitative detection of SARS-COV-2 coronavirus by using the obtained Ct value and the change of fluorescence signal.
9. The method according to claim 8, wherein the method further comprises the following steps:

   4) According to the Ct value and the standard curve in step 1), the copy number of the SARS-COV-2 coronavirus contained in the sample to be tested is obtained to realize quantitative detection.
10. The method according to claim 8 or 9, wherein the sample to be tested in step 2) includes raw materials for vaccine production, vaccine semi-finished products and finished products.
11. The method according to claim 8 or 9, wherein the 20 μL real-time fluorescent quantitative PCR detection system in step 1) and step 2) comprises: 2 μL of template, real-time fluorescent quantitative one-step PCR reaction solution 2×One Step RT-PCR Buffer III 10μL, PrimeScript RT Enzyme Mix II 0.4μL, 5U/μL TaKaRa Ex Taq HS 0.4μL, upstream primer 0.4μL, downstream primer 0.4μL, probe 0.8μL, RNase Free ddH ₂ O 5.6μL;

    The real-time fluorescent quantitative PCR detection conditions in the step 1) and step 2) are: reverse transcription reaction program: 42°C 5min; 95°C 10sec; 1 cycle; PCR reaction program: 95°C 5sec; 60°C 20sec; 40 Cycles.
12. The method according to claim 8 or 9, wherein the determination method in step 3) is:

    If the positive control product has an S-type amplification curve in the channel corresponding to the fluorescent reporter group, and the negative control product has no amplification curve in the channel corresponding to the fluorescent reporter group, the experiment is judged to be valid; otherwise the experimental result is invalid;

    When the experiment is established, the following judgments are made:

    If the sample to be tested has an S-type amplification curve in the channel corresponding to the fluorescent reporter group, and the Ct value is ≤38, it is determined that the sample to be tested contains SARS-COV-2 coronavirus;

    If the sample to be tested has an S-type amplification curve in the channel corresponding to the fluorescent reporter group, and the Ct value is greater than 38, the sample to be tested is determined to be an undetermined sample, and the RNA needs to be re-extracted and tested; if the retest results are the same, It is judged as a weak positive sample;

    If the sample to be tested has no obvious S-type amplification curve in the channel corresponding to the fluorescent reporter group, it is judged as a negative sample, that is, it does not contain SARS-COV-2 coronavirus.

Images