WO2020224195A1 - Primer-probe combination for aspergillus species detection and distinguishing, kit, detection method and use thereof - Google Patents

Abstract

The present application provides a primer-probe combination for Aspergillus species detection and distinguishing, a kit, a detection method, and use thereof. The primer-probe combination for Aspergillus species detection and distinguishing comprises specific primers, detection probes, and complementary probes for Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus, respectively. The complementary probe and the detection probe are not completely complementary and paired. The primer-probe combination of the present application determines whether it is an Aspergillus infection by means of one detection, and can simultaneously distinguish Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus in the same fluorescent channel.

Description

Primer probe combination, kit, detection method and application of Aspergillus species detection Technical field

The application belongs to the field of biotechnology, and relates to a primer probe combination, kit, detection method and application for the detection of Aspergillus species, and specifically to a primer for the detection of Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus Probe combination, kit, detection method and application thereof.

Background technique

Aspergillus is a conditional pathogen, which is widely present in the living environment. It can produce conidia into the body with breathing, and mainly infect the lungs, skin or mucous membranes. Common pathogens include Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus terreus and so on.

At present, the detection methods for Aspergillus mainly include: (1) Pathogen culture and identification. Take samples from the affected area for smear or culture. The smear shows hyphae or Aspergillus spores. The culture shows the growth of Aspergillus. Aspergillus is a common contaminating bacteria. Smears or cultures must be repeated, multiple positives and the same strain are of diagnostic value, and the culture cycle is long. (2) Pathological examination, taking biopsy of damaged tissue or lymph node, and confirming the diagnosis based on fungal morphology, but this method is invasive examination, which is poorly accepted by patients. (3) Immunological examination, galactomannan is a highly specific and conservative polysaccharide in the cell wall of Aspergillus. It can be used as a molecular marker for detecting Aspergillus. It is detected by ELISA method, but the sensitivity of this method is not high. Can't distinguish bacterial species. (4) The real-time fluorescent PCR method improves the detection specificity through the combination of primers and probes, and provides a basis for clinical diagnosis. The existing method has a long detection cycle, which is not conducive to clinical diagnosis and medication. Although there are a variety of antifungal drugs, the treatment options for various Aspergillus species are the same, and precise treatment for specific species cannot be achieved.

CN108070675A discloses a primer probe combination and a fluorescent quantitative PCR kit for simultaneously detecting three Aspergillus species, belonging to the technical field of in vitro molecular detection of pathogenic microorganisms. This application provides a primer-probe combination for simultaneous detection of three Aspergillus species based on a fluorescent PCR method, the Aspergillus including Aspergillus fumigatus, Aspergillus flavus and Aspergillus niger. However, this application can only detect any one or a combination of Aspergillus fumigatus, Aspergillus flavus, and Aspergillus niger in the sample, and cannot detect and determine the specific strain, and this method cannot diagnose the presence of Aspergillus terreus.

CN106755379A discloses a fluorescent quantitative PCR method based on dimer mutation primers to quantitatively detect 4 Aspergillus species and synchronously perform genotyping. The detection method includes 1) extracting DNA from samples to be tested and 4 standard strains 2) Prepare positive plasmid standards; 3) Run fluorescent quantitative PCR; 4) Data analysis. The application also provides a detection kit for simultaneous quantification and genotyping of Aspergillus fumigatus, Aspergillus niger, Aspergillus flavus, and Aspergillus terreus, which includes an upstream primer labeled with a fluorescent reporter group and a quenching group The complementary strand of the labeled upstream primer and the downstream primer. However, the primers of this application are designed with fluorescent groups, which affect the amplification of fluorescence quantitative PCR; secondly, the melting curve temperature of the product is too high, the difference in annealing temperature between species of Aspergillus is too small, and the sensitivity and specificity of Aspergillus typing identification Not high; in the end, only common primers are used without probes, and the complementary primers are also designed with mutation sites, resulting in amplification of non-specific products, and the method has poor specificity.

CN101038254A discloses a kit that specifically amplifies the genes of the Aspergillus ITS I interval, and the product size is 79bp, which can quickly and accurately detect a variety of common pathogenic Aspergillus (such as Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus, Aspergillus and Aspergillus nidulans). However, the application was unable to detect interspecies differences of Aspergillus.

CN102321738A discloses a universal primer for fluorescent quantitative PCR detection of Aspergillus, a detection probe and a detection kit, which identify Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus and Aspergillus niger through a pair of universal primers and 4 specific probes. Although it can detect interspecies differences of Aspergillus, this method requires four fluorescence channels for analysis, which increases the experimental period and cost.

Therefore, it is of great significance to provide a simple method with good specificity, high sensitivity and capable of distinguishing Aspergillus species.

Summary of the invention

In view of the shortcomings of the prior art and the actual needs, this application provides a primer probe combination, kit, detection method and application for the detection of Aspergillus species, one detection to determine whether it is Aspergillus infection, can be in the same fluorescence channel It also distinguishes Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus.

To achieve this goal, this application adopts the following technical solutions:

In the first aspect, this application provides a primer probe combination for the detection of Aspergillus species, including specific primers, detection probes and complementary probes for Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus, respectively. The probe and the detection probe are not completely complementary paired.

In this application, multiplex PCR is used to simultaneously amplify the specific target sequences of Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus terreus, which are common in the invasive Aspergillus genus, and then use the specially designed Taqman probe melting curve analysis and identification to realize the For multiple detection of common invasive Aspergillus species, the primer probe combination of the present application has good specificity and high sensitivity, and realizes the interspecies detection of Aspergillus.

In this application, the detection probe and the complementary probe are not completely complementary paired, and the non-complementary base positions are not located within the 5 base sequence of the 5'end or 3'end of the detection primer, and the non-complementary positions cannot be continuous. Calculate the Tm values of the incompletely complementary detection probes and complementary probes according to the Tm value calculation formula of the nearest neighbor method. The formula is as follows: Tm=ΔH ^* /(ΔS ^* +RlnC _T ), where ΔH ^* and ΔS ^* are the standard enthalpy change and entropy change of the hybridization reaction, respectively, R is the gas constant 1.987 cal/kmol, and C _T is the mole of DNA molecule The concentration (when the DNA molecule is an asymmetric sequence, its molar concentration is taken as CT/4) respectively, using this formula to design the designed detection probe and complementary probe Tm value probe, and then design a series of A combination of complementary probes and detection probes clearly distinguished by Tm values, so that different Aspergillus species can be distinguished by different Tm values in the same fluorescence channel.

In one embodiment, the nucleotide sequence of the specific primer of Aspergillus fumigatus is shown in SEQ ID NO.1-2, and the nucleotide sequence of the specific primer of Aspergillus flavus is shown in SEQ ID NO.3- As shown in 4, the nucleotide sequence of the specific primer of Aspergillus niger is shown in SEQ ID NO. 5-6, and the nucleotide sequence of the specific primer of Aspergillus terreus is shown in SEQ ID NO. 7-8 Shown.

Multiple pairs of primers and probes exist in the same reaction system to detect different target sequences. It is necessary to balance the stability, reaction conditions, and amplification efficiency among various sequences. As the number of detected bacteria increases, the combination of primers and probes The difficulty of design is significantly increased and is restricted by various conditions. In this application, specific primers are designed through multiple sequence alignments against Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, and Aspergillus terreus, so that multiple primers can stably exist in the same reaction In the system, and the amplification efficiency is consistent, the detection specificity and sensitivity are improved, and the cross effect between primers is avoided.

In one embodiment, the nucleotide sequence of the detection probe of Aspergillus fumigatus is shown in SEQ ID NO. 9, and the nucleotide sequence of the detection probe of Aspergillus flavus is shown in SEQ ID NO. 10. Aspergillus niger The nucleotide sequence of the detection probe is shown in SEQ ID NO.11, and the nucleotide sequence of the detection probe of Aspergillus terreus is shown in SEQ ID NO.12.

In this application, a large number of nucleic acid sequences on NCBI are aligned through ClustaX, and the range of comparison bacteria includes: the range of comparison bacteria includes Aspergillus fumigatus AJ853744.1, AB197939.1, LC228654.1, LC171332.1, LN832990.1, etc. 264 sequences; Aspergillus flavus AJ853764.1, LT594458.1, LC133097.1, LC133096.1, LN832989.1 and 351 sequences; Aspergillus niger AJ853742.1, AJ280006.1, LC133093.1, LN832991.1, LM653115. 168 sequences of 1st class; 160 sequences of Aspergillus terreus AB661667.1, FN645432.1, LN832993.1, HG964331.1, LC317459.1, etc. By aligning the above 943 sequences, the highest degree of high conservation within the Aspergillus species can be obtained To obtain the highly conserved and variable regions of different clinical isolates, guide the design of primers and improve the sensitivity to different isolates of different strains. The selection of target sequences is crucial to the design of primer probe combinations. The stability between different primers and probes, the same amplification efficiency, detection specificity, sensitivity, and the consistency of reaction conditions must be met at the same time. The more Aspergillus species detected, the more factors need to be considered. At the same time, designing a combination of primers and probes for the detection of four Aspergillus species at the same time is not equivalent to the combination of primers and probes for a single species.

In this application, in the region of the four Aspergillus specific target sequences to be tested, preferably 18S rRNA and 28S rRNA sequence regions, four Taqman probes and four complementary sequences are designed and prepared respectively, and a pair is designed for the periphery of the detection probe sequence. Primer sequence, including one upstream primer and one downstream primer. Use the designed primers to perform single-plex or multiple single-color or multiple-multicolor real-time fluorescence quantitative PCR amplification reactions on specific targets.

In one embodiment, the nucleotide sequence of the complementary probe of Aspergillus fumigatus is shown in SEQ ID NO. 13, and the nucleotide sequence of the complementary probe of Aspergillus flavus is shown in SEQ ID NO. 14. Aspergillus niger The nucleotide sequence of the complementary probe is shown in SEQ ID NO.15, and the nucleotide sequence of the complementary probe of Aspergillus terreus is shown in SEQ ID NO.16.

In this application, a complementary probe is designed for the detection probes of four different Aspergillus species, and the complementary probe and the detection probe are not completely complementary paired to form a double-stranded probe, so that the double-stranded probe for different Aspergillus species The probe has different melting properties, and four different Aspergillus species can be distinguished by its characteristic melting temperature (Tm).

In one embodiment, the primer probe combination further includes an internal reference system.

In one embodiment, the internal reference system includes internal reference primers and internal reference probes.

In one embodiment, the nucleotide sequence of the internal reference primer is shown in SEQ ID NO. 17-18.

In one embodiment, the nucleotide sequence of the internal reference probe is shown in SEQ ID NO.19.

In one embodiment, the 3'end of the detection probe of Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus is modified with a quenching group, and the 5'end is modified with a fluorescent group.

In one embodiment, in one embodiment, the fluorophore includes ALEX-350, Alexa Fluor 488, CY3, FAM, VIC, TET, CALGold540, JOE, HEX, CALFluorOrange560, TAMRA, CALFluorRed590, ROX, CALFluorRed610, Any one or a combination of at least two of TexasRed, CALFluorRed635, Quasar670, CY5, CY5.5, LC RED640 or Quasar705.

In this application, the 5'ends of the detection probes for different Aspergillus species are all modified with fluorescent groups, which can be the same fluorescent group or different fluorescent groups. When modified with the same fluorescent group, The primer-probe combination designed in this application can be detected and analyzed in the same fluorescence detection channel. According to the melting temperature of the double-stranded probe formed by the detection probe and the complementary probe, it can be performed after the real-time fluorescence quantitative PCR amplification reaction. Melting curve analysis, according to the change of the melting point of the Taqman probe to determine whether there are one or more of the four pathogenic Aspergillus in the sample to be tested and identify the Aspergillus in the sample to be tested through the Tm value-strain standard comparison table Species, that is, multiple single-color real-time fluorescent quantitative PCR reactions; when modified with different fluorophores, multiple multi-color real-time fluorescent quantitative PCR reactions can also be performed; in addition, a single use for detection of one of the four Aspergillus species It is also feasible, namely single-color real-time fluorescence quantitative PCR reaction.

In one embodiment, the quenching group modified at the 3'end of the detection probe includes any one or a combination of at least two of TAMRA, DABCYL, BHQ-1, BHQ-2, BHQ-3 or Eclipse.

For different Aspergillus species, the fluorophore and quenching group used can be the same or different, but different fluorophores require different fluorescence detection channels, and different fluorophores are selected The excitation light and absorption light spectrum range need to avoid interference. In one embodiment, the probe-modified fluorophore and quencher group for detecting different Aspergillus species belong to the same group.

The combination of the fluorescent group and the quenching group can be, typically, but not limited to, the fluorescent group FAM and the quenching group TAMRA; the fluorescent group HEX quenching group BHQ-1; the fluorescent group ROX and the quenching group BHQ-2; the fluorescent group CY5 and the quenching group BHQ-3, preferably the fluorescent group FAM and the quenching group TAMRA.

In one embodiment, the 3'end of the complementary probe is modified with a quenching group.

In one embodiment, the quenching group modified at the 3'end of the complementary probe includes any one or a combination of at least two of TAMRA, DABCYL, BHQ-1, BHQ-2, BHQ-3 or Eclipse.

In one embodiment, the quencher group of the complementary probe and the detection probe are the same. The quenching group of the probe and the quenching group of the complementary sequence can also be different, but it needs to match the spectral band of the fluorescent group.

In this application, the 3'end of the complementary probe can be selectively modified with a quencher group. The detection probe is complementary to the target sequence. When the detection probe is designed, the 5'end is labeled with a fluorescent group, and the 3'end is labeled with a quenching group. The 3'end of the complementary probe can be designed to contain a quenching group or not designed to contain a quenching group. When the 3'end of the complementary probe does not have a quenching group, when the temperature increases, the fluorescence value decreases as the detection probe and the complementary probe melt. The reason for this phenomenon is that the linear single-stranded double-labeled oligonucleotide in the solution is randomly coiled: its two ends occasionally approach each other, causing the energy of the fluorescent group to be absorbed by the quenching group. However, when the detection probe and the complementary probe are combined, the labeled hybrid forces the two ends of the probe to separate, disrupting the interaction between the two end labels, thereby causing a change in the fluorescence value. If the complementary probe is labeled with a quenching group at the 3'end, the hybridization between the probes reduces the fluorescence value, and when the temperature is increased to denature the duplex, the fluorescence value increases. This is because the formation of the probe hybrid brings the quenching group and the fluorescent group close together, effectively quenching the fluorescent signal.

In the second aspect, the present application provides a kit for the detection of Aspergillus species, the kit comprising the primer probe combination as described in the first aspect.

In one embodiment, the kit further includes negative control, positive quality control and auxiliary reagents.

In one embodiment, the negative control is a plasmid containing an Arabidopsis DNA fragment, and the nucleotide sequence of the Arabidopsis DNA fragment is shown in SEQ ID NO.20.

In one embodiment, the positive quality controls are plasmids containing Aspergillus fumigatus DNA fragments, plasmids containing Aspergillus flavus DNA fragments, plasmids containing Aspergillus niger DNA fragments, and plasmids containing Aspergillus terreus DNA fragments.

In this application, both negative control and positive quality control use plasmid pMD19, which is commonly used in the art. It should be noted that any vector that satisfies the construction of negative control and positive quality control plasmids can be used to replace pMD19, and no special limitation is required here.

In one embodiment, the nucleotide sequences of the Aspergillus fumigatus DNA fragment, Aspergillus flavus DNA fragment, Aspergillus niger DNA fragment and Aspergillus terreus DNA fragment are as SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO. 23 and SEQ ID NO.24 are shown.

In one embodiment, the auxiliary reagents include Taq enzyme, dNTP, MgCl ₂ , DMSO and buffer.

In one embodiment, the buffer includes Tris-HCl and KCl.

In one embodiment, the concentration of Tris-HCl in the buffer is 15-20 mM, for example, it can be 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, or 20 mM.

In one embodiment, the concentration of the KCl in the buffer is 100-200mM, for example, it can be 100mM, 110mM, 120mM, 130mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM or 200mM.

In a fourth aspect, the present application provides a method for detecting Aspergillus species by using the kit as described in the second aspect, and the method includes the following steps:

(1) Extract sample DNA;

(2) Add Taq enzyme, dNTP, MgCl ₂ , DMSO, buffer, the primer probe combination as described in the first aspect to the sample DNA in step (1); and

(3) Real-time fluorescent PCR reaction.

In one embodiment, the final concentration of the DNA sample in step (2) is 0.1pg-10ng, for example, it can be 0.1pg, 0.5pg, 1pg, 2pg, 3pg, 4pg, 5pg, 10pg, 20pg, 30pg, 40pg, 50pg, 60pg, 70pg, 80pg, 90pg, 100pg, 200pg, 300pg, 400pg, 500pg, 600pg, 700pg, 800pg, 900pg, 1ng, 2ng, 3ng, 4ng, 5ng, 6ng, 7ng, 8ng, 9ng or 10ng.

In one embodiment, the final concentration of the Taq enzyme in step (2) is 0.5-5U, for example, it can be 0.5U, 0.8U, 1U, 1.2U, 1.5U, 1.8U, 2U, 2.5U, 3U, 3.5 U, 4U, 4.5U or 5U.

In one embodiment, the final concentration of the dNTP in step (2) is 0.1-5M, for example, it can be 0.1M, 0.3M, 0.5M, 0.8M, 1M, 1.2M, 1.5M, 1.8M, 2M, 2.5 M, 2.8M, 3M, 3.5M, 4M, 4.5M, 4.8M or 5M.

In one embodiment, the final concentration of the dNTP in step (2) is 0.1-5M, for example, it can be 0.1M, 0.3M, 0.5M, 0.8M, 1M, 1.2M, 1.5M, 1.8M, 2M, 2.5 M, 2.8M, 3M, 3.5M, 4M, 4.5M, 4.8M or 5M.

In one embodiment, the volume percentage of DMSO in step (2) is 1-8%, for example, it can be 1%, 2%, 3%, 4%, 5%, 6%, 7% or 8%, preferably Is 5%.

In one embodiment, the final concentration of the specific primers of the four Aspergillus species described in step (2) is 50-500nM, for example, it can be 50nM, 60nM, 70nM, 80nM, 90nM, 100nM, 120nM, 150nM, 180nM, 200nM , 250nM, 300nM, 350nM, 400nM, 450nM or 500nM.

In one embodiment, the final concentration of the four Aspergillus detection probes in step (2) is 50-500nM, for example, it can be 50nM, 60nM, 70nM, 80nM, 90nM, 100nM, 120nM, 150nM, 180nM, 200nM , 250nM, 300nM, 350nM, 400nM, 450nM or 500nM.

In one embodiment, the final concentration of the complementary probes of the four Aspergillus species described in step (2) is 50-500nM, for example, it can be 50nM, 60nM, 70nM, 80nM, 90nM, 100nM, 120nM, 150nM, 180nM, 200nM , 250nM, 300nM, 350nM, 400nM, 450nM or 500nM.

The final concentration of the specific primers for each Aspergillus in the PCR reaction system of this application is the same, according to the combination ratio of four pairs of primers 1:1:1:1, the final concentration range is the final concentration range of 50-500nM, The primer probe design of this application satisfies consistent amplification efficiency.

The final concentration of the detection probe for each Aspergillus in the PCR reaction system of this application is the same. According to the combination ratio of the four probes at 1:1:1:1, the final concentration range is the final concentration range of 50-500nM .

The final concentration of the complementary probes for each Aspergillus in the PCR reaction system of this application is the same. According to the 1:1:1:1 combination ratio of the four probes, the final concentration range is the final concentration range of 50-500 nM .

In one embodiment, the conditions of the real-time fluorescent PCR reaction in step (3) are:

(1’) 90-98℃ pre-denaturation, 1-10min, 1 cycle;

(2') Denaturation at 90-98°C for 10s, extension at 55-60°C for 35-45s, 40-50 cycles; and

(3') Heating at 35-97°C, 1 cycle.

In one embodiment, step (1') also includes a preheating process: 50°C, 2 min, 1 cycle.

In one embodiment, the real-time fluorescent PCR reaction in step (3) specifically includes the following steps:

(1”) Preheat at 50℃ for 2min, 1 cycle;

(2”) Pre-denaturation at 95°C for 10 minutes, 1 cycle;

(3”) Denaturation at 95°C for 10s, extension at 58°C for 40s, collecting fluorescence signal during extension, 45 cycles; and

(4") 95°C for 5s, 35°C for 1min; heating to 97°C, 0.2°C/s, continuous collection of fluorescence signal, 5 times/°C.

In one embodiment, after step (3), a judgment step is further included, and the judgment standard is:

(a) If the Ct value of the detection channel is not greater than 35, it is a positive result, and if the Ct value of the detection channel is greater than 35, it is a negative result;

(b) Further analysis of the positive results, through melting curve analysis, compare the corresponding annealing temperature Tm values of the product with the four positive quality controls. If the Tm value is the same, it is determined that the test sample contains the corresponding positive quality control Aspergillus species.

In a fourth aspect, this application provides a primer-probe combination as described in the first aspect and/or a kit as described in the second aspect for use in Aspergillus species detection or preparation of reagents for Aspergillus species detection application.

Compared with the prior art, this application has the following beneficial effects:

(1) The primer probe combination of the present application has high specificity and sensitivity, and can simultaneously detect Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus and distinguish specific bacterial species;

(2) The primers designed for Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus in this application not only meet the common amplification requirements, but also meet the consistency of amplification efficiency, make the detection system more stable, have good detection specificity, and avoid expansion. The difference in increasing efficiency leads to the mutual influence between bacterial species;

(3) The detection method of the present application has high sensitivity, and can quickly detect Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus in combination with a specific primer probe combination, and can simultaneously identify and distinguish different Aspergillus species in the same fluorescence detection channel. According to Taqman The change of the needle melting point can distinguish the specific target sequence of various Aspergillus species in the same fluorescence channel;

(4) Oligonucleotide probe melting curve analysis can be carried out directly after real-time fluorescent PCR amplification reaction, without opening the tube, or it can be transferred to real-time fluorescent PCR instrument for analysis after ordinary PCR amplification;

(5) Oligonucleotide probe melting curve analysis is a non-consumable test. After the analysis, the sample remains in the state after PCR, and the analysis can be repeated multiple times.

Description of the drawings

Figure 1 shows the melting curves of the detected products using plasmids containing DNA fragments of Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus respectively as templates;

2 is the amplification curve corresponding to the standard plasmid containing the DNA fragment of Aspergillus fumigatus at different concentrations in Example 4;

3 is the melting curve corresponding to the standard plasmid containing the Aspergillus fumigatus DNA fragment in different concentrations in Example 4;

4 is a graph showing the amplification curve of the Aspergillus fumigatus DNA with different concentration gradients in Example 5;

Fig. 5 is a graph showing the linear relationship between different concentrations of Aspergillus fumigatus DNA and Ct value in Example 5.

Detailed ways

In order to further illustrate the technical means adopted by the application and its effects, the technical solutions of the application will be further described through specific implementations below, but the application is not limited to the scope of the embodiments.

Example 1 Assembly of the kit

The nucleotide sequences of specific primers, detection probes and complementary probes for Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus are shown in Table 1.

Table 1

Primer name	Number SEQ ID NO.	Nucleotide sequence 5’-3’
Aspergillus fumigatus upstream primer	1	GTCGTTTACGAGCAGCCTTC
Aspergillus fumigatus downstream primer	2	TTTGGCTTCCGTTCTATTGG
Aspergillus flavus upstream primer	3	GGAAACCGATTGCCTTCATA
Aspergillus flavus downstream primer	4	TGATGAACAGCACCAGAAGC
Aspergillus niger upstream primer	5	CCAGCTGGCATTCCCTTT
Aspergillus niger downstream primer	6	TTTTATCGGTTGGAGGCAAG
Aspergillus terreus upstream primer	7	CTAAGGATTCCAGGGGAAGG
Aspergillus terreus downstream primer	8	TGGTGGCACAGAACTAAGCA
Aspergillus fumigatus detection probe	9	AAACGCTTATTTTGCTAGTGGCCA
Aspergillus flavus detection probe	10	ATACTCCGCCTTTCTTTCAAGCAAA
Aspergillus niger detection probe	11	TTTATACTCCGCCTTTCTTTCAAGCAA
Aspergillus terreus detection probe	12	TCACAGTAATGATCCTTCCGCAG
Aspergillus fumigatus complementary probe	13	TTTGCGAATAAAACGATCATCGG
Aspergillus flavus complementary probe	14	TATGACGCGCAATGAAAGTTCGTTT
Aspergillus niger complementary probe	15	AATTATGAGGCGGACAGTAAGTTAGTT
Aspergillus terreus complementary probe	16	AGTGTCATTACTAGGAAGGCGTC
Internal reference primer upstream primer	17	CTGTGAATGCCATTTCTC
Internal reference primer downstream primer	18	ACACCTCCTTTGGAATAG
Internal reference probe	19	CCTAACCTACCCGCCTTGGATATT

Negative control: The negative control is a plasmid containing an Arabidopsis DNA fragment. The nucleotide sequence of the Arabidopsis DNA fragment is shown in SEQ ID NO. 20, and the specific sequence is as follows:

Positive quality control products: plasmids containing Aspergillus fumigatus DNA fragments, plasmids containing Aspergillus flavus DNA fragments, plasmids containing Aspergillus niger DNA fragments and plasmids containing Aspergillus terreus DNA fragments.

The nucleotide sequence of the Aspergillus fumigatus DNA fragment is shown in SEQ ID NO. 21, and the details are as follows:

The nucleotide sequence of the Aspergillus flavus DNA fragment is shown in SEQ ID NO.22, and the details are as follows:

The nucleotide sequence of the Aspergillus niger DNA fragment is shown in SEQ ID NO.23, and the details are as follows:

The nucleotide sequence of the Aspergillus terreus DNA fragment is shown in SEQ ID NO. 24, and the details are as follows:

Auxiliary reagents: Taq enzyme, dNTP, MgCl ₂ , DMSO and buffer.

The centrifuge tube containing the above-mentioned components and instructions are loaded into the kit.

Example 2 Species detection of Aspergillus

Using the kit in Example 1 to detect Aspergillus species, including the following steps:

(1) Extract sample DNA;

(2) Add Taq enzyme, dNTP, MgCl ₂ , DMSO, buffer, specific primers for four Aspergillus species, detection probes and complementary probes to the sample DNA in step (1), and prepare the system according to Table 2;

Table 2

Component	dose
TaqPolymerase	2U
dNTP	2M
Primers	200nM
Probes	100nM
MgCl 2	3mM
Template	1μL
DMSO	5%
Total	25μL

(3) Put the system of step (2) into a real-time fluorescent PCR machine to perform PCR amplification reaction. The specific conditions are as follows:

(1”) Preheat at 50℃ for 2min, 1 cycle;

(2”) Pre-denaturation at 95°C for 10 minutes, 1 cycle;

(3”) Denaturation at 95°C for 10s, extension at 58°C for 40s, fluorescence signal collection during extension, 45 cycles;

(4") 95°C for 5s, 35°C for 1min; heating to 97°C, 0.2°C/s, continuous collection of fluorescence signal, 5 times/°C.

The detection fluorescence channel of step (4") is FAM, run the PCR reaction program, and save the file;

(4) Result judgment:

1) Judgment of the validity of the kit:

The negative control group is effective: the negative control group has no typical amplification curve or no Ct value under the FAM channel, otherwise there may be reagent contamination, please remove the source of contamination and retest;

The positive quality control group is valid: the positive quality control group has a typical amplification curve under the FAM channel. After confirming that it is correct, adjust the Ct value of the positive quality control to 20 by adjusting the threshold, and use this as the threshold of the sample to be tested;

2) Judgment of the validity of the test sample:

If the Ct value is present, it indicates that the amount of DNA added is normal;

3) Classification of Aspergillus:

After the PCR cycle amplification product, the melting temperature of the DNA sequence of different Aspergillus species is different, and the instrument is calibrated through the four plasmids of positive quality control. This application uses Roche 480 for detection to obtain Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, and Aspergillus terreus Corresponding product annealing temperature table (Table 3), it should be noted that any instrument that meets real-time fluorescent PCR is acceptable, and there is no need to make specific restrictions here. The purpose of calibration is to eliminate the specific annealing temperature difference caused by different instruments.

Table 3 Comparison table of annealing temperature Tm values of different Aspergillus species

Aspergillus species	Melting temperature (Tm value)℃
Aspergillus fumigatus	56
Aspergillus niger	48
Aspergillus flavus	41
Aspergillus terreus	62

It can be seen from Table 2 that the product Tm values of different Aspergillus species are quite different, all above 6°C, which is easy to distinguish, has good specificity and high sensitivity. It is not limited to the specific measurement value of the PCR instrument. There may be a slight deviation, but the Aspergillus species The Tm value is relatively stable. Through the detection of the positive quality control, a Tm value comparison table suitable for any machine can be obtained. The melting curve corresponding to the positive quality control is shown in Figure 1.

Example 3 Specific detection analysis

Separately extract Cryptococcus neoformans, Cryptococcus guttata, Aspergillus nidulans, Aspergillus versicolor, Saccharomyces cerevisiae, Penicillium marneffei, Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Candida krusei, The DNA of Candida Portugal, Candida jiyemeng, Bacillus pertussis, Haemophilus influenzae, Pseudomonas aeruginosa, Staphylococcus aureus and Streptococcus pneumoniae, using the kit of Example 1 of this application, and proceeding according to the method of Example 2. The results are shown in Table 4 below.

Table 4

Strain name	Detect Ct value	Detect Tm value
Cryptococcus neoformans	-	-
Cryptococcus gerte	-	-
Aspergillus nidulans	-	-
Aspergillus versicolor	-	-
Saccharomyces cerevisiae	-	-
Penicillium marneffei	-	-
Candida albicans	-	-
Candida parapsilosis	-	-
Candida tropicalis	-	-
Candida glabrata	-	-
Candida krusei	-	-
Candida Portugal	-	-
Candida jiyemeng	-	-
Bacillus pertussis	-	-
Haemophilus influenzae	-	-
Pseudomonas aeruginosa	-	-
Staphylococcus aureus	-	-
Streptococcus pneumoniae	-	-

Cryptococcus, Aspergillus and Candida are common clinical fungi of primer-invasive fungal diseases. The above-mentioned bacteria are common species that cause bacterial infections such as respiratory tract. It can be seen from Table 4 that the detection system of the present application does not produce an amplification reaction in the presence of nucleic acid of the above-mentioned fungi or bacteria, nor can it detect a specific melting curve and Tm value, indicating that the present application has good specificity .

Example 4 Sensitivity detection analysis

The melting curve method was used to detect the sensitivity of plasmid standards of four Aspergillus target sequences at different concentrations. The synthetic target sequence plasmid standards of Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus and Aspergillus niger (Shanghai Shenggong Synthesis) were used to dilute into ^{10 6 copies, 10 5 copies,} 10 4 copies, 10 3 copies, 10 2 copies, 10 1 copies, 10 0 copies. Using it as a template, using the kit in Example 1 and the method in Example 2, the Roche 480II fluorescent quantitative PCR instrument was used for detection, and melting curve analysis was performed. Taking Aspergillus fumigatus as an example, the amplification curves of different concentrations are shown in Figure 2. The curves 1-8 correspond to 10 ⁶ copies, 10 ⁵ copies, 10 ⁴ copies, 10 ³ copies, 10 ² copies, 10 ¹ copies, 10 ⁰ copies and negative control, the melting curve is shown in Figure 3.

From Figure 2 of the amplification curve, it can be seen that this application can give a good signal when the standard plasmid of 10 ⁶ copies-10 ² copies exists, and the standard of the plasmid of 10 ¹ copies-10 ⁰ copies exists. Under the circumstances, the fluorescent signal cannot be detected. In the absence of the target sequence, the application cannot detect the fluorescent signal. Figure 3 of the melting curve shows that in the presence of 10 ⁶ copies-10 ² copies plasmid standards, a unique and consistent melting point can be formed, forming a single peak in the figure; in the presence of 10 ¹ copies-10 ⁰ copies plasmid standards In the case of, a unique and consistent single peak cannot be formed, and in the absence of the target sequence, there is no single peak. Therefore, the melting curve method used in this application to detect the target sequence of Aspergillus fumigatus has a sensitivity of 10 ² copies.

Example 5 Quantitative analysis

Quantitative detection of four Aspergillus species: Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus and Aspergillus niger.

The four Aspergillus species that can be detected by this kit are evenly mixed at a concentration of 1ng/μl each, and a 10-fold serial dilution is performed to prepare a standard curve with 7 concentration points. Each concentration is performed in 3 replicate wells. The gene fragment of Arabidopsis thaliana was used as a negative control, the amplification curve is shown in Figure 4, and the linear relationship between Ct value and concentration is established in Figure 5.

It can be seen from Figure 5 that the standard curve forms a linear equation y=3.5521x+6.3457, R2=0.997 in the linear amplification region of the PCR reaction, the amplification efficiency of the kit is 91.2%, and its linear range is: 1ng/μl～0.000001ng/ μl. When measuring samples, the above-mentioned standard curve, negative control, and sample DNA of unknown concentration are used for fluorescent PCR reaction. When using Roche LightCycler 480II, ABI7500, StepOnePlus and other fluorescent quantitative PCR instruments, its built-in analysis software can be based on the standard curve and the Ct of the sample. Value, calculate the nucleic acid concentration of the target gene in the sample, and perform quantitative analysis.

Example 6 Stability Test

1) Using the auxiliary reagents in Example 1 and the specific primers, detection probes and complementary probes of Aspergillus fumigatus in accordance with the components and dosages in the following table constitute the stability detection kit-Fumigatus; using the auxiliary in Example 1 The reagents and specific primers, detection probes and complementary probes of Aspergillus flavus are composed of the components and dosages in the following table. Stability test kit-Aspergillus flavus; using the auxiliary reagents in Example 1 and specific primers of Aspergillus terreus, The detection probes and complementary probes compose the stability detection kit-Aspergillus terreus according to the components and dosages in the following table; use the auxiliary reagents in Example 1 and the specific primers, detection probes and complementary probes of Aspergillus niger according to the following The components and dosages in the table constitute the stability detection kit-Aspergillus niger, and the separate detection system for each bacteria is shown in Table 5;

table 5

Component	dose
TaqPolymerase	2U
dNTP	2M
Primer (1 pair)	200nM*2
Probe (1 piece)	100nM
MgCl 2	3mM
Template	1μL
DMSO	5%
Total	25μL

2) Extract the cultured Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus and Aspergillus niger DNA;

3) Use the method in Example 2 to compare the Ct value of the DNA of the above-mentioned bacterial species detected by the kit in Example 1 and the Ct value of the corresponding bacterial species in the four stability test kits in 1), namely Using the experimental method in Example 2 to compare the Ct value of the four Aspergillus DNA detection in Example 1 and the Ct value of the stability test kit for the four Aspergillus DNA detection results, and analyze and compare the standards of the two groups of results Difference and CV value, the results are shown in Table 6 below;

Table 6

	Aspergillus fumigatus	Aspergillus flavus	Aspergillus terreus	Aspergillus niger
Detection kit	24.34±0.05	22.43±0.06	21.26±0.04	25.12±0.05
Stability kit	24.35±0.03	22.44±0.08	21.25±0.05	25.13±0.04
STD	0.05	0.06	0.04	0.05
CV%	<3	<3	<3	<3

It can be seen from Table 6 that the complex primer and probe system designed in the detection kit has the same detection efficiency as the single system, and the detection performance is stable under the complex system.

The applicant declares that this application uses the above-mentioned embodiments to illustrate the detailed methods of this application, but this application is not limited to the above-mentioned detailed methods, which does not mean that this application must rely on the above-mentioned detailed methods to be implemented. Those skilled in the art should understand that any improvement to this application, the equivalent replacement of each raw material of the product of this application, the addition of auxiliary components, the selection of specific methods, etc., fall within the scope of protection and disclosure of this application.

Claims (15)

1. A primer probe combination for the detection of Aspergillus species, comprising specific primers, detection probes and complementary probes for Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus, wherein the complementary probe and the detection probe The needles are not perfectly complementary.
2. The primer-probe combination according to claim 1, wherein the nucleotide sequence of the specific primer of Aspergillus fumigatus is shown in SEQ ID NO.1-2, and the nucleotide sequence of the specific primer of Aspergillus flavus As shown in SEQ ID NO.3-4, the nucleotide sequence of the specific primer of Aspergillus niger is as shown in SEQ ID NO.5-6, and the nucleotide sequence of the specific primer of Aspergillus terreus is as shown in SEQ ID NO. 7-8;

   The nucleotide sequence of the detection probe of Aspergillus fumigatus is shown in SEQ ID NO.9, the nucleotide sequence of the detection probe of Aspergillus flavus is shown in SEQ ID NO.10, and the nucleotide sequence of the detection probe of Aspergillus niger The nucleotide sequence is shown in SEQ ID NO.11, and the nucleotide sequence of the detection probe of Aspergillus terreus is shown in SEQ ID NO.12; and

   The nucleotide sequence of the complementary probe of Aspergillus fumigatus is shown in SEQ ID NO. 13, and the nucleotide sequence of the complementary probe of Aspergillus flavus is shown in SEQ ID NO. 14, and the nucleotide sequence of the complementary probe of Aspergillus niger The nucleotide sequence is shown in SEQ ID NO. 15, and the nucleotide sequence of the complementary probe of Aspergillus terreus is shown in SEQ ID NO. 16.
3. The primer-probe combination according to claim 1, wherein the primer-probe combination further comprises an internal reference system;

   The internal reference system includes internal reference primers and internal reference probes;

   The nucleotide sequence of the internal reference primer is shown in SEQ ID NO. 17-18;

   The nucleotide sequence of the internal reference probe is shown in SEQ ID NO.19.
4. The primer probe combination according to any one of claims 1 to 3, wherein the 3'end of the detection probes of Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus is modified with a quenching group, and 5' The end is modified with a fluorescent group.
5. The primer-probe combination according to claim 4, wherein the 3'end of the complementary probes of Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger and Aspergillus terreus is modified with a quenching group.
6. The primer-probe combination according to claim 4 or 5, wherein the fluorescent group includes ALEX-350, Alexa Fluor 488, CY3, FAM, VIC, TET, CALGold540, JOE, HEX, CALFluorOrange560, TAMRA, CALFluorRed590, ROX , CALFluorRed610, TexasRed, CALFluorRed635, Quasar670, CY5, CY5.5, LC RED640 or Quasar705 or any one or a combination of at least two;

   The quenching group includes any one or a combination of at least two of TAMRA, DABCYL, BHQ-1, BHQ-2, BHQ-3 or Eclipse.
7. A kit for the detection of Aspergillus species, which comprises the primer-probe combination according to any one of claims 1 to 6.
8. The kit according to claim 7, wherein the kit further comprises negative control, positive quality control and auxiliary reagents.
9. The kit according to claim 8, wherein the negative control is a plasmid containing an Arabidopsis DNA fragment, and the nucleotide sequence of the Arabidopsis DNA fragment is shown in SEQ ID NO.20;

   The positive quality controls are plasmids containing Aspergillus fumigatus DNA fragments, plasmids containing Aspergillus flavus DNA fragments, plasmids containing Aspergillus niger DNA fragments, and plasmids containing Aspergillus terreus DNA fragments; wherein the Aspergillus fumigatus DNA fragments, Aspergillus flavus DNA fragments The nucleotide sequences of the fragment, the Aspergillus niger DNA fragment and the Aspergillus terreus DNA fragment are shown in SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23 and SEQ ID NO. 24, respectively;

   The auxiliary reagent includes Taq enzyme, dNTP, MgCl ₂ , DMSO and buffer; the buffer includes Tris-HCl and KCl; the concentration of Tris-HCl in the buffer is 15-20 mM; the KCl is in the buffer The concentration in the solution is 100-200mM.
10. A method for detecting Aspergillus species by using the kit according to any one of claims 7 to 9, which comprises the following steps:

    (1) Extract sample DNA;

    (2) Add Taq enzyme, dNTP, MgCl ₂ , DMSO, buffer and the primer probe combination according to any one of claims 1 to 6 to the sample DNA in step (1); and

    (3) Real-time fluorescent PCR reaction.
11. The method according to claim 10, wherein the final concentration of the DNA sample in step (2) is 0.1pg-10ng;

    The final concentration of the Taq enzyme in step (2) is 0.5-5U;

    The final concentration of the dNTP in step (2) is 0.1-5M;

    The volume percentage of DMSO in step (2) is 1-8%, preferably 5%;

    Step (2) The final concentration of the specific primers of the four Aspergillus species is 50-500nM;

    Step (2) The final concentration of the four Aspergillus detection probes is 50-500 nM; and

    The final concentration of the complementary probes of the four Aspergillus species in step (2) is 50-500 nM.
12. The method according to claim 10 or 11, wherein the conditions of the real-time fluorescent PCR reaction in step (3) are:

    (1’) 90-98℃ pre-denaturation, 1-10min, 1 cycle;

    (2') Denaturation at 90-98°C for 10s, extension at 55-60°C for 35-45s, 40-50 cycles; and

    (3') Heating at 35-97°C, 1 cycle.
13. The method according to claim 10 or 11, wherein the real-time fluorescent PCR reaction in step (3) specifically includes the following steps:

    (1”) Preheat at 50℃ for 2min, 1 cycle;

    (2”) Pre-denaturation at 95°C for 10 minutes, 1 cycle;

    (3”) Denaturation at 95°C for 10s, extension at 58°C for 40s, collecting fluorescence signal during extension, 45 cycles; and

    (4") 95°C for 5s, 35°C for 1min; heating to 97°C, 0.2°C/s, continuous collection of fluorescence signal, 5 times/°C.
14. The method according to claim 10, wherein after step (3), a judgment step is further included, and the judgment standard is:

    (a) If the Ct value of the detection channel is not greater than 35, it is a positive result, and if the Ct value of the detection channel is greater than 35, it is a negative result;

    (b) Further analysis of the positive results, through melting curve analysis, compare the corresponding annealing temperature Tm values of the product with the four positive quality controls. If the Tm value is the same, it is determined that the test sample contains the corresponding positive quality control Aspergillus species.
15. A primer-probe combination according to any one of claims 1 to 6 and/or a kit according to any one of claims 7 to 9 for use in Aspergillus species detection or preparation of Aspergillus species Application of detection reagents.

Images