CN109811079A

CN109811079A - A kind of DPO primer pair, detection method, kit and its application of Aspergillus point kind detection

Info

Publication number: CN109811079A
Application number: CN201910263008.XA
Authority: CN
Inventors: 王志贤; 阎香言; 盛长忠; 周泽奇; 粟艳
Original assignee: Danner (tianjin) Biological Technology Co Ltd
Current assignee: Danner (tianjin) Biological Technology Co Ltd
Priority date: 2019-04-02
Filing date: 2019-04-02
Publication date: 2019-05-28

Abstract

The present invention provides DPO primer pair, detection method, kit and its applications of a kind of Aspergillus point kind detection, and the nucleotide sequence of the DPO primer pair is as shown in SEQ ID NO.1-2.DPO primer pair of the invention can be with specific amplification Eurotium, do not intersect with other common causative Pseudomonas such as candida albicans, Escherichia coli, staphylococcus aureus, furthermore, the design of DPO primer pair of the present invention is so that the product of different aspergillus strains has different annealing temperature, pass through the melting curve analysis of product, it can determine that it is which kind of in aspergillus fumigatus, aspergillus flavus, aspergillus niger or Aspergillus terreus, Multiple detection only can be realized with pair of primers, it is more easy to be economical compared with the prior art.

Description

A kind of DPO primer pair of Aspergillus point kind detection, detection method, kit and its Using

Technical field

The invention belongs to field of biotechnology, it is related to a kind of DPO primer pair, detection method, kit and its application, mainly It is related to DPO primer pair, detection method, kit and its application more particularly to a kind of Aspergillus of a kind of Aspergillus point kind detection DPO primer pair, detection method, kit and its an application for point kind of detection, and in particular to a kind of aspergillus fumigatus, aspergillus flavus, aspergillus niger, DPO primer pair, detection method, kit and its application of Aspergillus terreus point kind detection.

Background technique

Eurotium is widely present in living environment in conditioned pathogen, be can produce conidium and is entered with breathing Body mainly infects lung, skin or mucous membrane.Common pathogen has aspergillus fumigatus, aspergillus flavus, aspergillus niger, Aspergillus terreus etc..

It is main for the detection method of Aspergillus at present are as follows: (1) pathogen culture identify, take the sample in affected part do smear or Culture, the visible mycelia of smear or Aspergillus spore, culture are shown in that Aspergillus is grown, and Aspergillus is functions on common pollutant bacteria, must smear repeatedly Or culture, repeatedly positive and just have diagnostic value for same strain, cultivation cycle is long.(2) pathologic diagnosis takes damaged tissues Or lymph node biopsy, it is made a definite diagnosis according to fungal morphology, but this method is invasive inspection, patient acceptance is poor.(3) immunology is examined It looks into, galactomannans is the polysaccharide of the high degree of specificity and conservative in aspergillus cell wall, can be used as detection Aspergillus Molecular marker is detected by ELISA method, but this method sensitivity is not high, cannot distinguish between strain.(4) real-time fluorescence PCR method improves detection specificity by the combination of primer and probe, provides foundation for clinical diagnosis.Existing method detection cycle It is long, it is unfavorable for clinical diagnosis medication.Although there are many antifungal drugs, identical for the therapeutic scheme of various Aspergillus, It cannot achieve the accurate treatment for specified strain.

CN108070675A discloses primer combination of probe and quantitative fluorescent PCR reagent a kind of while that detect three kinds of aspergillus Box belongs to the external field of molecular detection of pathogenic microorganism.The invention provides one kind to detect three based on fluorescent PCR method simultaneously The primer combination of probe of kind aspergillus, the aspergillus includes aspergillus fumigatus, aspergillus flavus and aspergillus niger.But the invention can only detect sample In containing in aspergillus fumigatus, aspergillus flavus or aspergillus niger any one or combinations thereof, can not detect and determine specific strain, and this method The presence of Aspergillus terreus can not be diagnosed.

CN106755379A discloses a kind of fluorescence quantifying PCR method quantitative detection established based on dimer mutant primer Aspergillus and the synchronous method for carrying out Genotyping, the detection method include 1) extracting sample to be tested and 4 kinds of reference cultures in 4 In DNA；2) positive plasmid standard items are prepared；3) quantitative fluorescent PCR is run；4) data are analyzed.The invention also provides a kind of cigarette Aspergillus, black-koji mould, Aspergillus flavus quantitative and Genotyping detection kit synchronous with aspergillus terreus, the kit include It is marked with the upstream primer of fluorescent reporter group, the upstream primer complementary strand and downstream primer of quenching group label.But the invention Design of primers have fluorophor, influence the amplification of quantitative fluorescent PCR；Secondly, the product melting curve temperature is excessively high, Aspergillus Inter-species annealing temperature difference it is too small, the sensitivity and specificity of Aspergillus Classification Identification are not high；Finally, only passing through general primer No probe cooperation, and complementary primer is also devised with mutational site, causes to expand nonspecific products, method specificity is bad.

CN101038254A discloses a kind of gene in section kit specific amplification Aspergillus ITS I, primer size For 79bp, can rapidly and accurately detect common a variety of pathogenic Aspergillus (such as aspergillus fumigatus, aspergillus flavus, Aspergillus terreus, aspergillus niger and Aspergillus nidulans).But the invention can not detect the interspecific difference of Aspergillus.

CN102321738A discloses a kind of fluorescence quantitative PCR detection universal primer of Aspergillus, detection probe and detection Kit identifies aspergillus fumigatus, aspergillus flavus, Aspergillus terreus and aspergillus niger by a pair of of universal primer and 4 specific probes.Although The interspecific difference of Aspergillus can be detected, but this method needs to design 4 probes of synthesis, cost is high.

Therefore it provides a species specificity is good, high sensitivity, can distinguish aspergillus strain and low cost short-cut method have weight Want meaning.

Summary of the invention

In view of the deficiencies of the prior art and actual demand, the present invention provide a kind of DPO primer of Aspergillus point kind detection To, detection method, kit and its application, effectively differentiation aspergillus fumigatus, aspergillus flavus, aspergillus niger and Aspergillus terreus, and this method is special Property good, high sensitivity, the strain information of Aspergillus contained by sample to be tested is judged using melting curve, high-efficient simple, precisely to control It treats and medication lays the foundation.

To achieve this purpose, the present invention adopts the following technical scheme:

In a first aspect, the present invention provides a kind of DPO primer pair of Aspergillus point kind detection, the nucleosides of the DPO primer pair Acid sequence is specific as follows shown as shown in SEQ ID NO.1-2:

DPO upstream primer sequence (SEQ ID NO.1):

5'-ACAAGGTTTCCGTAGGTGIIIIIICGGAAGGAT-3'；

DPO downstream primer sequence (SEQ ID NO.2):

5’-CATTTCGCTGCGTTCTTCIIIIIIGCGAGAACC-3’.

DPO (Dual priming oligonucleotide) primer is a kind of double startup Oligonucleolide primers, including two A independent specific primer region, this two sections of independent specific regions are carried out by oligomerization hypoxanthine (Inosine, I) Connection, in annealing, oligomerization hypoxanthine forms the structure of similar blister, and 5 ' and 3 ' regions is made to form the double of two standalone features Specific primer structure.

The present invention provides a kind of aggressive aspergillus DPO primer detection method based on melting curve analysis, using ClustaX Compare NCBI on a large amount of nucleic acid sequences, the strain range of comparison include aspergillus fumigatus AJ853744.1, AB197939.1, 264 sequences such as LC228654.1, LC171332.1, LN832990.1；Aspergillus flavus AJ853764.1, LT594458.1, 351 sequences such as LC133097.1, LC133096.1, LN832989.1；Aspergillus niger AJ853742.1, AJ280006.1, 168 sequences such as LC133093.1, LN832991.1, LM653115.1；Aspergillus terreus AB661667.1, FN645432.1, 160 sequences such as LN832993.1, HG964331.1, LC317459.1 can be with maximum journey by comparing above-mentioned 943 sequences Degree obtains high conserved region in aspergillus strain, obtains the high conserved region and variable region of different clinical separation strains, and then primer is instructed to set Position is counted, the sensibility to the different separation strains of different strain is improved；On the other hand, by the sequence alignment between different strain, The high saltation zone between different strain and high conserved region can be specified, the specificity of DPO primer pair difference aspergillus strain is improved.Pass through Predict that aspergillus fumigatus, aspergillus niger, aspergillus flavus and Aspergillus terreus highly conserved sequence as specific target sequence, utilize the interspecific difference in the area ITS1 Different carry out design of primers realizes the aspergillus Multiple detection common for four kinds using the melting curve analysis of target product.Through than To discovery, there are still individual mutational sites for the conserved sequence of the Aspergillus of different inter-species, evade height guarantor by designing DPO primer Keep individual mutational sites in sequence.The present invention significantly improves detection specificity by the design of DPO primer pair, while only with one Multiple detection can be realized to primer, it is more easy to be economical compared with the prior art.

Specific design of primers includes the following steps:

(1) Multiple sequence alignments determine the high conserved region of target sequence

There is semi-conservative area in 18S rRNA580-730bp section through comparing discovery Aspergillus, remaining is high conserved region, sequence Column comparison result schematic diagram is shown in Fig. 1；

(2) DPO primer is designed

Using the region 18s rRNA-ITS1-5.8s rRNA-28s rRNA, 18s, 5.8s, 28s rRNA mutation are few, and The region ITS1 and ITS2 inter-species is mutated more feature.Design primer is gone across ITS on 18s, the region 5.8s, 28s rRNA, is made Primer is located at and is mutated few 18s, the area 5.8s, 28s rRNA, with guarantee different aspergillus it is normal expand and efficiency, and the area ITS The mutation in domain and difference allow different aspergillus kinds to be able to analyze and determine by melting curve analysis, and DPO design of primers is shown Intention is shown in Fig. 2, and wherein the mutable site of deoxyinosine across target sequence is as shown in Figure 3 in DPO primer.In figure in red frame For the design section of DPO primer of the present invention, sequence top has the expression of * conservative, so there is a variable sequence in this section of sequence.

In the present invention, needed for the versatility for guaranteeing design of primers in conserved sequence in conjunction with software prediction and artificial prediction Area's design primer, so that the primer sequence of design can be with efficiently and accurately in the aspergillus strain in most clinical samples Amplification.But in individual mutational sites that the conserved region of design primer occurs, the general primer of design is difficult to avoid the mutation Site is introduced into primer, will lead to the primer to can not be expanded there are the clinical separation strain in the mutational site (or amplification Efficiency is greatly reduced) the case where occur, and by Multiple Alignment Analysis, find out mutational site and using DPO primer across the position When point, such case can be substantially improved, improves the amplification efficiency of primer system and the sensibility of a whole set of detection architecture.

Second aspect, the present invention provide the DPO primer pair of one kind as described in relation to the first aspect in preparation Aspergillus point kind detection Product in application.

The third aspect, the present invention provide a kind of kit of Aspergillus point kind detection, and the kit includes such as first party DPO primer pair described in face.

Preferably, the negative Quality Control is the plasmid containing arabidopsis DNA fragmentation, the nucleosides of the arabidopsis DNA fragmentation Acid sequence is specific as follows as shown in SEQ ID NO.3:

CATGATTCAGCCAACATAACCCGACCCGTACAATTCTATTACGCGTCTCCGGCGACTGACTATACTTG CCGTTCGGAGTTAGGGTTTTACTCCGAGAGAAAATTGAGTCAGCGATGAATCCGTTGACAAGGTGAAGAAGACGCA GAGCATTAACGCGAAAGAATTAGATCTAGGGATTTACGACGAAGCATCTTGGCACGCCAAGTACAAAGATTCAGCC TACGTTTACGTCGGAGAATTACCTTACGATCTCACGGAGGGTGACCTCCTCGCCGTTTTCTCACAATATGGTGAAG TTGTTGATTTGAATCTTGTTCGAGATAAAGGAACTGGGAGATCAAAAAGATTTGCGTTTGTTGCTTATGAAGATCA GAGAAGTACTAATCTTGCTGTTGGATAATAAAAGTGGAGCATTGTGGTAAATACTTAAAGAGAGAAGAGGAAGATG AAGAGACGAAGCAGAAGAAGAGAGAAGCTCCGTGGTGTTTGCAGAGCTTTTCAGAGAAAGGAGTGTACTCGTGGAG ATTCTTGCAAATTTTCTCACGATGAAAATAGAGCTGCCAATACCGGGTGGGGTCACGAAGATCGTAGAAGTTCCAA GTGAGAGATCAAGTAAGTAAATACCATAATGATGTAGAGGATAAATAGGGATTGTTCATATTGATATCCAAGTGGT AATGCTCTACATTGAAGAATGGTTTCTAAGTTGTAGCTAGAATCTAATGGAAAATGTGATTTATTGACCATTAGCT TACACACCGGTGTTTTGCTCTGTATATGTCGATCTTATTTTCAGTGTTCACCTTTAC.

Preferably, the positive quality control is respectively the plasmid containing aspergillus fumigatus DNA fragmentation, contains aspergillus niger DNA fragmentation Plasmid, the plasmid containing flavus dna segment and the plasmid containing Aspergillus terreus DNA fragmentation.

Preferably, the aspergillus fumigatus DNA fragmentation, aspergillus niger DNA fragmentation, flavus dna segment and Aspergillus terreus DNA fragmentation Nucleotide sequence is respectively as shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7.

In the present invention, negative Quality Control and positive quality control are all made of plasmid pMD19 commonly used in the art, it should be noted that The carrier of any satisfaction feminine gender Quality Control and positive quality control plasmid construction is used equally for replacement pMD19, is not necessarily to particular determination herein.

The nucleotide sequence of aspergillus fumigatus DNA fragmentation is specific as follows as shown in SEQ ID NO.4:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAG CTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTA AGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCTGCGTCCGTGTGAAGCTCCT TCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAG ACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGT TGAAAGGGAAGCGTTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGC GGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTATCACCTCTCGGGGTGTCTTATAGCCGAGGG TGCAATGCGGCCTGCCTGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAATGAC.

The nucleotide sequence of aspergillus niger DNA fragmentation is specific as follows as shown in SEQ ID NO.5:

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAG CTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTA AGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCT TCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAG ACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGT TGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGC GGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGG TGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC.

The nucleotide sequence of flavus dna segment is specific as follows as shown in SEQ ID NO.6:

AAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCC TTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCA GAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGG AATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGT GATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACC AGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGG CCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACC GAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC.

The nucleotide sequence of Aspergillus terreus DNA fragmentation is specific as follows as shown in SEQ ID NO.7:

ATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGC ATTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGA ATCCCGTATGGGGCGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTA AATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATG AAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGC GGGGTTCAGCCGGGCTTCGGCCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGC CTCCGGAATGTAGCGCCCTTCGGGGCGCCTTATAGCCGGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCT TCGGCACGGACGCTGGCA.

Preferably, the auxiliary reagent includes Taq enzyme, dNTP, MgCl₂, DMSO, buffer and SYBR Green I dye Material.

Preferably, the buffer includes Tris-HCl and KCl.

Preferably, concentration of the Tris-HCl in buffer be 15-20mM, such as can be 15mM, 16mM, 17mM, 18mM, 19mM or 20mM.

Preferably, concentration of the KCl in buffer be 100-200mM, such as can be 100mM, 110mM, 120mM, 130mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM or 200mM.

Fourth aspect, the present invention provides a kind of method of Aspergillus point kind detection, including using DPO described in first aspect The step of kit described in primer pair, the third aspect.

Preferably, described method includes following steps:

(1) it is added respectively using four kinds of plasmids of the DNA of sample to be tested, the plasmid of negative Quality Control and positive quality control as template DPO primer pair, Taq enzyme, dNTP, MgCl described in claim 1₂, DMSO and SYBR Green I dyestuff, carry out real-time fluorescence PCR reaction；

(2) by whether there is Aspergillus in the amplification curve and melting curve analysis judgement sample of product and determine aspergillus Bacterium strain.

Preferably, the final concentration of 0.5-5U of step (1) described Taq enzyme, for example, can be 0.5U, 0.8U, 1U, 1.2U, 1.5U, 1.8U, 2U, 2.5U, 3U, 3.5U, 4U, 4.5U or 5U.

Preferably, the final concentration of 0.1-5M of step (1) described dNTP, for example, can be 0.1M, 0.3M, 0.5M, 0.8M, 1M, 1.2M, 1.5M, 1.8M, 2M, 2.5M, 2.8M, 3M, 3.5M, 4M, 4.5M, 4.8M or 5M.

Preferably, the final concentration of 50-500nM of step (1) the DPO primer pair, for example, can be 50nM, 60nM, 70nM, 80nM, 90nM, 100nM, 120nM, 150nM, 180nM, 200nM, 250nM, 300nM, 350nM, 400nM, 450nM or 500nM。

Preferably, step (1) MgCl₂Final concentration of 0.8-10nM, such as can be 0.8nM, 1nM, 1.2nM, 1.5nM、1.8nM、2nM、2.5nM、3nM、3.5nM、4nM、4.5nM、5nM、5.5nM、6nM、6.5nM、7nM、7.5nM、8nM、 8.5nM, 9nM, 9.5nM or 10nM.

Preferably, the final concentration of 0.1pg-10ng of step (1) described template, for example, can be 0.1pg, 0.5pg, 1pg, 2pg、3pg、4pg、5pg、10pg、20pg、30pg、40pg、50pg、60pg、70pg、80pg、90pg、100pg、200pg、 300pg、400pg、500pg、600pg、700pg、800pg、900pg、1ng、2ng、3ng、4ng、5ng、6ng、7ng、8ng、9ng Or 10ng, preferably 0.5-1ng.

Preferably, the mass percent of step (1) described DMSO is 1-15%, for example, can be 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14% or 15%.

Preferably, the final concentration of 0.5-2 of step (1) the SYBR Green I dyestuff ×.

In the present invention, the additive amount of dyestuff be 0.5-2 ×, those skilled in the art should know and grasp according to dyestuff Working concentration needed for cycles of concentration is adjusted to system, such as fluorescent dye are generally the SYBR Green I dye of Sigma 10000 ×, for 10000 times of concentrates of DMSO dissolution, when use, needs to be diluted to working concentration.Such as final concentration of 1 ×, it needs The concentrate of storage is diluted 1000 times, 2.5 μ L is taken to be added in system (25 μ L system).

Preferably, step (1) the real-time fluorescence PCR reaction includes the following steps:

(1 ') 90-98 DEG C of initial denaturation, 1-2min, 1 circulation；

(2 ') 90-98 DEG C of denaturation 10s, 55-60 DEG C of extension 35-45s, 40-50 recycles；

(3 ') 65-97 DEG C of heating, 1 circulation.

It preferably, further include the process of preheating before step (1 '): 50 DEG C, 2min, 1 circulations.

In the present invention, by the enzyme system in preheating activating reaction system, reaction efficiency is improved.

Preferably, step (1) the real-time fluorescence PCR reaction specifically comprises the following steps:

(1 ") 50 DEG C of preheating 2min, 1 circulation；

(2 ") 95 DEG C of initial denaturation 10min, 1 circulation；

95 DEG C of (3 ") denaturation 10s, 58 DEG C of extension 40s, when extension, acquire fluorescence signal, 45 circulations；

(4 ") 95 DEG C of 5s, 65 DEG C of 1min；It is warming up to 97 DEG C, 0.2 DEG C/s, continuous acquisition fluorescence signal, 5 times/DEG C.

In the present invention, the DPO primer pair designed by specific primer design principle cooperates PCR of the present invention to react System and reaction condition, can significantly improve aspergillus strain point kind detection specificity, not with other common strain such as large intestines Bacillus, candida albicans or staphylococcus aureus are intersected, while the high sensitivity detected.In the prior art, different to realize A point kind for strain needs to cooperate a variety of probes, not only increases economic cost, while increasing the complexity in detection architecture, system Stability decline, and a variety of probes need multiple fluorescence channels to be analyzed, and the present invention is only by a pair of of DPO primer pair It may be implemented in point kind of the identification in same fluorescence channel to four kinds of common aspergillus strains, method simple and effective.

Preferably, the standard of step (2) described judgement are as follows:

If (a) the Ct value of sense channel is not more than 35, for positive findings, if the Ct value of sense channel is greater than 35, for Negative findings；

(b) positive findings are further analyzed, by melting curve analysis, it is corresponding with four kinds of positive quality controls compares product Annealing temperature Tm value, the identical aspergillus strain for determining sample to be tested and containing corresponding positive quality control of Tm value.

5th aspect, the present invention provide a kind of use that the kit as described in the third aspect is detected for Aspergillus point kind On the way.

Compared with prior art, the invention has the following beneficial effects:

(1) DPO primer pair of the invention can with specific amplification Eurotium, not with other common causative Pseudomonas such as beads Bacterium, Escherichia coli, staphylococcus aureus are intersected, in addition, the design of DPO primer pair of the present invention is so that different aspergillus strains Product have different annealing temperature by the melting curve analysis of product can determine that it is aspergillus fumigatus, aspergillus flavus, aspergillus niger Or which kind of in Aspergillus terreus；

(2) in the present invention, melting curve analysis method can directly carry out after real-time fluorescent PCR amplification reaction, without opening Pipe operation can also be transferred to real-time fluorescence PCR instrument and analyzed after regular-PCR amplification, and melting curve analysis belong to it is non- Expendable detection, after analysis, sample keeps the state after PCR, and analysis can be repeated several times；

(3) in the present invention, a variety of aspergillus strains can be analyzed and be detected to melting curve method simultaneously in same fluorescence channel, Changed according to the Tm value of amplified production, the specific target sequence of a variety of aspergillus strains can be distinguished in same fluorescence channel；

(4) DPO design of primers specificity of the invention is high, and 50-65 DEG C of annealing region, the reaction temperature of whole system It is easily adjusted.

Detailed description of the invention

Fig. 1 is that the 18s rRNA-ITS1-5.8s rRNA-ITS2-28s rRNA multiple sequence of different aspergillus strains compares Result schematic diagram；

Fig. 2 is DPO design of primers schematic diagram, and wherein pf1 is DPO upstream primer, and pr1 is DPO downstream primer；

Fig. 3 is the mutable site in Eurotium target sequence；There is * to represent comparison result above each column sequence consistent, position Point is conservative, and no * indicates that comparison result is inconsistent, and site has mutation；

Fig. 4 is to detect the melting curve of product using the plasmid containing aspergillus fumigatus DNA fragmentation as template；

Fig. 5 is to detect the melting curve of product using the plasmid containing aspergillus niger DNA fragmentation as template；

Fig. 6 is to detect the melting curve of product using the plasmid containing flavus dna segment as template；

Fig. 7 is to detect the melting curve of product using the plasmid containing Aspergillus terreus DNA fragmentation as template；

Fig. 8 is the amplification curve of sample to be tested in embodiment 2；

Fig. 9 is the melting curve of sample to be tested in embodiment 2；

Figure 10 is various concentration plasmid standard and the amplification curve of blank control in embodiment 4, wherein curve 1-7 points Not corresponding plasmid copy number is 10⁶copies、10⁵copies、10⁴copies、10³copies、102copies、10¹copies With 10⁰Copies, 8 be the blank control without target sequence；

Figure 11 is various concentration plasmid standard and the melting curve of blank control in embodiment 4；

Figure 12 is the positive criteria plasmid of various concentration and the amplification curve of negative control in embodiment 5；

Figure 13 is the linear relationship chart of Ct value and target sequence concentration in embodiment 5；

Figure 14 expands the amplification curve of same concentration sample for DPO primer of the present invention in comparative example 1 and general primer respectively, Wherein curve 1 is DPO primer system of the present invention, and curve 2 is general primer system；

Figure 15 expands the melting curve of same concentration sample for DPO primer of the present invention in comparative example 1 and general primer respectively, Wherein curve 1 is DPO primer system of the present invention, and curve 2 is general primer system.

Specific embodiment

Further to illustrate technological means and its effect adopted by the present invention, below by way of specific embodiment come into One step illustrates technical solution of the present invention, but the present invention is not limited in scope of embodiments.

Material and instrument

Roche LightCycler 480II fluorescent quantitative PCR detector；

Big dragon constant temperature oscillation metal bath HM100-Pro；

Big dragon high speed freezing centrifuge D3204R；

Eppendorf pipettor.

The material used in following embodiment be not limited to it is above-mentioned enumerate, can be substituted with other same type of material, instrument is not specified Actual conditions, according to normal conditions, or according to the normal condition proposed by manufacturer, those skilled in the art should grasp use The relevant knowledge of conventional material and instrument.

The assembling of 1 kit of embodiment

The nucleotide sequence of DPO primer is as shown in SEQ ID NO.1-2:

DPO upstream primer sequence (SEQ ID NO.1):

5'-ACAAGGTTTCCGTAGGTGIIIIIICGGAAGGAT-3'；

DPO downstream primer sequence (SEQ ID NO.2):

5’-CATTTCGCTGCGTTCTTCIIIIIIGCGAGAACC-3’.

Negative quality-control product: the feminine gender Quality Control is the plasmid containing arabidopsis DNA fragmentation, the arabidopsis DNA fragmentation For nucleotide sequence as shown in SEQ ID NO.3, particular sequence is as follows:

Positive quality control product: the plasmid containing aspergillus fumigatus DNA fragmentation, the plasmid containing aspergillus niger DNA fragmentation contain aspergillus flavus The plasmid of DNA fragmentation and plasmid containing Aspergillus terreus DNA fragmentation.

Wherein, the nucleotide sequence of aspergillus fumigatus DNA fragmentation is specific as follows as shown in SEQ ID NO.4:

Auxiliary reagent: Taq enzyme, dNTP, MgCl₂, DMSO and SYBR Green I dyestuff.

The centrifuge tube that said components are housed and specification etc. are fitted into kit.

2 Aspergillus of embodiment point kind detection

Aspergillus point kind detection is carried out using the kit in embodiment 1, is included the following steps:

(1) sample to be tested DNA is extracted:

(2) system is prepared, specific system composition is shown in Table 1:

Table 1

Component	Dosage
		TaqPolymerase	2U
dNTP	2M
		Primers	200nM
MgCl₂	3mM
		Tris-HCl	15mM
KCl	100mM
		Template	2μL
DMSO	5%
		SYBR Green I Dye	1×
Total	25μL

(3) step (2) system is put into real-time fluorescence PCR instrument, carries out pcr amplification reaction, actual conditions are as follows:

(1 ") 50 DEG C of preheating 2min, 1 circulation；

(2 ") 95 DEG C of initial denaturation 10min, 1 circulation；

The detection fluorescence channel of step (4 ") is SYBR Green I, runs PCR response procedures, saves file；

(4) result judgement:

1) judgement of kit validity:

Negative Quality Control group is effective: negative Quality Control group under the channel SYBR Green I without typical amplification curve or without Ct value, Otherwise it there may be reagent contamination, is resurveyed behind the source that please decontaminate；

Positive quality control group is effective: positive quality control group has typical amplification curve under the channel SYBR Green I, confirms nothing The Ct value of positive quality control is adjusted to 20 by adjusting threshold value after accidentally, and in this, as the threshold value of sample to be tested；

2) availability deciding of sample is detected:

If Ct value exists, show that the amount of DNA being added is normal；

3) Aspergillus point kind determines:

After PCR cycle amplified production, the melting temperature of different aspergillus strain DNA sequence dnas is different, passes through the four of positive quality control Kind plasmid carries out instrument calibration, and the present invention is detected using Roche 480, obtains aspergillus fumigatus, aspergillus niger, aspergillus flavus and Aspergillus terreus Corresponding product annealing temperature table (table 2), it should be noted that any instrument for meeting real-time fluorescence PCR is not necessarily to herein It is specifically limited, alignment purpose is to eliminate the different specific annealing temperature differences of instrument bring.

The annealing temperature Tm value comparison table of the different aspergillus strains of table 2

Strain	Tm value	CG content	Product length
				Aspergillus fumigatus	83.2	48.00%	204bp
Aspergillus niger	81.0	40.70%	194bp
				Aspergillus flavus	82.1	44.60%	177bp
Aspergillus terreus	87.5	57.00%	214bp

As shown in Table 2, the product Tm value of different aspergillus strains differs greatly, at 1 DEG C or more, convenient for distinguishing, and specificity It is good, high sensitivity, be not limited to PCR instrument specific measured value may slightly deviation, but the Tm value of Aspergillus inter-species is relatively steady Fixed, by the detection to positive quality control, the available Tm value comparison table suitable for any machine, positive quality control is corresponding to be melted Solution curve figure is shown in that Fig. 4-7, the amplification curve of sample to be tested are shown in that Fig. 8, melting curve are shown in Fig. 9.Comparing the Tm value that sample to be tested produces is It can be seen which kind of Aspergillus sample is.

As shown in Figure 8, there are target sequences in sample to be tested, and can using kit of the present invention and corresponding detection architecture Effectively to expand to it, in typical S curve, Ct value is greater than 20 and less than 35 for amplification, shows that kit is working properly and expands Increase effective；As shown in Figure 9, melting curve analysis is carried out after amplified reaction, is carried out with detection, and fluorescent value changes, can The annealing temperature Tm value for further determining that amplified production is 83.18, is compared by table 2 it is found that the sample to be tested is aspergillus fumigatus sense Dye.

It should be noted that point kind to Aspergillus may be implemented within the scope of kit each component additive amount of the present invention Detection, that is, the MgCl of the DPO primer pair of dNTP, 50-500nM of 0.1-5M, 0.8-10nM₂, the template of 0.1pg-10ng, 1- 15% DMSO and 0.5-2 × SYBR Green I dyestuff, the present embodiment 2 only enumerates optimal additive amount proportion therein.

The analysis of 3 specific detection of embodiment

It is luxuriant and rich with fragrance green that neogenesis cryptococcus, lattice spy cryptococcus, aspergillus nidulans, aspergillus versicolor, saccharomyces cerevisiae, Marni are extracted respectively Mould, Candida albicans, candida krusei, Candida glabrata, Candida parapsilosis, Candida tropicalis, Bordetella pertussis, influenza are thermophilic The DNA of blood bacillus, Pseudomonas aeruginosa, staphylococcus aureus and streptococcus pneumonia is pressed using the kit of the embodiment of the present invention 1 It is detected according to the method for embodiment 2, the results are shown in Table 3.

3 specific detection result of table

As shown in Table 3, the specificity of kit of the present invention is good, can effectively distinguish Eurotium and non-Eurotium, non-song Mould category, which shows it not without Ct value, can be carried out effective amplification, in addition, for closest to aspergillus fumigatus, aspergillus flavus, aspergillus niger, Aspergillus terreus Other aspergillus strain such as aspergillus versicolors and aspergillus nidulans, although can be carried out effective amplification, 1 DEG C of product annealing temperature difference with On, it can effectively distinguish different aspergillus strains.

4 sensitivity analysis of embodiment detection

The sensitivity that the plasmid standard of four kinds of aspergillus target sequences of various concentration is detected by melting curve method, using artificial The aspergillus fumigatus of synthesis, aspergillus flavus, Aspergillus terreus and aspergillus niger target sequence plasmid standard (the raw work synthesis in Shanghai) i.e. positive quality control, It is diluted to 10⁶copies、10⁵copies、10⁴copies、10³copies、10²copies、10¹copies、10⁰copies.It will It uses the system of no target sequence as blank control, uses the side in the kit and embodiment 2 in embodiment 1 as template Method is detected using Roche 480II quantitative fluorescent PCR instrument, and carries out melting curve analysis.Amplification curve diagram is shown in Figure 10, Melting curve is shown in Figure 11.

By the amplification curve of Figure 10 it is found that 10⁶copies-10²In the presence of copies plasmid standard, this hair It is bright to provide preferable signal, 10¹copies-10⁰In the presence of copies plasmid standard, it can not detect glimmering Optical signal, in the case where target sequence is not present, the present invention can not detect fluorescence signal.Shown by the melting curve of Figure 11 10⁶copies-10²In the presence of copies plasmid standard, it is capable of forming unique and consistent fusing point, is formed in figure It is unimodal；10¹copies-10⁰In the presence of copies plasmid standard, can not be formed it is unique consistent unimodal, in target In the case that sequence is not present, without unimodal.Therefore, the plasmid of melting curve method detection Aspergillus target sequence is carried out using the present invention The sensitivity of standard items is up to 10²copies。

5 quantitative analysis of embodiment

Four kinds of Aspergillus of quantitative detection: being that 1ng/ μ l equivalent is equal by this kit every kind of concentration of detectable four kinds of Aspergillus Even mixing carries out the standard curve that 10 times of continuous gradient dilutions are prepared into 7 concentration points, and each concentration carries out 3 multiple holes, uses The genetic fragment of arabidopsis is shown in Figure 12 as negative control, amplification curve, it is established that the linear relationship between Ct value and concentration is shown in Figure 13.

As shown in Figure 13, standard curve forms linear equation y=3.445x+ in the linear amplification region that PCR reacts 7.4314 R²=0.9996, kit amplification efficiency is 95.11%, and the range of linearity is: 1ng/ μ l~0.000001ng/ μ l. When measuring sample, the sample DNA of above-mentioned standard curve, negative control and unknown concentration carries out Fluorescence PCR, uses sieve When the fluorescence quantitative PCR instruments such as family name LightCycler 480II, ABI7500, StepOne Plus, built-in analysis software can be with According to the Ct value of standard curve and sample, the nucleic acid concentration of the target gene in sample is calculated, carries out quantitative analysis.

Comparative example 1

Using the Testing and appraisal of general primer march mould species, the sequence of the general primer such as SEQ ID NO.8-9 It is shown, while detection comparison is carried out using DPO primer and matched reagent box of the invention, amplification curve is shown in Figure 14, melting curve See Figure 15, wherein 1 is DPO primer system of the invention, 2 be general primer system.

SEQ ID NO.8:5'-CTTGGATTTGCTGAAGACTAAC-3'；

SEQ ID NO.9:5’-CTAACTTTCGTTCCCTGATTAATG-3’.

As shown in Figure 14, for the target sequence DNA of same concentration, DPO primer pair of the present invention and the detection of matched reagent box The cooperation of system can significantly improve amplification efficiency, hence it is evident that higher than the amplification efficiency of general primer；As shown in Figure 15, of the invention DPO primer pair and matched reagent box detection architecture can significantly improve the specificity of detection, and general primer is in amplified production Existing non-characteristic amplified peak.

The Applicant declares that the present invention is explained by the above embodiments method detailed of the invention, but the present invention not office Be limited to above-mentioned method detailed, that is, do not mean that the invention must rely on the above detailed methods to implement.Technical field Technical staff it will be clearly understood that any improvement in the present invention, equivalence replacement and auxiliary element to each raw material of product of the present invention Addition, selection of concrete mode etc., all of which fall within the scope of protection and disclosure of the present invention.

SEQUENCE LISTING

<110>red Na (Tianjin) Biotechnology Co., Ltd

<120>DPO primer pair, detection method, kit and its application of a kind of Aspergillus point kind detection

<130> 2019

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 33

<212> DNA

<213>artificial synthesized sequence

<220>

<221> misc_feature

<222> (19)..(24)

<223> n is a, c, g, or t

<400> 1

acaaggtttc cgtaggtgnn nnnncggaag gat 33

<210> 2

<211> 33

<212> DNA

<213>artificial synthesized sequence

<220>

<221> misc_feature

<222> (19)..(24)

<223> n is a, c, g, or t

<400> 2

catttcgctg cgttcttcnn nnnngcgaga acc 33

<210> 3

<211> 809

<212> DNA

<213>artificial synthesized sequence

<400> 3

catgattcag ccaacataac ccgacccgta caattctatt acgcgtctcc ggcgactgac 60

tatacttgcc gttcggagtt agggttttac tccgagagaa aattgagtca gcgatgaatc 120

cgttgacaag gtgaagaaga cgcagagcat taacgcgaaa gaattagatc tagggattta 180

cgacgaagca tcttggcacg ccaagtacaa agattcagcc tacgtttacg tcggagaatt 240

accttacgat ctcacggagg gtgacctcct cgccgttttc tcacaatatg gtgaagttgt 300

tgatttgaat cttgttcgag ataaaggaac tgggagatca aaaagatttg cgtttgttgc 360

ttatgaagat cagagaagta ctaatcttgc tgttggataa taaaagtgga gcattgtggt 420

aaatacttaa agagagaaga ggaagatgaa gagacgaagc agaagaagag agaagctccg 480

tggtgtttgc agagcttttc agagaaagga gtgtactcgt ggagattctt gcaaattttc 540

tcacgatgaa aatagagctg ccaataccgg gtggggtcac gaagatcgta gaagttccaa 600

gtgagagatc aagtaagtaa ataccataat gatgtagagg ataaataggg attgttcata 660

ttgatatcca agtggtaatg ctctacattg aagaatggtt tctaagttgt agctagaatc 720

taatggaaaa tgtgatttat tgaccattag cttacacacc ggtgttttgc tctgtatatg 780

tcgatcttat tttcagtgtt cacctttac 809

<210> 4

<211> 593

<212> DNA

<213>artificial synthesized sequence

<400> 4

atatcaataa gcggaggaaa agaaaccaac agggattgcc tcagtaacgg cgagtgaagc 60

ggcaagagct caaatttgaa agctggcccc ttcggggtcc gcgttgtaat ttgcagagga 120

tgcttcgggt gcagcccccg tctaagtgcc ctggaacggg ccgtcataga gggtgagaat 180

cccgtctggg acggggtgtc tgcgtccgtg tgaagctcct tcgacgagtc gagttgtttg 240

ggaatgcagc tctaaatggg tggtaaattt catctaaagc taaatactgg ccggagaccg 300

atagcgcaca agtagagtga tcgaaagatg aaaagcactt tgaaaagaga gttaaacagc 360

acgtgaaatt gttgaaaggg aagcgtttgc gaccagactc gcccgcgggg ttcagccggc 420

attcgtgccg gtgtacttcc ccgtgggcgg gccagcgtcg gtttgggcgg ccggtcaaag 480

gccctcggaa tgtatcacct ctcggggtgt cttatagccg agggtgcaat gcggcctgcc 540

tggaccgagg aacgcgcttc ggctcggacg ctggcgtaat ggtcgtaaat gac 593

<210> 5

<211> 593

<212> DNA

<213>artificial synthesized sequence

<400> 5

atatcaataa gcggaggaaa agaaaccaac cgggattgcc tcagtaacgg cgagtgaagc 60

ggcaagagct caaatttgaa agctggctcc ttcggagtcc gcattgtaat ttgcagagga 120

tgctttgggt gcggcccccg tctaagtgcc ctggaacggg ccgtcagaga gggtgagaat 180

cccgtcttgg gcggggtgtc cgtgcccgtg taaagctcct tcgacgagtc gagttgtttg 240

ggaatgcagc tctaaatggg tggtaaattt catctaaagc taaatactgg ccggagaccg 300

atagcgcaca agtagagtga tcgaaagatg aaaagcactt tgaaaagaga gttaaacagc 360

acgtgaaatt gttgaaaggg aagcgcttgc gaccagactc gcccgcgggg ttcagccggc 420

attcgtgccg gtgtacttcc ccgtgggcgg gccagcgtcg gtttgggcgg ccggtcaaag 480

gcccctggaa tgtagtgccc tccggggcac cttatagcca ggggtgcaat gcggccagcc 540

tggaccgagg aacgcgcttc ggcacggacg ctggcataat ggtcgtaaac gac 593

<210> 6

<211> 571

<212> DNA

<213>artificial synthesized sequence

<400> 6

aaaccaaccg ggattgcctc agtaacggcg agtgaagcgg caagagctca aatttgaaag 60

ctggctcctt cggggtccgc attgtaattt gcagaggatg cttcgggtgc ggcccctgtc 120

taagtgccct ggaacgggcc gtcagagagg gtgagaatcc cgtctgggat ggggtgtccg 180

cgcccgtgtg aagctccttc gacgagtcga gttgtttggg aatgcagctc taaatgggtg 240

gtaaatttca tctaaagcta aatactggcc ggagaccgat agcgcacaag tagagtgatc 300

gaaagatgaa aagcactttg aaaagagagt taaaaagcac gtgaaattgt tgaaagggaa 360

gcgcttgcga ccagactcgc ctccagggtt cagccggcat tcgtgccggt gtacttccct 420

gggggcgggc cagcgtcggt ttgggcggcc ggtcaaaggc tcccggaatg tagtgccctc 480

cggggcacct tatagccggg agtgcaatgc ggccagcctg gaccgaggaa cgcgcttcgg 540

cacggacgct ggcataatgg tcgtaaacga c 571

<210> 7

<211> 542

<212> DNA

<213>artificial synthesized sequence

<400> 7

attgcctcag taacggcgag tgaagcggca agagctcaaa tttgaaagct ggctccttcg 60

gggtccgcat tgtaatttgc agaggatgct tcgggtgcag cccccgtcta agtgccctgg 120

aacgggccgt catagagggt gagaatcccg tatggggcgg ggtgtctgcg tccgtgtgaa 180

gctccttcga cgagtcgagt tgtttgggaa tgcagctcta aatgggtggt aaatttcatc 240

taaagctaaa tactggccgg agaccgatag cgcacaagta gagtgatcga aagatgaaaa 300

gcactttgaa aagagagtta aacagcacgt gaaattgttg aaagggaagc gcttgcaacc 360

agactcgctc gcggggttca gccgggcttc ggcccggtgt acttccccgc gggcgggcca 420

gcgtcggttt gggcggccgg tcaaaggcct ccggaatgta gcgcccttcg gggcgcctta 480

tagccggggg tgcaatgcgg ccagcctgga ccgaggaacg cgcttcggca cggacgctgg 540

ca 542

<210> 8

<211> 22

<212> DNA

<213>artificial synthesized sequence

<400> 8

cttggatttg ctgaagacta ac 22

<210> 9

<211> 24

<212> DNA

<213>artificial synthesized sequence

<400> 9

ctaactttcg ttccctgatt aatg 24

Claims

1. a kind of DPO primer pair of Aspergillus point kind detection, which is characterized in that the nucleotide sequence such as SEQ of the DPO primer pair Shown in ID NO.1-2.

2. a kind of application of DPO primer pair as described in claim 1 in the product of preparation Aspergillus point kind detection.

3. a kind of kit of Aspergillus point kind detection, which is characterized in that the kit includes as described in claim 1 DPO primer pair.

4. kit according to claim 3, which is characterized in that the kit further includes negative Quality Control, positive quality control And auxiliary reagent；

Preferably, the negative Quality Control is the plasmid containing arabidopsis DNA fragmentation, the nucleotides sequence of the arabidopsis DNA fragmentation Column are as shown in SEQ ID NO.3；

Preferably, the positive quality control be respectively the plasmid containing aspergillus fumigatus DNA fragmentation, the plasmid containing aspergillus niger DNA fragmentation, Plasmid containing flavus dna segment and the plasmid containing Aspergillus terreus DNA fragmentation；

Preferably, the aspergillus fumigatus DNA fragmentation, aspergillus niger DNA fragmentation, flavus dna segment and Aspergillus terreus DNA fragmentation nucleosides Acid sequence is respectively as shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7；

Preferably, the auxiliary reagent includes Taq enzyme, dNTP, MgCl₂, DMSO, buffer and SYBR Green I dyestuff；

Preferably, the buffer includes Tris-HCl and KCl；

Preferably, concentration of the Tris-HCl in buffer is 15-20mM；

Preferably, concentration of the KCl in buffer is 100-200mM.

5. a kind of method of Aspergillus point kind detection, which is characterized in that including using DPO primer pair described in claim 1, power Benefit requires the step of 3 or 4 kit.

6. according to the method described in claim 5, it is characterized in that, described method includes following steps:

(1) right is added using four kinds of plasmids of the DNA of sample to be tested, the plasmid of negative Quality Control and positive quality control as template respectively It is required that the 1 DPO primer pair, Taq enzyme, dNTP, MgCl₂, DMSO, buffer and SYBR Green I dyestuff, carry out glimmering in real time Light PCR reaction；

(2) by whether there is Aspergillus in the amplification curve and melting curve analysis judgement sample of product and determine Aspergillus bacterium Kind.

7. according to the method described in claim 6, it is characterized in that, the final concentration of 0.5-5U of step (1) described Taq enzyme；

Preferably, the final concentration of 0.1-5M of step (1) described dNTP；

Preferably, the final concentration of 50-500nM of step (1) the DPO primer pair；

Preferably, step (1) MgCl₂Final concentration of 0.8-10nM；

Preferably, the final concentration of 0.1pg-10ng, preferably 0.5-1ng of step (1) described template；

Preferably, the mass percent of step (1) described DMSO is 1-15%；

8. method according to claim 6 or 7, which is characterized in that step (1) the real-time fluorescence PCR reaction includes such as Lower step:

(1 ') 90-98 DEG C of initial denaturation, 1-2min, 1 circulation；

(3 ') 65-97 DEG C of heating, a circulation.

9. according to the method described in claim 8, it is characterized in that, further including the process of preheating before step (1 '): 50 DEG C, 2min, 1 circulation；

(1 ") 50 DEG C of preheating 2min, 1 circulation；

(2 ") 95 DEG C of initial denaturation 10min, 1 circulation；

(4 ") 95 DEG C of 5s, 65 DEG C of 1min；It is warming up to 97 DEG C, 0.2 DEG C/s, continuous acquisition fluorescence signal, 5 times/DEG C；

Preferably, the standard of step (2) described judgement are as follows:

If (a) the Ct value of sense channel is not more than 35, for positive findings, if the Ct value of sense channel is greater than 35, for feminine gender As a result；

(b) positive findings are further analyzed, by melting curve analysis, compares the corresponding annealing of product with four kinds of positive quality controls Temperature Tm value, the identical aspergillus strain for determining sample to be tested and containing corresponding positive quality control of Tm value.

10. a kind of purposes of kit as described in claim 3 or 4 for Aspergillus point kind detection.