CN108070675A - Primer combination of probe and PCR kit for fluorescence quantitative a kind of while that detect three kinds of aspergillus - Google Patents
Primer combination of probe and PCR kit for fluorescence quantitative a kind of while that detect three kinds of aspergillus Download PDFInfo
- Publication number
- CN108070675A CN108070675A CN201810137954.5A CN201810137954A CN108070675A CN 108070675 A CN108070675 A CN 108070675A CN 201810137954 A CN201810137954 A CN 201810137954A CN 108070675 A CN108070675 A CN 108070675A
- Authority
- CN
- China
- Prior art keywords
- aspergillus
- primer
- probe
- positive
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of while three kinds of aspergillus of detection primer combination of probe and PCR kit for fluorescence quantitative, belong to the external field of molecular detection of pathogenic microorganism.The present invention provides a kind of primer combination of probe for detecting three kinds of aspergillus simultaneously based on fluorescent PCR method, the aspergillus includes aspergillus fumigatus, aspergillus flavus and aspergillus niger, the primer includes sense primer and anti-sense primer, the nucleotide sequence of the sense primer is as shown in SEQ ID NO.1, for the sequence of the anti-sense primer as shown in SEQ ID NO.2, the probe is terminal modified to have fluorophor, 3 ' the terminal modified substances for having fluorescent quenching group 5 ' of sequence shown in SEQ ID NO.3.Primer combination of probe provided by the invention detects while can realizing aspergillus fumigatus, aspergillus flavus and aspergillus niger, and detection Idiotype is strong, high sensitivity.
Description
Technical field
The present invention relates to the external field of molecular detection of pathogenic microorganism, and in particular to a kind of to detect three kinds of aspergillus simultaneously
Primer combination of probe and PCR kit for fluorescence quantitative.
Background technology
Deep mycosis refers to that pathomycete not only invades skin, mucous membrane but also infringement and gos deep into caused by portion's tissue and internal organ
Disease.Fungi is distributed widely in nature, and some fungies can infect human body and cause a disease.Deep mycosis is often scabies secondary infection,
Mostly on the basis of diabetes, blood disease, malignant tumour, large-area burns, severe malnutrition or other chronic wasting diseases
Upper morbidity.Or prolonged application antibiotic, glucocorticoid, immunosuppressor, make flora imbalance in body or inhibit body
Immune response and induce.
Aspergillus belongs to conditioned pathogen, is widely present in living environment, and conidium is small, can enter machine with breathing
Body with fibrin, laminin, fibrinogen etc. for intermediary, attaches to host tissue cells, sprouts mycelia, and then
It causes a disease.Aspergillosis is the disease as causing a disease caused by Aspergillus.Pathogenic Aspergillus mainly invades lung through respiratory tract, can also invade
Violate skin, mucous membrane.Septicemia can occur for severe patient, make its hetero-organization and system involvement.Common pathogen has aspergillus fumigatus, Huang Qu
Mould, aspergillus niger etc., wherein aspergillus fumigatus are most common pathogens, when immune function is suppressed or damage when susceptible.
Mainly there is following four in laboratory for the detection of aspergillus at present：
(1) pathogen culture identification detection method
The sample for being derived from affected part makees direct smear or culture, the visible mycelia of smear or Aspergillus spore, and Aspergillus is shown in culture
Growth.Aspergillus is the common contaminated bacteria in laboratory, it is necessary to smear or culture repeatedly, it is repeatedly positive and just examined for same strain
Disconnected value.Although culture identification method is clinical commonly used method, its cultivation cycle is longer.
(2) pathologic diagnosis
Damaged tissues or lymph node biopsy are taken, can be made a definite diagnosis according to fungal morphology.Especially to dissemination Aspergillus, can make in time
Go out diagnosis.The result of pathologic diagnosis is more reliable, but since it is with invasive, most of patients is difficult to receive, and limits
It is applied.
(3) immunological detection
Detect the enzyme-linked immunosorbent assay of aspergillus fumigatus IgM and IgG antibody (ELISA) in serum, the detection of Aspergillus antigen
Method mainly has 1,3- β-D glucans detection (G experiments) and galactomannan antigen for detection (GM experiments).1,3- β-D glucans resist
Original is all distinctive a kind of cell wall constituents of fungi in addition to tulase and cryptococcus, using serum as detection sample.Galactomannan
Glycan is that the one kind being present in aspergillus cell wall has the polysaccharide of high degree of specificity and highly conserved type, can be used as Aspergillus
The specificity molecular marker of detection, enzyme-linked immunosorbent assay (ELISA) are relatively conventional galactomannans antigen inspections
Survey method, but this method sensitivity is not high, it is impossible to different strains is distinguished, it occur frequently that false positive or false negative.
(4) real-time fluorescence detection method (Real-Time Fluorescence Polymerase Chain
Reaction, fluorescent PCR)
Detection technique based on real-time fluorescence detection method passes through the practice of more than 20 years, continuously improves and complete
It is kind, the most ripe nucleic acid detection method of clinical molecular diagnosis is increasingly becoming, it has merged the nucleic acid efficient amplification of round pcr, base
It the characteristics of sensibility and accurate quantification of the sensitivity of gene-amplification, the specificity of molecule hybridization and spectral technique, fundamentally solves
It has determined the pollution problem of pcr amplification product, especially fluorescence probe method (TaqMan methods), with pair of primers plus a probe, certainly
It is very high to have determined its specificity, has been substantially absent from non-specific amplification, solves the problems, such as cross reaction.Result judgement visitor
It sees, is true.By the detection of nucleic acids to microbial pathogens, can not only assist to determine whether the sense of microbial pathogens
Dye, can also be investigated and monitored to the prevalence of microbial pathogens, help to establish the examination criteria of microbial pathogens disease,
Foundation is provided for clinic examination curative effect, and can helping directive clinical application and the development of predictive disease etc..However, aspergillus is due to kind
Class is various, and the nucleic acid sequence homology between kind, between kind (with other category such as Mycotoruloides, Cryptococcus etc.) is higher,
Meanwhile the probability that morphs of entire fungal gene group is much larger than human genome so that may be selected as target-gene sequence into
The gene order of row kind detection is few, therefore, for the design common aspergillus of specific detection such as aspergillus fumigatus, aspergillus flavus, black
The difficulty of the primer and probe of the fluorescent PCR of aspergillus etc. is with regard to bigger.
The content of the invention
It is an object of the invention to provide a kind of while three kinds of aspergillus of detection primer combination of probe and fluorescent quantitation RCR examinations
Agent box.Primer combination of probe provided by the invention detects while can realizing aspergillus fumigatus, aspergillus flavus and aspergillus niger, and detection is special
Type is strong, high sensitivity.
The present invention provides a kind of primer combination of probe for detecting three kinds of aspergillus simultaneously based on fluorescent PCR method, the aspergillus
Including aspergillus fumigatus, aspergillus flavus and aspergillus niger, the primer includes sense primer and anti-sense primer, the nucleotide of the sense primer
Sequence is as shown in SEQ ID NO.1, and for the sequence of the anti-sense primer as shown in SEQID NO.2, the probe is in SEQ ID
The 5 ' of sequence shown in NO.3 are terminal modified fluorophor, 3 ' the terminal modified substances for having fluorescent quenching group.
Preferably, the fluorophor includes FAM, SYBR Green I, JOE, VIC, NED, CY-3, TEXAS Red
Or CY-5.
Preferably, the fluorescent quenching group includes TAMRA or BHQ1.
The present invention also provides a kind of while three kinds of aspergillus of detection detection kit, the kit includes：Above-mentioned skill
Primer combination of probe, negative control, positive control and PCR reaction solution described in art scheme.
Preferably, the PCR reaction solution includes：DATP, dCTP, dGTP, dUTP, Taq archaeal dna polymerase, uracil-
N- glycosylases, reference fluorescent, MgCl2And buffer solution.
Preferably, the concentration of the sense primer, anti-sense primer and probe independently is 8~12 μM.
Preferably, the negative control be containing independent basis because plasmid, the independent basis because sequence such as SEQ ID
Shown in NO.4.
Preferably, it is right to include the plasmid of the segment of positive control dna containing aspergillus fumigatus, the positive containing aspergillus flavus for the positive control
The plasmid of plasmid according to DNA fragmentation and the segment of positive control dna containing aspergillus niger, the aspergillus fumigatus positive control dna segment, Huang Qu
The nucleotide sequence of mould positive control dna segment and aspergillus niger positive control dna segment is respectively as shown in SEQ ID NO.5~7.
Preferably, every 20 μ L reaction systems include：10 μ LPCR reaction solutions, 1 μ L sense primers and anti-sense primer, 0.5 μ L
Probe, 4.5 μ L water and 4 μ L detected samples.
Preferably, the response procedures of the kit are：50℃2min；95℃10min；95 DEG C of 15s, 57 DEG C of 30s, 40
A cycling.
The present invention provides a kind of while three kinds of aspergillus of detection primer combination of probe.Primed probe group provided by the invention
Conjunction detects while can realizing aspergillus fumigatus, aspergillus flavus and aspergillus niger, and detection Idiotype is strong, high sensitivity.Result of the test shows
Primer combination of probe provided by the invention can detectable concentration cigarette in the range of 0.000001ng/ μ L~1.0ng/ μ L is bent respectively
Mould, aspergillus flavus and aspergillus niger；With other bacterium no cross reactions；Precision CV value≤5%；Stability is high；Application clinically
Effect is good.Minimum detection limit is 0.000001ng/ μ L.
Description of the drawings
Fig. 1 is the standard fluorescence PCR amplification graph that the embodiment of the present invention 5 provides；
Fig. 2 is the canonical plotting for the amplification curve that the embodiment of the present invention 5 provides.
Specific embodiment
The present invention provides a kind of primer combination of probe for detecting three kinds of aspergillus simultaneously based on fluorescent PCR method, the aspergillus
Including aspergillus fumigatus, aspergillus flavus and aspergillus niger, the primer includes sense primer and anti-sense primer, the nucleotide of the sense primer
Sequence is as shown in SEQ ID NO.1, and for the sequence of the anti-sense primer as shown in SEQ ID NO.2, the probe is in SEQ ID
The 5 ' of sequence shown in NO.3 are terminal modified fluorophor, 3 ' the terminal modified substances for having fluorescent quenching group.
The present invention designs special according to the homologous conservative gene group DNA fragmentation of three kinds of aspergillus niger, aspergillus fumigatus, aspergillus flavus aspergillus
The probe of primer and fluorescent marker determines whether there is specificity by detecting the intensity of fluorescence signal and the shape of amplification curve
PCR product formed, and then judge whether contain target DNA fragment in institute's test sample sheet.Present invention selection aspergillus ribose body region
Conserved sequence as the position of target gene, by a large amount of sequence alignments and screening, aspergillus fumigatus, Huang can be detected simultaneously by designing
The universal primer and probe of three kinds of aspergillus, aspergillus niger aspergillus, these three oligonucleotides can identify above-mentioned three kinds of aspergillus simultaneously, but
Not with other fungi strains such as Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, neogenesis cryptococcus, lattice
Special cryptococcus, Lauren spy cryptococcus etc. are intersected, and adequately achieve the specificity of primer and probe, without losing sensitivity.
The present invention screens general according to the sequence of the genomic DNA of the rRNA of aspergillus fumigatus, aspergillus flavus and aspergillus niger
Above-mentioned aspergillus and the target sequence not homologous with other species are detected, the nucleotide sequence of the target sequence is as follows：
(1) aspergillus fumigatus target sequence (109bp) is as shown in SEQ ID NO.8：
CGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGAGTCGTTGCC
AACTCCCCTGAGCCAGTCCGAAGGCCTCACCG；
(2) aspergillus flavus target sequence (107bp) is as shown in SEQ ID NO.9：
CGGAAACCTTGTTACGACTTTTACTTCCTCTAATGACCGGGTTTGACCAACTTTCCGGCCCTGGGGGGTCGTTGCCA
ACCCTCCTGGGCAGTCCGAAGGCCTCACCG；
(3) aspergillus niger target sequence (109bp) is as shown in SEQ ID NO.10：
CGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGGGTCGTTGCC
AACCCTCCTGAGCCAGTCCGAAGGCCTCACCG；
The present invention carries out the design of primer, upstream of the present invention for the target sequence of aspergillus fumigatus, aspergillus flavus and aspergillus niger
The nucleotide sequence of primer (Asp-F) is as shown in SEQ ID NO.1：5'-CGGAAACCTTGTTACGACTTTTACT-3'；It is described
The nucleotide sequence of anti-sense primer (Asp-R) nucleotide is as shown in SEQ ID NO.2：5'-CGGTGAGGCCTTCGGACT-3'.
The present invention does not have the source of the primer special restriction, is carried out using biotech firm well known to those skilled in the art artificial
Synthesis, such as Shanghai JaRa Bioisystech Co., Ltd.
The present invention carries out the design of probe, the spy that the present invention obtains according to the target sequence of aspergillus fumigatus, aspergillus flavus and aspergillus niger
Pin is：Nucleotide sequence (5 '-CCGGGTTTGACCAACTTTCCGGC-3 ') shown in SEQ ID NO.3 5 ' it is terminal modified have it is glimmering
Light group, 3 ' the terminal modified substances for having fluorescent quenching group.In the present invention, the fluorophor includes FAM, SYBR
GreenI, JOE, VIC, NED, CY-3, TEXAS Red or CY-5 etc. are preferably FAM；In the present invention, the fluorescent quenching base
Group includes TAMRA or BHQ1 etc., is preferably tetramethylrhodamine (TAMRA).The present invention does not have the synthetic method of the probe
Special restriction is synthesized using biotech firm well known to those skilled in the art, as Shanghai JaRa biotechnology has
Limit company.
The present invention also provides a kind of while three kinds of aspergillus of detection detection kit, the kit includes：Above-mentioned skill
Primer combination of probe, negative control, positive control and PCR reaction solution described in art scheme.
In the present invention, the sense primer that concentration is 8~12 μM, more preferably 9~11 μ are preferably included in the kit
M is most preferably 10 μM.In the present invention, the sense primer of 15~25 μ L is preferably comprised in the kit, more preferably 18~
23 μ L are most preferably 22 μ L.In the present invention, the solvent of the sense primer is preferably deionized water.
In the present invention, the anti-sense primer that concentration is 8~12 μM, more preferably 9~11 μ are preferably included in the kit
M is most preferably 10 μM.In the present invention, the anti-sense primer of 15~25 μ L is preferably comprised in the kit, more preferably 18~
23 μ L are most preferably 22 μ L.In the present invention, the solvent of the anti-sense primer is preferably deionized water.
In the present invention, the probe that concentration is 8~12 μM, more preferably 9~11 μM are preferably included in the kit, most
Preferably 10 μM.In the present invention, the probe of 8~15 μ L is preferably comprised in the kit, more preferably 10~12 μ L, it is optimal
Elect 11 μ L as.In the present invention, the solvent of the probe is preferably deionized water.
In the present invention, the negative control be containing independent basis because plasmid, the independent basis because sequence such as SEQ ID
Shown in NO.4.In the present invention, the independent basis is because the DNA fragmentation of plant Arabidopsis thaliana, the specific sequence of arabidopsis DNA fragmentation
It is classified as：
AATCGCCAAGCCAAATTCACACTTCAGTATGACTTGTGTCTTTCCAGGAAGGAATTTCTCAACCTCACTTTTTTCCT
TCTCAGTAGAAACGGCCTTATGACCTGAAAGTGACATTAACATCAAGTATCATGCATAACGCATTTTCTATAAAAGA
AAAAGGGTCTAAACCAAAAAAAGGTGCATAATAAACCCACATGATGCAGACGGTTAATAATCAACAGCTCCTCTTCA
TCTGTAAGACTGGCACTACCACATTCTGCGAATGGAGTATTAAACCATTCTTCGAAATTATGAATTGAGTTAAAGAT
GTGAGGAAGAAGAAAATTAAGCAGCGACCATAGTTCTTGCAGACTGTTCTGTATGGGAGTTCCAGTTAATAGAAGTC
TGCGCTTAATCCGGTAGCTGCATCCAGGACAAATTAGTGTAAGCAAAATGTCTTTAAATTTCCTTTGTGACAGTATC
TTTAAGAGATAAATCAGAGTAACAACTAATTAACACCATTCACTTCAGACTTCATCAAGCTAATGCGTAAAAAGGCA
TGTCTAAACATCTTTAAGAAACTAGATACAGTCTACTCAAAGACCAGAGTAACATACAGAAACATACCCAGTTCCTA
GAGTCTTTGCGAGAGCACATTCATGGTTCTTCAGACGATGTCCTTCATCAACAATCATGTAGTTCCAGTCAATTTTC
TTCAAAAATGCTTTATCTCTCATGATAAGATCGTAGTGGGTTATCAACACATTAAATTTTCCTCCTGCTATTCTTGC
TCTTATTTCAGTTCTTTTCTCCTTTGATCCATCGTAAAGAAAATCGCTGAATCATG。
In the present invention, the setting of the negative control selects a species inhereditary material gene, the gene with people
There is no significant homology, there is no significant homology with the gene of fungi, will not cause to intersect with the gene of people and fungi
Reaction；However the unrelated genetic fragment has universal feature possessed by all genetic fragments, i.e., by four kinds of common deoxidation cores
Ribosomal ribonucleic acid ATCG is formed, and is one section of real nucleic acid gene sequence, as negative control than conventionally used blank control or slow
Fliud flushing control is more representative.The concentration of the negative control is preferably 1ng/mL.In the present invention, the negative control is preferred
For the plasmid of the DNA fragmentation containing plant Arabidopsis thaliana, in the present invention, the plasmid is preferably pTG19-T.Feminine gender of the present invention is right
Building process according to plasmid is preferably：Extract the genomic DNA of arabidopsis；Using arabidopsis thaliana genomic dna as template, with primer A
PCR amplification is carried out with primer B, obtains arabidopsis DNA fragmentation；The arabidopsis DNA fragmentation is connected into pTG19-T carriers, is built
Obtain negative control plasmids.In the present invention, the nucleotide sequence of the primer A is as shown in SEQ ID NO.11：5'-
AATCGCCAAGCCAAATTCACAC-3'；The nucleotide sequence of the primer B is as shown in SEQ ID NO.12：5'-
CATGATTCAGCGATTTTCTTTACG-3'。
In the present invention, the system of the PCR amplification arabidopsis DNA fragmentation is preferably：4 μ l (50mM of 5X buffer solutions
Tris-HCl [pH 8.5], 50mM NaCl, 0.5mg/ml BSA)；25mM MgCl 1.6μl；10mM dNTP 0.5μl；10μM
Primer-F 0.5μl；10μM Primer-R 0.5μl；Genomic DNA 1ng；0.25 μ l of 5U/ μ l Taq enzymes；What is sterilized is ultrapure
Water adds to 20 μ l.
In the present invention, the amplification condition of the PCR amplification arabidopsis DNA fragmentation is preferably：95℃4min；95 DEG C of 30s,
51 DEG C of 30s, 72 DEG C of 60s, 35 Xun Huans；72℃5min；12℃∝.
In the present invention, the method that the arabidopsis DNA fragmentation is connected into pTG19-T carriers preferably includes：pTG19-T
(25ng/μl)1μl；Fresh 4 μ l of PCR product；10xT4Buffer1μl；T4DNALigase2.5units；ddH2O adds to 10 μ l.
Mentioned reagent mixing simultaneously centrifuges, and when 16 DEG C of connections 1 are small, 10 μ l of ligation reaction are converted 100 μ l competent cells, ice bath 20
Minute, after 42 DEG C of heat shocks 45 seconds, then is placed 2 minutes in ice bath, add in 500 μ L SOC or LB culture mediums, shaken at 37 DEG C
Culture 60 minutes, is cultivated on the L- Agar Platings containing X-Gal, IPTG, Amp, forms single bacterium colony, is selected single white
Color bacterium colony carries out identification Insert Fragment with enzyme cutting method or PCR methods, finally sequencing is sent to confirm the target gene cloned PCR product
Segment.
In the present invention, the positive control includes the plasmid of the segment of positive control dna containing aspergillus fumigatus, containing the aspergillus flavus positive
The plasmid of the plasmid of comparison DNA segment and the segment of positive control dna containing aspergillus niger, the aspergillus fumigatus positive control dna segment, Huang
The nucleotide sequence of aspergillus positive control dna segment and aspergillus niger positive control dna segment is respectively such as the institute of SEQ ID NO.5~7
Show.In the present invention, the positive control dna segment of three kinds of aspergillus is designed respectively for three kinds of aspergillus target sequences
, the length of three kinds of aspergillus positive control dna segment is longer than three kinds of aspergillus target sequences, i.e., the sun of described three kinds of aspergillus respectively
Property comparison DNA the target sequence of entire fluorescent PCR amplification can be completely covered.
In the present invention, the positive control be preferably the plasmid containing the positive control dna segment, the plasmid it is dense
Degree is preferably 20ng/mL.In the present invention, the plasmid is preferably pTG19-T.
In the present invention, nucleotide sequence (the AYc 1101bp) such as SEQ ID of the aspergillus fumigatus positive control dna segment
Shown in NO.5：
TTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGAGCTTCACACGGACGCAGACACCCCGTCCCAGACGGGA
TTCTCACCCTCTATGACGGCCCGTTCCAGGGCACTTAGACGGGGGCTGCACCCGAAGCATCCTCTGCAAATTACAAC
GCGGACCCCGAAGGGGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCTGTTGG
TTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTTAGAAAAAT
AAAGTTGGGTGTCGGCTGGCGCCGGCCGGGCCTACAGAGCAGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCG
GTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGAGGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGCA
GCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTG
AATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAA
AGTTTTAACTGATTACGATAATCAACTCAGACTGCATACTTTCAGAACAGCGTTCATGTTGGGGTCTTCGGCGGGCG
CGGGCCCGGGGGCGCAGGGCCTCCCCGGCGGCCGTCGAAACGGCGGGCCCGCCGAAGCAACAAGGTACGATAGACAC
GGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACG
ACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGAGTCGTTGCCAACTCCCCTGAGCCAG
TCCGAAGGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCGGCAC
GAGCTGATGACTCGTGCCTACTAGGCATTCCTCGTTGAAGAGCAATAATTGCAATGCTCTATCCCCAGCACGACAGG
GTTTAACAAGATTACCCAGACCT。
In the present invention, nucleotide sequence (the AFc 905bp) such as SEQ ID of the aspergillus flavus positive control dna segment
Shown in NO.6：
TGACGGCCCGTTCCAGGGCACTTAGACAGGGGCCGCACCCGAAGCATCCTCTGCAAATTACAATGCGGACCCCGAAG
GAGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCGGTTGGTTTCTTTTCCTCC
GCTTATTGATATGCTTATGTTCAGCGGGGATCCCTACCTGATCCGAGGTCAACCTGGAAAAAGATTGATTTGCGTTC
GGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGC
CTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACGACCCAACACACAAGCCGTGCTTGATGGGCAGCAATGACGCTC
GGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATCCACGGAATTCTGCAATT
CACACTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGA
TTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTCCGGCGGGCGCGGGCCCGGGGCTG
AGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGCGGGAGGTTGGGCTC
GCTAGGAACCCTACACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCT
AATGACCGGGTTTGACCAACTTTCCGGCCCTGGGGGGTCGTTGCCAACCCTCCTGGGCAGTCCGAAGGCCTCACCGA
GCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCGGC。
In the present invention, nucleotide sequence (the AHc 1103bp) such as SEQ ID of the aspergillus niger positive control dna segment
Shown in NO.7：
CAAACAACTCGACTCGTCGAAGGAGCTTTACACGGGCACGGACACCCCGCCCAAGACGGGATTCTCACCCTCTCTGA
CGGCCCGTTCCAGGGCACTTAGACGGGGGCCGCACCCAAAGCATCCTCTGCAAATTACAATGCGGACTCCGAAGGAG
CCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCGGTTGGTTTCTTTTCCTCCGCT
TATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAGAATGGTTGGAAAACGTCGG
CAGGCGCCGGCCAATCCTACAGAGCATGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCT
TTCGGGCCCGTCCCCCCGGAGAGGGGGACGGCGACCCAACACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGA
CAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCAC
ATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTG
CATTCAATCAACTCAGACTGCACGCTTTCAGACAGTGTCCGTGTTGGGGTCTCCGGCGGGCACGGGCCCGGGGGGCA
GAGGCGCCCCCCCGGCGGCCGACAAGCGGCGGGCCCGCCGAAGCAACAGGGTACAATAGACACGGATGGGAGGTTGG
GCCCAAAGGACCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTC
TAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGGGTCGTTGCCAACCCTCCTGAGCCAGTCCGAAGGCCTCAC
CGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCGGCACGAGCTGATGACTCG
TGCCTACTAGGCATTCCTCGTTGAAGAGCAATAATTGCAATGCTCTATCCCCAGCACGACAGGGTTTAACAAGATTA
CCCAGACCTCTCGGCCAAGGTGATG。
In the present invention, by taking aspergillus fumigatus as an example, the construction method of the cloned plasmids of the aspergillus fumigatus positive control dna segment
It is as follows：Extract the genomic DNA of aspergillus fumigatus；Using the aspergillus fumigatus genomic DNA as template, carried out using primer AY-F/AY-R
PCR amplification, amplification obtain aspergillus fumigatus positive control dna segment；Simultaneously purified pcr product is recycled, is connected into plasmid vector
(pTG19-T) in, bacillus coli DH 5 alpha, the sub- sequence verification of recombinant conversion are converted.Plasmid is extracted after recombinant conversion son culture, is obtained
Cloned plasmids AYc-T.In the present invention, the nucleotide sequence of the primer AY-F is as shown in SEQ ID NO.13：5'-
TTTAGAGCTGCATTCCCAAACAACT-3'；The nucleotide sequence of the primer AY-R is as shown in SEQ ID NO.14：5'-
AGGTCTGGGTAATCTTGTTAAACC-3'。
The present invention is with reference to the construction method of the cloned plasmids of aspergillus fumigatus positive control dna segment, and structure is containing aspergillus flavus respectively
The cloned plasmids of positive control dna segment, aspergillus niger positive control dna segment, are respectively designated as successively：AFc-T and AHc-T.
The present invention is in the building process of the cloned plasmids AFc-T of aspergillus flavus positive control dna segment, it is preferred to use AF-
F/AF-R primers carry out the amplification of aspergillus flavus positive control dna segment.The nucleotide sequence of the primer AF-F such as SEQ ID
Shown in NO.15：5'-TGACGGCCCGTTCCAGGGCACTTA-3'；The nucleotide sequence of the primer AF-R such as SEQ ID
Shown in NO.16：5'-GCCGATTACGTCCCTGCCCTTTGTA-3'.
The present invention is in the building process of the cloned plasmids AHc-T of aspergillus niger positive control dna segment, it is preferred to use AH-
F/AH-R primers carry out the amplification of aspergillus niger positive control dna segment.The nucleotide sequence of the primer AH-F such as SEQ ID
Shown in NO.17：5'-CAAACAACTCGACTCGTCGAAGGA-3'；The nucleotide sequence of the primer AH-R such as SEQ ID
Shown in NO.18：5'-CATCACCTTGGCCGAGAGGTCTGG-3'.
In the present invention, the PCR reaction solution includes：DATP, dCTP, dGTP, dUTP, Taq archaeal dna polymerase, urine are phonetic
Pyridine-N- glycosylases, reference fluorescent, MgCl2And buffer solution.Reference fluorescent of the present invention is preferably purchased from American AB I companies, goods
Number for 4440038, the fluorescence signal ROX acting as correcting between Kong Yukong of the reference fluorescent.In the present invention, institute
State PCR reaction solution preferably include 400~500 μM dNTP, the Taq enzyme of 0.1~0.2U/ μ L, 0.1~0.2U/ μ L UNG enzymes,
0.1~0.25 μM of reference fluorescent ROX, the MgCl of 3~6mM2And buffer solution；In the present invention, the buffer solution include 10~
The Tris-HCl of 20mM, the KCl of 100~200mM, the pH value of the Tris-HCl is 8.
In the present invention, the storage temperature of each component is preferably -20 DEG C in the kit, wherein, the probe is preferred
It is preserved under the conditions of being protected from light.
In the present invention, the detected sample of the kit includes sputum, hydrothorax, ascites and secretion etc..The present invention
There is no special restriction to the extracting method of the detected sample kind DNA, DNA extractions are carried out using conventional method.
In the present invention, every 20 μ L reaction systems include：10 μ LPCR reaction solutions, 1 μ L sense primers and anti-sense primer, 0.5
μ L probes, 4.5 μ L water and 4 μ L detected samples.
In the present invention, the response procedures of the kit are：50℃2min；95℃10min；95 DEG C of 15s, 57 DEG C of 30s,
40 Xun Huans.
In the present invention, when sample Ct value≤34, and amplification curve shape is normal, that is, has preferable Increasing Curve of Logarithm,
Testing result is the positive；As sample Ct values ＞ 34, either " Undetermined " or amplification curve shape are abnormal, that is, do not have
Preferable Increasing Curve of Logarithm, testing result are feminine gender.The present invention preferably calculates sample according to the Ct values of standard curve and sample
The DNA content of target gene starting template.
With reference to specific embodiment to it is of the present invention a kind of and meanwhile detect three kinds of aspergillus primer combination of probe and
Fluorescent quantitation RCR kits are further described in detail, and technical scheme includes but not limited to following embodiment.
Embodiment 1
The composition of kit
1st, design of primers
According to aspergillus niger, aspergillus fumigatus, aspergillus flavus rRNA genomic DNA sequence, screening general can detect
These three aspergillus and the target sequence not homologous with other species, the nucleotide sequence of target sequence are as follows：
(1) aspergillus fumigatus target sequence (109bp)：
CGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGAGTCGTTGCC
AACTCCCCTGAGCCAGTCCGAAGGCCTCACCG。
(2) aspergillus flavus target sequence (107bp)：
CGGAAACCTTGTTACGACTTTTACTTCCTCTAATGACCGGGTTTGACCAACTTTCCGGCCCTGGGGGGTCGTTGCCA
ACCCTCCTGGGCAGTCCGAAGGCCTCACCG。
(3) aspergillus niger target sequence (109bp)：
CGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGGGTCGTTGCC
AACCCTCCTGAGCCAGTCCGAAGGCCTCACCG。
For aspergillus fumigatus, aspergillus flavus, aspergillus niger target sequence, detect the special of these three aspergillus designed for fluorescent PCR
Property primer, and entrust Shanghai JaRa Bioisystech Co., Ltd synthesize.
The base sequence of specific primer is：
Sense primer (Asp-F)：5'-CGGAAACCTTGTTACGACTTTTACT-3'
Anti-sense primer (Asp-R)：5'-CGGTGAGGCCTTCGGACT-3'
2nd, fluorescence probe designs
The design of above-mentioned primer and probe is preferably set according to the common homologous target sequence of above-mentioned three kinds of aspergillus in the present invention
Meter is drawn.
Fluorescence probe sequence：
Probe：FAM-5'-CCGGGTTTGACCAACTTTCCGGC-3'-TAMRA.
There is FAM fluorophors at 5 ' ends of the fluorescence probe, FAM is Fluoresceincarboxylic acid, absorbing wavelength 492nm,
Launch wavelength is 518nm.3 ' ends of the fluorescence probe have fluorescent quenching group TAMRA (tetramethylrhodamine).Probe by
Shanghai JaRa Bioisystech Co., Ltd synthesizes.
3rd, the composition of kit
(1) primer
Primer is made of above-mentioned sense primer and anti-sense primer, and concentration is respectively 10 μM.
(2) probe
Probe is above-mentioned fluorescence probe, and concentration and probe concentration is 10 μM.
(3) negative control
Negative control be containing independent basis because plasmid, for the independent basis because the DNA fragmentation of plant Arabidopsis thaliana, negative control is dense
It spends for 1ng/mL.
The building process of negative control plasmids is：Extract the genomic DNA of arabidopsis；Using arabidopsis thaliana genomic dna as mould
Plate carries out PCR amplification with primer A and primer B, obtains arabidopsis DNA fragmentation；The arabidopsis DNA fragmentation is connected into pTG19-T to carry
In body, structure obtains negative control plasmids.
Primer A：5'-AATCGCCAAGCCAAATTCACAC-3'
Primer B：5'-CATGATTCAGCGATTTTCTTTACG-3'
Arabidopsis sequence dna fragment：
AATCGCCAAGCCAAATTCACACTTCAGTATGACTTGTGTCTTTCCAGGAAGGAATTTCTCAACCTCACTTTTTTCCT
TCTCAGTAGAAACGGCCTTATGACCTGAAAGTGACATTAACATCAAGTATCATGCATAACGCATTTTCTATAAAAGA
AAAAGGGTCTAAACCAAAAAAAGGTGCATAATAAACCCACATGATGCAGACGGTTAATAATCAACAGCTCCTCTTCA
TCTGTAAGACTGGCACTACCACATTCTGCGAATGGAGTATTAAACCATTCTTCGAAATTATGAATTGAGTTAAAGAT
GTGAGGAAGAAGAAAATTAAGCAGCGACCATAGTTCTTGCAGACTGTTCTGTATGGGAGTTCCAGTTAATAGAAGTC
TGCGCTTAATCCGGTAGCTGCATCCAGGACAAATTAGTGTAAGCAAAATGTCTTTAAATTTCCTTTGTGACAGTATC
TTTAAGAGATAAATCAGAGTAACAACTAATTAACACCATTCACTTCAGACTTCATCAAGCTAATGCGTAAAAAGGCA
TGTCTAAACATCTTTAAGAAACTAGATACAGTCTACTCAAAGACCAGAGTAACATACAGAAACATACCCAGTTCCTA
GAGTCTTTGCGAGAGCACATTCATGGTTCTTCAGACGATGTCCTTCATCAACAATCATGTAGTTCCAGTCAATTTTC
TTCAAAAATGCTTTATCTCTCATGATAAGATCGTAGTGGGTTATCAACACATTAAATTTTCCTCCTGCTATTCTTGC
TCTTATTTCAGTTCTTTTCTCCTTTGATCCATCGTAAAGAAAATCGCTGAATCATG。
(4) positive control
Positive control for respectively containing aspergillus fumigatus, aspergillus flavus, aspergillus niger positive control dna sequence 3 kinds of cloned plasmids, each
Aspergillus concentration is 20ng/mL.
The preparation process of positive control is：
1) structure of three kinds of cloned plasmids
Extract the genomic DNA of aspergillus niger；Using the genomic DNA as template, PCR expansions are carried out using primer AH-F/AH-R
Increase, amplification obtains aspergillus niger positive control dna segment；Simultaneously purified pcr product is recycled, is connected into plasmid vector (pTG19-T)
In, bacillus coli DH 5 alpha is converted, the sub- sequence verification of recombinant conversion, aspergillus niger positive control dna segment (AHc) is as follows.Weight
Plasmid is extracted after group transformant culture, obtains cloned plasmids AHc-T.
AH-F：5'-CAAACAACTCGACTCGTCGAAGGA-3'
AH-R：5'-CATCACCTTGGCCGAGAGGTCTGG-3'
AHc sequences (1103bp)：
CAAACAACTCGACTCGTCGAAGGAGCTTTACACGGGCACGGACACCCCGCCCAAGACGGGATTCTCACC
CTCTCTGACGGCCCGTTCCAGGGCACTTAGACGGGGGCCGCACCCAAAGCATCCTCTGCAAATTACAATGCGGACTC
CGAAGGAGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCGGTTGGTTTCTTTT
CCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAGAATGGTTGGAA
AACGTCGGCAGGCGCCGGCCAATCCTACAGAGCATGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGC
CGCTGCCTTTCGGGCCCGTCCCCCCGGAGAGGGGGACGGCGACCCAACACACAAGCCGGGCTTGAGGGCAGCAATGA
CGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTG
CAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTA
ACTGATTGCATTCAATCAACTCAGACTGCACGCTTTCAGACAGTGTCCGTGTTGGGGTCTCCGGCGGGCACGGGCCC
GGGGGGCAGAGGCGCCCCCCCGGCGGCCGACAAGCGGCGGGCCCGCCGAAGCAACAGGGTACAATAGACACGGATGG
GAGGTTGGGCCCAAAGGACCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTT
ACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGGGTCGTTGCCAACCCTCCTGAGCCAGTCCGAA
GGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCGGCACGAGCTG
ATGACTCGTGCCTACTAGGCATTCCTCGTTGAAGAGCAATAATTGCAATGCTCTATCCCCAGCACGACAGGGTTTAA
CAAGATTACCCAGACCTCTCGGCCAAGGTGATG
With reference to the construction method of the cloned plasmids of the segment of positive control dna containing aspergillus niger, structure is positive containing aspergillus fumigatus respectively
The cloned plasmids of comparison DNA segment, aspergillus flavus positive control dna segment, are respectively designated as AYc-T, AFc-T successively.
In cloned plasmids AYc-T building process, the aspergillus fumigatus positive that the primer AY-F/AY-R of use and amplification obtain is right
It is as follows according to the sequence of DNA fragmentation (AYc)：
AY-F：5'-TTTAGAGCTGCATTCCCAAACAACT-3'
AY-R：5'-AGGTCTGGGTAATCTTGTTAAACC-3'
AYc sequences (1101bp)：
TTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGAGCTTCACACGGACGCAGACACCCCGTCCC
AGACGGGATTCTCACCCTCTATGACGGCCCGTTCCAGGGCACTTAGACGGGGGCTGCACCCGAAGCATCCTCTGCAA
ATTACAACGCGGACCCCGAAGGGGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATC
CCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTT
AGAAAAATAAAGTTGGGTGTCGGCTGGCGCCGGCCGGGCCTACAGAGCAGGTGACAAAGCCCCATACGCTCGAGGAC
CGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGAGGGGGACGGGGGCCCAACACACAAGCCGTGCT
TGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATG
ATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCG
TTGTTGAAAGTTTTAACTGATTACGATAATCAACTCAGACTGCATACTTTCAGAACAGCGTTCATGTTGGGGTCTTC
GGCGGGCGCGGGCCCGGGGGCGCAGGGCCTCCCCGGCGGCCGTCGAAACGGCGGGCCCGCCGAAGCAACAAGGTACG
ATAGACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACC
TTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGAGTCGTTGCCAACTCCCC
TGAGCCAGTCCGAAGGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTA
ATCGGCACGAGCTGATGACTCGTGCCTACTAGGCATTCCTCGTTGAAGAGCAATAATTGCAATGCTCTATCCCCAGC
ACGACAGGGTTTAACAAGATTACCCAGACCT
In cloned plasmids AFc-T building process, the aspergillus flavus positive that the primer AF-F/AF-R of use and amplification obtain is right
It is as follows according to the sequence of DNA fragmentation (AFc)：
AF-F：5'-TGACGGCCCGTTCCAGGGCACTTA-3'
AF-R：5'-GCCGATTACGTCCCTGCCCTTTGTA-3'
AFc sequences (905bp)：
TGACGGCCCGTTCCAGGGCACTTAGACAGGGGCCGCACCCGAAGCATCCTCTGCAAATTACAATGCGGA
CCCCGAAGGAGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCGGTTGGTTTCT
TTTCCTCCGCTTATTGATATGCTTATGTTCAGCGGGGATCCCTACCTGATCCGAGGTCAACCTGGAAAAAGATTGAT
TTGCGTTCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCC
GCCGCTGCCTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACGACCCAACACACAAGCCGTGCTTGATGGGCAGCAA
TGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATCCACGGAATT
CTGCAATTCACACTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTT
TTAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTCCGGCGGGCGCGGGCC
CGGGGCTGAGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGCGGGAGG
TTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTA
CTTCCTCTAATGACCGGGTTTGACCAACTTTCCGGCCCTGGGGGGTCGTTGCCAACCCTCCTGGGCAGTCCGAAGGC
CTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCGGC
2) 3 kinds of cloned plasmids mixing containing aspergillus niger, aspergillus fumigatus, aspergillus flavus positive control dna sequence, it is every to adjust concentration
Kind plasmid 0.02ng/ μ L.
(5) PCR reaction solution
PCR reaction solution includes dNTP (containing deoxyribonucleoside triphosphate, including dATP, dCTP, dGTP and dUTP), heat-resisting
Taq archaeal dna polymerases (Taq enzyme), uracil-N-glycosylase (UNG enzymes), reference fluorescent (be used between correction hole and hole
Fluorescence signal ROX), it is purchased from American AB I companies, article No. 4440038, MgCl2And buffer solution.
The composition of table 1, kit
Embodiment 2
The detection method of kit
Before this kit is used to be detected, the DNA of sample to be detected need to be extracted, sample to be detected can be sputum,
Hydrothorax, ascites, secretion etc. may contain the sample of aspergillus, and sample DNA can be used conventional method and extract.
1st, the preparation (reagent area in preparation) of PCR reaction tubes
(1) determine to need the reaction tube number n (sample number+negative control+positive control) carried out；Take out sterilizing purified water
(user provides for oneself) and PCR reaction solution；The other components in kit are taken out, puts on ice or room temperature is melted.All reagent constituents
Brief centrifugation is required to before use.Every part of reaction system such as table 2：
Table 2, reaction system composition
| PCR reaction solution | Primer | Probe | Sterilize purified water | Sample/reference substance | Total volume |
| 10μL | 1μL | 0.5μL | 4.5μL | 4μL | 20μL |
The dosage of above-mentioned each reagent (except sample/reference substance) is calculated by reaction tube number n, and is added in into centrifuge tube, is filled
Point mixing (it is recommended that slowly blowing and beating mixing repeatedly with pipettor, while avoids liquid splash or generates a large amount of bubbles), brief centrifugation
Afterwards, 16 μ L are dispensed to each PCR reaction tubes.
(2) above-mentioned ready PCR reaction tubes and negative control, positive control are transferred to sample process area or sample-adding
Area.
2nd, it is loaded (sample process area or sample application zone)
The DNA of 4 μ L samples to be tested or negative control or positive control sample are separately added into ready PCR reaction tubes
This, covers tightly pipe lid (or sticking sealing plate film) brief centrifugation afterwards, is transferred to pattern detection area.
3rd, PCR amplification and fluoroscopic examination (pattern detection area)
Ready reaction tube is placed in fluorescent PCR instrument, is carried out according to the sample information edited by following condition
Amplified reaction and detection (table 3)：
Table 3, amplification reaction condition
4th, interpretation of result condition is set
(1) during analysing amplified graph (AmplificationPlot) result, graph type (Plot can be generally set to
Type) it is：ΔRnvs Cycle.
(2) baseline (Baseline) is set：The analysis software of fluorescent PCR instrument can set baseline automatically, be generally circulated
3 periods are baseline before number 2 to amplification curve at first.
(3) threshold value (Threshold) is set：The analysis software of fluorescent PCR instrument can set threshold line automatically, also can be manual
It sets, usual threshold line is located at position linear in the Exponential growth stage of baseline more than amplification curve, amplification curve and threshold value
The point that line intersects is Ct values, represents report group fluorescence intensity (Rn, The Normalized Intensity after standardization
Ofthe Reporter) [Δ Rn=Rn (reading after PCR amplification)-Rn (is read the front and rear variate-value Δ Rn of amplification before PCR amplification
Number)], Ct values and the amount for reacting initial purpose DNA fragmentation are linearly negatively correlated to numerical value.
5th, quality control standard
To correlating while meeting the following conditions, otherwise this experiment is considered as invalid, it is necessary to reform this kit positive and negative：
(1) negative Quality Control：Negative control Ct values ＞ 34, and amplification curve shape is normal；Or " Undetermined ".
(2) positive quality control：Positive control Ct value≤34, and amplification curve shape is normal.
6th, the reading of experimental result
According to the analysis software specification that fluorescent PCR instrument is mating, baseline and threshold value are set (it is recommended that baseline is set first
Fixed be selected from is moved, and threshold value setting player moves, and may be provided near Δ Rn=0.3), analysis (Analyse) is then clicked in software, is
System will be automatically generated as a result, observing the Ct values of each sample amplification curve, and download in Excel file.
It is automatically analyzed using instrument software kit, obtains each sample aspergillus (FAM) Ct values, judged according to table 4.
Table 4, positive cutoff value
Embodiment 3
The performance evaluation of kit
1st, detection limit
1) this kit and the dose-effect curve of aspergillus niger positive reference product
Aspergillus niger positive reference product：That is the aspergillus niger cloned plasmids AHc-T of various concentration.
Using the kit of the embodiment of the present invention 1, according to the method for embodiment 2, aspergillus niger positive reference product are examined
It surveys.
Table 5, aspergillus niger positive reference product experimental result
5 are the results are shown in Table, kit can detect in the range of 0.000001ng/ μ l-1.0ng/ μ l.
2) this kit and the dose-effect curve of aspergillus fumigatus positive reference product
Aspergillus fumigatus positive reference product：That is the aspergillus fumigatus cloned plasmids AYc-T of various concentration.
Using the kit of the embodiment of the present invention 1, according to the method for embodiment 2, aspergillus fumigatus positive reference product are examined
It surveys.
Table 6, aspergillus fumigatus positive reference experimental result
6 are the results are shown in Table, kit can just detect in the range of 0.000001ng/ μ l-1.0ng/ μ l.
3) this kit and the dose-effect curve of aspergillus flavus positive reference product
Aspergillus flavus positive reference product：That is the aspergillus flavus cloned plasmids AFc-T of various concentration.
Using the kit of the embodiment of the present invention 1, according to the method for embodiment 2, aspergillus flavus positive reference product are examined
It surveys.
Table 7, aspergillus flavus positive reference product experimental result
7 are the results are shown in Table, kit can be detected in 0.000001ng/ μ l-1.0ng/ μ l scopes.
4) this kit and the dosage effect that three kinds of aspergillus niger, aspergillus fumigatus, aspergillus flavus positive reference product mix are bent
Line
Three kinds of aspergillus niger, aspergillus fumigatus, aspergillus flavus positive reference quality grains are by (ng/ μ l) etc. than mixing (mixing positive reference
Product), then it is diluted by 8 concentration of table.
Using the kit of the embodiment of the present invention 1, according to the method for embodiment 2, mixing positive reference product are detected.
Table 8, three kind of aspergillus mixing positive reference product experimental result
8 are the results are shown in Table, kit can be detected in 0.00001ng/ μ l-1.0ng/ μ l scopes.
2nd, it is specific
1) positive reaction
Aspergillus niger, aspergillus fumigatus, the DNA (template concentrations 1ng/ul) of aspergillus flavus are extracted respectively, using the embodiment of the present invention 1
Kit, be detected according to the method for embodiment 2.
Table 9, positive reaction experimental result
| Sample type | CT values | As a result |
| Aspergillus niger | 12.926±0.144 | It is positive |
| Aspergillus fumigatus | 12.022±0.393 | It is positive |
| Aspergillus flavus | 12.607±0.257 | It is positive |
9 are the results are shown in Table, this product can generate positive reaction with aspergillus niger, aspergillus fumigatus, aspergillus flavus.
2) cross reaction
Method：Neogenesis cryptococcus, lattice spy cryptococcus, Lauren spy cryptococcus, Candida albicans, tropical beads are extracted respectively
Bacterium, Candida glabrata, Candida parapsilosis, the DNA of staphylococcus aureus (gold subspecies) and streptococcus pneumonia, using this hair
The kit of bright embodiment 1, is detected according to the method for embodiment 2.
It the results are shown in Table 10, this kit and clinical common other kinds fungal pathogens (the special hidden ball of neogenesis cryptococcus, lattice
Bacterium, Lauren spy cryptococcus, Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis) do not generate cross reaction.
In addition, cross reaction is not present with the staphylococcus aureus (gold subspecies) in respiratory tract and streptococcus pneumonia.
Table 10, cross reaction experimental result
3rd, precision
Using the kit of the embodiment of the present invention 1, according to the method for embodiment 2, with high concentration (concentration of specimens 20ng/
ML), the mixing positive reference product of low concentration (concentration of specimens 0.4ng/mL) continuously repeat 10 detections.
Height is calculated referring to table 12 referring to table 11, the testing result of low concentration sample in the testing result of high concentration sample
Batch interior CV values of concentration samples are 0.8%, and batch interior CV values of low concentration sample are 0.5%.
Table 11, high concentration sample experimental result
| Sample number | CT values | As a result |
| J2-1 | 18.58210945 | It is positive |
| J2-2 | 18.8727932 | It is positive |
| J2-3 | 18.7986927 | It is positive |
| J2-4 | 18.62550926 | It is positive |
| J2-5 | 18.80405045 | It is positive |
| J2-6 | 18.49184036 | It is positive |
| J2-7 | 18.85089684 | It is positive |
| J2-8 | 18.52189636 | It is positive |
| J2-9 | 18.585289 | It is positive |
| J2-10 | 18.48835373 | It is positive |
Table 12, low concentration sample experimental result
| Sample number | CT values | As a result |
| J1-1 | 24.87825394 | It is positive |
| J1-2 | 24.97818947 | It is positive |
| J1-3 | 24.90193558 | It is positive |
| J1-4 | 24.72224617 | It is positive |
| J1-5 | 24.97403336 | It is positive |
| J1-6 | 24.68059349 | It is positive |
| J1-7 | 24.62869644 | It is positive |
| J1-8 | 24.84980202 | It is positive |
| J1-9 | 24.74020767 | It is positive |
| J1-10 | 24.90803337 | It is positive |
4th, stability
Heat stabilization test is carried out to kit, kit is placed in 37 DEG C of incubators and is placed, reagent can be carried out daily by taking out
The kit of box performance indicator full inspection amount carries out performance detection, continuous detection six days.Performance indicator includes minimum detection limit, the positive
Reference material coincidence rate, specificity and precision.
(1) minimum detection limit
The lowest detection of setting kit is limited to 0.005ng/mL, using the kit of the embodiment of the present invention 1, according to implementation
The method of example 2 is detected the mixing positive reference product that concentration is 0.005ng/mL, is repeated 20 times, and calculates positive detection ratio
(positive detection sample number/20).
(2) positive reference product coincidence rate
Using the kit of the embodiment of the present invention 1, according to the method for embodiment 2,10 parts of positive reference product are detected,
Calculate positive reference product coincidence rate (positive sample number/10).
Positive reference product include：100ng/mL aspergillus niger positive references product, 50ng/mL aspergillus niger positive references product, 20ng/
ML aspergillus niger positive references product, 10ng/mL aspergillus niger positive references product, 100ng/mL aspergillus flavus positive references product, 20ng/mL are yellow
Aspergillus positive reference product, 10ng/mL aspergillus flavus positive references product, 100ng/mL aspergillus fumigatus positive references product, 20ng/mL aspergillus fumigatus
Positive reference product, 10ng/mL aspergillus fumigatus positive reference product.
(3) it is specific
Using the kit of the embodiment of the present invention 1, according to the method for embodiment 2, sample is detected.Sample includes：
Specific sample similar in specific sample without measured object and measured object kind.
Specific sample without measured object includes：Plasmid, the genes of ITM2B containing the mankind of the genetic fragments of DSCR3 containing the mankind 1
The plasmid of segment, the plasmid of the genetic fragments of KLHDC8A containing the mankind, containing the mankind
The plasmid of LINC00441 genetic fragments, the plasmid of the genetic fragments of LPAR6 containing the mankind 1, the gene pieces of LPAR6 containing the mankind
Plasmid, the plasmid of the genetic fragments of RB1 containing the mankind 1, the plasmid of the genetic fragments of RB1 containing the mankind 2, the genes of RCBTB2 containing the mankind of section 2
Plasmid, the plasmid of the genetic fragments of TTC3 containing the mankind 1 of segment.
Specific sample close with measured object kind, that infection site is identical or infection symptoms are similar includes：It is read containing white
Pearl bacterium genetic fragment plasmid, the plasmid of genetic fragment containing Candida tropicalis, are read containing near smooth the plasmid of genetic fragment containing Candida glabrata
Pearl bacterium genetic fragment plasmid, the cryptococcus genetic fragment of spy containing Lauren plasmid, the cryptococcus genetic fragment of spy containing lattice plasmid, containing newborn hidden
Coccus genetic fragment plasmid, DNA containing genome of E.coli, genomic DNA containing streptococcus pneumonia, containing staphylococcus aureus
(gold subspecies) genomic DNA.
(4) precision
Using the kit of the embodiment of the present invention 1, according to the method for embodiment 2, with high concentration (concentration of specimens 20ng/
ML), the mixing positive reference product of low concentration (concentration of specimens 0.4ng/mL) continuously repeat 10 detections.
More than the testing results of 4 kinds of performance indicators summarize referring to table 13.
Table 13, stability experiment result
After can showing that this kit is placed 6 days in incubator of the temperature at 37 DEG C according to table 13, property indices bag
It includes positive reference product coincidence rate, minimum detection limit, specificity and precision and reaches design requirement.
Embodiment 4
Application of the kit in clinical sample
Clinical test chooses aspergillus traditional clinical laboratory " goldstandard " culture checking method and is used as " contrast method ".Using
" double blinding table " progress " culture calibrating " and " fluorescent PCR experiment ".For carrying out the sample of fluorescent PCR testing inspection, according to product
Specification related request is handled, and by treated, sample is (following with three kit for detecting nucleic acid of aspergillus (fluorescent PCR method)
Referred to as " examination reagent ") it is detected, testing result carries out hypothesis testing using 2 × 2 contingency tables to enumeration data, calculates
Kappa values, evaluation " examination reagent " and the uniformity of " contrast method ".For inconsistent testing result, then use and train again
It supports or send to third party's specialty sequencing company the method for making DNA sequencing, as a result further compare, comprehensive descision " examination reagent "
Clinical efficacy and uniformity.
This experiment has detected secretion, sputum and 329, bronchoalveolar lavage fluid sample altogether, and wherein positive sample is (including cigarette
Aspergillus, aspergillus flavus and aspergillus niger) 168, negative sample 161 the results are shown in Table 14：
Table 14, clinical sample testing result table
Above detection statistics indicate that, the result and the result of culture checking method detection of the detection of this kit have preferable symbol
Conjunction property (Kappa=0.79), positive coincidence rate 87.22%, negative match-rate 92.62%, total coincidence rate 89.67%.
As seen from the above embodiment, one probe specificity of pair of primers provided by the invention simultaneously detect aspergillus niger,
Three kinds of aspergillus flavus, aspergillus fumigatus aspergillus；While aspergillus niger, aspergillus flavus, aspergillus fumigatus is detected, with other clinical Common fungis, carefully
Bacterium no cross reaction, i.e. high specificity；DNA content can be detected down to the sample of 0.00001ng/ μ l-0.000001ng/ μ l
In aspergillus niger, aspergillus flavus, aspergillus fumigatus, i.e. high sensitivity, total coincidence rate be 89.67%.
Embodiment 5
Kit can quantify and detect three kinds of aspergillus
It is (each concentration of the detectable three kinds of aspergillus of this kit is uniform for 1ng/ μ l equivalent with the standard items of known concentration
Mixing), carry out the standard curve that 10 times of continuous gradient dilutions are prepared into 5 to 7 concentration points, each multiple pipe of concentration 3, to establish
Linear relationship between Ct values and concentration.An additional positive control made of positive criteria product (can also be not added with, because mark
Used in directrix curve is exactly positive criteria product), in addition plus a negative control, with independent basis because arabidopsis genetic fragment as
Negative control.Furthermore it is possible to plus an internal reference, the GAPDH house-keeping genes of employment herein, with monitor sample nucleic acid extraction process with
And the state of Fluorescence PCR system.In addition ROX fluoresceins are added in reaction system, to calibrate basic fluorescence value, eliminate hole with
Difference between hole.Standard curve forms linear equation Y=aX+b in the linear amplification region that PCR reacts, and wherein a is straight line
Slope, b are intercept of the straight line in Y-axis.Can standard curve, this hair be drawn to numerical value and Ct values according to starting template content
In bright middle Fluorescence PCR, R2For 0.997 (see Fig. 1 and Fig. 2；Fig. 1 is the fluorescent PCR amplification of the standard of quantitative detecting method
Graph；Fig. 2 is the canonical plotting of the standard amplification curve carried out by above-mentioned Fig. 1, and wherein transverse axis is containing for target DNA
Amount, the longitudinal axis is Ct values), the range of linearity is：1ng/ μ l~0.00001ng/ μ l, the Average Ct values of each concentration point are shown in Table 8.
When measuring sample, above-mentioned standard curve, positive and negative control, internal reference and certain density sample DNA are carried out at the same time fluorescent PCR
Reaction, using fluorescent PCRs instrument such as ABI7500,7300, Roches 480, quantitative principle is the Ct values according to standard curve and sample
Calculate the DNA content of sample target gene starting template.
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications also should
It is considered as protection scope of the present invention.
Sequence table
<110>Hangzhou Di Lan Bioisystech Co., Ltd
<120>Primer combination of probe and PCR kit for fluorescence quantitative a kind of while that detect three kinds of aspergillus
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
cggaaacctt gttacgactt ttact 25
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
cggtgaggcc ttcggact 18
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ccgggtttga ccaactttcc ggc 23
<210> 4
<211> 826
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
aatcgccaag ccaaattcac acttcagtat gacttgtgtc tttccaggaa ggaatttctc 60
aacctcactt ttttccttct cagtagaaac ggccttatga cctgaaagtg acattaacat 120
caagtatcat gcataacgca ttttctataa aagaaaaagg gtctaaacca aaaaaaggtg 180
cataataaac ccacatgatg cagacggtta ataatcaaca gctcctcttc atctgtaaga 240
ctggcactac cacattctgc gaatggagta ttaaaccatt cttcgaaatt atgaattgag 300
ttaaagatgt gaggaagaag aaaattaagc agcgaccata gttcttgcag actgttctgt 360
atgggagttc cagttaatag aagtctgcgc ttaatccggt agctgcatcc aggacaaatt 420
agtgtaagca aaatgtcttt aaatttcctt tgtgacagta tctttaagag ataaatcaga 480
gtaacaacta attaacacca ttcacttcag acttcatcaa gctaatgcgt aaaaaggcat 540
gtctaaacat ctttaagaaa ctagatacag tctactcaaa gaccagagta acatacagaa 600
acatacccag ttcctagagt ctttgcgaga gcacattcat ggttcttcag acgatgtcct 660
tcatcaacaa tcatgtagtt ccagtcaatt ttcttcaaaa atgctttatc tctcatgata 720
agatcgtagt gggttatcaa cacattaaat tttcctcctg ctattcttgc tcttatttca 780
gttcttttct cctttgatcc atcgtaaaga aaatcgctga atcatg 826
<210> 5
<211> 1101
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
tttagagctg cattcccaaa caactcgact cgtcgaagga gcttcacacg gacgcagaca 60
ccccgtccca gacgggattc tcaccctcta tgacggcccg ttccagggca cttagacggg 120
ggctgcaccc gaagcatcct ctgcaaatta caacgcggac cccgaagggg ccagctttca 180
aatttgagct cttgccgctt cactcgccgt tactgaggca atccctgttg gtttcttttc 240
ctccgcttat tgatatgctt aagttcagcg ggtatcccta cctgatccga ggtcaacctt 300
agaaaaataa agttgggtgt cggctggcgc cggccgggcc tacagagcag gtgacaaagc 360
cccatacgct cgaggaccgg acgcggtgcc gccgctgcct ttcgggcccg tcccccggga 420
gagggggacg ggggcccaac acacaagccg tgcttgaggg cagcaatgac gctcggacag 480
gcatgccccc cggaatacca gggggcgcaa tgtgcgttca aagactcgat gattcactga 540
attctgcaat tcacattact tatcgcattt cgctgcgttc ttcatcgatg ccggaaccaa 600
gagatccgtt gttgaaagtt ttaactgatt acgataatca actcagactg catactttca 660
gaacagcgtt catgttgggg tcttcggcgg gcgcgggccc gggggcgcag ggcctccccg 720
gcggccgtcg aaacggcggg cccgccgaag caacaaggta cgatagacac gggtgggagg 780
ttggacccag agggccctca ctcggtaatg atccttccgc aggttcacct acggaaacct 840
tgttacgact tttacttcct ctaaatgacc gggtttgacc aactttccgg ctctggggag 900
tcgttgccaa ctcccctgag ccagtccgaa ggcctcaccg agccattcaa tcggtagtag 960
cgacgggcgg tgtgtacaaa gggcagggac gtaatcggca cgagctgatg actcgtgcct 1020
actaggcatt cctcgttgaa gagcaataat tgcaatgctc tatccccagc acgacagggt 1080
ttaacaagat tacccagacc t 1101
<210> 6
<211> 905
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
tgacggcccg ttccagggca cttagacagg ggccgcaccc gaagcatcct ctgcaaatta 60
caatgcggac cccgaaggag ccagctttca aatttgagct cttgccgctt cactcgccgt 120
tactgaggca atcccggttg gtttcttttc ctccgcttat tgatatgctt atgttcagcg 180
gggatcccta cctgatccga ggtcaacctg gaaaaagatt gatttgcgtt cggcaagcgc 240
cggccgggcc tacagagcgg gtgacaaagc cccatacgct cgaggatcgg acgcggtgcc 300
gccgctgcct ttggggcccg tcccccccgg agaggggacg acgacccaac acacaagccg 360
tgcttgatgg gcagcaatga cgctcggaca ggcatgcccc ccggaatacc agggggcgca 420
atgtgcgttc aaagactcga tgatccacgg aattctgcaa ttcacactag ttatcgcatt 480
tcgctgcgtt cttcatcgat gccggaacca agagatccat tgttgaaagt tttaactgat 540
tgcgatacaa tcaactcaga cttcactaga tcagacagag ttcgtggtgt ctccggcggg 600
cgcgggcccg gggctgagag cccccggcgg ccatgaatgg cgggcccgcc gaagcaacta 660
aggtacagta aacacgggcg ggaggttggg ctcgctagga accctacact cggtaatgat 720
ccttccgcag gttcacctac ggaaaccttg ttacgacttt tacttcctct aatgaccggg 780
tttgaccaac tttccggccc tggggggtcg ttgccaaccc tcctgggcag tccgaaggcc 840
tcaccgagcc attcaatcgg tagtagcgac gggcggtgtg tacaaagggc agggacgtaa 900
tcggc 905
<210> 7
<211> 1103
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
caaacaactc gactcgtcga aggagcttta cacgggcacg gacaccccgc ccaagacggg 60
attctcaccc tctctgacgg cccgttccag ggcacttaga cgggggccgc acccaaagca 120
tcctctgcaa attacaatgc ggactccgaa ggagccagct ttcaaatttg agctcttgcc 180
gcttcactcg ccgttactga ggcaatcccg gttggtttct tttcctccgc ttattgatat 240
gcttaagttc agcgggtatc cctacctgat ccgaggtcaa cctggaaaga atggttggaa 300
aacgtcggca ggcgccggcc aatcctacag agcatgtgac aaagccccat acgctcgagg 360
atcggacgcg gtgccgccgc tgcctttcgg gcccgtcccc ccggagaggg ggacggcgac 420
ccaacacaca agccgggctt gagggcagca atgacgctcg gacaggcatg ccccccggaa 480
taccaggggg cgcaatgtgc gttcaaagac tcgatgattc actgaattct gcaattcaca 540
ttagttatcg catttcgctg cgttcttcat cgatgccgga accaagagat ccattgttga 600
aagttttaac tgattgcatt caatcaactc agactgcacg ctttcagaca gtgtccgtgt 660
tggggtctcc ggcgggcacg ggcccggggg gcagaggcgc ccccccggcg gccgacaagc 720
ggcgggcccg ccgaagcaac agggtacaat agacacggat gggaggttgg gcccaaagga 780
cccgcactcg gtaatgatcc ttccgcaggt tcacctacgg aaaccttgtt acgactttta 840
cttcctctaa atgaccgggt ttgaccaact ttccggctct ggggggtcgt tgccaaccct 900
cctgagccag tccgaaggcc tcaccgagcc attcaatcgg tagtagcgac gggcggtgtg 960
tacaaagggc agggacgtaa tcggcacgag ctgatgactc gtgcctacta ggcattcctc 1020
gttgaagagc aataattgca atgctctatc cccagcacga cagggtttaa caagattacc 1080
cagacctctc ggccaaggtg atg 1103
<210> 8
<211> 109
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
cggaaacctt gttacgactt ttacttcctc taaatgaccg ggtttgacca actttccggc 60
tctggggagt cgttgccaac tcccctgagc cagtccgaag gcctcaccg 109
<210> 9
<211> 107
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
cggaaacctt gttacgactt ttacttcctc taatgaccgg gtttgaccaa ctttccggcc 60
ctggggggtc gttgccaacc ctcctgggca gtccgaaggc ctcaccg 107
<210> 10
<211> 109
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
cggaaacctt gttacgactt ttacttcctc taaatgaccg ggtttgacca actttccggc 60
tctggggggt cgttgccaac cctcctgagc cagtccgaag gcctcaccg 109
<210> 11
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
aatcgccaag ccaaattcac ac 22
<210> 12
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
catgattcag cgattttctt tacg 24
<210> 13
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
tttagagctg cattcccaaa caact 25
<210> 14
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
aggtctgggt aatcttgtta aacc 24
<210> 15
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
tgacggcccg ttccagggca ctta 24
<210> 16
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
gccgattacg tccctgccct ttgta 25
<210> 17
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
caaacaactc gactcgtcga agga 24
<210> 18
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 18
catcaccttg gccgagaggt ctgg 24
Claims (10)
1. a kind of primer combination of probe for detecting three kinds of aspergillus simultaneously based on fluorescent PCR method, the aspergillus include aspergillus fumigatus, Huang Qu
Mould and aspergillus niger, which is characterized in that the primer includes sense primer and anti-sense primer, the nucleotide sequence of the sense primer
As shown in SEQ ID NO.1, for the sequence of the anti-sense primer as shown in SEQ ID NO.2, the probe is in SEQ ID NO.3
Terminal modified there are fluorophor, 3 ' the terminal modified substances for having fluorescent quenching group in the 5 ' of shown sequence.
2. primer combination of probe according to claim 1, which is characterized in that the fluorophor includes FAM, SYBR
Green I, JOE, VIC, NED, CY-3, TEXAS Red or CY-5.
3. primer combination of probe according to claim 1, which is characterized in that the fluorescent quenching group include TAMRA or
BHQ1。
4. detection kit that is a kind of while detecting three kinds of aspergillus, which is characterized in that the kit includes：Claims 1 to 3
Primer combination of probe, negative control, positive control and PCR reaction solution described in any one.
5. detection kit according to claim 4, which is characterized in that the PCR reaction solution includes：dATP、dCTP、
DGTP, dUTP, Taq archaeal dna polymerase, uracil-N-glycosylase, reference fluorescent, MgCl2And buffer solution.
6. kit according to claim 4, which is characterized in that the use of the sense primer, anti-sense primer and probe
Concentration independently is 8~12 μM.
7. kit according to claim 4, which is characterized in that the negative control be containing independent basis because plasmid, institute
State independent basis because sequence as shown in SEQ ID NO.4.
8. kit according to claim 4, which is characterized in that the positive control includes positive control containing aspergillus fumigatus
The plasmid of the plasmid of DNA fragmentation, the plasmid of the segment of positive control dna containing aspergillus flavus and the segment of positive control dna containing aspergillus niger, institute
State the nucleotide of aspergillus fumigatus positive control dna segment, aspergillus flavus positive control dna segment and aspergillus niger positive control dna segment
Sequence is respectively as shown in SEQ ID NO.5~7.
9. kit according to claim 4, which is characterized in that every 20 μ L reaction systems include：10 μ LPCR reaction solutions, 1
μ L sense primers and anti-sense primer, 0.5 μ L probes, 4.5 μ L water and 4 μ L detected samples.
10. kit according to claim 4, which is characterized in that the response procedures of the kit are：50℃2min；
95℃10min；95 DEG C of 15s, 57 DEG C of 30s, 40 Xun Huans.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810137954.5A CN108070675B (en) | 2018-02-10 | 2018-02-10 | Primer probe combination and fluorescent quantitative PCR kit for simultaneously detecting three kinds of aspergillus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810137954.5A CN108070675B (en) | 2018-02-10 | 2018-02-10 | Primer probe combination and fluorescent quantitative PCR kit for simultaneously detecting three kinds of aspergillus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108070675A true CN108070675A (en) | 2018-05-25 |
| CN108070675B CN108070675B (en) | 2020-04-21 |
Family
ID=62155112
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810137954.5A Active CN108070675B (en) | 2018-02-10 | 2018-02-10 | Primer probe combination and fluorescent quantitative PCR kit for simultaneously detecting three kinds of aspergillus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108070675B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108707691A (en) * | 2018-06-07 | 2018-10-26 | 杭州缔蓝生物技术有限公司 | A kind of primer combination of probe of specific detection aspergillus fumigatus and the kit that aspergillus fumigatus is detected based on fluorescent PCR method |
| CN109943662A (en) * | 2019-05-07 | 2019-06-28 | 丹娜（天津）生物科技有限公司 | A kind of primer combination of probe, kit, detection method and its application of Aspergillus point kind detection |
| CN113930542A (en) * | 2021-11-29 | 2022-01-14 | 拱北海关技术中心 | Primer probe combination and kit for detecting aflatoxin-producing fungi in food |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE19806274A1 (en) * | 1998-02-16 | 1999-08-19 | Hehlmann | Detecting Aspergillus nucleic acid in body samples by two-step polymerase chain reaction, for diagnosing aspergillosis |
| WO2002079512A2 (en) * | 2001-03-29 | 2002-10-10 | University Of Nevada - Las Vegas | Method for detection and quantification of the fungus aspergillus fumigatus using quantitative pcr |
| WO2002088386A2 (en) * | 2001-04-10 | 2002-11-07 | Eberhard-Karls-Universität Tübingen Universitätsklinikum | Nasba-based detection of fungi |
| CN101038254A (en) * | 2007-04-29 | 2007-09-19 | 南方医科大学 | PCR kit for fluorescence quantitative detecting aspergilli |
| CN103635592A (en) * | 2011-06-09 | 2014-03-12 | 东洋制罐集团控股株式会社 | Method for detecting fungi, reaction solution for PCR, and carrier for detecting fungi |
| CN104087665A (en) * | 2014-07-07 | 2014-10-08 | 福建医科大学附属协和医院 | Universal primer for detecting aspergillus flavus and aspergillus fumigatus and real-time fluorescence tHDA (Thermophilic Helicase Dependent Amplification) kit |
| US9657355B2 (en) * | 2006-11-02 | 2017-05-23 | Rutgers, The State University Of New Jersey | Assays for fungal infection |
-
2018
- 2018-02-10 CN CN201810137954.5A patent/CN108070675B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE19806274A1 (en) * | 1998-02-16 | 1999-08-19 | Hehlmann | Detecting Aspergillus nucleic acid in body samples by two-step polymerase chain reaction, for diagnosing aspergillosis |
| WO2002079512A2 (en) * | 2001-03-29 | 2002-10-10 | University Of Nevada - Las Vegas | Method for detection and quantification of the fungus aspergillus fumigatus using quantitative pcr |
| WO2002088386A2 (en) * | 2001-04-10 | 2002-11-07 | Eberhard-Karls-Universität Tübingen Universitätsklinikum | Nasba-based detection of fungi |
| US9657355B2 (en) * | 2006-11-02 | 2017-05-23 | Rutgers, The State University Of New Jersey | Assays for fungal infection |
| CN101038254A (en) * | 2007-04-29 | 2007-09-19 | 南方医科大学 | PCR kit for fluorescence quantitative detecting aspergilli |
| CN103635592A (en) * | 2011-06-09 | 2014-03-12 | 东洋制罐集团控股株式会社 | Method for detecting fungi, reaction solution for PCR, and carrier for detecting fungi |
| CN104087665A (en) * | 2014-07-07 | 2014-10-08 | 福建医科大学附属协和医院 | Universal primer for detecting aspergillus flavus and aspergillus fumigatus and real-time fluorescence tHDA (Thermophilic Helicase Dependent Amplification) kit |
Non-Patent Citations (1)
| Title |
|---|
| 洪秀华等: "《临床微生物学检验》", 31 August 2015 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108707691A (en) * | 2018-06-07 | 2018-10-26 | 杭州缔蓝生物技术有限公司 | A kind of primer combination of probe of specific detection aspergillus fumigatus and the kit that aspergillus fumigatus is detected based on fluorescent PCR method |
| CN109943662A (en) * | 2019-05-07 | 2019-06-28 | 丹娜（天津）生物科技有限公司 | A kind of primer combination of probe, kit, detection method and its application of Aspergillus point kind detection |
| CN113930542A (en) * | 2021-11-29 | 2022-01-14 | 拱北海关技术中心 | Primer probe combination and kit for detecting aflatoxin-producing fungi in food |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108070675B (en) | 2020-04-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108060263A (en) | It is a kind of to detect three kinds of cryptococcal primer combination of probe and PCR kit for fluorescence quantitative simultaneously | |
| JP5317430B2 (en) | Probe set, probe carrier, and fungal discrimination identification method | |
| CN108034745A (en) | Primer combination of probe and kit a kind of while that detect four kinds of candida albicans | |
| CN109055502B (en) | Detection method, detection kit and application of invasive fungal infection | |
| CN114085903B (en) | Primer pair probe combination product for detecting mitochondria 3243A & gtG mutation, kit and detection method thereof | |
| CN113151610B (en) | Central nervous system infection pathogen detection kit and application thereof | |
| CN108070675A (en) | Primer combination of probe and PCR kit for fluorescence quantitative a kind of while that detect three kinds of aspergillus | |
| CN111690760A (en) | Method for accurately detecting cryptococcus neoformans | |
| CN110551840A (en) | Nucleic acid reagent, kit, system and method for detecting invasive fungi | |
| CN108707691A (en) | A kind of primer combination of probe of specific detection aspergillus fumigatus and the kit that aspergillus fumigatus is detected based on fluorescent PCR method | |
| CN108456726A (en) | Spinal muscular atrophy genetic test probe, primer and kit | |
| CN115820921A (en) | Primer probe combination for detecting three kinds of lung invasive fungi and digital PCR kit thereof | |
| US20110287965A1 (en) | Methods and compositions to detect clostridium difficile | |
| CN104263833B (en) | Nucleic acid film bar and test kit for candidiasis strain identification and detection in Gene Mutation | |
| CN107447043A (en) | The type PCR detection primers pair of pig circular ring virus 3 and kit | |
| CN111206114A (en) | Primer and kit for fluorescence PCR (polymerase chain reaction) detection of nine dermatophytes | |
| CN109943662A (en) | A kind of primer combination of probe, kit, detection method and its application of Aspergillus point kind detection | |
| CN112359125A (en) | Method for rapidly detecting cryptococcus gatherensis | |
| CN110144386A (en) | For detecting the primer, probe and kit of POLE gene mutation | |
| CN106048051B (en) | A kind of candida krusei fluorescence PCR detection reagent kit | |
| CN109457020A (en) | Resistance detection composition, Resistance detection kit and Resistance detection method | |
| TW201140051A (en) | Gene group test structure | |
| CN111961763A (en) | Novel gene chip for detecting coronavirus | |
| CN109811079A (en) | A kind of DPO primer pair, detection method, kit and its application of Aspergillus point kind detection | |
| CN114381458B (en) | Ortsutsugamushi quantitative detection kit based on droplet PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |