CN108070675B

CN108070675B - Primer probe combination and fluorescent quantitative PCR kit for simultaneously detecting three kinds of aspergillus

Info

Publication number: CN108070675B
Application number: CN201810137954.5A
Authority: CN
Inventors: 方园; 任云; 欧阳云
Original assignee: Hangzhou Derlead Biotech Co ltd
Current assignee: Hangzhou Derlead Biotech Co ltd
Priority date: 2018-02-10
Filing date: 2018-02-10
Publication date: 2020-04-21
Anticipated expiration: 2038-02-10
Also published as: CN108070675A

Abstract

The invention relates to a primer probe combination and a fluorescent quantitative PCR kit for simultaneously detecting three kinds of aspergillus, belonging to the technical field of in-vitro molecular detection of pathogenic microorganisms. The invention provides a primer probe combination for simultaneously detecting three aspergillus, including aspergillus fumigatus, aspergillus flavus and aspergillus niger, based on a fluorescence PCR method, wherein the primer includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID No.1, the sequence of the downstream primer is shown as SEQ ID No.2, and the probe is a substance modified with a fluorescent group at the 5 'end and a fluorescence quenching group at the 3' end of the sequence shown as SEQ ID No. 3. The primer probe combination provided by the invention can realize simultaneous detection of aspergillus fumigatus, aspergillus flavus and aspergillus niger, and has strong detection specificity and high sensitivity.

Description

Primer probe combination and fluorescent quantitative PCR kit for simultaneously detecting three kinds of aspergillus

Technical Field

The invention relates to the technical field of in-vitro molecular detection of pathogenic microorganisms, in particular to a primer probe combination and a fluorescent quantitative PCR kit for simultaneously detecting three kinds of aspergillus.

Background

Deep mycosis is a disease caused by pathogenic fungi invading not only the skin, mucous membranes but also deep tissues and internal organs. Fungi are widely distributed in nature, and some fungi can infect human bodies to cause diseases. Deep mycoses are often secondary infections, mostly on the basis of diabetes, hematological disorders, malignancies, extensive burns, severe malnutrition or other chronic wasting diseases. Or long-term application of antibiotics, glucocorticoids and immunosuppressants to cause dysbacteriosis in the body or inhibit the immune response of the body.

Aspergillus belongs to conditional pathogenic bacteria, widely exists in a living environment, has tiny conidia, can enter an organism along with respiration, is adhered to host tissue cells by taking fibrin, laminin, fibrinogen and the like as mediators, germinates hyphae and further causes diseases. Aspergillosis is a disease caused by pathogenic aspergillus. Pathogenic aspergillus attacks the lung mainly through respiratory tract, and also can attack skin and mucous membrane. Sepsis can occur in critically ill patients, causing other tissues and systems to become compromised. Common pathogenic bacteria are aspergillus fumigatus, aspergillus flavus, aspergillus niger and the like, wherein aspergillus fumigatus is the most common pathogenic bacteria and is susceptible to infection when immune function is inhibited or impaired.

At present, the detection of aspergillus in a laboratory is mainly performed by the following four methods:

(1) pathogen culture identification and detection method

Taking the specimen from the affected part for direct smear or culture, wherein hypha or aspergillus spore can be seen on the smear, and aspergillus growth can be seen in the culture. Aspergillus is a common pollution bacterium in a laboratory, and has diagnostic value only after being repeatedly smeared or cultured and being positive for multiple times and the same strain. Although culture identification is the most commonly used method in clinical practice, the culture period is long.

(2) Pathological tissue examination

Taking damaged tissue or lymph node for biopsy, and determining diagnosis according to fungus morphology. Especially for disseminated aspergillus, the diagnosis can be made in time. The results of pathological tissue examinations are reliable, but are unacceptable to most patients due to their invasive nature, limiting their use.

(3) Immunological detection method

An enzyme-linked immunosorbent assay (ELISA) for detecting IgM and IgG antibodies of aspergillus fumigatus in serum mainly comprises 1,3- β -D glucan detection (G test) and galactomannan detection (GM test). 1,3- β -D glucan antigen is a cell wall component which is specific to all fungi except tubercle bacillus and cryptococcus, serum is used as a detection sample, galactomannan is a polysaccharide which is highly specific and highly conservative and exists in the cell wall of aspergillus and can be used as a specific molecular marker for detecting aspergillus, and the enzyme-linked immunosorbent assay (ELISA) is a common galactomannan antigen detection method, but the method has low sensitivity, cannot distinguish different strains, and often generates false positive or false negative.

(4) Real-Time fluorescent Polymerase chain reaction (Real-Time Fluorescence Polymerase chain reaction, fluorescent PCR)

The detection technology based on the real-time fluorescence polymerase chain reaction method is continuously improved and perfected after being practiced for more than two decades, is gradually the most mature nucleic acid detection method for clinical molecular diagnosis, integrates the characteristics of efficient nucleic acid amplification, gene amplification sensitivity, molecular hybridization specificity and spectral technology sensitivity and accurate quantification of a PCR technology, fundamentally solves the pollution problem of PCR amplification products, particularly a fluorescence probe method (TaqMan method), uses a pair of primers and a probe, determines that the specificity is very high, basically has no non-specific amplification, and solves the problem of cross reaction. The result judgment is objective and real. Through nucleic acid detection of the microbial pathogens, the method not only can assist in judging whether the microbial pathogens are infected, but also can investigate and monitor the prevalence of the microbial pathogens, help to establish a detection standard of the microbial pathogens, provide a basis for clinical evaluation of curative effects, assist in guiding clinical medication, predicting development of diseases and the like. However, aspergillus has a large variety, and the nucleic acid sequence homology between species and between species (and other genera such as candida, cryptococcus, etc.) is high, and meanwhile, the probability of variation of the whole fungal genome is far greater than that of a human genome, so that the gene sequences which can be selected as target gene sequences for species detection are not many, and therefore, the difficulty in designing primers and probes for specifically detecting the fluorescence PCR of common aspergillus such as aspergillus fumigatus, aspergillus flavus, aspergillus niger, etc. is relatively high.

Disclosure of Invention

The invention aims to provide a primer probe combination and a fluorescence quantitative RCR kit for simultaneously detecting three aspergilli. The primer probe combination provided by the invention can realize simultaneous detection of aspergillus fumigatus, aspergillus flavus and aspergillus niger, and has strong detection specificity and high sensitivity.

The invention provides a primer probe combination for simultaneously detecting three aspergillus, including aspergillus fumigatus, aspergillus flavus and aspergillus niger, based on a fluorescence PCR method, wherein the primer includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID No.1, the sequence of the downstream primer is shown as SEQ ID No.2, and the probe is a substance modified with a fluorescent group at the 5 'end and a fluorescence quenching group at the 3' end of the sequence shown as SEQ ID No. 3.

Preferably, the fluorophore comprises FAM, SYBR Green I, JOE, VIC, NED, CY-3, TEXAS Red or CY-5.

Preferably, the fluorescence quenching group comprises TAMRA or BHQ 1.

The invention also provides a detection kit for simultaneously detecting three aspergilli, which comprises: the technical scheme comprises a primer probe combination, a negative control, a positive control and a PCR reaction solution.

Preferably, the PCR reaction solution includes: dATP, dCTP, dGTP, dUTP, Taq DNA polymerase, uracil-N-glycosylase, reference fluorescence, MgCl₂And a buffer.

Preferably, the upstream primer, the downstream primer and the probe are independently used at a concentration of 8 to 12. mu.M.

Preferably, the negative control is a plasmid containing an unrelated gene, and the sequence of the unrelated gene is shown as SEQ ID No. 4.

Preferably, the positive control comprises a plasmid containing an aspergillus fumigatus positive control DNA fragment, a plasmid containing an aspergillus flavus positive control DNA fragment and a plasmid containing an aspergillus niger positive control DNA fragment, and the nucleotide sequences of the aspergillus fumigatus positive control DNA fragment, the aspergillus flavus positive control DNA fragment and the aspergillus niger positive control DNA fragment are respectively shown in SEQ ID No. 5-7.

Preferably, each 20. mu.L of the reaction system comprises: 10 μ L of LPCR reaction solution, 1 μ L of upstream primer and downstream primer, 0.5 μ L of probe, 4.5 μ L of water, and 4 μ L of sample to be detected.

Preferably, the reaction procedure of the kit is as follows: 2min at 50 ℃; 10min at 95 ℃; 95 ℃ for 15s, 57 ℃ for 30s, 40 cycles.

The invention provides a primer probe combination for simultaneously detecting three kinds of aspergillus. The primer probe combination provided by the invention can realize simultaneous detection of aspergillus fumigatus, aspergillus flavus and aspergillus niger, and has strong detection specificity and high sensitivity. Test results show that the primer probe combination provided by the invention can detect aspergillus fumigatus, aspergillus flavus and aspergillus niger with the concentration respectively in the range of 0.000001 ng/muL-1.0 ng/muL; no cross reaction with other bacteria; the precision CV value is less than or equal to 5 percent; the stability is high; has good clinical application effect. The lowest detection limit was 0.000001 ng/. mu.L.

Drawings

FIG. 1 is a graph of a standard fluorescent PCR amplification curve provided in example 5 of the present invention;

FIG. 2 is a standard curve of the amplification curve provided in example 5 of the present invention.

Detailed Description

According to the invention, specific primers and fluorescence-labeled probes are designed according to homologous conserved genome DNA fragments of aspergillus niger, aspergillus fumigatus and aspergillus flavus, whether a specific PCR product is formed or not is judged by detecting the intensity of a fluorescence signal and the shape of an amplification curve, and then whether a detected sample contains a target DNA fragment or not is judged. The invention selects the conserved sequence of the aspergillus ribosome part as the part of the target gene, designs the universal primer and the probe which can simultaneously detect three aspergillus fumigatus, aspergillus flavus and aspergillus niger through a large amount of sequence comparison and screening, the three oligonucleotides can simultaneously identify the three aspergillus, but do not cross with other fungus strains such as candida albicans, candida tropicalis, candida glabrata, candida parapsilosis, cryptococcus neoformans, cryptococcus gatae, cryptococcus laurentii and the like, and the specificity of the primer and the probe is fully realized without losing sensitivity.

The invention screens target sequences which are used for detecting the aspergillus and are different from other species according to the sequence of genome DNA of ribosome RNA of aspergillus fumigatus, aspergillus flavus and aspergillus niger, wherein the nucleotide sequence of the target sequences is as follows:

(1) the Aspergillus fumigatus target sequence (109bp) is shown in SEQ ID NO. 8:

CGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGAGTCGTTGCCAACTCCCCTGAGCCAGTCCGAAGGCCTCACCG；

(2) the target sequence of the aspergillus flavus (107bp) is shown as SEQ ID NO. 9:

CGGAAACCTTGTTACGACTTTTACTTCCTCTAATGACCGGGTTTGACCAACTTTCCGGCCCTGGGGGGTCGTTGCCAACCCTCCTGGGCAGTCCGAAGGCCTCACCG；

(3) the Aspergillus niger target sequence (109bp) is shown in SEQ ID NO. 10:

CGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGGGTCGTTGCCAACCCTCCTGAGCCAGTCCGAAGGCCTCACCG；

the invention designs a primer aiming at target sequences of aspergillus fumigatus, aspergillus flavus and aspergillus niger, wherein the nucleotide sequence of an upstream primer (Asp-F) is shown as SEQ ID NO. 1: 5'-CGGAAACCTTGTTACGACTTTTACT-3', respectively; the nucleotide sequence of the downstream primer (Asp-R) nucleotide is shown as SEQ ID NO. 2: 5'-CGGTGAGGCCTTCGGACT-3' are provided. The source of the primer is not particularly limited in the present invention, and the primer can be artificially synthesized by a biological company well known to those skilled in the art, such as the Shanghai Czeri Biotechnology Ltd.

The invention designs the probe according to the target sequences of aspergillus fumigatus, aspergillus flavus and aspergillus niger, and the obtained probe is as follows: a substance of which the 5 'end of the nucleotide sequence (5'-CCGGGTTTGACCAACTTTCCGGC-3') shown in SEQ ID NO.3 is modified with a fluorescent group and the 3' end is modified with a fluorescence quenching group. In the present invention, the fluorescent group includes FAM, SYBRGreenI, JOE, VIC, NED, CY-3, TEXAS Red or CY-5, etc., preferably FAM; in the present invention, the fluorescence quenching group includes TAMRA, BHQ1, and the like, and Tetramethylrhodamine (TAMRA) is preferable. The method for synthesizing the probe is not particularly limited in the present invention, and the probe may be synthesized by a biological company known to those skilled in the art, such as the Shanghai Czeri Biotechnology Ltd.

In the invention, the kit preferably comprises the upstream primer with the concentration of 8-12 mu M, more preferably 9-11 mu M, and most preferably 10 mu M. In the invention, the kit preferably comprises 15-25 μ L of upstream primer, more preferably 18-23 μ L, and most preferably 22 μ L. In the present invention, the solvent of the upstream primer is preferably deionized water.

In the invention, the kit preferably comprises a downstream primer with the concentration of 8-12 mu M, more preferably 9-11 mu M, and most preferably 10 mu M. In the invention, the kit preferably comprises 15-25 μ L of downstream primer, more preferably 18-23 μ L, and most preferably 22 μ L. In the present invention, the solvent of the downstream primer is preferably deionized water.

In the invention, the kit preferably comprises probes with the concentration of 8-12 mu M, more preferably 9-11 mu M, and most preferably 10 mu M. In the invention, the kit preferably comprises 8-15 μ L of the probe, more preferably 10-12 μ L, and most preferably 11 μ L. In the present invention, the solvent of the probe is preferably deionized water.

In the invention, the negative control is a plasmid containing an unrelated gene, and the sequence of the unrelated gene is shown as SEQ ID No. 4. In the invention, the unrelated gene is a DNA fragment of a plant Arabidopsis thaliana, and the specific sequence of the Arabidopsis thaliana DNA fragment is as follows:

AATCGCCAAGCCAAATTCACACTTCAGTATGACTTGTGTCTTTCCAGGAAGGAATTTCTCAACCTCACTTTTTTCCTTCTCAGTAGAAACGGCCTTATGACCTGAAAGTGACATTAACATCAAGTATCATGCATAACGCATTTTCTATAAAAGAAAAAGGGTCTAAACCAAAAAAAGGTGCATAATAAACCCACATGATGCAGACGGTTAATAATCAACAGCTCCTCTTCATCTGTAAGACTGGCACTACCACATTCTGCGAATGGAGTATTAAACCATTCTTCGAAATTATGAATTGAGTTAAAGATGTGAGGAAGAAGAAAATTAAGCAGCGACCATAGTTCTTGCAGACTGTTCTGTATGGGAGTTCCAGTTAATAGAAGTCTGCGCTTAATCCGGTAGCTGCATCCAGGACAAATTAGTGTAAGCAAAATGTCTTTAAATTTCCTTTGTGACAGTATCTTTAAGAGATAAATCAGAGTAACAACTAATTAACACCATTCACTTCAGACTTCATCAAGCTAATGCGTAAAAAGGCATGTCTAAACATCTTTAAGAAACTAGATACAGTCTACTCAAAGACCAGAGTAACATACAGAAACATACCCAGTTCCTAGAGTCTTTGCGAGAGCACATTCATGGTTCTTCAGACGATGTCCTTCATCAACAATCATGTAGTTCCAGTCAATTTTCTTCAAAAATGCTTTATCTCTCATGATAAGATCGTAGTGGGTTATCAACACATTAAATTTTCCTCCTGCTATTCTTGCTCTTATTTCAGTTCTTTTCTCCTTTGATCCATCGTAAAGAAAATCGCTGAATCATG。

in the present invention, the negative control is set by selecting a plant pattern genetic material gene which has no significant homology with human genes and no significant homology with fungal genes, and does not cause cross reaction with human and fungal genes; however, the unrelated gene fragment has the general characteristics of all gene fragments, i.e., it is composed of four common deoxyribonucleic acids ATCG, and is a real nucleic acid gene sequence, which is more representative as a negative control than a blank control or a buffer control which is usually used. The concentration of the negative control is preferably 1 ng/mL. In the present invention, the negative control is preferably a plasmid containing a plant Arabidopsis DNA fragment, and in the present invention, the plasmid is preferably pTG 19-T. The construction process of the negative control plasmid of the invention is preferably as follows: extracting the genome DNA of arabidopsis; using arabidopsis genome DNA as a template, and carrying out PCR amplification by using a primer A and a primer B to obtain an arabidopsis DNA fragment; this Arabidopsis thaliana DNA fragment was ligated into pTG19-T vector to construct a negative control plasmid. In the invention, the nucleotide sequence of the primer A is shown as SEQ ID NO. 11: 5'-AATCGCCAAGCCAAATTCACAC-3', respectively; the nucleotide sequence of the primer B is shown as SEQ ID NO. 12: 5'-CATGATTCAGCGATTTTCTTTACG-3' are provided.

In the present invention, the system for amplifying arabidopsis DNA fragment by PCR is preferably: 4. mu.l of 5 Xbuffer (50mM Tris-HCl [ pH 8.5], 50mM NaCl, 0.5mg/ml BSA); 25mM MgCl 1.6. mu.l; 0.5. mu.l of 10mM dNTP; 10 μ MPrimer-F0.5 μ l; 10 μ M Primer-R0.5 μ l; genomic DNA1 ng; 5U/. mu.l Taq enzyme 0.25. mu.l; sterilized ultrapure water was added to 20. mu.l.

In the present invention, the amplification conditions for PCR amplification of an Arabidopsis DNA fragment are preferably: 4min at 95 ℃; 30s at 95 ℃, 30s at 51 ℃, 60s at 72 ℃ and 35 cycles; 5min at 72 ℃; 12 ℃ and oc.

In the present inventionIn the present invention, the method for ligating the Arabidopsis thaliana DNA fragment into pTG19-T vector preferably comprises: 1. mu.l of pTG19-T (25 ng/. mu.l); 4. mu.l of fresh PCR product; 10xT4Buffer1 μ l; T4DNALigase2.5units; ddH₂O was added to 10. mu.l. The reagents are mixed evenly and centrifuged, the mixture is connected for 1 hour at 16 ℃, 10 mul of connection reactant is transformed into 100 mul of competent cells, the competent cells are placed in an ice bath for 20 minutes, after heat shock is carried out for 45 seconds at 42 ℃, the competent cells are placed in the ice bath for 2 minutes, 500 mul of SOC or LB culture medium is added, shake culture is carried out for 60 minutes at 37 ℃, the competent cells are cultured on an L-agar plate culture medium containing X-Gal, IPTG and Amp to form a single colony, a single white colony is selected, an insert fragment is identified by an enzyme cutting method or a PCR method, and finally a PCR product is sent to sequence to confirm the cloned target gene fragment.

In the invention, the positive control comprises a plasmid containing an aspergillus fumigatus positive control DNA fragment, a plasmid containing an aspergillus flavus positive control DNA fragment and a plasmid containing an aspergillus niger positive control DNA fragment, and the nucleotide sequences of the aspergillus fumigatus positive control DNA fragment, the aspergillus flavus positive control DNA fragment and the aspergillus niger positive control DNA fragment are respectively shown in SEQ ID No. 5-7. In the invention, the three aspergillus positive control DNA fragments are respectively designed aiming at the three aspergillus target sequences, and the lengths of the three aspergillus positive control DNA fragments are respectively longer than the three aspergillus target sequences, namely, the three aspergillus positive control DNA fragments can completely cover the whole target sequence of fluorescence PCR amplification.

In the present invention, the positive control is preferably a plasmid containing the DNA fragment of the positive control, and the concentration of the plasmid is preferably 20 ng/mL. In the present invention, the plasmid is preferably pTG 19-T.

In the invention, the nucleotide sequence (AYc 1101bp 1101) of the aspergillus fumigatus positive control DNA fragment is shown in SEQ ID NO. 5:

TTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGAGCTTCACACGGACGCAGACACCCCGTCCCAGACGGGATTCTCACCCTCTATGACGGCCCGTTCCAGGGCACTTAGACGGGGGCTGCACCCGAAGCATCCTCTGCAAATTACAACGCGGACCCCGAAGGGGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTTAGAAAAATAAAGTTGGGTGTCGGCTGGCGCCGGCCGGGCCTACAGAGCAGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGAGGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTGATTACGATAATCAACTCAGACTGCATACTTTCAGAACAGCGTTCATGTTGGGGTCTTCGGCGGGCGCGGGCCCGGGGGCGCAGGGCCTCCCCGGCGGCCGTCGAAACGGCGGGCCCGCCGAAGCAACAAGGTACGATAGACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGAGTCGTTGCCAACTCCCCTGAGCCAGTCCGAAGGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCGGCACGAGCTGATGACTCGTGCCTACTAGGCATTCCTCGTTGAAGAGCAATAATTGCAATGCTCTATCCCCAGCACGACAGGGTTTAACAAGATTACCCAGACCT。

in the invention, the nucleotide sequence (AFc 905bp) of the Aspergillus flavus positive control DNA fragment is shown as SEQ ID NO. 6:

TGACGGCCCGTTCCAGGGCACTTAGACAGGGGCCGCACCCGAAGCATCCTCTGCAAATTACAATGCGGACCCCGAAGGAGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCGGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTATGTTCAGCGGGGATCCCTACCTGATCCGAGGTCAACCTGGAAAAAGATTGATTTGCGTTCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACGACCCAACACACAAGCCGTGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATCCACGGAATTCTGCAATTCACACTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTCCGGCGGGCGCGGGCCCGGGGCTGAGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGCGGGAGGTTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAATGACCGGGTTTGACCAACTTTCCGGCCCTGGGGGGTCGTTGCCAACCCTCCTGGGCAGTCCGAAGGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCGGC。

in the invention, the nucleotide sequence (AHc 1103bp) of the Aspergillus niger positive control DNA fragment is shown in SEQ ID NO. 7:

CAAACAACTCGACTCGTCGAAGGAGCTTTACACGGGCACGGACACCCCGCCCAAGACGGGATTCTCACCCTCTCTGACGGCCCGTTCCAGGGCACTTAGACGGGGGCCGCACCCAAAGCATCCTCTGCAAATTACAATGCGGACTCCGAAGGAGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCGGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAGAATGGTTGGAAAACGTCGGCAGGCGCCGGCCAATCCTACAGAGCATGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCCGGAGAGGGGGACGGCGACCCAACACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCATTCAATCAACTCAGACTGCACGCTTTCAGACAGTGTCCGTGTTGGGGTCTCCGGCGGGCACGGGCCCGGGGGGCAGAGGCGCCCCCCCGGCGGCCGACAAGCGGCGGGCCCGCCGAAGCAACAGGGTACAATAGACACGGATGGGAGGTTGGGCCCAAAGGACCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGGGTCGTTGCCAACCCTCCTGAGCCAGTCCGAAGGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCGGCACGAGCTGATGACTCGTGCCTACTAGGCATTCCTCGTTGAAGAGCAATAATTGCAATGCTCTATCCCCAGCACGACAGGGTTTAACAAGATTACCCAGACCTCTCGGCCAAGGTGATG。

according to the invention, taking aspergillus fumigatus as an example, the construction method of the clone plasmid of the aspergillus fumigatus positive control DNA fragment comprises the steps of extracting the genomic DNA of aspergillus fumigatus, taking the aspergillus fumigatus genomic DNA as a template, carrying out PCR amplification by using a primer AY-F/AY-R to obtain the aspergillus fumigatus positive control DNA fragment, recovering and purifying a PCR product, connecting the PCR product into a plasmid vector (pTG19-T), transforming escherichia coli DH5 α, carrying out sequencing verification on a recombinant transformant, extracting the plasmid after culturing the recombinant transformant to obtain a clone plasmid AYc-T.

According to the construction method of the cloning plasmid of the positive control DNA fragment of aspergillus fumigatus, the cloning plasmids containing the positive control DNA fragment of aspergillus flavus and the positive control DNA fragment of aspergillus niger are respectively constructed and are respectively named as follows in sequence: AFc-T and AHc-T.

In the construction process of the clone plasmid AFc-T of the positive control DNA fragment of the aspergillus flavus, the AF-F/AF-R primer is preferably adopted to amplify the positive control DNA fragment of the aspergillus flavus. The nucleotide sequence of the primer AF-F is shown as SEQ ID NO. 15: 5'-TGACGGCCCGTTCCAGGGCACTTA-3', respectively; the nucleotide sequence of the primer AF-R is shown as SEQ ID NO. 16: 5'-GCCGATTACGTCCCTGCCCTTTGTA-3' are provided.

In the construction process of the cloning plasmid AHc-T of the Aspergillus niger positive control DNA fragment, the AH-F/AH-R primer is preferably adopted to amplify the Aspergillus niger positive control DNA fragment. The nucleotide sequence of the primer AH-F is shown as SEQ ID NO. 17: 5'-CAAACAACTCGACTCGTCGAAGGA-3', respectively; the nucleotide sequence of the primer AH-R is shown as SEQ ID NO. 18: 5'-CATCACCTTGGCCGAGAGGTCTGG-3' are provided.

In the present invention, the PCR reaction solution includes: dATP, dCTP, dGTP, dUTP, Taq DNA polymerase, uracil-N-glycosylase, reference fluorescence, MgCl₂And a buffer. The reference fluorescence of the present invention, preferably available from ABI, USA under the designation 4440038, functions to correct the well-to-well fluorescence signal ROX. In the present invention, the PCR reaction solution preferably includes 400 to 500. mu.M dNTP, 0.1 to 0.2U/. mu.L Taq enzyme, 0.1 to 0.2U/. mu.L UNG enzyme, 0.1 to 0.25. mu.M reference fluorescence ROX, and 3 to 6mM MgCl₂And a buffer; in the invention, the buffer solution comprises 10-20 mM Tris-HCl and 100-200 mM KCl, and the pH value of the Tris-HCl is 8.

In the present invention, the storage temperature of each component in the kit is preferably-20 ℃, wherein the probe is preferably stored under the condition of being protected from light.

In the invention, the samples to be detected of the kit comprise sputum, pleural effusion, ascites, secretion and the like. The invention has no special limitation on the method for extracting the DNA of the sample variety to be detected, and the DNA can be extracted by adopting a conventional method.

In the present invention, each 20. mu.L of the reaction system comprises: 10 μ L of LPCR reaction solution, 1 μ L of upstream primer and downstream primer, 0.5 μ L of probe, 4.5 μ L of water, and 4 μ L of sample to be detected.

In the present invention, the reaction procedure of the kit is as follows: 2min at 50 ℃; 10min at 95 ℃; 95 ℃ for 15s, 57 ℃ for 30s, 40 cycles.

In the invention, when the Ct value of the sample is less than or equal to 34 and the amplification curve shape is normal, a better logarithmic growth curve is obtained, and the detection result is positive; when the Ct value of the sample is more than 34 or "degraded" or the shape of the amplification curve is abnormal, i.e., no good logarithmic growth curve exists, the detection result is negative. The invention preferably calculates the DNA content of the target gene starting template in the sample according to the standard curve and the Ct value of the sample.

The primer probe combination for simultaneously detecting three aspergilli and the fluorescence quantitative RCR kit are further described in detail with reference to specific examples, and the technical scheme of the invention includes but is not limited to the following examples.

Example 1

Composition of the kit

1. Primer design

According to the sequences of the genome DNA of ribosomal RNA of Aspergillus niger, Aspergillus fumigatus and Aspergillus flavus, the target sequences which can universally detect the three Aspergillus species and are different from other species are screened, and the nucleotide sequences of the target sequences are as follows:

(1) aspergillus fumigatus target sequence (109 bp):

CGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGAGTCGTTGCCAACTCCCCTGAGCCAGTCCGAAGGCCTCACCG。

(2) aspergillus flavus target sequence (107 bp):

CGGAAACCTTGTTACGACTTTTACTTCCTCTAATGACCGGGTTTGACCAACTTTCCGGCCCTGGGGGGTCGTTGCCAACCCTCCTGGGCAGTCCGAAGGCCTCACCG。

(3) aspergillus niger target sequence (109 bp):

CGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGGGTCGTTGCCAACCCTCCTGAGCCAGTCCGAAGGCCTCACCG。

specific primers for detecting the three aspergillus are designed aiming at target sequences of aspergillus fumigatus, aspergillus flavus and aspergillus niger by fluorescent PCR, and are consigned to Shanghai Czejust biotechnology Limited company for synthesis.

The base sequence of the specific primer is as follows:

upstream primer (Asp-F): 5'-CGGAAACCTTGTTACGACTTTTACT-3'

Downstream primer (Asp-R): 5'-CGGTGAGGCCTTCGGACT-3'

2. Fluorescent probe design

In the present invention, the primer and the probe are preferably designed based on a homologous target sequence common to the three types of koji molds.

Fluorescent probe sequence:

and (3) probe: FAM-5'-CCGGGTTTGACCAACTTTCCGGC-3' -TAMRA.

The 5' end of the fluorescent probe is provided with a FAM fluorescent group, FAM is carboxyfluorescein, the absorption wavelength of the fluorescent probe is 492nm, and the emission wavelength of the fluorescent probe is 518 nm. The 3' end of the fluorescent probe is provided with a fluorescence quenching group TAMRA (tetramethyl rhodamine). The probe was synthesized by Shanghai Czeri Biotechnology, Inc.

3. Composition of the kit

(1) Primer and method for producing the same

The primer consists of the upstream primer and the downstream primer, and the concentration is 10 mu M respectively.

(2) Probe needle

The probe was the above-mentioned fluorescent probe, and the probe concentration was 10. mu.M.

(3) Negative control

The negative control is a plasmid containing an irrelevant gene, the irrelevant gene is a DNA fragment of a plant Arabidopsis thaliana, and the concentration of the negative control is 1 ng/mL.

The construction process of the negative control plasmid is as follows: extracting the genome DNA of arabidopsis; using arabidopsis genome DNA as a template, and carrying out PCR amplification by using a primer A and a primer B to obtain an arabidopsis DNA fragment; this Arabidopsis thaliana DNA fragment was ligated into pTG19-T vector to construct a negative control plasmid.

Primer A: 5'-AATCGCCAAGCCAAATTCACAC-3'

And (3) primer B: 5'-CATGATTCAGCGATTTTCTTTACG-3'

Arabidopsis DNA fragment sequence:

(4) positive control

The positive control is 3 kinds of cloning plasmids respectively containing positive control DNA sequences of aspergillus fumigatus, aspergillus flavus and aspergillus niger, and the concentration of each aspergillus is 20 ng/mL.

The preparation process of the positive control comprises the following steps:

1) construction of three cloning plasmids

Extracting the genomic DNA of Aspergillus niger, using the genomic DNA as a template, adopting a primer AH-F/AH-R to carry out PCR amplification to obtain an Aspergillus niger positive control DNA fragment, recovering and purifying a PCR product, connecting the PCR product into a plasmid vector (pTG19-T), transforming Escherichia coli DH5 α, carrying out sequencing verification on a recombinant transformant, wherein the Aspergillus niger positive control DNA fragment (AHc) is shown as follows.

AH-F：5'-CAAACAACTCGACTCGTCGAAGGA-3'

AH-R：5'-CATCACCTTGGCCGAGAGGTCTGG-3'

AHc sequence (1103 bp):

CAAACAACTCGACTCGTCGAAGGAGCTTTACACGGGCACGGACACCCCGCCCAAGACGGGATTCTCACCCTCTCTGACGGCCCGTTCCAGGGCACTTAGACGGGGGCCGCACCCAAAGCATCCTCTGCAAATTACAATGCGGACTCCGAAGGAGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCGGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAGAATGGTTGGAAAACGTCGGCAGGCGCCGGCCAATCCTACAGAGCATGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCCGGAGAGGGGGACGGCGACCCAACACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCATTCAATCAACTCAGACTGCACGCTTTCAGACAGTGTCCGTGTTGGGGTCTCCGGCGGGCACGGGCCCGGGGGGCAGAGGCGCCCCCCCGGCGGCCGACAAGCGGCGGGCCCGCCGAAGCAACAGGGTACAATAGACACGGATGGGAGGTTGGGCCCAAAGGACCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGGGTCGTTGCCAACCCTCCTGAGCCAGTCCGAAGGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCGGCACGAGCTGATGACTCGTGCCTACTAGGCATTCCTCGTTGAAGAGCAATAATTGCAATGCTCTATCCCCAGCACGACAGGGTTTAACAAGATTACCCAGACCTCTCGGCCAAGGTGATG

by referring to the construction method of the cloning plasmid containing the Aspergillus niger positive control DNA fragment, the cloning plasmids containing the Aspergillus fumigatus positive control DNA fragment and the Aspergillus flavus positive control DNA fragment are respectively constructed and are respectively named AYc-T, AFc-T in sequence.

The primers AY-F/AY-R and the amplified Aspergillus fumigatus positive control DNA fragment (AYc) used in the construction of the cloned plasmid AYc-T have the following sequences:

AY-F：5'-TTTAGAGCTGCATTCCCAAACAACT-3'

AY-R：5'-AGGTCTGGGTAATCTTGTTAAACC-3'

AYc sequence (1101 bp):

TTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGAGCTTCACACGGACGCAGACACCCCGTCCCAGACGGGATTCTCACCCTCTATGACGGCCCGTTCCAGGGCACTTAGACGGGGGCTGCACCCGAAGCATCCTCTGCAAATTACAACGCGGACCCCGAAGGGGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTTAGAAAAATAAAGTTGGGTGTCGGCTGGCGCCGGCCGGGCCTACAGAGCAGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGAGGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTGATTACGATAATCAACTCAGACTGCATACTTTCAGAACAGCGTTCATGTTGGGGTCTTCGGCGGGCGCGGGCCCGGGGGCGCAGGGCCTCCCCGGCGGCCGTCGAAACGGCGGGCCCGCCGAAGCAACAAGGTACGATAGACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGAGTCGTTGCCAACTCCCCTGAGCCAGTCCGAAGGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCGGCACGAGCTGATGACTCGTGCCTACTAGGCATTCCTCGTTGAAGAGCAATAATTGCAATGCTCTATCCCCAGCACGACAGGGTTTAACAAGATTACCCAGACCT

in the construction process of the clone plasmid AFc-T, the adopted primer AF-F/AF-R and the amplified positive control DNA fragment (AFc) of the aspergillus flavus have the following sequences:

AF-F：5'-TGACGGCCCGTTCCAGGGCACTTA-3'

AF-R：5'-GCCGATTACGTCCCTGCCCTTTGTA-3'

AFc sequence (905 bp):

TGACGGCCCGTTCCAGGGCACTTAGACAGGGGCCGCACCCGAAGCATCCTCTGCAAATTACAATGCGGACCCCGAAGGAGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCGGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTATGTTCAGCGGGGATCCCTACCTGATCCGAGGTCAACCTGGAAAAAGATTGATTTGCGTTCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACGACCCAACACACAAGCCGTGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATCCACGGAATTCTGCAATTCACACTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTCCGGCGGGCGCGGGCCCGGGGCTGAGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGCGGGAGGTTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAATGACCGGGTTTGACCAACTTTCCGGCCCTGGGGGGTCGTTGCCAACCCTCCTGGGCAGTCCGAAGGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCGGC

2) 3 kinds of cloning plasmids containing Aspergillus niger, Aspergillus fumigatus and Aspergillus flavus positive control DNA sequences are mixed, and the regulation concentration is 0.02 ng/microliter per plasmid.

(5) PCR reaction solution

The PCR reaction solution includes dNTPs (containing deoxyribonucleotide triphosphates including dATP, dCTP, dGTP and dUTP), thermostable Taq DNA polymerase (Taq enzyme), uracil-N-glycosylase (UNG enzyme), reference fluorescence (for correcting the well-to-well fluorescence signal ROX), available from ABI, USA under the trade name 4440038, MgCl₂And a buffer.

TABLE 1 compositions of the kits

Example 2

Detection method of kit

Before the kit is used for detection, DNA of a sample to be detected needs to be extracted, the sample to be detected can be a sample possibly containing aspergillus, such as sputum, pleural effusion, ascites, secretion and the like, and the DNA of the sample can be extracted by adopting a conventional method.

1. Preparation of PCR reaction tube (reagent preparation zone)

(1) Determining the number n of reaction tubes to be performed (the number of samples + negative control + positive control); taking out sterilized purified water (self-prepared by a user) and a PCR reaction solution; other components in the kit were removed and placed on ice or melted at room temperature. All kit components required transient centrifugation prior to use. The reaction systems are shown in Table 2:

TABLE 2 reaction System composition

PCR reaction solution	Primer and method for producing the same	Probe needle	Sterilized purified water	Sample/control	Total volume
						10μL	1μL	0.5μL	4.5μL	4μL	20μL

The amount of each reagent (except for the sample/reference) was calculated according to the number n of reaction tubes, added to a centrifuge tube, mixed well (it is recommended to blow and mix well slowly and repeatedly with a pipette while avoiding splashing of the liquid or generation of a large amount of air bubbles), centrifuged instantaneously, and then dispensed into each PCR reaction tube by 16. mu.L.

(2) And transferring the prepared PCR reaction tube, the negative control and the positive control to a sample processing area or a sample adding area.

2. Application of sample (sample treatment zone or application zone)

Adding 4 μ L of DNA of the sample to be detected or the negative control or positive control sample into the prepared PCR reaction tube, covering the tube cover tightly (or attaching a sealing plate film), performing instantaneous centrifugation, and transferring to the sample detection area.

3. PCR amplification and fluorescence detection (sample detection zone)

The prepared reaction tube was placed in a fluorescent PCR apparatus, and amplification reaction and detection were performed according to the edited sample information under the following conditions (Table 3):

TABLE 3 amplification reaction conditions

4. Setting of conditions for analysis of results

(1) When analyzing the results of the amplification plot (amplification plot), the graph type (Plottype) can be generally set as: Δ Rnvs Cycle.

(2) Baseline (Baseline) settings: the analysis software of the fluorescence PCR instrument can automatically set the baseline, typically from 2 cycles to 3 cycles prior to the first amplification curve.

(3) Threshold (Threshold) setting: the analysis software of The fluorescence PCR instrument can automatically set a threshold line or manually set The threshold line, usually The threshold line is set at a linear part in an exponential amplification period of an amplification curve above a baseline, a point where The amplification curve intersects with The threshold line is a Ct value which represents a variable value delta Rn [ delta Rn ═ Rn (reading after PCR amplification) -Rn (reading before PCR amplification) ] before and after The Normalized reported group fluorescence intensity (Rn, The Normalized Intensityfthe Reporter) is amplified, and The Ct value is linearly and negatively correlated with a quantity logarithm value of a reaction initial target DNA fragment.

5. Quality control standard

The kit simultaneously meets the following conditions in terms of negative and positive controls, otherwise the test is regarded as invalid and needs to be redone:

(1) negative quality control: the Ct value of the negative control is more than 34, and the shape of the amplification curve is normal; or "undersized".

(2) Positive quality control: the positive control Ct value is less than or equal to 34, and the amplification curve shape is normal.

6. Reading of Experimental results

According to the specification of analysis software matched with a fluorescent PCR instrument, firstly setting a base line and a threshold value (the base line is recommended to be set automatically, the threshold value is set manually, and can be set near delta Rn to be 0.3), then clicking analysis (analysis) in the software, automatically generating a result by a system, observing the Ct value of each sample amplification curve, and downloading the result into an Excel file.

Automatic analysis is carried out by using instrument matched software to obtain the Ct value of aspergillus (FAM) of each sample, and judgment is carried out according to the table 4.

TABLE 4 Positive judgment values

Example 3

Evaluation of the Performance of the kit

1. Detection limit

1) Dose effect curve of the kit and Aspergillus niger positive reference substance

Aspergillus niger positive reference: namely the Aspergillus niger cloning plasmid AHc-T with different concentrations.

The kit of embodiment 1 of the invention is adopted to detect the Aspergillus niger positive reference substance according to the method of embodiment 2.

TABLE 5 Aspergillus niger Positive reference test results

The results are shown in Table 5, and the kit was detectable at a range of 0.000001 ng/. mu.l to 1.0 ng/. mu.l.

2) Dose effect curve of the kit and aspergillus fumigatus positive reference substance

Aspergillus fumigatus positive reference: i.e., a different concentration of Aspergillus fumigatus clone plasmid AYc-T.

The kit of the embodiment 1 of the invention is adopted to detect the aspergillus fumigatus positive reference substance according to the method of the embodiment 2.

TABLE 6 results of Aspergillus fumigatus positive reference experiments

The results are shown in Table 6, and the kit is being detected in the range of 0.000001 ng/. mu.l to 1.0 ng/. mu.l.

3) Dose effect curve of the kit and aspergillus flavus positive reference substance

Aspergillus flavus positive reference: namely the Aspergillus flavus clone plasmid AFc-T with different concentrations.

The kit of the embodiment 1 is adopted to detect the positive reference substance of the aspergillus flavus according to the method of the embodiment 2.

TABLE 7 test results for Aspergillus flavus positive reference

The results are shown in Table 7, and the kit was detectable at a range of 0.000001 ng/. mu.l to 1.0 ng/. mu.l.

4) The kit is mixed with three positive reference products of aspergillus niger, aspergillus fumigatus and aspergillus flavus together to form a dose-effect curve

Three positive reference plasmids of Aspergillus niger, Aspergillus fumigatus and Aspergillus flavus were mixed in equal ratio (ng/. mu.l) (mixed positive reference), and then diluted according to the concentrations in Table 8.

The mixed positive reference substance was detected by using the kit of example 1 of the present invention according to the method of example 2.

TABLE 8 results of the three Aspergillus mixed positive reference

The results are shown in Table 8, and the kit was detectable at a range of 0.00001 ng/. mu.l to 1.0 ng/. mu.l.

2. Specificity of

1) Positive reaction

DNAs of Aspergillus niger, Aspergillus fumigatus and Aspergillus flavus (the template concentration is 1ng/ul) are respectively extracted, and the detection is carried out by adopting the kit of the embodiment 1 of the invention and the method of the embodiment 2.

TABLE 9 results of the Positive reaction experiment

Type of sample	CT value	Results
			Aspergillus niger	12.926±0.144	Positive for
Aspergillus fumigatus	12.022±0.393	Positive for
			Aspergillus flavus	12.607±0.257	Positive for

The results are shown in Table 9, and the product can produce positive reaction with Aspergillus niger, Aspergillus fumigatus and Aspergillus flavus.

2) Cross reaction

The method comprises the following steps: DNAs of Cryptococcus neoformans, Cryptococcus gatherens, Cryptococcus laurentii, Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, Staphylococcus aureus (subspecies aureofaciens) and Streptococcus pneumoniae were extracted, respectively, and detection was performed by the method of example 2 using the kit of example 1 of the present invention.

The results are shown in Table 10, and the kit does not produce cross reaction with other common fungal pathogens (cryptococcus neoformans, cryptococcus gatherensis, cryptococcus laurentii, candida albicans, candida tropicalis, candida glabrata and candida parapsilosis) clinically. In addition, there was no cross-reaction with staphylococcus aureus (subspecies aurantiacae) and streptococcus pneumoniae in the respiratory tract.

TABLE 10 results of the Cross-reaction experiments

3. Precision degree

Using the kit of example 1 of the present invention, the detection was repeated 10 times in succession using a mixed positive reference substance at a high concentration (sample concentration of 20ng/mL) and a low concentration (sample concentration of 0.4ng/mL) according to the method of example 2.

The results of the tests on the high concentration samples are shown in table 11, and the results of the tests on the low concentration samples are shown in table 12, and the intra-lot CV value of the high concentration samples was calculated to be 0.8%, and the intra-lot CV value of the low concentration samples was calculated to be 0.5%.

TABLE 11 results of high concentration sample experiments

Sample numbering	CT value	Results
			J2-1	18.58210945	Positive for
J2-2	18.8727932	Positive for
			J2-3	18.7986927	Positive for
J2-4	18.62550926	Positive for
			J2-5	18.80405045	Positive for
J2-6	18.49184036	Positive for
			J2-7	18.85089684	Positive for
J2-8	18.52189636	Positive for
			J2-9	18.585289	Positive for
J2-10	18.48835373	Positive for

TABLE 12 results of low concentration sample experiments

Sample numbering	CT value	Results
			J1-1	24.87825394	Positive for
J1-2	24.97818947	Positive for
			J1-3	24.90193558	Positive for
J1-4	24.72224617	Positive for
			J1-5	24.97403336	Positive for
J1-6	24.68059349	Positive for
			J1-7	24.62869644	Positive for
J1-8	24.84980202	Positive for
			J1-9	24.74020767	Positive for
J1-10	24.90803337	Positive for

4. Stability of

And (3) carrying out a thermal stability test on the kit, placing the kit in a 37 ℃ incubator, taking out the kit which can carry out the full detection quantity of the kit performance indexes every day for performance detection, and continuously detecting for six days. The performance indexes include minimum detection limit, positive reference product coincidence rate, specificity and precision.

(1) Minimum limit of detection

The lowest detection limit of the kit was set to 0.005ng/mL, and the kit of example 1 of the present invention was used to detect a mixed positive reference substance at a concentration of 0.005ng/mL by the method of example 2, and the detection was repeated 20 times to calculate the positive detection ratio (number of positive detection samples/20).

(2) Positive reference compliance rate

With the kit of example 1 of the present invention, 10 positive reference samples were detected by the method of example 2, and the positive reference sample coincidence rate (number of positive samples/10) was calculated.

The positive reference includes: 100ng/mL of Aspergillus niger positive reference substance, 50ng/mL of Aspergillus niger positive reference substance, 20ng/mL of Aspergillus niger positive reference substance, 10ng/mL of Aspergillus niger positive reference substance, 100ng/mL of Aspergillus flavus positive reference substance, 20ng/mL of Aspergillus flavus positive reference substance, 10ng/mL of Aspergillus flavus positive reference substance, 100ng/mL of Aspergillus fumigatus positive reference substance, 20ng/mL of Aspergillus fumigatus positive reference substance and 10ng/mL of Aspergillus fumigatus positive reference substance.

(3) Specificity of

The kit of example 1 of the present invention was used to detect a sample according to the method of example 2. The sample includes: a specific sample without a tested object and a specific sample similar to the species of the tested object.

Specific samples without test substances include: plasmid containing human DSCR3 gene fragment 1, plasmid containing human ITM2B gene fragment, plasmid containing human KLHDC8A gene fragment, plasmid containing human

A plasmid containing a LINC00441 gene fragment, a plasmid containing a human LPAR6 gene fragment 1, a plasmid containing a human LPAR6 gene fragment 2, a plasmid containing a human RB1 gene fragment 1, a plasmid containing a human RB1 gene fragment 2, a plasmid containing a human RCBTB2 gene fragment, and a plasmid containing a human TTC3 gene fragment 1.

Specific samples similar to the species of the test substance, the same as the site of infection, or similar to the symptoms of infection include: plasmid containing candida albicans gene fragment, plasmid containing candida tropicalis gene fragment, plasmid containing candida glabrata gene fragment, plasmid containing candida parapsilosis gene fragment, plasmid containing cryptococcus laurentii gene fragment, plasmid containing cryptococcus gatus gene fragment, plasmid containing cryptococcus neoformans gene fragment, genomic DNA containing escherichia coli, genomic DNA containing streptococcus pneumoniae, and genomic DNA containing staphylococcus aureus (golden subspecies).

(4) Precision degree

The results of the above 4 performance indicators are summarized in Table 13.

TABLE 13 stability test results

According to table 13, it can be found that after the kit is placed in an incubator at 37 ℃ for 6 days, various performance indexes including the positive reference product compliance rate, the minimum detection limit, the specificity and the precision all meet the design requirements.

Example 4

Application of kit in clinical samples

In clinical experiments, a 'gold standard' culture assay method in the traditional clinical laboratory of aspergillus is selected as a 'control method'. "culture assays" and "fluorescent PCR assays" were performed using a "double-blind table". For samples for carrying out fluorescence PCR test detection, the samples are processed according to the relevant requirements of product specifications, the processed samples are detected by an aspergillus triple nucleic acid detection kit (fluorescence PCR method) (hereinafter referred to as 'examination reagent'), the detection result adopts a 2 x 2 list table to carry out hypothesis test on counting data, a Kappa value is calculated, and the consistency of the 'examination reagent' and the 'comparison method' is evaluated. And for inconsistent detection results, adopting a method of cultivating again or sending to a third-party professional sequencing company for DNA sequencing, further comparing the results, and comprehensively judging the clinical effectiveness and consistency of the assessment reagent.

329 samples of secretion, sputum and alveolar lavage fluid were tested in this experiment, 168 samples of positive samples (including aspergillus fumigatus, aspergillus flavus and aspergillus niger) and 161 samples of negative samples, and the results are shown in table 14:

TABLE 14 Table of clinical specimen test results

The detection data show that the detection result of the kit has better conformity (Kappa is 0.79) with the detection result of a culture detection method, the positive conformity rate is 87.22%, the negative conformity rate is 92.62%, and the total conformity rate is 89.67%.

From the above embodiments, it can be known that one pair of primers and one probe provided by the invention can specifically and simultaneously detect three aspergillus niger, aspergillus flavus and aspergillus fumigatus; when detecting aspergillus niger, aspergillus flavus and aspergillus fumigatus, the kit has no cross reaction with other clinical common fungi and bacteria, namely strong specificity; aspergillus niger, Aspergillus flavus and Aspergillus fumigatus in a sample with the DNA content as low as 0.00001 ng/mu l-0.000001 ng/mu l can be detected, namely the sensitivity is high, and the total coincidence rate is 89.67%.

Example 5

The kit can quantitatively detect three kinds of aspergillus

A standard curve of 5 to 7 concentration points was prepared by 10-fold serial gradient dilution using standards of known concentration (three aspergilli detectable by the kit were each mixed homogeneously in equal amounts of 1 ng/. mu.l) to establish a linear relationship between Ct value and concentration, with 3 double tubes per concentration. Adding a positive control made of positive standard (or not, because the standard is added)The standard curve is used as a positive standard), and a negative control is added, and the gene fragment of the unrelated gene Arabidopsis is used as the negative control. In addition, an internal reference, here human GAPDH housekeeping gene, can be added to monitor the sample nucleic acid extraction process and the state of the fluorescent PCR reaction system. In addition, ROX fluorescein was added to the reaction system to calibrate the basal fluorescence values and eliminate the well-to-well differences. The standard curve forms the linear equation Y ═ aX + b in the linear amplification region of the PCR reaction, where a is the slope of the line and b is the intercept of the line on the Y axis. A standard curve can be drawn according to the logarithm value and the Ct value of the initial template content, and in the fluorescent PCR reaction of the invention, R²0.997 (see FIGS. 1 and 2; FIG. 1 is a graph showing a standard fluorescent PCR amplification curve of a quantitative detection method; FIG. 2 is a graph showing a standard amplification curve from the above FIG. 1, in which the horizontal axis represents the content of the objective DNA and the vertical axis represents the Ct value), and the linear range is: the average Ct values at each concentration point are shown in Table 8, and the average Ct values at each concentration point are from 1 ng/. mu.l to 0.00001 ng/. mu.l. When a sample is measured, the standard curve, the negative and positive controls, the internal reference and the sample DNA with a certain concentration are subjected to fluorescence PCR reaction simultaneously, and the fluorescence PCR instrument such as ABI7500, 7300, Roche 480 and the like is used, and the quantitative principle is to calculate the DNA content of the target gene initial template in the sample according to the standard curve and the Ct value of the sample.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Hangzhou Dai blue Biotechnology Co., Ltd

<120> primer probe combination and fluorescent quantitative PCR kit for simultaneously detecting three aspergilli

<160>18

<170>SIPOSequenceListing 1.0

<210>1

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

cggaaacctt gttacgactt ttact 25

<210>2

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

cggtgaggcc ttcggact 18

<210>3

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ccgggtttga ccaactttcc ggc 23

<210>4

<211>826

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

aatcgccaag ccaaattcac acttcagtat gacttgtgtc tttccaggaa ggaatttctc 60

aacctcactt ttttccttct cagtagaaac ggccttatga cctgaaagtg acattaacat 120

caagtatcat gcataacgca ttttctataa aagaaaaagg gtctaaacca aaaaaaggtg 180

cataataaac ccacatgatg cagacggtta ataatcaaca gctcctcttc atctgtaaga 240

ctggcactac cacattctgc gaatggagta ttaaaccatt cttcgaaatt atgaattgag 300

ttaaagatgt gaggaagaag aaaattaagc agcgaccata gttcttgcag actgttctgt 360

atgggagttc cagttaatag aagtctgcgc ttaatccggt agctgcatcc aggacaaatt 420

agtgtaagca aaatgtcttt aaatttcctt tgtgacagta tctttaagag ataaatcaga 480

gtaacaacta attaacacca ttcacttcag acttcatcaa gctaatgcgt aaaaaggcat 540

gtctaaacat ctttaagaaa ctagatacag tctactcaaa gaccagagta acatacagaa 600

acatacccag ttcctagagt ctttgcgaga gcacattcat ggttcttcag acgatgtcct 660

tcatcaacaa tcatgtagtt ccagtcaatt ttcttcaaaa atgctttatc tctcatgata 720

agatcgtagt gggttatcaa cacattaaat tttcctcctg ctattcttgc tcttatttca 780

gttcttttct cctttgatcc atcgtaaaga aaatcgctga atcatg 826

<210>5

<211>1101

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

tttagagctg cattcccaaa caactcgact cgtcgaagga gcttcacacg gacgcagaca 60

ccccgtccca gacgggattc tcaccctcta tgacggcccg ttccagggca cttagacggg 120

ggctgcaccc gaagcatcct ctgcaaatta caacgcggac cccgaagggg ccagctttca 180

aatttgagct cttgccgctt cactcgccgt tactgaggca atccctgttg gtttcttttc 240

ctccgcttat tgatatgctt aagttcagcg ggtatcccta cctgatccga ggtcaacctt 300

agaaaaataa agttgggtgt cggctggcgc cggccgggcc tacagagcag gtgacaaagc 360

cccatacgct cgaggaccgg acgcggtgcc gccgctgcct ttcgggcccg tcccccggga 420

gagggggacg ggggcccaac acacaagccg tgcttgaggg cagcaatgac gctcggacag 480

gcatgccccc cggaatacca gggggcgcaa tgtgcgttca aagactcgat gattcactga 540

attctgcaat tcacattact tatcgcattt cgctgcgttc ttcatcgatg ccggaaccaa 600

gagatccgtt gttgaaagtt ttaactgatt acgataatca actcagactg catactttca 660

gaacagcgtt catgttgggg tcttcggcgg gcgcgggccc gggggcgcag ggcctccccg 720

gcggccgtcg aaacggcggg cccgccgaag caacaaggta cgatagacac gggtgggagg 780

ttggacccag agggccctca ctcggtaatg atccttccgc aggttcacct acggaaacct 840

tgttacgact tttacttcct ctaaatgacc gggtttgacc aactttccgg ctctggggag 900

tcgttgccaa ctcccctgag ccagtccgaa ggcctcaccg agccattcaa tcggtagtag 960

cgacgggcgg tgtgtacaaa gggcagggac gtaatcggca cgagctgatg actcgtgcct 1020

actaggcatt cctcgttgaa gagcaataat tgcaatgctc tatccccagc acgacagggt 1080

ttaacaagat tacccagacc t 1101

<210>6

<211>905

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tgacggcccg ttccagggca cttagacagg ggccgcaccc gaagcatcct ctgcaaatta 60

caatgcggac cccgaaggag ccagctttca aatttgagct cttgccgctt cactcgccgt 120

tactgaggca atcccggttg gtttcttttc ctccgcttat tgatatgctt atgttcagcg 180

gggatcccta cctgatccga ggtcaacctg gaaaaagatt gatttgcgtt cggcaagcgc 240

cggccgggcc tacagagcgg gtgacaaagc cccatacgct cgaggatcgg acgcggtgcc 300

gccgctgcct ttggggcccg tcccccccgg agaggggacg acgacccaac acacaagccg 360

tgcttgatgg gcagcaatga cgctcggaca ggcatgcccc ccggaatacc agggggcgca 420

atgtgcgttc aaagactcga tgatccacgg aattctgcaa ttcacactag ttatcgcatt 480

tcgctgcgtt cttcatcgat gccggaacca agagatccat tgttgaaagt tttaactgat 540

tgcgatacaa tcaactcaga cttcactaga tcagacagag ttcgtggtgt ctccggcggg 600

cgcgggcccg gggctgagag cccccggcgg ccatgaatgg cgggcccgcc gaagcaacta 660

aggtacagta aacacgggcg ggaggttggg ctcgctagga accctacact cggtaatgat 720

ccttccgcag gttcacctac ggaaaccttg ttacgacttt tacttcctct aatgaccggg 780

tttgaccaac tttccggccc tggggggtcg ttgccaaccc tcctgggcag tccgaaggcc 840

tcaccgagcc attcaatcgg tagtagcgac gggcggtgtg tacaaagggc agggacgtaa 900

tcggc 905

<210>7

<211>1103

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

caaacaactc gactcgtcga aggagcttta cacgggcacg gacaccccgc ccaagacggg 60

attctcaccc tctctgacgg cccgttccag ggcacttaga cgggggccgc acccaaagca 120

tcctctgcaa attacaatgc ggactccgaa ggagccagct ttcaaatttg agctcttgcc 180

gcttcactcg ccgttactga ggcaatcccg gttggtttct tttcctccgc ttattgatat 240

gcttaagttc agcgggtatc cctacctgat ccgaggtcaa cctggaaaga atggttggaa 300

aacgtcggca ggcgccggcc aatcctacag agcatgtgac aaagccccat acgctcgagg 360

atcggacgcg gtgccgccgc tgcctttcgg gcccgtcccc ccggagaggg ggacggcgac 420

ccaacacaca agccgggctt gagggcagca atgacgctcg gacaggcatg ccccccggaa 480

taccaggggg cgcaatgtgc gttcaaagac tcgatgattc actgaattct gcaattcaca 540

ttagttatcg catttcgctg cgttcttcat cgatgccgga accaagagat ccattgttga 600

aagttttaac tgattgcatt caatcaactc agactgcacg ctttcagaca gtgtccgtgt 660

tggggtctcc ggcgggcacg ggcccggggg gcagaggcgc ccccccggcg gccgacaagc 720

ggcgggcccg ccgaagcaac agggtacaat agacacggat gggaggttgg gcccaaagga 780

cccgcactcg gtaatgatcc ttccgcaggt tcacctacgg aaaccttgtt acgactttta 840

cttcctctaa atgaccgggt ttgaccaact ttccggctct ggggggtcgt tgccaaccct 900

cctgagccag tccgaaggcc tcaccgagcc attcaatcgg tagtagcgac gggcggtgtg 960

tacaaagggc agggacgtaa tcggcacgag ctgatgactc gtgcctacta ggcattcctc 1020

gttgaagagc aataattgca atgctctatc cccagcacga cagggtttaa caagattacc 1080

cagacctctc ggccaaggtg atg 1103

<210>8

<211>109

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

cggaaacctt gttacgactt ttacttcctc taaatgaccg ggtttgacca actttccggc 60

tctggggagt cgttgccaac tcccctgagc cagtccgaag gcctcaccg 109

<210>9

<211>107

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

cggaaacctt gttacgactt ttacttcctc taatgaccgg gtttgaccaa ctttccggcc 60

ctggggggtc gttgccaacc ctcctgggca gtccgaaggc ctcaccg 107

<210>10

<211>109

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

cggaaacctt gttacgactt ttacttcctc taaatgaccg ggtttgacca actttccggc 60

tctggggggt cgttgccaac cctcctgagc cagtccgaag gcctcaccg 109

<210>11

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

aatcgccaag ccaaattcac ac 22

<210>12

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

catgattcag cgattttctt tacg 24

<210>13

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

tttagagctg cattcccaaa caact 25

<210>14

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

aggtctgggt aatcttgtta aacc 24

<210>15

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

tgacggcccg ttccagggca ctta 24

<210>16

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

gccgattacg tccctgccct ttgta 25

<210>17

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

caaacaactc gactcgtcga agga 24

<210>18

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

catcaccttg gccgagaggt ctgg 24

Claims

1. A primer probe combination for simultaneously detecting three aspergilli by a fluorescence PCR method is characterized in that the primer comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, the sequence of the downstream primer is shown as SEQ ID NO.2, and the probe is a substance modified with a fluorescent group at the 5 'end and a fluorescence quenching group at the 3' end of the sequence shown as SEQ ID NO. 3.

2. The primer probe combination of claim 1, wherein the fluorophore comprises FAM, SYBRGreenI, JOE, VIC, NED, CY-3, TEXASRed, or CY-5.

3. The primer probe combination of claim 1, wherein the fluorescence quenching group comprises TAMRA or BHQ 1.

4. A detection kit for simultaneously detecting three aspergilli is characterized by comprising: the primer probe combination according to any one of claims 1 to 3, a negative control, a positive control and a PCR reaction solution.

5. The detection kit according to claim 4, wherein the PCR reaction solution comprises: dATP, dCTP, dGTP, dUTP, TaqDNA polymerase, uracil-N-glycosylase, reference fluorescence, MgCl₂And a buffer.

6. The kit according to claim 4, wherein the negative control is a plasmid containing an unrelated gene, and the sequence of the unrelated gene is shown as SEQ ID No. 4.

7. The kit according to claim 4, wherein the positive control comprises a plasmid containing an Aspergillus fumigatus positive control DNA fragment, a plasmid containing an Aspergillus flavus positive control DNA fragment, and a plasmid containing an Aspergillus niger positive control DNA fragment, and the nucleotide sequences of the Aspergillus fumigatus positive control DNA fragment, the Aspergillus flavus positive control DNA fragment, and the Aspergillus niger positive control DNA fragment are respectively shown in SEQ ID No. 5-7.