CN110734988A

CN110734988A - methicillin-resistant staphylococcus aureus (MRSA) nucleic acid isothermal amplification method

Info

Publication number: CN110734988A
Application number: CN201810803884.2A
Authority: CN
Inventors: 商学军; 居金良; 于明辉; 崔振玲
Original assignee: SHANGHAI RENDU BIOTECHNOLOGY CO Ltd
Current assignee: SHANGHAI RENDU BIOTECHNOLOGY CO Ltd
Priority date: 2018-07-20
Filing date: 2018-07-20
Publication date: 2020-01-31
Anticipated expiration: 2038-07-20
Also published as: CN110734988B

Abstract

The invention discloses a Methicillin-resistant Staphylococcus aureus (MRSA) nucleic acid constant-temperature amplification method, which comprises the steps of amplifying in a reaction system, wherein the reaction system contains two specific primer pairs for amplifying Methicillin-resistant Staphylococcus aureus (MRSA), and the primers can amplify amplification products of two characteristic sequences (SA23s rRNA and mecA RNA) corresponding to Methicillin-resistant Staphylococcus aureus (MRSA) from a detection sample with extremely low MRSA copy number.

Description

methicillin-resistant staphylococcus aureus (MRSA) nucleic acid isothermal amplification method

Technical Field

The invention relates to the technical field of biological detection of bacteria, in particular to primers, probes and related kits used in real-time isothermal amplification detection of methicillin-resistant staphylococcus aureus (MRSA) by combining a specific target capture technology and a real-time isothermal amplification detection technology of fluorescent nucleic acid.

Background

Staphylococcus aureus (SA, abbreviated as Staphylococcus aureus) is an important pathogenic bacterium in medicine, is distributed in types, has various infection types and high drug resistance rate, particularly has multiple drug resistance to infection of methicillin-resistant Staphylococcus aureus (MRSA), has high fatality rate and becomes a difficult point of clinical anti-infection treatment.

In 1961, Jevons discovered MRSA for the first time in the United kingdom, the MRSA expanded to a plurality of countries in Europe and Canada in the middle of 60 years, and sharply increased throughout the world at the end of 70 years, and caused outbreaks, leading to rising mortality and increasing medical expenses, which become global problems.20 th century 90 th, the research reports on the prevalence of MRSA in various parts of the world increased significantly.in large teaching hospitals abroad , MRSA accounted for 60% -80% of the clinical isolation of Staphylococcus aureus, MRSA accounted for more than 80% of Staphylococcus aureus in our hospitals to 1999, while community infection MRSA accounted for nearly 22% of Staphylococcus aureus, all regions and hospitals had a trend of increasing detection rate year by year.

The detection method of methicillin-resistant staphylococcus aureus in clinical application at present comprises the following steps: paper diffusion method (K-B method), broth (agar) dilution (MIC) method, concentration gradient (E-test) method, automatic drug sensitive detection, Real-Time PCR method, etc.

The paper diffusion method (K-B method) is to add oxacillin into MH agar, adjust the bacterial liquid to 0.5 McLeod turbidity, coat on the above-mentioned plate, incubate 24h at 35 deg.C, the resistant bacteriostatic map is not more than 11mm, the sensitive bacteriostatic map is not less than 17 mm. the biggest advantage of K-B method is fast, simple and convenient, cheap, easy to accept by the inspector, but easy to cause the condition of missing detection, influenced by various factors in the culture environment, the drug resistance of bacterial strains can not be expressed completely.

The broth (agar) dilution (MIC) method comprises adding NaCl to 20g/L MH broth (or agar) culture solution, adding quantitative Ca and Mg ions, and diluting oxacillin at a ratio of about 0.125-16 μ g/ml and a bacteria concentration of 10⁴The single cell/mL is incubated for 24 hours at 35 ℃, the sensitivity is determined when the MIC is less than 2 mu g/mL, the drug resistance is determined when the MIC is more than 4 mu g/mL, the detection rate of the method can reach 95 percent, the repeatability is good, but the operation is more complicated than the specification.

The concentration gradient (E-test) method is that a test strip of oxacillin is attached to an MH agar plate containing 20g/L NaCl, the bacterial liquid is adjusted to 0.5-1 McLeod turbidity, and the bacterial liquid is incubated for 24 hours at 35 ℃ to directly read the MIC value. MIC value > 4 mug/mL is drug resistant, and MIC <2 mug/mL is sensitive. The E-test method results more accurately when detecting low or moderate drug resistant MRSA. Has the characteristics of accuracy, reliability and good stability, but is expensive.

The automatic drug sensitive detection is to dilute the bacteria liquid and inject the diluted bacteria liquid into a drug sensitive plate or a hole, and then to judge the result by detecting the turbidity of the bacteria liquid, the fluorescence intensity of a fluorescence indicator or the hydrolysis reaction of a fluorescence substrate. The method has the advantages that the method is rapid, but sometimes the accurate detection level of MRSA which has slow growth or delayed expression drug resistance is difficult to achieve within 3-4 h, and MRSA is easy to miss detection or misinformation. At present, automatic drug sensitive detection products such as a Vitek system, an ATB system, a MicroScan system, a sensor ARIS and the like exist in the market.

The nucleic acid detection is mainly Real-Time PCR method, which needs to go through dozens of temperature change cycle processes, the amplification reaction Time is long, and the product is DNA and is easy to pollute, therefore, it is necessary to develop detection kits which are rapid, sensitive, specific and not easy to pollute.

A real-time fluorescent isothermal nucleic acid Amplification and detection technology (SAT) is methods for directly and rapidly detecting RNA, and compared with real-time fluorescent PCR for detecting DNA, the detection system of the technology has reverse transcription steps, the nucleic acid Amplification is performed at temperatures (42 ℃), thermal cycling is not required, M-MLV reverse transcriptase and T7RNA polymerase are adopted for nucleic acid Amplification, compared with other nucleic acid Amplification technologies, reaction inhibitors are fewer, and false negative results can be effectively reduced.

Disclosure of Invention

The invention aims to provide MRSA detection methods which are rapid, high in accuracy, easy to control pollution, simple in equipment and low in cost.

In , the invention provides a method for amplifying methicillin-resistant staphylococcus aureus MRSA, which comprises the steps of amplifying in a reaction system, wherein the reaction system contains a specific primer pair aiming at SA23s rRNA and mecA RNA of MRSA, and the primer pair comprises:

(i) t7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 4;

(ii) nT7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 5;

(iii) t7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 6; and

(iv) nT7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 7.

In another preferred embodiment of , the reaction system further comprises M-MLV reverse transcriptase and T7RNA polymerase.

In another preferred embodiment, the reaction system further comprises capture probes for methicillin-resistant Staphylococcus aureus MRSA 23srRNA and mecA RNA.

In another preferred example, the reaction system further comprises a probe for detecting specificity of MRSA 23srRNA of methicillin-resistant Staphylococcus aureus and a probe for detecting specificity of mecA RNA.

In another preferred embodiment, the capture probes for MRSA 23s rRNA and mecA RNA specifically bind to the target nucleic acids SA23s rRNA and mecA RNA sequences of methicillin-resistant Staphylococcus aureus MRSA, respectively.

In another preferred embodiment of , the capture probe has the nucleotide sequence shown in SEQ ID NO. 3.

In another preferred embodiment of , the detection probe is labeled with a fluorescent group at end and a quenching group at end .

In another preferred embodiment of , the detection probe is labeled with FAM fluorophore at its 5 'end and DABCYL quencher at its 3' end.

In another preferred example, the MRSA SA23s rRNA detection probe has a nucleotide sequence shown in SEQ ID NO. 8, and the mecA RNA detection probe has a sequence shown in SEQ ID NO. 9.

In another preferred embodiment, the MRSA 23s rRNA detection probe and the mecA RNA detection probe are used to specifically bind to RNA copies generated from DNA copies of the MRSA target nucleic acids SA23s rRNA and mecA RNA, respectively, by T7RNA polymerase.

In another preferred embodiment of , the method further comprises performing the amplification reaction in another positive (control) reaction system or negative (control) reaction system.

In another preferred embodiment of , the control reaction system comprises the specific primer pair, SA23s rRNA internal standard and mecA RNA IC RNA internal standard, the capture probe and the detection probe.

In another preferred embodiment, the reaction system has a methicillin-resistant Staphylococcus aureus MRSA amount of less than 500 copies/ml, preferably 1-100 copies/ml, more preferably 1-50 copies/ml, most preferably 1-20 copies/ml, and a mecA copy number of less than 1000 copies/ml, preferably 1-500 copies/ml, more preferably 1-100 copies/ml, most preferably 1-20 copies/ml.

In another preferred embodiment , the method further comprises the step of detecting a fluorescent signal from a specific detection probe that detects methicillin-resistant Staphylococcus aureus MRSA 23s rRNA and mecA RNA during or after the amplification reaction.

In another preferred embodiment of , the method is a real-time fluorescent isothermal nucleic acid amplification method.

In another preferred embodiment of , the reaction system further comprises methicillin-resistant staphylococcus aureus to be detected or nucleic acid derived from SA23s rRNA or mecA RNA of the methicillin-resistant staphylococcus aureus.

In another preferred embodiment, the test nucleic acid is a nucleic acid from a methicillin-resistant Staphylococcus aureus culture.

In another preferred embodiment , the method is non-diagnostic and non-therapeutic.

In a second aspect of the invention, there is provided a non-diagnostic test for methicillin-resistant staphylococcus aureus MRSA, the test comprising:

(a) providing a reaction system, wherein the reaction system contains a sample to be detected, and also contains a specific detection probe of methicillin-resistant staphylococcus aureus MRSA 23s rRNA and a specific detection probe of mecA RNA;

(b) amplifying the reaction system by the amplification method as described in the th aspect of the invention, and

(c) and detecting fluorescent signals emitted by the specific detection probe for methicillin-resistant staphylococcus aureus MRSA 23srRNA and the specific detection probe for mecA RNA during or after the amplification reaction.

In another preferred embodiment, the method further comprises providing or more control groups.

In another preferred embodiment of , the control group comprises MRSA positive control group, MRSA negative control group, and MRSA internal standard control group.

In a third aspect of the invention, there is provided a kit for detecting methicillin-resistant staphylococcus aureus MRSA, the kit comprising:

(a) , and a pair of primers specific for amplifying SA23s rRNA of methicillin-resistant Staphylococcus aureus (MRSA) located in the container, the pair of primers comprising:

(i) t7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 4;

(ii) nT7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 5;

(b) a second container, and a specific primer pair located within the container for amplifying mecA RNA of methicillin-resistant Staphylococcus aureus (MRSA), the primer pair comprising:

(iii) t7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 6; and

(iv) nT7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 7;

and (c) instructions for use.

In another preferred embodiment of , the th container and the second container are the same or different containers.

In another preferred embodiment of , the composition further comprises or more components selected from the group consisting of:

(d) a capture probe;

(e) detecting the probe;

(f) MRSA internal standard sequence; and/or

(g) And detecting the probe by an internal standard.

In another preferred embodiment, or more features selected from the group consisting of:

the MRSA 23s rRNA detection probe comprises a nucleotide sequence shown as SEQ ID NO. 8, and the mecAN RNA detection probe comprises a nucleotide sequence shown as SEQ ID NO. 9; and/or

The capture probe comprises a nucleotide sequence shown as SEQ ID NO. 3; and/or

The MRSA 23s rRNA internal standard sequence comprises a nucleotide sequence shown as SEQ ID NO. 12, and the internal standard detection probe of the MRSA 23s rRNA comprises a nucleotide sequence shown as SEQ ID NO. 14; and/or

The mecA RNA internal standard sequence comprises a nucleotide sequence shown as SEQ ID NO. 13, and the internal standard detection probe of the mecA RNA comprises a nucleotide sequence shown as SEQ ID NO. 15.

In another preferred embodiment of , the kit further comprises or more enzymes.

In another preferred embodiment, the enzymes are M-MLV reverse transcriptase and T7RNA polymerase.

In another preferred embodiment of , the M-MLV reverse transcriptase and T7RNA polymerase are present in enzyme solution, the capture probe is present in nucleic acid extract, the T7 primer, nT7 primer and detection probe of SA23s rRNA are present in detection solution 1, and the T7 primer, nT7 primer and detection probe of mecA RNA are present in detection solution 2.

In another preferred embodiment of , the SA23s rRNA internal standard detection probe is present in detection solution 1, and the mecA RNA internal standard detection probe is present in detection solution 2.

In another preferred embodiment, the MRSA internal standard is a competitive internal standard and used with pairs of primers (T7 and nT7 of SA23s rRNA) and with MRSA target nucleotide (MecARNA) and T7 and nT7 of pairs of primer MecA RNA).

In another preferred embodiment, the kit further comprises an MRSA positive control and/or an MRSA negative control.

In another preferred embodiment, the kit includes or more of the following features:

the capture probe is specifically combined with target nucleic acid SA23s rRNA and mecA RNA sequences of methicillin-resistant staphylococcus aureus; and/or

The detection probe is an SA detection probe specifically binding to an RNA copy generated from a DNA copy of the MRSA target nucleic acid SA23s rRNA; a mecA detection probe that specifically binds to a copy of RNA generated from a DNA copy of the MRSA target nucleic acid mecA RNA.

In another preferred embodiment, the capture probe and/or the detection probe can also specifically bind to the target nucleic acids SA23s rRNA and mecA RNA sequence of methicillin-resistant Staphylococcus aureus MRSA.

In another preferred embodiment of , the kit comprises sample storage solution, nucleic acid extract, washing solution, amplification detection solution 1, extension detection solution 2, enzyme solution, positive control, negative control and internal standard;

wherein the content of the first and second substances,

the sample preservation solution comprises ammonium sulfate ((NH)₄)₂SO₄) And HEPES;

the nucleic acid extracting solution comprises a capture probe and magnetic beads;

the washing solution comprises NaCl and SDS;

the amplification detection solution 1 comprises dNTP, NTP, a T7 primer of SA23s rRNA, an nT7 primer, a detection probe and an internal standard detection probe;

the amplification detection solution 2 comprises dNTP, NTP, a T7 primer of mecA RNA, an nT7 primer, a detection probe and an internal standard detection probe;

the enzyme solution comprises M-MLV reverse transcriptase and T7RNA polymerase;

the positive control comprises methicillin-resistant staphylococcus aureus 10⁴-10⁶copy/mL SA23s rRNA and 10⁴-10⁶A mixture of in vitro transcribed RNA dilutions of the copy/mL drug-resistant mecA gene;

the negative control is a solution which does not contain methicillin-resistant staphylococcus aureus SA23s rRNA and mecA RNA sequences or does not contain methicillin-resistant staphylococcus aureus, and preferably, the negative control is physiological saline;

said internal standard is 10⁸copy/mL SA23s rRNA IC RNA (SEQ ID No.:12) dilutions and 10⁵copy/mL mecA IC RNA (SEQ ID No.:13) diluted mixture.

In another preferred embodiment of , the kit comprises a box A and a box B, wherein,

the A box is a sample processing unit and comprises the sample preservation solution, the nucleic acid extracting solution and the washing solution;

the B box is a nucleic acid amplification detection unit and comprises the amplification detection solution 1, the amplification detection solution 2, an enzyme solution, a positive control, a negative control and an internal standard.

In a fourth aspect of the invention, there are provided specific primer pairs for amplifying methicillin-resistant staphylococcus aureus MRSA 23 srna and mecA RNA, the primer pairs comprising:

(i) t7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 4;

(ii) nT7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 5;

(iii) t7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 6; and

(iv) nT7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 7.

In a fifth aspect of the invention, there is provided a use of the kit according to the third aspect of the invention or the primer pair according to the fourth aspect of the invention for preparing a detection kit or a detection reagent for detecting methicillin-resistant staphylococcus aureus MRSA.

In another preferred embodiment, the test kit or test reagent is used to detect the presence of methicillin-resistant staphylococcus aureus MRSA in human nasal, pharyngeal swab and wound exudate.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) can be combined with one another to form new or preferred embodiments.

Drawings

FIG. 1 shows the results of fluorescence detection of primer pairs and probe sequences of the SA ratio pair group;

wherein the template concentrations of

curves

1, 2, 3, 4 and 5 are 5X 10, respectively⁵Copy/ml, 5X 10⁴Copy/ml, 5000 copy/ml, 500 copy/ml, 50 copy/ml.

FIG. 2 shows the results of fluorescence detection of the primer pairs and probe sequences of the SA panel of the invention;

wherein the template concentrations of

curves

FIG. 3 shows the results of fluorescence detection of the primer pairs and probe sequences of the mecA ratio pair group;

wherein the template concentrations of

curves

1, 2, 3, 4 and 5 are 1X 10, respectively⁶Copy/ml, 1X 10⁵Copy/ml, 1X 10⁴Copy/ml, 1000 copies/ml, 100 copies/ml.

FIG. 4 shows the results of fluorescence detection of the primer pairs and probe sequences of mecA panels of the invention;

wherein the template concentrations of

curves

FIG. 5 shows the result of fluorescent detection of SA target in SAT detection of a culture sample.

FIG. 6 shows the result of fluorescence detection of SA internal standard in SAT detection of a culture sample.

FIG. 7 shows the results of mecA target fluorescence detection of SAT in culture samples.

FIG. 8 shows the results of fluorescence detection of mecA internal standard in the detection of SAT in a culture sample.

FIG. 9 shows the results of SA detection of a culture sample by comparison using a methicillin-resistant Staphylococcus aureus nucleic acid detection kit (fluorescent PCR method).

FIG. 10 shows the mecA results of the control detection of the cultured bacteria samples using the methicillin-resistant Staphylococcus aureus nucleic acid detection kit (fluorescent PCR method).

Detailed Description

Through long-term and intensive research and a large amount of screening and verification of target sequences, primers and probes, the inventor firstly develops a primer pair which is special for detecting methicillin-resistant staphylococcus aureus (MRSA) and has high specificity and high sensitivity and a specific detection probe which is matched with the primer pair for use. Specifically, when two specific nucleic acid targets (SA23s rRNA and mecA RNA) of methicillin-resistant staphylococcus aureus (MRSA) are amplified by using the specific primer sequence, the primer sequence has the excellent advantages of high specificity, high sensitivity and the like, and can be used for accurately detecting methicillin-resistant staphylococcus aureus (MRSA) and distinguishing other staphylococcus aureus. The present invention has been completed based on this finding.

Primers and probes

As used herein, the term "two pairs of specific primers (SA23 srna and mecA RNA) for methicillin-resistant staphylococcus aureus (MRSA)" refers to two sets of primers (pairs) that amplify amplification products having 23s rRNA strands of SA and mRNA strands of mecA gene for methicillin-resistant staphylococcus aureus (MRSA).

In the design of primers, in order to better meet the requirement of the current detection on methicillin-resistant staphylococcus aureus (MRSA), the inventor selects sections with high conservation and strong specificity in methicillin-resistant staphylococcus aureus 23s rRNA and drug-resistant gene mecA as amplification target sequence regions (the nucleotide sequences are shown as SEQ ID NO:1 and SEQ ID NO: 2). Preferred primer sequences include those set forth as SEQ ID NO:4 and SEQ ID NO:5 and the sequence of the SA23s rRNA primer pair consisting of SEQ ID NO:6 and SEQ ID NO:7 in the sequence of MecA RNA primers.

In the amplification method of the present invention, or more probes, such as a detection probe, a capture probe, etc., may be included in the reaction system in addition to the primers.

As used herein, the term "capture probe for methicillin-resistant Staphylococcus aureus (MRSA)" refers to a nucleotide sequence that specifically binds to a sequence of a target nucleic acid (SA23s rRNA and mecA gene mRNA) of methicillin-resistant Staphylococcus aureus (MRSA). preferred capture probes of the present invention have a nucleotide sequence as shown in SEQ ID NO. 3. more preferably, the capture probe specifically binds to a sequence of a target nucleic acid SA 3523 s rRNA and mecA gene mRNA of methicillin-resistant Staphylococcus aureus (MRSA). in another preferred embodiment, the capture probe can also specifically bind to a sequence of an MRSA internal standard (SA and mecA gene IC RNA) when the methicillin-resistant Staphylococcus aureus (MRSA) contains MRSA internal standards (SA and mecA gene IC RNA) for designing a negative control group.

The MRSA detection probes are all molecular beacons, are -class high-specificity and high-sensitivity molecular probes, consist of single-stranded nucleic acid molecules with two ends respectively and covalently labeled with fluorescent dyes and quenchers, are in a hairpin type or stem-loop structure, the loop part of the molecular beacons is complementary with a target, and the two ends are stems due to the complementary, compared with a linear TaqMan probe, the molecular beacon probe needs force for opening the hairpin structure, so that the specificity is better than that of the linear probe.

The primer sequence and the probe sequence of the invention use DNASAR, DNAMAN software and artificial design to detect the special primer and the probe sequence of methicillin-resistant staphylococcus aureus (MRSA) by real-time fluorescent nucleic acid isothermal amplification according to the design principle of the primer and the probe.

For the present invention, preferred primer pairs and probes are as follows:

control substance

Since SAT amplification is susceptible to multiple factors, which results in amplification failure, and erroneous conclusions can be drawn by misjudgment of the kit user, a control can be provided in the kit of the present invention to eliminate the case of distorted detection results.

References that can be provided in the present invention include the MRSA positive control, the MRSA negative control and or more of the MRSA internal standards.

The MRSA positive control may be RNA transcribed in vitro, with no biological activity. By detecting positive control, the detection method and materials of the kit can be proved to be correct, the detection accuracy is ensured, and the repeatability and stability of each detection and the difference among kit batches can be monitored.

In addition, a critical weak positive control can be prepared by a positive control (physiological saline and lysate are mixed into a diluent according to the ratio of 1:1, SA23s rRNA and mecA genes are both diluted by 100 times of the positive control and are used as the critical weak positive control), the test operation condition in a critical value state can be prompted, the SAT laboratory is regularly detected by the critical weak positive control, indoor quality control can be carried out, and the condition of missed test (false negative) in the detection process can be prevented.

The MRSA internal standard may be RNA transcribed in vitro, with no biological activity. MRSA internal standards are respectively used as competitive internal standards of MRSA (SA23s rRNA and mecA gene) RNA and can be used as reference substances for preventing false negative results, and whether the whole amplification reaction system is inhibited or not can be known by detecting a sample added with the internal standards, so that false negative is better suggested.

The negative control can eliminate false positive, and can ensure the specificity of detection under the condition of correctly using the detection method and materials of the kit.

In another preferred embodiment, the in vitro transcribed MRSA (SA23srRNA and mecA RNA) is prepared by the following method:

(1) respectively synthesizing SA23s rRNA and drug-resistant mecA gene fragments of MRSA (SA23s rRNA and drug-resistant mecA positive fragments, wherein the nucleotide sequences of the SA23s rRNA and the drug-resistant mecA positive fragments are shown as

sequences

10 and 11 in a sequence table) by using a chemical synthesis method;

(2) inserting SA23s rRNA and drug-resistant mecA gene fragments into the geneConstructing a positive control plasmid of SA23srRNA and drug-resistant mecA in a T vector;

(3) the SA23s rRNA and the drug-resistant mecA positive control plasmid were transformed into E.coli DH5 α, respectively, and named-T-SA23s rRNA and

-T-mecA strain, stored at-70 ℃;

(4) are respectively provided with-T-SA23s rRNA and

extraction from the-T-mecA Strain

-T-SA23srRNA and

-T-mecA plasmid, which is divided intoTranscribing RNA, purifying to eliminate DNA, and quantifying and identifying RNA.

In another preferred embodiment of , the in vitro transcribed MRSA (SA23s rRNA and drug-resistant mecA gene) IC RNA in the MRSA internal standard is prepared by the following method:

(1) respectively synthesizing sections by chemical synthesis methods, except that the sequences of probe detection regions are different, and other sequences are basically the same as SA23s rRNA and drug-resistant mecA target sequence regions of the MRSA (SA23s rRNA and drug-resistant mecA internal standard fragments of the MRSA, and the nucleotide sequences are respectively shown as SEQ ID No. 12 and 13 in a sequence table);

(2) cloning SA23s rRNA and drug-resistant mecA gene fragment intoConstructing internal standard plasmids of SA23s rRNA and drug-resistant mecA of MRSA in a T vector;

(3) SA23s rRNA of MRSA and drug-resistant mecA internal standard plasmid are transformed into Escherichia coli DH5 α, and the plasmid is named

-T-SA23s rRNA IC and

-T-mecA IC strain, stored at-70 ℃;

(4) are respectively provided with

-T-SA23s rRNA IC and

extraction from the-T-mecA IC Strain

-T-SA23s rRNA IC and

-T-mecA IC plasmid, RNA purification of the plasmid transcription to remove DNA, and quantification and identification of internal standard RNA.

Detection method

The invention also provides a detection method of methicillin-resistant staphylococcus aureus (MRSA), which comprises the steps of carrying out amplification of SA23s rRNA and drug-resistant mecA on a sample to be detected by using the specific primer; and detecting separately during or after the amplification reaction, the SA23s rRNA and drug-resistant mecA amplification products of methicillin-resistant Staphylococcus aureus (MRSA), for example by detecting a fluorescent signal emitted by a specific probe.

The method may also optionally include providing two or more control groups, such as an MRSA positive control group, an MRSA negative control group, an MRSA internal standard group, and the like.

In the present invention, the detection method may be a conventional PCR method or a different method such as a real-time fluorescence detection method, and particularly preferred methods are a real-time fluorescence isothermal nucleic acid amplification method.

Real-time fluorescent nucleic acid isothermal amplification (SAT)

A nucleic acid isothermal amplification real-time fluorescence detection technology is characterized in that novel nucleic acid detection technologies combining RNA isothermal amplification and real-time fluorescence detection are realized simultaneously by M-MLV reverse transcriptase, T7RNA polymerase and an optimized probe (optimal probe, and probe) technology, wherein the reverse transcriptase is used for generating DNA copies of target nucleic acid (RNA), the T7RNA polymerase generates multiple RNA copies from the DNA copies, the optimized probe with a fluorescent label is specifically combined with the RNA copies to generate fluorescence, the fluorescence signal can be captured by a detection instrument, and the detection result is judged by combining a positive control, a negative control and an internal standard signal according to the occurrence time and the intensity of a real-time fluorescence signal.

In the invention, the general detection technology of methicillin-resistant staphylococcus aureus (MRSA) can efficiently and specifically capture SA23s rRNA and drug-resistant mecA RNA of MRSA by using a special primer pair with high specificity and high sensitivity aiming at two groups of targets and using a special capture probe in cooperation, nucleic acid amplification is simultaneously realized by using M-MLV reverse transcriptase and T7RNA polymerase, wherein the reverse transcriptase is used for generating DNA copies of target nucleic acid RNA, the T7RNA polymerase generates a plurality of RNA copies from the DNA copies, and an optimized detection probe with a fluorescent label is specifically combined with the RNA copies generated after amplification so as to generate fluorescence, and the fluorescence signal can be captured by a detection instrument.

Reagent kit

The invention provides an detection kit for methicillin-resistant staphylococcus aureus (MRSA), which comprises:

(a) a specific primer pair for amplifying SA23s rRNA and drug-resistant mecA, wherein an amplification product amplified by the primer has MRSA 23s rRNA and drug-resistant mecA mRNA sequences;

(b) a capture probe;

(c) and (3) detecting the probe.

The primer pair is pairs of SA23s rRNA and drug-resistant mecA amplification primers for generating DNA copies of MRSA 23s rRNA and drug-resistant mecA target nucleic acid (SA23s rRNA and drug-resistant mecA RNA) under the action of M-MLV reverse transcriptase, and in preferred embodiments of the invention, the MRSA amplification primers comprise SA23s rRNA T7 primer of SEQ ID NO:4, nT7 primer of SEQ ID NO:5, drug-resistant mecA T7 primer of SEQ ID NO:6, and nT7 primer of SEQ ID NO: 7.

The detection probes are MRSA 23s rRNA and drug-resistant mecA RNA detection probes which are respectively specifically combined with RNA copies generated according to DNA copies of the MRSA 23s rRNA and the drug-resistant mecA target nucleic acid (SA23s rRNA and the drug-resistant mecA RNA). in another preferred example, the capture probes and/or the detection probes can also be specifically combined with the sequences of the target nucleic acids (SA23s rRNA and the drug-resistant mecA RNA) of the methicillin-resistant staphylococcus aureus (MRSA).

The methicillin-resistant staphylococcus aureus (MRSA) can also be designed to contain MRSA internal standards (SA23 srna IC and drug-resistant mecA IC RNA), and when the methicillin-resistant staphylococcus aureus contains MRSA (SA23s rRNA and drug-resistant mecA RNA) internal standards, the capture probe and the detection probe are designed to respectively and specifically bind with the MRSA (SA23s rRNA and drug-resistant mecA RNA) internal standard sequences to respectively form MRSA (SA23s rRNA and drug-resistant mecA RNA) internal standard control groups.

In another preferred embodiment, the M-MLV reverse transcriptase and T7RNA polymerase are present in enzyme solution, the capture probe is present in nucleic acid extract, the SA T7 primer, nT7 primer and detection probe are present in the same detection solution, and the mecA T7 primer, nT7 primer and detection probe are separately present in the same detection solution.

In another preferred embodiment of , the kit comprises a sample storage solution, a nucleic acid extracting solution, a washing solution, an SA23s rRNA amplification detection solution, a mecA amplification detection solution, an enzyme solution, an MRSA positive control, an MRSA negative control and an MRSA internal standard, wherein the lysis solution comprises ammonium sulfate ((NH)₄)₂SO₄) And HEPES;

the washing solution comprises NaCl and SDS;

the SA23s rRNA amplification detection solution comprises dNTP and NTP; an SA T7 primer, an nT7 primer, an SA detection probe and an internal standard detection probe;

the mecA amplification detection solution comprises dNTP and NTP; mecA T7 primer, nT7 primer, mecA detection probe and internal standard detection probe;

the enzyme solution comprises M-MLV reverse transcriptase and T7RNA polymerase;

the MRSA positive control comprises SA23s rRNA of methicillin-resistant staphylococcus aureus and in-vitro transcription RNA dilution of a drug-resistant mecA gene;

the MRSA negative control is a methicillin-resistant staphylococcus aureus target nucleic acid (SA23s rRNA and drug-resistant mecA RNA) sequence or a solution without methicillin-resistant staphylococcus aureus, and preferably, the negative control is physiological saline;

MRSA internal standard: contains dilutions of MRSA internal standard RNA (SA23s rRNA IC RNA and drug-resistant mecA RNA, the sequences of which are respectively shown as SEQ ID NO:12 and SEQ ID NO: 13).

In another preferred embodiment, the reagent composition of reaction units of the kit is as follows:

(1) sample preservation solution: HEPES 25-250mM, (NH)₄)₂SO₄5-50mM；

(2) Nucleic acid extracting solution: HEPES 50-400mM, EDTA 40-200mM, LiCl 400 + 2000mM, capture probe 1-50 μm (preferably 5-25 μm), magnetic beads 50-500mg/L (preferably 50-250 mg/L);

(3) washing liquid: HEPES 5-50mM, NaCl 50-500mM, 1% SDS, EDTA 1-10 mM;

(4) SA23s rRNA amplification detection solution: preparing reaction solution from 10-50mM Tris, 210-40 mM MgCl, 0.1-10mM (preferably 0.5-5mM) dNTP, 1-20mM (preferably 1-10mM) NTP, 401-10% PVP and 5-40Mm KCl; the SA23s rRNA amplification primer and the SA23s rRNA detection probe are dissolved in TE solution (mixed solution of 10mM Tris and 1mM EDTA) to prepare the kit, and the concentration of each primer and probe can be 5-10 pmol/reaction; wherein the concentration of the T7 primer is preferably 7.5 pmol/reaction, the concentration of the nT7 primer is preferably 7.5 pmol/reaction, the concentration of the SA23s rRNA detection probe is preferably 5 pmol/reaction, and the concentration of the internal standard detection probe is preferably 5 pmol/reaction to prepare a detection solution; the two were mixed at 16: 1.

(5) mecA amplification detection solution: preparing reaction solution from 10-50mM Tris, 210-40 mM MgCl, 0.1-10mM (preferably 0.5-5mM) dNTP, 1-20mM (preferably 1-10mM) NTP, 401-10% PVP and 5-40Mm KCl; dissolving mecA amplification primers and a mecA detection probe in a TE solution (a mixed solution of 10mM Tris and 1mM EDTA) to prepare the probe, wherein the concentration of each primer and each probe can be 5-10 pmol/reaction; wherein the concentration of the T7 primer is preferably 5 pmol/reaction, the concentration of the nT7 primer is preferably 2.5 pmol/reaction, the concentration of the mecA detection probe is preferably 5 pmol/reaction, and the concentration of the internal standard detection probe is preferably 5 pmol/reaction to prepare a detection solution; the two were mixed at 16: 1.

(6) Enzyme solution: M-MLV reverse transcriptase 400-;

(7) MRSA positive control; contains 10⁴-10⁶copy/mL SA23s rRNA and 10⁴-10⁶A mixture of in vitro transcribed RNA dilutions of the copy/mL drug-resistant mecA gene;

(8) MRSA negative control: solutions that do not contain the sequence of the target nucleic acids (SA23s rRNA and mecA RNA) of methicillin-resistant staphylococcus aureus or that do not contain methicillin-resistant staphylococcus aureus;

(9) MRSA internal standard: contains 10⁸copy/mL SA23s rRNA IC RNA (sequence shown as sequence 12 in sequence table) dilution and 10⁵copy/mL mecA IC RNA (sequence shown as sequence 13 in the sequence table) dilution mixture.

In another preferred embodiment, the kit further comprises or more containers, and the above components can be separately located in or more containers, in another preferred embodiment, the kit comprises a box A and a box B, wherein,

the A box is a sample processing unit and comprises the sample preservation, the nucleic acid extracting solution and the washing solution;

the B box is a nucleic acid amplification detection unit and comprises the SA23s rRNA amplification detection solution, the mecA amplification detection solution, an enzyme solution, an MRSA positive control, an MRSA negative control and an MRSA internal standard.

In another preferred embodiment of , the detection probe comprises the nucleotide sequence shown in SEQ ID NO. 8 and SEQ ID NO. 9, and/or the capture probe comprises the nucleotide sequence shown in SEQ ID NO. 3.

The kit is used for carrying out real-time fluorescent nucleic acid isothermal amplification detection on methicillin-resistant staphylococcus aureus, and comprises the following steps:

1) cracking methicillin-resistant staphylococcus aureus in a sample to be detected by using a sample preserving fluid to obtain a cracking fluid containing methicillin-resistant staphylococcus aureus nucleic acid;

2) adding a nucleic acid extracting solution and MRSA IC RNA into the lysis solution obtained in the step 1), specifically binding a capture probe with a target or internal standard nucleic acid, then binding with magnetic beads, washing with a washing solution, and removing nucleic acids not bound with the magnetic beads to obtain nucleic acids (SA23s rRNA and mecA RNA) and MRSA IC RNA (SA23s rRNA ICRNA and mecA IC RNA) of methicillin-resistant staphylococcus aureus;

3) adding the nucleic acids (SA23s rRNA and mecA RNA) and MRSA IC RNA (SA23s rRNA IC RNA and mecA IC RNA) of the methicillin-resistant staphylococcus aureus extracted in the step 2) into a -stage reactant consisting of an SA23s rRNA amplification detection solution and a mecA amplification detection solution, incubating for 10 minutes at 60 ℃, then incubating for 5 minutes at 42 ℃, then adding a second-stage enzyme reactant enzyme solution, continuing to incubate for 60 minutes at 42 ℃, and synchronously recording the change of a fluorescent signal by using a detector, wherein the volume ratio of the -stage reactant to the second-stage enzyme reactant is 3: 1;

4) and according to the time and the intensity of the generated fluorescent signal, comprehensively and qualitatively detecting the SA23s rRNA and mecA samples to be detected by referring to the detection results of the MRSA positive control, the MRSA negative control and the MRSA internal standard.

In the detection operation, the sample to be detected in the step 1) is a methicillin-resistant staphylococcus aureus culture.

Compared with the existing methicillin-resistant staphylococcus aureus detection, the method has the following advantages:

(1) high specificity, high purity, low pollution: the preferred capture probe designed for MRSA target nucleic acids (SA23s rRNA and mecA) can efficiently and specifically capture RNA of MRSA (SA23s rRNA and mecA). Meanwhile, because a closed constant-temperature amplification detection system is adopted, the reaction system does not need to be opened in the whole reaction process, thereby avoiding the pollution of the amplicon.

(2) The rapid detection is that the amplification and the detection of the nucleic acid are synchronously carried out in the closed system, and the whole process has no temperature rise and fall and circulation, so the required time is greatly shortened, and the amplification detection only needs 40 minutes.

(3) Pollution is easy to control: compared with real-time fluorescent PCR, the amplification product of the invention is RNA which is easy to degrade in nature, so that the pollution control is easier.

(4) The equipment is simple, and the cost is low: compared with real-time fluorescent quantitative PCR, the instrument used in the invention does not need temperature rise and fall circulation, thereby greatly reducing the design and production cost.

In conclusion, the kit can detect the RNA of the methicillin-resistant staphylococcus aureus in nasal, pharyngeal swab, wound secretion or sterile body fluid such as cerebrospinal fluid, has the characteristics of high specificity, high sensitivity (which can reach 50 copies/mL and 100 copies/mL), low pollution (amplification product RNA is easy to degrade in natural environment) and quick detection (amplification detection is completed in 40 minutes), plays an important role in clinical diagnosis of the early infection of the methicillin-resistant staphylococcus aureus, and has a wide application prospect of .

The invention is further illustrated at in connection with specific examples, it being understood that these examples are intended to illustrate the invention only and are not intended to limit the scope of the invention the experimental procedures, for which specific conditions are not indicated in the following examples, are generally in accordance with conventional conditions, such as those set forth in Sambrook et al, molecular cloning, A laboratory Manual (New York: Cold Spring harbor laboratory Press,1989), or as recommended by the manufacturer.

In the examples, the main raw material enzyme solution, positive control and internal standard in vitro transcription RNA were provided by American RDbiosciences, 7500 type PCR instrument is a product of American ABI, and reagents such as NTPs, dNTPs and the like and other instruments are all conventional commercially available products.

Example 1 design of Special primers and probes for real-time fluorescent nucleic acid isothermal amplification detection of methicillin-resistant Staphylococcus aureus (MRSA)

The invention selects a highly conserved and highly specific segment in MRSA (SA23s rRNA and mecA) gene as an amplification target sequence region (the nucleotide sequence of the segment is shown as SEQ ID No.:1 and SEQ ID No.: 2), and uses DNASAR, DNMAN software and artificial design to detect special primers and probe sequences of methicillin-resistant staphylococcus aureus (SA23s rRNA and mecA of MRSA) by real-time fluorescent nucleic acid isothermal amplification according to the design principle of primer and probe to obtain the following specific sequences:

(1) Capture probes (TCO, Target Capture Oligo) capable of specifically binding with a Target nucleic acid (SA23s rRNA) sequence of methicillin-resistant Staphylococcus aureus (MRSA), wherein the nucleotide sequence of the Capture probes is 5'TGCACACCGGATGGCCAATCCAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 3' (SEQ ID No.:3), Capture probes (TCO, Target Capture Oligo) capable of specifically binding with a Target nucleic acid (mecA RNA) sequence of methicillin-resistant Staphylococcus aureus (MRSA), the nucleotide sequences of the Capture probes are 5'TGCACACCGGATGGCCAATCCAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 3' (SEQ ID No.: 3);

(2) pairs of SA amplification primers for generating DNA copies of MRSA target nucleic acids SA23s rRNA and pairs of mecA amplification primers for DNA copies of target nucleic acids mecA under the action of M-MLV reverse transcriptase, wherein the SA23s rRNA and mecA amplification primers respectively consist of separate T7 primer and nT7 primer, and the SA T7 primer sequence is 5' AATTTAATACGACTCACTATAGGGAGACATATTTC

TCTACACCTTT 3' (SEQ ID No.:4), nT7 primer sequence 5' AGCGATTGATGGTGATACGGTT 3' (SEQ ID No.: 5);

the mecA T7 primer sequence was 5'AATTTAATACGACTCACTATAGGGAGATTCTTTAGCGATTGCTTTATAATC 3' (SEQ ID No.:6) and the nT7 primer sequence was 5'AATCAGAACGTGGTAAAA 3' (SEQ ID No.: 7);

(3) pieces of SA detection probes for specifically binding with the RNA copy generated by the DNA copy of the MRSA target nucleic acid SA23s rRNA under the action of T7RNA polymerase, wherein the nucleotide sequence of the SA detection probes is 5'CCGUCAUUCAGACUAUUAUUGGACGG 3' (SEQ ID No.:8), the 5 'end is fluorescently labeled with FAM, and the 3' end is fluorescently labeled with DABCYL, pieces of mecA detection probes for specifically binding with the RNA copy generated by the DNA copy of the MRSA target nucleic acid mecA RNA under the action of T7RNA polymerase, the nucleotide sequence of the mecA detection probes is 5'CACAUCAGGAACAGCAUAUGAGAUGUG 3' (SEQ ID No.:9), the 5 'end is fluorescently labeled with FAM, and the 3' end is fluorescently labeled with DABCYL.

(4) Other alignment sequences

During the primer, probe design process, pairs of primer and probe sequences are generated, such as tens of pairs of primers and corresponding detection probes, for example for target SA, including the following primer pairs and detection probes:

t7 primer S1 a: 5'AATTTAATACGACTCACTATAGGGAGACCGTATCACCATCAATCGCTT 3' (as shown in SEQ ID NO: 18),

nT7 primer S1 b: 5'CAAATGCATCACAAACAGA 3' (shown in SEQ ID NO: 19),

the detection probe S1c was 5'CGCUCUGAAGAUCCAACAGUGAGCG 3' (shown in SEQ ID NO: 20),

wherein the 5 'end of the detection probe is fluorescently labeled with FAM and the 3' end is fluorescently labeled with DABCYL.

For the target MecA, the following primer pairs and detection probes were included:

t7 primer M1 a: 5'AATTTAATACGACTCACTATAGGGAGAATGCTTTGGTCTTTCTG 3' (shown in SEQ ID NO: 21),

nT7 primer M1 b: 5'CTACGGTAACATTGATCGCA 3' (shown in SEQ ID NO: 22),

detection probe M1c5'CGCCGGUGGAAGUUAGAUUGGGCGGCG 3' (shown in SEQ ID NO: 23),

(5) Amplification screening

For each designed group of sequences, the same reaction system is adopted for amplification, and the comparison sensitivity is detected and the better one is selected. Through screening and comparing the designed primer pairs and probe sequences, the optimal primer and probe sequence with high detection sensitivity is selected.

Partial results are shown in FIGS. 1-4.

The results of SA are shown in FIG. 1 and FIG. 2, (FIG. 1 is the comparison group, FIG. 2 is the invention group); the results of mecA are shown in FIGS. 3 and 4 (FIG. 3 is an alignment group, and FIG. 4 is a group of the present invention).

The sensitivity of the SA ratio pair group (adopting the S1a, the S1b primer pair and the S1c detection probe) can detect 500 copies/mL, while the sensitivity of the group is optimal and can reach 50 copies/mL, and the sensitivity of the group is at least improved by orders of magnitude.

The sensitivity of mecA ratio pair (adopting M1a, M1b primer pair and M1c detection probe) can detect 1000 copies/mL, while the sensitivity of the group of the invention is optimal and can reach 100 copies/mL, and the sensitivity of the group of the invention is at least improved by orders of magnitude and can reach 100 copies/mL or lower.

Furthermore, it is clear from the curve shape that both inventive groups are superior to the comparative group.

Preferred primer pairs were therefore identified as follows: for SA, the primer pair is SEQ ID NO: 4. 5, SEQ ID NO; the probe sequence is SEQ ID NO 8;

for mecA, the primer pair is SEQ ID NO: 6. 7 in SEQ ID NO; the probe sequence is SEQ ID NO 9.

(6) Screening of internal standards and internal standard detection probes

In order to facilitate result analysis, the kit is further matched with added MRSA internal standards (SEQ ID No.: 12; SEQ ID No.:13), internal standard detection probes are respectively optimized, the MRSA (SA23s rRNA and mecA) internal standards and MRSA target nucleotides ((SA 23s rRNA and mecA) RNA) respectively have the same primer binding regions, the nucleic acid sequences or arrangements of the two primers are different, so that the MRSA internal standards can not be combined with the detection probes but can be combined with the internal standard probes, the MRSA internal standards can be obtained by MRSA (SA23s rRNA and mecA) target template fixed-point mutation construction, can be specifically combined with capture probes, the internal standard detection probes are probes which are different from the MRSA (SA23s rRNA and mecA) detection probe sequences and fluorescent labels, the nucleotide sequences of the internal standard detection probes are 5'CCGACAGUGAUACGAGAGTCGG 3' (SEQ ID No.:14), and the nucleotide sequences of the mecA:5'CCGACCCAGGUAUCAGUGTCGG3' (SEQ ID No.:15), the 5 'end is marked with HEX fluorescent group, and the 3' end is marked with DABCYL quenching group.

Example 2 preparation of a real-time fluorescent nucleic acid isothermal amplification detection kit for methicillin-resistant Staphylococcus aureus (MRSA)

The real-time fluorescent nucleic acid isothermal amplification detection kit for methicillin-resistant staphylococcus aureus (MRSA) is obtained by using the special primers and the probes provided in the embodiment 1. The kit comprises components such as a capture probe (TCO), a T7 primer, an nT7 primer, an MRSA (SA23 srRNA) detection probe, an SA internal standard detection probe, an MRSA (mecA) detection probe, a mecA internal standard detection probe, an internal standard, M-MLV reverse transcriptase, T7RNA polymerase and the like.

The capture probe is present in a nucleic acid extracting solution, the T7 primer, the nT7 primer, the MRSA detection probe and the internal standard detection probe are respectively present in an MRSA (SA23 srRNA) detection solution and an MRSA (mecA) detection solution, and the M-MLV reverse transcriptase and the T7RNA polymerase are present in an enzyme solution, specifically, the kit is divided into an A box (a specimen processing unit) stored at the temperature of 2-30 ℃ and a B box (a nucleic acid amplification detection unit) stored at the temperature of-15 to-35 ℃, wherein the A box comprises a sample preservation solution, a nucleic acid extracting solution and a washing solution, the B box comprises an amplification detection solution 1, an enzyme solution, an MRSA positive control, an MRSA negative control and an MRSA internal standard, and the main components are as follows:

the kit a (specimen processing unit) is composed of:

a sample preservation solution; containing ammonium sulfate ((NH)₄)₂SO₄) And HEPES;

nucleic acid extracting solution: contains 1-50 muM (preferably 5-25 muM) of capture probe and 50-500mg/L (preferably 50-250mg/L) of magnetic bead;

washing liquid: mainly 1% (V/V) SDS.

The B box (nucleic acid amplification detection unit) is composed of:

amplification detection solution 1: contains dNTP 0.1-10mM (preferably 0.5-5mM), NTP 1-20mM (preferably 1-10 mM); the concentration of each primer and probe of SA can be 5-10 pmol/reaction, wherein the concentration of the T7 primer is preferably 7.5 pmol/reaction, the concentration of the nT7 primer is preferably 7.5 pmol/reaction, the concentration of the SA detection probe is preferably 5 pmol/reaction, and the concentration of the internal standard detection probe is preferably 5 pmol/reaction;

amplification detection solution 2: contains dNTP 0.1-10mM (preferably 0.5-5mM), NTP 1-20mM (preferably 1-10 mM); the concentration of each primer and probe of mecA can be 5-10 pmol/reaction, wherein the concentration of the T7 primer is preferably 2.5 pmol/reaction, the concentration of the nT7 primer is preferably 5 pmol/reaction, the concentration of the mecA detection probe is preferably 5 pmol/reaction, and the concentration of the internal standard detection probe is preferably 5 pmol/reaction;

enzyme solution: contains M-MLV reverse transcriptase 400-4000U/reaction (preferably 500-1500U/reaction), T7RNA polymerase 200-2000U/reaction (preferably 500-1000U/reaction);

MRSA positive control; contains 10⁴-10⁶copy/mL SA23s rRNA and 10⁴-10⁶A mixture of in vitro transcribed RNA dilutions of the copy/mL drug-resistant mecA gene;

MRSA negative control: solutions that do not contain the sequence of the target nucleic acids (SA23s rRNA and mecA RNA) of methicillin-resistant staphylococcus aureus or that do not contain methicillin-resistant staphylococcus aureus;

MRSA internal standard: contains 10⁸copy/mL SA23s rRNA IC RNA (SEQ ID No.:12) dilutions and 10⁵copy/mL mecA IC RNA (SEQ ID No.:13) diluted mixture.

All reagents contained in the kit may be prepared by conventional methods or purchased commercially as suggested.

Specifically, in each reaction unit, the specific combination of various reagents of the kit is as follows:

(1) sample preservation solution: HEPES 25-250mM, (NH)₄)₂SO₄5-50mM；

(3) washing liquid: HEPES 5-50mM, NaCl 50-500mM, 1% SDS, EDTA 1-10 mM;

(4) amplification detection solution 1: contains dNTP 0.1-10mM (preferably 0.5-5mM), NTP 1-20mM (preferably 1-10 mM); the concentration of each primer and probe of SA can be 5-10 pmol/reaction, wherein the concentration of the T7 primer is preferably 7.5 pmol/reaction, the concentration of the nT7 primer is preferably 7.5 pmol/reaction, the concentration of the SA detection probe is preferably 5 pmol/reaction, and the concentration of the internal standard detection probe is preferably 5 pmol/reaction;

(5) amplification detection solution 2: contains dNTP 0.1-10mM (preferably 0.5-5mM), NTP 1-20mM (preferably 1-10 mM); the concentration of each primer and probe of mecA can be 5-10 pmol/reaction, wherein the concentration of the T7 primer is preferably 2.5 pmol/reaction, the concentration of the nT7 primer is preferably 5 pmol/reaction, the concentration of the mecA detection probe is preferably 5 pmol/reaction, and the concentration of the internal standard detection probe is preferably 5 pmol/reaction;

(6) enzyme solution: contains M-MLV reverse transcriptase 400-4000U/reaction (preferably 500-1500U/reaction), T7RNA polymerase 200-2000U/reaction (preferably 500-1000U/reaction);

(9) MRSA internal standard: contains 10⁸copy/mL SA23s rRNA IC RNA (SEQ ID No.:12) dilutions and 10⁵copy/mL mecA IC RNA (SEQ ID No.:13) diluted mixture.

In vitro transcribed MRSA (SA23 srna and mecA RNA) in MRSA positive control can be prepared by a variety of methods, among which is prepared as follows:

(1) respectively synthesizing SA23s rRNA and drug-resistant mecA gene fragments of MRSA (SA23s rRNA and drug-resistant mecA positive fragments with nucleotide sequences shown in SEQ ID No. 10 and SEQ ID No. 11) by using a chemical synthesis method;

(2) inserting SA23s rRNA and drug-resistant mecA gene fragments into the gene

Constructing a positive control plasmid of SA23srRNA and drug-resistant mecA in a T vector;

(3) the SA23s rRNA and the drug-resistant mecA positive control plasmid were transformed into E.coli DH5 α, respectively, and named

-T-SA23s rRNA and

-T-mecA strain, stored at-70 ℃;

(4) are respectively provided with

-T-SA23s rRNA and

extraction from the-T-mecA Strain

-T-SA23srRNA and

-T-mecA plasmid, RNA transcription of the plasmid, DNA purification, quantification and RNA identification.

Example 3 methicillin-resistant Staphylococcus aureus real-time fluorescent nucleic acid isothermal amplification detection method

1. Sample collection, transport and storage

Sample collection

1.1 collecting nose and oropharynx swab specimens: taking nasal and oropharyngeal secretions by using a medical cotton swab, placing a swab head in 2mL of physiological saline for soaking and adhering to the wall of a tube for squeezing, and adding 2mL of sample preservation solution for later use, wherein the sample is a sample to be detected.

1.2 wound surface secretion sample collection: taking the secretion of the wound surface by using a medical cotton swab, placing a swab head in 2mL of physiological saline for soaking, sticking the swab head to the wall of a tube, squeezing, adding 2mL of sample preservation solution into the swab head for later use, wherein the sample is a sample to be detected.

Specimen transport and preservation

The collected specimen can be used for testing immediately or stored for a long time at-70 ℃ and the storage period at-20 ℃ is 6 months, and repeated freezing and thawing of the specimen should be avoided. The specimen was transported using a 0 ℃ curling stone.

2. Nucleic acid extraction

2.1 mu.l of specimen storage solution (HEPES 50mM, (NH)) was added to a sample processing tube (1.5mL centrifuge tube)₄)₂SO₄35mM) and 400 mul of sample to be detected (not enough to be complemented by normal saline), and preserving and cracking the methicillin-resistant staphylococcus aureus in the sample to be detected by using the sample to obtain a lysate containing methicillin-resistant staphylococcus aureus nucleic acid.

2.2 Add 200. mu.l of nucleic acid extract (HEPES 200mM, EDTA100mM, LiCl 800mM, capture probe 15. mu. m, magnetic beads 150mg/L) and 20. mu.l to sample processing tube (1.5mL centrifuge tube)Internal standard solution (containing 10)⁸copy/mL SA23srRNA IC RNA and 10⁵copy/mL mecA IC RNA), mixing, keeping the temperature at 60 ℃ for 5 minutes, standing at room temperature for 10 minutes, and evenly dividing the prepared liquid into two equal parts for later use.

2.3 placing the sample processing tube on the magnetic bead separation device, and standing for 5-10 minutes. And after the magnetic beads are adsorbed on the tube wall, keeping the sample processing tube on the magnetic bead separation device, and sucking away liquid to retain the magnetic beads. After adding 1mL of a washing solution (HEPES 25mM, NaCl150mM, 1% SDS, EDTA 2.5 mM; prepared), the mixture was shaken well and allowed to stand for 5 to 10 minutes, and the solution was discarded, the magnetic beads were retained, and the process was repeated 2 times.

2.4 remove the sample processing tube from the bead separation device, and the bead-nucleic acid complexes in the tube are ready for use (this step should make the beads clearly visible).

In the detection operation, the sample to be detected in the step 2.1 is a methicillin-resistant staphylococcus aureus culture.

3. SAT nucleic acid amplification assay

3.1 Add 40. mu.l of amplification assay solution (40. mu.l reaction solution + 2.5. mu.l assay solution) to the sample processing tube to wash the magnetic beads. The reaction solution specifically contains Tris 15mM, MgCl₂15mM, dNTP 2.5mM, NTP 3mM, PVP 401%, KCl 10 mM; the concentration of the T7 primer in the SA detection solution is 7.5 pmol/reaction, the concentration of the nT7 primer is 7.5 pmol/reaction, the concentration of the SA detection probe is 5 pmol/reaction, and the concentration of the SA internal standard detection probe is 5 pmol/reaction; the concentration of the T7 primer in the mecA detection solution was 2.5 pmol/reaction, the concentration of the nT7 primer was 5 pmol/reaction, the concentration of the mecA detection probe was 5 pmol/reaction, and the concentration of the mecA internal standard detection probe was 5 pmol/reaction.

3.2 adding 30 μ l of the reaction detection solution into a clean micro reaction tube, and keeping the temperature at 60 ℃ for 10 minutes and 42 ℃ for 5 minutes by using a 7500 type PCR instrument (product of ABI company, USA); mu.l of the enzyme solution preheated to 42 ℃ was added to the micro reaction tube, and the mixture was shaken at 1200rpm for 15 seconds and mixed. The enzyme solution contained 1500U/reaction of M-MLV reverse transcriptase, 1000U/reaction of T7RNA polymerase, 10mM HEPES pH7.5, 15mM N-acetyl-L-cysteine (N-acetyl-L-cysteine), 0.15mM zinc acetate (zinc acetate), 20mM trehalase (trehalose), 100mM Tris-HCl pH 8.0, 80mM KCl, 0.25mM EDTA, 0.5% (v/v) Triton X-100, and 30% (v/v) glycerol (glycerol).

3.3 the micro reaction tube is quickly transferred to a constant temperature fluorescence detection instrument (ABI7500 fluorescence quantitative instrument, product of ABI company), the reaction is carried out for 40 minutes at 42 ℃, times of fluorescence detection are set every 1 minute, the detection is carried out for 40 times totally, and a FAM channel (target signal detection, F1) and a VIC channel (HEX and VIC wavelength are close, internal standard signal detection, F2) are selected as a fluorescein channel.

4. Determination of results

Setting a threshold line according to a curve obtained from the SAT amplification result, reading the dt value, and determining the result.

Threshold setting with the threshold line just above the highest point of the normal negative control amplification curve dt represents the abscissa reading of the intersection of the sample curve and the threshold line (similar to ct for -like real-time fluorescent PCR experiment results)

① judging the result:

and SA: f1 channel: samples with dt less than or equal to 35 are SA positive; samples 35 < dt < 40 suggest retesting, test result F1 channel: samples with dt < 40 were SA positive.

mecA: f1 channel: samples with dt less than or equal to 35 are mecA positive; samples 35 < dt < 40 suggest retesting, test result F1 channel: samples with dt < 40 were mecA positive.

The result of ② indicates that the channel F1 has no dt value or 40, and the channel F2 has dt less than or equal to 35, which is negative.

③ judging the result:

TABLE 1

SA test results	mecA detection result	MRSA result determination
			+	+	+
—	+	—
			+	—	—
—	—	—

Quality control: the dt values of the positive control, the critical weak positive control and the negative control are set to simultaneously meet the following conditions, otherwise, the experiment is regarded as invalid and needs to be carried out again.

(1) SA positive control, SA critical weak positive control: f1 channel: the positive control dt is less than or equal to the critical weak positive control dt is less than or equal to 35.

(2) SA negative control: f1 channel: dt is no value or 40, while F2 channel: dt is less than or equal to 35.

(3) mecA positive control, mecA critical weak positive control: f1 channel: the positive control dt is less than or equal to the critical weak positive control dt is less than or equal to 35.

(4) mecA negative control: f1 channel: dt is no value or 40, while F2 channel: dt is less than or equal to 35.

The kit is designed for methicillin-resistant staphylococcus aureus, real-time fluorescence isothermal amplification is adopted for detecting RNA, the operation is simpler and more convenient than that of the conventional PCR, the sensitivity and the specificity are higher, the amplification detection can be completed in only 40 minutes, the amplification product is RNA rather than DNA, the kit is easy to degrade in the environment and has low pollution, and the addition of competitive internal standard in the kit can further reduce false negative results caused by system inhibition and ensure that the detection result is more accurate.

5. Results

Methoxy-resistant western medicineThe number of the staphylococcus aureus sample is methicillin-resistant staphylococcus aureus culture or other bacterial culture specimens 1-7, and a negative control (containing no methicillin-resistant staphylococcus aureus target nucleic acid (SA23srRNA and mecA RNA) sequence or a solution containing no methicillin-resistant staphylococcus aureus) and a positive control (containing 10)⁴-10⁶copy/mL SA23s rRNA and 10⁴-10⁶ copies/mL of the mixture of in vitro transcription RNA dilutions of mecA gene) result SA is shown in FIG. 5(F1 fluorescence channel) and FIG. 6(F2 fluorescence channel), mecA is shown in FIG. 7(F1 fluorescence channel) and FIG. 8(F2 fluorescence channel),

samples

1, 3, 4, 6 and 7 are judged to be positive and

samples

2 and 5 are judged to be negative according to dt values of F1 channel and F2 channel in combination with result judgment standard, and the result shows that the kit has high accuracy when being used for detecting methicillin-resistant staphylococcus aureus, but the on-machine amplification detection time only needs 40 minutes and has the characteristics of short period, high sensitivity, high specificity, low pollution and stable reaction.

Based on the disclosure of the present invention, those skilled in the art can implement the universal real-time fluorescence isothermal nucleic acid amplification detection kit for methicillin-resistant staphylococcus aureus (MRSA) without undue experimentation, and achieve the desired effect. The disclosed embodiments of the present invention are merely detailed descriptions of the present invention and are not to be construed as limiting the present invention. It will be apparent to those skilled in the art that similar substitutes or modifications for obvious substitutions or modifications of the invention, or certain chemically or biologically structurally and functionally related agents may be substituted for the agents described herein or modifications may be made thereto without departing from the spirit, scope and concept of the invention and within the scope and ambit of the appended claims.

Sequence listing

<110> Shanghai Kenryi Biotechnology Ltd

<120> methicillin-resistant staphylococcus aureus (MRSA) nucleic acid isothermal amplification method

<130>P2018-0782

<160>23

<170>PatentIn version 3.5

<210>1

<211>116

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>1

agcgattgat ggtgatacgg ttaaattaat gtacaaaggt caaccaatga cattcagact 60

attattggtt gatacacctg aaacaaagca tcctaaaaaa ggtgtagaga aatatg 116

<210>2

<211>125

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>2

aatcagaacg tggtaaaatt ttagaccgaa acaatgtgga attggccaat acaggaacag 60

catatgagat aggcatcgtt ccaaagaatg tatctaaaaa agattataaa gcaatcgcta 120

aagaa 125

<210>3

<211>54

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>3

tgcacaccgg atggccaatc caataaaaaa aaaaaaaaaa aaaaaaaaaa aaaa 54

<210>4

<211>46

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>4

aatttaatac gactcactat agggagacat atttctctac accttt 46

<210>5

<211>22

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>5

agcgattgat ggtgatacgg tt 22

<210>6

<211>51

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>6

aatttaatac gactcactat agggagattc tttagcgatt gctttataat c 51

<210>7

<211>18

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>7

aatcagaacg tggtaaaa 18

<210>8

<211>26

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>8

ccgucauuca gacuauuauu ggacgg 26

<210>9

<211>27

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>9

cacaucagga acagcauaug agaugug 27

<210>10

<211>434

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>10

cgtaaataga agtggttctg aagatccaac agtatatagt gcaacttcaa ctaaaaaatt 60

acataaagaa cctgcgacat taattaaagc gattgatggt gatacggtta aattaatgta 120

caaaggtcaa ccaatgacat tcagactatt attggttgat acacctgaaa caaagcatcc 180

taaaaaaggt gtagagaaat atggtcctga agcaagtgca tttacgaaaa aaatggtaga 240

aaatgcaaag aaaattgaag tcgagtttga caaaggtcaa agaactgata aatatggacg 300

tggcttagcg tatatttatg ctgatggaaa aatggtaaac gaagctttag ttcgtcaagg 360

cttggctaaa gttgcttatg tttataaacc taacaataca catgaacaac ttttaagaaa 420

aagtgaagca caag 434

<210>11

<211>424

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>11

aggcgttaaa gatataaaca ttcaggatcg taaaataaaa aaagtatcta aaaataaaaa 60

acgagtagat gctcaatata aaattaaaac aaactacggt aacattgatc gcaacgttca 120

atttaatttt gttaaagaag atggtatgtg gaagttagat tgggatcata gcgtcattat 180

tccaggaatg cagaaagacc aaagcataca tattgaaaat ttaaaatcag aacgtggtaa 240

aattttagac cgaaacaatg tggaattggc caatacagga acagcatatg agataggcat 300

cgttccaaag aatgtatcta aaaaagatta taaagcaatc gctaaagaac taagtatttc 360

tgaagactat atcaaacaac aaatggatca aaattgggta caagatgata ccttcgttcc 420

actt 424

<210>12

<211>430

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>12

cgtaaataga agtggttctg aagatccaac agtatatagt gcaacttcaa ctaaaaaatt 60

acataaagaa cctgcgacat taattaaagc gattgatggt gatacggtta aattaatgta 120

caaaggtcaa ccaatgacag ugauacgaga gttgatacac ctgaaacaaa gcatcctaaa 180

aaaggtgtag agaaatatgg tcctgaagca agtgcattta cgaaaaaaat ggtagaaaat 240

gcaaagaaaa ttgaagtcga gtttgacaaa ggtcaaagaa ctgataaata tggacgtggc 300

ttagcgtata tttatgctga tggaaaaatg gtaaacgaag ctttagttcg tcaaggcttg 360

gctaaagttg cttatgttta taaacctaac aatacacatg aacaactttt aagaaaaagt 420

gaagcacaag 430

<210>13

<211>419

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>13

aggcgttaaa gatataaaca ttcaggatcg taaaataaaa aaagtatcta aaaataaaaa 60

acgagtagat gctcaatata aaattaaaac aaactacggt aacattgatc gcaacgttca 120

atttaatttt gttaaagaag atggtatgtg gaagttagat tgggatcata gcgtcattat 180

tccaggaatg cagaaagacc aaagcataca tattgaaaat ttaaaatcag aacgtggtaa 240

aattttagac cgaaacaatg tggaattggc caataccagg uaucaguata ggcatcgttc 300

caaagaatgt atctaaaaaa gattataaag caatcgctaa agaactaagt atttctgaag 360

actatatcaa acaacaaatg gatcaaaatt gggtacaaga tgataccttc gttccactt 419

<210>14

<211>22

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>14

ccgacaguga uacgagagtc gg 22

<210>15

<211>22

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>15

ccgacccagg uaucagugtc gg 22

<210>16

<211>112

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>16

agcgattgat ggtgatacgg ttaaattaat gtacaaaggt caaccaatga cagugauacg 60

agagttgata cacctgaaac aaagcatcct aaaaaaggtg tagagaaata tg 112

<210>17

<211>120

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>17

aatcagaacg tggtaaaatt ttagaccgaa acaatgtgga attggccaat accagguauc 60

aguataggca tcgttccaaa gaatgtatct aaaaaagatt ataaagcaat cgctaaagaa 120

<210>18

<211>48

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>18

aatttaatac gactcactat agggagaccg tatcaccatc aatcgctt 48

<210>19

<211>19

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>19

caaatgcatc acaaacaga 19

<210>20

<211>25

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>20

cgcucugaag auccaacagu gagcg 25

<210>21

<211>44

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>21

aatttaatac gactcactat agggagaatg ctttggtctt tctg 44

<210>22

<211>20

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>22

ctacggtaac attgatcgca 20

<210>23

<211>27

<212>DNA/RNA

<213> Artificial sequence (artificial sequence)

<400>23

cgccggugga aguuagauug ggcggcg 27

Claims

The amplification method of methicillin-resistant staphylococcus aureus MRSA is characterized by comprising the following steps of carrying out amplification in a reaction system, wherein the reaction system contains a specific primer pair aiming at SA23s rRNA and mecA RNA of the MRSA, and the primer pair comprises:

(i) t7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 4;

(ii) nT7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 5;

(iii) t7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 6; and

(iv) nT7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 7.
2. The method of claim 1, wherein the reaction system further comprises: a capture probe for methicillin-resistant staphylococcus aureus MRSA SA23s rRNA and mecA RNA.
3. The method of claim 1, wherein the reaction system further comprises: a specific detection probe of methicillin-resistant staphylococcus aureus MRSA 23s rRNA and a specific detection probe of mecA RNA.
4. The method of claim 3, wherein the method further comprises the steps of: during or after the amplification reaction, fluorescence signals emitted by specific detection probes for detecting MRSA 23s rRNA and mecA RNA of methicillin-resistant Staphylococcus aureus are detected.
A non-diagnostic method for detecting the MRSA of methicillin-resistant staphylococcus aureus, the method comprising:

(a) providing a reaction system, wherein the reaction system contains a sample to be detected, and also contains a specific detection probe of methicillin-resistant staphylococcus aureus MRSA 23s rRNA and a specific detection probe of mecA RNA;

(b) amplifying the reaction system by the amplification method as set forth in claim 1; and

(c) during or after the amplification reaction, fluorescence signals emitted by the specific detection probe for methicillin-resistant staphylococcus aureus MRSA 23s rRNA and the specific detection probe for mecA RNA are detected.
6, detection kit for methicillin-resistant staphylococcus aureus MRSA, characterized in that, the kit includes:

(a) , and a primer pair specific for amplifying SA23s rRNA of methicillin-resistant Staphylococcus aureus (MRSA) located within the container, the primer pair comprising:

(i) t7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 4;

(ii) nT7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 5;

(b) a second container, and a specific primer pair located within the container for amplifying mecA RNA of methicillin-resistant Staphylococcus aureus (MRSA), the primer pair comprising:

(iii) t7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 6; and

(iv) nT7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 7;

and (c) instructions for use.
7. The kit of claim 6, further comprising or more components selected from the group consisting of:

(d) a capture probe;

(e) detecting the probe;

(f) MRSA internal standard sequence; and/or

(g) And detecting the probe by an internal standard.
8. The kit of claim 7, comprising or more features selected from the group consisting of:

the MRSA 23s rRNA detection probe comprises a nucleotide sequence shown as SEQ ID NO. 8, and the mecA RNA detection probe comprises a nucleotide sequence shown as SEQ ID NO. 9; and/or

The capture probe comprises a nucleotide sequence shown as SEQ ID NO. 3; and/or

The MRSA 23s rRNA internal standard sequence comprises a nucleotide sequence shown as SEQ ID NO. 12, and the MRSASA 23s rRNA internal standard detection probe comprises a nucleotide sequence shown as SEQ ID NO. 14; and/or

The mecA RNA internal standard sequence comprises a nucleotide sequence shown as SEQ ID NO. 13; and the internal standard detection probe of mecA RNA comprises a nucleotide sequence shown as SEQ ID NO. 15.
9, specific primer pairs for amplifying methicillin-resistant staphylococcus aureus MRSA 23s rRNA and mecA RNA, wherein the primer pairs comprise:

(i) t7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 4;

(ii) nT7 primer for SA23s rRNA: the sequence is shown as SEQ ID NO. 5;

(iii) t7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 6; and

(iv) nT7 primer for mecA RNA: the sequence is shown as SEQ ID NO. 7.
10. The use of the kit of claim 6 or the primer pair of claim 9 for preparing a detection kit or a detection reagent for detecting methicillin-resistant staphylococcus aureus MRSA.