CN107723376B

CN107723376B - RPA method for detecting rickettsia prowazekii, special primer and probe thereof and application

Info

Publication number: CN107723376B
Application number: CN201710850532.8A
Authority: CN
Inventors: 李越希; 齐永; 邵银秀; 尹琼; 王长军; 李素芹; 陈红霞; 饶继先; 李佳萌; 胡志斌; 陈乐如; 郭峻; 杨彬彬
Original assignee: Individual
Current assignee: Eastern Theater Disease Prevention And Control Center Of Pla
Priority date: 2017-09-20
Filing date: 2017-09-20
Publication date: 2020-10-20
Anticipated expiration: 2037-09-20
Also published as: CN107723376A

Abstract

The invention provides an RPA detection method for detecting rickettsia pulcheri, a special primer and a probe thereof, and application of the RPA detection method in rickettsia pulcheri detection. The detection method, the special primer and the probe thereof, and the oligonucleotide sequences designed based on the rickettsia prowazekii specificity conserved sequence and shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO. 4. The invention applies the novel constant temperature amplification technology RPA to the detection of rickettsia prowazekii for the first time, the method simulates the enzyme reaction process of DNA replication in vivo, and amplifies a DNA template by depending on specific enzyme and protein combination, including recombinase, single-chain binding protein and DNA polymerase, the amplification of a specific nucleic acid sequence can be realized at the constant temperature of 37 ℃, and the amplification product can realize visual discrimination by a lateral chromatography nucleic acid test detection paper strip. The detection method established by the invention has the advantages of sensitivity reaching 10 copy number/mu L, high specificity and low requirement on hardware equipment, can finish detection within 30min, does not need to carry out complex treatment on samples, is suitable for field detection, and is suitable for popularization and application.

Description

RPA method for detecting rickettsia prowazekii, special primer and probe thereof and application

Technical Field

The invention belongs to the technical field of biology, relates to molecular biology of rickettsia pulcheri, relates to a method for detecting rickettsia pulcheri and application thereof, and particularly relates to a method for rapidly detecting rickettsia pulcheri by utilizing recombinase polymerase isothermal amplification technology (RPA technology), a special primer and a probe thereof and application thereof.

Background

Rickettsia pulchella (Rickettsia prowazekii) The epidemic typhus is commonly called epidemic typhus, is gram-negative bacteria parasitizing in obligate cells, has strong resistance to the external environment and long survival time, is generally susceptible to human beings and animals, can be widely spread through aerosol, and is one of high-lethality and bio-warfare pathogens. Epidemic typhus is spread by lice, has serious clinical symptoms, mainly shows high fever, headache and rash, even has obvious neurological symptoms, and can cause auditory disturbance, coma and death.

Clinical manifestations after infection, the latent period of 10-14 days, sudden onset of disease, severe headache, general pain and high fever, 4-7 days later appearing rash, serious is hemorrhagic rash. Some are accompanied by damage to the nervous system, cardiovascular system, and other parenchymal organs. Epidemic typhus is more serious in an environment with dense population and abundant insects. When epidemic, the average mortality rate of the patients is 20%, and when serious, the mortality rate can reach 70%. Pathogens are transmitted among people by human lice, so killing lice is an important measure for preventing epidemic typhus. The detection method of rickettsia includes mainly plate separation culture, serology and fluorescent quantitative PCR. However, these methods have disadvantages of high cost, requiring specific equipment, time consuming and requiring complicated sample handling, resulting in a severely limited range of their practical applications. The establishment of a simple and rapid detection method of rickettsia rickettsii suitable for field application is of great significance.

In recent years, isothermal nucleic acid Amplification technology has been rapidly developed, wherein Recombinase Polymerase isothermal Amplification (RPA) developed by british TwistDx Inc is known as a nucleic acid detection technology capable of replacing PCR, which is based on Recombinase Polymerase-mediated Amplification principle, simulates an enzymatic reaction process of in vivo DNA replication, amplifies a DNA template depending on specific enzyme and protein combination (Recombinase, single-strand binding protein and DNA Polymerase), can realize Amplification of a specific nucleic acid sequence at a constant temperature of 25-43 ℃, and an Amplification product can realize visual discrimination through a lateral chromatography detection test strip. The technology has low requirement on hardware equipment and short reaction time, does not need to carry out complex treatment on samples, and is particularly suitable for the fields of in-vitro diagnosis, food safety, biological safety and the like.

Disclosure of Invention

The invention relates to an RPA method for detecting rickettsia prowazekii, aiming at solving the technical problems of providing a group of specific primers and probes for quickly detecting rickettsia prowazekii and a detection method capable of quickly, simply and specifically detecting rickettsia prowazekii.

Therefore, the first object of the present invention is to provide primers for detecting rickettsia pustulosis, including a forward primer and a reverse primer, which are two in total. The primer is designed according to the conserved gene of the rickettsia pulcheri, and simultaneously, the conserved region of the rickettsia pulcheri gene is further determined by comparing and analyzing the homologous sequence of the gene through software, and is positioned at 16680 to 17240 nucleotide sites of the whole genome of the rickettsia pulcheri (GenBank: AJ 235270), and the region contains a nucleotide fragment with 561 basic groups and has a nucleotide sequence shown as SEQ ID NO. 1. Specific primers are screened and designed from the SEQ ID NO.1 sequence. The screened specific primers comprise a forward primer prf20 and a reverse primer prr246, wherein the two primers are respectively positioned at 16699 to 16728 nucleotide sites and 16896 to 16925 nucleotide sites of the whole genome of rickettsia pustulosis (GenBank: AJ 235270), have oligonucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO.3, the length of the primers is more than 30bp, and the 5' end of the reverse primer is marked with Biotin (Biotin). The double-stranded DNA obtained after amplification of the forward primer and the reverse primer is labeled with biotin.

SEQ ID NO.1：

AAACAGGAAATTAATTCTATTAATAGTTTAGATTCAGCAGTTCTTGTAGAATCACAACAGTTTAAAAAAACTAAAAGTCTAGAAGATATAGAAGATGGATCTTTATCATCACAATTAAAGCAAACTAAATATAAATCGGTGTTATCACCTTCTTCTTATGTTAACGACATGTTTAGTAATGAGCATCATCAAAACTCTAGCATTGAACTACCAAAGTTGTTGCATAGTTCATTGAGTGATACGAACAGTTCGCTTAATGATTGTATAAATCAACTACGATGTGCAAATACATCAGATGTATATAATTTATCATATACACTTTCAAATAAAACAAAGCAATTAAGTATTGATGAACTCAAAAATACATTAGAACAAATGCAAACTTCTCCTAATATAAATATAGTATTGCCTATGCTAATTAGAGTACAACAAGATTATGTAAATGAGGTTGCTGAAATATACCAGCAGACTATAGAACAAAGAAAGCAAAACCCAAGTGAGCAGGCAAAAAATCAAGAAGAGGTAGTAGCAGCTTACTTTACTCAAGAATACGATAAACTA

SEQ ID NO.2：5’ TTAATAGTTTAGATTCAGCAGTTCTTGTAG 3’

SEQ ID NO.3：5’ GTTCGTATCACTCAATGAACTATGCAACAA 3’

It is a second object of the present invention to provide a probe for detecting rickettsia pulcheri. The probe is designed according to a specific conserved sequence of the rickettsia pulcheri, and a conserved region of the rickettsia pulcheri gene is further determined by comparing and analyzing a gene homologous sequence through software, wherein the region contains a nucleotide fragment with 561 bases and has a nucleotide sequence shown in SEQ ID NO. 1. Screening and designing a specific probe from the sequence of SEQ ID NO.1, wherein the designed probe has an oligonucleotide sequence shown in SEQ ID NO.4, the sequence is positioned between 16850 and 16895 nucleotide sites of a whole genome of rickettsia pusillis (GenBank: AJ 235270), the 5 'end is marked with fluorescein FAM, the 3' end is added with an extension blocking group (such as a phosphate group), and Tetrahydrofuran (THF) is inserted between 30 th and 31 th bases.

SEQ ID NO.4：

5’ GTTTAGTAATGAGCATCATCAAAACTCTAGATTGAACTACCAAAG 3’

The length of the probe is 45bp, wherein the 5 'end is 30bp, and the 3' end is 15 bp.

The probe consists of fluorescein (carboxyfluorescein FAM), a 5 ' terminal sequence, Tetrahydrofuran (THF), a 3 ' terminal sequence and a 3 ' terminal extension blocking group (phosphate group).

The probe is annealed with amplified DNA marked with Biotin, and nfo enzyme in an RPA system cuts the probe at a THF position, so that the probe can continue to extend at the 3' end under the action of polymerase, and finally, an amplification product double-marked by FAM and Biotin is obtained.

The third purpose of the invention is to provide an RPA detection method for the rapid detection of rickettsia pulchella, which adopts the RPA primer and the probe to carry out amplification and combines a lateral chromatography nucleic acid detection test strip (hybrid 2T, Milena Biotec GmbH, Germany) to carry out visual judgment.

The invention relates to an RPA method for detecting rickettsia prowazekii, which comprises the following steps:

(1) taking the genome DNA of a sample to be detected as a template, and carrying out RPA reaction under the marks of the primer group and the probe;

(2) and (5) judging a result: detecting the recovered RPA product by using the lateral chromatography nucleic acid detection test strip, wherein a detection line and a quality control line are both displayed, and a judgment result is a positive result; the detection line is not shown, the quality control line is shown, and the judgment result is a negative result; the quality control line is not shown, and whether the detection line is shown or not is judged that the result is invalid.

Preferably, the invention relates to an RPA method for detecting rickettsia prowazekii, which comprises the following steps:

(1) amplification reagent preparation and loading: mu.l of forward primer 2.1. mu.l, 5. mu. mol/L of reverse primer 2.1. mu.l, 10. mu. mol/L of probe 0.6. mu.l, 1. mu.l of sample, 12.2. mu.l of DNase-free and RNase-free water and 29.5. mu.l of buffer were combined to make a premix, which was added to a 0.2mL TwistAmp nfo reaction tube containing lyophilized enzyme powder. Then 2.5. mu.L of a 280mM magnesium acetate solution was added to the cap of the reaction tube.

(2) Amplification: throwing the magnesium acetate solution on the cover of the reaction tube, fully and uniformly mixing, amplifying at 37 ℃ for 20min, taking out the reaction tube in the 4 th min of reaction, fully and uniformly mixing, and then putting the reaction tube back to the reaction device for continuous amplification.

(3) And (5) judging a result: diluting 5 μ L of RPA amplification product to 100 μ L with PBST, detecting the recovered RPA product with the colloidal gold transverse flow test strip, and determining that the detection line and quality control line show positive result; the detection line is not shown, the quality control line is shown, and the judgment result is a negative result; the quality control line is not shown, and whether the detection line is shown or not is judged that the result is invalid.

The invention relates to an RPA method for detecting rickettsia proudenreichii, which adopts the detection principle that the specific conservative target sequence of rickettsia proudenreichii, namely the conservative sequence of rickettsia proudenreichii, is detected by adopting an RPA technology, and the sequence can be used as one of the marker genes of rickettsia proudenreichii.

The RPA method for detecting rickettsia prowazekii saves the detection time of rickettsia prowazekii, can complete the amplification within 20min at 37 ℃, can complete the whole detection process within 1 hour, and greatly shortens the detection time compared with the conventional PCR and the real-time fluorescent quantitative PCR which need hours.

The RPA method for detecting the rickettsia prowazekii reduces the reaction temperature, the RPA can complete the experiment only by keeping the temperature at 37 ℃, and the temperature is far lower than 60-95 ℃ of the fluorescence quantitative PCR and 63 ℃ of LAMP.

The RPA method for detecting rickettsia pulcheri is simpler and more convenient to carry: the enzyme and other necessary matters required by amplification can be stored in a freeze-drying way, the enzyme and other necessary matters can be placed for a long time at normal temperature, only hydrolysis buffer solution, primers, probes and templates need to be added during amplification, magnesium ions are added for initiating reaction, and the sample does not need to be subjected to complex reaction.

The RPA method for detecting rickettsia prowazekii has high sensitivity and strong specificity. Can be used for on-site or bedside detection and has wide application prospect.

Drawings

FIG. 1 is a combination of primers and probes for determining a method for detecting Rickettsia prowazekii RPA. Combining the three groups of forward primers and the three groups of reverse primers respectively to form 9 groups of combinations and a group of positive controls, wherein the combination numbers are shown in table 2, each group of combinations is provided with a group of negative controls, the test results are shown in the figure, and the sample sequence is as follows: the primer combinations in Table 2 are numbered 1-9;

FIG. 2 is a graph showing the determination of the optimal reverse primer and probe combination concentration for the detection of rickettsia prowazekii RPA. Setting the concentration gradient of the reverse primer as 10 mu mol/L, 5 mu mol/L and 2.5 mu mol/L, setting the concentration of the probe as 10 mu mol/L, 5 mu mol/L and 2.5 mu mol/L, combining the reverse primers with three concentrations with the probes with three concentrations respectively to form 9 groups of combinations, wherein the combination numbers are shown in Table 3, each group of combinations is provided with a group of negative controls, the test results are shown in the figure, and the sample sequence is as follows: the combination numbers of the primers and the probes in the table 3 are 1 to 9;

FIG. 3 is a graph showing the determination of the optimal amplification time for the detection of rickettsia rickettsii RPA. Setting the amplification time to be 10min, 15min and 20min, and respectively setting a negative control for each group of samples with the amplification time, wherein the test result is shown in the figure, and NC represents the negative control;

FIG. 4 shows the sensitivity of the method for detecting Rickettsia prowazekii RPA, in which the synthesized positive plasmid was quantified and diluted to 10 concentration by ten-fold dilution⁴- 10⁰Taking plasmid DNA of copies/mu L as a template to carry out the test, wherein the test conditions are the optimal test conditions, the test result is shown in the figure, and NC represents negative control;

FIG. 5 shows the specificity of the method for detecting Rickettsia proudesii RPA, which uses Rickettsia proudesii, Coxiella burnetii, Rickettsia blacklongjiang, Rickettsia sibirica, Staphylococcus aureus, Streptococcus suis genome DNA and human plasma DNA as templates for testing, and the test results are shown in the figure.

Detailed Description

The following examples are intended to illustrate the invention only and are not intended to limit the scope of the invention. The experimental procedures, for which specific conditions are not indicated in the following examples, are generally carried out according to conventional conditions, for example as described in the molecular cloning instructions, published by Sambrook et al, or according to the manufacturer's recommendations.

The various biological materials described in the examples are obtained by way of experimental acquisition for the purposes of this disclosure and should not be construed as limiting the source of the biological material of the invention. In fact, the sources of the biological materials used are wide and any biological material that can be obtained without violating the law and ethics can be used instead as suggested in the examples.

The RPA primers and probes are synthesized by Nanjing Kingsry Biotechnology GmbH, the qPCR primers and probes are synthesized by Shanghai Biotechnology GmbH, and all sequence determination work is completed by Nanjing Kingsry Biotechnology GmbH.

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Example 1 design and screening of Rickettsia prowazekii primers and probes

(1) Design of primers and probes

The inventors have analyzed and determined that the specific sequence of rickettsia pustulosis is used as the target gene by file search. A known template gene sequence, namely a nucleotide sequence shown in SEQ ID NO.1, is obtained from an NCBI database, and the sequence is synthesized by Nanjing Kingsler Biotech limited to be used as a positive plasmid and used as a template in the processes of subsequent primer probe screening, reaction system optimization and the like. Based on the principle of RPA primer and probe design, 6 primers and 1 probe were designed as shown in Table 1.

TABLE 1 primers and probes

Primer/probe	Sequence (5 '→ 3')
		PrF20	TTAATAGTTTAGATTCAGCAGTTCTTGTAG
PrF96	TGGATCTTTATCATCACAATTAAAGCAAAC
		PrF133	AAATCGGTGTTATCACCTTCTTCTTATGTT
PrR246	Biotin-GTTCGTATCACTCAATGAACTATGCAACAA
		PrR267	Biotin-TATACAATCATTAAGCGAACTGTTCGTATC
PrR298	Biotin-CATCTGATGTATTTGCACATCGTAGTTGAT
		Pr probe171	FAM-GTTTAGTAATGAGCATCATCAAAACTCTAG[THF]ATTGAACTACCAAAG-PO4

(2) Primer screening

Artificially synthesizing a sequence shown in SEQ ID NO.1 containing rickettsia prowazekii, taking the plasmid as a template, and comprehensively combining the primers and the probes into 9 groups of primer combinations, wherein the combination numbers are shown in Table 2. The 9 groups of primer combinations are respectively used for RPA amplification at 37 ℃, the condition shown by the detection line of the lateral chromatography nucleic acid detection test strip is taken as an index, and the primer probe combination with the highest amplification efficiency at 37 ℃ is screened out for evaluation and application of subsequent RPA detection.

A50. mu.L RPA reaction was selected as follows: 2.1. mu.L of forward primer 10. mu. mol/L, 2.1. mu.L of reverse primer 5. mu. mol/L, 0.6. mu.L of probe 10. mu. mol/L, 5.3X 10¹⁰1 mu L of copies/mu L of template, 12.2 mu L of DNase-free and RNase-free water and 29.5 mu L of buffer solution to form a premixed solution, and the premixed solution is added into 0.2mL of TwistAmp nfo reaction tubes containing freeze-dried enzyme powder. Then 2.5. mu.L of 280mM magnesium acetate solution was added to the cap of the reaction tube, and in view of the high sensitivity of the RPA reaction and the susceptibility to false positive, the inventors set up a set of negative controls for each set of primer probe combination, the negative controls were not added with template, and the volume of the template was made up with water. The inventor also sets a group of positive controls, the positive controls are provided by TwistAmp RPA nfo reagent boxes, meanwhile, a group of negative controls are set for the positive controls, the negative controls are not added with templates, and the volume of the templates is complemented with water. Amplification: throwing the magnesium acetate solution on the cover of the reaction tube, fully and uniformly mixing, amplifying at 37 ℃ for 20min, taking out the reaction tube in the 4 th min of reversal, fully and uniformly mixing, and then putting the reaction tube back to the reaction device for continuous amplification. And (5) judging a result: mu.L of RPA amplification product was diluted to 100. mu.L with PBST and the RPA product was detected using the lateral flow nucleic acid detection strip described above. One multiple well was set for each reaction.

The 6 primers were combined into 9 sets (table 2), and the test results of the lateral chromatography nucleic acid test strip are shown in fig. 1. FIG. 1 is a diagram showing the detection line and quality control line of a lateral chromatography nucleic acid detection test strip with 9 groups of probe-probe combinations, positive controls and corresponding negative controls when the detection time is 5 min.

TABLE 2 primer combination numbering

Numbering	Combination of	Numbering	Combination of	Numbering	Combination of
						1	PrF20 + prR246	4	PrF96 + prR246	7	PrF133 + prR246
2	PrF20 + prR267	5	PrF96 + prR267	8	PrF133 + prR267
						3	PrF20 + prR298	6	PrF96 + prR298	9	PrF133 + prR298

The primer combination determined by the invention comprises: two forward primers prF20 and two reverse primers prR246, each having the oligonucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO. 3.

(3) Determination of the Probe

The cbbprobe 171 probe listed in Table 1 is preferred in the present invention, and the length of the probe is 45bp, wherein the 5 'end is 30bp, and the 3' end is 15 bp.

The probe consists of fluorescein (carboxyfluorescein FAM), a 5 ' terminal sequence, Tetrahydrofuran (THF), a 3 ' terminal sequence and a 3 ' terminal extension blocking group (phosphate group). The probe has SEQ ID No.: 4, and the 5 'end is marked with fluorescein FAM, the 3' end is added with an extension blocking group (such as a phosphate group), and Tetrahydrofuran (THF) is inserted between the 30 th base and the 31 th base. The probe is annealed with amplified DNA marked with Biotin, and nfo enzyme in an RPA system cuts the probe at a THF position, so that the probe can continue to extend at the 3' end under the action of polymerase, and finally, an amplification product double-marked by FAM and Biotin is obtained.

Example 2: optimization of RPA reaction systems, amplification and detection conditions

In the process of primer screening, the lateral chromatography nucleic acid detection test strip still has false positive in detection, so that the RPA reaction system, the amplification and detection conditions need to be optimized

(1) Concentration of primer Probe

Setting the concentration gradient of the reverse primer as 10 mu mol/L, 5 mu mol/L and 2.5 mu mol/L, setting the concentration gradient of the probe as 10 mu mol/L, 5 mu mol/L and 2.5 mu mol/L, combining the reverse primer with one concentration with the probes with three concentrations respectively to form 3 groups of combinations, and setting one group of negative control in each group of combinations. Respectively carrying out RPA amplification at 37 ℃, and taking the condition shown by a detection line of a lateral chromatography nucleic acid detection test paper strip as an index after the amplification is finished. The combination with the best amplification effect and no false positive is screened out.

TABLE 3 combination numbering of reverse primer concentrations and Probe concentrations

Numbering	Combination of	Numbering	Combination of
				1	10μM PrR246 + 10μM prprobe171	6	2.5μM PrR246 + 5μM prprobe171
2	5μM PrR246 + 10μM prprobe171	7	10μMPrR246 + 2.5μM prprobe171
				3	2.5μM PrR246+ 10μM prprobe171	8	5μM PrR246 + 2.5μM prprobe171
4	10μM PrR246 + 5μM prprobe171	9	2.5μM PrR246+ 2.5μM prprobe171
				5	5μM PrR246 + 5μM prprobe171

Through analyzing the detection result of the lateral chromatography nucleic acid detection test paper strip, the concentration of the reverse primer determined by the invention is 5 mu mol/L, and the concentration of the probe is 10 mu mol/L.

(2) Time of amplification

A50 μ L RPA reaction was as follows: 2.1. mu.L of forward primer 10. mu. mol/L, 2.1. mu.L of reverse primer 5. mu. mol/L, 0.6. mu.L of probe 10. mu. mol/L, 1X 10⁴1 mu L of copies/mu L of template, 12.2 mu L of DNase-free and RNase-free water and 29.5 mu L of buffer solution to form a premixed solution, and the premixed solution is added into 0.2mL of TwistAmp nfo reaction tubes containing freeze-dried enzyme powder. Then 2.5. mu.L of a 280mM magnesium acetate solution was added to the cap of the reaction tube. Amplification: throwing the magnesium acetate solution on the cover of the reaction tube, fully and uniformly mixing, amplifying at 37 ℃ for 10min, 15min and 20min, reacting for 4min, taking out the reaction tube, fully and uniformly mixing, and then putting back to the reaction device for continuous amplification. The inventor sets a group of negative controls for each group, the negative controls do not add a template, and the volume of the template is complemented by water. And (5) judging a result: mu.L of the RPA amplification product was diluted to 100. mu.L with PBST and the RPA product was detected using the lateral flow nucleic acid detection test strip described above.

By analyzing the detection result of the lateral chromatography nucleic acid detection test paper strip, the amplification time of 10min and 15min is shorter, and the amplification time determined by the invention is 20min in consideration of the subsequent sensitivity test.

In conclusion, through optimization of an RPA reaction system and amplification and detection conditions, the finding confirms that the detection effect is best when a downstream primer with the concentration of 5 mu mol/L and a probe with the concentration of 10 mu mol/L are used for amplification for 20min, the sample addition amount is 5 mu L, and the color development time of a test strip is controlled to be 3-5 min.

Example 3: sensitivity evaluation of RPA detection

Diluting the positive plasmid to 10 times according to a 10-fold ratio⁴To a series of different concentrations such as 1/. mu.L, 1. mu.L of each of the primers was added to the reaction system determined in example 2, and the amplification determined in example 2 was performed using the combination of the primers selectedAnd detecting the template with different copy numbers under the detection condition to detect the RPA, and observing the sensitivity of the RPA detection.

As a result, the samples were all positive from the 10 copies/. mu.L, indicating that the sensitivity of the RPA detection method of the present invention reached 10 copies/. mu.L.

Example 4: evaluation of specificity of RPA detection

And specifically evaluating genome DNA of rickettsia prowazekii, coxiella burnetii, rickettsia rickettii, rickettsia blacklongjiang, rickettsia sibirica, staphylococcus aureus and streptococcus suis and human plasma DNA as controls to determine the specificity of the RPA detection method.

Respectively taking genome DNA and human plasma DNA of rickettsia pulcheri, coxiella burnetii, rickettsia riluensis, rickettsia heilongjiang, rickettsia sibirica, staphylococcus aureus and streptococcus suis as templates, and adopting the following reaction systems: mu.l of forward primer 2.1. mu.l, 5. mu. mol/L of reverse primer 2.1. mu.l, 10. mu. mol/L of probe 0.6. mu.l, 1. mu.l of sample, 12.2. mu.l of DNase-free and RNase-free water and 29.5. mu.l of buffer were combined to make a premix, which was added to a 0.2mL TwistAmp nfo reaction tube containing lyophilized enzyme powder. Then 2.5. mu.L of a 280mM magnesium acetate solution was added to the cap of the reaction tube. Amplification: throwing the magnesium acetate solution on the cover of the reaction tube, fully and uniformly mixing, amplifying at 37 ℃ for 20min, taking out the reaction tube in the 4 th min of reaction, fully and uniformly mixing, and then putting the reaction tube back to the reaction device for continuous amplification. And (5) judging a result: diluting 5 μ L of RPA amplification product to 100 μ L with PBST, detecting the RPA product with the lateral chromatography nucleic acid detection test strip, wherein the detection line and the quality control line are both shown, and the judgment result is positive; the detection line is not shown, the quality control line is shown, and the judgment result is a negative result; the quality control line is not shown, and whether the detection line is shown or not is judged that the result is invalid.

The results show that the detection lines of genomic DNA of Coxiella burnetii, Rickettsia rickettsii, Richardia longuensis, Rickettsia siberia, Staphylococcus aureus and Streptococcus suis and human plasma DNA samples all have bands, and are negative, and only the detection line of the Rickettsia pratensis has clear bands and is positive, so that the RPA detection method disclosed by the invention has strong specificity to the Rickettsia pratensis.

Sequence listing

<110> Liviehig

<120> RPA method for detecting rickettsia prowazekii, special primer and probe thereof and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>561

<212>DNA

<213> Rickettsia prowazekii (Rickettsia prowazekii)

<220>

<221>misc_feature

<222>(1)..(561)

<400>1

aaacaggaaa ttaattctat taatagttta gattcagcag ttcttgtaga atcacaacag 60

tttaaaaaaa ctaaaagtct agaagatata gaagatggat ctttatcatc acaattaaag 120

caaactaaat ataaatcggt gttatcacct tcttcttatg ttaacgacat gtttagtaat 180

gagcatcatc aaaactctag cattgaacta ccaaagttgt tgcatagttc attgagtgat 240

acgaacagtt cgcttaatga ttgtataaat caactacgat gtgcaaatac atcagatgta 300

tataatttat catatacact ttcaaataaa acaaagcaat taagtattga tgaactcaaa 360

aatacattag aacaaatgca aacttctcct aatataaata tagtattgcc tatgctaatt 420

agagtacaac aagattatgt aaatgaggtt gctgaaatat accagcagac tatagaacaa 480

agaaagcaaa acccaagtga gcaggcaaaa aatcaagaag aggtagtagc agcttacttt 540

actcaagaat acgataaact a 561

<210>2

<211>30

<212>DNA

<213> Rickettsia prowazekii (Rickettsia prowazekii)

<220>

<221>misc_feature

<222>(1)..(30)

<400>2

ttaatagttt agattcagca gttcttgtag 30

<210>3

<211>30

<212>DNA

<213> Rickettsia prowazekii (Rickettsia prowazekii)

<220>

<221>misc_feature

<222>(1)..(30)

<223> 5' end labeling biotin

<400>3

gttcgtatca ctcaatgaac tatgcaacaa 30

<210>4

<211>45

<212>DNA

<213> Rickettsia prowazekii (Rickettsia prowazekii)

<220>

<221>misc_feature

<222>(1)..(45)

<300>

<301> red poplar, old plum, warm boysenia cattle, east-rising juliena, plum, green phoenix, frugal, and the like.

<302> real-time fluorescent quantitative PCR detection of rickettsia proudenreichii

<303> Chinese epidemiology journal

<304>2006, 27(11)

<305>35-1284/R

<306>963-967

<400>4

gtttagtaat gagcatcatc aaaactctag attgaactac caaag 45

Claims

1. An RPA special primer for detecting rickettsia pulcheri is designed according to a rickettsia pulcheri specific conserved sequence which has a nucleotide sequence shown in SEQ ID NO.1,

SEQ ID NO.1：

AAACAGGAAATTAATTCTATTAATAGTTTAGATTCAGCAGTTCTTGTAGAATCACAACAGTTTAAAAAAACTAAAAGTCTAGAAGATATAGAAGATGGATCTTTATCATCACAATTAAAGCAAACTAAATATAAATCGGTGTTATCACCTTCTTCTTATGTTAACGACATGTTTAGTAATGAGCATCATCAAAACTCTAGCATTGAACTACCAAAGTTGTTGCATAGTTCATTGAGTGATACGAACAGTTCGCTTAATGATTGTATAAATCAACTACGATGTGCAAATACATCAGATGTATATAATTTATCATATACACTTTCAAATAAAACAAAGCAATTAAGTATTGATGAACTCAAAAATACATTAGAACAAATGCAAACTTCTCCTAATATAAATATAGTATTGCCTATGCTAATTAGAGTACAACAAGATTATGTAAATGAGGTTGCTGAAATATACCAGCAGACTATAGAACAAAGAAAGCAAAACCCAAGTGAGCAGGCAAAAAATCAAGAAGAGGTAGTAGCAGCTTACTTTACTCAAGAATACGATAAACTA ；

the forward primer in the primers has an oligonucleotide sequence shown in SEQ ID NO.2, the reverse primer has an oligonucleotide sequence shown in SEQ ID NO.3, and the 5' end is marked with Biotin (Biotin),

SEQ ID NO.2：5’ TTAATAGTTTAGATTCAGCAGTTCTTGTAG 3’

SEQ ID NO.3：5’ GTTCGTATCACTCAATGAACTATGCAACAA 3’。

2. an RPA probe for detecting rickettsia prowazekii is designed according to a rickettsia prowazekii specific conserved sequence, and the rickettsia prowazekii specific conserved sequence has a nucleotide sequence shown in SEQ ID NO. 1; the probe has an oligonucleotide sequence shown in SEQ ID NO.4, fluorescein is marked at the 5 'end, an extension blocking group is added at the 3' end, and Tetrahydrofuran (THF) is added between the 30 th and 31 th bases;

SEQ ID NO.4：

5’ GTTTAGTAATGAGCATCATCAAAACTCTAGATTGAACTACCAAAG 3’ 。

3. the probe of claim 2, wherein: the probe consists of fluorescein, a 5 ' terminal sequence, Tetrahydrofuran (THF), a 3 ' terminal sequence and a 3 ' terminal extension blocking group.

4. The probe of claim 2, wherein: the fluorescein is carboxyl fluorescein FAM or other fluorescein such as FITC, and the extension blocking group is a phosphate group or other blocking groups.

5. The probe of claim 2, wherein: the length is 45bp, wherein the 5 'end is 30bp, and the 3' end is 15 bp.

6. Use of a primer according to claim 1 and/or a probe according to any one of claims 2 to 5 for the preparation of a reagent for detecting procalcitonin RPA.

7. Use according to claim 6, characterized in that: in the application, a primer and a probe are used in a 50 mu L RPA reaction system, the concentration of the forward primer is 10 mu mol/L, the concentration of the reverse primer is 5 mu mol/L, the concentration of the probe is 10 mu mol/L, the concentration of magnesium ions is 280 mu mol/L, and the sample adding amount of a template is 1 mu L; a premix of 2.1. mu.L of the forward primer, 2.1. mu.L of the reverse primer, 0.6. mu.L of the probe, 1. mu.L of the sample, 12.2. mu.L of DNase-free and RNase-free water and 29.5. mu.L of buffer was added to a 0.2mL TwistAmp nfo reaction tube containing lyophilized enzyme powder, and then 2.5. mu.L of a magnesium acetate solution was added to the cap of the reaction tube; throwing the magnesium acetate solution on the cover of the reaction tube, fully and uniformly mixing, amplifying at 37 ℃ for 20min, taking out the reaction tube in the 4 th min of reaction, fully and uniformly mixing, then putting the reaction tube back into the reaction device for continuous amplification, wherein the sample adding amount is 5 mu L during detection, and the color development time of the test strip is controlled to be 3-5 min.