CN107723376A - A kind of RPA methods for detecting Rickettsia prowazeki, its primer special and probe and purposes - Google Patents
A kind of RPA methods for detecting Rickettsia prowazeki, its primer special and probe and purposes Download PDFInfo
- Publication number
- CN107723376A CN107723376A CN201710850532.8A CN201710850532A CN107723376A CN 107723376 A CN107723376 A CN 107723376A CN 201710850532 A CN201710850532 A CN 201710850532A CN 107723376 A CN107723376 A CN 107723376A
- Authority
- CN
- China
- Prior art keywords
- probe
- seq
- rpa
- detection
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides the RPA detection methods for detecting Rickettsia prowazeki, its primer special, probe and its purposes in Rickettsia prowazeki detection.The detection method, its primer special and probe and based on Rickettsia prowazeki specific and conserved sequence design, have SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 shown in oligonucleotide sequence.Novel constant-temperature amplification technique RPA is applied in the detection of Rickettsia prowazeki by the present invention first, the enzyme reaction process of DNA replication dna in this method analogue body, rely on specific enzyme and protein combination, including recombinase, single strand binding protein and archaeal dna polymerase, DNA profiling is expanded, the amplification of specific nucleic acid sequence can be realized under 37 DEG C of constant temperature, amplified production can be tried detection paper slip by lateral chromatography nucleic acid and realize that visualization differentiates.The detection method sensitivity that the present invention establishes is up to 10 copy numbers/μ L, and specificity is high, and the requirement to hardware device is very low, and detection can be completed in 30min, without carrying out complex process to sample, being adapted to Site Detection, suitable for popularization and application.
Description
Technical field
The invention belongs to biological technical field, is related to the molecular biology of Rickettsia prowazeki, is related to a kind of detection Pu Shi
Method of Richettsia and application thereof, it is more particularly to a kind of to utilize recombinase polymerase isothermal amplification technology（RPA technologies）Quickly
Detect method, its primer special and probe of Rickettsia prowazeki and application thereof.
Background technology
Rickettsia prowazeki（Rickettsia prowazekii）Epidemic typhus is commonly called as, to be posted in special sexual cell
Raw Gram-negative bacteria, time-to-live length strong to extraneous environmental resistance, human and animal is generally susceptible, and can pass through gas
Colloidal sol wide-scale distribution, it is high lethal, one of pathogen of biological warfare agent.Epidemic typhus is louse-borne, clinical
Symptom is heavier, is mainly shown as high fever, headache, fash, and notably nervous symptoms are notable, may occur in which that dysacousis, divine coma are straight
To death.
Clinical manifestation through the incubation period of 10-14 days, is fallen ill after people is infected, there is severe headache, general pain and height suddenly
Heat, there is fash after 4-7 days, it is serious for hemorrhagic fash.Some also with symptoms such as nervous system, cardiovascular systems and
Other organa parenchymatosums damage.Epidemic typhus, it is more serious in the environment internal ratio that densely populated and insect is grown prosperity.Work as prevalence
When, patient's average mortality 20%, up to 70% when serious.Pathogen infects by means of humanlice in crowd, so delousing is prevention stream
The typhic important measures of row.Plate isolation method, serology are mainly included to the detection method of rickettsia rickettsii
Technology, fluorescence quantitative PCR method.But these methods are present that cost is higher, need particular device, be time-consuming and sample need to be carried out
The defects of complex process, cause their practical ranges critical constraints.Establish a kind of simple, quick, suitable field application
Rickettsia rickettsii detection method it is significant.
In recent years, constant temperature nucleic acid amplification technology was developed rapidly, and wherein Britain TwistDx Inc companies develop
Recombinase polymerase constant-temperature amplification（Recombinase Polymerase Amplification, RPA）It is alternative to be described as
PCR nucleic acid detection technique, it is the enzyme reaction of DNA replication dna in analogue body based on recombinase polymerase-mediated amplification principle
Process, rely on specific enzyme and protein combination（Recombinase, single strand binding protein and archaeal dna polymerase）DNA profiling is expanded,
The amplification of specific nucleic acid sequence can be realized under 25-43 DEG C of constant temperature, and amplified production can pass through lateral chromatography Test paper
Bar realizes that visualization differentiates.Requirement of the technology to hardware device is very low, and the reaction time is short, without carrying out complicated place to sample
Reason, particularly suitable for fields such as in-vitro diagnosis, food security, bio-safeties.
The content of the invention
A kind of RPA methods for detecting Rickettsia prowazeki of the present invention, technical problem to be solved are to provide one group and are used for
The specific primer and probe of quick detection Rickettsia prowazeki, and a kind of detection Pu Shi Garricks that can be quick, easy, special
The detection method of secondary body.
Therefore first purpose of the present invention is to provide primer for detecting Rickettsia prowazeki, including forward primer and
Reverse primer, totally two.The primer is designed according to the conservative gene of Rickettsia prowazeki, while by software to gene
Homologous sequence is analyzed, and further determined that the conserved region of Rickettsia prowazeki gene, complete positioned at Rickettsia prowazeki
Genome（GenBank: AJ235270）The nucleotides of 561 bases is contained in 16680th to 17240 nucleotide site, this region
Fragment, there is the nucleotide sequence shown in SEQ ID NO.1.The screening design specific primer out of SEQ ID NO.1 sequences.Sieve
The specific primer of choosing includes forward primer prf20 and reverse primer prr246, totally two, complete positioned at Rickettsia prowazeki respectively
Genome（GenBank: AJ235270）16699th to 16728 nucleotide site and the 16896th to 16925 nucleotide site,
With the oligonucleotide sequence as shown in SEQ ID NO.2 and SEQ ID NO.3, the length of primer is more than 30bp, wherein instead
Mark biotin is held to primer 5 '（Biotin）.The double-stranded DNA obtained after the completion of forward primer and reverse primer amplification will mark
There is biotin.
SEQ ID NO.1：
AAACAGGAAATTAATTCTATTAATAGTTTAGATTCAGCAGTTCTTGTAGAATCACAACAGTTTAAAAAAACTA
AAAGTCTAGAAGATATAGAAGATGGATCTTTATCATCACAATTAAAGCAAACTAAATATAAATCGGTGTTATCACCT
TCTTCTTATGTTAACGACATGTTTAGTAATGAGCATCATCAAAACTCTAGCATTGAACTACCAAAGTTGTTGCATAG
TTCATTGAGTGATACGAACAGTTCGCTTAATGATTGTATAAATCAACTACGATGTGCAAATACATCAGATGTATATA
ATTTATCATATACACTTTCAAATAAAACAAAGCAATTAAGTATTGATGAACTCAAAAATACATTAGAACAAATGCAA
ACTTCTCCTAATATAAATATAGTATTGCCTATGCTAATTAGAGTACAACAAGATTATGTAAATGAGGTTGCTGAAAT
ATACCAGCAGACTATAGAACAAAGAAAGCAAAACCCAAGTGAGCAGGCAAAAAATCAAGAAGAGGTAGTAGCAGCTT
ACTTTACTCAAGAATACGATAAACTA
SEQ ID NO.2：5’ TTAATAGTTTAGATTCAGCAGTTCTTGTAG 3’
SEQ ID NO.3：5’ GTTCGTATCACTCAATGAACTATGCAACAA 3’
Second object of the present invention is to provide the probe for detecting Rickettsia prowazeki.The probe is according to Pu Shi Garricks
The specific and conserved sequence design of secondary body, while DNA homolog sequence is analyzed by software, further determine that
The nucleotide fragments of 561 bases are contained in the conserved region of Rickettsia prowazeki gene, this region, have a SEQ ID NO.1 institutes
The nucleotide sequence shown.The screening design specific probe out of SEQ ID NO.1 sequences, design probe have SEQ ID NO.4
Shown oligonucleotide sequence, the sequence are located at Rickettsia prowazeki full-length genome（GenBank: AJ235270）16850th to
Between 16895 nucleotide sites, and 5 ' end mark fluorescent element FAM, 3 ' end addition extension blocking groups（Such as phosphate group）,
A tetrahydrofuran is inserted between 30-31 bit bases（THF）.
SEQ ID NO.4：
5’ GTTTAGTAATGAGCATCATCAAAACTCTAGATTGAACTACCAAAG 3’
The length of the probe is 45bp, wherein 5 ' end 30bp, 3 ' end 15bp.
The probe is by fluorescein（Fluoresceincarboxylic acid FAM）, 5 ' terminal sequences, tetrahydrofuran（THF）, 3 ' terminal sequences and 3 ' end extension
Blocking group（Phosphate group）A few part compositions.
The DNA that the probe has with the mark after amplification is annealed, and the nfo enzymes in RPA systems will be cut at THF positions
Disconnected probe, probe is set to continue to extend at 3 ' ends in the case where polymerizeing enzyme effect, the final amplification production for obtaining FAM and Biotin double labellings
Thing.
Third object of the present invention there is provided the RPA detection methods for Rickettsia prowazeki quick detection, described
Method is expanded using above-mentioned RPA primer and probes, and combines lateral chromatography nucleic acid detection test strip (Hybridetect
2T, Milenia Biotec GmbH, Germany) carry out visualization judgement.
A kind of RPA methods for detecting Rickettsia prowazeki of the present invention, comprise the following steps：
（1）Using testing sample genomic DNA as template, RPA reactions are carried out under the mark of the primer sets and probe；
（2）As a result judge：The RPA products after recovery are detected with above-mentioned lateral chromatography nucleic acid detection test strip, detection line
Show with nature controlling line, judged result is positive findings；Detection line is not showed, and nature controlling line shows, and judged result is negative findings；
Nature controlling line does not show, no matter whether detection line is showed, equal result of determination is invalid.
Preferably, a kind of RPA methods for detecting Rickettsia prowazeki of the present invention, are comprised the following steps that：
（1）Amplifing reagent prepares and sample-adding：By 10 μm of μ L of ol/L forward primers 2.1,5 μm of μ L of ol/L reverse primers 2.1,10 μ
μ L of mol/L probes 0.6,1 μ L samples, 12.2 μ L are added to without DNase and RNase water and 29.5 μ L buffer solutions composition premixed liquid
In the TwistAmp nfo reaction tubes of 0.2mL containing lyophilized enzyme powder.Then 2.5 μ L 280mM magnesium acetate solutions are added to instead
Should be on the lid of pipe.
（2）Amplification：Magnesium acetate solution on reaction tube lid is got rid of down, 37 DEG C of amplification 20min after fully mixing, anti-
4min is answered, reaction tube is taken out and fully mixed, puts back to afterwards in reaction unit and continues to expand.
（3）As a result judge：5 μ L RPA amplified productions are taken to be diluted to 100 μ L with PBST, with above-mentioned collaurum lateral flow
Test strips detect to the RPA products after recovery, and detection line and nature controlling line show, and judged result is positive findings；Detection
Line does not show, and nature controlling line shows, and judged result is negative findings；Nature controlling line does not show, no matter whether detection line is showed, judges
As a result it is invalid.
A kind of RPA methods for detecting Rickettsia prowazeki of the present invention, Cleaning Principle is to use RPA technologies, to Pu Shi Garricks
Specific conservative's target sequence of secondary body, the i.e. conserved sequence of Rickettsia prowazeki are detected, and the sequence can be used as Pu Shi Garricks
One of marker gene of secondary body.
A kind of RPA methods for detecting Rickettsia prowazeki of the present invention, have saved the detection time of Rickettsia prowazeki, have detected
Amplification can be completed in 20min at 37 DEG C, whole detection process can be completed in 1 hour, determined with Standard PCR and real-time fluorescence
Amount PCR needs a few hours compared to highly shortened detection time.
A kind of RPA methods for detecting Rickettsia prowazeki of the present invention, reduce reaction temperature, RPA only needs 37 DEG C of constant temperature
It can complete to test, 63 DEG C of the temperature well below 60-95 DEG C and LAMP of quantitative fluorescent PCR.
A kind of RPA methods for detecting Rickettsia prowazeki of the present invention, it is simpler, be easy to carry：Amplification needed for enzyme and
Some other requirement can freeze preservation, can place for a long time at normal temperatures, only need during amplification to add hydrolysis buffering
Liquid, primer, probe and template, and magnesium ion initial action is added, and sample need not carry out complex reaction.
A kind of RPA methods for detecting Rickettsia prowazeki of the present invention, bright sensitivity is high, high specificity.Available for scene or
Bed is other to be detected, and is had broad application prospects.
Brief description of the drawings
Fig. 1 is the primer and probe combination for determining detection Rickettsia prowazeki RPA detection methods.By three groups of forward primers and
Three groups of reverse primers are respectively combined, and are combined into 9 groups of combinations and one group of positive control, and combination number is shown in Table 2, and every group of combination is equal
One group of negative control is set, and result of the test is as illustrated, sampfe order：The inner primer combination number 1-9 of table 2;
Fig. 2 is the optimal reverse primer and probe combined concentration for determining detection Rickettsia prowazeki RPA detection methods.Setting is reverse
The concentration gradient of primer is 10 μm of ol/L, 5 μm of ol/L, 2.5 μm of ol/L, and the concentration of probe is 10 μm of ol/L, 5 μm of ol/L, 2.5 μ
Mol/L, probe of the reverse primer of three kinds of concentration respectively with three kinds of concentration is combined, is combined into 9 groups of combinations, combination number
3 are shown in Table, every group of combination is respectively provided with one group of negative control, and result of the test is as illustrated, sampfe order：The inner primer of table 3 and probe groups
The number of compiling in collaboration with 1-9;
Fig. 3 is the optimal proliferation time for determining detection rickettsia rickettsii RPA detection methods.Set proliferation time as 10min,
15min, 20min, and the sample of respectively each group proliferation time is provided with a negative control, result of the test as illustrated,
NC represents negative control;
Fig. 4 is the sensitivity of detection Rickettsia prowazeki RPA methods, and the positive plasmid of synthesis is quantified, and with ten times times
Mode than dilution dilutes concentration for 104 - 100 Copies/ μ L DNA is tested as template, experimental condition
For above-mentioned optimum test condition, result of the test is as illustrated, NC represents negative control;
Fig. 5 is the specificity of detection Rickettsia prowazeki RPA methods, respectively with Rickettsia prowazeki, Coxiella burnetii, vertical
Family name's Richettsia, Rana amurensis, dermacetor sibericus, staphylococcus aureus, the genomic DNA of Streptococcus suis
Tested with human plasma DNA as template, result of the test is as shown in the figure.
Embodiment
Following embodiments are only illustrative of the invention and is not intended to limit the scope of the invention.It is unreceipted in the following example
The experimental method of actual conditions, generally compiled according to normal condition such as Sambrook et al.《Molecular Cloning:A Laboratory guide》Middle institute
The condition stated, or the condition suggested according to manufacturer.
The acquirement approach of various biomaterials described in embodiment be only to provide it is a kind of test obtain approach with up to
To specifically disclosed purpose, the limitation to biological material source of the present invention should not be turned into.In fact, used biomaterial
Source be it is extensive, it is any keep on the right side of the law the biomaterial that can be obtained with moral ethics can be according to carrying in embodiment
Show and be replaced.
RPA primer and probes used are synthesized by Nanjing Genscript Biotechnology Co., Ltd., qPCR primer and probes Shanghai
Sheng Gong Bioisystech Co., Ltd is synthesized, and all sequences measure work is completed by Nanjing Genscript Biotechnology Co., Ltd..
The invention will now be further described with reference to specific embodiments, advantages of the present invention and feature will be with description and
It is apparent.But these embodiments are only exemplary, do not form any restrictions to the scope of the present invention.People in the art
Member to the details and form of technical solution of the present invention it should be understood that can enter without departing from the spirit and scope of the invention
Row modifications or substitutions, but these modifications and replacement are each fallen within protection scope of the present invention.
Embodiment 1, the design and screening of Rickettsia prowazeki primer and probe
（1）The design of primer and probe
For inventor by document retrieval, it is target gene that analysis, which determines that the present invention uses the specific sequence of Rickettsia prowazeki,.
Known templet gene sequence, i.e. nucleotide sequence shown in SEQ ID NO.1 are obtained from ncbi database, and by Nanjing gold
Si Rui bio tech ltd synthesizes to above-mentioned sequence, as positive plasmid, in the screening of follow-up primed probe, reactant
Used during optimization of system etc. as template.According to RPA primers and probe design principle, 6 primers and 1 probe are designed,
As shown in table 1.
The primer of table 1 and probe
| Primer/probe | Sequence（5’→3’） |
| PrF20 | TTAATAGTTTAGATTCAGCAGTTCTTGTAG |
| PrF96 | TGGATCTTTATCATCACAATTAAAGCAAAC |
| PrF133 | AAATCGGTGTTATCACCTTCTTCTTATGTT |
| PrR246 | Biotin-GTTCGTATCACTCAATGAACTATGCAACAA |
| PrR267 | Biotin-TATACAATCATTAAGCGAACTGTTCGTATC |
| PrR298 | Biotin-CATCTGATGTATTTGCACATCGTAGTTGAT |
| Prprobe171 | FAM-GTTTAGTAATGAGCATCATCAAAACTCTAG[THF]ATTGAACTACCAAAG-PO4 |
（2）Primer screening
Sequence shown in the artificial synthesized SEQ ID NO.1 containing Rickettsia prowazeki, using this plasmid as template, by primer and probe
Carry out global combinatorial to combine into 9 groups of primers, combination number is as shown in table 2.9 groups of primer combinations are carried out under the conditions of 37 DEG C respectively
RPA amplifications are carried out, situation is showed as index using lateral chromatography nucleic acid detection test strip detection line, filtered out under the conditions of 37 DEG C,
Amplification efficiency highest primer combination of probe, evaluation and application for follow-up RPA detections.
50 μ L of screening RPA reaction systems are as follows：By 10 μm of μ L of ol/L forward primers 2.1,5 μm of ol/L reverse primers
2.1 μ L, 10 μm of μ L of ol/L probes 0.6,5.3 × 1010μ L of copies/ μ L templates 1,12.2 μ L without DNase and RNase water and
29.5 μ L buffer solutions form premixed liquid, are added in the TwistAmp nfo reaction tubes of the 0.2mL containing lyophilized enzyme powder.Then will
2.5 μ L 280mM magnesium acetate solutions are added on the lid of reaction tube, it is contemplated that RPA reaction sensitivities are higher, false positive easily occur
Situation, inventor be each group of primer combination of probe be provided with one group of negative control, negative control is not added with template, template body
Product is supplied with water.Inventor is also provided with one group of positive control, and positive control in TwistAmp RPA nfo kits by carrying
For, while one group of negative control also is provided with for positive control, negative control is not added with template, and template volume is supplied with water.Amplification：
Magnesium acetate solution on reaction tube lid is got rid of down, 37 DEG C of amplification 20min after fully mixing, in 4min anyway, by reaction tube
Take out and fully mix, put back to afterwards in reaction unit and continue to expand.As a result judge：5 μ L RPA amplified productions are taken to be diluted with PBST
RPA products are detected to 100 μ L, then with above-mentioned lateral chromatography nucleic acid detection test strip.Each reaction sets a multiple holes.
6 primers are combined into 9 groups（Table 2）, lateral chromatography nucleic acid detection test strip testing result is shown in Fig. 1.Fig. 1 is detection
The lateral chromatography detection of nucleic acids examination of 9 groups of probes probes combinations, positive control and its corresponding negative control when time is 5min
The detection line of paper slip and the display situation of nature controlling line.
The primer combination number of table 2
| Numbering | Combination | Numbering | Combination | Numbering | Combination |
| 1 | PrF20 + prR246 | 4 | PrF96 + prR246 | 7 | PrF133 + prR246 |
| 2 | PrF20 + prR267 | 5 | PrF96 + prR267 | 8 | PrF133 + prR267 |
| 3 | PrF20 + prR298 | 6 | PrF96 + prR298 | 9 | PrF133 + prR298 |
Present invention determine that primer combination include：Forward primer prF20 and reverse primer prR246, totally two, have respectively such as
Oligonucleotide sequence shown in SEQ ID NO.2 and SEQ ID NO.3.
（3）The determination of probe
For the present invention preferably, the length of probe is 45bp to the cbprobe171 probes that table 1 is listed, wherein 5 ' end 30bp, 3 ' ends
15bp。
Probe is by fluorescein（Fluoresceincarboxylic acid FAM）, 5 ' terminal sequences, tetrahydrofuran（THF）, 3 ' terminal sequences and 3 ' end extension
Blocking group（Phosphate group）A few part compositions.Probe has SEQ ID NO.：Oligonucleotide sequence shown in 4, and 5 ' end marks
Remember fluorescein FAM, 3 ' end addition extension blocking groups（Such as phosphate group）, a tetrahydrochysene is inserted between 30-31 bit bases
Furans（THF）.The DNA that the probe has with the mark after amplification anneals, and the nfo enzymes in RPA systems will be at THF positions
Probe is cut off, enables probe to continue to extend at 3 ' ends in the case where polymerizeing enzyme effect, the final amplification for obtaining FAM and Biotin double labellings
Product.
Embodiment 2：RPA reaction systems, amplification and the optimization of testing conditions
During primer screening, lateral chromatography nucleic acid detection test strip is the situation that still suffers from false positive in detection, therefore
RPA reaction systems, amplification and testing conditions need to be optimized
（1）Primed probe concentration
The concentration gradient gradient of reverse primer is set as 10 μm of ol/L, 5 μm of ol/L, 2.5 μm of ol/L, the concentration gradient of probe is 10
μm ol/L, 5 μm of ol/L, 2.5 μm of ol/L, a kind of probe of reverse primer of concentration respectively with three kinds of concentration are combined, group
3 groups of combinations are synthesized, every group of combination is respectively provided with one group of negative control.Carry out carrying out RPA amplifications under the conditions of 37 DEG C respectively, amplification
Finish and situation is showed as index using lateral chromatography detection of nucleic acids paper slip detection line of having a try.It is best to filter out expanding effect, and does not go out
The combination of existing false positive.
The reverse primer concentration of table 3 and concentration and probe concentration combination number
| Numbering | Combination | Numbering | Combination |
| 1 | 10μM PrR246 + 10μM prprobe171 | 6 | 2.5μM PrR246 + 5μM prprobe171 |
| 2 | 5μM PrR246 + 10μM prprobe171 | 7 | 10μMPrR246 + 2.5μM prprobe171 |
| 3 | 2.5μM PrR246+ 10μM prprobe171 | 8 | 5μM PrR246 + 2.5μM prprobe171 |
| 4 | 10μM PrR246 + 5μM prprobe171 | 9 | 2.5μM PrR246+ 2.5μM prprobe171 |
| 5 | 5μM PrR246 + 5μM prprobe171 |
By paper slip Analysis of test results of being had a try to lateral chromatography detection of nucleic acids, present invention determine that the concentration of reverse primer be 5 μ
Mol/L, the concentration of probe are 10 μm of ol/L.
（2）Proliferation time
50 μ L RPA reaction systems are as follows：By 10 μm of μ L of ol/L forward primers 2.1,5 μm of μ L of ol/L reverse primers 2.1,10 μ
μ L of mol/L probes 0.6,1 × 104μ L of copies/ μ L templates 1,12.2 μ L are without DNase and RNase water and 29.5 μ L buffer solutions
Premixed liquid is formed, is added in the TwistAmp nfo reaction tubes of the 0.2mL containing lyophilized enzyme powder.Then by 2.5 μ L 280mM
Magnesium acetate solution is added on the lid of reaction tube.Amplification：Magnesium acetate solution on reaction tube lid is got rid of down, 37 after fully mixing
DEG C amplification 10min, 15min, 20min, reaction 4min, by reaction tube take out fully mix, put back to reaction unit afterwards
In continue to expand.Inventor is each group and is respectively provided with one group of negative control, and negative control is not added with template, template volume water
Supply.As a result judge：Take 5 μ L RPA amplified productions to be diluted to 100 μ L with PBST, then tried with above-mentioned lateral chromatography detection of nucleic acids
Test strips detect to RPA products.
By paper slip Analysis of test results of being had a try to lateral chromatography detection of nucleic acids, 10min and 15min proliferation time sample
Detection line band is shallower, it is contemplated that follow-up sensitivity test, present invention determine that proliferation time be 20min.
To sum up, optimized by RPA reaction systems, amplification and testing conditions, this discovery is determined dense using 5 μm of ol/L
The probe amplification 20min of the anti-sense primer of degree and 10 μm of ol/L concentration, sample-adding amount are 5 μ L, the control of test strips developing time 3 ~
During 5min, Detection results are best.
Embodiment 3：The sensitivity evaluation of RPA detections
Positive plasmid is pressed into 10 doubling dilutions into 104To a series of various concentrations such as 1/μ L, 1 μ L are respectively taken to be separately added into embodiment
Reaction system determined by 2, combined using the primer filtered out, the amplification determined using embodiment 2 and testing conditions are to above-mentioned
The template of different copy numbers carries out RPA detections, the sensitivity of observation RPA detections.
As a result, above sample is positive since 10/μ L copy numbers, illustrates the sensitive of RPA detection methods of the present invention
Degree reaches 10 copies/μ L.
Embodiment 4：The Evaluation on specificity of RPA detections
Evaluation on specificity Rickettsia prowazeki, Coxiella burnetii, rickettsia rickettsii, Rana amurensis, Siberia
Richettsia, staphylococcus aureus, the genomic DNA of Streptococcus suis and human plasma DNA are control, to determine RPA of the present invention
The specificity of detection method.
Respectively with Rickettsia prowazeki, Coxiella burnetii, rickettsia rickettsii, Rana amurensis Spotted Fever, west
Berli Asia Richettsia spotted fever, staphylococcus aureus, the genomic DNA of Streptococcus suis and human plasma DNA are template, are used
Following reaction system：By 10 μm of μ L of ol/L forward primers 2.1,5 μm of μ L of ol/L reverse primers 2.1,10 μm of μ L of ol/L probes 0.6,1
μ L samples, 12.2 μ L are added to containing lyophilized enzyme powder without DNase and RNase water and 29.5 μ L buffer solutions composition premixed liquid
In 0.2mL TwistAmp nfo reaction tubes.Then 2.5 μ L 280mM magnesium acetate solutions are added on the lid of reaction tube.Expand
Increase：Magnesium acetate solution on reaction tube lid is got rid of down, 37 DEG C of amplification 20min after fully mixing, will be anti-in reaction 4min
Should pipe take out fully mix, put back to afterwards in reaction unit and continue to expand.As a result judge：Take 5 μ L RPA amplified productions PBST
100 μ L are diluted to, RPA products are detected with above-mentioned lateral chromatography nucleic acid detection test strip, detection line and nature controlling line are aobvious
Go out, judged result is positive findings；Detection line is not showed, and nature controlling line shows, and judged result is negative findings；Nature controlling line does not show
Go out, no matter whether detection line is showed, equal result of determination is invalid.
As a result Coxiella burnetii, rickettsia rickettsii, Rana amurensis, dermacetor sibericus, golden yellow
Staphylococcus, the genomic DNA of Streptococcus suis and human plasma DNA sample detection line are band occur, are negative, only Pu Shi
There is clear band in Richettsia sample detection line, is positive, illustrates that RPA detection methods of the present invention have very to Rickettsia prowazeki
Strong specificity.
Sequence table
<110>Li Yuexi
<120>A kind of RPA methods, its primer special and probe for detecting Rickettsia prowazeki and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 561
<212> DNA
<213>Rickettsia prowazeki (Rickettsia prowazekii)
<220>
<221> misc_feature
<222> (1)..(561)
<400> 1
aaacaggaaa ttaattctat taatagttta gattcagcag ttcttgtaga atcacaacag 60
tttaaaaaaa ctaaaagtct agaagatata gaagatggat ctttatcatc acaattaaag 120
caaactaaat ataaatcggt gttatcacct tcttcttatg ttaacgacat gtttagtaat 180
gagcatcatc aaaactctag cattgaacta ccaaagttgt tgcatagttc attgagtgat 240
acgaacagtt cgcttaatga ttgtataaat caactacgat gtgcaaatac atcagatgta 300
tataatttat catatacact ttcaaataaa acaaagcaat taagtattga tgaactcaaa 360
aatacattag aacaaatgca aacttctcct aatataaata tagtattgcc tatgctaatt 420
agagtacaac aagattatgt aaatgaggtt gctgaaatat accagcagac tatagaacaa 480
agaaagcaaa acccaagtga gcaggcaaaa aatcaagaag aggtagtagc agcttacttt 540
actcaagaat acgataaact a 561
<210> 2
<211> 30
<212> DNA
<213>Rickettsia prowazeki (Rickettsia prowazekii)
<220>
<221> misc_feature
<222> (1)..(30)
<400> 2
ttaatagttt agattcagca gttcttgtag 30
<210> 3
<211> 30
<212> DNA
<213>Rickettsia prowazeki (Rickettsia prowazekii)
<220>
<221> misc_feature
<222> (1)..(30)
<223>5 ' end mark biotins
<400> 3
gttcgtatca ctcaatgaac tatgcaacaa 30
<210> 4
<211> 45
<212> DNA
<213>Rickettsia prowazeki (Rickettsia prowazekii)
<220>
<221> misc_feature
<222> (1)..(45)
<300>
<301>Yang Xiao Chen Mei tinkling of pieces of jade temperature Bo Hainiudong rises Zhu Linali green grass or young crops phoenix grandson and grows the such as thrifty
<302>Detection of Rickettsia prowazekii by quantitative real-time PCR
<303>Chinese epidemiology magazine
<304> 2006, 27(11)
<305> 35-1284/R
<306> 963-967
<400> 4
gtttagtaat gagcatcatc aaaactctag attgaactac caaag 45
Claims (8)
1. a kind of RPA primer specials for being used to detect Rickettsia prowazeki, are according to Rickettsia prowazeki specific and conserved sequence
Design, the Rickettsia prowazeki specific and conserved sequence has the nucleotide sequence shown in SEQ ID NO.1
SEQ ID NO.1：
AAACAGGAAATTAATTCTATTAATAGTTTAGATTCAGCAGTTCTTGTAGAATCACAACAGTTTAAAAAAACTA
AAAGTCTAGAAGATATAGAAGATGGATCTTTATCATCACAATTAAAGCAAACTAAATATAAATCGGTGTTATCACCT
TCTTCTTATGTTAACGACATGTTTAGTAATGAGCATCATCAAAACTCTAGCATTGAACTACCAAAGTTGTTGCATAG
TTCATTGAGTGATACGAACAGTTCGCTTAATGATTGTATAAATCAACTACGATGTGCAAATACATCAGATGTATATA
ATTTATCATATACACTTTCAAATAAAACAAAGCAATTAAGTATTGATGAACTCAAAAATACATTAGAACAAATGCAA
ACTTCTCCTAATATAAATATAGTATTGCCTATGCTAATTAGAGTACAACAAGATTATGTAAATGAGGTTGCTGAAAT
ATACCAGCAGACTATAGAACAAAGAAAGCAAAACCCAAGTGAGCAGGCAAAAAATCAAGAAGAGGTAGTAGCAGCTT
ACTTTACTCAAGAATACGATAAACTA 。
2. primer according to claim 1, it is characterised in that：Forward primer in the primer has SEQ ID NO.2
Shown oligonucleotide sequence, reverse primer have the oligonucleotide sequence shown in SEQ ID NO.3, and 5 ' end mark biotins
（Biotin）
SEQ ID NO.2：5’ TTAATAGTTTAGATTCAGCAGTTCTTGTAG 3’
SEQ ID NO.3：5’ GTTCGTATCACTCAATGAACTATGCAACAA 3’ .
3. a kind of RPA probes for being used to detect Rickettsia prowazeki, are designed according to Rickettsia prowazeki specific and conserved sequence
, the Rickettsia prowazeki specific and conserved sequence has the nucleotide sequence shown in SEQ ID NO.1；The probe has
Oligonucleotide sequence shown in SEQ ID NO.4, and 5 ' end mark fluorescent elements, 3 ' end addition extension blocking groups, in 30-31
Increase a tetrahydrofuran between bit base（THF）；
SEQ ID NO.4：
5’ GTTTAGTAATGAGCATCATCAAAACTCTAGATTGAACTACCAAAG 3’ 。
4. probe according to claim 3, it is characterised in that：The probe is by fluorescein, 5 ' terminal sequences, tetrahydrofuran
（THF）, 3 ' terminal sequences and 3 ' end extension blocking groups composition.
5. probe according to claim 3, it is characterised in that：Described fluorescein is Fluoresceincarboxylic acid FAM or FITC etc.
Other fluoresceins, described extension blocking group are phosphate group or other blocking groups.
6. probe according to claim 3, it is characterised in that：Length is 45bp, wherein 5 ' end 30bp, 3 ' end 15bp.
7. a kind of RPA methods for being used to detect general formula Richettsia, primer and/or right including the use of claim 2 will
Seek 3-6 probe.
8. according to the method for claim 7, it is characterised in that：It is used for the examination of 50 μ L RPA reaction systems in methods described
Agent, the concentration of described forward primer is 10 μm of ol/L, and the concentration of reverse primer is 5 μm of ol/L, and the concentration of described probe is
280 μm of 10 μm of ol/L, magnesium ion concentration ol/L, template sample-adding amount are 1 μ L；By 2.1 μ L forward primers, 2.1 μ L reverse primers,
0.6 μ L probes, 1 μ L samples, 12.2 μ L are added to containing jelly without DNase and RNase water and 29.5 μ L buffer solutions composition premixed liquid
In the 0.2mL of dry enzyme powder TwistAmp nfo reaction tubes, then 2.5 μ L magnesium acetate solution is added to the lid of reaction tube
On；Magnesium acetate solution on reaction tube lid is got rid of down, 37 DEG C of amplification 20min after fully mixing, in reaction 4min, will be reacted
Pipe, which takes out, fully to be mixed, and is put back to afterwards in reaction unit and is continued to expand, and sample-adding amount is 5 μ L during detection, test strips developing time control
System is in 3-5min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710850532.8A CN107723376B (en) | 2017-09-20 | 2017-09-20 | RPA method for detecting rickettsia prowazekii, special primer and probe thereof and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710850532.8A CN107723376B (en) | 2017-09-20 | 2017-09-20 | RPA method for detecting rickettsia prowazekii, special primer and probe thereof and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107723376A true CN107723376A (en) | 2018-02-23 |
| CN107723376B CN107723376B (en) | 2020-10-20 |
Family
ID=61207280
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710850532.8A Active CN107723376B (en) | 2017-09-20 | 2017-09-20 | RPA method for detecting rickettsia prowazekii, special primer and probe thereof and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107723376B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060099628A1 (en) * | 2004-11-10 | 2006-05-11 | Wei-Mei Ching | Diagnostic assay for rickettsia prowazekii disease by detection of responsive gene expression |
| CN105483232A (en) * | 2015-12-24 | 2016-04-13 | 四川国际旅行卫生保健中心 | Detection method for Rickettsia liquid phase gene chip |
| CN105543346A (en) * | 2015-12-24 | 2016-05-04 | 四川国际旅行卫生保健中心 | Multiplex fluorescence PCR (polymerase chain reaction) detection method for rickettsia |
-
2017
- 2017-09-20 CN CN201710850532.8A patent/CN107723376B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060099628A1 (en) * | 2004-11-10 | 2006-05-11 | Wei-Mei Ching | Diagnostic assay for rickettsia prowazekii disease by detection of responsive gene expression |
| CN105483232A (en) * | 2015-12-24 | 2016-04-13 | 四川国际旅行卫生保健中心 | Detection method for Rickettsia liquid phase gene chip |
| CN105543346A (en) * | 2015-12-24 | 2016-05-04 | 四川国际旅行卫生保健中心 | Multiplex fluorescence PCR (polymerase chain reaction) detection method for rickettsia |
Non-Patent Citations (3)
| Title |
|---|
| ANDERSSON,S.G等: "GenBank: AJ235270.1", 《NCBI-GENBANK》 * |
| 崔红等: "用种特异性聚合酶链反应检测普氏立克次体的研究", 《中国人兽共患病杂志》 * |
| 杨晓等: "实时荧光定量PCR检测普氏立克次体", 《中华流行病学杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107723376B (en) | 2020-10-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111187856B (en) | Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof | |
| CN110408726B (en) | Method for detecting 29 respiratory pathogens by using Taqman low-density microfluidic chip technology | |
| CN108676920B (en) | Primer and kit for rapidly detecting mouse norovirus and RT-RPA method thereof | |
| CN110106290A (en) | A kind of field fast detection method and kit being used to detect ASFV based on CRISPR/Cas system | |
| CN108624720A (en) | The primed probe group and kit of RAA Fluorometric assay Rift Valley fever virus | |
| CN113637778A (en) | Kit and method for detecting brucella | |
| CN105603123A (en) | Real-time fluorescence RPA reagent kit and test strip RPA reagent kit for rapidly detecting porcine parvovirus and application of reagent kits | |
| CN112739833A (en) | Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof | |
| CN104975098A (en) | Method for rapid fluorescence detection of polynucleotide target objects simultaneously at room temperature and constant temperature | |
| CN108531627A (en) | One kind is for detecting the streptococcic RPA fluorescent quantitations primer pair of B races, probe, kit and detection method | |
| Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
| WO2006121134A1 (en) | Primer and probe for use in detection of mycobacterium kansasii and method for detection of mycobacterium kansasii using the same | |
| CN109504800A (en) | A kind of RPA method for detecting universal adenovirus hominis, its primer special and probe and purposes | |
| CN105189781B (en) | The probability-guide of nucleotide sequence separates (PINS) | |
| CN112831605A (en) | Multienzyme isothermal amplification detection kit and application thereof | |
| CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
| CN111793703A (en) | Kit for enzyme digestion probe constant temperature detection of mycobacterium tuberculosis nucleic acid | |
| CN110042175A (en) | Primer, probe, kit and application based on RPA technology detection Bean common mosaic virus | |
| CN107385089B (en) | Nucleic acid combination, kit and method for detecting cryptosporidium oocysts | |
| CN108070638B (en) | Recombinase polymerase isothermal amplification method for detecting orientia tsutsutsugamushi, special primer and probe thereof and application | |
| CN107723375A (en) | A kind of RPA methods for detecting rickettsia rickettsii, its primer special and probe and purposes | |
| CN115747361A (en) | Real-time fluorescent MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method | |
| CN107723376A (en) | A kind of RPA methods for detecting Rickettsia prowazeki, its primer special and probe and purposes | |
| CN103725761A (en) | Group B streptococcus (GBS) nucleic acid detection kit and detection method | |
| CN107988429B (en) | Reagent for detecting rabies virus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230924 Address after: 210002 No. 293 East Zhongshan Road, Jiangsu, Nanjing Patentee after: EASTERN THEATER DISEASE PREVENTION AND CONTROL CENTER OF PLA Address before: 210002 No. 293 East Zhongshan Road, Jiangsu, Nanjing Patentee before: Li Jiameng |
|
| TR01 | Transfer of patent right |