CN1468965A - Gene detection reagent kit for SARS virus and its detection method - Google Patents

Abstract

The detection process of SARS virus of the gene detection reagent kit with rationing standard specific SARS virus nucleic acid as reference includes RNA extraction, PCR amplification and fluorescent detection. The venous blood sample, gargled liquid or respiratory tract secretion of the patient is used as the analysis sample directly, RNA of the sample is extracted as the nucleic acid template, and the template is used in fluorescent PCR amplification. The used fluorescent amplification detecting reagents includes one-step process RT-PCR buffering liquid, deoxynucleoside triphosphate (dNTP) mixture, specific amplification primer and specific probe. The method of the present invention is fast and convenient in detecting SARS virus.

Description

The gene detecting kit of SARS virus and detection method

One, technical field

The present invention relates to a kind of gene detecting kit and with the gene tester that whether contains SARS virus in this test kit test sample.

Two, background technology

Atypical pneumonia is a kind of acute respiratory transmissible disease, and (Severe Acute Respiratory Syndrome SARS), abbreviates SARS as to be called severe acute respiratory syndrome abroad.Mainly by the closely air spittle and contact transmission closely, onset is anxious, propagation is fast, and case fatality rate surpasses in 5%.First case appears in China Guangdong Province since in November, 2002, short six months, relate to nearly 30 countries and regions, the world at present, and global patient has reached 6000 many cases, and number of the infected still has ever-increasing trend.Because it does not also have vaccine and specific medicine at present by the closely air spittle and contact transmission closely, majority do not have immunizing power to SARS, cut off the biography source and have just become blocking-up SARS to propagate important method.But several present clinical diagnosis standards could be made a definite diagnosis after patient SARS falls ill even be seriously ill always.This obviously is unfavorable for controlling epidemic situation very much.Seeking one can accurately diagnose the method for SARS most important rapidly.

On April 16th, 2003, the World Health Organization announces at Geneva, Switzerland, through 13 breadboard the working in concert in 10 countries and regions, the whole world, the quick infectious atypical pneumonia of a plurality of countries in the whole world, English name is SARS, pathogenic agent finally be identified.This is a kind of coronavirus, and the genome that the SARS pathogenic agent is complete is cracked.It at first announced April 12 that after several days, the Center for Disease Control had also been done similar declaration by Canadian scientist.The researchist of Canada Fan Kufumaike Smith genome scientific center has decoded the gene mapping of this virus.

The decoding of the discovery of the pathogenic agent of SARS and this virogene collection of illustrative plates makes that seeking the gene diagnosis method that can detect SARS virus fast and accurately becomes possibility.

Opening up the fluorescent PCR technology of getting up rapidly in recent years is to grow up on people's round pcr (polymerase chain reaction technology) basis, can detect virus from nucleic acid level.The fluorescent PCR technology has been done very big improvement to the detection principle of PCR product, but the formation of dynamic real-time monitoring nucleic acid product need not last handling process, has avoided the pollution of amplified production so to a certain extent, both shorten detection time, saved specific apparatus and professional's outfit again.

The principle of fluorescent PCR technology: fluorescent PCR is different from the variation that other PCR part is to utilize the fluorescence luminous energy that fluorescence dye discharged under the effect of exciting light variation comes dynamically directly to reflect the pcr amplification product amount.Because of the fluorescent signal variable is directly proportional with the amplified production amount, by enough sensitive self-reacting devices to the collection of fluorescence with analyze realize to original template quantitatively.

The introducing of fluorescence dye has following approach: direct bind nucleic acid product, labeled primer or mark specific probe, and fluorescently-labeled probe has three classes: (1) molecular beacon probe; (2) the two probes of hybridization; (3) Taqman double-tagging probe.Except that a pair of primer of routine, other has the fluorescence double-tagging probe of an energy and PCR product hybridization in the PCR reaction system.5 ' the end and 3 ' of this probe is held different fluorophor on the difference mark, probe 5 ' end mark one report fluorophor (reporter, R), 3 ' end mark, one cancellation fluorophor (quencher, Q), when probe is kept perfectly, energy can be transferred to behind 5 ' the end fluorophor R absorption luminous energy and close on 3 ' end fluorescent quenching group Q, its Q group has suppressed the fluorescent signal of R group, this detection will be so detection system can not detect this probe 5 ' end fluorescent signal that fluorophor sent under the 5 ' normal circumstances.But in PCR extension process, 5 '-3 ' 5 prime excision enzyme activity of archaeal dna polymerase (Taq) cuts down 5 ' end fluorophor from probe, make it to be free in the reaction system, thereby the shielding that has broken away from 3 ' end fluorescent quenching group, can accept light stimulus and send the fluorescence that can supply instrument detecting, (instrument detecting goes out minimum cycle number (the cycle threshold that fluorescent value goes out the peak, Ct) with detect viral nucleic acid amount logarithmic value and be linear negative correlation), thereby according to the fluorescence Ct value in the fluorescent PCR reaction) just can calculate primary template amount.

The present invention is exactly according to above-mentioned principle, design is fit to the Auele Specific Primer and the specific probe of SARS virus, goal of the invention is to provide a kind of gene detecting kit and gene tester that can quick and precisely detect SARS virus, thereby whether the quick diagnosis patient carries SARS virus and can measure viral quantity.

Three, summary of the invention

For realizing the object of the invention, detection reagent and detection method that solution can't quick and precisely diagnose the virus of SARS in patients'blood and the respiratory secretions sample whether to deposit.For this reason, the present invention takes following technical scheme:

A kind of gene detecting kit of SARS virus, comprise SARS virus specific nucleic acid quantitative criterion product, be the partial sequence of SARS: the described test kit of 5 ' TACCGTAGACTCATCTCTATGATGGGTTTCAAAATGAATTACCAAGTCATGGTTAC CCTAATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTGG CTTTGATGTAGAGGGCTGTCATGCAACTAGAGATGCTGTGGGTACTAACCTACCTC TCCAGCTAGGATTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTATGTT GACACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCCACCAGGTGA CCAGTTTAAACATCTTATACC-3 ' also comprises following component: (1) amplified fluorescence detection reagent: by single stage method RT-PCR damping fluid, deoxidation nucleoside triphosphate (dNTP) mixture, specificity amplification primer and specific probe are that solvent forms with distilled water, and described Auele Specific Primer is:

Primer S1: primer sequence is 5 '-CCAAGTCAATGGTTACCCTAATATGTT-3 '

Primer S2: primer sequence is 5 '-GTTAGTACCCACAGCATCTCTAGTT-3 '

Described specific probe is:

Probe S3: probe sequence is 5 '-R-AGCCCTCTACATCAAAGCCAATCCACGC-Q-3 ' R is the report fluorophor, Q is the cancellation fluorophor.(2) archaeal dna polymerase (3) antipollution uridylic glycosyl enzyme (UNG); (4) be used for the reversed transcriptive enzyme of reverse transcription.

The gene detecting kit of described SARS virus, described amplified fluorescence detection reagent are that solvent forms with distilled water by following component:

Single stage method RT-PCR damping fluid content volume per-cent 10%

Deoxidation nucleoside triphosphate (dNTP mixture content 100-300 μ M

Auele Specific Primer S1 content 0.05-1.5 μ M

Auele Specific Primer S2 content 0.05-1.5 μ M

Specific probe S3 content 0.05-1.0 μ M

Surplus is a distilled water

The present invention is a SARS virus PCR fluorescent quantitation detection reagent, adopts reverse transcriptase polymerase chain reaction (RT-PCR) combination technology, the specific RNA nucleic acid fragment of SARS virus is carried out fluorescent quantitation detect.This reagent is applicable to that the specific RNA nucleic acid fragment to the SARS virus in blood and the cast-off cells (upper respiratory tract, urinary tract) carries out the detection of fluorescence.The core of this detection reagent be in the amplified fluorescence detection reagent at the Auele Specific Primer and the probe of SARS virus, SARS specific nucleic acid quantitative criterion product.Auele Specific Primer S1, S2; Specific probe S3.SARS specific nucleic acid quantitative criterion product core is one section SARS virus specific nucleic acid sequence.Specific probe S3 is the core of TaqMan polymerase chain reaction technique (TaqMan-PCR), and this probe 5 ' end mark one report fluorophor (reporter, R), 3 ' end mark, one cancellation fluorophor (quencher, Q).Report fluorescence R group has: FAM (carboxyl fluorescent yellow), HEX (6-chlorine fluorescent yellow), TAMARA (tetramethyl-6 carboxylic rhodamine), CY3 (indoles dicarboxyl cyanines), CY5 (indoles dicarboxyl cyanines), ROX (6-carboxylic-X-rhodamine); Quenching group Q has: TAMARA (tetramethyl-6 carboxylic rhodamine), BHQ, DABSYL (dimethyl amino-azo-benzene formyl radical).Report fluorophor R and quenching group Q can be according to conveniently selecting for use.

TaqMan polymerase chain reaction technique (TaqMan-PCR) is one of a kind of up-to-date fluorescent quantitation gene amplification technology.Most of Taq enzymes not only have 5 ' → 3 ' dna polymerase activity, can be under the guiding of primer the extended DNA chain, also have 5 ' → 3 ' 5 prime excision enzyme activity, the fluorescent quantitation gene analysis is exactly to have used these two kinds of enzymic activitys of Taq enzyme to grow up dexterously.In amplification reaction system, add one with purpose fragment complementation fluorescence labeling probe to be amplified, this probe 5 ' end mark one report fluorophor (reporter, R), 3 ' end mark, one cancellation fluorophor (quencher, Q), when probe was kept perfectly, its Q group had suppressed the fluorescent signal of R group, and this detection system can not detect the signal of report fluorescence; In case probe is cut, the R group is free, and the restraining effect of Q group disappears, and this detection system just can detect the fluorescent signal of R group.Before the PCR reaction, probe combines with template is complementary, after the PCR reaction beginning, extension along with the product chain, the Taq enzyme moves to the fluorescence labeling probe binding site along dna profiling, performance 5 ' → 3 ' 5 prime excision enzyme activity, fluorescent probe is cut off, make the report fluorophor free, the restraining effect of Q group disappears, and this detection system just detects the report fluorescent signal, and (instrument detecting goes out minimum cycle number (the cycle threshold that fluorescent value goes out the peak, Ct) with detect viral nucleic acid amount logarithmic value and be linear negative correlation), thereby according to the fluorescence Ct value in the fluorescent PCR reaction) just can calculate primary template amount.

Only needing by method in common each component to be dissolved in distilled water respectively according to the reagent in the test kit of above-mentioned principle design is made into mixture and gets final product.

Be cloned into plasmid PUmC18 carrier.Screen the plasmid PUmC18-SARS that reorganization has above-mentioned sequence by PCR and determining nucleic acid sequence,, analyze plasmid purity and measure its concentration with ultraviolet spectrophotometer with the Qiagen plasmid extraction test kit extracting plasmid PUmC18-SARS of company.Use following formula concentration is become copy number/ml:Y (copy number/ml)=X (μ g/ml) ÷ 10 ⁶÷ 976590 * 6.23 * 10 ²³With distilled water plasmid PUmC18-SARS concentration is debugged into 10 ⁷Copy number/ml, 10 ⁶Copy number/ml, 10 ⁵Copy number/ml, 10 ⁴Copy number/ml.

Quantitative with external standard method: in the real-time fluorescence PCR process, cycler threshold value (Ct value) is linear negative correlation with sample amplifying nucleic acid template amount logarithmic value.Set up typical curve with standard substance, the Ct value of Jian Ceing can calculate SARS virus nucleic acid content in the sample by typical curve per sample.

The preferred following compounds of single stage method RT-PCR damping fluid in the gene detecting kit of described SARS virus is formed: 500mM Repone K (KCl), 100mM Tris-Cl, 25mM magnesium chloride (MgCl2), 0.1% polyethylene glycol 6000,0.1%1,4-DTT (DTT), 1% bovine serum albumin (BSA), content are wherein pressed amplified fluorescence detection reagent cumulative volume and are calculated.

Single stage method RT-PCR damping fluid can have different combinations as required, also can have other assembly to replace, but aforesaid combination is comparatively ideal selection.

The gene detecting kit of described SARS virus, described deoxidation nucleoside triphosphate (dNTP) mixture are selected dATP, dTTP, dCTP, dGTP, dUTP combination for use, can be one of following formulas: (1) dATP, dCTP, dGTP, the dTTP proportioning is 1: 1: 1: 1 (2) dATP, dGTP, dCTP, the dUTP proportioning is 1: 1: 1: 1 (3) dATP, dCTP, dGTP, dTTP, the dUTP proportioning is 4: 4: 4: 4: 1

Wherein organize described dATP, dCTP, dGTP, dTTP, the dUTP combination, proportioning is 4: 4: 4: 4: 1 deoxidation nucleoside triphosphate (dNTP) mixture most preferred combinations.

The gene detecting kit of described SARS virus, described uridylic glycosyl enzyme (UNG) working concentration is 100-300 enzyme activity unit/reaction (U), described archaeal dna polymerase working concentration is 0.5-5 enzyme activity unit/reaction (U), and described archaeal dna polymerase can be can be one of following formula: Ampli TaqR archaeal dna polymerase (2) rTth archaeal dna polymerase (3) rTth archaeal dna polymerase XL.

Usually uridylic glycosyl enzyme (UNG) working concentration of selecting for use is 200 enzyme activity unit/reactions (U), and the archaeal dna polymerase working concentration can have different variations, the preferred Ampli TaqR of the present invention archaeal dna polymerase.

The fluorescent PCR technology has been avoided the back detection of nucleic acid product, has just prevented the generation of polluting from principle itself; Special anti-fouling system has further been stopped pollution.Principle is mainly based under the effect of uridylic glycosyl enzyme (UNG), nucleic acid generation hydrolysis, and the pyroprocessing in the PCR process fragments into fragment and can't become the template of next round PCR reaction.

Described reversed transcriptive enzyme working concentration is 6-300 enzyme activity unit/reaction, can be one of following formula:

(1) M-MuLV reversed transcriptive enzyme (2) AMV reversed transcriptive enzyme

The preferred following component of described amplified fluorescence detection reagent is that solvent forms with distilled water:

Single stage method RT-PCR damping fluid is: 500mM Repone K (KCl), 100mM Tris-Cl, 25mM magnesium chloride (MgCl2), 0.1% polyethylene glycol 6000,0.1%1,4-DTT (DTT), 1% bovine serum albumin (BSA)

Deoxidation nucleoside triphosphate (dNTP mixture) is: 200 μ MdATP, 200 μ M dCTP, 200 μ MdGTP, 200 μ M dTTP, 50 μ M dUTP

Auele Specific Primer S1 0.6 μ M

Auele Specific Primer S2 0.6 μ M

Specific probe S3 0.2 μ M.

Surplus is a distilled water

Described test kit preferred version following comprising:

(1) amplified fluorescence detection reagent: by following component is that solvent forms with distilled water:

Single stage method RT-PCR damping fluid is: 500mM Repone K (KCl), 100mM Tris-Cl, 25mM magnesium chloride (MgCl2), 0.1% polyethylene glycol 6000,0.1%1,4-DTT (DTT), 1% bovine serum albumin (BSA);

Deoxidation nucleoside triphosphate (dNTP mixture) is: 200 μ MdATP, 200 μ M dCTP, 200 μ MdGTP, 200 μ M dTTP, 50 μ M dUTP

Auele Specific Primer S1 0.6 μ M

Auele Specific Primer S2 0.6 μ M

Specific probe S3 0.2 μ M

(2) archaeal dna polymerase: select the 2.0 enzyme activity unit/reactions (U) of Ampli TaqR archaeal dna polymerase for use

(3) uridylic glycosyl enzyme (UNG): 200 enzyme activity unit/reactions (U)

(4) reversed transcriptive enzyme is selected M-MuLV 200 enzyme activity unit/reactions (U) for use.

A kind of gene tester of SARS virus, with SARS virus specific nucleic acid quantitative criterion product is contrast, be the partial sequence of SARS: 5 '-TACCGTAGACTCATCTCTATGATGGGTTTCAAAATGAATTACCAAGTCAATGGTTA CCCTAATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTG GCTTTGATGTAGAGGGCTGTCATGCAACTAGAGATGCTGTGGGTACTAACCTACCT CTCCAGCTAGGATTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTATGT TGACACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCCACCAGGTG ACCAGTTTAAACATCTTATACC-3 ' comprises that RNA extracts, polymkeric substance enzyme chain reaction (PCR) amplification and fluoroscopic examination, described detection method is an analyzing samples with patient's to be measured venous blood sample or collutory or respiratory secretions directly, extract RNA in the sample as nucleic acid-templated, again the nucleic acid-templated fluorescent polymer enzyme chain reaction that carries out is increased, used amplified fluorescence detection reagent comprises single stage method RT-PCR damping fluid, deoxidation nucleoside triphosphate (dNTP) mixture, specificity amplification primer and specific probe, described specificity amplification primer is:

Primer S1: primer sequence is 5 '-CCAAGTCAATGGTTACCCTAATATGTT-3 '

Primer S2: primer sequence is 5 '-GTTAGTACCCACAGCATCTCTAGTT-3 '

Described specific probe is:

Probe S3: probe sequence is 5 '-R-AGCCCTCTACATCAAAGCCAATCCACGC-Q-3, wherein R is the report fluorophor, Q is the cancellation fluorophor.Also need add archaeal dna polymerase and antipollution uridylic glycosyl enzyme when increasing and be used for the reversed transcriptive enzyme of reverse transcription with the amplified fluorescence detection reagent.

Described detection method step is as follows: (1) extracts RNA

Take a certain amount of sample of patient to be measured through pre-treatment, extract RNA according to a conventional method:

Sample is a blood specimen: venous blood 5mL (EDTA anti-freezing), separate karyocyte with lymphocyte separation medium Ficoll400, karyocyte is collected (import, aseptic) in the 1.5mL pipe, add Trizol 500 μ L mixings, add chloroform 100 μ L mixings, centrifugal 10 minutes of 4 ℃ of 10000rpm, draw the upper strata water in the 1.5mL pipe, and add long-pending Virahol (precooling) mixing of isoploid, put 4 ℃ of centrifugal 15 minutes of 15000rpm (precipitated rna) on ice 20 minutes.Abandon supernatant liquor, with 75% alcohol 1.0mL rinsing once, the centrifugal fast liquid (noting keeping sedimentary RNA) that blots, gas is done the back and is added 10 μ L DEPC H ₂O dissolves RNA.Directly carry out the RT-PCR operation or place-80 ℃ of preservations.

Sample is a collutory: centrifugal 5 minutes of 3ml collutory 5000rpm, abandon supernatant, and add Trizol500 μ L mixing, other the same processing.(throat swab, upper respiratory tract secretory product add 3mL physiological saline).

Take a certain amount of sample of patient to be measured through pre-treatment, extract RNA as stated above, gas is done the back and is added 10 μ LDEPC H ₂O solution dissolving RNA, this dissolved RNA directly carry out fluorescent PCR amplification operation or place-80 ℃ of preservations as nucleic acid-templated; (2) fluorescent PCR amplification

Get quantitative fluorescence augmentation detection reagent, add an amount of archaeal dna polymerase and antipollution uridylic glycosyl enzyme, reversed transcriptive enzyme is in the thin-walled test tube, mixing, is got above-mentioned mixed solution in thin-walled tube at the centrifugal several seconds of 3000rpm, at least prepare simultaneously two parts of thin-walled tubes that above-mentioned mixed solution is housed, portion does not add the RNA solution of step (1) preparation, and the standard substance that another part adding has been demarcated carry out polymkeric substance enzyme chain (PCR) amplified reaction in contrast immediately; (3) fluoroscopic examination

Example reaction pipe and reference standards reaction tubes place the quantitative fluorescence PCR instrument to detect, and the cycling condition setting is set, and carry out fluoroscopic examination; (4) interpretation of result

Select fluoroscopic examination model F AM fluorescence, baseline adjustment is got 6-16 round-robin fluorescent signal; The threshold setting principle is with the vertex of threshold line just above normal negative control product; The fluorescence growth curve surpasses threshold line, and is good logarithmic growth, is judged as the positive.

When being to select for use test kit preferred version of the present invention, the amplification of described detection method step (2) fluorescent PCR for concrete steps is: get 35 μ L amplified fluorescence detection reagent, add 0.4 μ LDNA polysaccharase and antifouling uridylic glycosyl enzyme (Taq+UNG), 1 μ L reversed transcriptive enzyme is in the thin-walled test tube, mixing, the centrifugal several seconds of 3000rpm, get above-mentioned mixed solution in thin-walled tube, prepare two parts of thin-walled tubes that above-mentioned mixed solution is housed simultaneously, the a RNA solution 4 μ L that add step (1) preparation, the standard substance that another part adding has been demarcated compare, and carry out polymkeric substance enzyme chain (PCR) amplified reaction immediately; Described detection method step (3) fluoroscopic examination is: reaction tubes and reference standard QC place the quantitative fluorescence PCR instrument to detect, and FTC2000 or PE5700 or PE7700 instrument are recommended the cycling condition setting: 45 ℃ * 30min; 94 ℃ * 5min; By 93 ℃ * 10sec → 56 ℃ * 10sec → 72 ℃ * 10sec, circulate 10 times again; By 93 ℃ * 10sec → 60 ℃ * 40sec, circulate 40 times again; The single-point fluoroscopic examination is at 60 ℃.Lightcycler recommends the cycling condition setting: 45 ℃ * 20min; 94 ℃ * 2min; By 93 ℃ * 2sec → 55 ℃ * 15sec → 72 ℃ * 12sec, circulate 50 times again; The single-point fluoroscopic examination is at 55 ℃.

Advantage applies of the present invention exists:

1. early diagnosis.Immunology diagnosis mainly is antigen antibody reaction, be applied to clinically produce after the antibody in vivo usually, and there be long " window phase " in the immunology detection of many pathogenic agent, is unfavorable for the early diagnosis to disease; PCR method directly detects the RNA of pathogenic agent, can shorten " window phase " greatly, and its highly sensitive detection obviously also helps the early diagnosis of disease.Particularly can and once make a definite diagnosis patient the Close contacts was arranged the SARS patient suspected with SARS, be not true to type period in latent period or morbidity early symptom, just can detect whether the SARS virus specific gene is arranged when also high fever, dry cough not occurring, for isolating early, make a definite diagnosis and treatment being provided convenience.

2. it is simple and convenient to take a sample, can be used on latent period or the secretory product sample of fall ill early stage atypical symptoms SARS patients'blood, collutory and respiratory tract in detect the SARS virus specific gene, to clarify a diagnosis;

3. compare with traditional gene amplification technology, this method of detection provided by the invention saves time much, and the sample high to viral level can detect in 2 hours, and the sample low to viral level also can detect in 3 hours.

4. highly sensitive, owing to adopted specific gene amplification and specific gene probe hybridization bonded double technique, the specificity of diagnosis is higher.

5. adopt the computer real-time monitoring technology, can judge whether automatically that in the experiment process virogene exists, and the judgement of experimental result is accurately convenient.

6. the present invention has designed anti-pollution measure from many aspects, and this detects particularly important to very easily infectious SARS virus, and the fluorescent PCR technology has been avoided the back detection of nucleic acid product, has just prevented the generation of polluting from principle itself; Totally-enclosed reaction has guaranteed reliably can repeating of result.

7. can realize the two inspections of single tube or many inspections, also can design mark in the specific aim, monitoring template extraction efficiency and get rid of inhibitor and disturb.

Four, description of drawings

Fig. 1 is the schematic diagram of fluorescent PCR technology of the present invention.

Fig. 2 is the typical curve of detection by quantitative in the gene quantification detection method of SARS virus.

Fig. 3 is a fluorescence growth curve in the gene quantification detection method of SARS virus.

Fig. 4 be the embodiment of the invention 1 with German ARTUS company gene detection reagent to SARS virus standard substance detected result figure.

Five, embodiment

Below in conjunction with accompanying drawing embodiments of the invention are described further:

Embodiment 1

The gene detecting kit of preferred SARS virus, comprise that SARS virus specific nucleic acid quantitative criterion product are the partial sequence of SARS: 5 '-TACCGTAGACTCATCTCTATGATGGGTTTCAAAATGAATTACCAAGTCAATGGTTA CCCTAATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTG GCTTTGATGTAGAGGGCTGTCATGCAACTAGAGATGCTGTGGGTACTAACCTACCT CTCCAGCTAGGATTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTATGT TGACACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCCACCAGGTG ACCAGTTTAAACATCTTATACC-3 ' and (1) amplified fluorescence detection reagent: by following component is that solvent forms with distilled water :-footwork RT-PCR damping fluid is: 50mM Repone K (KCl), 10mM Tris-Cl, 25mM magnesium chloride (MgCl2), 0.1% polyethylene glycol 6000,0.1%1,4-DTT (DTT), 1% bovine serum albumin (BSA) deoxidation nucleoside triphosphate (dNTP mixture) is: 200 μ MdATP, 200 μ M dCTP, 200 μ M dGTP, 200 μ M dTTP, 50 μ M dUTP Auele Specific Primer S1,0.6 μ M Auele Specific Primer S2,0.6 μ M specific probe S3,0.2 μ M, R is FAM (a carboxyl fluorescent yellow), Q is TAMARA (tetramethyl-6 a carboxylic rhodamine), and (2) archaeal dna polymerase (Taq): select Ampli TaqR archaeal dna polymerase 2.0 enzyme activity unit/reaction (U) (3) uridylic glycosyl enzymes (UNG) for use: 200 enzyme activity unit/reaction (U) (4) reversed transcriptive enzymes are selected M-MuLV:200 enzyme activity unit/reaction (U) for use

Each composition in the above-mentioned luciferase assay reagent is hybridly prepared into sufficient amount by proportioning, is used for the amplified fluorescence detection reagent of using when following fluorescent PCR increases.

Be cloned into plasmid PUmC18 carrier.Screen the plasmid PUmC18-SARS that reorganization has above-mentioned sequence by PCR and determining nucleic acid sequence,, analyze plasmid purity and measure its concentration with ultraviolet spectrophotometer with the Qiagen plasmid extraction test kit extracting plasmid PUmC18-SARS of company.Use following formula concentration is become copy number/ml:Y (copy number/ml)=X (μ g/ml) ÷ 10 ⁶÷ 976590 * 6.23 * 10 ²³With distilled water plasmid PUmC18-SARS concentration is debugged into 10 ⁷Copy number/ml, 10 ⁶Copy number/ml, 10 ⁵Copy number/ml, 10 ⁴Copy number/ml.

Quantitative with external standard method: in the real-time fluorescence PCR process, cycler threshold value (Ct value) is linear negative correlation with sample amplifying nucleic acid template amount logarithmic value.Set up typical curve with standard substance, the Ct value of Jian Ceing can calculate SARS virus nucleic acid content in the sample by typical curve per sample.

When using above-mentioned preferred reagent box, the gene tester of SARS virus, it is as follows to detect step: (1) extracts RNA

Sample is got patient's blood specimen: venous blood 5ml (EDTA anti-freezing), separate karyocyte with lymphocyte separation medium Ficoll400, karyocyte is collected (import, aseptic) in the 1.5ml pipe, add Trizol 500 μ l mixings, add chloroform 100 μ l mixings, centrifugal 10 minutes of 4 ℃ of 10000rpm, draw the upper strata water in the 1.5ml pipe, and add long-pending Virahol (precooling) mixing of isoploid, put 4 ℃ of centrifugal 15 minutes of 15000rpm (precipitated rna) on ice 20 minutes.Abandon supernatant liquor, with 75% alcohol 1.0ml rinsing once, the centrifugal fast liquid (noting keeping sedimentary RNA) that blots, gas is done the back and is added 10 μ l DEPCH ₂O dissolves RNA.Directly carry out the RT-PCR operation or place-80 ℃ of preservations.(2) fluorescent PCR amplification

Get 35 μ L amplified fluorescence detection reagent, add 0.4 μ LDNA polysaccharase and antifouling uridylic glycosyl enzyme (Taq+UNG), 1 μ L reversed transcriptive enzyme is in the thin-walled test tube, mixing, is got above-mentioned mixed solution in thin-walled tube at the centrifugal several seconds of 3000rpm, prepare two parts of thin-walled tubes that above-mentioned mixed solution is housed simultaneously, the a RNA solution 4 μ L that add step (1) preparation, the standard substance that another part adding has been demarcated compare, and carry out polymkeric substance enzyme chain (PCR) amplified reaction immediately; (3) fluoroscopic examination:

Example reaction pipe and reference standard QC place the quantitative fluorescence PCR instrument to detect (optional FTC2000 or PE5700 or PE7700).The recommendation cycling condition is provided with: 37 ℃ * 30min; 94 ℃ * 5min; By 93 ℃ * 10sec → 56 ℃ * 10sec → 72 ℃ * 10sec, circulate 10 times again; By 93 ℃ * 10sec → 60 ℃ * 40sec, circulate 40 times again; The single-point fluoroscopic examination is at 60 ℃.(4) fluoroscopic examination model F AM fluorescence is selected in interpretation of result, and baseline adjustment is got 6-16 round-robin fluorescent signal; The threshold setting principle is with the vertex of threshold line just above normal negative control product; The fluorescence growth curve surpasses threshold line, and is good logarithmic growth, is judged as the positive.

Clinical application: use above-mentioned test kit, the utilization aforesaid method is respectively to 3 routine clinical atypical pneumonia (SARS) patients; 7 routine atypical pneumonia patients suspected; And 10 routine body temperature increase, but do not meet atypical pneumonia patient and atypical pneumonia patient suspected requirement in the atypical pneumonia Case definition that national Center for Disease Control recommends; 30 routine health examination person result such as tables 1.Table 1:

Detected object	3 routine atypical pneumonia (SARS) patients			7 routine atypical pneumonia patients suspected	10 routine body temperature increase, but do not meet atypical pneumonia patient and atypical pneumonia patient suspected requirement in the atypical pneumonia Case definition that national Center for Disease Control recommends	30 routine health examination persons
							First	Second	Third
	The result (copy number/ml)	1.23×10 6	1.96×10 5							2.86×10 5	6 examples do not detect, and 1 example is positive: 1.34 * 10 3	Do not detect	Do not detect

Above-mentioned quantitative values unit is copy number/ml

This test kit is used for clinical case simultaneously with the SARS virus kit of fluorescence diagnosis that German ARTUS company produces, and detected result sees Table 2.Table 2:

The detected object result	3 routine atypical pneumonia (SARS) patients			7 routine atypical pneumonia patients suspected	10 routine body temperature increase, but do not meet atypical pneumonia patient and atypical pneumonia patient suspected requirement in the atypical pneumonia Case definition that national Center for Disease Control recommends	30 routine health examination persons
							(copy number/ml)	First	Second	Third
6.98×10 6	4.90×10 5	1.55×10 5	1 example is positive, and 7.89 * 10 3								Do not detect	Do not detect

Table 1 is basic identical with the result of table 2, and the 1 routine reactor who occurs among the 7 routine atypical pneumonia patients suspected is same detection target.

Embodiment 2:

The gene detecting kit of preferred SARS virus, comprise SARS virus specific nucleic acid quantitative criterion product such as embodiment 1, also comprise: (1) amplified fluorescence detection reagent: by following component is that solvent forms with distilled water: single stage method RT-PCR damping fluid is: 500mM Repone K (KCl), 100mM Tris-Cl, 25mM magnesium chloride (MgCl2), 0.1% polyethylene glycol 6000,0.1%1,4-DTT (DTT), 1% bovine serum albumin (BSA).Deoxidation nucleoside triphosphate (dNTP mixture) is: dATP: dCTP: dGTP: dTTP: dUTP=4: 4: 4: 4: 1; Working concentration is 100 μ M Auele Specific Primer S1,0.45 μ M Auele Specific Primer S2,0.55 μ M specific probe S3,0.2 μ M, R is FAM (a carboxyl fluorescent yellow), Q is TAMARA (tetramethyl-6 carboxylic rhodamine) (2) archaeal dna polymerase (Taq): select Ampli TaqR DNA enzyme for use, 1.5 enzyme activity unit/reaction (U) (3) uridylic glycosyl enzymes (UNG): 200 enzyme activity unit/reaction (U) (4) reversed transcriptive enzymes are selected M-MuLV 200 enzyme activity unit/reactions (U) for use

By common blending means, the branch of respectively forming in the luciferase assay reagent is mixed by proportioning, be made into the amplified fluorescence detection reagent of sufficient amount, standby when following fluorescent PCR increases.

When using the mentioned reagent box, the gene tester of SARS virus, it is as follows to detect step: (1) extracts RNA: method is with embodiment 1.(2) fluorescent PCR amplification

Get quantitative fluorescence augmentation detection reagent, add an amount of archaeal dna polymerase and antifouling uridylic glycosyl enzyme (Taq+UNG), reversed transcriptive enzyme is in the thin-walled test tube, mixing, is got above-mentioned mixed solution in thin-walled tube at the centrifugal several seconds of 3000rpm, prepare two parts of thin-walled tubes that above-mentioned mixed solution is housed simultaneously, the a RNA solution 4 μ L that add step (1) preparation, the standard substance that another part adding has been demarcated compare, and carry out polymkeric substance enzyme chain (PCR) amplified reaction immediately; (3) fluoroscopic examination: the results are shown in Table 3, table 3 with embodiment 1 (4) clinical detection:

Detected object	3 routine atypical pneumonia (SARS) patients			7 routine atypical pneumonia patients suspected	10 routine body temperature increase, but do not meet atypical pneumonia patient and atypical pneumonia patient suspected requirement in the atypical pneumonia Case definition that national Center for Disease Control recommends	30 routine health examination persons
							First	Second	Third
	The result (copy number/ml)	8.79×10 5	6.49×10 4							1.15×10 5	6 examples do not detect, and 1 example is positive: 5.93 * 10 2	Do not detect	Do not detect

Embodiment 3

The kit gene of preferred SARS virus of the present invention is compared with the similar reagent that German ARTUS company produces:

Sample is for No. No. 1 a blank;

Sample is selected the test kit of embodiment 1 and the SARS standard substance result that detection method detects different dilution gradients for 2～No. 6 for use;

Sample 8～12 adopts the SARS standard substance results of the different dilution of German ARTUS company's SARS virus gene detection reagent detection gradients.

Detected result sees Table 4, and Fig. 4 both detected results as can be known is basic identical: table 4:

Sample	??1	????2	????3	????4	????5	????6
							The dilution standard product (copy number/ml)	Blank	????1×10 3	????1×10 4	????1×10 5	????1×10 6	????1×10 7
Sample number	??1	????2	????3	????4	????5	????6
							. detection reagent detected result of the present invention (copy number/ml)	??-	????1.286×10 3	????7.128×10 4	????1.044×10 5	????9.263×10 6	????1.128×10 7
Sample number	??7	????8	????9	????10	????11	????12
							Germany ARTUS company reagent detected result (copy number/ml)	??-	????2.801×10 2	????3.233×10 3	????1.041×10 5	????1.264×10 6	????3.114×10 7

Embodiment 4-20

Embodiment 4-20 adopts to prepare certain density standard substance for simulating test sample, to detect detectivity and the accuracy of used kit to sample.

The reagent of embodiment 4-20 is selected and (demarcating concentration is 1 * 10 to the SARS virus nucleic acid standards ⁶Copy/ml) the detection effect data is as shown in table 5, used reagent compound method and detection method such as embodiment 2 to simulating test sample.

The result shows that the selected reagent of embodiment 4-21 is accurate substantially to the detected result that simulates test sample.It is 1 * 10 that table standard substance that 5:(examines are demarcated concentration ⁶Standard substance that copy/ml examines)

Embodiment	Auele Specific Primer, specific probe, dNTP mixture are selected (unit: μ M) for use				Taq+UNG (unit: enzyme activity unit/reaction)				Reversed transcriptive enzyme (unit: enzyme activity unit/reaction)		The test effect (copy number/ml)
												The dNTP mixture is selected for use	Auele Specific Primer S1	Auele Specific Primer S2	Specific probe S3	Ampli TaqR DNA enzyme	RTth DNA polysaccharase	RTth DNA polymerase x L	UNG uridylic glycosyl enzyme	M-MuLV reversed transcriptive enzyme	The AMV reversed transcriptive enzyme
	1	?100 ?dATP∶dCTP∶dGTP∶dTTP∶d ?UTP＝4∶4∶4∶4∶1	?0.6	?0.6	?0.2	?2.0	?-	??-	?200	?6													?1.03×10 6
2											?100 ?dATP∶dCTP∶dGTP∶dTTP＝ ?1∶1∶1∶1	?0.45	?0.55	?0.20		?0.5		?200		?6	?3.04×10 6
	4	?100 ?dATP∶dCTP∶dGTP∶dTTP＝ ?1∶1∶1∶1	?1.10	?0.55	?0.70	?0.5			?300	?50													?5.55×10 6
5											?100 ?dATP∶dCTP∶dGTP∶dUTP＝ ?1∶1∶1∶1	?1.50	?1.00	?1.00			0.75	?300		?50	?1.64×10 6
	6	?150 ?dATP∶dCTP∶dGTP∶dTTP∶d ?UTP＝4∶4∶4∶4∶1	?0.05	?0.55	?0.05	?0.75			?200													?160	?9.69×10 5
7											?150 ?dATP∶dCTP∶dGTP∶dTTP＝ ?1∶1∶1∶1	?0.55	?1.00	?0.50		?0.75		?250		?100	?6.39×10 5

??8	??150 ??dATP∶dCTP∶dGTP∶dTTP＝ ??1∶1∶1∶1	??1.10	??1.50	??0.70	??1.0			??100	??300		??4.23×10 6
												??9	??150 ??dATP∶dCTP∶dGTP∶dUTP＝ ??1∶1∶1∶1	??1.50	??1.10	??1.00	??1.0			??150	??170		??7.96×10 5
??10	??200 ??dATP∶dCTP∶dGTP∶dTTP∶d ??UTP＝4∶4∶4∶4∶1	??0.05	??0.05	??0.50			??1.0	??300		??200	??4.56×10 6
												??11	??200 ??dATP∶dCTP∶dGTP∶dTTP＝ ??1∶1∶1∶1	??0.45	??0.60	??0.80		??1.5		??200	??150		??7.48×10 6
??12	??200 ??dATP∶dCTP∶dGTP∶dTTP＝ ??1∶1∶1∶1	??1.10	??1.05	??1.00			??1.5	??300		??300	??1.83×10 6
												??13	??200 ??dATP∶dCTP∶dGTP∶dUTP＝ ??1∶1∶1∶1	??1.45	??1.50	??0.05		??1.5		??200		??100	??3.10×10 6
??14	??250 ??dATP∶dCTP∶dGTP∶dTTP∶d ??UTP＝4∶4∶4∶4∶1	??0.05	??0.50	??1.00			??2.0	??200	??200		??9.56×10 5
												??15	??250 ??dATP∶dCTP∶dGTP∶dTTP∶d ??UTP＝4∶4∶4∶4∶1	??0.75	??1.05	??0.50	??2.0			??200		??210	??4.32×10 6
??16	??250 ??dATP∶dcTP∶dGTP∶dTTP＝ ??1∶1∶1∶1	??0.45	??1.45	??1.00		??2.0		??200	??160		??1.56×10 6
												??17	??250	??1.50	??0.75	??0.05			??2.5			??280	??2.21×10 6

	?dATP∶dCTP∶dGTP∶dUTP＝ ?1∶1∶1∶1
												17	?300 ?dATP∶dCTP∶dGTP∶dTTP∶d ?UTP＝4∶4∶4∶4∶1	?0.05	?0.50	?0.05	?2.5				?250		?6.98×10 6
19	?300 ?dATP∶dCTP∶dGTP∶dTTP∶d ?UTP＝4∶4∶4∶4∶1	?0.75	?1.10	?0.75		?2.5				?120	?4.71×10 6
												20	?300 ?dATP∶dCTP∶dGTP∶dTTP＝ ?1∶1∶1∶1	?0.90	?0.50	?0.50			?5.0		?120		?8.95×10 5
21	?300 ?dATP∶dCTP∶dGTP∶dUTP＝ ?1∶1∶1∶1	?1.45	?1.50	?1.00		?5.0				?250	?4.36×10 6

Claims (12)

1. the gene detecting kit of a SARS virus, comprise SARS virus specific nucleic acid quantitative criterion product, be the partial sequence of SARS: 5 '-TACCGTAGACTCATCTCTATGATGGGTTTCAAAATGAATTACCAAGTCAATGGTTA CCCTAATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTG GCTTTGATGTAGAGGGCTGTCATGCAACTAGAGATGCTGTGGGTACTAACCTACCT CTCCAGCTAGGATTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTATGT TGACACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCCACCAGGTG ACCAGTTTAAACATCTTATACC-3 ' is characterized in that described test kit also comprises following component: (1) amplified fluorescence detection reagent: by single stage method RT-PCR damping fluid, deoxidation nucleoside triphosphate (dNTP) mixture, specific amplification primer and specific probe are that solvent forms with distilled water, and described Auele Specific Primer is:

Primer S1: primer sequence is 5 '-CCAAGTCAATGGTTACCCTAATATGTT-3 '

Primer S2: primer sequence is 5 '-GTTAGTACCCACAGCATCTCTAGTT-3 '

Described specific probe is:

Probe S3: probe sequence is 5 '-R-AGCCCTCTACATCAAAGCCAATCCACGC-Q-3 ' R is the report fluorophor, Q is the cancellation fluorophor.(2) archaeal dna polymerase (3) antipollution uridylic glycosyl enzyme (UNG); (4) be used for the reversed transcriptive enzyme of reverse transcription.

2. the gene detecting kit of SARS virus as claimed in claim 1 is characterized in that described amplified fluorescence detection reagent is that solvent forms with distilled water by following component: it is distilled water that single stage method RT-PCR damping fluid accounts for reaction total volume percent 10% deoxidation nucleoside triphosphate (dNTP) mixture 100-300 μ M Auele Specific Primer S1 0.05-1.5 μ M Auele Specific Primer S2 0.05-1.5 μ M specific probe S3 0.05-1.0 μ M surplus

3. the gene detecting kit of SARS virus as claimed in claim 1, it is characterized in that described single stage method RT-PCR damping fluid is made up of following compounds: 500mM Repone K (KCl), 100mM Tris-Cl, 25mM magnesium chloride (MgCl2), 0.1% polyethylene glycol 6000,0.1%1,4-DTT (DTT), 1% bovine serum albumin (BSA), content are wherein pressed amplified fluorescence detection reagent cumulative volume and are calculated.

4. the gene detecting kit of SARS virus as claimed in claim 1 is characterized in that described deoxidation nucleoside triphosphate (dNTP) mixture selects the Several combination of dATP, dTTP, dCTP, dGTP, dUTP for use, can be one of following formula: (1) dATP, dCTP, dGTP, the dTTP proportioning is 1: 1: 1: 1 (3) dATP, dGTP, dCTP, the dUTP proportioning is 1: 1: 1: 1 (4) dATP, dCTP, dGTP, dTTP, the dUTP proportioning is 4: 4: 4: 4: 1

5. the gene detecting kit of SARS virus as claimed in claim 1 is characterized in that described deoxidation nucleoside triphosphate (dNTP) mixture selects dATP for use, dCTP, and dGTP, dTTP, the dUTP combination, proportioning is 4: 4: 4: 4: 1.

6. the gene detecting kit of SARS virus as claimed in claim 1, it is characterized in that described uridylic glycosyl enzyme (UNG) working concentration is 100-300 enzyme activity unit/reaction, described archaeal dna polymerase working concentration is 0.5-5 enzyme activity unit/reaction, and described archaeal dna polymerase can be can be one of following formula: Ampli TaqR archaeal dna polymerase (2) rTth archaeal dna polymerase (3) rTth archaeal dna polymerase XL.

7. the gene detecting kit of SARS virus as claimed in claim 1 is characterized in that described reversed transcriptive enzyme working concentration is 6-300 enzyme activity unit/reaction, can be one of following formula: (1) M-MuLV reversed transcriptive enzyme (2) AMV reversed transcriptive enzyme

8. as the gene detecting kit of one of claim 1-7 described SARS virus, it is characterized in that described amplified fluorescence detection reagent is that solvent forms with distilled water by following component: single stage method RT-PCR damping fluid is: 500mM Repone K (KCl), 100mM Tris-Cl, 25mM magnesium chloride (MgCl2), 0.1% polyethylene glycol 6000,0.1%1,4-DTT (DTT), 1% bovine serum albumin (BSA) deoxidation nucleoside triphosphate (dNTP mixture) is: 200 μ MdATP, 200 μ M dCTP, 200 μ M dGTP, 200 μ M dTTP, 50 μ M dUTP Auele Specific Primer S1,0.6 μ M Auele Specific Primer S2,0.6 μ M specific probe S3,0.2 μ M surplus is a distilled water

9. the gene detecting kit of SARS virus as claimed in claim 1, it is characterized in that described test kit comprises (1) amplified fluorescence detection reagent: by following component is that solvent forms with distilled water: single stage method RT-PCR damping fluid is: 500mM Repone K (KCl), 100mM Tris-Cl, 25mM magnesium chloride (MgCl2), 0.1% polyethylene glycol 6000,0.1%1,4-DTT (DTT), 1% bovine serum albumin (BSA) deoxidation nucleoside triphosphate (dNTP mixture) is: 200 μ MdATP, 200 μ M dCTP, 200 μ M dGTP, 200 μ M dTTP, 50 μ M dUTP Auele Specific Primer S1,0.6 μ M Auele Specific Primer S2,0.6 μ M specific probe S3,0.2 μ M surplus is water (a 2) archaeal dna polymerase: select the 2.0 enzyme activity unit/reactions (U) of Ampli TaqR archaeal dna polymerase for use; (3) uridylic glycosyl enzyme (UNG): 200 enzyme activity unit/reactions (U); (4) reversed transcriptive enzyme is selected M-MuLV 200 enzyme activity unit/reactions (U) for use.

10. the gene tester of a SARS virus, with SARS virus specific nucleic acid quantitative criterion product is contrast, be the partial sequence of SARS: 5 '-TACCGTAGACTCATCTCTATGATGGGTTTCAAAATGAATTACCAAGTCAATGGTTA CCCTAATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTG GCTTTGATGTAGAGGGCTGTCATGCAACTAGAGATGCTGTGGGTACTAACCTACCT CTCCAGCTAGGATTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTATGT TGACACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCCACCAGGTG ACCAGTTTAAACATCTTATACC-3 ', comprise that RNA extracts, polymkeric substance enzyme chain reaction (PCR) amplification and fluoroscopic examination, it is characterized in that described detection method is an analyzing samples with patient's to be measured venous blood sample or collutory or respiratory secretions directly, extract RNA in the sample as nucleic acid-templated, again the nucleic acid-templated fluorescence polymerase chain reaction that carries out is increased, used amplified fluorescence detection reagent comprises single stage method RT-PCR damping fluid, deoxidation nucleoside triphosphate (dNTP) mixture, specific amplification primer and specific probe, described specific amplification primer is:

Primer S1: primer sequence is 5 '-CCAAGTCAATGGTTACCCTAATATGTT-3 '

Primer S2: primer sequence is 5 '-GTTAGTACCCACAGCATCTCTAGTT-3 '

Described specific probe is:

Probe S3: probe sequence is 5 '-R-AGCCCTCTACATCAAAGCCAATCCACGC-Q-3, wherein R is the report fluorophor, Q is the cancellation fluorophor.Also need add archaeal dna polymerase and antipollution uridylic glycosyl enzyme when increasing and be used for the reversed transcriptive enzyme of reverse transcription with the amplified fluorescence detection reagent.

11. the gene tester of SARS virus as claimed in claim 10 is characterized in that described detection method step is as follows: (1) extracts RNA

Take a certain amount of sample of patient to be measured through pre-treatment, extract RNA according to a conventional method, gas is done the back and is added 10 μ lDEPC H ₂O solution dissolving RNA, this dissolved RNA directly carry out fluorescent PCR amplification operation or place-80 ℃ of preservations as nucleic acid-templated; (2) fluorescent PCR amplification

Get quantitative fluorescence augmentation detection reagent, add an amount of archaeal dna polymerase and antipollution uridylic glycosyl enzyme, reversed transcriptive enzyme in the thin-walled test tube, mixing, the centrifugal several seconds of 3000rpm, get above-mentioned mixed solution in thin-walled tube, prepare two parts of thin-walled tubes that above-mentioned mixed solution is housed simultaneously at least, portion does not add the RNA solution of step (1) preparation, the standard substance that another part adding has been demarcated carry out polymkeric substance enzyme chain (PCR) amplified reaction in contrast immediately; (3) fluoroscopic examination

Example reaction pipe and reference standards reaction tubes place the quantitative fluorescence PCR instrument to detect, and the cycling condition setting is set, and carry out fluoroscopic examination; (4) interpretation of result

Select fluoroscopic examination model F AM fluorescence, baseline adjustment is got 6-16 round-robin fluorescent signal; The threshold setting principle is with the vertex of threshold line just above normal negative control product; The fluorescence growth curve surpasses threshold line, and is good logarithmic growth, is judged as the positive.

12. the gene tester of SARS virus as claimed in claim 11, it is characterized in that selecting for use the gene detecting kit of following preferred SARS virus, comprise SARS virus specific nucleic acid quantitative criterion product and (1) amplified fluorescence detection reagent: by following component is that solvent forms with distilled water: single stage method RT-PCR damping fluid is: 500mM Repone K (KCl), 100mM Tris-Cl, 25mM magnesium chloride (MgCl2), 0.1% polyethylene glycol 6000,0.1%1,4-DTT (DTT), 1% bovine serum albumin (BSA) deoxidation nucleoside triphosphate (dNTP mixture) is: 200 μ MdATP, 200 μ M dCTP, 200 μ MdGTP, 200 μ M dTTP, 50 μ M dUTP Auele Specific Primer S1,0.6 μ M Auele Specific Primer S2,0.6 μ M specific probe S3,0.2 μ M surplus is distilled water (a 2) archaeal dna polymerase: when selecting for use Ampli TaqR archaeal dna polymerase 2.0U (3) uridylic glycosyl enzyme (UNG): 200U (4) reversed transcriptive enzyme to select for use M-MuLV 200U to use the above preferred reagent box, the amplification of described detection method step (2) fluorescent PCR is: get 35 μ L amplified fluorescence detection reagent, add 0.4 μ L archaeal dna polymerase and antifouling uridylic glycosyl enzyme (Taq+UNG), 1 μ L reversed transcriptive enzyme is in the thin-walled test tube, mixing, the centrifugal several seconds of 3000rpm, get above-mentioned mixed solution in thin-walled tube, prepare two parts of thin-walled tubes that above-mentioned mixed solution is housed simultaneously, the a RNA solution 4 μ L that add step (1) preparation, the standard substance that another part adding has been demarcated compare, and carry out polymkeric substance enzyme chain (PCR) amplified reaction immediately; Described detection method step (3) fluoroscopic examination is: example reaction pipe and reference standard QC place the quantitative fluorescence PCR instrument to detect, and FTC2000 or PE5700 or PE7700 instrument are recommended the cycling condition setting: 45 ℃ * 30min; 94 ℃ * 5min; By 93 ℃ * 10sec → 56 ℃ * 10sec → 72 ℃ * 10sec, circulate 10 times again; By 93 ℃ * 10sec → 60 ℃ * 40sec, circulate 40 times again; The single-point fluoroscopic examination is at 60 ℃.Lightcycler recommends the cycling condition setting: 45 ℃ * 20min; 94 ℃ * 2min; By 93 ℃ * 2sec → 55 ℃ * 15sec → 72 ℃ * 12sec, circulate 50 times again; The single-point fluoroscopic examination is at 55 ℃.

Images